Determination of rust resistance genes in pakistani bread wheats

International Nuclear Information System (INIS)

Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

2014-01-01

Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

Coliform bacteria isolated from recreational lakes carry class 1 and class 2 integrons and virulence-associated genes.

Science.gov (United States)

Koczura, R; Krysiak, N; Taraszewska, A; Mokracka, J

2015-08-01

To characterize the integron-harbouring Gram-negative bacteria in recreational lakes, with focus on the genetic content of integrons, antimicrobial resistance profiles and virulence-associated genes. The presence and structure of integrons in coliform bacteria isolated from the water of four recreational lakes located in Poznań, Poland, was determined by PCR method. Antimicrobial resistance testing was done by disc diffusion method. Virulence-associated genes in integron-bearing Escherichia coli isolates were detected by PCR. A total of 155 integron-bearing strains of coliform bacteria were cultured. Sequence analysis showed the presence of dfrA7, aadA1, dfrA1-aadA1, dfrA17-aadA5 and dfrA12-orfF-aadA2 gene cassette arrays in class 1 integrons and dfrA1-sat2-aadA1 in class 2 integrons. Higher frequency of integron-positive bacteria and higher antimicrobial resistance ranges were noted in colder months (January and November) compared with spring and summer months. The integron-harbouring E. coli carried up to nine virulence-associated genes, with the highest frequency of kpsMT (84.6%) and traT (783%), coding for group 2 capsule and determining human serum resistance respectively. Integron-bearing multidrug resistant coliform bacteria carrying virulence genes are present in waters of recreational lakes. This study presents antimicrobial resistance and virulence-associated genes in integron-bearing coliform bacteria present in the waters of recreational lakes, which showed that multidrug resistant bacteria with virulence traits might pose a threat to public health. Moreover, the presence of genes typical for enterotoxigenic and Shiga toxin-producing E. coli is a concern. © 2015 The Society for Applied Microbiology.

Detection and Characterizations of Genes Resistant to Tetracycline and Sulfa among the Bacteria in Mariculture Water

Science.gov (United States)

Qu, L.; Li, Y.; Zhu, P.

2013-12-01

One hundred and thirty-five bacteria from maricultural environments were tested for sensitivity to tetracycline and sulfa. Result show that 72% of the bacteria were sulfa-resistant, 36% of the bacteria were tetracycline-resistant, and 16.5% of bacteria showed resistance to both tetracyclines and sulfa ,indicating that the proportion of sulfa and tetracycline resistance bacteria isvery large in the maricultural environments. PCR methods were used to detect if these resistant bacteria carry tetracycline and sulfa resistance genes. Out of the 33 tetracycline-resistant bacteria screened, 3 were positive for tetA, 6 were positive for tetB and no isolate wasboth positive for tetA and tetB. Of the 97 sulfa-resistant bacteria screened, 9 were positive for sul2, 6 were positive for sul1, 1 isolate was positive for bothsul1 and sul2. The minimum inhibitory concentration (MIC) of tetracycline for tetA-carrying isolates were higher than those tetB-carrying isolates.while The MIC of sulfa for sul2-carrying isolates were higher than those sul1-carrying isolates. Indicating that tetA and sul2 gene may play ubknown roles in resisting tetracycline and sulfa than tetB and sul1 genes. The results showed the 4 kinds of genes (tetA,tetB,sul1,sul2) has no host specificity. All these 16S sequence are from the isolates which are positive for the above genes, it indicated the above antibiotic resistance genes are widespread in the environment regardless of the host. While the DNA sequence of these four genes showed tetA, sul1, sul2 genes are conservative in different bacteria , etB gene conserved poorly. The research aim is to get a preliminary understanding of resistance mechanism related to the resistant bacteria and the resistance genes in marine aquaculture environment through the analysis of resistant genes, providing research base for the prevention and treatment of drug-resistant bacteria so as to reduce the threat to the ecological environment, aquaculture and human health.

A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

Science.gov (United States)

Sahoo, Dipak K; Abeysekara, Nilwala S; Cianzio, Silvia R; Robertson, Alison E; Bhattacharyya, Madan K

2017-01-01

Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs) (F7 families) were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR)-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

Directory of Open Access Journals (Sweden)

Dipak K Sahoo

Full Text Available Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs (F7 families were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

Emergence of a Staphylococcus aureus Clone Resistant to Mupirocin and Fusidic Acid Carrying Exotoxin Genes and Causing Mainly Skin Infections.

Science.gov (United States)

Doudoulakakis, Anastassios; Spiliopoulou, Iris; Spyridis, Nikolaos; Giormezis, Nikolaos; Kopsidas, John; Militsopoulou, Maria; Lebessi, Evangelia; Tsolia, Maria

2017-08-01

Skin and soft tissue infections (SSTIs) caused by mupirocin-resistant Staphylococcus aureus strains have recently increased in number in our settings. We sought to evaluate the characteristics of these cases over a 43-month period. Data for all community-acquired staphylococcal infections caused by mupirocin-resistant strains were retrospectively reviewed. Genes encoding products producing high-level resistance (HLR) to mupirocin ( mupA ), fusidic acid resistance ( fusB ), resistance to macrolides and lincosamides ( ermC and ermA ), Panton-Valentine leukocidin (PVL) ( lukS/lukF -PV), exfoliative toxins ( eta and etb ), and fibronectin binding protein A ( fnbA ) were investigated by PCRs in 102 selected preserved strains. Genotyping was performed by SCC mec and agr typing, whereas clonality was determined by pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). A total of 437 cases among 2,137 staphylococcal infections were recorded in 2013 to 2016; they were all SSTIs with the exception of 1 case of primary bacteremia. Impetigo was the predominant clinical entity (371 cases [84.9%]), followed by staphylococcal scalded skin syndrome (21 cases [4.8%]), and there were no abscesses. The number of infections detected annually increased during the study years. All except 3 isolates were methicillin susceptible. The rates of HLR to mupirocin and constitutive resistance to clindamycin were 99% and 20.1%, respectively. Among the 102 tested strains, 100 (98%) were mupA positive and 97 (95%) were fusB positive, 26/27 clindamycin-resistant strains (96.3%) were ermA positive, 83 strains (81.4%) were lukS/lukF positive, 95 (93%) carried both eta and etb genes, and 99 (97%) were fnbA positive. Genotyping of methicillin-sensitive S. aureus (MSSA) strains revealed that 96/99 (96.7%) belonged to one main pulsotype, pulsotype 1, classified as sequence type 121 (ST121). The emergence of a single MSSA clone (ST121) causing impetigo was documented. Resistance to

Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent.

Science.gov (United States)

Hultman, Jenni; Tamminen, Manu; Pärnänen, Katariina; Cairns, Johannes; Karkman, Antti; Virta, Marko

2018-04-01

Wastewater treatment plants (WWTPs) collect wastewater from various sources for a multi-step treatment process. By mixing a large variety of bacteria and promoting their proximity, WWTPs constitute potential hotspots for the emergence of antibiotic resistant bacteria. Concerns have been expressed regarding the potential of WWTPs to spread antibiotic resistance genes (ARGs) from environmental reservoirs to human pathogens. We utilized epicPCR (Emulsion, Paired Isolation and Concatenation PCR) to detect the bacterial hosts of ARGs in two WWTPs. We identified the host distribution of four resistance-associated genes (tetM, int1, qacEΔ1and blaOXA-58) in influent and effluent. The bacterial hosts of these resistance genes varied between the WWTP influent and effluent, with a generally decreasing host range in the effluent. Through 16S rRNA gene sequencing, it was determined that the resistance gene carrying bacteria include both abundant and rare taxa. Our results suggest that the studied WWTPs mostly succeed in decreasing the host range of the resistance genes during the treatment process. Still, there were instances where effluent contained resistance genes in bacterial groups not carrying these genes in the influent. By permitting exhaustive profiling of resistance-associated gene hosts in WWTP bacterial communities, the application of epicPCR provides a new level of precision to our resistance gene risk estimates.

Characterization of Antibiotic Resistance Genes from Lactobacillus Isolated from Traditional Dairy Products.

Science.gov (United States)

Guo, Huiling; Pan, Lin; Li, Lina; Lu, Jie; Kwok, Laiyu; Menghe, Bilige; Zhang, Heping; Zhang, Wenyi

2017-03-01

Lactobacilli are widely used as starter cultures or probiotics in yoghurt, cheese, beer, wine, pickles, preserved food, and silage. They are generally recognized as safe (GRAS). However, recent studies have shown that some lactic acid bacteria (LAB) strains carry antibiotic resistance genes and are resistant to antibiotics. Some of them may even transfer their intrinsic antibiotic resistance genes to other LAB or pathogens via horizontal gene transfer, thus threatening human health. A total of 33 Lactobacillus strains was isolated from fermented milk collected from different areas of China. We analyzed (1) their levels of antibiotic resistance using a standardized dilution method, (2) their antibiotic resistance gene profiles by polymerase chain reaction (PCR) using gene-specific primers, and (3) the transferability of some of the detected resistance markers by a filter mating assay. All Lactobacillus strains were found to be resistant to vancomycin, but susceptible to gentamicin, linezolid, neomycin, erythromycin, and clindamycin. Their susceptibilities to tetracycline, kanamycin, ciprofloxacin, streptomycin, quinupristin/dalfopristin, trimethoprim, ampicillin, rifampicin, and chloramphenicol was different. Results from our PCR analysis revealed 19 vancomycin, 10 ciprofloxacin, and 1 tetracycline-resistant bacteria that carried the van(X), van(E), gyr(A), and tet(M) genes, respectively. Finally, no transferal of the monitored antibiotic resistance genes was observed in the filter mating assay. Taken together, our study generated the antibiotic resistance profiles of some milk-originated lactobacilli isolates and preliminarily assessed their risk of transferring antibiotic gene to other bacteria. The study may provide important data concerning the safe use of LAB. © 2017 Institute of Food Technologists®.

Macrolide resistance gene erm(TR) and erm(TR)-carrying genetic elements in Streptococcus agalactiae: characterization of ICESagTR7, a new composite element containing IMESp2907.

Science.gov (United States)

Mingoia, Marina; Morici, Eleonora; Marini, Emanuela; Brenciani, Andrea; Giovanetti, Eleonora; Varaldo, Pietro E

2016-03-01

The objective of this study was to investigate macrolide-resistant Streptococcus agalactiae isolates harbouring erm(TR), an erm(A) gene subclass, with emphasis on their erm(TR)-carrying genetic elements. Four erm(TR)-carrying elements have been described to date: three closely related (ICE10750-RD.2, Tn1806 and ICESp1108) in Streptococcus pyogenes, Streptococcus pneumoniae and S. pyogenes, respectively; and one completely different (IMESp2907, embedded in ICESp2906 to form ICESp2905) in S. pyogenes. Seventeen macrolide-resistant erm(TR)-positive S. agalactiae isolates were phenotypically and genotypically characterized. Their erm(TR)-carrying elements were explored by analysing the distinctive recombination genes of known erm(TR)-carrying integrative and conjugative elements (ICEs) and by PCR mapping. The new genetic context and organization of IMESp2907 in S. agalactiae were explored using several experimental procedures and in silico analyses. Five isolates harboured ICE10750-RD.2/Tn1806, five isolates harboured ICESp1108 and five isolates bore unknown erm(TR)-carrying elements. The remaining two isolates, exhibiting identical serotypes and pulsotypes, harboured IMESp2907 in a new genetic environment, which was further investigated in one of the two isolates, SagTR7. IMESp2907 was circularizable in S. agalactiae, as described in S. pyogenes. The new IMESp2907 junctions were identified based on its site-specific integration; the att sites were almost identical to those in S. pyogenes. In strain SagTR7, erm(TR)-carrying IMESp2907 was embedded in an erm(TR)-less internal element related to ICE10750-RD.2/Tn1806, which, in turn, was embedded in an ICESde3396-like element. The resulting whole ICE, ICESagTR7 (∼129 kb), was integrated into the chromosome downstream of the rplL gene, and was excisable in circular form and transferable by conjugation. This is the first study exploring erm(TR)-carrying genetic elements in S. agalactiae. © The Author 2015. Published by

Comparative mapping of powdery mildew resistance gene Pm21 and functional characterization of resistance-related genes in wheat.

Science.gov (United States)

He, Huagang; Zhu, Shanying; Jiang, Zhengning; Ji, Yaoyong; Wang, Feng; Zhao, Renhui; Bie, Tongde

2016-04-01

The powdery mildew resistance gene Pm21 was physically and comparatively mapped by newly developed markers. Seven candidate genes were verified to be required for Pm21 -mediated resistance to wheat powdery mildew. Pm21, a gene derived from wheat wild relative Dasypyrum villosum, has been transferred into common wheat and widely utilized in wheat resistance breeding for powdery mildew. Previously, Pm21 has been located to the bin FL0.45-0.58 of 6VS by using deletion stocks. However, its fine mapping is still a hard work. In the present study, 30 gene-derived 6VS-specific markers were obtained based on the collinearity among genomes of Brachypodium distachyon, Oryza and Triticeae, and then physically and comparatively mapped in the bin FL0.45-0.58 and its nearby chromosome region. According to the maps, the bin FL0.45-0.58 carrying Pm21 was closely flanked by the markers 6VS-03 and 6VS-23, which further narrowed the orthologous regions to 1.06 Mb in Brachypodium and 1.38 Mb in rice, respectively. Among the conserved genes shared by Brachypodium and rice, four serine/threonine protein kinase genes (DvMPK1, DvMLPK, DvUPK and DvPSYR1), one protein phosphatase gene (DvPP2C) and two transcription factor genes (DvGATA and DvWHY) were confirmed to be required for Pm21-mediated resistance to wheat powdery mildew by barley stripe mosaic virus-induced gene silencing (BSMV-VIGS) and transcriptional pattern analyses. In summary, this study gives new insights into the genetic basis of the Pm21 locus and the disease resistance pathways mediated by Pm21.

Emissions of Escherichia coli Carrying Extended-Spectrum β-Lactamase Resistance from Pig Farms to the Surrounding Environment

Directory of Open Access Journals (Sweden)

Lili Gao

2015-04-01

Full Text Available The dissemination of extended-spectrum β-lactamase (ESBL-producing Escherichia coli (E. coli from food-producing animals to the surrounding environment has attracted much attention. To determine the emissions of ESBL-producing E. coli from pig farms to the surrounding environment, fecal and environmental samples from six pig farms were collected. In total, 119 ESBL-producing E. coli were isolated from feces, air samples, water, sludge and soil samples. Antibiotic susceptibility testing showed that the ESBL-producing isolates were resistant to multiple antibiotics and isolates of different origin within the same farm showed similar resistance phenotypes. Both CTX-M and TEM ESBL-encoding genes were detected in these isolates. CTX-M-14 and CTX-M-15 were the predominant ESBL genes identified. ESBL producers from feces and environmental samples within the same farm carried similar CTX-M types. The results indicated that the ESBL-producing E. coli carrying multidrug resistance could readily disseminate to the surrounding environment.

Distribution of the multidrug resistance gene cfr in Staphylococcus species isolates from swine farms in China.

Science.gov (United States)

Wang, Yang; Zhang, Wanjiang; Wang, Juan; Wu, Congming; Shen, Zhangqi; Fu, Xiao; Yan, Yang; Zhang, Qijing; Schwarz, Stefan; Shen, Jianzhong

2012-03-01

A total of 149 porcine Staphylococcus isolates with florfenicol MICs of ≥ 16 μg/ml were screened for the presence of the multiresistance gene cfr, its location on plasmids, and its genetic environment. In total, 125 isolates carried either cfr (16 isolates), fexA (92 isolates), or both genes (17 isolates). The 33 cfr-carrying staphylococci, which included isolates of the species Staphylococcus cohnii, S. arlettae, and S. saprophyticus in which the cfr gene has not been described before, exhibited a wide variety of SmaI pulsed-field gel electrophoresis patterns. In 18 cases, the cfr gene was located on plasmids. Four different types of cfr-carrying plasmids--pSS-01 (n = 2; 40 kb), pSS-02 (n = 3; 35.4 kb), pSS-03 (n = 10; 7.1 kb), and pBS-01 (n = 3; 16.4 kb)--were differentiated on the basis of their sizes, restriction patterns, and additional resistance genes. Sequence analysis revealed that in plasmid pSS-01, the cfr gene was flanked in the upstream part by a complete aacA-aphD-carrying Tn4001-like transposon and in the downstream part by a complete fexA-carrying transposon Tn558. In plasmid pSS-02, an insertion sequence IS21-558 and the cfr gene were integrated into transposon Tn558 and thereby truncated the tnpA and tnpB genes. The smallest cfr-carrying plasmid pSS-03 carried the macrolide-lincosamide-streptogramin B resistance gene erm(C). Plasmid pBS-01, previously described in Bacillus spp., harbored a Tn917-like transposon, including the macrolide-lincosamide-streptogramin B resistance gene erm(B) in the cfr downstream region. Plasmids, which in part carry additional resistance genes, seem to play an important role in the dissemination of the gene cfr among porcine staphylococci.

Identification and characterization of antibiotic resistance genes in Lactobacillus reuteri and Lactobacillus plantarum.

Science.gov (United States)

Egervärn, M; Roos, S; Lindmark, H

2009-11-01

The study aimed to identify the resistance genes mediating atypical minimum inhibitory concentrations (MICs) for tetracycline, erythromycin, clindamycin and chloramphenicol within two sets of representative strains of the species Lactobacillus reuteri and Lactobacillus plantarum and to characterize identified genes by means of gene location and sequencing of flanking regions. A tet(W) gene was found in 24 of the 28 Lact. reuteri strains with atypical MIC for tetracycline, whereas four of the six strains with atypical MIC for erythromycin were positive for erm(B) and one strain each was positive for erm(C) and erm(T). The two Lact. plantarum strains with atypical MIC for tetracycline harboured a plasmid-encoded tet(M) gene. The majority of the tet(W)-positive Lact. reuteri strains and all erm-positive Lact. reuteri strains carried the genes on plasmids, as determined by Southern blot and a real-time PCR method developed in this study. Most of the antibiotic-resistant strains of Lact. reuteri and Lact. plantarum harboured known plasmid-encoded resistance genes. Examples of putative transfer machineries adjacent to both plasmid- and chromosome-located resistance genes were also demonstrated. These data provide some of the knowledge required for assessing the possible risk of using Lact. reuteri and Lact. plantarum strains carrying antibiotic resistance genes as starter cultures and probiotics.

Anthropogenic antibiotic resistance genes mobilization to the polar regions.

Science.gov (United States)

Hernández, Jorge; González-Acuña, Daniel

2016-01-01

Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL)-type CTX-M genes in which multilocus sequencing typing (MLST) showed different sequence types (STs), previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs) appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait) revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M) in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China.

Science.gov (United States)

Zhao, Yongda; Guo, Lili; Li, Jie; Huang, Xianhui; Fang, Binghu

2018-01-01

Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase ( gyrA and gyrB ) and topoisomerase IV ( parC and parE ). The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%), levofloxacin (20.28%), norfloxacin (22.38%), ciprofloxacin (23.78%), however, high resistance levels were found to nalidixic acid (82.52%) and enrofloxacin (55.94%). In addition, we found 14 antimicrobial resistance genes were present in these isolates, including bla TEM-1 , bla ROB-1 , ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3')-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes ( tetB, tetC, flor, rmtB, sul1 ). The genes tetB , rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G) were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target gene mutations. These data provide novel

Mapping of stripe rust resistance gene in an Aegilops caudate introgression line in wheat and its genetic association with leaf rust resistance.

Science.gov (United States)

Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen

2016-12-01

A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.

[Analysis of resistant genes of beta-lactam antibiotics from Pseudomonas aeruginosa in pediatric patients].

Science.gov (United States)

Dong, Fang; Xu, Xi-wei; Song, Wen-qi; Lü, Ping; Yang, Yong-hong; Shen, Xu-zhuang

2008-11-18

To analyze the antibiotic resistance of the Pseudomonas aeruginosa (PA) isolated from pediatric patients and the resistant genes of beta-lactam antibiotics thereof. 146 PA strains were isolated from pediatric patients. Agar dilution method recommended by the Clinical and Laboratory Standards Institute was used to examine the minimum inhibitory concentrations (MICs) of 12 antimicrobial agents, including the penicillins, third and fourth genet ration cephalosporins, carbapenemase, Aztreonam, beta-lactamase inhibitors, quinolones, and aminoglycosides. PCR was used to detect the expression of the genes TEM, SHV, OXA, PER, GES, CTX-M, IMP, VIM, DHA, MIR, FOX, and oprD2. The multi-drug resistance rates against different antibiotic were high among the 146 PA strains. The rates of imipenem and meropenem resistance were 41.1% and 35.6% respectively. Among the 146 PA strains, 46 (31.5%) were positive for the MBL genotype; 38 (82.6%) carried the blaIMP gene, 8 (17.4%) carried the blaVIM gene, and 114 (78.1%) were oprD2 negative. The genes TEM, SHV, OXA, CTX-M, PER, VEB, GES, FOX, MIR, and DHA were not found in all strains. Many PA isolated from pediatric patients carry the genes IMP or VIM and losses oprD2 gene related to the expression of the outer membrane porin OprD2. The loss of the gene oprD2 is essential mechanism of beta-lactam antibiotics resistance in PA.

Predominance of carbapenem-resistant Pseudomonas aeruginosa isolates carrying blaIMP and blaVIM metallo-β-lactamases in a major hospital in Costa Rica.

Science.gov (United States)

Toval, Francisco; Guzmán-Marte, Anel; Madriz, Vivian; Somogyi, Teresita; Rodríguez, César; García, Fernando

2015-01-01

This study aimed to assess the molecular basis of the resistance to carbapenems in clinical isolates of Pseudomonas aeruginosa recovered from a tertiary-level health facility in San José, Costa Rica. A total of 198 non-duplicated isolates were evaluated for their susceptibility to β-lactams, aminoglycosides and fluoroquinolones. The production of metallo-β-lactamases (MBLs), the presence of MBL encoding genes (blaIMP, blaVIM and blaGIM-1) and the occurrence of these genes within class 1 integrons were investigated. In addition, an ERIC2 PCR fingerprinting method was used to elucidate the distribution of the detected MBL genes within the strain collection. Of the 198 isolates tested, 125 (63.1 %) were categorized as carbapenem-resistant. The majority (88.8 %) of the carbapemen-resistant isolates also showed resistance to ceftazidime, cefepime, aztreonam, ticarcillin/clavulanic acid, amikacin, gentamicin, tobramycin, ciprofloxacin and gatifloxacin. Among the carbapenem-resistant isolates, 102 (81.6 %) showed MBL activity. Strikingly, both blaIMP and blaVIM genes were simultaneously detected in most (94.1 %) of the 102 MBL producers. Five carbapenem-resistant MBL producers were positive only for blaIMP genes. Almost 70 % of the isolates examined harboured the intI1 gene, accompanied by the sul1 and qacEΔ1 genes in 136 (99 %) and 122 (89 %) isolates, respectively. The majority (94.4 %) of the carbapenem-resistant isolates carried the intI1 gene, in contrast to 26 % of the carbapenem-susceptible isolates. Ninety-three out of 96 (96.9 %) isolates carrying both blaIMP and blaVIM genes also harboured the intI1, sul1 and qacEΔ1 genes. Gene cassettes from carbapenem-susceptible and MBL-negative carbapenem-resistant isolates encoded aminoglycoside-resistance enzymes (aadA2, aadA4 and aadA6) as well as orfD and qacF genes. RAPD analysis distributed 126 of the isolates in 29 clusters. Eighty of the 90 blaIMP (+) blaVIM (+) isolates were sorted into 16

Detection and coexistence of six categories of resistance genes in Escherichia coli strains from chickens in Anhui Province, China

Directory of Open Access Journals (Sweden)

Lin Li

2015-12-01

Full Text Available The aim of this study was to characterise the prevalence of class 1 integrons and gene cassettes, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants in 184 Escherichia coli isolates from chickens in Anhui Province, China. Susceptibility to 15 antimicrobials was determined using broth micro-dilution. Polymerase chain reaction and DNA sequencing were used to characterise the molecular basis of the antibiotic resistance. High rates of antimicrobial resistance were observed; 131 out of the 184 (72.3% isolates were resistant to at least six antimicrobial agents. The prevalences of class 1 integrons, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants were 49.5, 17.4, 15.8, 0.5, 57.6 and 46.2%, respectively. In 82 isolates, 48 different kinds of coexistence of the different genes were identified. Statistical (χ2 analysis showed that the resistance to amoxicillin, doxycycline, florfenicol, ofloxacin and gentamicin had significant differences (P<0.01 or 0.01carried and did not carry the resistance genes, which showed a certain correlation between antimicrobial resistance and the presence of resistance genes.

Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China

Directory of Open Access Journals (Sweden)

Yongda Zhao

2018-04-01

Full Text Available Background Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. Methods We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase (gyrA and gyrB and topoisomerase IV (parC and parE. The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Results Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%, levofloxacin (20.28%, norfloxacin (22.38%, ciprofloxacin (23.78%, however, high resistance levels were found to nalidixic acid (82.52% and enrofloxacin (55.94%. In addition, we found 14 antimicrobial resistance genes were present in these isolates, including blaTEM-1, blaROB-1, ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3′-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes (tetB, tetC, flor, rmtB, sul1. The genes tetB, rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. Discussion The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target

First detection of the staphylococcal trimethoprim resistance gene dfrK and the dfrK-carrying transposon Tn559 in enterococci.

Science.gov (United States)

López, María; Kadlec, Kristina; Schwarz, Stefan; Torres, Carmen

2012-02-01

The trimethoprim resistance gene dfrK has been recently described in Staphylococcus aureus, but so far has not been found in other bacteria. A total of 166 enterococci of different species (E. faecium, E. faecalis, E. hirae, E. durans, E. gallinarum, and E. casseliflavus) and origins (food, clinical diseases in humans, healthy humans or animals, and sewage) were studied for their susceptibility to trimethoprim as determined by agar dilution (European Committee on Antimicrobial Susceptibility Testing) and the presence of (a) the dfrK gene and its genetic environment and (b) other dfr genes. The dfrK gene was detected in 49% of the enterococci (64% and 42% of isolates with minimum inhibitory concentrations of ≥2 mg/L or ≤1 mg/L, respectively). The tet(L)-dfrK linkage was detected in 21% of dfrK-positive enterococci. The chromosomal location of the dfrK gene was identified in one E. faecium isolate in which the dfrK was not linked to tet(L) gene but was part of a Tn559 element, which was integrated in the chromosomal radC gene. This Tn559 element was also found in 14 additional isolates. All combinations of dfr genes were detected among the isolates tested (dfrK, dfrG, dfrF, dfrK+dfrG, dfrK+dfrF, dfrF+dfrG, and dfrF+dfrG+dfrK). The gene dfrK gene was found together with other dfr genes in 58% of the tested enterococci. This study suggested an exchange of the trimethoprim resistance gene dfrK between enterococci and staphylococci, as previously observed for the trimethoprim resistance gene dfrG.

Incorporation of Bacterial Blight Resistance Genes Into Lowland Rice Cultivar Through Marker-Assisted Backcross Breeding.

Science.gov (United States)

Pradhan, Sharat Kumar; Nayak, Deepak Kumar; Pandit, Elssa; Behera, Lambodar; Anandan, Annamalai; Mukherjee, Arup Kumar; Lenka, Srikanta; Barik, Durga Prasad

2016-07-01

Bacterial blight (BB) of rice caused by Xanthomonas oryzae pv. oryzae is a major disease of rice in many rice growing countries. Pyramided lines carrying two BB resistance gene combinations (Xa21+xa13 and Xa21+xa5) were developed in a lowland cultivar Jalmagna background through backcross breeding by integrating molecular markers. In each backcross generation, markers closely linked to the disease resistance genes were used to select plants possessing the target genes. Background selection was continued in those plants carrying resistant genes until BC(3) generation. Plants having the maximum contribution from the recurrent parent genome were selected in each generation and hybridized with the recipient parent. The BB-pyramided line having the maximum recipient parent genome recovery of 95% was selected among BC3F1 plants and selfed to isolate homozygous BC(3)F(2) plants with different combinations of BB resistance genes. Twenty pyramided lines with two resistance gene combinations exhibited high levels of tolerance against the BB pathogen. In order to confirm the resistance, the pyramided lines were inoculated with different X. oryzae pv. oryzae strains of Odisha for bioassay. The genotypes with combination of two BB resistance genes conferred high levels of resistance to the predominant X. oryzae pv. oryzae isolates prevalent in the region. The pyramided lines showed similarity with the recipient parent with respect to major agro-morphologic traits.

Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa.

Science.gov (United States)

Ueno, Hiroki; Matsumoto, Etsuo; Aruga, Daisuke; Kitagawa, Satoshi; Matsumura, Hideo; Hayashida, Nobuaki

2012-12-01

Clubroot disease is one of the major diseases affecting Brassicaceae crops, and a number of these crops grown commercially, such as Chinese cabbage (Brassica rapa L. ssp. pekinensis), are known to be highly susceptible to clubroot disease. To provide protection from this disease, plant breeders have introduced genes for resistance to clubroot from the European turnip into susceptible lines. The CRa gene confers specific resistance to the clubroot pathogen Plasmodiophora brassicae isolate M85. Fine mapping of the CRa locus using synteny to the Arabidopsis thaliana genome and partial genome sequences of B. rapa revealed a candidate gene encoding a TIR-NBS-LRR protein. Several structural differences in this candidate gene were found between susceptible and resistant lines, and CRa expression was observed only in the resistant line. Four mutant lines lacking clubroot resistance were obtained by the UV irradiation of pollen from a resistant line, and all of these mutant lines carried independent mutations in the candidate TIR-NBS-LRR gene. This genetic and molecular evidence strongly suggests that the identified gene is CRa. This is the first report on the molecular characterization of a clubroot Resistance gene in Brassicaceae and of the disease resistance gene in B. rapa.

Molecular and cytogenetic characterization of wheat introgression lines carrying the stem rust resistance gene Sr39.

Science.gov (United States)

Stem rust, caused by Puccinia graminis Pers.:Pers. f.sp. tritici Eriks. and Henn., poses a serious threat to global wheat production because of the emergence of Pgt-TTKSK (Ug99). The TTKSK resistant gene Sr39 was derived from Aegilops speltoides through chromosome translocation. In this study, we ch...

A novel Capsicum gene inhibits host-specific disease resistance to Phytophthora capsici.

Science.gov (United States)

Reeves, Gregory; Monroy-Barbosa, Ariadna; Bosland, Paul W

2013-05-01

A novel disease resistance inhibitor gene (inhibitor of P. capsici resistance [Ipcr]), found in the chile pepper (Capsicum annuum) variety 'New Mexico Capsicum Accession 10399' (NMCA10399), inhibits resistance to Phytophthora capsici but not to other species of Phytophthora. When a highly P. capsici-resistant variety was hybridized with NMCA10399, the resultant F1 populations, when screened, were completely susceptible to P. capsici for root rot and foliar blight disease syndromes, despite the dominance inheritance of P. capsici resistance in chile pepper. The F2 population displayed a 3:13 resistant-to-susceptible (R:S) ratio. The testcross population displayed a 1:1 R:S ratio, and a backcross population to NMCA10399 displayed complete susceptibility. These results demonstrate the presence of a single dominant inhibitor gene affecting P. capsici resistance in chile pepper. Moreover, when lines carrying the Ipcr gene were challenged against six Phytophthora spp., the nonhost resistance was not overcome. Therefore, the Ipcr gene is interfering with host-specific resistance but not the pathogen- or microbe-associated molecular pattern nonhost responses.

Presence of antiseptic resistance genes in porcine methicillin-resistant Staphylococcus aureus.

Science.gov (United States)

Wong, T Z; Zhang, M; O'Donoghue, M; Boost, M

2013-03-23

Numerous studies have documented the presence of methicillin-resistant Staphylococcus aureus (MRSA) in meat-producing animals, which has led to concern about its spread into the community. Disinfectants play an important role in reduction of contamination in both animal husbandry and food-preparation, helping control spread of organisms from foodstuffs, including raw meat. Plasmid-borne antiseptic resistance (AR) genes increasing tolerance to several disinfectants have been reported in S. aureus of human origin (qacA/B and smr) and from bovine, equine, and caprine staphylococcal isolates (qacG, qacH, and qacJ). This study investigated the presence of AR genes in porcine MRSA isolates. Plasmid DNA from 100 MRSA ST9 strains isolated from pig carcasses was amplified for the presence of AR genes. Minimum inhibitory concentrations (MICs) and minimum bactericidal concentrations (MBCs) to benzalkonium chloride (BC) and chlorhexidine gluconate (CHX) were determined in AR gene-positive isolates. qacG was present in 45 strains, eight of which also harbored smr. No strains carried qacA/B, qacH or qacJ. Presence of smr increased MICs to both BC and CHX and MBCs of CHX, but qacG presence only resulted in elevated MBC for CHX. This is the first report of AR genes from a porcine source. AR gene positivity has previously been associated with methicillin resistance and AR gene presence in these strains may increase their ability to persist in the environment. Improved implementation of hygiene measures during transportation and pre- and post-slaughter should be considered to prevent spread in the community. Copyright © 2012 Elsevier B.V. All rights reserved.

Isolation of Enterobacter aerogenes carrying blaTEM-1 and blaKPC-3 genes recovered from a hospital Intensive Care Unit.

Science.gov (United States)

Pulcrano, Giovanna; Pignanelli, Salvatore; Vollaro, Adriana; Esposito, Matilde; Iula, Vita Dora; Roscetto, Emanuela; Soriano, Amata Amy; Catania, Maria Rosaria

2016-06-01

Enterobacter aerogenes has recently emerged as an important hospital pathogen. In this study, we showed the emergence of E. aerogenes isolates carrying the blaKPC gene in patients colonized by carbapenem-resistant Klebsiella pneumoniae strains. Two multiresistant E. aerogenes isolates were recovered from bronchial aspirates of two patients hospitalized in the Intensive Care Unit at the "Santa Maria della Scaletta" Hospital, Imola. The antimicrobial susceptibility test showed the high resistance to carbapenems and double-disk synergy test confirmed the phenotype of KPC and AmpC production. Other investigation revealed that ESBL and blaKPC genes were carried on the conjugative pKpQIL plasmid. This is a relevant report in Italy that describes a nosocomial infection due to the production of KPC beta-lactamases by an E. aerogenes isolate in patients previously colonized by K. pneumoniae carbapenem-resistant. In conclusion, it's necessary a continuous monitoring of multidrug-resistant strains for the detection of any KPC-producing bacteria that could expand the circulation of carbapenem-resistant pathogens. © 2016 APMIS. Published by John Wiley & Sons Ltd.

Ventilator-associated pneumonia caused by carbapenem-resistant Enterobacteriaceae carrying multiple metallo-beta-lactamase genes

Directory of Open Access Journals (Sweden)

Dwivedi Mayank

2009-07-01

Full Text Available Context: Ventilator-associated pneumonia (VAP is a leading nosocomial infection in the intensive care unit (ICU. Members of Enterobacteriaceae are the most common causative agents and carbapenems are the most commonly used antibiotics. Metallo-beta-lactamase (MBL production leading to treatment failure may go unnoticed by routine disc diffusion susceptibility testing. Moreover, there is not much information on association of MBL-producing Enterobacteriaceae with ICU-acquired VAP. Therefore, a study was undertaken to find out the association of MBL-producing Enterobacteriaceae with VAP. Settings: This study was conducted in a large tertiary care hospital of North India with an eight-bed critical care unit. Materials and Methods: The respiratory samples (bronchoalveolar lavage, protected brush catheter specimens and endotracheal or transtracheal aspirates obtained from VAP patients (during January 2005-December 2006 were processed, isolated bacteria identified and their antibiotic susceptibilities tested as per standard protocols. The isolates of Enterobacteriaceae resistant to carbapenem were subjected to phenotypic and genotypic tests for the detection of MBLs. Results: Twelve of 64 isolates of Enterobacteriaceae were detected as MBL producers, bla IMP being the most prevalent gene. Additionally, in three strains, simultaneous coexistence of multiple MBL genes was detected. Conclusion: The coexistence of multiple MBL genes in Enterobacteriaceae is an alarming situation. As MBL genes are associated with integrons that can be embedded in transposons, which in turn can be accommodated on plasmids thereby resulting in a highly mobile genetic apparatus, the further spread of these genes in different pathogens is likely to occur.

Antibiotic resistance and virulence genes in coliform water isolates.

Science.gov (United States)

Stange, C; Sidhu, J P S; Tiehm, A; Toze, S

2016-11-01

Widespread fecal pollution of surface water may present a major health risk and a significant pathway for dissemination of antibiotic resistance bacteria. The River Rhine is one of the longest and most important rivers in Europe and an important raw water source for drinking water production. A total of 100 coliform isolates obtained from River Rhine (Germany) were examined for their susceptibility to seven antimicrobial agents. Resistances against amoxicillin, trimethoprim/sulfamethoxazole and tetracycline were detected in 48%, 11% and 9% of isolates respectively. The antibiotic resistance could be traced back to the resistance genes bla TEM , bla SHV , ampC, sul1, sul2, dfrA1, tet(A) and tet(B). Whereby, the ampC gene represents a special case, because its presence is not inevitably linked to a phenotypic antibiotic resistance. Multiple antibiotics resistance was often accompanied by the occurrence of class 1 or 2 integrons. E. coli isolates belonging to phylogenetic groups A and B1 (commensal) were more predominant (57%) compared to B2 and D groups (43%) which are known to carry virulent genes. Additionally, six E. coli virulence genes were also detected. However, the prevalence of virulence genes in the E. coli isolates was low (not exceeding 4.3% per gene) and no diarrheagenic E. coli pathotypes were detected. This study demonstrates that surface water is an important reservoir of ARGs for a number of antibiotic classes such as sulfonamide, trimethoprim, beta-lactam-antibiotics and tetracycline. The occurrence of antibiotic resistance in coliform bacteria isolated from River Rhine provides evidence for the need to develop management strategies to limit the spread of antibiotic resistant bacteria in aquatic environment. Copyright © 2016 Elsevier GmbH. All rights reserved.

Postulation of rust resistance genes in Nordic spring wheat genotypes and identification of widely effective sources of resistance against the Australian rust flora.

Science.gov (United States)

Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans

2016-11-01

Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.

Gene Expression Profiling and Identification of Resistance Genes to Aspergillus flavus Infection in Peanut through EST and Microarray Strategies

Directory of Open Access Journals (Sweden)

Baozhu Guo

2011-06-01

Full Text Available Aspergillus flavus and A. parasiticus infect peanut seeds and produce aflatoxins, which are associated with various diseases in domestic animals and humans throughout the world. The most cost-effective strategy to minimize aflatoxin contamination involves the development of peanut cultivars that are resistant to fungal infection and/or aflatoxin production. To identify peanut Aspergillus-interactive and peanut Aspergillus-resistance genes, we carried out a large scale peanut Expressed Sequence Tag (EST project which we used to construct a peanut glass slide oligonucleotide microarray. The fabricated microarray represents over 40% of the protein coding genes in the peanut genome. For expression profiling, resistant and susceptible peanut cultivars were infected with a mixture of Aspergillus flavus and parasiticus spores. The subsequent microarray analysis identified 62 genes in resistant cultivars that were up-expressed in response to Aspergillus infection. In addition, we identified 22 putative Aspergillus-resistance genes that were constitutively up-expressed in the resistant cultivar in comparison to the susceptible cultivar. Some of these genes were homologous to peanut, corn, and soybean genes that were previously shown to confer resistance to fungal infection. This study is a first step towards a comprehensive genome-scale platform for developing Aspergillus-resistant peanut cultivars through targeted marker-assisted breeding and genetic engineering.

Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China

Science.gov (United States)

Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.

2011-01-01

Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

Directory of Open Access Journals (Sweden)

Chen Tingfu

2010-07-01

Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

The novel kasugamycin 2'-N-acetyltransferase gene aac(2')-IIa, carried by the IncP island, confers kasugamycin resistance to rice-pathogenic bacteria.

Science.gov (United States)

Yoshii, Atsushi; Moriyama, Hiromitsu; Fukuhara, Toshiyuki

2012-08-01

Kasugamycin (KSM), a unique aminoglycoside antibiotic, has been used in agriculture for many years to control not only rice blast caused by the fungus Magnaporthe grisea but also rice bacterial grain and seedling rot or rice bacterial brown stripe caused by Burkholderia glumae or Acidovorax avenae subsp. avenae, respectively. Since both bacterial pathogens are seed-borne and cause serious injury to rice seedlings, the emergence of KSM-resistant B. glumae and A. avenae isolates highlights the urgent need to understand the mechanism of resistance to KSM. Here, we identified a novel gene, aac(2')-IIa, encoding a KSM 2'-N-acetyltransferase from both KSM-resistant pathogens but not from KSM-sensitive bacteria. AAC(2')-IIa inactivates KSM, although it reveals no cross-resistance to other aminoglycosides. The aac(2')-IIa gene from B. glumae strain 5091 was identified within the IncP genomic island inserted into the bacterial chromosome, indicating the acquisition of this gene by horizontal gene transfer. Although excision activity of the IncP island and conjugational gene transfer was not detected under the conditions tested, circular intermediates containing the aac(2')-IIa gene were detected. These results indicate that the aac(2')-IIa gene had been integrated into the IncP island of a donor bacterial species. Molecular detection of the aac(2')-IIa gene could distinguish whether isolates are resistant or susceptible to KSM. This may contribute to the production of uninfected rice seeds and lead to the effective control of these pathogens by KSM.

Identification and characterization of two novel bla(KLUC resistance genes through large-scale resistance plasmids sequencing.

Directory of Open Access Journals (Sweden)

Teng Xu

Full Text Available Plasmids are important antibiotic resistance determinant carriers that can disseminate various drug resistance genes among species or genera. By using a high throughput sequencing approach, two groups of plasmids of Escherichia coli (named E1 and E2, each consisting of 160 clinical E. coli strains isolated from different periods of time were sequenced and analyzed. A total of 20 million reads were obtained and mapped onto the known resistance gene sequences. As a result, a total of 9 classes, including 36 types of antibiotic resistant genes, were identified. Among these genes, 25 and 27 single nucleotide polymorphisms (SNPs appeared, of which 9 and 12 SNPs are nonsynonymous substitutions in the E1 and E2 samples. It is interesting to find that a novel genotype of bla(KLUC, whose close relatives, bla(KLUC-1 and bla(KLUC-2, have been previously reported as carried on the Kluyvera cryocrescens chromosome and Enterobacter cloacae plasmid, was identified. It shares 99% and 98% amino acid identities with Kluc-1 and Kluc-2, respectively. Further PCR screening of 608 Enterobacteriaceae family isolates yielded a second variant (named bla(KLUC-4. It was interesting to find that Kluc-3 showed resistance to several cephalosporins including cefotaxime, whereas bla(KLUC-4 did not show any resistance to the antibiotics tested. This may be due to a positively charged residue, Arg, replaced by a neutral residue, Leu, at position 167, which is located within an omega-loop. This work represents large-scale studies on resistance gene distribution, diversification and genetic variation in pooled multi-drug resistance plasmids, and provides insight into the use of high throughput sequencing technology for microbial resistance gene detection.

Surveillance of multidrug resistance-associated genes in Acinetobacter baumannii isolates from elderly patients

Directory of Open Access Journals (Sweden)

Zhe DONG

2012-03-01

Full Text Available Objective　To understand the status of multidrug resistance-associated genes carried by Acinetobacter baumannii isolates from elderly patients in our hospital in order to provide a basis for surveillance of drug-resistance and inflection control. Methods　One hundred and twenty A. baumannii isolates were collected from elderly patients between 2008 and 2010. The mean age of the patients was 85 (65 to 95 years. Whonet 5.6 software was used to analyze the resistance rate of 16 antimicrobial agents. Polymerase chain reaction (PCR and the sequencing method were adopted to detect 10 kinds of resistance genes (blaOXA-51-like, blaOXA- 23-like, blaOXA-24-like, blaOXA-58-like, blaTEM, blaampC, armA, ISAba1, intI 1, and intI 2. The corresponding resistance gene profiling(RGP was analyzed and designated according to the status of resistance genes. Results　The resistance rates to the remaining 15 kinds of antibiotics varied between 70.8% and 97.5%, with the exception of the sensitivity rate to polymyxin B by up to more than 90%. The positivity rates of blaOXA-51-like, blaOXA-23-like, blaOXA-58-like, blaTEM, blaampC, armA, ISAba1 and intI 1 were 100%, 81.7%, 0.8%, 10.8%, 91.7%, 81.7%, 86.7%, and 83.3% respectively. A total of 18 kinds of drug-resistant gene maps were found, but blaOXA-24-like and intI 2 were not detected. Among these gene maps, the rate of RGP1 (blaOXA-23-like+blaampC+armA+ISAba1+ intI 1 was as high as 60.8%. Conclusions A. baumannii isolates from elderly patients have a higher carrying rate of drug-resistant genes, resulting in severe multidrugresistant conditions. Therefore, full-time infection control personnel and clinical physicians should actively participate in the surveillance, prevention, and control of infections caused by A. baumannii in the elderly.

Environmental cycle of antibiotic resistance encoded genes: A systematic review

Directory of Open Access Journals (Sweden)

R. ghanbari

2017-12-01

Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

Rapid cloning of disease-resistance genes in plants using mutagenesis and sequence capture

Science.gov (United States)

Genetic solutions to protect crops against pests and pathogens are preferable to agrichemicals 1. Wild crop relatives carry immense diversity of disease resistance (R) genes that could enable more sustainable disease control. However, recruiting R genes for crop improvement typically involves long b...

Are duplicated genes responsible for anthracnose resistance in common bean?

Science.gov (United States)

Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida

2017-01-01

The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

Development of 25 near-isogenic lines (NILs) with ten BPH resistance genes in rice (Oryza sativa L.): production, resistance spectrum, and molecular analysis.

Science.gov (United States)

Jena, Kshirod K; Hechanova, Sherry Lou; Verdeprado, Holden; Prahalada, G D; Kim, Sung-Ryul

2017-11-01

A first set of 25 NILs carrying ten BPH resistance genes and their pyramids was developed in the background of indica variety IR24 for insect resistance breeding in rice. Brown planthopper (Nilaparvata lugens Stal.) is one of the most destructive insect pests in rice. Development of near-isogenic lines (NILs) is an important strategy for genetic analysis of brown planthopper (BPH) resistance (R) genes and their deployment against diverse BPH populations. A set of 25 NILs with 9 single R genes and 16 multiple R gene combinations consisting of 11 two-gene pyramids and 5 three-gene pyramids in the genetic background of the susceptible indica rice cultivar IR24 was developed through marker-assisted selection. The linked DNA markers for each of the R genes were used for foreground selection and confirming the introgressed regions of the BPH R genes. Modified seed box screening and feeding rate of BPH were used to evaluate the spectrum of resistance. BPH reaction of each of the NILs carrying different single genes was variable at the antibiosis level with the four BPH populations of the Philippines. The NILs with two- to three-pyramided genes showed a stronger level of antibiosis (49.3-99.0%) against BPH populations compared with NILs with a single R gene NILs (42.0-83.5%) and IR24 (10.0%). Background genotyping by high-density SNPs markers revealed that most of the chromosome regions of the NILs (BC 3 F 5 ) had IR24 genome recovery of 82.0-94.2%. Six major agronomic data of the NILs showed a phenotypically comparable agronomic performance with IR24. These newly developed NILs will be useful as new genetic resources for BPH resistance breeding and are valuable sources of genes in monitoring against the emerging BPH biotypes in different rice-growing countries.

A novel resistance gene, lnu(H), conferring resistance to lincosamides in Riemerella anatipestifer CH-2.

Science.gov (United States)

Luo, Hong-Yan; Liu, Ma-Feng; Wang, Ming-Shu; Zhao, Xin-Xin; Jia, Ren-Yong; Chen, Shun; Sun, Kun-Feng; Yang, Qiao; Wu, Ying; Chen, Xiao-Yue; Biville, Francis; Zou, Yuan-Feng; Jing, Bo; Cheng, An-Chun; Zhu, De-Kang

2018-01-01

The Gram-negative bacterium Riemerella anatipestifer CH-2 is resistant to lincosamides, having a lincomycin (LCM) minimum inhibitory concentration (MIC) of 128 µg/mL. The G148_1775 gene of R. anatipestifer CH-2, designated lnu(H), encodes a 260-amino acid protein with ≤41% identity to other reported lincosamide nucleotidylyltransferases. Escherichia coli Rosetta TM (DE3) containing the pBAD24-lnu(H) plasmid showed four- and two-fold increases in the MICs of LCM and clindamycin (CLI), respectively. A kinetic assay of the purified Lnu(H) enzyme for LCM and CLI showed that the protein could inactive lincosamides. Mass spectrometry analysis demonstrated that the Lnu(H) enzyme catalysed adenylylation of lincosamides. In addition, an lnu(H) gene deletion strain exhibited 512- and 32-fold decreases in LCM and CLI MICs, respectively. The wild-type level of lincosamide resistance could be restored by complementation with a shuttle plasmid carrying the lnu(H) gene. The transformant R. anatipestifer ATCC 11845 [lnu(H)] acquired by natural transformation also exhibited high-level lincosamide resistance. Moreover, among 175 R. anatipestifer field isolates, 56 (32.0%) were positive for the lnu(H) gene by PCR. In conclusion, Lnu(H) is a novel lincosamide nucleotidylyltransferase that inactivates LCM and CLI by nucleotidylylation, thus conferring high-level lincosamide resistance to R. anatipestifer CH-2. Copyright © 2017. Published by Elsevier B.V.

Multiyear evaluation of the durability of the resistance conferred by Ma and RMia genes to Meloidogyne incognita in Prunus under controlled conditions.

Science.gov (United States)

Khallouk, Samira; Voisin, Roger; Portier, Ulysse; Polidori, Joël; Van Ghelder, Cyril; Esmenjaud, Daniel

2013-08-01

Root-knot nematodes (RKNs) (Meloidogyne spp.) are highly polyphagous pests that parasitize Prunus crops in Mediterranean climates. Breeding for RKN-resistant Prunus cultivars, as an alternative to the now-banned use of nematicides, is a real challenge, because the perennial nature of these trees increases the risk of resistance breakdown. The Ma plum resistance (R) gene, with a complete spectrum, and the RMia peach R gene, with a more restricted spectrum, both provide total control of Meloidogyne incognita, the model parthenogenetic species of the genus and the most important RKN in terms of economic losses. We investigated the durability of the resistance to this nematode conferred by these genes, comparing the results obtained with those for the tomato Mi-1 reference gene. In multiyear experiments, we applied a high and continuous nematode inoculum pressure by cultivating nematode-infested susceptible tomato plants with either Prunus accessions carrying Ma or RMia R genes, or with resistant tomato plants carrying the Mi-1 gene. Suitable conditions for Prunus development were achieved by carrying out the studies in a glasshouse, in controlled conditions allowing a short winter leaf fall and dormancy. We first assessed the plum accession 'P.2175', which is heterozygous for the Ma gene, in two successive 2-year evaluations, for resistance to two M. incognita isolates. Whatever the isolate used, no nematodes reproducing on P.2175 were detected, whereas galls and nematodes reproducing on tomato plants carrying Mi-1 were observed. In a second experiment with the most aggressive isolate, interspecific full-sib material (P.2175 × ['Garfi' almond × 'Nemared' peach]), carrying either Ma or RMia (from Nemared) or both (in the heterozygous state) or neither of these genes, was evaluated for 4 years. No virulent nematodes developed on Prunus spp. carrying R genes, whereas galling and virulent individuals were observed on Mi-1-resistant tomato plants. Thus, the resistance to

Identification of a novel vga(E) gene variant that confers resistance to pleuromutilins, lincosamides and streptogramin A antibiotics in staphylococci of porcine origin.

Science.gov (United States)

Li, Jun; Li, Beibei; Wendlandt, Sarah; Schwarz, Stefan; Wang, Yang; Wu, Congming; Ma, Zhiyong; Shen, Jianzhong

2014-04-01

To investigate the genetic basis of pleuromutilin resistance in coagulase-negative staphylococci of porcine origin that do not carry known pleuromutilin resistance genes and to determine the localization and genetic environment of the identified resistance gene. Plasmid DNA of two pleuromutilin-resistant Staphylococcus cohnii and Staphylococcus simulans isolates was transformed into Staphylococcus aureus RN4220. The identified resistance plasmids were sequenced completely. The candidate gene for pleuromutilin resistance was cloned into shuttle vector pAM401. S. aureus RN4220 transformants carrying this recombinant shuttle vector were tested for their MICs. S. cohnii isolate SA-7 and S. simulans isolate SSI1 carried the same plasmid of 5584 bp, designated pSA-7. A variant of the vga(E) gene was detected, which encodes a 524 amino acid ATP-binding cassette protein. The variant gene shared 85.7% nucleotide sequence identity and the variant protein 85.3% amino acid sequence identity with the original vga(E) gene and Vga(E) protein, respectively. The Vga(E) variant conferred cross-resistance to pleuromutilins, lincosamides and streptogramin A antibiotics. Plasmid pSA-7 showed an organization similar to that of the apmA-carrying plasmid pKKS49 from methicillin-resistant S. aureus and the dfrK-carrying plasmid pKKS966 from Staphylococcus hyicus. Sequence comparisons suggested that recombination events may have played a role in the acquisition of this vga(E) variant. A novel vga(E) gene variant was identified, which was located on a small plasmid and was not associated with the transposon Tn6133 [in contrast to the original vga(E) gene]. The plasmid location may enable its further dissemination to other staphylococci and possibly also to other bacteria.

Next-generation sequencing to identify candidate genes and develop diagnostic markers for a novel Phytophthora resistance gene, RpsHC18, in soybean.

Science.gov (United States)

Zhong, Chao; Sun, Suli; Li, Yinping; Duan, Canxing; Zhu, Zhendong

2018-03-01

A novel Phytophthora sojae resistance gene RpsHC18 was identified and finely mapped on soybean chromosome 3. Two NBS-LRR candidate genes were identified and two diagnostic markers of RpsHC18 were developed. Phytophthora root rot caused by Phytophthora sojae is a destructive disease of soybean. The most effective disease-control strategy is to deploy resistant cultivars carrying Phytophthora-resistant Rps genes. The soybean cultivar Huachun 18 has a broad and distinct resistance spectrum to 12 P. sojae isolates. Quantitative trait loci sequencing (QTL-seq), based on the whole-genome resequencing (WGRS) of two extreme resistant and susceptible phenotype bulks from an F 2:3 population, was performed, and one 767-kb genomic region with ΔSNP-index ≥ 0.9 on chromosome 3 was identified as the RpsHC18 candidate region in Huachun 18. The candidate region was reduced to a 146-kb region by fine mapping. Nonsynonymous SNP and haplotype analyses were carried out in the 146-kb region among ten soybean genotypes using WGRS. Four specific nonsynonymous SNPs were identified in two nucleotide-binding sites-leucine-rich repeat (NBS-LRR) genes, RpsHC18-NBL1 and RpsHC18-NBL2, which were considered to be the candidate genes. Finally, one specific SNP marker in each candidate gene was successfully developed using a tetra-primer ARMS-PCR assay, and the two markers were verified to be specific for RpsHC18 and to effectively distinguish other known Rps genes. In this study, we applied an integrated genomic-based strategy combining WGRS with traditional genetic mapping to identify RpsHC18 candidate genes and develop diagnostic markers. These results suggest that next-generation sequencing is a precise, rapid and cost-effective way to identify candidate genes and develop diagnostic markers, and it can accelerate Rps gene cloning and marker-assisted selection for breeding of P. sojae-resistant soybean cultivars.

The genetics of resistance to powdery mildew in cultivated oats (Avena sativa L.): current status of major genes.

Science.gov (United States)

Hsam, Sai L K; Mohler, Volker; Zeller, Friedrich J

2014-05-01

The genetics of resistance to powdery mildew caused by Blumeria graminis f. sp. avenae of four cultivated oats was studied using monosomic analysis. Cultivar 'Bruno' carries a gene (Pm6) that shows a recessive mode of inheritance and is located on chromosome 10D. Cultivar 'Jumbo' possesses a dominant resistance gene (Pm1) on chromosome 1C. In cultivar 'Rollo', in addition to the gene Pm3 on chromosome 17A, a second dominant resistance gene (Pm8) was identified and assigned to chromosome 4C. In breeding line APR 122, resistance was conditioned by a dominant resistance gene (Pm7) that was allocated to chromosome 13A. Genetic maps established for resistance genes Pm1, Pm6 and Pm7 employing amplified fragment length polymorphism (AFLP) markers indicated that these genes are independent of each other, supporting the results from monosomic analysis.

Molecular epidemiology of outbreak-related pseudomonas aeruginosa strains carrying the novel variant blaVIM-17 metallo-beta-lactamase gene.

Science.gov (United States)

Siarkou, Victoria I; Vitti, Danai; Protonotariou, Efthimia; Ikonomidis, Alexandros; Sofianou, Danai

2009-04-01

A study was designed to investigate the molecular epidemiological characteristics of multidrug-resistant outbreak-related Pseudomonas aeruginosa isolates collected in a university hospital in northern Greece. Of 29 nonreplicate P. aeruginosa isolates resistant to carbapenems and ceftazidime, 14 were positive for metallo-beta-lactamase production. PCR analyses with primers specific for bla(VIM) and bla(IMP) revealed that 13 isolates carried a novel bla(VIM-2) gene variant, designated bla(VIM-17), and only 1 isolate carried bla(VIM-2), a gene predominant among P. aeruginosa strains in Greek hospitals. Pulsed-field gel electrophoresis of XbaI-digested genomic DNAs showed a close genetic relationship for 12 of 13 bla(VIM-17)-carrying outbreak-related isolates, which were of the O11 serotype; the clonally unrelated isolate carrying bla(VIM-17) was of the O12 serotype. PCR mapping strategies for the detection of class 1 integrons and sequencing approaches revealed the presence of integrons containing one bla(VIM) cassette flanked by two aacA29 cassettes. These integrons were similar but not identical to In59 (GenBank accession number AF263519) initially described in France. All isolates carrying bla(VIM-17), regardless of their genetic profile, had an identical integron, named In59.3, indicating that although the hospital outbreak was mainly due to clonal dissemination, the horizontal transmission of the bla(VIM-17)-containing integron among P. aeruginosa isolates should also have occurred. An outbreak-related isolate and a control strain, both of which carried the bla(VIM-2) gene but which were clonally distinct, had an identical integron, named In59.2, which differed only at the level of the bla(VIM) gene from In59.3 integrons, suggesting a common ancestry. The spread of the bla(VIM-17)-containing integron in clonally unrelated P. aeruginosa isolates without any evidence of plasmid carriage is probably associated with a transposon.

The Novel Kasugamycin 2′-N-Acetyltransferase Gene aac(2′)-IIa, Carried by the IncP Island, Confers Kasugamycin Resistance to Rice-Pathogenic Bacteria

Science.gov (United States)

Moriyama, Hiromitsu; Fukuhara, Toshiyuki

2012-01-01

Kasugamycin (KSM), a unique aminoglycoside antibiotic, has been used in agriculture for many years to control not only rice blast caused by the fungus Magnaporthe grisea but also rice bacterial grain and seedling rot or rice bacterial brown stripe caused by Burkholderia glumae or Acidovorax avenae subsp. avenae, respectively. Since both bacterial pathogens are seed-borne and cause serious injury to rice seedlings, the emergence of KSM-resistant B. glumae and A. avenae isolates highlights the urgent need to understand the mechanism of resistance to KSM. Here, we identified a novel gene, aac(2′)-IIa, encoding a KSM 2′-N-acetyltransferase from both KSM-resistant pathogens but not from KSM-sensitive bacteria. AAC(2′)-IIa inactivates KSM, although it reveals no cross-resistance to other aminoglycosides. The aac(2′)-IIa gene from B. glumae strain 5091 was identified within the IncP genomic island inserted into the bacterial chromosome, indicating the acquisition of this gene by horizontal gene transfer. Although excision activity of the IncP island and conjugational gene transfer was not detected under the conditions tested, circular intermediates containing the aac(2′)-IIa gene were detected. These results indicate that the aac(2′)-IIa gene had been integrated into the IncP island of a donor bacterial species. Molecular detection of the aac(2′)-IIa gene could distinguish whether isolates are resistant or susceptible to KSM. This may contribute to the production of uninfected rice seeds and lead to the effective control of these pathogens by KSM. PMID:22660700

Identification of acquired antimicrobial resistance genes

DEFF Research Database (Denmark)

Zankari, Ea; Hasman, Henrik; Cosentino, Salvatore

2012-01-01

ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic laborato......ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic...... laboratories and is anticipated to substitute traditional methods for resistance gene identification. Thus, the current challenge is to extract the relevant information from the large amount of generated data.MethodsWe developed a web-based method, ResFinder that uses BLAST for identification of acquired...... antimicrobial resistance genes in whole-genome data. As input, the method can use both pre-assembled, complete or partial genomes, and short sequence reads from four different sequencing platforms. The method was evaluated on 1862 GenBank files containing 1411 different resistance genes, as well as on 23 de...

Identification and characterization of the multidrug resistance gene cfr in a Panton-Valentine leukocidin-positive sequence type 8 methicillin-resistant Staphylococcus aureus IVa (USA300) isolate.

LENUS (Irish Health Repository)

Shore, Anna C

2010-12-01

The staphylococcal cfr gene mediates resistance to phenicols, lincosamides, oxazolidinones, pleuromutilins, and streptogramin A, a phenotype that has been termed PhLOPS(A). The cfr gene has mainly been associated with coagulase-negative staphylococcal isolates from animals, and only a few cfr-positive methicillin-resistant Staphylococcus aureus (MRSA) isolates have been described so far. This study reports the first description of a cfr-positive MRSA isolate (M05\\/0060) belonging to the pandemic Panton-Valentine leukocidin (PVL)-positive sequence type 8 MRSA IVa\\/USA300 (ST8-MRSA-IVa\\/USA300) clone. The cfr gene was detected in M05\\/0060 using a DNA microarray which was used to screen PVL-positive MRSA isolates for the presence of virulence genes, typing markers, and antimicrobial resistance genes. Antimicrobial susceptibility testing revealed that M05\\/0060 exhibited the cfr-associated resistance phenotype. Molecular analysis identified the presence of cfr and a second phenicol resistance gene, fexA, on a novel 45-kb conjugative plasmid, which was designated pSCFS7. Within pSCFS7, a DNA segment consisting of cfr, a truncated copy of insertion sequence IS21-558, and a region with homology to the DNA invertase gene bin3 of transposon Tn552 from Bacillus mycoides was integrated into the transposase gene tnpB of the fexA-carrying transposon Tn558. The emergence of a multidrug-resistant cfr-positive variant of ST8-MRSA-IVa\\/USA300 is alarming and requires ongoing surveillance. Moreover, the identification of a novel conjugative plasmid carrying the cfr gene indicates the ability of cfr to spread to other MRSA strains.

The Brassicaceae family displays divergent, shoot-skewed NLR resistance gene expression

DEFF Research Database (Denmark)

Munch, David; Gupta, Vikas; Bachmann, Asger

2018-01-01

Nucleotide-binding site leucine-rich repeat resistance genes (NLRs) allow plants to detect microbial effectors. We hypothesized that NLR expression patterns could reflect organ-specific differences in effector challenge and tested this by carrying out a meta-analysis of expression data for 1,235 ...

Relocation of a rust resistance gene R 2 and its marker-assisted gene pyramiding in confection sunflower (Helianthus annuus L.).

Science.gov (United States)

Qi, L L; Ma, G J; Long, Y M; Hulke, B S; Gong, L; Markell, S G

2015-03-01

The rust resistance gene R 2 was reassigned to linkage group 14 of the sunflower genome. DNA markers linked to R 2 were identified and used for marker-assisted gene pyramiding in a confection type genetic background. Due to the frequent evolution of new pathogen races, sunflower rust is a recurring threat to sunflower production worldwide. The inbred line Morden Cross 29 (MC29) carries the rust resistance gene, R 2 , conferring resistance to numerous races of rust fungus in the US, Canada, and Australia, and can be used as a broad-spectrum resistance resource. Based on phenotypic assessments and SSR marker analyses on the 117 F2 individuals derived from a cross of HA 89 with MC29 (USDA), R 2 was mapped to linkage group (LG) 14 of the sunflower, and not to the previously reported location on LG9. The closest SSR marker HT567 was located at 4.3 cM distal to R 2 . Furthermore, 36 selected SNP markers from LG14 were used to saturate the R 2 region. Two SNP markers, NSA_002316 and SFW01272, flanked R 2 at a genetic distance of 2.8 and 1.8 cM, respectively. Of the three closely linked markers, SFW00211 amplified an allele specific for the presence of R 2 in a marker validation set of 46 breeding lines, and SFW01272 was also shown to be diagnostic for R 2 . These newly developed markers, together with the previously identified markers linked to the gene R 13a , were used to screen 524 F2 individuals from a cross of a confection R 2 line and HA-R6 carrying R 13a . Eleven homozygous double-resistant F2 plants with the gene combination of R 2 and R 13a were obtained. This double-resistant line will be extremely useful in confection sunflower, where few rust R genes are available, risking evolution of new virulence phenotypes and further disease epidemics.

Genotypes, Virulence Factors and Antimicrobial Resistance Genes of Staphylococcus aureus Isolated in Bovine Subclinical Mastitis from Eastern China

Directory of Open Access Journals (Sweden)

Javed Memon§, Yongchun Yang§, Jam Kashifa, Muhammad Yaqoob, Rehana Buriroa, Jamila Soomroa, Wang Liping and Fan Hongjie*

2013-11-01

Full Text Available This study was carried out to determine the genotypes, virulence factors and antimicrobial resistance traits of 34 Staphylococcus aureus isolated from subclinical mastitis in Eastern China. Minimal inhibitory concentration (MIC results showed resistance to erythromycin in all isolates. A high frequency of Methicillin resistant S. aureus (MRSA; 29% was observed and these isolates were also highly resistant to penicillin, oxacillin, oxytetracycline and chloramphenicol than methicillin sensitive S. aureus (MSSA isolates. Thirteen pathogenic factors and seven resistance genes including mecA and blaZ gene were checked through PCR. The spaX gene was found in all isolates, whereas cna, spaIg, nuc, clfA, fnbpB, hlA, hlB and seA were present in 35, 79, 85, 59, 35, 85, 71 and 38% isolates, respectively. Nine isolates carried a group of 8 different virulence genes. Moreover, macrolide resistance genes ermB and ermC were present in all isolates. High resistance rate against methicillin was found but no isolate was positive for mecA gene, whereas blaZ and tetK were detected in 82 and 56% isolates, respectively. Genes; fnbpA, seB, seC, seD, dfrK and tetM were not found in any isolate. The statistical association between phenotypic resistance and virulence genes showed, clfA, fnbpB, hlB and seA, were potentially associated with penicillin G, ciprofloxacin, methicillin, chloramphenicol, trimethoprim and oxytetracycline resistance (P≤0.05. REP-PCR based genotyping showed seven distinct genotypes (A-G prevalent in this region. This study reports the presence of multidrug resistant S. aureus in sub-clinical mastitis which were also highly virulent that could be a major obstacle in the treatment of mastitis in this region of China.

Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

Science.gov (United States)

Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

2007-09-01

The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

Cereal cyst nematode resistance conferred by the Cre7 gene from Aegilops triuncialis and its relationship with Cre genes from Australian wheat cultivars

OpenAIRE

Montes, Maria Jesus; Andrés, María Fe; Sin, E.; Lopez Braña, Isidoro; Martín-Sánchez, J.A.; Romero, M.D.; Delibes Castro, Angeles

2008-01-01

Cereal cyst nematode (CCN; Heterodera avenae Woll.) is a root pathogen of cereal crops that can cause severe yield losses in wheat (Triticum aestivum). Differential host–nematode interactions occur in wheat cultivars carrying different CCN resistance (Cre) genes. The objective of this study was to determine the CCN resistance conferred by the Cre7 gene from Aegilops triuncialis in a 42-chromosome introgression line and to assess the effects of the Cre1, Cre3, Cre4, and Cre8 genes present in A...

Impact of colistin sulfate treatment of broilers on the presence of resistant bacteria and resistance genes in stored or composted manure.

Science.gov (United States)

Le Devendec, Laetitia; Mourand, Gwenaelle; Bougeard, Stéphanie; Léaustic, Julien; Jouy, Eric; Keita, Alassane; Couet, William; Rousset, Nathalie; Kempf, Isabelle

2016-10-15

The application of manure may result in contamination of the environment with antimicrobials, antimicrobial-resistant bacteria, resistance genes and plasmids. The aim of this study was to investigate the impact of the administration of colistin and of manure management on (i) the presence of colistin-resistant Escherichia coli, Klebsiella pneumoniae and Pseudomonas aeruginosa and (ii) the prevalence of various antimicrobial resistance genes in feces and in composted or stored manure. One flock of chickens was treated with colistin at the recommended dosage and a second flock was kept as an untreated control. Samples of feces, litter and stored or composted manure from both flocks were collected for isolation and determination of the colistin-susceptibility of E. coli, K. pneumoniae and P. aeruginosa and quantification of genes coding for resistance to different antimicrobials. The persistence of plasmids in stored or composted manure from colistin-treated broilers was also evaluated by plasmid capturing experiments. Results revealed that colistin administration to chickens had no apparent impact on the antimicrobial resistance of the dominant Enterobacteriaceae and P. aeruginosa populations in the chicken gut. Composting stimulated an apparently limited decrease in genes coding for resistance to different antimicrobial families. Importantly, it was shown that even after six weeks of composting or storage, plasmids carrying antimicrobial resistance genes could still be transferred to a recipient E. coli. In conclusion, composting is insufficient to completely eliminate the risk of spreading antimicrobial resistance through chicken manure. Copyright © 2015 Elsevier B.V. All rights reserved.

Inactivation Effect of Antibiotic-Resistant Gene Using Chlorine Disinfection

Directory of Open Access Journals (Sweden)

Takashi Furukawa

2017-07-01

Full Text Available The aim of this study was to elucidate the inactivation effects on the antibiotic-resistance gene (vanA of vancomycin-resistant enterococci (VRE using chlorination, a disinfection method widely used in various water treatment facilities. Suspensions of VRE were prepared by adding VRE to phosphate-buffered saline, or the sterilized secondary effluent of a wastewater treatment plant. The inactivation experiments were carried out at several chlorine concentrations and stirring time. Enterococci concentration and presence of vanA were determined. The enterococci concentration decreased as chlorine concentrations and stirring times increased, with more than 7.0 log reduction occurring under the following conditions: 40 min stirring at 0.5 mg Cl2/L, 20 min stirring at 1.0 mg Cl2/L, and 3 min stirring at 3.0 mg Cl2/L. In the inactivation experiment using VRE suspended in secondary effluent, the culturable enterococci required much higher chlorine concentration and longer treatment time for complete disinfection than the cases of suspension of VRE. However, vanA was detected in all chlorinated suspensions of VRE, even in samples where no enterococcal colonies were present on the medium agar plate. The chlorine disinfection was not able to destroy antibiotic-resistance genes, though it can inactivate and decrease bacterial counts of antibiotic-resistant bacteria (ARB. Therefore, it was suggested that remaining ARB and/or antibiotic-resistance gene in inactivated bacterial cells after chlorine disinfection tank could be discharged into water environments.

Herbicide resistance-endowing ACCase gene mutations in hexaploid wild oat (Avena fatua): insights into resistance evolution in a hexaploid species

Science.gov (United States)

Yu, Q; Ahmad-Hamdani, M S; Han, H; Christoffers, M J; Powles, S B

2013-01-01

Many herbicide-resistant weed species are polyploids, but far too little about the evolution of resistance mutations in polyploids is understood. Hexaploid wild oat (Avena fatua) is a global crop weed and many populations have evolved herbicide resistance. We studied plastidic acetyl-coenzyme A carboxylase (ACCase)-inhibiting herbicide resistance in hexaploid wild oat and revealed that resistant individuals can express one, two or three different plastidic ACCase gene resistance mutations (Ile-1781-Leu, Asp-2078-Gly and Cys-2088-Arg). Using ACCase resistance mutations as molecular markers, combined with genetic, molecular and biochemical approaches, we found in individual resistant wild-oat plants that (1) up to three unlinked ACCase gene loci assort independently following Mendelian laws for disomic inheritance, (2) all three of these homoeologous ACCase genes were transcribed, with each able to carry its own mutation and (3) in a hexaploid background, each individual ACCase resistance mutation confers relatively low-level herbicide resistance, in contrast to high-level resistance conferred by the same mutations in unrelated diploid weed species of the Poaceae (grass) family. Low resistance conferred by individual ACCase resistance mutations is likely due to a dilution effect by susceptible ACCase expressed by homoeologs in hexaploid wild oat and/or differential expression of homoeologous ACCase gene copies. Thus, polyploidy in hexaploid wild oat may slow resistance evolution. Evidence of coexisting non-target-site resistance mechanisms among wild-oat populations was also revealed. In all, these results demonstrate that herbicide resistance and its evolution can be more complex in hexaploid wild oat than in unrelated diploid grass weeds. Our data provide a starting point for the daunting task of understanding resistance evolution in polyploids. PMID:23047200

Isolation and characterization of NBS-LRR- resistance gene candidates in turmeric (Curcuma longa cv. surama).

Science.gov (United States)

Joshi, R K; Mohanty, S; Subudhi, E; Nayak, S

2010-09-08

Turmeric (Curcuma longa), an important asexually reproducing spice crop of the family Zingiberaceae is highly susceptible to bacterial and fungal pathogens. The identification of resistance gene analogs holds great promise for development of resistant turmeric cultivars. Degenerate primers designed based on known resistance genes (R-genes) were used in combinations to elucidate resistance gene analogs from Curcuma longa cultivar surama. The three primers resulted in amplicons with expected sizes of 450-600 bp. The nucleotide sequence of these amplicons was obtained through sequencing; their predicted amino acid sequences compared to each other and to the amino acid sequences of known R-genes revealed significant sequence similarity. The finding of conserved domains, viz., kinase-1a, kinase-2 and hydrophobic motif, provided evidence that the sequences belong to the NBS-LRR class gene family. The presence of tryptophan as the last residue of kinase-2 motif further qualified them to be in the non-TIR-NBS-LRR subfamily of resistance genes. A cluster analysis based on the neighbor-joining method was carried out using Curcuma NBS analogs together with several resistance gene analogs and known R-genes, which classified them into two distinct subclasses, corresponding to clades N3 and N4 of non-TIR-NBS sequences described in plants. The NBS analogs that we isolated can be used as guidelines to eventually isolate numerous R-genes in turmeric.

Functional markers based molecular characterization and cloning of resistance gene analogs encoding NBS-LRR disease resistance proteins in finger millet (Eleusine coracana).

Science.gov (United States)

Panwar, Preety; Jha, Anand Kumar; Pandey, P K; Gupta, Arun K; Kumar, Anil

2011-06-01

Magnaporthe grisea, the blast fungus is one of the main pathological threats to finger millet crop worldwide. A systematic search for the blast resistance gene analogs was carried out, using functional molecular markers. Three-fourths of the recognition-dependent disease resistance genes (R-genes) identified in plants encodes nucleotide binding site (NBS) leucine-rich repeat (LRR) proteins. NBS-LRR homologs have only been isolated on a limited scale from Eleusine coracana. Genomic DNA sequences sharing homology with NBS region of resistance gene analogs were isolated and characterized from resistant genotypes of finger millet using PCR based approach with primers designed from conserved regions of NBS domain. Attempts were made to identify molecular markers linked to the resistance gene and to differentiate the resistant bulk from the susceptible bulk. A total of 9 NBS-LRR and 11 EST-SSR markers generated 75.6 and 73.5% polymorphism respectively amongst 73 finger millet genotypes. NBS-5, NBS-9, NBS-3 and EST-SSR-04 markers showed a clear polymorphism which differentiated resistant genotypes from susceptible genotypes. By comparing the banding pattern of different resistant and susceptible genotypes, five DNA amplifications of NBS and EST-SSR primers (NBS-05(504,) NBS-09(711), NBS-07(688), NBS-03(509) and EST-SSR-04(241)) were identified as markers for the blast resistance in resistant genotypes. Principal coordinate plot and UPGMA analysis formed similar groups of the genotypes and placed most of the resistant genotypes together showing a high level of genetic relatedness and the susceptible genotypes were placed in different groups on the basis of differential disease score. Our results provided a clue for the cloning of finger millet blast resistance gene analogs which not only facilitate the process of plant breeding but also molecular characterization of blast resistance gene analogs from Eleusine coracana.

Horizontol dissemination of TEM- and SHV-typr beta-lactamase genes-carrying resistance plasmids amongst clonical isolates of Enterobacteriaceae Disseminação horizontal de plasmídios de resistência contendo genes de beta-lactamase dos tipos TEM e SHV entre isolados clínicos de Enterobacteriaceae

Directory of Open Access Journals (Sweden)

Osman Birol Ozgumus

2008-12-01

Full Text Available The extended-spectrum β-lactamase (ESBL-producing bacteria have been isolated at increasing frequency worldwide. Expression of ESBL is often associated with multidrug resistance and dissemination by resistance plasmids. During a two-month period in 2000, 133 clinical isolates of enterobacterial strains were randomly collected from outpatients and inpatients at a university hospital in Turkey. The ESBL producing strains were determined by double-disk synergy (DDS testing. Twenty ESBL producing strains (15% including Escherichia coli (n = 9, Klebsiella pneumoniae (n = 7, Klebsiella oxytoca (n = 2 and Enterobacter aerogenes (n = 2 were detected and further analyzed for their resistance transfer features, plasmid profile and nature of the resistance genes. Plasmid transfer assays were performed using broth mating techniques. TEM- and SHV- genes were analyzed by polymerase chain reaction (PCR and hybridization using specific probes. EcoRI restriction enzyme analyses of R plasmids were used in the detection of epidemic plasmids. Fourteen plasmid profiles (A, B1, B2, C1, and C2 to L were obtained with EcoRI restriction enzyme analysis. Most of these plasmids were detected to carry both TEM- and SHV-derived genes by PCR, and confirmed by localizing each gene by hybridization assay. Epidemiological evidence indicated that there was an apparent horizontal dissemination of conjugative R plasmids among multidrug-resistant enterobacterial genera and species in this hospitalO isolamento de bactérias produtoras de beta-lactamases de espectro expandido (ESBL está aumentando no mundo todo. Freqüentemente, a expressão de ESBL está associada com resistência a múltiplas drogas e disseminação por plasmídios de resistência. Durante um período de dois meses em 2000, 133 isolados clínicos de cepas de enterobactérias foram obtidos aleatoriamente de pacientes internos e externos de um hospital universitário na Turquia. As cepas produtoras de ESBL foram

Spread of ISCR1 Elements Containing blaDHA-1 and Multiple Antimicrobial Resistance Genes Leading to Increase of Flomoxef Resistance in Extended-Spectrum-β-Lactamase-Producing Klebsiella pneumoniae▿

Science.gov (United States)

Lee, Chen-Hsiang; Liu, Jien-Wei; Li, Chia-Chin; Chien, Chun-Chih; Tang, Ya-Fen; Su, Lin-Hui

2011-01-01

Increasing resistance to quinolones, aminoglycosides, and/or cephamycins in extended-spectrum-β-lactamase (ESBL)-producing Enterobacteriaceae exacerbates the already limited antibiotic treatment options for infections due to these microbes. In this study, the presence of resistance determinants for these antimicrobial agents was examined by PCR among ESBL-producing Klebsiella pneumoniae (ESBL-KP) isolates that caused bacteremia. Pulsed-field gel electrophoresis was used to differentiate the clonal relationship among the isolates studied. Transferability and the location of the resistance genes were analyzed by conjugation experiments, followed by DNA-DNA hybridization. Among the 94 ESBL-KP isolates studied, 20 isolates of flomoxef-resistant ESBL-KP were identified. They all carried a DHA-1 gene and were genetically diverse. CTX-M genes were found in 18 of the isolates. Among these DHA-1/CTX-M-producing K. pneumoniae isolates, ISCR1 was detected in 13 (72%) isolates, qnr genes (1 qnrA and 17 qnrB genes) were detected in 18 (100%), aac(6′)-Ib-cr was detected in 11 (61%), and 16S rRNA methylase (all armA genes) was detected in 14 (78%). Four transconjugants were available for further analysis, and qnrB4, aac(6′)-Ib-cr, armA, and blaDHA-1 were all identified on these self-transferable blaCTX-M-carrying plasmids. The genetic environments of ISCR1 associated with armA, blaDHA-1, and qnrB4 genes in the four transconjugants were identical. Replicon-type analysis revealed a FIIA plasmid among the four self-transferable plasmids, although the other three were nontypeable. The cotransfer of multiple resistance genes with the ISCR1 element-carrying plasmids has a clinical impact and warrants close monitoring and further study. PMID:21746945

Spread of ISCR1 elements containing blaDHA-₁ and multiple antimicrobial resistance genes leading to increase of flomoxef resistance in extended-spectrum-beta-lactamase-producing Klebsiella pneumoniae.

Science.gov (United States)

Lee, Chen-Hsiang; Liu, Jien-Wei; Li, Chia-Chin; Chien, Chun-Chih; Tang, Ya-Fen; Su, Lin-Hui

2011-09-01

Increasing resistance to quinolones, aminoglycosides, and/or cephamycins in extended-spectrum-β-lactamase (ESBL)-producing Enterobacteriaceae exacerbates the already limited antibiotic treatment options for infections due to these microbes. In this study, the presence of resistance determinants for these antimicrobial agents was examined by PCR among ESBL-producing Klebsiella pneumoniae (ESBL-KP) isolates that caused bacteremia. Pulsed-field gel electrophoresis was used to differentiate the clonal relationship among the isolates studied. Transferability and the location of the resistance genes were analyzed by conjugation experiments, followed by DNA-DNA hybridization. Among the 94 ESBL-KP isolates studied, 20 isolates of flomoxef-resistant ESBL-KP were identified. They all carried a DHA-1 gene and were genetically diverse. CTX-M genes were found in 18 of the isolates. Among these DHA-1/CTX-M-producing K. pneumoniae isolates, ISCR1 was detected in 13 (72%) isolates, qnr genes (1 qnrA and 17 qnrB genes) were detected in 18 (100%), aac(6')-Ib-cr was detected in 11 (61%), and 16S rRNA methylase (all armA genes) was detected in 14 (78%). Four transconjugants were available for further analysis, and qnrB4, aac(6')-Ib-cr, armA, and bla(DHA-1) were all identified on these self-transferable bla(CTX-M)-carrying plasmids. The genetic environments of ISCR1 associated with armA, bla(DHA-1), and qnrB4 genes in the four transconjugants were identical. Replicon-type analysis revealed a FIIA plasmid among the four self-transferable plasmids, although the other three were nontypeable. The cotransfer of multiple resistance genes with the ISCR1 element-carrying plasmids has a clinical impact and warrants close monitoring and further study.

Modification of barley powdery mildew resistance controlled by the gene M1-a212

International Nuclear Information System (INIS)

Torp, J.; Joergensen, J.H.

1989-01-01

Full text: The barley line Sultan 5 carries resistance gene M1-a12. Seeds were treated with EMS or NaN 3 . Among 10381 M 1 -spike progenies inoculated with M1-a12 a-virulent isolates of Erysiphe graminis, 25 segregated for less resistant infection type. Among 10 mutants analyzed, 9 had mutant allels of M1-a12 and one had a recessive mutant gene in a different locus acting as a ''suppressor'' of M1-a12. (author)

A set of vectors for introduction of antibiotic resistance genes by in vitro Cre-mediated recombination

Directory of Open Access Journals (Sweden)

Vassetzky Yegor S

2008-12-01

Full Text Available Abstract Background Introduction of new antibiotic resistance genes in the plasmids of interest is a frequent task in molecular cloning practice. Classical approaches involving digestion with restriction endonucleases and ligation are time-consuming. Findings We have created a set of insertion vectors (pINS carrying genes that provide resistance to various antibiotics (puromycin, blasticidin and G418 and containing a loxP site. Each vector (pINS-Puro, pINS-Blast or pINS-Neo contains either a chloramphenicol or a kanamycin resistance gene and is unable to replicate in most E. coli strains as it contains a conditional R6Kγ replication origin. Introduction of the antibiotic resistance genes into the vector of interest is achieved by Cre-mediated recombination between the replication-incompetent pINS and a replication-competent target vector. The recombination mix is then transformed into E. coli and selected by the resistance marker (kanamycin or chloramphenicol present in pINS, which allows to recover the recombinant plasmids with 100% efficiency. Conclusion Here we propose a simple strategy that allows to introduce various antibiotic-resistance genes into any plasmid containing a replication origin, an ampicillin resistance gene and a loxP site.

High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil.

Science.gov (United States)

Spano, Liliana Cruz; da Cunha, Keyla Fonseca; Monfardini, Mariane Vedovatti; de Cássia Bergamaschi Fonseca, Rita; Scaletsky, Isabel Christina Affonso

2017-12-18

Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas. A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns. DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates. The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.

Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family

Institute of Scientific and Technical Information of China (English)

Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang

2007-01-01

The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.

Development and dissection of diagnostic SNP markers for the downy mildew resistance genes Pl Arg and Pl 8 and maker-assisted gene pyramiding in sunflower (Helianthus annuus L.).

Science.gov (United States)

Qi, L L; Talukder, Z I; Hulke, B S; Foley, M E

2017-06-01

Diagnostic DNA markers are an invaluable resource in breeding programs for successful introgression and pyramiding of disease resistance genes. Resistance to downy mildew (DM) disease in sunflower is mediated by Pl genes which are known to be effective against the causal fungus, Plasmopara halstedii. Two DM resistance genes, Pl Arg and Pl 8 , are highly effective against P. halstedii races in the USA, and have been previously mapped to the sunflower linkage groups (LGs) 1 and 13, respectively, using simple sequence repeat (SSR) markers. In this study, we developed high-density single nucleotide polymorphism (SNP) maps encompassing the Pl arg and Pl 8 genes and identified diagnostic SNP markers closely linked to these genes. The specificity of the diagnostic markers was validated in a highly diverse panel of 548 sunflower lines. Dissection of a large marker cluster co-segregated with Pl Arg revealed that the closest SNP markers NSA_007595 and NSA_001835 delimited Pl Arg to an interval of 2.83 Mb on the LG1 physical map. The SNP markers SFW01497 and SFW06597 delimited Pl 8 to an interval of 2.85 Mb on the LG13 physical map. We also developed sunflower lines with homozygous, three gene pyramids carrying Pl Arg , Pl 8 , and the sunflower rust resistance gene R 12 using the linked SNP markers from a segregating F 2 population of RHA 340 (carrying Pl 8 )/RHA 464 (carrying Pl Arg and R 12 ). The high-throughput diagnostic SNP markers developed in this study will facilitate marker-assisted selection breeding, and the pyramided sunflower lines will provide durable resistance to downy mildew and rust diseases.

High Prevalence of Plasmid-Mediated Quinolone Resistance and IncQ Plasmids Carrying qnrS2 Gene in Bacteria from Rivers near Hospitals and Aquaculture in China

OpenAIRE

Wen, Yanping; Pu, Xiaoying; Zheng, Wei; Hu, Guang

2016-01-01

Effluents from hospital and aquaculture are considered important sources of quinolone resistance. However, little information is available on the impact of this effluent on nearby rivers. In this study, 188 ciprofloxacin-resistant bacterial isolates obtained from rivers near hospitals and aquaculture were screened for plasmid-mediated quinolone resistance (PMQR) genes. Species identification, antibiotic susceptibility testing, and PMQR gene transferability assessment were conducted for PMQR-p...

Characterisation of integrons and antibiotic resistance genes in Danish multiresistant Salmonella enterica Typhimurium DT104

DEFF Research Database (Denmark)

Sandvang, Dorthe; Aarestrup, Frank Møller; Jensen, Lars Bogø

1997-01-01

The presence and genetic content of integrons was investigated in eight Salmonella enterica Typhimurium DT104 isolates from different pig herds in Denmark. Two different integrons were identified using PCR and sequencing. Each of the integrons carried a single resistance cassette in addition...... to the sul1 and qacE Delta 1 genes characteristic of integrons. The first integron encoded the ant (3 ")-Ia gene that specified resistance to spectinomycin and streptomycin. The second contained the pse-l beta-lactamase gene. All the multiresistant strains contained both integrons. The presence of these two...... integrons did not account for the total phenotypic resistance of all the isolates and does not exclude the presence of other mobile DNA elements....

Characterisation of integrons and antibiotic resistance genes in Danish multiresistant Salmonella enterica Typhimurium DT104

DEFF Research Database (Denmark)

Sandvang, Dorthe; Aarestrup, Frank Møller; Jensen, Lars Bogø

1998-01-01

The presence and genetic content of integrons was investigated in eight Salmonella enteritica Typhimurium DT104 isolates from different pig herds in Denmark. Two different integrons were identified using PCR and sequencing. Each of the integrons carried a single resistance cassette in addition...... to the sul1 and qacE Delta 1 genes characteristic of integrons. The first integron encoded the ant (3")-Ia gene that specified resistance to spectinomycin and streptomycin. The second contained the pse-1 beta-lactamase gene. All the multiresistant strains contained both integrons. The presence of these two...... integrons did not account for the total phenotypic resistance of all the isolates and does not exclude the presence of other mobile DNA elements....

Subtyping of Chilean Methicillin-Resistant Staphylococcus aureus strains carrying the staphylococcal cassette chromosome mec type I

Directory of Open Access Journals (Sweden)

Gustavo Medina

2012-09-01

Full Text Available The cassette chromosome mec (SCCmec present in methicillin-resistant Staphylococcus aureus (MRSA has two essential components, the ccr gene complex and the mec gene complex. Additionally, SCCmec has non-essential components called J regions which are used for MRSA subtyping. This study was performed to determine subtypes MRSA strains carrying SCCmec type I based on polymorphism of regions located downstream of the mecA gene. A total of 98 MRSA strains carrying SCCmec type I isolated from patients hospitalized at the County Hospital of Valdivia (Chile between May 2007 and May 2008, were analyzed by multiplex PCR designed to amplify the mecA gene and 7 DNA hypervariable regions located around the mecA gene. MRSA strains were classified into seventeen genotypes accordingly to amplification patterns of DNA hypervariable regions. Five genotypes showed amplification patterns previously described. The remaining twelve genotypes showed new amplification patterns. Genotypes 18 and Genotype 19 were the most frequently detected. Regions HVR, Ins117 and pI258 stand out as being present in more than 60% of tested isolates. The acquisition of hypervariable regions by MRSA is a continuous horizontal transfer process through which the SCCmec have been preserved intact, or even may give rise to new types and subtypes of SCCmec. Therefore it is possible to infer that most MRSA strains isolated at the County Hospital of Valdivia (Chile were originated from two local clones which correspond to Genotype 18 and Genotype 19.

Characterization of a Staphylococcal Plasmid Related to pUB110 and Carrying Two Novel Genes, vatC and vgbB, Encoding Resistance to Streptogramins A and B and Similar Antibiotics

Science.gov (United States)

Allignet, Jeanine; Liassine, Nadia; El Solh, Névine

1998-01-01

We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation. PMID:9661023

Characterization of a staphylococcal plasmid related to pUB110 and carrying two novel genes, vatC and vgbB, encoding resistance to streptogramins A and B and similar antibiotics.

Science.gov (United States)

Allignet, J; Liassine, N; el Solh, N

1998-07-01

We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation.

vanI: a novel d-Ala-d-Lac vancomycin resistance gene cluster found in Desulfitobacterium hafniense

NARCIS (Netherlands)

Kruse, T.; Levisson, M.; Vos, de W.M.; Smidt, H.

2014-01-01

The glycopeptide vancomycin was until recently considered a drug of last resort against Gram-positive bacteria. Increasing numbers of bacteria, however, are found to carry genes that confer resistance to this antibiotic. So far, 10 different vancomycin resistance clusters have been described. A

Prevalence of Methicillin-Resistant Staphylococcus Aureus Carrying Panton-Valentine Leukocidin Gene in Cutaneous Infections in the City of Isfahan

Directory of Open Access Journals (Sweden)

Mohammad Reza Pourmand

2012-03-01

Full Text Available Background: Methicillin-Resistant Staphylococcus aureus (MRSA is a major cause of Nosocomial and community infections that are becoming increasingly difficult to combat, because of emerging resistance to all classes of antibiotics. Moreover Panton-Valentine leukocidin (PVL is an important virulence factor in S. aureus and causes white blood cell destruction, necrosis and accelerated apoptosis. The aim of this study was to determine the frequency of PVL-positive MRSA in cutaneous infections, for epidemiological purposes and also to determine antibiotic resistance of the isolates.Methods: Collectively, 56 isolates of S. aureus were obtained from Isfahan University of Medical sciences affiliated hospitals and confirmed with biochemical tests (coagulase, mannitol fermentation, and DNase. Then polymerase chain reaction (PCR was used to detect pvl gene. Coagulase gene was used as internal control. The antibiotic susceptibility of all isolates to methicillin was determined using disk diffusion method.Results: Out of 56 isolates 14.3% were PVL positive that 37.5% were from abscess and 62.5% were from wound. Among all of these isolates 67.8% were MRSA and also 75% of PVL-positive isolates were MRSA.Conclusion: The prevalence of PVL positive MRSA in cutaneous isolates is high. Future works are necessary for a more complete understanding of distribution of these virulent isolates in nasal carriers to decrease the risk of infections.

The New Macrolide-Lincosamide-Streptogramin B Resistance Gene erm(45) Is Located within a Genomic Island in Staphylococcus fleurettii

DEFF Research Database (Denmark)

Wipf, Juliette R K; Schwendener, Sybille; Nielsen, Jesper Boye

2015-01-01

Genome alignment of a macrolide, lincosamide, and streptogramin B (MLSB)-resistant Staphylococcus fleurettii strain with an MLSB-susceptible S. fleurettii strain revealed a novel 11,513-bp genomic island carrying the new erythromycin resistance methylase gene erm(45). This gene was shown to confer...... inducible MLSB resistance when cloned into Staphylococcus aureus. The erm(45)-containing island was integrated into the housekeeping gene guaA in S. fleurettii and was able to form a circular intermediate but was not transmissible to S. aureus....

Molecular Identification and Quantification of Tetracycline and Erythromycin Resistance Genes in Spanish and Italian Retail Cheeses

Directory of Open Access Journals (Sweden)

Ana Belén Flórez

2014-01-01

Full Text Available Large antibiotic resistance gene pools in the microbiota of foods may ultimately pose a risk for human health. This study reports the identification and quantification of tetracycline- and erythromycin-resistant populations, resistance genes, and gene diversity in traditional Spanish and Italian cheeses, via culturing, conventional PCR, real-time quantitative PCR (qPCR, and denaturing gradient gel electrophoresis (DGGE. The numbers of resistant bacteria varied widely among the antibiotics and the different cheese varieties; in some cheeses, all the bacterial populations seemed to be resistant. Up to eight antibiotic resistance genes were sought by gene-specific PCR, six with respect to tetracycline, that is, tet(K, tet(L, tet(M, tet(O, tet(S, and tet(W, and two with respect to erythromycin, that is, erm(B and erm(F. The most common resistance genes in the analysed cheeses were tet(S, tet(W, tet(M, and erm(B. The copy numbers of these genes, as quantified by qPCR, ranged widely between cheeses (from 4.94 to 10.18log⁡10/g. DGGE analysis revealed distinct banding profiles and two polymorphic nucleotide positions for tet(W-carrying cheeses, though the similarity of the sequences suggests this tet(W to have a monophyletic origin. Traditional cheeses would therefore appear to act as reservoirs for large numbers of many types of antibiotic resistance determinants.

PCR Screening of Antibiotic Resistance Genes in Faecal Samples from Australian and Chinese Children.

Science.gov (United States)

Ravensdale, Joshua T; Xian, Darren Ten Wei; Wei, Chooi Ming; Lv, Quanjun; Wen, Xiajian; Guo, Jing; Coorey, Ranil; LeSouëf, Peter; Lu, Fengmin; Zhang, Brad; Dykes, Gary A

2018-03-31

Recent public awareness campaigns on the risk of antibiotic resistance in pathogenic microbes has placed pressure on governments to enforce stricter antimicrobial stewardship policies on the hospital and agricultural industry. This study aimed to screen faecal samples from Australian and Chinese children for the presence of antibiotic resistance genes to identify demographics at risk of carriage of these genes and examine antimicrobial stewardship policies from the two countries which may influence carriage. Faecal samples from 46 Australian and 53 Chinese children were screened for the presence of six clinically relevant antibiotic resistance genes using PCR. Clinical and demographic data was also collected from each patient. Over 90% of faecal samples from Chinese children tested positive for β-lactam, macrolide, tetracycline, and aminoglycoside resistance genes, which was substantially higher than Australian samples. Besides country of origin, no clear trend could be seen to predict carriage of resistance genes. The exception to this was Chinese born children who immigrated to Australia having higher rates of carriage for bla TEM and tetM genes than children born and still living in Australia. These data indicated that Chinese children were more likely to carry certain antibiotic resistance genes than Australian children. The Chinese government has recently implemented strict policies to control the overuse of antibiotics in hospitals. However, many of these policies do not extend to the agricultural industry which could explain the differences seen in this study. Copyright © 2018. Published by Elsevier Ltd.

Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

Science.gov (United States)

Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

1998-08-01

The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

Genetics and mapping of a new leaf rust resistance gene in Triticum ...

Indian Academy of Sciences (India)

AMIT KUMAR SINGH

Selection G12 carries a new gene for leaf rust resistance, tentatively named as LrSelG12. [Singh A. K. ..... long arm of chromosome 3B were found to be polymor- phic between ... due to the evolution of new virulent races in India (Tomar et al.

Occurrence of integrons and resistance genes among sulphonamide-resistant Shigella spp. from Brazil

DEFF Research Database (Denmark)

Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller

2005-01-01

Objectives: To determine the occurrence of class 1 and 2 integrons and antimicrobial resistance genes among sulphonamide-resistant Shigella strains isolated in Brazil during 1999-2003. Methods: Sixty-two Shigella (Shigella flexneri, n = 47 and Shigella sonnei, n = 15) were tested against 21...... antimicrobial agents. The presence of integrons classes 1 and 2 and antimicrobial resistance genes was investigated by PCR using specific primers. Results: A total of eight antimicrobial resistance profiles were identified, with the profile of resistance to sulfamethoxazole, trimethoprim, spectinomycin...... of 2214 bp harbouring a gene cassette array conferring resistance to trimethoprim, streptothricin and spectinomycin/streptomycin. The genes coding for resistance to chloramphenicol (catA1), tetracycline [tet(A) and tet(B)] and ampicillin (bla(OXA) and bla(TEM)), were detected in resistant strains...

Identification of a rice gene (Bph 1) conferring resistance to brown planthopper (Nilaparvata lugens Stal) using STS markers.

Science.gov (United States)

Kim, Suk-Man; Sohn, Jae-Keun

2005-08-31

This study was carried out to identify a high-resolution marker for a gene conferring resistance to brown planthopper (BPH) biotype 1, using japonica type resistant lines. Bulked segregant analyses were conducted using 520 RAPD primers to identify RAPD fragments linked to the BPH resistance gene. Eleven RAPDs were shown to be polymorphic amplicons between resistant and susceptible progeny. One of these primers, OPE 18, which amplified a 923 bp band tightly linked to resistance, was converted into a sequence-tagged-site (STS) marker. The STS marker, BpE18-3, was easily detectable as a dominant band with tight linkage (3.9cM) to Bph1. It promises to be useful as a marker for assisted selection of resistant progeny in backcross breeding programs to introgress the resistance gene into elite japonica cultivars.

Evolution of Regions Containing Antibiotic Resistance Genes in FII-2-FIB-1 ColV-Colla Virulence Plasmids.

Science.gov (United States)

Moran, Robert A; Hall, Ruth M

2018-05-01

Three ColV virulence plasmids carrying antibiotic resistance genes were assembled from draft genome sequences of commensal ST95, ST131, and ST2705 Escherichia coli isolates from healthy Australians. Plasmids pCERC4, pCERC5, and pCERC9 include almost identical backbones containing FII-2 and FIB-1 replicons and the conserved ColV virulence region with an additional ColIa determinant. Only pCERC5 includes a complete, uninterrupted F-like transfer region and was able to conjugate. pCERC5 and pCERC9 contain Tn1721, carrying the tet(A) tetracycline resistance determinant in the same location, with Tn2 (bla TEM ; ampicillin resistance) interrupting the Tn1721 in pCERC5. pCERC4 has a Tn1721/Tn21 hybrid transposon carrying dfrA5 (trimethoprim resistance) and sul1 (sulfamethoxazole resistance) in a class 1 integron. Four FII-2:FIB-1 ColV-ColIa plasmids in the GenBank nucleotide database have a related transposon in the same position, but an IS26 has reshaped the resistance gene region, deleting 2,069 bp of the integron 3'-CS, including sul1, and serving as a target for IS26 translocatable units containing bla TEM , sul2 and strAB (streptomycin resistance), or aphA1 (kanamycin/neomycin resistance). Another ColV-ColIa plasmid containing a related resistance gene region has lost the FII replicon and acquired a unique transfer region via recombination within the resistance region and at oriT. Eighteen further complete ColV plasmid sequences in GenBank contained FIB-1, but the FII replicons were of three types, FII-24, FII-18, and a variant of FII-36.

Organization of a resistance gene cluster linked to rhizomania resistance in sugar beet

Science.gov (United States)

Genetic resistance to rhizomania has been in use for over 40 years. Characterization of the molecular basis for susceptibility and resistance has proved challenging. Nucleotide-binding leucine-rich-repeat-containing (NB-LRR) genes have been implicated in numerous gene-for-gene resistance interaction...

Salmonella Typhimurium ST213 is associated with two types of IncA/C plasmids carrying multiple resistance determinants.

Science.gov (United States)

Wiesner, Magdalena; Calva, Edmundo; Fernández-Mora, Marcos; Cevallos, Miguel A; Campos, Freddy; Zaidi, Mussaret B; Silva, Claudia

2011-01-11

Salmonella Typhimurium ST213 was first detected in the Mexican Typhimurium population in 2001. It is associated with a multi-drug resistance phenotype and a plasmid-borne blaCMY-2 gene conferring resistance to extended-spectrum cephalosporins. The objective of the current study was to examine the association between the ST213 genotype and blaCMY-2 plasmids. The blaCMY-2 gene was carried by an IncA/C plasmid. ST213 strains lacking the blaCMY-2 gene carried a different IncA/C plasmid. PCR analysis of seven DNA regions distributed throughout the plasmids showed that these IncA/C plasmids were related, but the presence and absence of DNA stretches produced two divergent types I and II. A class 1 integron (dfrA12, orfF and aadA2) was detected in most of the type I plasmids. Type I contained all the plasmids carrying the blaCMY-2 gene and a subset of plasmids lacking blaCMY-2. Type II included all of the remaining blaCMY-2-negative plasmids. A sequence comparison of the seven DNA regions showed that both types were closely related to IncA/C plasmids found in Escherichia, Salmonella, Yersinia, Photobacterium, Vibrio and Aeromonas. Analysis of our Typhimurium strains showed that the region containing the blaCMY-2 gene is inserted between traA and traC as a single copy, like in the E. coli plasmid pAR060302. The floR allele was identical to that of Newport pSN254, suggesting a mosaic pattern of ancestry with plasmids from other Salmonella serovars and E. coli. Only one of the tested strains was able to conjugate the IncA/C plasmid at very low frequencies (10-7 to 10-9). The lack of conjugation ability of our IncA/C plasmids agrees with the clonal dissemination trend suggested by the chromosomal backgrounds and plasmid pattern associations. The ecological success of the newly emerging Typhimurium ST213 genotype in Mexico may be related to the carriage of IncA/C plasmids. We conclude that types I and II of IncA/C plasmids originated from a common ancestor and that the

Integrated Metabolo-Transcriptomics Reveals Fusarium Head Blight Candidate Resistance Genes in Wheat QTL-Fhb2.

Directory of Open Access Journals (Sweden)

Dhananjay Dhokane

Full Text Available Fusarium head blight (FHB caused by Fusarium graminearum not only causes severe losses in yield, but also reduces quality of wheat grain by accumulating mycotoxins. Breeding for host plant resistance is considered as the best strategy to manage FHB. Resistance in wheat to FHB is quantitative in nature, involving cumulative effects of many genes governing resistance. The poor understanding of genetics and lack of precise phenotyping has hindered the development of FHB resistant cultivars. Though more than 100 QTLs imparting FHB resistance have been reported, none discovered the specific genes localized within the QTL region, nor the underlying mechanisms of resistance.In our study recombinant inbred lines (RILs carrying resistant (R-RIL and susceptible (S-RIL alleles of QTL-Fhb2 were subjected to metabolome and transcriptome profiling to discover the candidate genes. Metabolome profiling detected a higher abundance of metabolites belonging to phenylpropanoid, lignin, glycerophospholipid, flavonoid, fatty acid, and terpenoid biosynthetic pathways in R-RIL than in S-RIL. Transcriptome analysis revealed up-regulation of several receptor kinases, transcription factors, signaling, mycotoxin detoxification and resistance related genes. The dissection of QTL-Fhb2 using flanking marker sequences, integrating metabolomic and transcriptomic datasets, identified 4-Coumarate: CoA ligase (4CL, callose synthase (CS, basic Helix Loop Helix (bHLH041 transcription factor, glutathione S-transferase (GST, ABC transporter-4 (ABC4 and cinnamyl alcohol dehydrogenase (CAD as putative resistance genes localized within the QTL-Fhb2 region.Some of the identified genes within the QTL region are associated with structural resistance through cell wall reinforcement, reducing the spread of pathogen through rachis within a spike and few other genes that detoxify DON, the virulence factor, thus eventually reducing disease severity. In conclusion, we report that the wheat

Strategies to be used in the struggle between resistance and virulence genes

International Nuclear Information System (INIS)

Zitelli, G.; Vallega, V.

1977-01-01

The cultivation of wheat varieties resistant to diseases such as stem and leaf rusts, mildew and septoria plays an important role in modern agriculture. However, the problem of how to keep varieties resistant for a long period has not yet been solved. Whatever type of resistance (specific, non-specific, tolerance etc.) the breeder chooses to use in his breeding work, the resistance stability will depend very much on the strategy used. There are many different approaches: (i) To introduce single specific factors into the cultivated varieties; (ii) To introduce the maximum number of factors in the same variety; (iii) To create multiline varieties; (iv) To cultivate different varieties carrying different resistant factors. Such a ''mosaic'' artificially creates, as in the case of multiline varieties, conditions similar to those which we find in wild populations. The use of multiline varieties and of ''mosaic'' varieties stresses the need for finding a greater number of different genes for resistance. At present we know that a large number of genes for resistance to rusts and to mildew is available in bread and durum wheats and in related species. (author)

Characterization of Acinetobacter baumannii clinical isolates carrying bla(OXA-23) carbapenemase and 16S rRNA methylase armA genes in Yemen.

Science.gov (United States)

Bakour, Sofiane; Alsharapy, Samer Ahmed; Touati, Abdelaziz; Rolain, Jean-Marc

2014-12-01

The aim of this study was to investigate the molecular support of resistance to carbapenems, aminoglycosides, and fluoroquinolones in Acinetobacter baumannii clinical isolates collected from Yemen hospital. Three A. baumannii were isolated in February 2013 from three patients hospitalized at Al-Thawra University Hospital in Sana'a, Yemen. Antibiotic susceptibility testing was performed using the disk diffusion and E-test methods. Carbapenemase production was carried out by the modified Hodge test (MHT) and imipenem-ethylenediaminetetraacetic acid (EDTA) methods. Carbapenem, aminoglycoside, and fluoroquinolone resistance determinants were studied by polymerase chain reaction and sequencing. The epidemiological relatedness of the three strains was studied using multilocus sequence typing (MLST). The isolates were resistant to almost all antibiotics tested with very high imipenem, amikacin, and ciprofloxacin minimum inhibitory concentrations (>32, >256, and >32 mg/L, respectively). The microbiological tests showed that the three A. baumannii were MHT positive, besides, the activity of β-lactamases was not inhibited by EDTA. All the three isolates contained the naturally occurring bla(OXA-51)-like gene and the bla(OXA-23)-like carbapenemase-encoding gene. The 16S rRNA methylase armA gene was detected in the three isolates. In addition, screening for genes encoding the aminoglycoside-modifying enzymes (AMEs) demonstrated that one isolate contained the acetyltransferase gene aac(6')-Ib. Fluoroquinolone resistance was associated with a single mutation Ser83Leu in the quinolone resistance determining region of the gyrA gene in all isolates. The MLST showed that the sequence type (ST) obtained corresponds to ST2 for the three strains. Here we report the first identification of multidrug-resistant A. baumannii isolates harboring the bla(OXA-23)-like gene, AMEs [aac(6')-Ib], and the 16S rRNA methylase (armA) in the Yemen hospital.

Metagenomic analysis of antibiotic resistance genes in coastal industrial mariculture systems.

Science.gov (United States)

Wang, Jian-Hua; Lu, Jian; Zhang, Yu-Xuan; Wu, Jun; Luo, Yongming; Liu, Hao

2018-04-01

The overuse of antibiotics has posed a propagation of antibiotic resistance genes (ARGs) in aquaculture systems. This study firstly explored the ARGs profiles of the typical mariculture farms including conventional and recirculating systems using metagenomics approach. Fifty ARGs subtypes belonging to 21 ARGs types were identified, showing the wide-spectrum profiles of ARGs in the coastal industrial mariculture systems. ARGs with multiple antibiotics resistance have emerged in the mariculure systems. The co-occurrence pattern between ARGs and microbial taxa showed that Proteobacteria and Bacteroidetes were potential dominant hosts of ARGs in the industrial mariculture systems. Typical nitrifying bacteria such as Nitrospinae in mariculture systems also carried with some resistance genes. Relative abundance of ARGs in fish ponds and wastewater treatment units was relatively high. The investigation showed that industrial mariculture systems were important ARGs reservoirs in coastal area, indicating the critical role of recirculating systems in the terms of ARGs pollution control. Copyright © 2018 Elsevier Ltd. All rights reserved.

Occurrence and Diversity of Tetracycline Resistance Genes in Lagoons and Groundwater Underlying Two Swine Production Facilities

Science.gov (United States)

Chee-Sanford, J. C.; Aminov, R.I.; Krapac, I.J.; Garrigues-Jeanjean, N.; Mackie, R.I.

2001-01-01

In this study, we used PCR typing methods to assess the presence of tetracycline resistance determinants conferring ribosomal protection in waste lagoons and in groundwater underlying two swine farms. All eight classes of genes encoding this mechanism of resistance [tet(O), tet(Q), tet(W), tet(M), tetB(P), tet(S), tet(T), and otrA] were found in total DNA extracted from water of two lagoons. These determinants were found to be seeping into the underlying groundwater and could be detected as far as 250 m downstream from the lagoons. The identities and origin of these genes in groundwater were confirmed by PCR-denaturing gradient gel electrophoresis and sequence analyses. Tetracycline-resistant bacterial isolates from groundwater harbored the tet(M) gene, which was not predominant in the environmental samples and was identical to tet(M) from the lagoons. The presence of this gene in some typical soil inhabitants suggests that the vector of antibiotic resistance gene dissemination is not limited to strains of gastrointestinal origin carrying the gene but can be mobilized into the indigenous soil microbiota. This study demonstrated that tet genes occur in the environment as a direct result of agriculture and suggested that groundwater may be a potential source of antibiotic resistance in the food chain.

Seedling Resistance to Stem Rust and Molecular Marker Analysis of Resistance Genes in Wheat Cultivars of Yunnan, China.

Directory of Open Access Journals (Sweden)

Tian Ya Li

Full Text Available Stem rust is one of the most potentially harmful wheat diseases, but has been effectively controlled in China since 1970s. However, the interest in breeding wheat with durable resistance to stem rust has been renewed with the emergence of Ug99 (TTKSK virulent to the widely used resistance gene Sr31, and by which the wheat stem rust was controlled for 40 years in wheat production area worldwide. Yunnan Province, located on the Southwest border of China, is one of the main wheat growing regions, playing a pivotal role in the wheat stem rust epidemic in China. This study investigated the levels of resistance in key wheat cultivars (lines of Yunnan Province. In addition, the existence of Sr25, Sr26, Sr28, Sr31, Sr32, and Sr38 genes in 119 wheat cultivars was assessed using specific DNA markers. The results indicated that 77 (64.7% tested wheat varieties showed different levels of resistance to all the tested races of Puccinia graminis f. sp. tritici. Using molecular markers, we identified the resistance gene Sr31 in 43 samples; Sr38 in 10 samples; Sr28 in 12 samples, and one sample which was resistant against Ug99 (avirulent to Sr32. No Sr25 or Sr26 (effective against Ug99 was identified in any cultivars tested. Furthermore, 5 out of 119 cultivars tested carried both Sr31 and Sr38 and eight contained both Sr31 and Sr28. The results enable the development of appropriate strategies to breed varieties resistant to stem rust.

Influence of tra genes of IncP and F plasmids on the mobilization of small Kanamycin resistance ColE1-Like plasmids in bacterial biofilms

Science.gov (United States)

Background: Horizontal gene transfer is a mechanism for movement of antibiotic resistance genes among bacteria. Some small kanamycin resistance (KanR) ColE1-like plasmids isolated from different serotypes of Salmonella enterica were shown to carry mobilization genes; although not self-transmissibl...

Quantitative and Qualitative Involvement of P3N-PIPO in Overcoming Recessive Resistance against Clover Yellow Vein Virus in Pea Carrying the cyv1 Gene

Science.gov (United States)

Choi, Sun Hee; Hagiwara-Komoda, Yuka; Atsumi, Go; Shimada, Ryoko; Hisa, Yusuke; Naito, Satoshi

2013-01-01

In pea carrying cyv1, a recessive gene for resistance to Clover yellow vein virus (ClYVV), ClYVV isolate Cl-no30 was restricted to the initially infected cells, whereas isolate 90-1 Br2 overcame this resistance. We mapped the region responsible for breaking of cyv1-mediated resistance by examining infection of cyv1 pea with chimeric viruses constructed from parts of Cl-no30 and 90-1 Br2. The breaking of resistance was attributed to the P3 cistron, which is known to produce two proteins: P3, from the main open reading frame (ORF), and P3N-PIPO, which has the N-terminal part of P3 fused to amino acids encoded by a small open reading frame (ORF) called PIPO in the +2 reading frame. We introduced point mutations that were synonymous with respect to the P3 protein but nonsynonymous with respect to the P3N-PIPO protein, and vice versa, into the chimeric viruses. Infection of plants with these mutant viruses revealed that both P3 and P3N-PIPO were involved in overcoming cyv1-mediated resistance. Moreover, P3N-PIPO quantitatively affected the virulence of Cl-no30 in cyv1 pea. Additional expression in trans of the P3N-PIPO derived from Cl-no30, using White clover mosaic virus as a vector, enabled Cl-no30 to move to systemic leaves in cyv1 pea. Susceptible pea plants infected with chimeric ClYVV possessing the P3 cistron of 90-1 Br2, and which were therefore virulent toward cyv1 pea, accumulated more P3N-PIPO than did those infected with Cl-no30, suggesting that the higher level of P3N-PIPO in infected cells contributed to the breaking of resistance by 90-1 Br2. This is the first report showing that P3N-PIPO is a virulence determinant in plants resistant to a potyvirus. PMID:23616656

Class 1 Integrons and the Antiseptic Resistance Gene (qacEΔ1) in Municipal and Swine Slaughterhouse Wastewater Treatment Plants and Wastewater-Associated Methicillin-Resistant Staphylococcus aureus.

Science.gov (United States)

Wan, Min Tao; Chou, Chin Cheng

2015-06-02

Class 1 integrons are mobile gene elements (MGEs) containing qacEΔ1 that are resistant to quaternary ammonium compound (QAC) disinfectants. This study compared the abundances of class 1 integrons and antiseptic resistance genes in municipal (M) and swine slaughterhouse (S) wastewater treatment plants (WWTPs) and investigated the presence of class 1 integrons and antiseptic resistance genes in methicillin-resistant Staphylococcus aureus (MRSA) isolated from wastewater samples. The abundances of intI1 and qacEΔ1 genes in 96 wastewater samples were quantified using real-time quantitative polymerase chain reaction (real-time qPCR), and 113 MRSA isolates recovered from the wastewater samples were detected class 1 integrons and linked antiseptic resistance genes (qacEΔ1), and minimum inhibitory concentrations (MICs) for QAC antiseptics. The intI1 and qacEΔ1 genes were detected in all the wastewater samples, and they were more abundant in S-WWTP samples than in M-WWTP samples. A higher percentage of MRSA isolates carried qacEΔ1 in MRSA from swine wastewater samples (62.8%) than in municipal MRSA (3.7%). All the MRSA isolates showed high MICs for antiseptic agents. This study provides important evidence regarding the abundances of intI1 and qacEΔ1 genes in municipal and swine slaughterhouse wastewater, and antiseptic-resistant MRSA strains were detected in swine slaughterhouse wastewater.

Class 1 Integrons and the Antiseptic Resistance Gene (qacEΔ1) in Municipal and Swine Slaughterhouse Wastewater Treatment Plants and Wastewater—Associated Methicillin-Resistant Staphylococcus aureus

Science.gov (United States)

Wan, Min Tao; Chou, Chin Cheng

2015-01-01

Class 1 integrons are mobile gene elements (MGEs) containing qacEΔ1 that are resistant to quaternary ammonium compound (QAC) disinfectants. This study compared the abundances of class 1 integrons and antiseptic resistance genes in municipal (M) and swine slaughterhouse (S) wastewater treatment plants (WWTPs) and investigated the presence of class 1 integrons and antiseptic resistance genes in methicillin-resistant Staphylococcus aureus (MRSA) isolated from wastewater samples. The abundances of intI1 and qacEΔ1 genes in 96 wastewater samples were quantified using real-time quantitative polymerase chain reaction (real-time qPCR), and 113 MRSA isolates recovered from the wastewater samples were detected class 1 integrons and linked antiseptic resistance genes (qacEΔ1), and minimum inhibitory concentrations (MICs) for QAC antiseptics. The intI1 and qacEΔ1 genes were detected in all the wastewater samples, and they were more abundant in S-WWTP samples than in M-WWTP samples. A higher percentage of MRSA isolates carried qacEΔ1 in MRSA from swine wastewater samples (62.8%) than in municipal MRSA (3.7%). All the MRSA isolates showed high MICs for antiseptic agents. This study provides important evidence regarding the abundances of intI1 and qacEΔ1 genes in municipal and swine slaughterhouse wastewater, and antiseptic-resistant MRSA strains were detected in swine slaughterhouse wastewater. PMID:26042365

Impact of fertilizing with raw or anaerobically digested sewage sludge on the abundance of antibiotic-resistant coliforms, antibiotic resistance genes, and pathogenic bacteria in soil and on vegetables at harvest.

Science.gov (United States)

Rahube, Teddie O; Marti, Romain; Scott, Andrew; Tien, Yuan-Ching; Murray, Roger; Sabourin, Lyne; Zhang, Yun; Duenk, Peter; Lapen, David R; Topp, Edward

2014-11-01

The consumption of crops fertilized with human waste represents a potential route of exposure to antibiotic-resistant fecal bacteria. The present study evaluated the abundance of bacteria and antibiotic resistance genes by using both culture-dependent and molecular methods. Various vegetables (lettuce, carrots, radish, and tomatoes) were sown into field plots fertilized inorganically or with class B biosolids or untreated municipal sewage sludge and harvested when of marketable quality. Analysis of viable pathogenic bacteria or antibiotic-resistant coliform bacteria by plate counts did not reveal significant treatment effects of fertilization with class B biosolids or untreated sewage sludge on the vegetables. Numerous targeted genes associated with antibiotic resistance and mobile genetic elements were detected by PCR in soil and on vegetables at harvest from plots that received no organic amendment. However, in the season of application, vegetables harvested from plots treated with either material carried gene targets not detected in the absence of amendment. Several gene targets evaluated by using quantitative PCR (qPCR) were considerably more abundant on vegetables harvested from sewage sludge-treated plots than on vegetables from control plots in the season of application, whereas vegetables harvested the following year revealed no treatment effect. Overall, the results of the present study suggest that producing vegetable crops in ground fertilized with human waste without appropriate delay or pretreatment will result in an additional burden of antibiotic resistance genes on harvested crops. Managing human exposure to antibiotic resistance genes carried in human waste must be undertaken through judicious agricultural practice. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

Directory of Open Access Journals (Sweden)

Qing-Bin Yuan

Full Text Available This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L. The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L. By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L. However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

Dissemination of antibiotic resistance genes from antibiotic producers to pathogens

DEFF Research Database (Denmark)

Jiang, Xinglin; Ellabaan, Mostafa M Hashim; Charusanti, Pep

2017-01-01

It has been hypothesized that some antibiotic resistance genes (ARGs) found in pathogenic bacteria derive from antibiotic-producing actinobacteria. Here we provide bioinformatic and experimental evidence supporting this hypothesis. We identify genes in proteobacteria, including some pathogens...... and experimentally test a 'carry-back' mechanism for the transfer, involving conjugative transfer of a carrier sequence from proteobacteria to actinobacteria, recombination of the carrier sequence with the actinobacterial ARG, followed by natural transformation of proteobacteria with the carrier-sandwiched ARG. Our...... results support the existence of ancient and, possibly, recent transfers of ARGs from antibiotic-producing actinobacteria to proteobacteria, and provide evidence for a defined mechanism....

Erythromycin-resistant genes in group A β-haemolytic Streptococci in Chengdu, Southwestern China

Directory of Open Access Journals (Sweden)

W Zhou

2014-01-01

Full Text Available Context: The management of Group A β-haemolytic Streptococci (Streptococcus pyogenes or GAS infection include the use of penicillins, cephalosporins or macrolides for treatment. A general increase in macrolides resistance in GAS has been observed in recent years. Differences in rates of resistance to these agents have existed according to geographical location and investigators. Aims: To investigate the antibiotic pattern and erythromycin-resistant genes of GAS isolates associated with acute tonsillitis and scarlet fever in Chengdu, southwestern China. Settings and Design: To assess the macrolide resistance, phenotype, and genotypic characterization of GAS isolated from throat swabs of children suffering from different acute tonsillitis or scarlet fever between 2004 and 2011 in the city of Chengdu, located in the southwestern region of China. Materials and Methods: Minimal inhibitory concentration with seven antibiotics was performed on 127 GAS isolates. Resistance phenotypes of erythromycin-resistant GAS isolates were determined by the double-disk test. Their macrolide-resistant genes (mefA, ermB and ermTR were amplified by PCR. Results: A total of 98.4% (125/127 of the isolates exhibited resistance to erythromycin, clindamycin and tetracycline. All isolates were sensitive to penicillin G and cefotaxime. Moreover, 113 ermB-positive isolates demonstrating the cMLS phenotype of erythromycin resistance were predominant (90.4% and these isolates showed high-level resistance to both erythromycin and clindamycin (MIC 90 > 256 μg/ml; 12 (9.6% isolates demonstrating the MLS phenotype of erythromycin resistance carried the mefA gene, which showed low-level resistance to both erythromycin (MIC 90 = 8 μg/ml and clindamycin (MIC 90 = 0.5 μg/ml; and none of the isolates exhibited the M phenotype. Conclusions: The main phenotype is cMLS, and the ermB gene code is the main resistance mechanism against macrolides in GAS. Penicillin is the most beneficial

Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus

Directory of Open Access Journals (Sweden)

Ting Xiang Neik

2017-11-01

Full Text Available Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae, Blackleg (Leptosphaeria maculans and L. biglobosa, Sclerotinia Stem Rot (Sclerotinia sclerotiorum, and Downy Mildew (Hyaloperonospora parasitica. We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus.

Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus

Science.gov (United States)

Neik, Ting Xiang; Barbetti, Martin J.; Batley, Jacqueline

2017-01-01

Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R) genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae), Blackleg (Leptosphaeria maculans and L. biglobosa), Sclerotinia Stem Rot (Sclerotinia sclerotiorum), and Downy Mildew (Hyaloperonospora parasitica). We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus. PMID:29163558

SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

Directory of Open Access Journals (Sweden)

Mehmet AYBEKE

2015-12-01

Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

Identifying resistance gene analogs associated with resistances to different pathogens in common bean.

Science.gov (United States)

López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe

2003-01-01

ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

Functional Analysis of Genes Comprising the Locus of Heat Resistance in Escherichia coli.

Science.gov (United States)

Mercer, Ryan; Nguyen, Oanh; Ou, Qixing; McMullen, Lynn; Gänzle, Michael G

2017-10-15

The locus of heat resistance (LHR) is a 15- to 19-kb genomic island conferring exceptional heat resistance to organisms in the family Enterobacteriaceae , including pathogenic strains of Salmonella enterica and Escherichia coli The complement of LHR-comprising genes that is necessary for heat resistance and the stress-induced or growth-phase-induced expression of LHR-comprising genes are unknown. This study determined the contribution of the seven LHR-comprising genes yfdX1 GI , yfdX2 , hdeD GI , orf11 , trx GI , kefB , and psiE GI by comparing the heat resistances of E. coli strains harboring plasmid-encoded derivatives of the different LHRs in these genes. (Genes carry a subscript "GI" [genomic island] if an ortholog of the same gene is present in genomes of E. coli ) LHR-encoded heat shock proteins sHSP20, ClpK GI , and sHSP GI are not sufficient for the heat resistance phenotype; YfdX1, YfdX2, and HdeD are necessary to complement the LHR heat shock proteins and to impart a high level of resistance. Deletion of trx GI , kefB , and psiE GI from plasmid-encoded copies of the LHR did not significantly affect heat resistance. The effect of the growth phase and the NaCl concentration on expression from the putative LHR promoter p2 was determined by quantitative reverse transcription-PCR and by a plasmid-encoded p2:GFP promoter fusion. The expression levels of exponential- and stationary-phase E. coli cells were not significantly different, but the addition of 1% NaCl significantly increased LHR expression. Remarkably, LHR expression in E. coli was dependent on a chromosomal copy of evgA In conclusion, this study improved our understanding of the genes required for exceptional heat resistance in E. coli and factors that increase their expression in food. IMPORTANCE The locus of heat resistance (LHR) is a genomic island conferring exceptional heat resistance to several foodborne pathogens. The exceptional level of heat resistance provided by the LHR questions the

No evidential correlation between veterinary antibiotic degradation ability and resistance genes in microorganisms during the biodegradation of doxycycline.

Science.gov (United States)

Wen, Xin; Wang, Yan; Zou, Yongde; Ma, Baohua; Wu, Yinbao

2018-01-01

Biodegradation of antibiotic residues in the environment by microorganisms may lead to the generation of antibiotic resistance genes (ARGs), which are of great concern to human health. The aim of this study was to determine whether there is a relationship between the ability to degrade antibiotic doxycycline (DOX) and the development of resistance genes in microorganisms. We isolated and identified ten bacterial strains from a vegetable field that had received long-term manure application as fertilizer and were capable of surviving in a series of DOX concentrations (25, 50, 80, and 100mg/L). Our results showed no evidential correlation between DOX degradation ability and the development of resistance genes among the isolated microorganisms that had high DOX degradation capability (P > 0.05). This was based on the fact that Escherichia sp. and Candida sp. were the most efficient bacterial strains to degrade DOX (92.52% and 91.63%, respectively), but their tetracycline resistance genes showed a relatively low risk of antibiotic resistance in a 7-day experiment. Moreover, the tetM of the ribosomal protection protein genes carried by these two preponderant bacteria was five-fold higher than that carried by other isolates (P genes of three isolates, except for Escherichia sp. and Candida sp., showed remarkable negative correlations (P < 0.05), mainly because tetG markedly increased during the DOX degradation process. Our results concluded that the biodegradation of antibiotic residues may not necessarily lead to the development of ARGs in the environment. In addition, the two bacteria that we isolated, namely, Escherichia sp. and Candida sp., are potential candidates for the engineering of environmentally friendly bacteria. Copyright © 2017 Elsevier Inc. All rights reserved.

Resistance Genes in Global Crop Breeding Networks.

Science.gov (United States)

Garrett, K A; Andersen, K F; Asche, F; Bowden, R L; Forbes, G A; Kulakow, P A; Zhou, B

2017-10-01

Resistance genes are a major tool for managing crop diseases. The networks of crop breeders who exchange resistance genes and deploy them in varieties help to determine the global landscape of resistance and epidemics, an important system for maintaining food security. These networks function as a complex adaptive system, with associated strengths and vulnerabilities, and implications for policies to support resistance gene deployment strategies. Extensions of epidemic network analysis can be used to evaluate the multilayer agricultural networks that support and influence crop breeding networks. Here, we evaluate the general structure of crop breeding networks for cassava, potato, rice, and wheat. All four are clustered due to phytosanitary and intellectual property regulations, and linked through CGIAR hubs. Cassava networks primarily include public breeding groups, whereas others are more mixed. These systems must adapt to global change in climate and land use, the emergence of new diseases, and disruptive breeding technologies. Research priorities to support policy include how best to maintain both diversity and redundancy in the roles played by individual crop breeding groups (public versus private and global versus local), and how best to manage connectivity to optimize resistance gene deployment while avoiding risks to the useful life of resistance genes. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .

Genetic Analysis of Resistance to Benzimidazoles in Physarum: Differential Expression of β-Tubulin Genes

Science.gov (United States)

Burland, Timothy G.; Schedl, Tim; Gull, Keith; Dove, William F.

1984-01-01

Physarum displays two vegetative cell types, uninucleate myxamoebae and multinucleate plasmodia. Mutant myxamoebae of Physarum resistant to the antitubulin drug methylbenzimidazole-2-yl-carbamate (MBC) were isolated. All mutants tested were cross-resistant to other benzimidazoles but not to cycloheximide or emetine. Genetic analysis showed that mutation to MBC resistance can occur at any one of four unlinked loci, benA, benB, benC or benD. MBC resistance of benB and benD mutants was expressed in plasmodia, but benA and benC mutant plasmodia were MBC sensitive, suggesting that benA and benC encode myxamoeba-specific products. Myxamoebae carrying the recessive benD210 mutation express a β-tubulin with noval electrophoretic mobility, in addition to a β-tubulin with wild-type mobility. This and other evidence indicates that benD is a structural gene for β-tubulin, and that at least two β-tubulin genes are expressed in myxamoebae. Comparisons of the β-tubulins of wildtype and benD210 strains by gel electrophoresis revealed that, of the three (or more) β-tubulin genes expressed in Physarum, one, benD, is expressed in both myxamoebae and plasmodia, one is expressed specifically in myxamoebae and one is expressed specifically in plasmodia. However, mutation in only one gene, benD, is sufficient to confer MBC resistance on both myxamoebae and plasmodia. PMID:6479584

Prevalence of sulfonamide resistance genes in bacterial isolates from manured agricultural soils and pig slurry in the United Kingdom.

Science.gov (United States)

Byrne-Bailey, K G; Gaze, W H; Kay, P; Boxall, A B A; Hawkey, P M; Wellington, E M H

2009-02-01

The prevalences of three sulfonamide resistance genes, sul1, sul2, and sul3 and sulfachloropyridazine (SCP) resistance were determined in bacteria isolated from manured agricultural clay soils and slurry samples in the United Kingdom over a 2-year period. Slurry from tylosin-fed pigs amended with SCP and oxytetracycline was used for manuring. Isolates positive for sul genes were further screened for the presence of class 1 and 2 integrons. Phenotypic resistance to SCP was significantly higher in isolates from pig slurry and postapplication soil than in those from preapplication soil. Of 531 isolates, 23% carried sul1, 18% sul2, and 9% sul3 only. Two percent of isolates contained all three sul genes. Class 1 and class 2 integrons were identified in 5% and 11.7%, respectively, of sul-positive isolates. In previous reports, sul1 was linked to class 1 integrons, but in this study only 8% of sul1-positive isolates carried the intI1 gene. Sulfonamide-resistant pathogens, including Shigella flexneri, Aerococcus spp., and Acinetobacter baumannii, were identified in slurry-amended soil and soil leachate, suggesting a potential environmental reservoir. Sulfonamide resistance in Psychrobacter, Enterococcus, and Bacillus spp. is reported for the first time, and this study also provides the first description of the genotypes sul1, sul2, and sul3 outside the Enterobacteriaceae and in the soil environment.

Prevalence of Sulfonamide Resistance Genes in Bacterial Isolates from Manured Agricultural Soils and Pig Slurry in the United Kingdom▿

Science.gov (United States)

Byrne-Bailey, K. G.; Gaze, W. H.; Kay, P.; Boxall, A. B. A.; Hawkey, P. M.; Wellington, E. M. H.

2009-01-01

The prevalences of three sulfonamide resistance genes, sul1, sul2, and sul3 and sulfachloropyridazine (SCP) resistance were determined in bacteria isolated from manured agricultural clay soils and slurry samples in the United Kingdom over a 2-year period. Slurry from tylosin-fed pigs amended with SCP and oxytetracycline was used for manuring. Isolates positive for sul genes were further screened for the presence of class 1 and 2 integrons. Phenotypic resistance to SCP was significantly higher in isolates from pig slurry and postapplication soil than in those from preapplication soil. Of 531 isolates, 23% carried sul1, 18% sul2, and 9% sul3 only. Two percent of isolates contained all three sul genes. Class 1 and class 2 integrons were identified in 5% and 11.7%, respectively, of sul-positive isolates. In previous reports, sul1 was linked to class 1 integrons, but in this study only 8% of sul1-positive isolates carried the intI1 gene. Sulfonamide-resistant pathogens, including Shigella flexneri, Aerococcus spp., and Acinetobacter baumannii, were identified in slurry-amended soil and soil leachate, suggesting a potential environmental reservoir. Sulfonamide resistance in Psychrobacter, Enterococcus, and Bacillus spp. is reported for the first time, and this study also provides the first description of the genotypes sul1, sul2, and sul3 outside the Enterobacteriaceae and in the soil environment. PMID:19064898

Detection of selected antibiotic resistance genes using multiplex PCR assay in mastitis pathogens in the Czech Republic

Directory of Open Access Journals (Sweden)

Vladimir Pyatov

2017-01-01

Full Text Available The aim of this research was to develop multiplex polymerase chain reaction assays for the detection of aminoglycoside (strA, strB, sulphonamide (sulI, sulII, tetracycline (tetA, tetB, tetK, tetM, tetO, macrolide and lincosamide (msrA, ermA, ermB, ermC, mefA/E genes of resistance in mastitis pathogens (Escherichia coli, Staphylococcus aureus, Streptococcus uberis, Streptococcus agalactiae and Streptococcus dysgalactiae. Applying the established assays, we investigated the distribution of antibiotic resistance genes in the above mentioned species isolated from milk samples in the Czech Republic. Each assay consisted of seven pairs of primers. Six of them amplified fragments of antibiotic resistance genes and one pair a fragment of a species specific gene. Polymerase chain reaction conditions were optimized to amplify seven gene fragments simultaneously in one reaction. In total, 249 isolates were used, among which 111 were positive for E. coli, 52 for S. aureus and 86 for Streptococcus spp. The majority (60.2% of bacteria carried at least one antibiotic resistance gene and 44.6% were multidrug-resistant. The designed multiplex polymerase chain reaction assays may be applied as diagnostic method to replace or complement standard techniques of antibiotic susceptibility testing in the mentioned pathogens.

Investigation of diversity of plasmids carrying the blaTEM-52 gene

DEFF Research Database (Denmark)

Bielak, Eliza Maria; Bergenholtz, Rikke D.; Jørgensen, Mikael Skaanning

2011-01-01

OBJECTIVES: To investigate the diversity of plasmids that carry blaTEM-52 genes among Escherichia coli and Salmonella enterica originating from animals, meat products and humans. METHODS: A collection of 22 blaTEM-52-encoding plasmids was characterized by restriction fragment length polymorphism...... of self-transfer to a plasmid-free E. coli recipient. CONCLUSIONS: The blaTEM-52 gene found in humans could have been transmitted on transferable plasmids originating from animal sources. Some of the blaTEM-52 plasmids carry replicons that differ from the classical ones. Two novel replicons were detected...

Enrichment of antibiotic resistance genes in soil receiving composts derived from swine manure, yard wastes, or food wastes, and evidence for multiyear persistence of swine Clostridium spp.

Science.gov (United States)

Scott, Andrew; Tien, Yuan-Ching; Drury, Craig F; Reynolds, W Daniel; Topp, Edward

2018-03-01

The impact of amendment with swine manure compost (SMC), yard waste compost (YWC), or food waste compost (FWC) on the abundance of antibiotic resistance genes in soil was evaluated. Following a commercial-scale application of the composts in a field experiment, soils were sampled periodically for a decade, and archived air-dried. Soil DNA was extracted and gene targets quantified by qPCR. Compared with untreated control soil, all 3 amendment types increased the abundance of gene targets for up to 4 years postapplication. The abundance of several gene targets was much higher in soil amended with SMC than in soil receiving either YWC or FWC. The gene target ermB remained higher in the SMC treatment for a decade postapplication. Clostridia were significantly more abundant in the SMC-amended soil throughout the decade following application. Eight percent of Clostridium spp. isolates from the SMC treatment carried ermB. Overall, addition of organic amendments to soils has the potential to increase the abundance of antibiotic resistance genes. Amendments of fecal origin, such as SMC, will in addition entrain bacteria carrying antibiotic resistance genes. Environmentally recalcitrant clostridia, and the antibiotic resistance genes that they carry, will persist for many years under field conditions following the application of SMC.

Listeria monocytogenes isolates from food and food environment harbouring tetM and ermB resistance genes.

Science.gov (United States)

Haubert, L; Mendonça, M; Lopes, G V; de Itapema Cardoso, M R; da Silva, W P

2016-01-01

Listeria monocytogenes is a foodborne pathogen that has become an important cause of human and animal diseases worldwide. The purpose of this study was to evaluate the serotypes, virulence potential, antimicrobial resistance profile, and genetic relationships of 50 L. monocytogenes isolates from food and food environment in southern Brazil. In this study, the majority of L. monocytogenes isolates belonged to the serotypes 1/2b (42%) and 4b (26%), which are the main serotypes associated with human listeriosis. In addition, all isolates harboured internalin genes (inlA, inlC, inlJ), indicating a virulence potential. The isolates were sensitive to most of the antimicrobial compounds analysed, and five isolates (10%) were multi-resistant. Two isolates harboured antimicrobial resistance genes (tetM and ermB) and in one of them, the gene was present in the plasmid. Moreover, according to the pulsed field gel electrophoresis assay, two multi-resistant isolates were a single clone isolated from food and the processing plant. The isolates were susceptible to the most frequently used antibiotics for listeriosis treatment. However, the presence of multidrug-resistant isolates and antimicrobial resistance genes including in the plasmid could even be transferred between bacterial species, suggesting a potential health risk to consumers and a potential risk of spreading multi-resistance genes to other bacteria. Listeria monocytogenes is an important agent of foodborne diseases. The results of this study suggest a potential capacity of L. monocytogenes isolates from food and food environment to cause human infections. Antimicrobial multi-resistance profiles were detected in 10%, and two isolates harboured tetM and ermB resistance genes. Moreover, the present research can help to build up a better knowledge about antimicrobial resistance of L. monocytogenes. Additionally, we found one isolate carrying tetM resistance gene in a plasmid, that suggests a possible transmission

Localization of the Laevigatum powdery mildew resistance gene to barley chromosome 2 by the use of RFLP markers

DEFF Research Database (Denmark)

Giese, H.; Holm-Jensen, A.G.; Jensen, H.P.

1993-01-01

The powdery mildew disease resistance gene Ml(La) was found to belong to a locus on barely chromosome 2. We suggest that this locus be designated MlLa. Linkage analysis was carried out on 72 chromosome-doubled, spring-type progeny lines from a cross between the winter var 'Vogelsanger Gold' and t......' and the spring var 'Alf'. A map of chromosome 2 spanning 119 cM and flanked by two peroxidase gene loci was constructed. In addition to the Laevigatum resistance locus the map includes nine RFLP markers, the two peroxidase gene loci and the six-row locus in barley....

Prevalence and characterization of methicillin-resistant Staphylococcus aureus carrying mecA or mecC and methicillin-susceptible Staphylococcus aureus in dairy sheep farms in central Italy.

Science.gov (United States)

Giacinti, G; Carfora, V; Caprioli, A; Sagrafoli, D; Marri, N; Giangolini, G; Amoruso, R; Iurescia, M; Stravino, F; Dottarelli, S; Feltrin, F; Franco, A; Amatiste, S; Battisti, A

2017-10-01

Between January and May 2012, a total of 286 bulk tank milk samples from dairy sheep farms located in central Italy were tested for the presence of Staphylococcus aureus. One hundred fifty-three samples were positive for S. aureus (53.5%), with an average count of 2.53 log cfu/mL. A total of 679 S. aureus colonies were screened for methicillin resistance by the cefoxitin disk diffusion test, and 104 selected cefoxitin-susceptible isolates were also tested for their susceptibility to other antimicrobials representative of the most relevant classes active against Staphylococcus spp. by using the Kirby-Bauer disk diffusion method. Two methicillin-resistant Staphylococcus aureus (MRSA) isolates, carrying respectively the mecA and the mecC genes, were detected in 2 samples from 2 different farms (prevalence 0.7%). The mecA-positive MRSA isolate was blaZ positive, belonged to spa type t127, sequence type (ST)1, clonal complex (CC)1, carried a staphylococcal cassette chromosome mec (SCCmec) type IVa, and was phenotypically resistant to all the β-lactams tested and to erythromycin, streptomycin, kanamycin, and tetracycline. The mecC-positive MRSA isolate was negative for the chromosomally or plasmid-associated blaZ gene but positive for the blaZ allotype associated with SCCmec XI (blaZ-SCCmecXI), belonged to spa type 843, ST(CC)130, carried a SCCmec type XI, and was resistant only to β-lactams. Both MRSA were negative for the presence of specific immune-evasion and virulence genes such as those coding for the Panton-Valentine leucocidin, the toxic shock syndrome toxin 1, and the immune evasion cluster genes. Regarding the presence of the major S. aureus enterotoxin genes, the mecC-positive MRSA tested negative, whereas the ST (CC)1 mecA-positive MRSA harbored the seh gene. Among the 104 methicillin-susceptible S. aureus isolates examined for antimicrobial susceptibility, 63 (60.58%) were susceptible to all the antimicrobials tested, and 41 (39.42%) were resistant to at

Detection of linezolid resistance due to the optrA gene in Enterococcus faecalis from poultry meat from the American continent (Colombia)

DEFF Research Database (Denmark)

Cavaco, Lina; Bernal, J F; Zankari, Ea

2017-01-01

Three Enterococcus isolates obtained from retail chicken collected in 2010-11 as part of the Colombian Integrated Program for Antimicrobial Resistance Surveillance (COIPARS) showed reduced susceptibility towards linezolid (MIC 8 mg/L). This study aimed at characterizing the isolates resistant......A gene encoding resistance to linezolid and phenicols. Additional screening of 37 enterococci strains from the same study did not detect any further positives. Typing showed that two of the isolates belong to ST59, while the last belongs to ST489. All isolates carry genes encoding resistance to macrolide...

The fosfomycin resistance gene fosB3 is located on a transferable, extrachromosomal circular intermediate in clinical Enterococcus faecium isolates.

Directory of Open Access Journals (Sweden)

Xiaogang Xu

Full Text Available Some VanM-type vancomycin-resistant Enterococcus faecium isolates from China are also resistant to fosfomycin. To investigate the mechanism of fosfomycin resistance in these clinical isolates, antimicrobial susceptibility testing, filter-mating, Illumina/Solexa sequencing, inverse PCR and fosfomycin resistance gene cloning were performed. Three E. faecium clinical isolates were highly resistant to fosfomycin and vancomycin with minimal inhibitory concentrations (MICs >1024 µg/ml and >256 µg/ml, respectively. The fosfomycin and vancomycin resistance of these strains could be co-transferred by conjugation. They carried a fosfomycin resistance gene fosB encoding a protein differing by one or two amino acids from FosB, which is encoded on staphylococcal plasmids. Accordingly, the gene was designated fosB3. The fosB3 gene was cloned into pMD19-T, and transformed into E. coli DH5α. The fosfomycin MIC for transformants with fosB3 was 750-fold higher than transformants without fosB3. The fosB3 gene could be transferred by an extrachromosomal circular intermediate. The results indicate that the fosB3 gene is transferable, can mediate high level fosfomycin resistance in both Gram-positive and Gram-negative bacteria, and can be located on a circular intermediate.

Correlation Between qacE and qacE∆1 Efflux Pump Genes, Antibiotic and Disinfectant Resistant Among Clinical Isolates of E.coli.

Science.gov (United States)

Shafaati, Maryam; Boroumand, Mohammadali; Nowroozi, Jamileh; Amiri, Pouya; Kazemian, Hossein

2016-01-01

Antiseptics and disinfectants have been used widely in hospitals and other health care settings to control the growth of microorganisms. However, some disinfectant resistant strains were reported. The objectives of our study were to evaluate correlation between the efflux pump genes, drugs and disinfectant resistant among clinical isolates of E.coli. A total of 102 of E. coli strains were isolated from urine sample of hospitalized patients. The antibiotic susceptibility was carried out by disc diffusion method. Didecyl di-methyl ammonium chloride (DDDMAC) was used as Quaternary ammonium compound (QAC) disinfectant which was used in Heart Center Hospital. PCR reaction was carried out for detection of qacE and qac∆E efflux pump genes. Almost all the strains had higher resistance to ampicillin, ciproflaxacin, cotrimaxazole and cephalothin. Totally 49% (n: 50) of strains were produced ESBL. Almost all the strains have MIC value between 0.00195 to 0.0078 mg/l for DDDMAC. Correlation between presence of qacE and qac∆E genes and antibiotic resistance was perceived. Presence of qacE and qac∆E genes among strains that have high disinfectant MIC value were 96.9% and 93.7% respectively. In addition, 98% of ESBL producing strains harbored qacE gene and 94% of ESBL producing strains harbored qac∆E gene. Our study indicated that there was a strong correlation between presence of qacE and qac∆E genes with resistance to some antibiotics and growth in media which contain high concentration of disinfectant. In conclusion, other mechanisms also play important role in resistant to antimicrobial agents but the role of efflux pumps in resistant to antimicrobial agents should not be neglected. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Properties of Cells Carrying the Herpes Simplex Virus Type 2 Thymidine Kinase Gene: Mechanisms of Reversion to a Thymidine Kinase-Negative Phenotype

Science.gov (United States)

Bastow, K. F.; Darby, G.; Wildy, P.; Minson, A. C.

1980-01-01

We have isolated cells with a thymidine kinase-negative (tk−) phenotype from cells which carry the herpes simplex virus type 2 tk gene by selection in 5-bromodeoxyuridine or 9-(2-hydroxyethoxymethyl)guanine. Both selection routines generated revertants with a frequency of 10−3 to 10−4, and resistance to either compound conferred simultaneous resistance to the other. tk− revertants fell into three classes: (i) cells that arose by deletion of all virus sequences, (ii) cells that had lost the virus tk gene but retained a nonselected virus-specific function and arose by deletion of part of the virus-specific sequence, and (iii) cells that retained the potential to express all of the virus-specific functions of the parental cells and retained all of the virus-specific DNA sequences. Images PMID:16789205

Antimicrobial resistance and prevalence of resistance genes of obligate anaerobes isolated from periodontal abscesses.

Science.gov (United States)

Xie, Yi; Chen, Jiazhen; He, Junlin; Miao, Xinyu; Xu, Meng; Wu, Xingwen; Xu, Beiyun; Yu, Liying; Zhang, Wenhong

2014-02-01

This study attempts to determine the antimicrobial resistance profiles of obligate anaerobic bacteria that were isolated from a periodontal abscess and to evaluate the prevalence of resistance genes in these bacteria. Forty-one periodontal abscess samples were cultivated on selective and non-selective culture media to isolate the oral anaerobes. Their antibiotic susceptibilities to clindamycin, doxycycline, amoxicillin, imipenem, cefradine, cefixime, roxithromycin, and metronidazole were determined using the agar dilution method, and polymerase chain reaction assays were performed to detect the presence of the ermF, tetQ, nim, and cfxA drug resistance genes. A total of 60 different bacterial colonies was isolated and identified. All of the isolates were sensitive to imipenem. Of the strains, 6.7%, 13.3%, 16.7%, and 25% were resistant to doxycycline, metronidazole, cefixime, and amoxicillin, respectively. The resistance rate for both clindamycin and roxithromycin was 31.7%. Approximately 60.7% of the strains had the ermF gene, and 53.3% of the amoxicillin-resistant strains were found to have the cfxA gene. Two nim genes that were found in eight metronidazole-resistant strains were identified as nimB. In the present study, the Prevotella species are the most frequently isolated obligate anaerobes from periodontal abscesses. The current results show their alarmingly high resistance rate against clindamycin and roxithromycin; thus, the use of these antibiotics is unacceptable for the empirical therapy of periodontal abscesses. A brief prevalence of four resistance genes in the anaerobic bacteria that were isolated was also demonstrated.

The gene expression profile of resistant and susceptible Bombyx mori strains reveals cypovirus-associated variations in host gene transcript levels.

Science.gov (United States)

Guo, Rui; Wang, Simei; Xue, Renyu; Cao, Guangli; Hu, Xiaolong; Huang, Moli; Zhang, Yangqi; Lu, Yahong; Zhu, Liyuan; Chen, Fei; Liang, Zi; Kuang, Sulan; Gong, Chengliang

2015-06-01

High-throughput paired-end RNA sequencing (RNA-Seq) was performed to investigate the gene expression profile of a susceptible Bombyx mori strain, Lan5, and a resistant B. mori strain, Ou17, which were both orally infected with B. mori cypovirus (BmCPV) in the midgut. There were 330 and 218 up-regulated genes, while there were 147 and 260 down-regulated genes in the Lan5 and Ou17 strains, respectively. Gene ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment for differentially expressed genes (DEGs) were carried out. Moreover, gene interaction network (STRING) analyses were performed to analyze the relationships among the shared DEGs. Some of these genes were related and formed a large network, in which the genes for B. mori cuticular protein RR-2 motif 123 (BmCPR123) and the gene for B. mori DNA replication licensing factor Mcm2-like (BmMCM2) were key genes among the common up-regulated DEGs, whereas the gene for B. mori heat shock protein 20.1 (Bmhsp20.1) was the central gene among the shared down-regulated DEGs between Lan5 vs Lan5-CPV and Ou17 vs Ou17-CPV. These findings established a comprehensive database of genes that are differentially expressed in response to BmCPV infection between silkworm strains that differed in resistance to BmCPV and implied that these DEGs might be involved in B. mori immune responses against BmCPV infection.

The diversity of antimicrobial resistance genes among staphylococci of animal origin.

Science.gov (United States)

Wendlandt, Sarah; Feßler, Andrea T; Monecke, Stefan; Ehricht, Ralf; Schwarz, Stefan; Kadlec, Kristina

2013-08-01

Staphylococci of animal origin harbor a wide variety of resistance genes. So far, more than 40 different resistance genes have been identified in staphylococci from animals. This includes genes that confer resistance to virtually all classes of antimicrobial agents approved for use in animals, such as penicillins, cephalosporins, tetracyclines, macrolides, lincosamides, phenicols, aminoglycosides, aminocyclitols, pleuromutilins, and diaminopyrimidines. The gene products of some of these resistance genes confer resistance to only specific members of a class of antimicrobial agents, whereas others confer resistance to the entire class or even to members of different classes of antimicrobial agents. The resistance mechanisms specified by the resistance genes fall into three major categories: (i) enzymatic inactivation, (ii) active efflux, or (iii) protection/modification/replacement of the cellular target sites of the antimicrobial agents. Mobile genetic elements, in particular plasmids and transposons, play a major role as carriers of antimicrobial resistance genes in animal staphylococci. They facilitate the exchange of resistance genes with staphylococci of human origin but also with other Gram-positive bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

Influence of mutations in some structural genes of heat-shock proteins on radiation resistance of Escherichia coli

International Nuclear Information System (INIS)

Verbenko, V.N.; Kuznetsova, L.V.; Bikineeva, E.G.; Kalinin, V.L.

1992-01-01

Lethal effects of γ-irradiation were studied in Escherichia coli strains with normal repair genotype and in radiation-resistant Gam r strains, both carrying additional mutations in the structural genes dnaK, grpE, groES or groEL. The null mutation ΔdnaK52::Cm r enhanced radiation sensitivity of wild-type cells and abolished the effect of heat induced rediation-resistance (ETIRR) and elevated radiation resistance of the Gam r strains

The Prevalence of Transmitted Drug Resistance in Newly Diagnosed HIV-Infected Individuals in Croatia: The Role of Transmission Clusters of Men Who Have Sex with Men Carrying the T215S Surveillance Drug Resistance Mutation

Science.gov (United States)

Grgic, Ivana; Lunar, Maja M.; Poljak, Mario; Vince, Adriana; Vrakela, Ivana Baca; Planinic, Ana; Seme, Katja; Begovac, Josip

2013-01-01

Abstract The aim of this study was to determine the prevalence of transmitted drug resistance (TDR) in newly diagnosed and treatment-naive HIV-infected patients from Croatia and evaluate a possible contribution of transmission clusters to the spread of resistant virus. The study enrolled treatment-naive HIV-infected patients that entered clinical care at the Croatian Reference Center for HIV/AIDS between 2006 and 2008. The protease gene and a part of the reverse transcriptase gene of the HIV-1 genome were sequenced by using the Trugene HIV-1 Genotyping System. The prevalence of transmitted drug resistance was analyzed by using the surveillance drug resistance mutations (SDRM) list recommended by the WHO in 2009. We report findings for 118 of 180 eligible patients (65.6% coverage). SDRM were detected in 26 of 118 patients (22.0%) who were infected with subtype B and belonged mostly to the men having sex with men (MSM). The majority of patients with primary resistance carried SDRM associated with resistance to nucleoside analogues reverse transcriptase inhibitors (NRTIs, 23 of 118 patients, 19.5%). The most frequently found NRTI SDRM was T215S (17 of 118 patients, 14.4%). SDRM associated with resistance to nonnucleoside reverse transcriptase inhibitors were detected in three (2.5%) patients and primary resistance to protease inhibitors was not detected. Non-B subtypes were detected in 13/118 patients (11%). A total of 12 transmission pairs and eight distinct transmission clusters were identified with the largest cluster harboring sequences from 19 patients; among them all but two were carrying the T215S mutation. This study showed a high prevalence of TDR in newly diagnosed MSM from Croatia and is an important contribution concerning the relationship between local transmission clusters and the spread of resistant virus. PMID:22906365

Antibiotic resistance profile and virulence genes of uropathogenic Escherichia coli isolates in relation to phylogeny.

Science.gov (United States)

Adib, N; Ghanbarpour, R; Solatzadeh, H; Alizade, H

2014-03-01

Escherichia coli (E. coli) strains are the major cause of urinary tract infections (UTI) and belong to the large group of extra-intestinal pathogenic E. coli. The purposes of this study were to determine the antibiotic resistance profile, virulence genes and phylogenetic background of E. coli isolates from UTI cases. A total of 137 E. coli isolates were obtained from UTI samples. The antimicrobial susceptibility of confirmed isolates was determined by disk diffusion method against eight antibiotics. The isolates were examined to determine the presence and prevalence of selected virulence genes including iucD, sfa/focDE, papEF and hly. ECOR phylo-groups of isolates were determined by detection of yjaA and chuA genes and fragment TspE4.C2. The antibiogram results showed that 71% of the isolates were resistant to cefazolin, 60.42% to co-trimoxazole, 54.16% to nalidixic acid, 36.45% to gentamicin, 29.18% to ciprofloxacin, 14.58% to cefepime, 6.25% to nitrofurantoin and 0.00% to imipenem. Twenty-two antibiotic resistance patterns were observed among the isolates. Virulence genotyping of isolates revealed that 58.39% isolates had at least one of the four virulence genes. The iucD gene was the most prevalent gene (43.06%). The other genes including sfa/focDE, papEF and hly genes were detected in 35.76%, 18.97% and 2.18% isolates, respectively. Nine combination patterns of the virulence genes were detected in isolates. Phylotyping of 137 isolates revealed that the isolates fell into A (45.99%), B1 (13.14%), B2 (19.71%) and D (21.16%) groups. Phylotyping of multidrug resistant isolates indicated that these isolates are mostly in A (60.34%) and D (20.38%) groups. In conclusion, the isolates that possessed the iucD, sfa/focDE, papEF and hly virulence genes mostly belonged to A and B2 groups, whereas antibiotic resistant isolates were in groups A and D. Escherichia coli strains carrying virulence factors and antibiotic resistance are distributed in specific phylogenetic

Candidate genes for cross-resistance against DNA-damaging drugs

DEFF Research Database (Denmark)

Wittig, Rainer; Nessling, Michelle; Will, Rainer D

2002-01-01

Drug resistance of tumor cells leads to major drawbacks in the treatment of cancer. To identify candidate genes for drug resistance, we compared the expression patterns of the drug-sensitive human malignant melanoma cell line MeWo and three derived sublines with acquired resistance to the DNA...... as several apoptosis-related genes, in particular STK17A and CRYAB. As MPP1 and CRYAB are also among the 14 genes differentially expressed in all three of the drug-resistant sublines, they represent the strongest candidates for resistance against DNA-damaging drugs....

Phenotypic and genotypic antimicrobial resistance and virulence genes of Salmonella enterica isolated from pet dogs and cats

Science.gov (United States)

Srisanga, Songsak; Angkititrakul, Sunpetch; Sringam, Patcharee; Le Ho, Phuong T.; Vo, An T. T.

2017-01-01

Salmonella enterica isolates (n = 122), including 32 serotypes from 113 dogs and 9 cats, were obtained from household dogs (n = 250) and cats (n = 50) during 2012–2015. The isolates were characterized by serotyping, antimicrobial resistance phenotyping and genotyping, and virulence gene screening. Serovars Weltevreden (15.6%) and Typhimurium (13.9%) were the most common. The majority (43%) of the isolates were multidrug resistant. The dog isolates (12.3%) harbored class 1 integrons, of which the dfrA12-aadA2 cassette was most frequent (66.7%). The only class integron in serovar Albany was located on a conjugative plasmid. Two ESBL-producing isolates (i.e., a serovar Krefeld and a serovar Enteritridis) carried blaTEM and blaCTX-M, and the blaTEM gene in both was horizontally transferred. Of the plasmid-mediated quinolone resistance genes tested, only qnrS (4.9%) was detected. Most Salmonella isolates harbored invA (100%), prgH (91.8%), and sipB (91%). Positive associations between resistance and virulence genes were observed for blaPSE-1/orgA, cmlA/spaN, tolC, and sul1/tolC (p resistance and virulence genes and that antimicrobial use in companion animals may select for the examined Salmonella virulence factors. PMID:27586467

Role of NADPH-insensitive nitroreductase gene to metronidazole resistance of Helicobacter pylori strains

Directory of Open Access Journals (Sweden)

M Kargar

2010-06-01

Full Text Available Background and the purpose of the study: Current anti-H. pylori therapies are based on the use of two antibiotics with a proton pump inhibitor and/or a bismuth component. Metronidazole is a key component of such combination therapies in Iran. The aim of this study was to determine the role of rdxA gene in resistant strains of H. pylori isolated from Shahrekord Hajar hospital to metronidazole. Methods: This study was a cross-sectional method, which was carried out on 263 patients who referred to endoscopy department of Hajar hospital, in 2007. Biopsy samples were cultured on selective Brucella agar containing 10% blood and incubated under microerophilic condition at 370C for 3 - 7 days. Suspected colonies were tested by Gram staining, urease, oxidase and catalase activities. Organisms were confirmed to be H. pylori on the basis of the presence of ureC(glmM gene by PCR .Specific primers were used for detection of rdxA gene mutation . Results: Eighty and four strains of H. pylori determined by PCR method. Of the isolated strains, 49 (58.33% were resistant, 7 (8.33% were semi-sensitive to metronidazole and 200bp deletion in rdxA gene was observed in 2 strains. Conclusion: Because of the high metronidazole resistance in patients under study it was necessary to replace it by other antibiotics in therapeutic regimens. On the basis of low frequency of resistance mutation in rdxA gene, sequence analysis for identification of other mechanisms is suggested.

Mapping of powdery mildew resistance gene Pm53 introgressed from Aegilops speltoides into soft red winter wheat.

Science.gov (United States)

Petersen, Stine; Lyerly, Jeanette H; Worthington, Margaret L; Parks, Wesley R; Cowger, Christina; Marshall, David S; Brown-Guedira, Gina; Murphy, J Paul

2015-02-01

A powdery mildew resistance gene was introgressed from Aegilops speltoides into winter wheat and mapped to chromosome 5BL. Closely linked markers will permit marker-assisted selection for the resistance gene. Powdery mildew of wheat (Triticum aestivum L.) is a major fungal disease in many areas of the world, caused by Blumeria graminis f. sp. tritici (Bgt). Host plant resistance is the preferred form of disease prevention because it is both economical and environmentally sound. Identification of new resistance sources and closely linked markers enable breeders to utilize these new sources in marker-assisted selection as well as in gene pyramiding. Aegilops speltoides (2n = 2x = 14, genome SS), has been a valuable disease resistance donor. The powdery mildew resistant wheat germplasm line NC09BGTS16 (NC-S16) was developed by backcrossing an Ae. speltoides accession, TAU829, to the susceptible soft red winter wheat cultivar 'Saluda'. NC-S16 was crossed to the susceptible cultivar 'Coker 68-15' to develop F2:3 families for gene mapping. Greenhouse and field evaluations of these F2:3 families indicated that a single gene, designated Pm53, conferred resistance to powdery mildew. Bulked segregant analysis showed that multiple simple sequence repeat (SSR) and single nucleotide polymorphism (SNP) markers specific to chromosome 5BL segregated with the resistance gene. The gene was flanked by markers Xgwm499, Xwmc759, IWA6024 (0.7 cM proximal) and IWA2454 (1.8 cM distal). Pm36, derived from a different wild wheat relative (T. turgidum var. dicoccoides), had previously been mapped to chromosome 5BL in a durum wheat line. Detached leaf tests revealed that NC-S16 and a genotype carrying Pm36 differed in their responses to each of three Bgt isolates. Pm53 therefore appears to be a new source of powdery mildew resistance.

Molecular study on some antibiotic resistant genes in Salmonella spp. isolates

Science.gov (United States)

Nabi, Ari Q.

2017-09-01

Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.

Evolution of IncA/C blaCMY-₂-carrying plasmids by acquisition of the blaNDM-₁ carbapenemase gene.

Science.gov (United States)

Carattoli, Alessandra; Villa, Laura; Poirel, Laurent; Bonnin, Rémy A; Nordmann, Patrice

2012-02-01

The bla(NDM-1) gene has been reported to be often located on broad-host-range plasmids of the IncA/C type in clinical but also environmental bacteria recovered from the New Delhi, India, area. IncA/C-type plasmids are the main vehicles for the spread of the cephalosporinase gene bla(CMY-2), frequently identified in the United States, Canada, and Europe. In this study, we completed the sequence of IncA/C plasmid pNDM-KN carrying the bla(NDM-1) gene, recovered from a Klebsiella pneumoniae isolate from Kenya. This sequence was compared with those of three IncA/C-type reference plasmids from Escherichia coli, Yersinia ruckeri, and Photobacterium damselae. Comparative analysis showed that the bla(NDM-1) gene was located on a widely diffused plasmid scaffold known to be responsible for the spread of bla(CMY-2)-like genes and consequently for resistance to broad-spectrum cephalosporins. Considering that IncA/C plasmids possess a broad host range, this scaffold might support a large-scale diffusion of the bla(NDM-1) gene among Gram-negative rods.

Profiles of phenotype resistance to antibiotic other than β-lactams in Klebsiella pneumoniae ESBLs-producers, carrying blaSHV genes

Directory of Open Access Journals (Sweden)

Pawel Sacha

2010-04-01

Full Text Available Extended spectrum β-lactamases production is one of the most common mechanism of resistance to extendedspectrum β-lactam antibiotics is increasing worldwide. Twenty five strains of Klebsiella pneumoniae isolated from clinicalspecimens were tested. Based on the phenotypic confirmatory test all these strains were defined as ESBL producers namedESBL(+. The plasmid DNA from each strains was used to investigate the presence of blaSHV genes responsible for extendedspectrum β-lactamases production. Moreover, susceptibility of these strains to antibiotic other than β-lactams in was tested.

Chronic exposure to triclosan sustains microbial community shifts and alters antibiotic resistance gene levels in anaerobic digesters.

Science.gov (United States)

Carey, Daniel E; Zitomer, Daniel H; Kappell, Anthony D; Choi, Melinda J; Hristova, Krassimira R; McNamara, Patrick J

2016-08-10

Triclosan, an antimicrobial chemical found in consumer personal care products, has been shown to stimulate antibiotic resistance in pathogenic bacteria. Although many studies focus on antibiotic resistance pertinent to medical scenarios, resistance developed in natural and engineered environments is less studied and has become an emerging concern for human health. In this study, the impacts of chronic triclosan (TCS) exposure on antibiotic resistance genes (ARGs) and microbial community structure were assessed in lab-scale anaerobic digesters. TCS concentrations from below detection to 2500 mg kg(-1) dry solids were amended into anaerobic digesters over 110 days and acclimated for >3 solid retention time values. Four steady state TCS concentrations were chosen (30-2500 mg kg(-1)). Relative abundance of mexB, a gene coding for a component of a multidrug efflux pump, was significantly higher in all TCS-amended digesters (30 mg kg(-1) or higher) relative to the control. TCS selected for bacteria carrying tet(L) and against those carrying erm(F) at concentrations which inhibited digester function; the pH decrease associated with digester failure was suspected to cause this selection. Little to no impact of TCS was observed on intI1 relative abundance. Microbial communities were also surveyed by high-throughput 16S rRNA gene sequencing. Compared to the control digesters, significant shifts in community structure towards clades containing commensal and pathogenic bacteria were observed in digesters containing TCS. Based on these results, TCS should be included in studies and risk assessments that attempt to elucidate relationships between chemical stressors (e.g. antibiotics), antibiotic resistance genes, and public health.

Genome-Wide Association Study with Sequence Variants Identifies Candidate Genes for Mastitis Resistance in Dairy Cattle

DEFF Research Database (Denmark)

Sahana, Goutam; Guldbrandtsen, Bernt; Bendixen, Christian

Six genomic regions affecting clinical mastitis were identified through a GWAS study with imputed BovineHD chip genotype data in the Nordic Holstein cattle population. The association analyses were carried out using a SNP-by-SNP analysis by fitting the regression of allele dosage and a polygenic...... Effect Predictor (VEP) vers. 2.6 using ENSEMBL vers. 67 databases. Candidate polymorphisms affecting clinical mastitis were selected based on their association with the traits and functional annotations. A strong positional candidate gene for mastitis resistance on chromosome-6 is the NPFFR2 which...... Factor Receptor Alpha (LIFR) emerged as a strong candidate gene for mastitis resistance. The LIFR gene is involved in acute phase response and is expressed in saliva and mammary gland....

High Prevalence of Plasmid-Mediated Quinolone Resistance and IncQ Plasmids Carrying qnrS2 Gene in Bacteria from Rivers near Hospitals and Aquaculture in China.

Directory of Open Access Journals (Sweden)

Yanping Wen

Full Text Available Effluents from hospital and aquaculture are considered important sources of quinolone resistance. However, little information is available on the impact of this effluent on nearby rivers. In this study, 188 ciprofloxacin-resistant bacterial isolates obtained from rivers near hospitals and aquaculture were screened for plasmid-mediated quinolone resistance (PMQR genes. Species identification, antibiotic susceptibility testing, and PMQR gene transferability assessment were conducted for PMQR-positive bacteria. Representative qnrS2-encoding plasmids were subsequently sequenced using a primer-walking approach. In total, 44 isolates (23.4% were positive for qnr genes (16 qnrB2, 3 qnrS1, and 25 qnrS2 and 32 isolates (17.0% were positive for aac(6'-Ib-cr. Other PMQR genes were not detected. The qnrB2 and aac(6'-Ib-cr genes had a higher prevalence in aquaculture samples than in hospital samples, and were significantly associated with Enterobacteriaceae (p < 0.05. In contrast, the prevalence of qnrS2 was not site-related, but was significantly associated with Aeromonas spp. (p < 0.05. All PMQR isolates were resistant to three or more classes of antibiotics. Eleven qnrS2-harboring plasmids from Aeromonas spp., including a novel conjugative plasmid pHP18, were selected for sequencing. These plasmids were small in size (6,388-16,197 bp and belonged to the IncQ or IncU plasmid family, with qnrS2 being part of a mobile insertion cassette. Taken together, our findings suggest that aquaculture is a possible source for aac(6'-Ib-cr and qnrB2 dissemination, and demonstrate the ubiquity of qnrS2 in aquatic environments. Finally, Aeromonas spp. served as vectors for qnrS2 with the help of IncQ-type plasmids.

The expression of antibiotic resistance genes in antibiotic-producing bacteria.

Science.gov (United States)

Mak, Stefanie; Xu, Ye; Nodwell, Justin R

2014-08-01

Antibiotic-producing bacteria encode antibiotic resistance genes that protect them from the biologically active molecules that they produce. The expression of these genes needs to occur in a timely manner: either in advance of or concomitantly with biosynthesis. It appears that there have been at least two general solutions to this problem. In many cases, the expression of resistance genes is tightly linked to that of antibiotic biosynthetic genes. In others, the resistance genes can be induced by their cognate antibiotics or by intermediate molecules from their biosynthetic pathways. The regulatory mechanisms that couple resistance to antibiotic biosynthesis are mechanistically diverse and potentially relevant to the origins of clinical antibiotic resistance. © 2014 John Wiley & Sons Ltd.

Presence of the resistance genes vanC1 and pbp5 in phenotypically vancomycin and ampicillin susceptible Enterococcus faecalis.

Science.gov (United States)

Schwaiger, Karin; Bauer, Johann; Hörmansdorfer, Stefan; Mölle, Gabriele; Preikschat, Petra; Kämpf, Peter; Bauer-Unkauf, Ilse; Bischoff, Meike; Hölzel, Christina

2012-08-01

Ampicillin and vancomycin are important antibiotics for the therapy of Enterococcus faecalis infections. The ampicillin resistance gene pbp5 is intrinsic in Enterococcus faecium. The vanC1 gene confers resistance to vancomycin and serves as a species marker for Enterococcus gallinarum. Both genes are chromosomally located. Resistance to ampicillin and vancomycin was determined in 484 E. faecalis of human and porcine origin by microdilution. Since E. faecalis are highly skilled to acquire resistance genes, all strains were investigated for the presence of pbp5 (and, in positive strains, for the penicillin-binding protein synthesis repressor gene psr) and vanC1 (and, in positive strains, for vanXYc and vanT) by using polymerase chain reaction (PCR). One porcine and one human isolate were phenotypically resistant to ampicillin; no strain was vancomycin resistant. Four E. faecalis (3/1 of porcine/human origin) carried pbp5 (MIC=1 mg/L), and four porcine strains were vanC1 positive (minimum inhibitory concentration [MIC]=1 mg/L). Real-time reverse transcriptase (RT)-PCR revealed that the genes were not expressed. The psr gene was absent in the four pbp5-positive strains; the vanXYc gene was absent in the four vanC1-positive strains. However, vanT of the vanC gene cluster was detected in two vanC1-positive strains. To our knowledge, this is the first report on the presence of pbp5, identical with the "E. faecium pbp5 gene," and of vanC1/vanT in E. faecalis. Even if resistance is not expressed in these strains, this study shows that E. faecalis have a strong ability to acquire resistance genes-and potentially to spread them to other bacteria. Therefore, close monitoring of this species should be continued.

Genetic characterization of antibiotic resistance in enteropathogenic Escherichia coli carrying extended-spectrum beta-lactamases recovered from diarrhoeic rabbits.

Science.gov (United States)

Poeta, P; Radhouani, H; Gonçalves, A; Figueiredo, N; Carvalho, C; Rodrigues, J; Igrejas, G

2010-05-01

A total of 52 Escherichia coli strains isolated from diarrhoeic rabbits were investigated for their enteropathogenic E. coli (EPEC) pathotype by PCR amplification of eae and bfp virulence genes. A total of 22 EPEC isolates were identified, serotyped and studied for antibiotic resistance and screened for the detection of extended-spectrum beta-lactamases (ESBLs). The EPEC isolates belonged to three serogroups (O26, O92 and O103). The most common serogroup (O103:K-:H2) was observed among 17 EPEC strains, the O92:K-serogroup in three isolates (the antibiotic sensitive ones) and the remaining O26:K-serogroup in two isolates (the ESBLs isolates). Resistances to ampicillin and tetracycline were the most frequent and detected followed by resistance to nalidixic acid, streptomycin, trimethoprim-sulphamethoxazole, cefoxitin, gentamicin and ciprofloxacin. All the isolates were sensitive for amikacin, ceftazidime, aztreonam, imipenem, chloramphenicol, tobramycin and amoxicillin + clavulanic acid. Two isolates recovered from two adult animals showed an intermediate susceptibility to cefotaxime, and a positive screening test for ESBL was demonstrated in both. The bla(TEM) gene was demonstrated in the majority of ampicillin-resistant isolates. The aac(3)-II or aac(3)-IV genes were detected in the four gentamicin-resistant isolates. In addition, the aadA gene was detected in 60% of streptomycin-resistant isolates. The tet(A) or tet(B) genes were identified in all tetracycline-resistant isolates. A total of nine EPEC isolates showed the phenotype SXT-resistant, and the sul1 and/or sul2 and/or sul3 genes were detected in all of them. Our findings showed that the molecular detection by the eae and bfp genes by PCR followed by serotyping is useful for monitoring trends in EPEC infections of rabbits allowing the identification of their possible reservoirs. The detection of genes involved in the resistance to antibiotics of different families in a relatively high proportion of faecal E

Molecular Scree ning of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae

Directory of Open Access Journals (Sweden)

Liang Yan

2017-01-01

Full Text Available Molecular screening of major rice blast resistance genes was determined with molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2, in a collection of 32 accessions resistant to Magnaporthe oryzae. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive express. As the second dominant, Pi-b and Piz-t gene frequencies were 96.9% and 87.5%. And Pik-h and Pik-p gene frequencies were 43.8% and 28.1%, respectively. The molecular marker linkage to Pi-ta2 produced positive bands in eleven accessions, while the molecular marker linkage to Pi-36 and Pi-37 in only three and four accessions, respectively. The natural field evaluation analysis showed that 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Infection types were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and Pik-p, although the correlation coefficients were very little. These results are useful in identification and incorporation of functional resistance genes from these germplasms into elite cultivars through marker-assisted selection for improved blast resistance in China and worldwide.

Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

Directory of Open Access Journals (Sweden)

Masayoshi Hashimoto

2016-10-01

Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

Quantification and characterization of β-lactam resistance genes in 15 sewage treatment plants from East Asia and North America.

Science.gov (United States)

Yang, Ying; Zhang, Tong; Zhang, Xu-Xiang; Liang, Da-Wei; Zhang, Ming; Gao, Da-Wen; Zhu, He-Guang; Huang, Qing-Guo; Fang, Herbert H P

2012-09-01

The emerging antibiotic resistance genes in the aquatic environment have aroused public concern. As β-lactam is the most widely used group of antibiotics, β-lactam resistance genes were selected to investigate their distribution and diversity in the activated sludge from 15 geographically different sewage treatment plants (STPs) of China, Singapore, USA, and Canada. Specific PCR and quantitative real-time PCR (q-PCR) were used to investigate the occurrence and abundance of nine β-lactam resistance genes. Five genes (OXA-1, OXA-2, OXA-10, ampC, and TEM-1) were detected in most of the sludge collected, while three genes (mecA, CTX-M-1, and SME) were not found in any sludge sample. The total abundances of the six detected β-lactam resistance genes in the 15 STPs varied from 5.34 × 10(1) copies/ng DNA (ampC) to 5.49 × 10(4) copies/ng DNA (OXA-1). Overall, OXA-1 had the highest total concentration, followed by IMP and OXA-10. Noticeably, the abundances of TEM-1 in Chinese STPs were generally higher than those in the STPs of other countries, while the abundances of OXA-2 and IMP in the STPs of North America were much greater than those of East Asia. A total of 78 clones carrying β-lactam resistance genes were randomly selected from six clone libraries for phylogenetic diversity analysis; the similarity of these cloned genes to known β-lactam resistance genes with sequence identities ranged from 96% to 100%. Furthermore, OXA-1, ampC, and IMP were found to be more diverse than the other β-lactam resistance genes.

Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria.

Science.gov (United States)

Adelowo, Olawale O; Fagade, Obasola E; Agersø, Yvonne

2014-09-12

This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), strB (61%), catA1 (25%), cmlA1 (13%), tetA (21%) and tetB (17%). Class 1 and 2 integrons were found in five (14%) and six (17%) isolates, respectively, while one isolate was positive for both classes of integrons. Seven out of eight isolates with resistance to ciprofloxacin and MIC ≤ 32 mg/L to nalidixic acid contained qnrS genes. Our findings provided additional evidence that the poultry production environment in Nigeria represents an important reservoir of antibiotic resistance genes such as qnrS that may spread from livestock production farms to human populations via manure and water.

Neofunctionalization of Duplicated P450 Genes Drives the Evolution of Insecticide Resistance in the Brown Planthopper.

Science.gov (United States)

Zimmer, Christoph T; Garrood, William T; Singh, Kumar Saurabh; Randall, Emma; Lueke, Bettina; Gutbrod, Oliver; Matthiesen, Svend; Kohler, Maxie; Nauen, Ralf; Davies, T G Emyr; Bass, Chris

2018-01-22

Gene duplication is a major source of genetic variation that has been shown to underpin the evolution of a wide range of adaptive traits [1, 2]. For example, duplication or amplification of genes encoding detoxification enzymes has been shown to play an important role in the evolution of insecticide resistance [3-5]. In this context, gene duplication performs an adaptive function as a result of its effects on gene dosage and not as a source of functional novelty [3, 6-8]. Here, we show that duplication and neofunctionalization of a cytochrome P450, CYP6ER1, led to the evolution of insecticide resistance in the brown planthopper. Considerable genetic variation was observed in the coding sequence of CYP6ER1 in populations of brown planthopper collected from across Asia, but just two sequence variants are highly overexpressed in resistant strains and metabolize imidacloprid. Both variants are characterized by profound amino-acid alterations in substrate recognition sites, and the introduction of these mutations into a susceptible P450 sequence is sufficient to confer resistance. CYP6ER1 is duplicated in resistant strains with individuals carrying paralogs with and without the gain-of-function mutations. Despite numerical parity in the genome, the susceptible and mutant copies exhibit marked asymmetry in their expression with the resistant paralogs overexpressed. In the primary resistance-conferring CYP6ER1 variant, this results from an extended region of novel sequence upstream of the gene that provides enhanced expression. Our findings illustrate the versatility of gene duplication in providing opportunities for functional and regulatory innovation during the evolution of an adaptive trait. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Characterization of Pm59, a novel powdery mildew resistance gene in Afghanistan wheat landrace PI 181356.

Science.gov (United States)

Tan, Chengcheng; Li, Genqiao; Cowger, Christina; Carver, Brett F; Xu, Xiangyang

2018-05-01

A new powdery mildew resistance gene, designated Pm59, was identified in Afghanistan wheat landrace PI 181356, and mapped in the terminal region of the long arm of chromosome 7A. Powdery mildew, caused by Blumeria graminis f. sp. tritici (Bgt), is an important foliar disease of wheat worldwide. In the Great Plains of the USA, Bgt isolates virulent to widely used powdery mildew resistance genes, such as Pm3a, were previously identified. The objectives of this study were to characterize the powdery mildew resistance gene in Afghanistan landrace PI 181356, which exhibited high resistance to Bgt isolates collected in southern Great Plains, and identify molecular markers for marker-assisted selection. An F 2 population and F 2:3 lines derived from a cross between PI 181356 and OK1059060-126135-3 were used in this study. Genetic analysis indicated that PI 181356 carries a single dominant gene, designated Pm59, in the terminal region of the long arm of chromosome 7A. Pm59 was mapped to an interval between sequence tag site (STS) markers Xmag1759 and Xmag1714 with genetic distances of 0.4 cM distal to Xmag1759 and 5.7 cM proximal to Xmag1714. Physical mapping suggested that Pm59 is in the distal bin 7AL 0.99-1.00. Pm59 is a novel powdery mildew resistance gene, and confers resistance to Bgt isolates collected from the Great Plains and the state of Montana. Therefore, Pm59 can be used to breed powdery mildew-resistant cultivars in these regions. Xmag1759 is ideal for marker-assisted selection of Pm59 in wheat breeding.

Marker-aided Incorporation of Xa38, a Novel Bacterial Blight Resistance Gene, in PB1121 and Comparison of its Resistance Spectrum with xa13 + Xa21.

Science.gov (United States)

Ellur, Ranjith K; Khanna, Apurva; S, Gopala Krishnan; Bhowmick, Prolay K; Vinod, K K; Nagarajan, M; Mondal, Kalyan K; Singh, Nagendra K; Singh, Kuldeep; Prabhu, Kumble Vinod; Singh, Ashok K

2016-07-11

Basmati rice is preferred internationally because of its appealing taste, mouth feel and aroma. Pusa Basmati 1121 (PB1121) is a widely grown variety known for its excellent grain and cooking quality in the international and domestic market. It contributes approximately USD 3 billion to India's forex earning annually by being the most traded variety. However, PB1121 is highly susceptible to bacterial blight (BB) disease. A novel BB resistance gene Xa38 was incorporated in PB1121 from donor parent PR114-Xa38 using a modified marker-assisted backcross breeding (MABB) scheme. Phenotypic selection prior to background selection was instrumental in identifying the novel recombinants with maximum recovery of recurrent parent phenome. The strategy was effective in delimiting the linkage drag to <0.5 mb upstream and <1.9 mb downstream of Xa38 with recurrent parent genome recovery upto 96.9% in the developed NILs. The NILs of PB1121 carrying Xa38 were compared with PB1121 NILs carrying xa13 + Xa21 (developed earlier in our lab) for their resistance to BB. Both NILs showed resistance against the Xoo races 1, 2, 3 and 6. Additionally, Xa38 also resisted Xoo race 5 to which xa13 + Xa21 was susceptible. The PB1121 NILs carrying Xa38 gene will provide effective control of BB in the Basmati growing region.

Gene expression analysis of two extensively drug-resistant tuberculosis isolates show that two-component response systems enhance drug resistance.

Science.gov (United States)

Yu, Guohua; Cui, Zhenling; Sun, Xian; Peng, Jinfu; Jiang, Jun; Wu, Wei; Huang, Wenhua; Chu, Kaili; Zhang, Lu; Ge, Baoxue; Li, Yao

2015-05-01

Global analysis of expression profiles using DNA microarrays was performed between a reference strain H37Rv and two clinical extensively drug-resistant isolates in response to three anti-tuberculosis drug exposures (isoniazid, capreomycin, and rifampicin). A deep analysis was then conducted using a combination of genome sequences of the resistant isolates, resistance information, and related public microarray data. Certain known resistance-associated gene sets were significantly overrepresented in upregulated genes in the resistant isolates relative to that observed in H37Rv, which suggested a link between resistance and expression levels of particular genes. In addition, isoniazid and capreomycin response genes, but not rifampicin, either obtained from published works or our data, were highly consistent with the differentially expressed genes of resistant isolates compared to those of H37Rv, indicating a strong association between drug resistance of the isolates and genes differentially regulated by isoniazid and capreomycin exposures. Based on these results, 92 genes of the studied isolates were identified as candidate resistance genes, 10 of which are known resistance-related genes. Regulatory network analysis of candidate resistance genes using published networks and literature mining showed that three two-component regulatory systems and regulator CRP play significant roles in the resistance of the isolates by mediating the production of essential envelope components. Finally, drug sensitivity testing indicated strong correlations between expression levels of these regulatory genes and sensitivity to multiple anti-tuberculosis drugs in Mycobacterium tuberculosis. These findings may provide novel insights into the mechanism underlying the emergence and development of drug resistance in resistant tuberculosis isolates and useful clues for further studies on this issue. Copyright © 2015 Elsevier Ltd. All rights reserved.

Occurrence of the mcr-1 Colistin Resistance Gene and other Clinically Relevant Antibiotic Resistance Genes in Microbial Populations at Different Municipal Wastewater Treatment Plants in Germany

Directory of Open Access Journals (Sweden)

Norman Hembach

2017-07-01

Full Text Available Seven wastewater treatment plants (WWTPs with different population equivalents and catchment areas were screened for the prevalence of the colistin resistance gene mcr-1 mediating resistance against last resort antibiotic polymyxin E. The abundance of the plasmid-associated mcr-1 gene in total microbial populations during water treatment processes was quantitatively analyzed by qPCR analyses. The presence of the colistin resistance gene was documented for all of the influent wastewater samples of the seven WWTPs. In some cases the mcr-1 resistance gene was also detected in effluent samples of the WWTPs after conventional treatment reaching the aquatic environment. In addition to the occurrence of mcr-1 gene, CTX-M-32, blaTEM, CTX-M, tetM, CMY-2, and ermB genes coding for clinically relevant antibiotic resistances were quantified in higher abundances in all WWTPs effluents. In parallel, the abundances of Acinetobacter baumannii, Klebsiella pneumoniae, and Escherichia coli were quantified via qPCR using specific taxonomic gene markers which were detected in all influent and effluent wastewaters in significant densities. Hence, opportunistic pathogens and clinically relevant antibiotic resistance genes in wastewaters of the analyzed WWTPs bear a risk of dissemination to the aquatic environment. Since many of the antibiotic resistance gene are associated with mobile genetic elements horizontal gene transfer during wastewater treatment can't be excluded.

The Use of a Combined Bioinformatics Approach to Locate Antibiotic Resistance Genes on Plasmids From Whole Genome Sequences of Salmonella enterica Serovars From Humans in Ghana

Directory of Open Access Journals (Sweden)

Egle Kudirkiene

2018-05-01

Full Text Available In the current study, we identified plasmids carrying antimicrobial resistance genes in draft whole genome sequences of 16 selected Salmonella enterica isolates representing six different serovars from humans in Ghana. The plasmids and the location of resistance genes in the genomes were predicted using a combination of PlasmidFinder, ResFinder, plasmidSPAdes and BLAST genomic analysis tools. Subsequently, S1-PFGE was employed for analysis of plasmid profiles. Whole genome sequencing confirmed the presence of antimicrobial resistance genes in Salmonella isolates showing multidrug resistance phenotypically. ESBL, either blaTEM52−B or blaCTX−M15 were present in two cephalosporin resistant isolates of S. Virchow and S. Poona, respectively. The systematic genome analysis revealed the presence of different plasmids in different serovars, with or without insertion of antimicrobial resistance genes. In S. Enteritidis, resistance genes were carried predominantly on plasmids of IncN type, in S. Typhimurium on plasmids of IncFII(S/IncFIB(S/IncQ1 type. In S. Virchow and in S. Poona, resistance genes were detected on plasmids of IncX1 and TrfA/IncHI2/IncHI2A type, respectively. The latter two plasmids were described for the first time in these serovars. The combination of genomic analytical tools allowed nearly full mapping of the resistance plasmids in all Salmonella strains analyzed. The results suggest that the improved analytical approach used in the current study may be used to identify plasmids that are specifically associated with resistance phenotypes in whole genome sequences. Such knowledge would allow the development of rapid multidrug resistance tracking tools in Salmonella populations using WGS.

Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

Science.gov (United States)

Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

2014-01-01

Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs) increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (psulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

Science.gov (United States)

Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

2017-07-01

The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Sponge microbiota are a reservoir of functional antibiotic resistance genes

Directory of Open Access Journals (Sweden)

Dennis Versluis

2016-11-01

Full Text Available Wide application of antibiotics has contributed to the evolution of multi-drug resistant human pathogens, resulting in poorer treatment outcomes for infections. In the marine environment, seawater samples have been investigated as a resistance reservoir; however, no studies have methodically examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional resistance genes in the sponges Aplysina aerophoba, Petrosia ficiformis and Corticium candelabrum. We obtained 37 insert sequences facilitating resistance to D-cycloserine (n=6, gentamicin (n=1, amikacin (n=7, trimethoprim (n=17, chloramphenicol (n=1, rifampicin (n=2 and ampicillin (n=3. Fifteen of 37 inserts harboured resistance genes that shared <90% amino acid identity with known gene products, whereas on 13 inserts no resistance gene could be identified with high confidence, in which case we predicted resistance to be mainly mediated by antibiotic efflux. One marine-specific ampicillin-resistance-conferring β-lactamase was identified in the genus Pseudovibrio with 41% global amino acid identity to the closest β-lactamase with demonstrated functionality, and subsequently classified into a new family termed PSV. Taken together, our results show that sponge microbiota host diverse and novel resistance genes that may be harnessed by phylogenetically distinct bacteria.

High-resolution mapping of the brown planthopper resistance gene Bph6 in rice and characterizing its resistance in the 9311 and Nipponbare near isogenic backgrounds.

Science.gov (United States)

Qiu, Yongfu; Guo, Jianping; Jing, Shengli; Zhu, Lili; He, Guangcun

2010-11-01

Brown planthopper (Nilaparvata lugens Stål, BPH) is one of the most destructive insect pests of rice. Exploring resistance genes from diverse germplasms and incorporating them into cultivated varieties are critical for controlling this insect. The rice variety Swarnalata was reported to carry a resistance gene (designated Bph6), which has not yet been assigned to a chromosome location and the resistance mechanism is still unknown. In this study, we identified and mapped this gene using the F(2) and backcrossing populations and characterized its resistance in indica 9311 and japonica Nipponbare using near isogenic lines (NILs). In analysis of 9311/Swarnalata F(2) population, the Bph6 gene was located on the long arm of chromosome 4 between the SSR markers RM6997 and RM5742. The gene was further mapped precisely to a 25-kb region delimited between the STS markers Y19 and Y9; and the distance between these markers is 25-kb in Nipponbare genome. The Bph6 explained 77.5% of the phenotypic variance of BPH resistance in F(2) population and 84.9% in BC(2)F(2) population. Allele from Swarnalata significantly increased resistance to the BPH, resulted in a reduced damage score. In characterization of Bph6-mediated resistance, the BPH insects showed significant preference between NIL-9311 and 9311 in 3 h and between NIL-NIP and Nipponbare in 120 h after release. BPH growth and development were inhibited, and the insect's survival rates were lower on Bph6-NIL plants, compared with the parents 9311 and Nipponbare. The results indicate that the Bph6 exerted prolonged antixenotic and antibiotic effects in Bph6-NIL plants, and NIL-9311 plants showed a quicker and stronger effect toward BPH than NIL-NIP plants.

Vancomycin-resistant enterococci with vanA gene in treated municipal wastewater and their association with human hospital strains.

Science.gov (United States)

Oravcova, Veronika; Mihalcin, Matus; Zakova, Jana; Pospisilova, Lucie; Masarikova, Martina; Literak, Ivan

2017-12-31

Vancomycin-resistant enterococci (VRE) are pathogens of increasing medical importance. In Brno, Czech Republic, we collected 37 samples from the effluent of a wastewater treatment plant (WWTP), 21 surface swabs from hospital settings, and 59 fecal samples from hospitalized patients and staff. Moreover, we collected 284 gull cloacal swabs from the colony situated 35km downstream the WWTP. Samples were cultured selectively. Enterococci were identified using MALDI-TOF MS, phenotypically tested for susceptibility to antibiotics, and by PCR for occurrence of resistance and virulence genes. Pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST) were used to examine genotypic diversity. VRE carrying the vanA gene were found in 32 (86%, n=37) wastewater samples, from which we obtained 49 isolates: Enterococcus faecium (44) and Enterococcus gallinarum (2), Enterococcus casseliflavus (2), and Enterococcus raffinosus (1). From 33 (69%) of 48 inpatient stool samples, we obtained 39 vanA-carrying VRE, which belonged to E. faecium (33 isolates), Enterococcus faecalis (4), and Enterococcus raffinosus (2). Nearly one-third of the samples from hospital surfaces contained VRE with the vanA gene. VRE were not detected among gulls. Sixty-seven (84%, n=80) E. faecium isolates carried virulence genes hyl and/or esp. Virulence of E. faecalis was encoded by gelE, asa1, and cylA genes. A majority of the E. faecium isolates belonged to the clinically important sequence types ST17 (WWTP: 10 isolates; hospital: 4 isolates), ST18 (9;8), and ST78 (5;0). The remaining isolates belonged to ST555 (2;0), ST262 (1;6), ST273 (3;0), ST275 (1;0), ST549 (2;0), ST19 (0;1), ST323 (3;0), and ST884 (7;17). Clinically important enterococci carrying the vanA gene were almost continually detectable in the effluent of the WWTP, indicating insufficient removal of VRE during wastewater treatment and permanent shedding of these antibiotic resistant pathogens into the environment from this

Enterobacteriaceae isolates carrying the New Delhi metallo-β-lactamase gene in Yemen.

Science.gov (United States)

Gharout-Sait, Alima; Alsharapy, Samer-Ahmed; Brasme, Lucien; Touati, Abdelaziz; Kermas, Rachida; Bakour, Sofiane; Guillard, Thomas; de Champs, Christophe

2014-10-01

Ten carbapenem-resistant Enterobacteriaceae (eight Klebsiella pneumoniae isolates and two Enterobacter cloacae) isolates from Yemen were investigated using in vitro antimicrobial susceptibility testing, phenotypic carbapenemase detection, multilocus sequence typing (MLST) and replicon typing. Carbapenemase, extended-spectrum β-lactamase (ESBL) and plasmid-mediated quinolone resistance determinant genes were identified using PCR and sequencing. All of the 10 carbapenem-resistant Enterobacteriaceae were resistant to β-lactams, tobramycin, ciprofloxacin and cotrimoxazole. Imipenem, doripenem and meropenem MICs ranged from 2 to >32 mg l(-1) and ertapenem MICs ranged from 6 to >32 mg l(-1). All of the K. pneumoniae isolates showed ESBL activity in phenotypic tests. Genes encoding blaNDM were detected in all strains. All K. pneumoniae strains produced CTX-M-15 ESBL and SHV β-lactamases. TEM-1 β-lactamase was detected in seven isolates. Nine isolates were qnr positive including QnrB1, QnrA1 and QnrS1, and six isolates produced AAC-6'-Ib-cr. MLST identified five different sequence types (STs): ST1399, ST147, ST29, ST405 and ST340. Replicon typing showed the presence of IncFII1K plasmids in four transformants. To the best of our knowledge, this is the first report of NDM-1-producing Enterobacteriaceae isolates in Yemen. © 2014 The Authors.

Trueperella pyogenes isolated from dairy cows with endometritis in Inner Mongolia, China: Tetracycline susceptibility and tetracycline-resistance gene distribution.

Science.gov (United States)

Zhang, Dexian; Zhao, Jingcui; Wang, Qiuxia; Liu, Yaochuan; Tian, Chunlian; Zhao, Yujun; Yu, Lihui; Liu, Mingchun

2017-04-01

Trueperella pyogenes plays a crucial role in endometritis pathogenesis and is also associated with many infections, including metritis, mastitis, arthritis and liver abscessation, in many domestic animals. In this study, we investigated the prevalence of tetracycline resistance in T. pyogenes isolated from dairy cows with endometritis in Inner Mongolia, China, and we assessed tetracycline-resistance gene distribution among the isolates. Our results indicated that 68.7% and 62.5% of the isolates were resistant to tetracycline and doxycycline, respectively, and the rate of resistance to metacycline was 18.8%. The tetracycline resistance gene tetK was present in all isolates (n = 32), whereas the tetM gene was identified in 12.5% and 9.4% of the isolates, in the chromosome and plasmid, respectively. Strains carrying tetW were also common in the chromosome and plasmid, with abundances of 53.1% and 46.9%, respectively. However, tetO and otrA were absent in all isolates. The resistance phenotype analysis indicated that 6.3% of strains were susceptible to all tetracyclines, while 3.1% showed resistance to all tetracyclines. Copyright © 2017 Elsevier Ltd. All rights reserved.

A Gene Homologous to rRNA Methylase Genes Confers Erythromycin and Clindamycin Resistance in Bifidobacterium breve.

Science.gov (United States)

Martínez, Noelia; Luque, Roberto; Milani, Christian; Ventura, Marco; Bañuelos, Oscar; Margolles, Abelardo

2018-05-15

Bifidobacteria are mutualistic intestinal bacteria, and their presence in the human gut has been associated with health-promoting activities. The presence of antibiotic resistance genes in this genus is controversial, since, although bifidobacteria are nonpathogenic microorganisms, they could serve as reservoirs of resistance determinants for intestinal pathogens. However, until now, few antibiotic resistance determinants have been functionally characterized in this genus. In this work, we show that Bifidobacterium breve CECT7263 displays atypical resistance to erythromycin and clindamycin. In order to delimit the genomic region responsible for the observed resistance phenotype, a library of genomic DNA was constructed and a fragment of 5.8 kb containing a gene homologous to rRNA methylase genes was able to confer erythromycin resistance in Escherichia coli This genomic region seems to be very uncommon, and homologs of the gene have been detected in only one strain of Bifidobacterium longum and two other strains of B. breve In this context, analysis of shotgun metagenomics data sets revealed that the gene is also uncommon in the microbiomes of adults and infants. The structural gene and its upstream region were cloned into a B. breve -sensitive strain, which became resistant after acquiring the genetic material. In vitro conjugation experiments did not allow us to detect gene transfer to other recipients. Nevertheless, prediction of genes potentially acquired through horizontal gene transfer events revealed that the gene is located in a putative genomic island. IMPORTANCE Bifidobacterium breve is a very common human intestinal bacterium. Often described as a pioneer microorganism in the establishment of early-life intestinal microbiota, its presence has been associated with several beneficial effects for the host, including immune stimulation and protection against infections. Therefore, some strains of this species are considered probiotics. In relation to this

Alteration of gene expression and DNA methylation in drug-resistant gastric cancer.

Science.gov (United States)

Maeda, Osamu; Ando, Takafumi; Ohmiya, Naoki; Ishiguro, Kazuhiro; Watanabe, Osamu; Miyahara, Ryoji; Hibi, Yoko; Nagai, Taku; Yamada, Kiyofumi; Goto, Hidemi

2014-04-01

The mechanisms of drug resistance in cancer are not fully elucidated. To study the drug resistance of gastric cancer, we analyzed gene expression and DNA methylation profiles of 5-fluorouracil (5-FU)- and cisplatin (CDDP)-resistant gastric cancer cells and biopsy specimens. Drug-resistant gastric cancer cells were established with culture for >10 months in a medium containing 5-FU or CDDP. Endoscopic biopsy specimens were obtained from gastric cancer patients who underwent chemotherapy with oral fluoropyrimidine S-1 and CDDP. Gene expression and DNA methylation analyses were performed using microarray, and validated using real-time PCR and pyrosequencing, respectively. Out of 17,933 genes, 541 genes commonly increased and 569 genes decreased in both 5-FU- and CDDP-resistant AGS cells. Genes with expression changed by drugs were related to GO term 'extracellular region' and 'p53 signaling pathway' in both 5-FU- and CDDP-treated cells. Expression of 15 genes including KLK13 increased and 12 genes including ETV7 decreased, in both drug-resistant cells and biopsy specimens of two patients after chemotherapy. Out of 10,365 genes evaluated with both expression microarray and methylation microarray, 74 genes were hypermethylated and downregulated, or hypomethylated and upregulated in either 5-FU-resistant or CDDP-resistant cells. Of these genes, expression of 21 genes including FSCN1, CPT1C and NOTCH3, increased from treatment with a demethylating agent. There are alterations of gene expression and DNA methylation in drug-resistant gastric cancer; they may be related to mechanisms of drug resistance and may be useful as biomarkers of gastric cancer drug sensitivity.

Concentration of facultative pathogenic bacteria and antibiotic resistance genes during sewage treatment and in receiving rivers.

Science.gov (United States)

Heß, Stefanie; Lüddeke, Frauke; Gallert, Claudia

2016-10-01

Whereas the hygienic condition of drinking and bathing water by law must be monitored by culture-based methods, for quantification of microbes and antibiotic resistance in soil or the aquatic environment, often molecular genetic assays are used. For comparison of both methods, knowledge of their correlation is necessary. Therefore the population of total bacteria, Escherichia coli, enterococci and staphylococci during sewage treatment and in receiving river water was compared by agar plating and quantitative polymerase chain reaction (qPCR) assays. In parallel, all samples were investigated for clinically relevant antibiotic resistance genes. Whereas plating and qPCR data for total bacteria correlated well in sewage after primary treatment, qPCR data of river water indicated higher cell numbers for E. coli. It is unknown if these cells are 'only' not growing under standard conditions or if they are dead. Corresponding to the amount of non-culturable cells, the 'breakpoints' for monitoring water quality should be adapted. The abundances of clinically relevant antibiotic resistance genes in river water were in the same order of magnitude or even higher than in treated sewage. For estimation of the health risk it is important to investigate which species carry respective genes and whether these genes are disseminated via gene transfer.

DETERMINATION OF THE SPECTRUM OF ANTIBIOTIC RESISTANCE GENES HAVE PHENOTYPIC RESISTANT STRAINS OF PARIETAL INTESTINAL MICROBIOTA IN RATS BY RT-PCR

Directory of Open Access Journals (Sweden)

Bukina Y.V.

2016-06-01

Full Text Available Introduction. The problem of formation of bacterial resistance to glycopeptides and beta-lactam antibiotics (cephalosporins and carbapenems are used worldwide for the treatment of severe community acquired and nosocomial infections, especially caused by polymicrobial flora has become global and is a major factor limiting the effectiveness of antibiotic therapy. In this regard, the study of genetic microbial resistance determinants allows not only to carry out an effective antibiotic therapy, but also to identify two main processes leading to the development of epidemiologically significant events: the introduction of the agent in the risk population from the outside and in situ pathogen (spontaneous genetic drift targeted restructuring of the population. Therefore, the aim of our study was to investigate the resistance genes to carbapenems, cephalosporins, glycopeptides have clinically important phenotype of resistant strains of microorganisms families Enterobacteriaceae, Pseudomonadaceae, Bacteroidaceae, Enterococcaceae, Peptostreptococcaceae. Materials and methods. As a material for PCR studies 712 phenotypically resistant strains of microorganisms isolated from 80 rats "Wistar" line in microbiological study microflora of the wall were used. During the investigation 474 isolates of bacteria of the family Enterobacteriaceae, 39 - Pseudomonadaceae, 71 - Bacteroidaceae, 96 - Enterococcaceae, 32 - Peptostreptococcaceae were studied. Isolation of DNA from bacteria in the study was performed using reagents "DNA-Express" ("Litekh", Russia. For the detection of resistance genes by PCR in real time (RT-PCR reagent kits "FLUOROPOL-RV" ("Litekh", Russia were used. During the experiment, the VIM genes, OXA-48, NDM, KPC, responsible for the resistance of microorganisms to carbapenems, CTX-M - resistance to cephalosporins, as well as genes Van A and van B, the development of resistance to glycopeptides (vancomycin and teicoplanin were determined. Analysis

[Severe type A insulin resistance syndrome due to a mutation in the insulin receptor gene].

Science.gov (United States)

Ros, P; Colino-Alcol, E; Grasso, V; Barbetti, F; Argente, J

2015-01-01

Insulin resistance syndromes without lipodystrophy are an infrequent and heterogeneous group of disorders with variable clinical phenotypes, associated with hyperglycemia and hyperinsulinemia. The three conditions related to mutations in the insulin receptor gene are leprechaunism or Donohue syndrome, Rabson-Mendenhall syndrome, and Type A syndrome. A case is presented on a patient diagnosed with type A insulin resistance, defined by the triad of extreme insulin resistance, acanthosis nigricans, and hyperandrogenism, carrying a heterozygous mutation in exon 19 of the insulin receptor gene coding for its tyrosine kinase domain that is crucial for the catalytic activity of the receptor. The molecular basis of the syndrome is reviewed, focusing on the structure-function relationships of the insulin receptor, knowing that the criteria for survival are linked to residual insulin receptor function. It is also pointed out that, although type A insulin resistance appears to represent a somewhat less severe condition, these patients have a high morbidity and their treatment is still unsatisfactory. Copyright © 2014 Asociación Española de Pediatría. Published by Elsevier Espana. All rights reserved.

Obesity genes and insulin resistance.

Science.gov (United States)

Belkina, Anna C; Denis, Gerald V

2010-10-01

The exploding prevalence of insulin resistance and Type 2 diabetes (T2D) linked to obesity has become an alarming public health concern. Worldwide, approximately 171 million people suffer from obesity-induced diabetes and public health authorities expect this situation to deteriorate rapidly. An interesting clinical population of 'metabolically healthy but obese' (MHO) cases is relatively protected from T2D and its associated cardiovascular risk. The molecular basis for this protection is not well understood but is likely to involve reduced inflammatory responses. The inflammatory cells and pathways that respond to overnutrition are the primary subject matter for this review. The chance discovery of a genetic mutation in the Brd2 gene, which is located in the class II major histocompatibility complex and makes mice enormously fat but protects them from diabetes, offers revolutionary new insights into the cellular mechanisms that link obesity to insulin resistance and T2D. These Brd2-hypomorphic mice have reduced inflammation in fat that is normally associated with insulin resistance, and resemble MHO patients, suggesting novel therapeutic pathways for obese patients at risk for T2D. Deeper understanding of the functional links between genes that control inflammatory responses to diet-induced obesity is crucial to the development of therapies for obese, insulin-resistant patients.

DNA tagging of blast resistant gene(s in three Brazilian rice cultivars

Directory of Open Access Journals (Sweden)

S.S. Sandhu

2003-12-01

Full Text Available Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.. Seven randomly amplified polymorphic DNA (RAPD markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000, OPA5(1200, OPG17(700, OPG18(850, OPG19(500, OPG19(600, OPF9(600, OPF17(1200 and OPF19(600 were identified as dominant markers for the blast resistant gene in resistant cultivar lines. These loci facilitate the indirect scoring of blast resistant and blast susceptible genotypes. The codomine RAPDs markers will facilitate marker-assisted selection of the blast resistant gene in two blast resistant genotypes of rice (Labelle and Line 11 and will be useful in rice breeding programs.

Marker-aided Incorporation of Xa38, a Novel Bacterial Blight Resistance Gene, in PB1121 and Comparison of its Resistance Spectrum with xa13 + Xa21

Science.gov (United States)

Ellur, Ranjith K.; Khanna, Apurva; S, Gopala Krishnan.; Bhowmick, Prolay K.; Vinod, K. K.; Nagarajan, M.; Mondal, Kalyan K.; Singh, Nagendra K.; Singh, Kuldeep; Prabhu, Kumble Vinod; Singh, Ashok K.

2016-01-01

Basmati rice is preferred internationally because of its appealing taste, mouth feel and aroma. Pusa Basmati 1121 (PB1121) is a widely grown variety known for its excellent grain and cooking quality in the international and domestic market. It contributes approximately USD 3 billion to India’s forex earning annually by being the most traded variety. However, PB1121 is highly susceptible to bacterial blight (BB) disease. A novel BB resistance gene Xa38 was incorporated in PB1121 from donor parent PR114-Xa38 using a modified marker-assisted backcross breeding (MABB) scheme. Phenotypic selection prior to background selection was instrumental in identifying the novel recombinants with maximum recovery of recurrent parent phenome. The strategy was effective in delimiting the linkage drag to <0.5 mb upstream and <1.9 mb downstream of Xa38 with recurrent parent genome recovery upto 96.9% in the developed NILs. The NILs of PB1121 carrying Xa38 were compared with PB1121 NILs carrying xa13 + Xa21 (developed earlier in our lab) for their resistance to BB. Both NILs showed resistance against the Xoo races 1, 2, 3 and 6. Additionally, Xa38 also resisted Xoo race 5 to which xa13 + Xa21 was susceptible. The PB1121 NILs carrying Xa38 gene will provide effective control of BB in the Basmati growing region. PMID:27403778

Deletion analysis of the expression of rRNA genes and associated tRNA genes carried by a lambda transducing bacteriophage

International Nuclear Information System (INIS)

Morgan, E.A.; Nomura, M.

1979-01-01

Transducing phage lambda ilv5 carries genes for rRNA's, spacer tRNA's (tRNA 1 /sup Ile/ and tRNA/sub 1B//sup Ala/), and two other tRNA's (tRNA 1 /sup Asp/ and tRNA/sup Trp/). We have isolated a mutant of lambda ilv5, lambda ilv5su7, which carries an amber suppressor mutation in the tRNA/sup Trp/ gene. A series of deletion mutants were isolated from the lambda ilv5su7 phage. Genetic and biochemical analyses of these deletion mutants have confirmed our previous conclusion that the genes for tRNA 1 /sup Asp/ and tRNA/sup Trp/ located at the distal end of the rRNA operon (rrnC) are cotranscribed with other rRNA genes in that operon. In addition, these deletions were used to define roughly the physical location of the promoter(s) of the rRNA operon carried by the lambda ilv5su7 transducing phage

Mutations in DNA repair genes are associated with the Haarlem lineage of Mycobacterium tuberculosis independently of their antibiotic resistance.

Science.gov (United States)

Olano, Juanita; López, Beatriz; Reyes, Alejandro; Lemos, María del Pilar; Correa, Nidia; Del Portillo, Patricia; Barrera, Lucia; Robledo, Jaime; Ritacco, Viviana; Zambrano, María Mercedes

2007-11-01

The analysis of the DNA repair genes ogt and ung was carried out in 117 Mycobacterium tuberculosis clinical isolates from Argentina and Colombia in order to explore correlation between mutations in these genes and multi-drug resistance. With the exception of two Beijing family isolates, the rest of the strains harbored either two wild-type or two mutant alleles with identical single nucleotide polymorphisms (SNPs) in each gene (ogt44 and ung501). These ogt44 and ung501 mutations were not associated with multi-drug resistance and occurred simultaneously in circulating Haarlem genotype M. tuberculosis strains. We therefore propose the use of these markers as tools in phylogenetic and epidemiologic studies.

Study on drug resistance of mycobacterium tuberculosis in patients with pulmonary tuberculosis by drug resistance gene detecting

International Nuclear Information System (INIS)

Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing

2004-01-01

To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)

Clusters of Antibiotic Resistance Genes Enriched Together Stay Together in Swine Agriculture.

Science.gov (United States)

Johnson, Timothy A; Stedtfeld, Robert D; Wang, Qiong; Cole, James R; Hashsham, Syed A; Looft, Torey; Zhu, Yong-Guan; Tiedje, James M

2016-04-12

Antibiotic resistance is a worldwide health risk, but the influence of animal agriculture on the genetic context and enrichment of individual antibiotic resistance alleles remains unclear. Using quantitative PCR followed by amplicon sequencing, we quantified and sequenced 44 genes related to antibiotic resistance, mobile genetic elements, and bacterial phylogeny in microbiomes from U.S. laboratory swine and from swine farms from three Chinese regions. We identified highly abundant resistance clusters: groups of resistance and mobile genetic element alleles that cooccur. For example, the abundance of genes conferring resistance to six classes of antibiotics together with class 1 integrase and the abundance of IS6100-type transposons in three Chinese regions are directly correlated. These resistance cluster genes likely colocalize in microbial genomes in the farms. Resistance cluster alleles were dramatically enriched (up to 1 to 10% as abundant as 16S rRNA) and indicate that multidrug-resistant bacteria are likely the norm rather than an exception in these communities. This enrichment largely occurred independently of phylogenetic composition; thus, resistance clusters are likely present in many bacterial taxa. Furthermore, resistance clusters contain resistance genes that confer resistance to antibiotics independently of their particular use on the farms. Selection for these clusters is likely due to the use of only a subset of the broad range of chemicals to which the clusters confer resistance. The scale of animal agriculture and its wastes, the enrichment and horizontal gene transfer potential of the clusters, and the vicinity of large human populations suggest that managing this resistance reservoir is important for minimizing human risk. Agricultural antibiotic use results in clusters of cooccurring resistance genes that together confer resistance to multiple antibiotics. The use of a single antibiotic could select for an entire suite of resistance genes if

Mapping and marker-assisted selection of a brown planthopper resistance gene bph2 in rice (Oryza sativa L.).

Science.gov (United States)

Sun, Li-Hong; Wang, Chun-Ming; Su, Chang-Chao; Liu, Yu-Qiang; Zhai, Hu-Qu; Wan, Jian-Min

2006-08-01

Nilaparvata lugens Stål (brown planthopper, BPH), is one of the major insect pests of rice (Oryza sativa L.) in the temperate rice-growing region. In this study, ASD7 harboring a BPH resistance gene bph2 was crossed to a susceptible cultivar C418, a japonica restorer line. BPH resistance was evaluated using 134 F2:3 lines derived from the cross between "ASD7" and "C418". SSR assay and linkage analysis were carried out to detect bph2. As a result, the resistant gene bph2 in ASD7 was successfully mapped between RM7102 and RM463 on the long arm of chromosome 12, with distances of 7.6 cM and 7.2 cM, respectively. Meanwhile, both phenotypic selection and marker-assisted selection (MAS) were conducted in the BC1F1 and BC2F1 populations. Selection efficiencies of RM7102 and RM463 were determined to be 89.9% and 91.2%, respectively. It would be very beneficial for BPH resistance improvement by using MAS of this gene.

Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter.

Science.gov (United States)

Li, Lili; Heidemann Olsen, Rikke; Ye, Lei; Yan, He; Nie, Qing; Meng, Hecheng; Shi, Lei

2016-04-01

The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across species, genes conferring antimicrobial resistance were observed with the following frequencies: blaTEM, 40.7%; blaCMY-2, 15.2%; blaCTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%; tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial resistance genes were found in new carriers: blaTEM in Lactococcus garvieae, Myroides odoratimimus, Aeromonas hydrophila, Staphylococcus sciuri, Raoultella terrigena, Macrococcus caseolyticus, Acinetobacter ursingii, Sphingobacterium sp., and Oceanobacillus sp.; blaCMY-2 in Lactococcus lactis, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, and Myroides phaeus; tet(L) in M. caseolyticus; sul1 in Vibrio cincinnatiensis; sul2 in Acinetobacter bereziniae, Acinetobacter johnsonii, and V. cincinnatiensis; and the class 1 integron and gene cassette aadA2 in V. cincinnatiensis. Approximately 6.6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor- encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance of aerobic bacteria from pork as reservoirs for antimicrobial resistance genes and mobile genetic elements that can readily be transferred intra- and interspecies.

A maize resistance gene functions against bacterial streak disease in rice.

Science.gov (United States)

Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

2005-10-25

Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, which causes bacterial streak disease. Bacterial streak is an important disease of rice in Asia, and no simply inherited sources of resistance have been identified in rice. Although X. o. pv. oryzicola does not cause disease on maize, we identified a maize gene, Rxo1, that conditions a resistance reaction to a diverse collection of pathogen strains. Surprisingly, Rxo1 also controls resistance to the unrelated pathogen Burkholderia andropogonis, which causes bacterial stripe of sorghum and maize. The same gene thus controls resistance reactions to both pathogens and nonpathogens of maize. Rxo1 has a nucleotide-binding site-leucine-rich repeat structure, similar to many previously identified R genes. Most importantly, Rxo1 functions after transfer as a transgene to rice, demonstrating the feasibility of nonhost R gene transfer between cereals and providing a valuable tool for controlling bacterial streak disease.

Identifying clinically relevant drug resistance genes in drug-induced resistant cancer cell lines and post-chemotherapy tissues.

Science.gov (United States)

Tong, Mengsha; Zheng, Weicheng; Lu, Xingrong; Ao, Lu; Li, Xiangyu; Guan, Qingzhou; Cai, Hao; Li, Mengyao; Yan, Haidan; Guo, You; Chi, Pan; Guo, Zheng

2015-12-01

Until recently, few molecular signatures of drug resistance identified in drug-induced resistant cancer cell models can be translated into clinical practice. Here, we defined differentially expressed genes (DEGs) between pre-chemotherapy colorectal cancer (CRC) tissue samples of non-responders and responders for 5-fluorouracil and oxaliplatin-based therapy as clinically relevant drug resistance genes (CRG5-FU/L-OHP). Taking CRG5-FU/L-OHP as reference, we evaluated the clinical relevance of several types of genes derived from HCT116 CRC cells with resistance to 5-fluorouracil and oxaliplatin, respectively. The results revealed that DEGs between parental and resistant cells, when both were treated with the corresponding drug for a certain time, were significantly consistent with the CRG5-FU/L-OHP as well as the DEGs between the post-chemotherapy CRC specimens of responders and non-responders. This study suggests a novel strategy to extract clinically relevant drug resistance genes from both drug-induced resistant cell models and post-chemotherapy cancer tissue specimens.

Pediatric fecal microbiota harbor diverse and novel antibiotic resistance genes.

Directory of Open Access Journals (Sweden)

Aimée M Moore

Full Text Available Emerging antibiotic resistance threatens human health. Gut microbes are an epidemiologically important reservoir of resistance genes (resistome, yet prior studies indicate that the true diversity of gut-associated resistomes has been underestimated. To deeply characterize the pediatric gut-associated resistome, we created metagenomic recombinant libraries in an Escherichia coli host using fecal DNA from 22 healthy infants and children (most without recent antibiotic exposure, and performed functional selections for resistance to 18 antibiotics from eight drug classes. Resistance-conferring DNA fragments were sequenced (Illumina HiSeq 2000, and reads assembled and annotated with the PARFuMS computational pipeline. Resistance to 14 of the 18 antibiotics was found in stools of infants and children. Recovered genes included chloramphenicol acetyltransferases, drug-resistant dihydrofolate reductases, rRNA methyltransferases, transcriptional regulators, multidrug efflux pumps, and every major class of beta-lactamase, aminoglycoside-modifying enzyme, and tetracycline resistance protein. Many resistance-conferring sequences were mobilizable; some had low identity to any known organism, emphasizing cryptic organisms as potentially important resistance reservoirs. We functionally confirmed three novel resistance genes, including a 16S rRNA methylase conferring aminoglycoside resistance, and two tetracycline-resistance proteins nearly identical to a bifidobacterial MFS transporter (B. longum s. longum JDM301. We provide the first report to our knowledge of resistance to folate-synthesis inhibitors conferred by a predicted Nudix hydrolase (part of the folate synthesis pathway. This functional metagenomic survey of gut-associated resistomes, the largest of its kind to date, demonstrates that fecal resistomes of healthy children are far more diverse than previously suspected, that clinically relevant resistance genes are present even without recent selective

Fine Physical Bin Mapping of the Powdery Mildew Resistance Gene Pm21 Based on Chromosomal Structural Variations in Wheat

Directory of Open Access Journals (Sweden)

Shanying Zhu

2018-02-01

Full Text Available Pm21, derived from wheat wild relative Dasypyrum villosum, is one of the most effective powdery mildew resistance genes and has been widely applied in wheat breeding in China. Mapping and cloning Pm21 are of importance for understanding its resistance mechanism. In the present study, physical mapping was performed using different genetic stocks involving in structural variations of chromosome 6VS carrying Pm21. The data showed that 6VS could be divided into eight distinguishable chromosomal bins, and Pm21 was mapped to the bin FLb4–b5/b6 closely flanked by the markers 6VS-08.6 and 6VS-10.2. Comparative genomic mapping indicated that the orthologous regions of FLb4–b5/b6 carrying Pm21 were narrowed to a 117.7 kb genomic region harboring 19 genes in Brachypodium and a 37.7 kb region harboring 5 genes in rice, respectively. The result was consistent with that given by recent genetic mapping in diploid D. villosum. In conclusion, this study demonstrated that physical mapping based on chromosomal structural variations is an efficient method for locating alien genes in wheat background.

Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

Directory of Open Access Journals (Sweden)

Na Wang

Full Text Available Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (p<0.05. The combination of sul1 and sul2 was the most frequent, and the co-existence of sul1 and sul3 was not found either in the genomic DNA or plasmids. The sample type, animal type and sampling time can influence the prevalence and distribution pattern of sulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

Gateway binary vectors with the bialaphos resistance gene, bar, as a selection marker for plant transformation.

Science.gov (United States)

Nakamura, Shinya; Mano, Shoji; Tanaka, Yuji; Ohnishi, Masato; Nakamori, Chihiro; Araki, Masami; Niwa, Tomoko; Nishimura, Mikio; Kaminaka, Hironori; Nakagawa, Tsuyoshi; Sato, Yutaka; Ishiguro, Sumie

2010-01-01

We constructed two series of Gateway binary vectors, pGWBs and R4pGWBs, possessing the bialaphos resistance gene (bar) as a selection marker for plant transformation. The reporters and tags employed in this system are sGFP, GUS, LUC, EYFP, ECFP, G3GFP, mRFP, TagRFP, 6xHis, FLAG, 3xHA, 4xMyc, 10xMyc, GST, T7 and TAP. Selection of Arabidopsis transformants with BASTA was successfully carried out using both plate-grown and soil-grown seedlings. Transformed rice calli and suspension-cultured tobacco cells were selected on plates containing BASTA or glufosinate-ammonium. These vectors are compatible with existing pGWB and R4pGWB vectors carrying kanamycin and hygromycin B resistance.

Overexpression of antibiotic resistance genes in hospital effluents over time.

Science.gov (United States)

Rowe, Will P M; Baker-Austin, Craig; Verner-Jeffreys, David W; Ryan, Jim J; Micallef, Christianne; Maskell, Duncan J; Pearce, Gareth P

2017-06-01

Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varying antibiotic usage to the receiving environment. Gene abundance in effluents (municipal hospital and dairy farm) was compared against background samples of the receiving aquatic environment (i.e. the catchment source) to determine the resistome contribution of effluents. We used metagenomics and metatranscriptomics to correlate DNA and RNA abundance and identified differentially regulated gene transcripts. We found that mean antibiotic resistance gene and transcript abundances were correlated for both hospital ( ρ  = 0.9, two-tailed P  hospital effluent samples. High β-lactam resistance gene transcript abundance was related to hospital antibiotic usage over time and hospital effluents contained antibiotic residues. We conclude that effluents contribute high levels of antibiotic resistance genes to the aquatic environment; these genes are expressed at significant levels and are possibly related to the level of antibiotic usage at the effluent source. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

Gene Profiling in Late Blight Resistance in Potato Genotype SD20

Directory of Open Access Journals (Sweden)

Xiaohui Yang

2018-06-01

Full Text Available Late blight caused by the oomycete fungus Phytophthora infestans (Pi is the most serious obstacle to potato (Solanum tuberosum production in the world. A super race isolate, CN152, which was identified from Sichuan Province, China, could overcome nearly all known late blight resistance genes and caused serious damage in China. The potato genotype SD20 was verified to be highly resistant to CN152; however, the molecular regulation network underlying late blight resistance pathway remains unclear in SD20. Here, we performed a time-course experiment to systematically profile the late blight resistance response genes using RNA-sequencing in SD20. We identified 3354 differentially expressed genes (DEGs, which mainly encoded transcription factors and protein kinases, and also included four NBS-LRR genes. The late blight responsive genes showed time-point-specific induction/repression. Multi-signaling pathways of salicylic acid, jasmonic acid, and ethylene signaling pathways involved in resistance and defense against Pi in SD20. Gene Ontology and KEGG analyses indicated that the DEGs were significantly enriched in metabolic process, protein serine/threonine kinase activity, and biosynthesis of secondary metabolites. Forty-three DEGs were involved in immune response, of which 19 were enriched in hypersensitive response reaction, which could play an important role in broad-spectrum resistance to Pi infection. Experimental verification confirmed the induced expression of the responsive genes in the late blight resistance signaling pathway, such as WRKY, ERF, MAPK, and NBS-LRR family genes. Our results provided valuable information for understanding late blight resistance mechanism of potato.

The construction and use of versatile binary vectors carrying pyrG auxotrophic marker and fluorescent reporter genes for Agrobacterium-mediated transformation of Aspergillus oryzae.

Science.gov (United States)

Nguyen, Khuyen Thi; Ho, Quynh Ngoc; Pham, Thu Ha; Phan, Tuan-Nghia; Tran, Van-Tuan

2016-12-01

Aspergillus oryzae is a safe mold widely used in food industry. It is also considered as a microbial cell factory for production of recombinant proteins and enzymes. Currently, genetic manipulation of filamentous fungi is achieved via Agrobacterium tumefaciens-mediated transformation methods usually employing antibiotic resistance markers. These methods are hardly usable for A. oryzae due to its strong resistance to the common antifungal compounds used for fungal transformation. In this study, we have constructed two binary vectors carrying the pyrG gene from A. oryzae as a biochemical marker than an antibiotic resistance marker, and an expression cassette for GFP or DsRed reporter gene under control of the constitutive gpdA promoter from Aspergillus nidulans. All components of these vectors are changeable to generate new versions for specific research purposes. The developed vectors are fully functional for heterologous expression of the GFP and DsRed fluorescent proteins in the uridine/uracil auxotrophic A. oryzae strain. Our study provides a new approach for A. oryzae transformation using pyrG as the selectable auxotrophic marker, A. tumefaciens as the DNA transfer tool and fungal spores as the transformation material. The binary vectors constructed can be used for gene expression studies in this industrially important filamentous fungus.

Pyrethroid Resistance in Malaysian Populations of Dengue Vector Aedes aegypti Is Mediated by CYP9 Family of Cytochrome P450 Genes.

Science.gov (United States)

Ishak, Intan H; Kamgang, Basile; Ibrahim, Sulaiman S; Riveron, Jacob M; Irving, Helen; Wondji, Charles S

2017-01-01

Dengue control and prevention rely heavily on insecticide-based interventions. However, insecticide resistance in the dengue vector Aedes aegypti, threatens the continued effectiveness of these tools. The molecular basis of the resistance remains uncharacterised in many endemic countries including Malaysia, preventing the design of evidence-based resistance management. Here, we investigated the underlying molecular basis of multiple insecticide resistance in Ae. aegypti populations across Malaysia detecting the major genes driving the metabolic resistance. Genome-wide microarray-based transcription analysis was carried out to detect the genes associated with metabolic resistance in these populations. Comparisons of the susceptible New Orleans strain to three non-exposed multiple insecticide resistant field strains; Penang, Kuala Lumpur and Kota Bharu detected 2605, 1480 and 425 differentially expressed transcripts respectively (fold-change>2 and p-value ≤ 0.05). 204 genes were commonly over-expressed with monooxygenase P450 genes (CYP9J27, CYP6CB1, CYP9J26 and CYP9M4) consistently the most up-regulated detoxification genes in all populations, indicating that they possibly play an important role in the resistance. In addition, glutathione S-transferases, carboxylesterases and other gene families commonly associated with insecticide resistance were also over-expressed. Gene Ontology (GO) enrichment analysis indicated an over-representation of GO terms linked to resistance such as monooxygenases, carboxylesterases, glutathione S-transferases and heme-binding. Polymorphism analysis of CYP9J27 sequences revealed a high level of polymorphism (except in Joho Bharu), suggesting a limited directional selection on this gene. In silico analysis of CYP9J27 activity through modelling and docking simulations suggested that this gene is involved in the multiple resistance in Malaysian populations as it is predicted to metabolise pyrethroids, DDT and bendiocarb. The predominant

Sulfonamide-Resistant Bacteria and Their Resistance Genes in Soils Fertilized with Manures from Jiangsu Province, Southeastern China

OpenAIRE

Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

2014-01-01

Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of a...

AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA

Directory of Open Access Journals (Sweden)

Bertinellys TEIXEIRA

2016-01-01

Full Text Available The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC, aminoglycoside-adenyltransferases (AAD, and aminoglycoside-phosphotransferases (APH, is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137 were identified from the Intensive Care Unit (ICU, mainly from discharges (96/137. The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively. Phenotype VI, resistant to these antibiotics, was the most frequent (14/49, followed by phenotype I, resistant to all the aminoglycosides tested (12/49. The aac(6´-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA.

Science.gov (United States)

Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos

2016-01-01

The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

Expression Analysis of Multiple Genes May Involve in Antimony Resistance among Leishmania major Clinical Isolates from Fars Province, Central Iran

Directory of Open Access Journals (Sweden)

Nafiseh GHOBAKHLOO

2016-10-01

Full Text Available Background: Treatment of Cutaneous Leishmaniasis (CL is being faced with serious difficulties in Fars Province, due to emerging of resistance against meglumine antimonite (Glucantime®. In this context, determining some biomarkers for drug sensitivity monitoring seems to be highly essential. Different studies have been carried out to decipher the genes might be involved in antimony resistant phenotype in Leishmania spp. Here, we selected three genes: AQP (as drug transporter, TDR-1-1(as drug activator, and γ-GCS (inducing reduction environment for comparative expression analysis on clinical resistant and sensitive isolates of L. major.Methods: The clinical isolates of L. major were collected from CL patients referred to Valfajr Health Center, Shiraz from Oct 2011 to Feb 2012. The susceptibility test was performed to confirm drug sensitivity of strains in vitro as well. Then, the gene expression analysis was performed by quantitative real-time PCR using SYBR® Green.Results: By comparison of expression level between strains, up regulation of γ-GCS gene and down regulation of AQP gene were observed in resistant strains compared to the sensitive isolates; however, down regulation of AQP was not statistically specific. Analysis of TDR-1-1 gene unexpectedly showed a high level of expression in the non-responsive cases.Conclusion: The γ-GCS, at least, can be considered as a suitable molecular marker for screening antimony sensitivity in clinical isolates, although AQP and TDR-1-1gene seem not to be reliable resistant markers. 

Tagging and mapping of SSR marker for rust resistance gene in lentil (Lens culinaris Medikus subsp. culinaris).

Science.gov (United States)

Dikshit, H K; Singh, Akanksha; Singh, D; Aski, M; Jain, Neelu; Hegde, V S; Basandrai, A K; Basandrai, D; Sharma, T R

2016-06-01

Lentil, as an economical source of protein, minerals and vitamins, plays important role in nutritional security of the common man. Grown mainly in West Asia, North Africa (WANA) region and South Asia, it suffers from several biotic stresses such as wilt, rust, blight and broomrape. Lentil rust caused by autoecious fungus Uromyces viciae fabae (Pers.) Schroet is a serious lentil disease in Algeria, Bangladesh, Ethiopia, India, Italy, Morocco, Pakistan and Nepal. The disease symptoms are observed during flowering and early podding stages. Rust causes severe yield losses in lentil. It can only be effectively controlled by identifying the resistant source, understanding its inheritance and breeding for host resistance. The obligate parasitic nature of pathogen makes it difficult to maintain the pathogen in culture and to apply it to screen segregating progenies under controlled growth conditions. Hence, the use of molecular markers will compliment in identification of resistant types in different breeding programs. Here, we studied the inheritance of resistance to rust in lentil using F₁, F₂ and F₂:₃ from cross PL 8 (susceptible) x L 4149 (resistant) varieties. The phenotyping of lentil population was carried out at Sirmour, India. The result of genetic analysis revealed that a single dominant gene controls rust resistance in lentil genotype L 4149. The F2 population from this cross was used to tag and map the rust resistance gene using SSR and SRAP markers. Markers such as 270 SRAP and 162 SSR were studied for polymorphism and 101 SRAP and 33 SSRs were found to be polymorphic between the parents. Two SRAP and two SSR markers differentiated the resistant and susceptible bulks. SSR marker Gllc 527 was estimated to be linked to rust resistant locus at a distance of 5.9 cM. The Gllc 527 marker can be used for marker assisted selection for rust resistance; however, additional markers closer to rust resistant locus are required. The markers linked to the rust

Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters.

Science.gov (United States)

Miller, Jennifer H; Novak, John T; Knocke, William R; Pruden, Amy

2016-01-01

Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1-a Pseudomonas sp.) and thermophilic (Iso T10-a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457-0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130-0.486, P = 0.075-0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene

Molecular detection of disease resistance genes to powdery mildew ...

African Journals Online (AJOL)

A study was conducted to detect the presence of disease resistance genes to infection of wheat powdery mildew (Blumeria graminis f. sp. tritici) in selected wheat cultivars from China using molecular markers. Genomic DNA of sixty cultivars was extracted and tested for the presence of selected prominent resistance genes to ...

Gene Expression Analysis of Four Radiation-resistant Bacteria

OpenAIRE

Gao, Na; Ma, Bin-Guang; Zhang, Yu-Sheng; Song, Qin; Chen, Ling-Ling; Zhang, Hong-Yu

2009-01-01

To investigate the general radiation-resistant mechanisms of bacteria, bioinformatic method was employed to predict highly expressed genes for four radiation-resistant bacteria, i.e. Deinococcus geothermalis (D. geo), Deinococcus radiodurans (D. rad), Kineococcus radiotolerans (K. rad) and Rubrobacter xylanophilus (R. xyl). It is revealed that most of the three reference gene sets, i.e. ribosomal proteins, transcription factors and major chaperones, are generally highly expressed in the four ...

Carrying photosynthesis genes increases ecological fitness of cyanophage in silico.

Science.gov (United States)

Hellweger, Ferdi L

2009-06-01

Several viruses infecting marine cyanobacteria carry photosynthesis genes (e.g. psbA, hli) that are expressed, yield proteins (D1, HLIP) and help maintain the cell's photosynthesis apparatus during the latent period. This increases energy and speeds up virus production, allowing for a reduced latent period (a fitness benefit), but it also increases the DNA size, which slows down new virus production and reduces burst size (a fitness cost). How do these genes affect the net ecological fitness of the virus? Here, this question is explored using a combined systems biology and systems ecology ('systems bioecology') approach. A novel agent-based model simulates individual cyanobacteria cells and virus particles, each with their own genes, transcripts, proteins and other properties. The effect of D1 and HLIP proteins is explicitly considered using a mechanistic photosynthesis component. The model is calibrated to the available database for Prochlorococcus ecotype MED4 and podovirus P-SSP7. Laboratory- and field-scale in silico survival, competition and evolution (gene packaging error) experiments with wild type and genetically engineered viruses are performed to develop vertical survival and fitness profiles, and to determine the optimal gene content. The results suggest that photosynthesis genes are nonessential, increase fitness in a manner correlated with irradiance, and that the wild type has an optimal gene content.

Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

African Journals Online (AJOL)

SERVER

2008-02-19

Feb 19, 2008 ... plasmodiophoride-like fungus, Polymyxa betae Keskin. (1964) (Tamada and Richard, 1992). Source of resistance to rhizomania were found in Holly sugar beet company source (Lewellen, 1987). Resistance in Holly is simply inherited by a single dominant gene(Rz1). (Lewellen et al., 1987; Scholten et al., ...

Genetic analysis of the resistance to eight anthracnose races in the common bean differential cultivar Kaboon.

Science.gov (United States)

Campa, Ana; Giraldez, Ramón; Ferreira, Juan José

2011-06-01

Resistance to the eight races (3, 7, 19, 31, 81, 449, 453, and 1545) of the pathogenic fungus Colletotrichum lindemuthianum (anthracnose) was evaluated in F(3) families derived from the cross between the anthracnose differential bean cultivars Kaboon and Michelite. Molecular marker analyses were carried out in the F(2) individuals in order to map and characterize the anthracnose resistance genes or gene clusters present in Kaboon. The analysis of the combined segregations indicates that the resistance present in Kaboon against these eight anthracnose races is determined by 13 different race-specific genes grouped in three clusters. One of these clusters, corresponding to locus Co-1 in linkage group (LG) 1, carries two dominant genes conferring specific resistance to races 81 and 1545, respectively, and a gene necessary (dominant complementary gene) for the specific resistance to race 31. A second cluster, corresponding to locus Co-3/9 in LG 4, carries six dominant genes conferring specific resistance to races 3, 7, 19, 449, 453, and 1545, respectively, and the second dominant complementary gene for the specific resistance to race 31. A third cluster of unknown location carries three dominant genes conferring specific resistance to races 449, 453, and 1545, respectively. This is the first time that two anthracnose resistance genes with a complementary mode of action have been mapped in common bean and their relationship with previously known Co- resistance genes established.

Comparative genome analysis and resistance gene mapping in grain legumes

International Nuclear Information System (INIS)

Young, N.D.

1998-01-01

Using, DNA markers and genome organization, several important disease resistance genes have been analyzed in mungbean (Vigna radiata), cowpea (Vigna unguiculata), common bean (Phaseolus vulgaris), and soybean (Glycine max). In the process, medium-density linkage maps consisting of restriction fragment length polymorphism (RFLP) markers were constructed for both mungbean and cowpea. Comparisons between these maps, as well as the maps of soybean and common bean, indicate that there is significant conservation of DNA marker order, though the conserved blocks in soybean are much shorter than in the others. DNA mapping results also indicate that a gene for seed weight may be conserved between mungbean and cowpea. Using the linkage maps, genes that control bruchid (genus Callosobruchus) and powdery mildew (Erysiphe polygoni) resistance in mungbean, aphid resistance in cowpea (Aphis craccivora), and cyst nematode (Heterodera glycines) resistance in soybean have all been mapped and characterized. For some of these traits resistance was found to be oligogenic and DNA mapping uncovered multiple genes involved in the phenotype. (author)

Prevalence, antibiotic-resistance properties and enterotoxin gene ...

African Journals Online (AJOL)

Prevalence, antibiotic-resistance properties and enterotoxin gene profile of Bacillus cereus strains isolated from milk-based baby foods. ... Conclusion: Considerable prevalence of resistant and toxigenic B. cereus and high consumption of milk-based infant foods in Iran, represent an important public health issue which ...

Identification of Gene Resistance to Avian InfluenzaVirus (Mx Gene among Wild Waterbirds

Directory of Open Access Journals (Sweden)

Dewi Elfidasari

2013-04-01

Full Text Available The Mx gene is an antiviral gene used to determine the resistance or the susceptibility to different types of viruses, including the Avian Influenza (AI virus subtype H5N1. The AI virus subtype H5N1 infection in chickens causes Mx gene polymorphism. The Mx+ gene shows resistant to the AIvirus subtype H5N1, whereas the Mx-gene shows signs of susceptible. The objective of thisresearch was to detect the Mxgene in wild aquatic birds using the Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP method with the primer pairs F2 and NE-R2/R and the RsaI restriction enzyme. DNA samples were obtained from eight species of wild waterbirds with positive and negative exposure to the AI virus subtype H5N1. DNA amplification results showed that the Mxgene in wild aquatic birds is found in a 100 bp fragment, which is the same as the Mx gene found in chickens. However, unlike chickens, the Mxgene in wild aquatic birds did not show any polymorphism. This study proves that Mx- based resistance to AI virus subtype H5N1 in different in wild birds than in chickens.

A high prevalence of antimicrobial resistant Escherichia coli isolated from pigs and a low prevalence of antimicrobial resistant E. coli from cattle and sheep in Great Britain at slaughter.

Science.gov (United States)

Enne, Virve I; Cassar, Claire; Sprigings, Katherine; Woodward, Martin J; Bennett, Peter M

2008-01-01

The incidence of antimicrobial resistance and expressed and unexpressed resistance genes among commensal Escherichia coli isolated from healthy farm animals at slaughter in Great Britain was investigated. The prevalence of antimicrobial resistance among the isolates varied according to the animal species; of 836 isolates from cattle tested only 5.7% were resistant to one or more antimicrobials, while only 3.0% of 836 isolates from sheep were resistant to one or more agents. However, 92.1% of 2480 isolates from pigs were resistant to at least one antimicrobial. Among isolates from pigs, resistance to some antimicrobials such as tetracycline (78.7%), sulphonamide (66.9%) and streptomycin (37.5%) was found to be common, but relatively rare to other agents such as amikacin (0.1%), ceftazidime (0.1%) and coamoxiclav (0.2%). The isolates had a diverse range of resistance gene profiles, with tet(B), sul2 and strAB identified most frequently. Seven out of 615 isolates investigated carried unexpressed resistance genes. One trimethoprim-susceptible isolate carried a complete dfrA17 gene but lacked a promoter for it. However, in the remaining six streptomycin-susceptible isolates, one of which carried strAB while the others carried aadA, no mutations or deletions in gene or promoter sequences were identified to account for susceptibility. The data indicate that antimicrobial resistance in E. coli of animal origin is due to a broad range of acquired genes.

Dissecting the organ specificity of insecticide resistance candidate genes in Anopheles gambiae: known and novel candidate genes.

Science.gov (United States)

Ingham, Victoria A; Jones, Christopher M; Pignatelli, Patricia; Balabanidou, Vasileia; Vontas, John; Wagstaff, Simon C; Moore, Jonathan D; Ranson, Hilary

2014-11-25

The elevated expression of enzymes with insecticide metabolism activity can lead to high levels of insecticide resistance in the malaria vector, Anopheles gambiae. In this study, adult female mosquitoes from an insecticide susceptible and resistant strain were dissected into four different body parts. RNA from each of these samples was used in microarray analysis to determine the enrichment patterns of the key detoxification gene families within the mosquito and to identify additional candidate insecticide resistance genes that may have been overlooked in previous experiments on whole organisms. A general enrichment in the transcription of genes from the four major detoxification gene families (carboxylesterases, glutathione transferases, UDP glucornyltransferases and cytochrome P450s) was observed in the midgut and malpighian tubules. Yet the subset of P450 genes that have previously been implicated in insecticide resistance in An gambiae, show a surprisingly varied profile of tissue enrichment, confirmed by qPCR and, for three candidates, by immunostaining. A stringent selection process was used to define a list of 105 genes that are significantly (p ≤0.001) over expressed in body parts from the resistant versus susceptible strain. Over half of these, including all the cytochrome P450s on this list, were identified in previous whole organism comparisons between the strains, but several new candidates were detected, notably from comparisons of the transcriptomes from dissected abdomen integuments. The use of RNA extracted from the whole organism to identify candidate insecticide resistance genes has a risk of missing candidates if key genes responsible for the phenotype have restricted expression within the body and/or are over expression only in certain tissues. However, as transcription of genes implicated in metabolic resistance to insecticides is not enriched in any one single organ, comparison of the transcriptome of individual dissected body parts cannot

Isolation of NBS-LRR class resistant gene (I2 gene) from tomato ...

African Journals Online (AJOL)

aghomotsegin

2013-10-16

Oct 16, 2013 ... type of F. oxysporum f. sp. lycopersici observed commonly which require presence of I1 gene in tomato plant for the incompatibility ... Key words: Fusarium wilt, race, R-gene, resistance, tomato. ... MATERIALS AND METHODS.

Genome scanning for identification of resistance gene analogs (RGAs)

African Journals Online (AJOL)

Disease resistance in plants is a desirable economic trait. Many disease resistance genes from various plants have been cloned so far. The gene products of some of these can be distinguished by the presence of an N terminal nucleotide binding site and a C-terminal stretch of leucine-rich repeats. Oligonucleotides already ...

The antimicrobial resistance crisis: management through gene monitoring

Science.gov (United States)

2016-01-01

Antimicrobial resistance (AMR) is an acknowledged crisis for humanity. Its genetic origins and dire potential outcomes are increasingly well understood. However, diagnostic techniques for monitoring the crisis are currently largely limited to enumerating the increasing incidence of resistant pathogens. Being the end-stage of the evolutionary process that produces antimicrobial resistant pathogens, these measurements, while diagnostic, are not prognostic, and so are not optimal in managing this crisis. A better test is required. Here, using insights from an understanding of evolutionary processes ruling the changing abundance of genes under selective pressure, we suggest a predictive framework for the AMR crisis. We then discuss the likely progression of resistance for both existing and prospective antimicrobial therapies. Finally, we suggest that by the environmental monitoring of resistance gene frequency, resistance may be detected and tracked presumptively, and how this tool may be used to guide decision-making in the local and global use of antimicrobials. PMID:27831476

Mapping of novel powdery mildew resistance gene(s) from Agropyron cristatum chromosome 2P.

Science.gov (United States)

Li, Huanhuan; Jiang, Bo; Wang, Jingchang; Lu, Yuqing; Zhang, Jinpeng; Pan, Cuili; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

2017-01-01

A physical map of Agropyron cristatum 2P chromosome was constructed for the first time and the novel powdery mildew resistance gene(s) from chromosome 2P was(were) also mapped. Agropyron cristatum (L.) Gaertn. (2n = 28, PPPP), a wild relative of common wheat, is highly resistant to powdery mildew. Previous studies showed that wheat-A. cristatum 2P disomic addition line II-9-3 displayed high resistance to powdery mildew, and the resistance was attributable to A. cristatum chromosome 2P. To utilize and physically map the powdery mildew resistance gene(s), 15 wheat-A. cristatum 2P translocation lines and three A. cristatum 2P deletion lines with different chromosomal segment sizes, obtained from II-9-3 using 60 Co-γ ray irradiation, were characterized using cytogenetic and molecular marker analysis. A. cristatum 2P chromosomal segments in the translocations were translocated to different wheat chromosomes, including 1A, 4A, 5A, 6A, 7A, 1B, 2B, 3B, 7B, 3D, 4D, and 6D. A physical map of the 2P chromosome was constructed with 82 STS markers, consisting of nine bins with 34 markers on 2PS and eight bins with 48 markers on 2PL. The BC 1 F 2 populations of seven wheat-A. cristatum 2P translocation lines (2PT-3, 2PT-4, 2PT-5, 2PT-6, 2PT-8, 2PT-9, and 2PT-10) were developed by self-pollination, tested with powdery mildew and genotyped with 2P-specific STS markers. From these results, the gene(s) conferring powdery mildew resistance was(were) located on 2PL bin FL 0.66-0.86 and 19 2P-specific markers were identified in this bin. Moreover, two new powdery mildew-resistant translocation lines (2PT-4 and 2PT-5) with small 2PL chromosome segments were obtained. The newly developed wheat lines with powdery mildew resistance and the closely linked molecular markers will be valuable for wheat disease breeding in the future.

Identification of antimicrobial resistance genes in multidrug-resistant clinical Bacteroides fragilis isolates by whole genome shotgun sequencing

DEFF Research Database (Denmark)

Sydenham, Thomas Vognbjerg; Sóki, József; Hasman, Henrik

2015-01-01

Bacteroides fragilis constitutes the most frequent anaerobic bacterium causing bacteremia in humans. The genetic background for antimicrobial resistance in B. fragilis is diverse with some genes requiring insertion sequence (IS) elements inserted upstream for increased expression. To evaluate whole...... genome shotgun sequencing as a method for predicting antimicrobial resistance properties, one meropenem resistant and five multidrug-resistant blood culture isolates were sequenced and antimicrobial resistance genes and IS elements identified using ResFinder 2.1 (http...

SSTAR, a Stand-Alone Easy-To-Use Antimicrobial Resistance Gene Predictor.

Science.gov (United States)

de Man, Tom J B; Limbago, Brandi M

2016-01-01

We present the easy-to-use Sequence Search Tool for Antimicrobial Resistance, SSTAR. It combines a locally executed BLASTN search against a customizable database with an intuitive graphical user interface for identifying antimicrobial resistance (AR) genes from genomic data. Although the database is initially populated from a public repository of acquired resistance determinants (i.e., ARG-ANNOT), it can be customized for particular pathogen groups and resistance mechanisms. For instance, outer membrane porin sequences associated with carbapenem resistance phenotypes can be added, and known intrinsic mechanisms can be included. Unique about this tool is the ability to easily detect putative new alleles and truncated versions of existing AR genes. Variants and potential new alleles are brought to the attention of the user for further investigation. For instance, SSTAR is able to identify modified or truncated versions of porins, which may be of great importance in carbapenemase-negative carbapenem-resistant Enterobacteriaceae. SSTAR is written in Java and is therefore platform independent and compatible with both Windows and Unix operating systems. SSTAR and its manual, which includes a simple installation guide, are freely available from https://github.com/tomdeman-bio/Sequence-Search-Tool-for-Antimicrobial-Resistance-SSTAR-. IMPORTANCE Whole-genome sequencing (WGS) is quickly becoming a routine method for identifying genes associated with antimicrobial resistance (AR). However, for many microbiologists, the use and analysis of WGS data present a substantial challenge. We developed SSTAR, software with a graphical user interface that enables the identification of known AR genes from WGS and has the unique capacity to easily detect new variants of known AR genes, including truncated protein variants. Current software solutions do not notify the user when genes are truncated and, therefore, likely nonfunctional, which makes phenotype predictions less accurate. SSTAR

Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

International Nuclear Information System (INIS)

Tao Ran; Ying Guangguo; Su Haochang; Zhou Hongwei; Sidhu, Jatinder P.S.

2010-01-01

This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

Energy Technology Data Exchange (ETDEWEB)

Tao Ran [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Ying Guangguo, E-mail: guangguo.ying@gmail.co [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Su Haochang [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Zhou Hongwei [Department of Environmental Health, School of Public Health and Tropical Medicine, Southern Medical University, 1838 North Guangzhou Street, Baiyun District, Guangzhou 510515 (China); Sidhu, Jatinder P.S. [CSIRO Land and Water, Queensland Bioscience Precinct, 306 Carmody Road, St Lucia QLD 4067 (Australia)

2010-06-15

This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

Virulence Genes Profile of Multidrug Resistant Pseudomonas aeruginosa Isolated from Iranian Children with UTIs

Directory of Open Access Journals (Sweden)

Zohreh Heidary

2016-04-01

Full Text Available Virulent and resistant strains Pseudomonas aeruginosa (P. aeruginosa is one of the most important cause of UTIs in pediatrics. The present study was carried to investigate the frequency of virulence factors in the multi-drug resistant strains of P. aeruginosa isolated from pediatrics hospitalized due to the UTIs. One - hundred and forty three urine samples were collected from pediatric patients suffered from UTIs. Samples were cultured and those that were P. aeruginosa positive were analyzed for the presence of putative virulence genes. Seventy one out of 143 samples (49.65% were positive for P. aeruginosa. Monthly, sex and age-dependent prevalence were seen for P. aeruginosa. Bacterial strains had the highest levels of resistance against ampicillin (95.77%, gentamicin (92.95% and ciprofloxacin (81.69%. Of 71 P. aeruginosa isolates, 12 strains were resistant to more than 9 antibiotics (16.90%. The most commonly detected virulence factors in the cases of urethral infections were exoU and plcH while those of pyelonephritis and cystitis were were exoS and lasB. Our findings should raise awareness about antibiotic resistance in hospitalized pediatrics with UTIs in Iran. Clinicians should exercise caution in prescribing antibiotics, especially in cases of UTIs. Such information can help in identifying these virulence genes as useful diagnostic markers for clinical P. aeruginosa strains isolated from UTIs.

Persistence of antibiotic resistance and plasmid-associated genes in soil following application of sewage sludge and abundance on vegetables at harvest.

Science.gov (United States)

Rahube, Teddie O; Marti, Romain; Scott, Andrew; Tien, Yuan-Ching; Murray, Roger; Sabourin, Lyne; Duenk, Peter; Lapen, David R; Topp, Edward

2016-07-01

Sewage sludge recovered from wastewater treatment plants contains antibiotic residues and is rich in antibiotic resistance genes, selected for and enriched in the digestive tracts of human using antibiotics. The use of sewage sludge as a crop fertilizer constitutes a potential route of human exposure to antibiotic resistance genes through consumption of contaminated crops. Several gene targets associated with antibiotic resistance (catA1, catB3, ereA, ereB, erm(B), str(A), str(B), qnrD, sul1, and mphA), mobile genetic elements (int1, mobA, IncW repA, IncP1 groups -α, -β, -δ, -γ, -ε), and bacterial 16S rRNA (rrnS) were quantified by qPCR from soil and vegetable samples obtained from unamended and sludge-amended plots at an experimental field in London, Ontario. The qPCR data reveals an increase in abundance of gene targets in the soil and vegetables samples, indicating that there is potential for additional crop exposure to antibiotic resistance genes carried within sewage sludge following field application. It is therefore advisable to allow an appropriate delay period before harvesting of vegetables for human consumption.

Mutations inside rifampicin-resistance determining region of rpoB gene associated with rifampicin-resistance in Mycobacterium tuberculosis.

Science.gov (United States)

Zaw, Myo T; Emran, Nor A; Lin, Zaw

2018-04-26

Rifampicin (RIF) plays a pivotal role in the treatment of tuberculosis due to its bactericidal effects. Because the action of RIF is on rpoB gene encoding RNA polymerase β subunit, 95% of RIF resistant mutations are present in rpoB gene. The majority of the mutations in rpoB gene are found within an 81bp RIF-resistance determining region (RRDR). Literatures on RIF resistant mutations published between 2010 and 2016 were thoroughly reviewed. The most commonly mutated codons in RRDR of rpoB gene are 531, 526 and 516. The possibilities of absence of mutation in RRDR of rpoB gene in MDR-TB isolates in few studies was due to existence of other rare rpoB mutations outside RRDR or different mechanism of rifampicin resistance. Molecular methods which can identify extensive mutations associated with multiple anti-tuberculous drugs are in urgent need so that the research on drug resistant mutations should be extended. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

Energy Technology Data Exchange (ETDEWEB)

Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

2007-07-24

Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

Genetics and mapping of a novel downy mildew resistance gene, Pl(18), introgressed from wild Helianthus argophyllus into cultivated sunflower (Helianthus annuus L.).

Science.gov (United States)

Qi, L L; Foley, M E; Cai, X W; Gulya, T J

2016-04-01

A novel downy mildew resistance gene, Pl(18), was introgressed from wild Helianthus argophyllus into cultivated sunflower and genetically mapped to linkage group 2 of the sunflower genome. The new germplasm, HA-DM1, carrying Pl(18) has been released to the public. Sunflower downy mildew (DM) is considered to be the most destructive foliar disease that has spread to every major sunflower-growing country of the world, except Australia. A new dominant downy mildew resistance gene (Pl 18) transferred from wild Helianthus argophyllus (PI 494573) into cultivated sunflower was mapped to linkage group (LG) 2 of the sunflower genome using bulked segregant analysis with 869 simple sequence repeat (SSR) markers. Phenotyping 142 BC1F2:3 families derived from the cross of HA 89 and H. argophyllus confirmed the single gene inheritance of resistance. Since no other Pl gene has been mapped to LG2, this gene was novel and designated as Pl (18). SSR markers CRT214 and ORS203 flanked Pl(18) at a genetic distance of 1.1 and 0.4 cM, respectively. Forty-six single nucleotide polymorphism (SNP) markers that cover the Pl(18) region were surveyed for saturation mapping of the region. Six co-segregating SNP markers were 1.2 cM distal to Pl(18), and another four co-segregating SNP markers were 0.9 cM proximal to Pl(18). The new BC2F4-derived germplasm, HA-DM1, carrying Pl(18) has been released to the public. This new line is highly resistant to all Plasmopara halstedii races identified in the USA providing breeders with an effective new source of resistance against downy mildew in sunflower. The molecular markers that were developed will be especially useful in marker-assisted selection and pyramiding of Pl resistance genes because of their close proximity to the gene and the availability of high-throughput SNP detection assays.

Spread of tetracycline resistance genes at a conventional dairy farm

Directory of Open Access Journals (Sweden)

Martina eKyselkova

2015-05-01

Full Text Available The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of smaller farms remains to be evaluated. Here we monitor the spread of tetracycline resistance (TC-r genes at a middle-size conventional dairy farm, where chlortetracycline (CTC, as intrauterine suppository is prophylactically used after each calving. Our study has shown that animals at the farm acquired the TC-r genes in their early age (1-2 weeks, likely due to colonization with TC-resistant bacteria from their mothers and/or the farm environment. The relative abundance of the TC-r genes tet(W, tet(Q and tet(M in fresh excrements of calves was about 1-2 orders of magnitude higher compared to heifers and dairy cows, possibly due to the presence of antibiotic residues in milk fed to calves. The occurrence and abundance of TC-r genes in fresh excrements of heifers and adult cows remained unaffected by intrauterine CTC applications, with tet(O, tet(Q and tet(W representing a ‘core TC-resistome’ of the farm, and tet(A, tet(M, tet(Y and tet(X occurring occasionally. The genes tet(A, tet(M, tet(Y and tet(X were shown to be respectively harbored by Shigella, Lactobacillus and Clostridium, Acinetobacter, and Wautersiella. Soil in the farm proximity, as well as field soil to which manure from the farm was applied, was contaminated with TC-r genes occurring in the farm, and some of the TC-r genes persisted in the field over 3 months following the manure application. Concluding, our study shows that antibiotic resistance genes may be a stable part of the intestinal metagenome of cattle even if antibiotics are not used for growth stimulation, and that smaller dairy farms may also contribute to environmental pollution with antibiotic resistance genes.

Occurrence and Distribution of Antibiotic-resistant Bacteria and Transfer of Resistance Genes in Lake Taihu

Science.gov (United States)

Yin, Qian; Yue, Dongmei; Peng, Yuke; Liu, Ying; Xiao, Lin

2013-01-01

The overuse of antibiotics has accelerated antibiotic resistance in the natural environment, especially fresh water, generating a potential risk for public health around the world. In this study, antibiotic resistance in Lake Taihu was investigated and this was the first thorough data obtained through culture-dependent methods. High percentages of resistance to streptomycin and ampicillin among bacterial isolates were detected, followed by tetracycline and chloramphenicol. Especially high levels of ampicillin resistance in the western and northern regions were illustrated. Bacterial identification of the isolates selected for further study indicated the prevalence of some opportunistic pathogens and 62.0% of the 78 isolates exhibited multiple antibiotic resistance. The presence of ESBLs genes was in the following sequence: blaTEM > blaSHV > blaCTMX and 38.5% of the isolates had a class I integrase gene. Of all tested strains, 80.8% were able to transfer antibiotic resistance through conjugation. We also concluded that some new families of human-associated ESBLs and AmpC genes can be found in natural environmental isolates. The prevalence of antibiotic resistance and the dissemination of transferable antibiotic resistance in bacterial isolates (especially in opportunistic pathogens) was alarming and clearly indicated the urgency of realizing the health risks of antibiotic resistance to human and animal populations who are dependent on Lake Taihu for water consumption. PMID:24240317

Antibiotic Resistance and Antibiotic Resistance Genes in Escherichia coli Isolates from Hospital Wastewater in Vietnam.

Science.gov (United States)

Lien, La Thi Quynh; Lan, Pham Thi; Chuc, Nguyen Thi Kim; Hoa, Nguyen Quynh; Nhung, Pham Hong; Thoa, Nguyen Thi Minh; Diwan, Vishal; Tamhankar, Ashok J; Stålsby Lundborg, Cecilia

2017-06-29

The environmental spread of antibiotic-resistant bacteria has been recognised as a growing public health threat for which hospitals play a significant role. The aims of this study were to investigate the prevalence of antibiotic resistance and antibiotic resistance genes (ARGs) in Escherichia coli isolates from hospital wastewater in Vietnam. Wastewater samples before and after treatment were collected using continuous sampling every month over a year. Standard disk diffusion and E-test were used for antibiotic susceptibility testing. Extended-spectrum beta-lactamase (ESBL) production was tested using combined disk diffusion. ARGs were detected by polymerase chain reactions. Resistance to at least one antibiotic was detected in 83% of isolates; multidrug resistance was found in 32%. The highest resistance prevalence was found for co-trimoxazole (70%) and the lowest for imipenem (1%). Forty-three percent of isolates were ESBL-producing, with the bla TEM gene being more common than bla CTX-M . Co-harbouring of the bla CTX-M , bla TEM and qepA genes was found in 46% of isolates resistant to ciprofloxacin. The large presence of antibiotic-resistant E. coli isolates combined with ARGs in hospital wastewater, even post-treatment, poses a threat to public health. It highlights the need to develop effective processes for hospital wastewater treatment plants to eliminate antibiotic resistant bacteria and ARGs.

Two whitebacked planthopper resistance genes in rice share the same loci with those for brown planthopper resistance.

Science.gov (United States)

Tan, G X; Weng, Q M; Ren, X; Huang, Z; Zhu, L L; He, G C

2004-03-01

The whitebacked planthopper (WBPH), Sogatella furcifera, and brown planthopper (BPH) Nilaparvata lugens Stål are important sucking insects of rice (Oryza sativa L.) crops throughout the world. Rice 'B5', which has derived its resistance genes from the wild rice O. officinalis Wall ex Watt, is a line that is highly resistant to both WBPH and BPH. Previously, two resistance genes against BPH, Qbp1, and Qbp2 in 'B5' had been mapped onto chromosome 3 and chromosome 4, respectively. In this study, we employed a mapping population composed of 187 recombinant inbred lines (RILs), produced from a cross between 'B5' and susceptible variety 'Minghui63', to locate the WBPH and BPH resistance genes. A RFLP survey of the bulked extremes from the RIL population identified two genomic regions, one on chromosome 3 and the other on chromosome 4, likely containing the resistance genes to planthoppers. QTL analysis of the RILs further confirmed that two WBPH resistance genes were mapped on the same loci as Qbp1 and Qbp2, using a linkage map with 242 molecular markers distributed on 12 rice chromosomes. Of the two WBPH resistance genes, one designated Wbph7(t) was located within a 1.1-cM region between R1925 and G1318 on chromosome 3, the other designated Wbph8(t) was within a 0.3-cM region flanked by R288 and S11182 on chromosome 4. A two-way analysis of variance showed that two loci acted independently with each other in determining WBPH resistance. The results have significant implications in studying the interactions between sucking insects and plants and in breeding programs of resistance to rice planthoppers.

Whole Genome Sequencing and Plasmid Genomics of Antimicrobial Resistance – Salmonella’s mobile genetic elements and the antimicrobial resistance genes they carry

Science.gov (United States)

With the emergence of antibiotic resistance (AR), multidrug resistance (MDR), and carbapenem resistant Enterobacteriaceae (CRE), the specter of widespread untreatable bacterial infections threatens human and animal health. The ability of these emerging resistances to transfer between bacteria on mob...

Antimicrobial-Resistant Bacterial Populations and Antimicrobial Resistance Genes Obtained from Environments Impacted by Livestock and Municipal Waste.

Directory of Open Access Journals (Sweden)

Getahun E Agga

Full Text Available This study compared the populations of antimicrobial-resistant bacteria and the repertoire of antimicrobial resistance genes in four environments: effluent of three municipal wastewater treatment facilities, three cattle feedlot runoff catchment ponds, three swine waste lagoons, and two "low impact" environments (an urban lake and a relict prairie. Multiple liquid and solid samples were collected from each environment. The prevalences and concentrations of antimicrobial-resistant (AMR Gram-negative (Escherichia coli and Salmonella enterica and Gram-positive (enterococci bacteria were determined from individual samples (n = 174. The prevalences of 84 antimicrobial resistance genes in metagenomic DNA isolated from samples pooled (n = 44 by collection date, location, and sample type were determined. The prevalences and concentrations of AMR E. coli and Salmonella were similar among the livestock and municipal sample sources. The levels of erythromycin-resistant enterococci were significantly higher in liquid samples from cattle catchment ponds and swine waste lagoons than in liquid samples from municipal wastewater treatment facilities, but solid samples from these environments did not differ significantly. Similarly, trimethoprim/sulfamethoxazole-resistant E. coli concentrations were significantly higher in swine liquid than in municipal liquid samples, but there was no difference in solid samples. Multivariate analysis of the distribution of antimicrobial resistance genes using principal coordinate analysis showed distinct clustering of samples with livestock (cattle and swine, low impact environment and municipal samples forming three separate clusters. The numbers of class A beta-lactamase, class C beta-lactamase, and fluoroquinolone resistance genes detected were significantly higher (P < 0.05 in municipal samples than in cattle runoff or swine lagoon samples. In conclusion, we report that AMR is a very widespread phenomenon and that similar

High-throughput genotyping-by-sequencing facilitates molecular tagging of a novel rust resistance gene, R 15 , in sunflower (Helianthus annuus L.).

Science.gov (United States)

Ma, G J; Song, Q J; Markell, S G; Qi, L L

2018-03-21

A novel rust resistance gene, R 15 , derived from the cultivated sunflower HA-R8 was assigned to linkage group 8 of the sunflower genome using a genotyping-by-sequencing approach. SNP markers closely linked to R 15 were identified, facilitating marker-assisted selection of resistance genes. The rust virulence gene is co-evolving with the resistance gene in sunflower, leading to the emergence of new physiologic pathotypes. This presents a continuous threat to the sunflower crop necessitating the development of resistant sunflower hybrids providing a more efficient, durable, and environmentally friendly host plant resistance. The inbred line HA-R8 carries a gene conferring resistance to all known races of the rust pathogen in North America and can be used as a broad-spectrum resistance resource. Based on phenotypic assessments of 140 F 2 individuals derived from a cross of HA 89 with HA-R8, rust resistance in the population was found to be conferred by a single dominant gene (R 15 ) originating from HA-R8. Genotypic analysis with the currently available SSR markers failed to find any association between rust resistance and any markers. Therefore, we used genotyping-by-sequencing (GBS) analysis to achieve better genomic coverage. The GBS data showed that R 15 was located at the top end of linkage group (LG) 8. Saturation with 71 previously mapped SNP markers selected within this region further showed that it was located in a resistance gene cluster on LG8, and mapped to a 1.0-cM region between three co-segregating SNP makers SFW01920, SFW00128, and SFW05824 as well as the NSA_008457 SNP marker. These closely linked markers will facilitate marker-assisted selection and breeding in sunflower.

Tagging of blast resistance gene(s) to DNA markers and marker-assisted selection (MAS) in rice improvement

International Nuclear Information System (INIS)

Zhuang, J.Y.; Lu, J.; Qian, H.R.; Lin, H.X.; Zheng, K.L.

1998-01-01

This paper reports progress made on the tagging of blast resistance gene(s) to DNA markers and on the initiation of marker-assisted selection (MAS) for blast resistance in rice improvement. A pair of near isogenic lines, K8OR and K79S, were developed using a Chinese landrace Hong-jiao-zhan as the resistance donor. Ten putatively positive markers were identified by screening 177 mapped DNA markers. Using the F 2 population of 143 plants and the derived F 3 lines, three Restriction Fragment Length Polymorphism (RFLP) markers (RG81, RG869 and RZ397) on chromosome 12 of rice were identified to be closely linked to the blast resistance gene Pi-12(t). The genetic distance between Pi-12(t) and the closest marker RG869 was 5.1 cM. By employing the bulk segregant analysis (BSA) procedure, six of 199 arbitrary primers were found to produce positive Randomly Amplified Polymorphic DNA (RAPD) bands. Tight linkage between Pi-12(t) and three RAPD bands, each from a different primer, was confirmed after amplification of DNA of all F 2 individuals. Two fragments were cloned and sequenced, and two sequence characterised amplified re-ion (SCAR) markers were established. In two other F 3 populations, Xian-feng I/Tetep and Xian-feng, 1/Hong-jiao-zhan, the blast resistance was found to be controlled by interactions of two or more genes. One resistance gene was located in the vicinity of RG81 in both populations. Work to identify other gene(s) is currently under way. Marker assisted selection for blast resistance was initiated. Crosses were made between elite varieties and blast resistance donors to develop populations for DNA marker-assisted selection of blast resistance. In addition, 48 varieties widely used in current rice breeding programs were provided by rice breeders. DNA marker-based polymorphism among, these varieties and resistance donors were analysed to produce a database for future MAS program. (author)

Antimicrobial resistance and resistance genes in Salmonella strains isolated from broiler chickens along the slaughtering process in China.

Science.gov (United States)

Zhu, Yuanting; Lai, Haimei; Zou, Likou; Yin, Sheng; Wang, Chengtao; Han, Xinfeng; Xia, Xiaolong; Hu, Kaidi; He, Li; Zhou, Kang; Chen, Shujuan; Ao, Xiaolin; Liu, Shuliang

2017-10-16

A total of 189 Salmonella isolates were recovered from 627 samples which were collected from cecal contents of broilers, chicken carcasses, chicken meat after cutting step and frozen broiler chicken products along the slaughtering process at a slaughterhouse in Sichuan province of China. The Salmonella isolates were subjected to antimicrobial susceptibility testing to 10 categories of antimicrobial agents using the Kirby-Bauer disk diffusion method. Those antibiotics-resistant isolates were further investigated for the occurrence of resistance genes, the presence of class 1 integron as well as the associated gene cassettes, and the mutations within the gyrA and parC genes. Consequently, the prevalence of Salmonella was 30.14% (47.96% for cecal content, 18.78% for chicken carcasses, 31.33% for cutting meat and 14.00% for frozen meat, respectively). The predominant serotypes were S. Typhimurium (15.34%) and S. Enteritidis (69.84%). High resistance rates to the following drugs were observed: nalidixic acid (99.5%), ampicillin (87.8%), tetracycline (51.9%), ciprofloxacin (48.7%), trimethoprim/sulfamethoxazole (48.1%), and spectinomycin (34.4%). Antimicrobial resistance profiling showed that 60.8% of isolates were multidrug resistant (MDR), and MDR strains increased from 44.7% to 78.6% along the slaughtering line. 94.6% (n=157) of beta-lactam-resistant isolates harbored at least one resistance gene of bla TEM or bla CTX-M . The relatively low prevalence of aminoglycoside resistance genes (aac(3)-II, aac(3)-IV, and ant(2″)-I) was found in 49 (66.2%) of antibiotic-resistant isolates. The tetracycline resistance genes (tet(A), tet(B), tet(C), and tet(G) and sulfonamide resistance genes (sul1, sul2, and sul3) were identified in 84 (85.7%) and 89 (97.8%) antibiotic-resistant isolates respectively. floR was identified in 44 (97.8%) florfenicol-resistant isolates. Class 1 integron was detected in 37.4% (n=43) of the MDR isolates. Two different gene cassettes, bla OXA-30 -aad

Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

African Journals Online (AJOL)

The rhizomania disease is one of the most important diseases in Iran and some other parts of the world which potentially could play a role in decreasing sugar yield in fields. One approach to combat with this disease is the use of resistance varieties. This varieties have been identified which are having resistance genes to ...

A maize resistance gene functions against bacterial streak disease in rice

OpenAIRE

Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

2005-01-01

Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, wh...

Genetic Determinants of High-Level Oxacillin Resistance in Methicillin-Resistant Staphylococcus aureus.

Science.gov (United States)

Pardos de la Gandara, Maria; Borges, Vitor; Chung, Marilyn; Milheiriço, Catarina; Gomes, João Paulo; de Lencastre, Herminia; Tomasz, Alexander

2018-06-01

Methicillin-resistant Staphylococcus aureus (MRSA) strains carry either a mecA - or a mecC -mediated mechanism of resistance to beta-lactam antibiotics, and the phenotypic expression of resistance shows extensive strain-to-strain variation. In recent communications, we identified the genetic determinants associated with the stringent stress response that play a major role in the antibiotic resistant phenotype of the historically earliest "archaic" clone of MRSA and in the mecC -carrying MRSA strain LGA251. Here, we sought to test whether or not the same genetic determinants also contribute to the resistant phenotype of highly and homogeneously resistant (H*R) derivatives of a major contemporary MRSA clone, USA300. We found that the resistance phenotype was linked to six genes ( fruB , gmk , hpt , purB , prsA , and relA ), which were most frequently targeted among the analyzed 20 H*R strains (one mutation per clone in 19 of the 20 H*R strains). Besides the strong parallels with our previous findings (five of the six genes matched), all but one of the repeatedly targeted genes were found to be linked to guanine metabolism, pointing to the key role that this pathway plays in defining the level of antibiotic resistance independent of the clonal type of MRSA. Copyright © 2018 American Society for Microbiology.

Transfer of genes for stem rust resistance from Agropyron elongatum and imperial rye to durum wheat

International Nuclear Information System (INIS)

Prabhakara Rao, M.V.

1977-01-01

The Agropyron elongatum gene for stem rust resistance on chromosome 6A of Knott's Thatcher translocation line was transferred to a susceptible local durum wheat variety, Jaya, through a series of back-crosses. Plants heterozygous for the Agropyron translocation always show at least one open bivalent. Homozygotes have not been obtained, probably because of the absence of male transmission in durum background. Monotelosomic addition of the short arm of Imperial rye chromosome 3R (formerly ''G'' of Sears), which carries a gene(s) for resistance to wheat stem rust, was obtained in the local durum variety. Rust-resistant plants from parents having the added rye telocentric were irradiated with gamma rays just before meiosis, and the pollen obtained from the irradiated spikes was used to pollinate euploid plants. In addition, seeds harvested from 2n+1 resistant plants were irradiated with thermal neutrons and the resistant M 1 plants were selfed to raise M 2 families. Two durum-rye translocation lines were obtained following irradiation. DRT-1 was transmitted normally through the female gametes but showed no male transmission. As a result of this, homozygotes have not been obtained. Gametic transmission rates of DRT-2 are being tested. Alien translocations, which show normal gametic and zygotic transmissions in the hexaploid wheat, may behave differently in a tetraploid background. The results indicate that alien genetic transfers may be more difficult to obtain in durum wheat, probably owing to the reduced buffering effect of the tetraploid genome. (author)

Fosfomycin Resistance in Escherichia coli, Pennsylvania, USA.

Science.gov (United States)

Alrowais, Hind; McElheny, Christi L; Spychala, Caressa N; Sastry, Sangeeta; Guo, Qinglan; Butt, Adeel A; Doi, Yohei

2015-11-01

Fosfomycin resistance in Escherichia coli is rare in the United States. An extended-spectrum β-lactamase-producing E. coli clinical strain identified in Pennsylvania, USA, showed high-level fosfomycin resistance caused by the fosA3 gene. The IncFII plasmid carrying this gene had a structure similar to those found in China, where fosfomycin resistance is commonly described.

Putative resistance genes in the CitEST database

Directory of Open Access Journals (Sweden)

Simone Guidetti-Gonzalez

2007-01-01

Full Text Available Disease resistance in plants is usually associated with the activation of a wide variety of defense responses to prevent pathogen replication and/or movement. The ability of the host plant to recognize the pathogen and to activate defense responses is regulated by direct or indirect interaction between the products of plant resistance (R and pathogen avirulence (Avr genes. Attempted infection of plants by avirulent pathogens elicits a battery of defenses often followed by the collapse of the challenged host cells. Localized host cell death may help to prevent the pathogen from spreading to uninfected tissues, known as hypersensitive response (HR. When either the plant or the pathogen lacks its cognate gene, activation of the plant’s defense responses fails to occur or is delayed and does not prevent pathogen colonization. In the CitEST database, we identified 1,300 reads related to R genes in Citrus which have been reported in other plant species. These reads were translated in silico, and alignments of their amino acid sequences revealed the presence of characteristic domains and motifs that are specific to R gene classes. The description of the reads identified suggests that they function as resistance genes in citrus.

Pyramiding, alternating or mixing: comparative performances of deployment strategies of nematode resistance genes to promote plant resistance efficiency and durability.

Science.gov (United States)

Djian-Caporalino, Caroline; Palloix, Alain; Fazari, Ariane; Marteu, Nathalie; Barbary, Arnaud; Abad, Pierre; Sage-Palloix, Anne-Marie; Mateille, Thierry; Risso, Sabine; Lanza, Roger; Taussig, Catherine; Castagnone-Sereno, Philippe

2014-02-22

Resistant cultivars are key elements for pathogen control and pesticide reduction, but their repeated use may lead to the emergence of virulent pathogen populations, able to overcome the resistance. Increased research efforts, mainly based on theoretical studies, explore spatio-temporal deployment strategies of resistance genes in order to maximize their durability. We evaluated experimentally three of these strategies to control root-knot nematodes: cultivar mixtures, alternating and pyramiding resistance genes, under controlled and field conditions over a 3-years period, assessing the efficiency and the durability of resistance in a protected crop rotation system with pepper as summer crop and lettuce as winter crop. The choice of the resistance gene and the genetic background in which it is introgressed, affected the frequency of resistance breakdown. The pyramiding of two different resistance genes in one genotype suppressed the emergence of virulent isolates. Alternating different resistance genes in rotation was also efficient to decrease virulent populations in fields due to the specificity of the virulence and the trapping effect of resistant plants. Mixing resistant cultivars together appeared as a less efficient strategy to control nematodes. This work provides experimental evidence that, in a cropping system with seasonal sequences of vegetable species, pyramiding or alternating resistance genes benefit yields in the long-term by increasing the durability of resistant cultivars and improving the long-term control of a soil-borne pest. To our knowledge, this result is the first one obtained for a plant-nematode interaction, which helps demonstrate the general applicability of such strategies for breeding and sustainable management of resistant cultivars against pathogens.

[Mechanisms of endogenous drug resistance acquisition by spontaneous chromosomal gene mutation].

Science.gov (United States)

Fukuda, H; Hiramatsu, K

1997-05-01

Endogenous resistance in bacteria is caused by a change or loss of function and generally genetically recessive. However, this type of resistance acquisition are now prevalent in clinical setting. Chromosomal genes that afford endogenous resistance are the genes correlated with the target of the drug, the drug inactivating enzymes, and permeability of the molecules including the antibacterial agents. Endogenous alteration of the drug target are mediated by the spontaneous mutation of their structural gene. This mutation provides much lower affinity of the drugs for the target. Gene expression of the inactivating enzymes, such as class C beta-lactamase, is generally regulated by regulatory genes. Spontaneous mutations in the regulatory genes cause constitutive enzyme production and provides the resistant to the agent which is usually stable for such enzymes. Spontaneous mutation in the structural gene gives the enzyme extra-spectrum substrate specificity, like ESBL (Extra-Spectrum-beta-Lactamase). Expression of structural genes encoding the permeability systems are also regulated by some regulatory genes. The spontaneous mutation of the regulatory genes reduce an amount of porin protein. This mutation causes much lower influx of the drug in the cell. Spontaneous mutation in promoter region of the structural gene of efflux protein was observed. This mutation raised the gene transcription and overproduced efflux protein. This protein progresses the drug efflux from the cell.

Identification of antibiotic resistance genes in the multidrug-resistant Acinetobacter baumannii strain, MDR-SHH02, using whole-genome sequencing.

Science.gov (United States)

Wang, Hualiang; Wang, Jinghua; Yu, Peijuan; Ge, Ping; Jiang, Yanqun; Xu, Rong; Chen, Rong; Liu, Xuejie

2017-02-01

This study aimed to investigate antibiotic resistance genes in the multidrug-resistant (MDR) Acinetobacter baumannii (A. baumanii) strain, MDR-SHH02, using whole‑genome sequencing (WGS). The antibiotic resistance of MDR-SHH02 isolated from a patient with breast cancer to 19 types of antibiotics was determined using the Kirby‑Bauer method. WGS of MDR-SHH02 was then performed. Following quality control and transcriptome assembly, functional annotation of genes was conducted, and the phylogenetic tree of MDR-SHH02, along with another 5 A. baumanii species and 2 Acinetobacter species, was constructed using PHYLIP 3.695 and FigTree v1.4.2. Furthermore, pathogenicity islands (PAIs) were predicted by the pathogenicity island database. Potential antibiotic resistance genes in MDR-SHH02 were predicted based on the information in the Antibiotic Resistance Genes Database (ARDB). MDR-SHH02 was found to be resistant to all of the tested antibiotics. The total draft genome length of MDR-SHH02 was 4,003,808 bp. There were 74.25% of coding sequences to be annotated into 21 of the Clusters of Orthologous Groups (COGs) of protein terms, such as 'transcription' and 'amino acid transport and metabolism'. Furthermore, there were 45 PAIs homologous to the sequence MDRSHH02000806. Additionally, a total of 12 gene sequences in MDR-SHH02 were highly similar to the sequences of antibiotic resistance genes in ARDB, including genes encoding aminoglycoside‑modifying enzymes [e.g., aac(3)-Ia, ant(2'')‑Ia, aph33ib and aph(3')-Ia], β-lactamase genes (bl2b_tem and bl2b_tem1), sulfonamide-resistant dihydropteroate synthase genes (sul1 and sul2), catb3 and tetb. These results suggest that numerous genes mediate resistance to various antibiotics in MDR-SHH02, and provide a clinical guidance for the personalized therapy of A. baumannii-infected patients.

Expressed sequence enrichment for candidate gene analysis of citrus tristeza virus resistance.

Science.gov (United States)

Bernet, G P; Bretó, M P; Asins, M J

2004-02-01

Several studies have reported markers linked to a putative resistance gene from Poncirus trifoliata ( Ctv-R) located at linkage group 4 that confers resistance against one of the most important citrus pathogens, citrus tristeza virus (CTV). To be successful in both marker-assisted selection and transformation experiments, its accurate mapping is needed. Several factors may affect its localization, among them two are considered here: the definition of resistance and the genetic background of progeny. Two progenies derived from P. trifoliata, by self-pollination and by crossing with sour orange ( Citrus aurantium), a citrus rootstock well-adapted to arid and semi-arid areas, were used for linkage group-4 marker enrichment. Two new methodologies were used to enrich this region with expressed sequences. The enrichment of group 4 resulted in the fusion of several C. aurantium linkage groups. The new one A(7+3+4) is now saturated with 48 markers including expressed sequences. Surprisingly, sour orange was as resistant to the CTV isolate tested as was P. trifoliata, and three hybrids that carry Ctv-R, as deduced from its flanking markers, are susceptible to CTV. The new linkage maps were used to map Ctv-R under the hypothesis of monogenic inheritance. Its position on linkage group 4 of P. trifoliata differs from the location previously reported in other progenies. The genetic analysis of virus-plant interaction in the family derived from C. aurantium after a CTV chronic infection showed the segregation of five types of interaction, which is not compatible with the hypothesis of a single gene controlling resistance. Two major issues are discussed: another type of genetic analysis of CTV resistance is needed to avoid the assumption of monogenic inheritance, and transferring Ctv-R from P. trifoliata to sour orange might not avoid the CTV decline of sweet orange trees.

Detection of Genes that Determine Maize Grain Quality Characteristics and Resistance to Stress Factors

Directory of Open Access Journals (Sweden)

Markovskyi, O.V.

2014-01-01

Full Text Available 200 experimental maize samples (Maize Company were examined for the presence of genes that determine the quality characteristics of grain (wx and fl-2 genes, herbicide (bar (pat, epsps genes and insect (cry-genes resistance. The total DNA was extracted from maize living plant tissue. Primers to detect wx, fl-2, bar (pat, mepsps, CP4 epsps, cry1A(b, cry1F, cry1A.105, mcry3A, cry2Ab2, cry3Bb1, cry34Ab1, cry35Ab1 genes were designed and selected. Multiplex and Touchdown PCR were worked out. PCR amplification of certain sequences was carried out. No transgenes (bar (pat, mepsps, CP4 epsps, cry1A(b, cry1F, cry1A.105, mcry3A, cry2Ab2, cry3Bb1, cry34Ab1, cry35Ab1 were found among 200 analyzed experimental maize samples. At the same time, fl-2 gene was found in 41 samples, wx gene was found in 192 analyzed samples.

Molecular Analysis and Expression of bap Gene in Biofilm-Forming Multi-Drug-Resistant Acinetobacter baumannii

Directory of Open Access Journals (Sweden)

Omid Azizi

2016-10-01

Full Text Available Background: Acinetobacter baumannii is commonly resistant to nearly all antibiotics due to presence of antibiotic resistance genes and biofilm formation. In this study we determined the presence of certain antibiotic-resistance genes associated with biofilm production and the influence of low iron concentration on expression of the biofilm-associated protein gene (bap in development of biofilm among multi-drug-resistant A. baumannii (MDRAB. Methods: Sixty-five MDRAB isolates from clinical samples were collected. Molecular typing was carried out by random amplified polymorphism DNA polymerase chain reaction (RAPD-PCR. Biofilm formation was assayed by the microtiter method. Results: The sequence of bap was determined and deposited in the GenBank database (accession no. KR080550.1. Expression of bap in the presence of low iron was analyzed by relative quantitative real time PCR (rqRT-PCR. Nearly half of the isolates belonged to RAPD-types A and B remaining were either small clusters or singleton. The results of biofilm formation revealed that 23 (35.4%, 18 (27.7%, 13 (20%, and 11 (16.9% of the isolates had strong, moderate, weak, and no biofilm activities, respectively. ompA and csuE genes were detected in all, while bap and blaPER-1 were detected in 43 (66% and 42 (64% of the isolates that showed strong and moderate biofilm activities (p ≤ 0.05, respectively. Analysis of bap expression by rqRT-PCR revealed five isolates with four-fold bap overexpression in the presence of low iron concentration (20 μM. Conclusion: The results suggest that bap overexpression may influence biofilm formation in presence of low iron concentration.

Natural variation of rice blast resistance gene Pi-d2

Science.gov (United States)

Studying natural variation of rice resistance (R) genes in cultivated and wild rice relatives can predict resistance stability to rice blast fungus. In the present study, the protein coding regions of rice R gene Pi-d2 in 35 rice accessions of subgroups, aus (AUS), indica (IND), temperate japonica (...

Cloning of the nptII gene of Escherichia coli and construction of a recombinant strain harboring functional recA and nptII antibiotic resistance.

Science.gov (United States)

Ghanem, S

2011-01-01

In an attempt to clone the ORF of the nptII gene of Escherichia coli K12 (ATCC 10798), two degenerate primers were designed based on the nptII sequence of its Tn5 transposon. The nptII ORF was placed under the control of the E. coli hybrid trc promoter, in the pKK388-1 vector, transformed into E. coli DH5α ΔrecA (recombinant, deficient strain). Transferred cells were tested for ampicillin, tetracycline, kanamycin, neomycin, geneticin, paromomycin, penicillin, and UV resistance. The neomycin phosphotransferase gene of E. coli was cloned successfully and conferred kanamycin, neomycin, geneticin, and paromomycin resistance to recombinant DH5α; this did not inhibit insertion of additional antibiotic resistance against ampicillin and tetracycline, meaning the trc promoter can express two different genes carried by two different plasmids harbored in the same cell. This resistance conferral process could be considered as an emulation of horizontal gene transfer occurring in nature and would be a useful tool for understanding mechanisms of evolution of multidrug-resistant strains.

The relationship between codon usage bias and cold resistant genes

International Nuclear Information System (INIS)

Barozai, M.Y.; Din, M.

2014-01-01

This research is based on synonymous codon usage which has been well-known as a feature that affects typical expression level of protein in an organism. Different organisms prefer different codons for same amino acid and this is called Codon Usage Bias (CUB). The codon usage directly affects the level or even direction of changes in protein expression in responses to environmental stimuli. Cold stress is a major abiotic factor that limits the agricultural productivity of plants. In the recent study CUB has been studied in Arabidopsis thaliana cold resistant and housekeeping genes and their homologs in rice (Oryza sativa) to understand the cold stress and housekeeping genes relation with CUB. Six cold resistant and three housekeeping genes in Arabidopsis thaliana and their homologs in rice, were subjected to CUB analysis. The three cold resistant genes (DREB1B, RCI and MYB15) showed more than 50% (52%, 61% and 66% respectively) similar codon usage bias for Arabidopsis thaliana and rice. On the other hand three cold resistant genes (MPK3, ICE1 and ZAT12) showed less than 50% (38%, 38% and 47% respectively) similar codon usage bias for Arabidopsis thaliana and rice. The three housekeeping genes (Actin, Tubulin and Ubiquitin) showed 76% similar codon usage bias for Arabidopsis thaliana and rice. This study will help to manage the plant gene expression through codon optimization under the cold stress. (author)

Integron types, gene cassettes and antimicrobial resistance profile of Acinetobacter baumannii isolated from BAL samples in Babol, north of Iran.

Science.gov (United States)

Akrami, Fariba; Shahandashti, Elaheh Ferdosi; Yahyapour, Yousef; Sadeghi, Mohsen; Khafri, Soraya; Pournajaf, Abazar; Rajabnia, Ramazan

2017-08-01

Multi-drug resistant isolates of Acinetobacter baumannii have created therapeutic problems worldwide. This current study was intended to determine the Integron types, gene cassettes and antimicrobial resistance profile of A. baumannii isolated from BAL samples in Babol, north of Iran. During a 15-month period, 35 A. baumannii isolates were studied. Different classes of antimicrobial agents were used to determine the resistance ratios. Multiplex-PCR was used to detect different types of integrons and associated gene cassettes. The resistance rates to GM, FEP, AK, TOB, CP, PIP, SAM, IPM, SXT, CTX, CAZ, CL, TIM, MEM, and TZP were 85.7%, 100%, 91.4%, 68.5%, 94.3%, 88.5%, 97.1%, 94.3%, 100%, 100%, 100%, 0.0%, 91.4%, 94.3% and 91.4%, respectively. The distribution analysis of int genes showed that 25.7%, 88.6% and 28.6% of isolates carried the intI, intII and intIII genes, respectively. The prevalence of aadB, dfrA1, bla-OXA 30 and aadA1 genes were 94.3%, 77.1%, 40% and 5.7%, respectively. The current study showed that a high level of A. baumannii isolates harbor integrons in our therapeutic center, which may lead to distribution of multiple antimicrobial resistance. The different types of gene cassette arrays in the present study highlight the important role of geographical features in MDR isolates dissemination which could be credited to different profiles of drug consumption in different areas. The findings emphasized that the need for continuous surveillance to prevent distribution of multidrug resistance among A. baumannii strains in Iran. Copyright © 2017. Published by Elsevier Ltd.

Distribution of different efflux pump genes in clinical isolates of multidrug-resistant Acinetobacter baumannii and their correlation with antimicrobial resistance.

Science.gov (United States)

Lin, Ming-Feng; Lin, Yun-You; Tu, Chi-Chao; Lan, Chung-Yu

2017-04-01

Efflux pumps are one of the major mechanisms of antimicrobial resistance in Acinetobacter baumannii. This study aimed to understand the distribution of different types of pump genes in clinical isolates of multidrug-resistant A. baumannii (MDRAB) and to reveal the relationship between their presence and expression with antimicrobial resistance. MDRAB isolates were collected from five hospitals in Taiwan. Different categories of pump genes, including adeB, adeJ, macB, abeM, abeS, emrA-like, emrB-like, and craA, were chosen, and their presence in the collected isolates was determined. Three induced resistant strains of A. baumannii ATCC 17978 to tigecycline, imipenem, and amikacin were also included. The expressions of the selected pump genes were determined using quantitative reverse transcription-polymerase chain reaction. Twenty-one MDRAB clinical isolates were obtained from five hospitals. All of the studied pump genes were present in the collected MDRAB isolates except one isolate that lacked the emrA-like gene. The gene expression of these efflux pumps was variable among the strains. The upregulation of the adeB, adeJ, and macB genes was responsible for tigecycline resistance, and the increased abeS expression was strongly related to amikacin resistance. Of all the antibiotics studied, tigecycline was the strongest inducer of gene expression for many efflux pumps in A. baumannii. Efflux pump genes are universally present in the collected clinical MDRAB isolates. The upregulation of the adeB, adeJ, macB and abeS genes is more related with antibiotic resistance. Copyright © 2015. Published by Elsevier B.V.

Prevalence of the antibiotic resistance genes in coagulase-positive- and negative-Staphylococcus in chicken meat retailed to consumers

Directory of Open Access Journals (Sweden)

Kamelia Mahmoud Osman

2016-11-01

Full Text Available The use of antibiotics in farm management (growing crops and raising animals has become a major area of concern. Its implications is the consequent emergence of antibiotic resistant bacteria (ARB and accordingly their access into the human food chain with passage of antibiotic resistance genes (ARG to the normal human intestinal microbiota and hence to other pathogenic bacteria causative human disease. Therefore, we pursued in this study to unravel the frequency and the quinolone resistance determining region, mecA and cfr genes of methicillin-susceptible Staphylococcus aureus (MSSA, methicillin-resistant S. aureus (MRSA, methicillin-resistant coagulase-negative staphylococci (MRCNS and methicillin-susceptible coagulase-negative staphylococci (MSCNS isolated from the retail trade of ready-to-eat raw chicken meat samples collected during one year and sold across the Great Cairo area. The 50 Staphylococcus isolated from retail raw chicken meat were analyzed for their antibiotic resistance phenotypic profile on 12 antibiotics (penicillin, oxacillin, methicillin, ampicillin-sulbactam, erythromycin, tetracycline, clindamycin, gentamicin, ciprofloxacin, chloramphenicol, sulfamethoxazole-trimethoprim and vancomycin and their endorsement of the quinolone resistance determining region, mecA and cfr genes. The isolation results revealed 50 isolates, CPS (14 and CNS (36, representing ten species (S. aureus, S. hyicus, S. epidermedius, S. lugdunensis, S. haemolyticus, S. hominus, S. schleiferi, S. cohnii, S. intermedius and S. lentus. Twenty seven isolates were methicillin-resistant. Out of the characterized 50 staphylococcal isolates, three were MRSA but only 2/3 carried the mecA gene. The ARG that bestows resistance to quinolones, β-lactams, macrolides, lincosamides and streptogramin B (MLS(B in MRSA and MR-CNS were perceived. According to the available literature, the present investigation was a unique endeavor into the identification of the quinolone-resistance

Prevalence of the Antibiotic Resistance Genes in Coagulase-Positive-and Negative-Staphylococcus in Chicken Meat Retailed to Consumers.

Science.gov (United States)

Osman, Kamelia; Badr, Jihan; Al-Maary, Khalid S; Moussa, Ihab M I; Hessain, Ashgan M; Girah, Zeinab M S Amin; Abo-Shama, Usama H; Orabi, Ahmed; Saad, Aalaa

2016-01-01

The use of antibiotics in farm management (growing crops and raising animals) has become a major area of concern. Its implications is the consequent emergence of antibiotic resistant bacteria (ARB) and accordingly their access into the human food chain with passage of antibiotic resistance genes (ARG) to the normal human intestinal microbiota and hence to other pathogenic bacteria causative human disease. Therefore, we pursued in this study to unravel the frequency and the quinolone resistance determining region, mec A and cfr genes of methicillin-susceptible Staphylococcus aureus (MSSA), methicillin-resistant S. aureus (MRSA), methicillin-resistant coagulase-negative staphylococci (MRCNS) and methicillin-susceptible coagulase-negative staphylococci (MSCNS) isolated from the retail trade of ready-to-eat raw chicken meat samples collected during 1 year and sold across the Great Cairo area. The 50 Staphylococcus isolated from retail raw chicken meat were analyzed for their antibiotic resistance phenotypic profile on 12 antibiotics (penicillin, oxacillin, methicillin, ampicillin-sulbactam, erythromycin, tetracycline, clindamycin, gentamicin, ciprofloxacin, chloramphenicol, sulfamethoxazole-trimethoprim, and vancomycin) and their endorsement of the quinolone resistance determining region, mec A and cfr genes. The isolation results revealed 50 isolates, CPS (14) and CNS (36), representing ten species ( S. aureus, S. hyicus, S. epidermedius, S. lugdunensis, S. haemolyticus, S. hominus, S. schleiferi, S. cohnii, S. intermedius , and S. lentus ). Twenty seven isolates were methicillin-resistant. Out of the characterized 50 staphylococcal isolates, three were MRSA but only 2/3 carried the mec A gene. The ARG that bestows resistance to quinolones, β-lactams, macrolides, lincosamides, and streptogramin B [MLS( B )] in MRSA and MR-CNS were perceived. According to the available literature, the present investigation was a unique endeavor into the identification of the quinolone-resistance

Search Engine for Antimicrobial Resistance: A Cloud Compatible Pipeline and Web Interface for Rapidly Detecting Antimicrobial Resistance Genes Directly from Sequence Data.

Science.gov (United States)

Rowe, Will; Baker, Kate S; Verner-Jeffreys, David; Baker-Austin, Craig; Ryan, Jim J; Maskell, Duncan; Pearce, Gareth

2015-01-01

Antimicrobial resistance remains a growing and significant concern in human and veterinary medicine. Current laboratory methods for the detection and surveillance of antimicrobial resistant bacteria are limited in their effectiveness and scope. With the rapidly developing field of whole genome sequencing beginning to be utilised in clinical practice, the ability to interrogate sequencing data quickly and easily for the presence of antimicrobial resistance genes will become increasingly important and useful for informing clinical decisions. Additionally, use of such tools will provide insight into the dynamics of antimicrobial resistance genes in metagenomic samples such as those used in environmental monitoring. Here we present the Search Engine for Antimicrobial Resistance (SEAR), a pipeline and web interface for detection of horizontally acquired antimicrobial resistance genes in raw sequencing data. The pipeline provides gene information, abundance estimation and the reconstructed sequence of antimicrobial resistance genes; it also provides web links to additional information on each gene. The pipeline utilises clustering and read mapping to annotate full-length genes relative to a user-defined database. It also uses local alignment of annotated genes to a range of online databases to provide additional information. We demonstrate SEAR's application in the detection and abundance estimation of antimicrobial resistance genes in two novel environmental metagenomes, 32 human faecal microbiome datasets and 126 clinical isolates of Shigella sonnei. We have developed a pipeline that contributes to the improved capacity for antimicrobial resistance detection afforded by next generation sequencing technologies, allowing for rapid detection of antimicrobial resistance genes directly from sequencing data. SEAR uses raw sequencing data via an intuitive interface so can be run rapidly without requiring advanced bioinformatic skills or resources. Finally, we show that SEAR

The cfr and cfr-like multiple resistance genes

DEFF Research Database (Denmark)

Vester, Birte

2018-01-01

. The cfr gene is found in various bacteria in many geographical locations and placed on plasmids or associated with transposons. Cfr-related genes providing similar resistance have been identified in Bacillales, and now also in the pathogens Clostridium difficile and Enterococcus faecium. In addition......, the presence of the cfr gene has been detected in harbours and food markets....

Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India.

Science.gov (United States)

Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind

2014-04-01

A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

Transcriptome profiling and digital gene expression analysis of genes associated with salinity resistance in peanut

Directory of Open Access Journals (Sweden)

Jiongming Sui

2018-03-01

Full Text Available Background: Soil salinity can significantly reduce crop production, but the molecular mechanism of salinity tolerance in peanut is poorly understood. A mutant (S1 with higher salinity resistance than its mutagenic parent HY22 (S3 was obtained. Transcriptome sequencing and digital gene expression (DGE analysis were performed with leaves of S1 and S3 before and after plants were irrigated with 250 mM NaCl. Results: A total of 107,725 comprehensive transcripts were assembled into 67,738 unigenes using TIGR Gene Indices clustering tools (TGICL. All unigenes were searched against the euKaryotic Ortholog Groups (KOG, gene ontology (GO and Kyoto Encyclopedia of Genes and Genomes (KEGG databases, and these unigenes were assigned to 26 functional KOG categories, 56 GO terms, 32 KEGG groups, respectively. In total 112 differentially expressed genes (DEGs between S1 and S3 after salinity stress were screened, among them, 86 were responsive to salinity stress in S1 and/or S3. These 86 DEGs included genes that encoded the following kinds of proteins that are known to be involved in resistance to salinity stress: late embryogenesis abundant proteins (LEAs, major intrinsic proteins (MIPs or aquaporins, metallothioneins (MTs, lipid transfer protein (LTP, calcineurin B-like protein-interacting protein kinases (CIPKs, 9-cis-epoxycarotenoid dioxygenase (NCED and oleosins, etc. Of these 86 DEGs, 18 could not be matched with known proteins. Conclusion: The results from this study will be useful for further research on the mechanism of salinity resistance and will provide a useful gene resource for the variety breeding of salinity resistance in peanut. Keywords: Digital gene expression, Gene, Mutant, NaCl, Peanut (Arachis hypogaea L., RNA-seq, Salinity stress, Salinity tolerance, Soil salinity, Transcripts, Unigenes

Detection of Extended Spectrum Beta-Lactamases Resistance Genes among Bacteria Isolated from Selected Drinking Water Distribution Channels in Southwestern Nigeria.

Science.gov (United States)

Adesoji, Ayodele T; Ogunjobi, Adeniyi A

2016-01-01

Extended Spectrum Beta-Lactamases (ESBL) provide high level resistance to beta-lactam antibiotics among bacteria. In this study, previously described multidrug resistant bacteria from raw, treated, and municipal taps of DWDS from selected dams in southwestern Nigeria were assessed for the presence of ESBL resistance genes which include bla TEM, bla SHV, and bla CTX by PCR amplification. A total of 164 bacteria spread across treated (33), raw (66), and municipal taps (68), belonging to α-Proteobacteria, β-Proteobacteria, γ-Proteobacteria, Flavobacteriia, Bacilli, and Actinobacteria group, were selected for this study. Among these bacteria, the most commonly observed resistance was for ampicillin and amoxicillin/clavulanic acid (61 isolates). Sixty-one isolates carried at least one of the targeted ESBL genes with bla TEM being the most abundant (50/61) and bla CTX being detected least (3/61). Klebsiella was the most frequently identified genus (18.03%) to harbour ESBL gene followed by Proteus (14.75%). Moreover, combinations of two ESBL genes, bla SHV + bla TEM or bla CTX + bla TEM, were observed in 11 and 1 isolate, respectively. In conclusion, classic bla TEM ESBL gene was present in multiple bacterial strains that were isolated from DWDS sources in Nigeria. These environments may serve as foci exchange of genetic traits in a diversity of Gram-negative bacteria.

Resistance to Plum Pox Virus (PPV) in apricot (Prunus armeniaca L.) is associated with down-regulation of two MATHd genes.

Science.gov (United States)

Zuriaga, Elena; Romero, Carlos; Blanca, Jose Miguel; Badenes, Maria Luisa

2018-01-27

Plum pox virus (PPV), causing Sharka disease, is one of the main limiting factors for Prunus production worldwide. In apricot (Prunus armeniaca L.) the major PPV resistance locus (PPVres), comprising ~ 196 kb, has been mapped to the upper part of linkage group 1. Within the PPVres, 68 genomic variants linked in coupling to PPV resistance were identified within 23 predicted transcripts according to peach genome annotation. Taking into account the predicted functions inferred from sequence homology, some members of a cluster of meprin and TRAF-C homology domain (MATHd)-containing genes were pointed as PPV resistance candidate genes. Here, we have characterized the global apricot transcriptome response to PPV-D infection identifying six PPVres locus genes (ParP-1 to ParP-6) differentially expressed in resistant/susceptible cultivars. Two of them (ParP-3 and ParP-4), that encode MATHd proteins, appear clearly down-regulated in resistant cultivars, as confirmed by qRT-PCR. Concurrently, variant calling was performed using whole-genome sequencing data of 24 apricot cultivars (10 PPV-resistant and 14 PPV-susceptible) and 2 wild relatives (PPV-susceptible). ParP-3 and ParP-4, named as Prunus armeniaca PPVres MATHd-containing genes (ParPMC), are the only 2 genes having allelic variants linked in coupling to PPV resistance. ParPMC1 has 1 nsSNP, while ParPMC2 has 15 variants, including a 5-bp deletion within the second exon that produces a frameshift mutation. ParPMC1 and ParPMC2 are adjacent and highly homologous (87.5% identity) suggesting they are paralogs originated from a tandem duplication. Cultivars carrying the ParPMC2 resistant (mutated) allele show lack of expression in both ParPMC2 and especially ParPMC1. Accordingly, we hypothesize that ParPMC2 is a pseudogene that mediates down-regulation of its functional paralog ParPMC1 by silencing. As a whole, results strongly support ParPMC1 and/or ParPMC2 as host susceptibility genes required for PPV infection which

Reversing bacterial resistance to antibiotics by phage-mediated delivery of dominant sensitive genes.

Science.gov (United States)

Edgar, Rotem; Friedman, Nir; Molshanski-Mor, Shahar; Qimron, Udi

2012-02-01

Pathogen resistance to antibiotics is a rapidly growing problem, leading to an urgent need for novel antimicrobial agents. Unfortunately, development of new antibiotics faces numerous obstacles, and a method that resensitizes pathogens to approved antibiotics therefore holds key advantages. We present a proof of principle for a system that restores antibiotic efficiency by reversing pathogen resistance. This system uses temperate phages to introduce, by lysogenization, the genes rpsL and gyrA conferring sensitivity in a dominant fashion to two antibiotics, streptomycin and nalidixic acid, respectively. Unique selective pressure is generated to enrich for bacteria that harbor the phages carrying the sensitizing constructs. This selection pressure is based on a toxic compound, tellurite, and therefore does not forfeit any antibiotic for the sensitization procedure. We further demonstrate a possible way of reducing undesirable recombination events by synthesizing dominant sensitive genes with major barriers to homologous recombination. Such synthesis does not significantly reduce the gene's sensitization ability. Unlike conventional bacteriophage therapy, the system does not rely on the phage's ability to kill pathogens in the infected host, but instead, on its ability to deliver genetic constructs into the bacteria and thus render them sensitive to antibiotics prior to host infection. We believe that transfer of the sensitizing cassette by the constructed phage will significantly enrich for antibiotic-treatable pathogens on hospital surfaces. Broad usage of the proposed system, in contrast to antibiotics and phage therapy, will potentially change the nature of nosocomial infections toward being more susceptible to antibiotics rather than more resistant.

Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

OpenAIRE

Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

2014-01-01

Introduction: This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Methodology: Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. Results: A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resista...

TaEDS1 genes positively regulate resistance to powdery mildew in wheat.

Science.gov (United States)

Chen, Guiping; Wei, Bo; Li, Guoliang; Gong, Caiyan; Fan, Renchun; Zhang, Xiangqi

2018-04-01

Three EDS1 genes were cloned from common wheat and were demonstrated to positively regulate resistance to powdery mildew in wheat. The EDS1 proteins play important roles in plant basal resistance and TIR-NB-LRR protein-triggered resistance in dicots. Until now, there have been very few studies on EDS1 in monocots, and none in wheat. Here, we report on three common wheat orthologous genes of EDS1 family (TaEDS1-5A, 5B and 5D) and their function in powdery mildew resistance. Comparisons of these genes with their orthologs in diploid ancestors revealed that EDS1 is a conserved gene family in Triticeae. The cDNA sequence similarity among the three TaEDS1 genes was greater than 96.5%, and they shared sequence similarities of more than 99.6% with the respective orthologs from diploid ancestors. The phylogenetic analysis revealed that the EDS1 family originated prior to the differentiation of monocots and dicots, and EDS1 members have since undergone clear structural differentiation. The transcriptional levels of TaEDS1 genes in the leaves were obviously higher than those of the other organs, and they were induced by Blumeria graminis f. sp. tritici (Bgt) infection and salicylic acid (SA) treatment. The BSMV-VIGS experiments indicated that knock-down the transcriptional levels of the TaEDS1 genes in a powdery mildew-resistant variety of common wheat compromised resistance. Contrarily, transient overexpression of TaEDS1 genes in a susceptible common wheat variety significantly reduced the haustorium index and attenuated the growth of Bgt. Furthermore, the expression of TaEDS1 genes in the Arabidopsis mutant eds1-1 complemented its susceptible phenotype to powdery mildew. The above evidences strongly suggest that TaEDS1 acts as a positive regulator and confers resistance against powdery mildew in common wheat.

Class 1 and 2 integrons, sul resistance genes and antibiotic resistance in Escherichia coli isolated from Dongjiang River, South China

International Nuclear Information System (INIS)

Su Haochang; Ying Guangguo; Tao Ran; Zhang Ruiquan; Zhao Jianliang; Liu Yousheng

2012-01-01

Antibiotic susceptibility, detection of sul gene types and presence of class 1, 2 and 3 integrons and gene cassettes using PCR assays were investigated in 3456 Escherichia coli isolates obtained from 38 sampling sites of the Dongjiang River catchment in the dry and wet seasons. 89.1% of the isolates were resistant and 87.5% showed resistance to at least three antibiotics. sul2 was detected most frequently in 89.2% of 1403 SXT-resistant isolates. The presence of integrons (class 1 and 2) was frequently observed (82.3%) while no class 3 integron was found. In these integrons, 21 resistance genes of 14 gene cassette arrays and 10 different families of resistance genes were identified. Three gene cassette arrays, aac(6')-Ib-cr-aar-3-dfrA27-aadA16, aacA4-catB3-dfrA1 and aadA2-lnuF, were detected for the first time in surface water. The results showed that bacterial resistance in the catchment was seriously influenced by human activities, especially discharge of wastewater. Highlights: ► Antibiotic resistance was investigated for a river catchment of southern China. ► 87.5% of E coli isolates showed resistance to at least three antibiotics. ► The presence of integrons (class 1 and 2) was frequently observed (82.3%). ► Bacterial resistance in the catchment was seriously influenced by human activities. - Bacterial resistance to antibiotics in a catchment is related to the discharge of wastewater into the aquatic environment.

A novel gene of Kalanchoe daigremontiana confers plant drought resistance.

Science.gov (United States)

Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi

2018-02-07

Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

Induction of Xa10-like Genes in Rice Cultivar Nipponbare Confers Disease Resistance to Rice Bacterial Blight.

Science.gov (United States)

Wang, Jun; Tian, Dongsheng; Gu, Keyu; Yang, Xiaobei; Wang, Lanlan; Zeng, Xuan; Yin, Zhongchao

2017-06-01

Bacterial blight of rice, caused by Xanthomonas oryzae pv. oryzae, is one of the most destructive bacterial diseases throughout the major rice-growing regions in the world. The rice disease resistance (R) gene Xa10 confers race-specific disease resistance to X. oryzae pv. oryzae strains that deliver the corresponding transcription activator-like (TAL) effector AvrXa10. Upon bacterial infection, AvrXa10 binds specifically to the effector binding element in the promoter of the R gene and activates its expression. Xa10 encodes an executor R protein that triggers hypersensitive response and activates disease resistance. 'Nipponbare' rice carries two Xa10-like genes in its genome, of which one is the susceptible allele of the Xa23 gene, a Xa10-like TAL effector-dependent executor R gene isolated recently from 'CBB23' rice. However, the function of the two Xa10-like genes in disease resistance to X. oryzae pv. oryzae strains has not been investigated. Here, we designated the two Xa10-like genes as Xa10-Ni and Xa23-Ni and characterized their function for disease resistance to rice bacterial blight. Both Xa10-Ni and Xa23-Ni provided disease resistance to X. oryzae pv. oryzae strains that deliver the matching artificially designed TAL effectors (dTALE). Transgenic rice plants containing Xa10-Ni and Xa23-Ni under the Xa10 promoter provided specific disease resistance to X. oryzae pv. oryzae strains that deliver AvrXa10. Xa10-Ni and Xa23-Ni knock-out mutants abolished dTALE-dependent disease resistance to X. oryzae pv. oryzae. Heterologous expression of Xa10-Ni and Xa23-Ni in Nicotiana benthamiana triggered cell death. The 19-amino-acid residues at the N-terminal regions of XA10 or XA10-Ni are dispensable for their function in inducing cell death in N. benthamiana and the C-terminal regions of XA10, XA10-Ni, and XA23-Ni are interchangeable among each other without affecting their function. Like XA10, both XA10-Ni and XA23-Ni locate to the endoplasmic reticulum (ER) membrane

Analysis of differentially expressed genes related to resistance in spinosad- and neonicotinoid-resistant Musca domestica L. (Diptera: Muscidae) strains

DEFF Research Database (Denmark)

Castberg, Dorte Heidi Højland; Kristensen, Michael

2017-01-01

strains differing significantly in their response to insecticides. High differential expression of P450s and genes coding for cuticle protein indicates a combination of factors involved in metabolic neonicotinoid and spinosad resistance. Conclusion Resistance in these strains is apparently not linked...... interesting in terms of neonicotinoid resistance, while cyp4d9 was overexpressed in 791spin compared to spinosad-susceptible strains. GSTs, ESTs and UGTs were mostly overexpressed, but not to the same degree as P450s. We present a comprehensive and comparative picture of gene expression in three housefly......Background The housefly is a global pest that has developed resistance to most insecticides applied against it. Resistance of the spinosad-resistant strain 791spin and the neonicotinoid-resistant 766b strain is believed to be due to metabolism. We investigate differentially expressed genes...

The identification of candidate rice genes that confer resistance to the brown planthopper (Nilaparvata lugens) through representational difference analysis.

Science.gov (United States)

Park, Dong-Soo; Lee, Sang-Kyu; Lee, Jong-Hee; Song, Min-Young; Song, Song-Yi; Kwak, Do-Yeon; Yeo, Un-Sang; Jeon, Nam-Soo; Park, Soo-Kwon; Yi, Gihwan; Song, You-Chun; Nam, Min-Hee; Ku, Yeon-Chung; Jeon, Jong-Seong

2007-08-01

The development of rice varieties (Oryza sativa L.) that are resistant to the brown planthopper (BPH; Nilaparvata lugens Stål) is an important objective in current breeding programs. In this study, we generated 132 BC(5)F(5) near-isogenic rice lines (NILs) by five backcrosses of Samgangbyeo, a BPH resistant indica variety carrying the Bph1 locus, with Nagdongbyeo, a BPH susceptible japonica variety. To identify genes that confer BPH resistance, we employed representational difference analysis (RDA) to detect transcripts that were exclusively expressed in one of our BPH resistant NIL, SNBC61, during insect feeding. The chromosomal mapping of the RDA clones that we subsequently isolated revealed that they are located in close proximity either to known quantitative trait loci or to an introgressed SSR marker from the BPH resistant donor parent Samgangbyeo. Genomic DNA gel-blot analysis further revealed that loci of all RDA clones in SNBC61 correspond to the alleles of Samgangbyeo. Most of the RDA clones were found to be exclusively expressed in SNBC61 and could be assigned to functional groups involved in plant defense. These RDA clones therefore represent candidate defense genes for BPH resistance.

RNA-Seq analysis reveals candidate genes for ontogenic resistance in Malus-Venturia pathosystem.

Directory of Open Access Journals (Sweden)

Michele Gusberti

Full Text Available Ontogenic scab resistance in apple leaves and fruits is a horizontal resistance against the plant pathogen Venturia inaequalis and is expressed as a decrease in disease symptoms and incidence with the ageing of the leaves. Several studies at the biochemical level tried to unveil the nature of this resistance; however, no conclusive results were reported. We decided therefore to investigate the genetic origin of this phenomenon by performing a full quantitative transcriptome sequencing and comparison of young (susceptible and old (ontogenic resistant leaves, infected or not with the pathogen. Two time points at 72 and 96 hours post-inoculation were chosen for RNA sampling and sequencing. Comparison between the different conditions (young and old leaves, inoculated or not should allow the identification of differentially expressed genes which may represent different induced plant defence reactions leading to ontogenic resistance or may be the cause of a constitutive (uninoculated with the pathogen shift toward resistance in old leaves. Differentially expressed genes were then characterised for their function by homology to A. thaliana and other plant genes, particularly looking for genes involved in pathways already suspected of appertaining to ontogenic resistance in apple or other hosts, or to plant defence mechanisms in general. IN THIS WORK, FIVE CANDIDATE GENES PUTATIVELY INVOLVED IN THE ONTOGENIC RESISTANCE OF APPLE WERE IDENTIFIED: a gene encoding an "enhanced disease susceptibility 1 protein" was found to be down-regulated in both uninoculated and inoculated old leaves at 96 hpi, while the other four genes encoding proteins (metallothionein3-like protein, lipoxygenase, lipid transfer protein, and a peroxidase 3 were found to be constitutively up-regulated in inoculated and uninoculated old leaves. The modulation of the five candidate genes has been validated using the real-time quantitative PCR. Thus, ontogenic resistance may be the result

Genetic mapping of the rice resistance-breaking gene of the brown planthopper Nilaparvata lugens.

Science.gov (United States)

Kobayashi, Tetsuya; Yamamoto, Kimiko; Suetsugu, Yoshitaka; Kuwazaki, Seigo; Hattori, Makoto; Jairin, Jirapong; Sanada-Morimura, Sachiyo; Matsumura, Masaya

2014-07-22

Host plant resistance has been widely used for controlling the major rice pest brown planthopper (BPH, Nilaparvata lugens). However, adaptation of the wild BPH population to resistance limits the effective use of resistant rice varieties. Quantitative trait locus (QTL) analysis was conducted to identify resistance-breaking genes against the anti-feeding mechanism mediated by the rice resistance gene Bph1. QTL analysis in iso-female BPH lines with single-nucleotide polymorphism (SNP) markers detected a single region on the 10th linkage group responsible for the virulence. The QTL explained from 57 to 84% of the total phenotypic variation. Bulked segregant analysis with next-generation sequencing in F2 progenies identified five SNPs genetically linked to the virulence. These analyses showed that virulence to Bph1 was controlled by a single recessive gene. In contrast to previous studies, the gene-for-gene relationship between the major resistance gene Bph1 and virulence gene of BPH was confirmed. Identified markers are available for map-based cloning of the major gene controlling BPH virulence to rice resistance. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

First report in Africa of two clinical isolates of Proteus mirabilis carrying Salmonella genomic island (SGI1) variants, SGI1-PmABB and SGI1-W.

Science.gov (United States)

Soliman, Ahmed M; Ahmed, Ashraf M; Shimamoto, Toshi; El-Domany, Ramadan A; Nariya, Hirofumi; Shimamoto, Tadashi

2017-07-01

Two Proteus mirabilis strains, designated PmTAN59 and PmKAF126, were isolated from two different Egyptian cities in 2014 and 2015, respectively. PmTAN59 was isolated from a sputum swab from a pneumonia patient in Tanta University Teaching Hospital. PmKAF126 was isolated from a patient with a diabetic foot infection in a hospital in the city of Kafr El-Sheikh. The two isolates were identified with bacterial small ribosomal RNA (16S rRNA) gene amplification and sequencing and tested for antimicrobial sensitivity with a Kirby-Bauer disk diffusion assay. The two strains were resistant to amoxicillin/clavulante, ampicillin, cefotaxime, cefoxitin, ceftriaxone, chloramphenicol, ciprofloxacin, colistin, gentamicin, kanamycin, nalidixic acid, spectinomycin, streptomycin, sulfamethoxazole/trimethoprime, and tetracycline, but sensitive to aztreonam, imipenem, and meropenem. Molecular characterization was used to map the entire backbone, including the multiple antibiotic resistance (MDR) region, of Salmonella genomic island 1 (SGI1). Both isolates carried a structure similar to SGI1, with two different MDR regions corresponding to SGI1-PmABB in PmTAN59 and SGI1-W in PmKAF126. SGI1-PmABB carried an integron of ~1.5kb with a two-gene cassette, aacCA5-aadA7, which confers resistance to gentamicin, streptomycin, and spectinomycin, whereas SGI1-W carried an integron of ~1.9kb containing aadA2-lnuF, which confers resistance to spectinomycin, streptomycin, and lincosamides. PmKAF126 carried the entire SGI1 sequence, however PmTAN59 carried a SGI1 structure with a deletion in the region from ORF S005 to ORF S009 and accompanied by insertion of IS1359 (1258bp). Furthermore, PmTAN59 carried class 2 integron of ~2.2kb containing dfrA1-sat2-aadA1. An ERIC-PCR analysis detected no clonal relationship between the two strains. Molecular screening for other antimicrobial resistance genes and a plasmid analysis indicated that PmTAN59 carried an IncFIB plasmid type. This strain also carried bla

First Identification of a Patient Colonized With Klebsiella pneumoniae Carrying blaNDM-1 in Taiwan

Directory of Open Access Journals (Sweden)

Hua-Shin Wu

2010-11-01

Full Text Available New Delhi metallo-β-lactamase 1 (NDM-1 is a novel type of metallo-β-lactamase (MBL. Enterobacteriaceae carrying this NDM-1 encoding gene, blaNDM-1, have been identified worldwide. Bacteria carrying blaNDM-1 are not only resistant to carbapenem, but also highly resistant to many classes of antibiotics, which indicate the importance of prompt identification of these bacteria and implementation of strict infection control measures to prevent their transmission. Here, we report the first identification and management of a patient colonized with Klebsiella pneumoniae carrying blaNDM-1 in Taiwan, who returned from New Delhi where he had been hospitalized for a gun-shot injury.

Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

Science.gov (United States)

The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

The powdery mildew resistance gene Pm8 derived from rye is suppressed by its wheat ortholog Pm3.

Science.gov (United States)

Hurni, Severine; Brunner, Susanne; Stirnweis, Daniel; Herren, Gerhard; Peditto, David; McIntosh, Robert A; Keller, Beat

2014-09-01

The powdery mildew resistance gene Pm8 derived from rye is located on a 1BL.1RS chromosome translocation in wheat. However, some wheat lines with this translocation do not show resistance to isolates of the wheat powdery mildew pathogen avirulent to Pm8 due to an unknown genetically dominant suppression mechanism. Here we show that lines with suppressed Pm8 activity contain an intact and expressed Pm8 gene. Therefore, the absence of Pm8 function in certain 1BL.1RS-containing wheat lines is not the result of gene loss or mutation but is based on suppression. The wheat gene Pm3, an ortholog of rye Pm8, suppressed Pm8-mediated powdery mildew resistance in lines containing Pm8 in a transient single-cell expression assay. This result was further confirmed in transgenic lines with combined Pm8 and Pm3 transgenes. Expression analysis revealed that suppression is not the result of gene silencing, either in wheat 1BL.1RS translocation lines carrying Pm8 or in transgenic genotypes with both Pm8 and Pm3 alleles. In addition, a similar abundance of the PM8 and PM3 proteins in single or double homozygous transgenic lines suggested that a post-translational mechanism is involved in suppression of Pm8. Co-expression of Pm8 and Pm3 genes in Nicotiana benthamiana leaves followed by co-immunoprecipitation analysis showed that the two proteins interact. Therefore, the formation of a heteromeric protein complex might result in inefficient or absent signal transmission for the defense reaction. These data provide a molecular explanation for the suppression of resistance genes in certain genetic backgrounds and suggest ways to circumvent it in future plant breeding. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

Directory of Open Access Journals (Sweden)

Tiane Martin de Moura

2012-10-01

Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

Fine mapping and identification of a candidate gene for the barley Un8 true loose smut resistance gene.

Science.gov (United States)

Zang, Wen; Eckstein, Peter E; Colin, Mark; Voth, Doug; Himmelbach, Axel; Beier, Sebastian; Stein, Nils; Scoles, Graham J; Beattie, Aaron D

2015-07-01

The candidate gene for the barley Un8 true loose smut resistance gene encodes a deduced protein containing two tandem protein kinase domains. In North America, durable resistance against all known isolates of barley true loose smut, caused by the basidiomycete pathogen Ustilago nuda (Jens.) Rostr. (U. nuda), is under the control of the Un8 resistance gene. Previous genetic studies mapped Un8 to the long arm of chromosome 5 (1HL). Here, a population of 4625 lines segregating for Un8 was used to delimit the Un8 gene to a 0.108 cM interval on chromosome arm 1HL, and assign it to fingerprinted contig 546 of the barley physical map. The minimal tilling path was identified for the Un8 locus using two flanking markers and consisted of two overlapping bacterial artificial chromosomes. One gene located close to a marker co-segregating with Un8 showed high sequence identity to a disease resistance gene containing two kinase domains. Sequence of the candidate gene from the parents of the segregating population, and in an additional 19 barley lines representing a broader spectrum of diversity, showed there was no intron in alleles present in either resistant or susceptible lines, and fifteen amino acid variations unique to the deduced protein sequence in resistant lines differentiated it from the deduced protein sequences in susceptible lines. Some of these variations were present within putative functional domains which may cause a loss of function in the deduced protein sequences within susceptible lines.

Candidate genes revealed by a genome scan for mosquito resistance to a bacterial insecticide: sequence and gene expression variations

Directory of Open Access Journals (Sweden)

David Jean-Philippe

2009-11-01

Full Text Available Abstract Background Genome scans are becoming an increasingly popular approach to study the genetic basis of adaptation and speciation, but on their own, they are often helpless at identifying the specific gene(s or mutation(s targeted by selection. This shortcoming is hopefully bound to disappear in the near future, thanks to the wealth of new genomic resources that are currently being developed for many species. In this article, we provide a foretaste of this exciting new era by conducting a genome scan in the mosquito Aedes aegypti with the aim to look for candidate genes involved in resistance to Bacillus thuringiensis subsp. israelensis (Bti insecticidal toxins. Results The genome of a Bti-resistant and a Bti-susceptible strains was surveyed using about 500 MITE-based molecular markers, and the loci showing the highest inter-strain genetic differentiation were sequenced and mapped on the Aedes aegypti genome sequence. Several good candidate genes for Bti-resistance were identified in the vicinity of these highly differentiated markers. Two of them, coding for a cadherin and a leucine aminopeptidase, were further examined at the sequence and gene expression levels. In the resistant strain, the cadherin gene displayed patterns of nucleotide polymorphisms consistent with the action of positive selection (e.g. an excess of high compared to intermediate frequency mutations, as well as a significant under-expression compared to the susceptible strain. Conclusion Both sequence and gene expression analyses agree to suggest a role for positive selection in the evolution of this cadherin gene in the resistant strain. However, it is unlikely that resistance to Bti is conferred by this gene alone, and further investigation will be needed to characterize other genes significantly associated with Bti resistance in Ae. aegypti. Beyond these results, this article illustrates how genome scans can build on the body of new genomic information (here, full

Novel Aminoglycoside Resistance Transposons and Transposon-Derived Circular Forms Detected in Carbapenem-Resistant Acinetobacter baumannii Clinical Isolates

Science.gov (United States)

Dwibedi, Chinmay Kumar; Sjöström, Karin; Edquist, Petra; Wai, Sun Nyunt; Uhlin, Bernt Eric

2016-01-01

Acinetobacter baumannii has emerged as an important opportunistic pathogen equipped with a growing number of antibiotic resistance genes. Our study investigated the molecular epidemiology and antibiotic resistance features of 28 consecutive carbapenem-resistant clinical isolates of A. baumannii collected throughout Sweden in 2012 and 2013. The isolates mainly belonged to clonal complexes (CCs) with an extensive international distribution, such as CC2 (n = 16) and CC25 (n = 7). Resistance to carbapenems was related to blaOXA-23 (20 isolates), blaOXA-24/40-like (6 isolates), blaOXA-467 (1 isolate), and ISAba1-blaOXA-69 (1 isolate). Ceftazidime resistance was associated with blaPER-7 in the CC25 isolates. Two classical point mutations were responsible for resistance to quinolones in all the isolates. Isolates with high levels of resistance to aminoglycosides carried the 16S rRNA methylase armA gene. The isolates also carried a variety of genes encoding aminoglycoside-modifying enzymes. Several novel structures involved in aminoglycoside resistance were identified, including Tn6279, ΔTn6279, Ab-ST3-aadB, and different assemblies of Tn6020 and TnaphA6. Importantly, a number of circular forms related to the IS26 or ISAba125 composite transposons were detected. The frequent occurrence of these circular forms in the populations of several isolates indicates a potential role of these circular forms in the dissemination of antibiotic resistance genes. PMID:26824943

Characterization of resistance to tetracyclines and aminoglycosides of sheep mastitis pathogens: study of the effect of gene content on resistance.

Science.gov (United States)

Lollai, S A; Ziccheddu, M; Duprè, I; Piras, D

2016-10-01

Mastitis causes economic losses and antimicrobials are frequently used for mastitis treatment. Antimicrobial resistance surveys are still rare in the ovine field and characterization of strains is important in order to acquire information about resistance and for optimization of therapy. Bacterial pathogens recovered in milk samples from mastitis-affected ewes were characterized for resistance to tetracyclines and aminoglycosides, members of which are frequently used antimicrobials in small ruminants. A total of 185 strains of staphylococci, streptococci, and enterococci, common mastitis pathogens, were tested for minimal inhibitory concentration (MIC) to tetracycline, doxycycline, minocycline, gentamicin, kanamycin, streptomycin, and for resistance genes by PCR. Effects of different tet genes arrangements on MICs were also investigated. Staphylococci expressed the lowest MIC for tetracycline and tet(K) was the most common gene recovered; tet(M) and tet(O) were also found. Gene content was shown to influence the tetracycline MIC values. Enterococci and streptococci showed higher MICs to tetracyclines and nonsusceptible strains always harboured at least one ribosomal protection gene (MIC above 8 μg ml(-1) ). Streptococci often harboured two or more tet determinants. As regards the resistance to aminoglycosides, staphylococci showed the lowest gentamicin and kanamycin median MIC along with streptomycin high level resistant (HLR) strains (MIC >1024 μg ml(-1) ) all harbouring str gene. The resistance determinant aac(6')-Ie-aph(2″)-Ia was present in few strains. Streptococci were basically nonsusceptible to aminoglycosides but neither HLR isolates nor resistance genes were detected. Enterococci revealed the highest MICs for gentamicin; two str harbouring isolates were shown to be HLR to streptomycin. Evidence was obtained for the circulation of antimicrobial-resistant strains and genes in sheep dairy farming. Tetracycline MIC of 64 μg ml(-1) and high

The role of Cercospora zeae-maydis homologs of Rhodobacter sphaeroides 1O2-resistance genes in resistance to the photoactivated toxin cercosporin.

Science.gov (United States)

Beseli, Aydin; Goulart da Silva, Marilia; Daub, Margaret E

2015-01-01

The photosynthetic bacterium Rhodobacter sphaeroides and plant pathogenic fungus Cercospora nicotianae have been used as models for understanding resistance to singlet oxygen ((1)O(2)), a highly toxic reactive oxygen species. In Rhodobacter and Cercospora, (1)O(2) is derived, respectively, from photosynthesis and from the (1)O(2)-generating toxin cercosporin which the fungus produces to parasitize plants. We identified common genes recovered in transcriptome studies of putative (1)O(2)-resistance genes in these two systems, suggesting common (1)O(2)-resistance mechanisms. To determine if the Cercospora homologs of R. sphaeroides (1)O(2)-resistance genes are involved in resistance to cercosporin, we expressed the genes in the cercosporin-sensitive fungus Neurospora crassa and assayed for increases in cercosporin resistance. Neurospora crassa transformants expressing genes encoding aldo/keto reductase, succinyl-CoA ligase, O-acetylhomoserine (thiol) lyase, peptide methionine sulphoxide reductase and glutathione S-transferase did not have elevated levels of cercosporin resistance. Several transformants expressing aldehyde dehydrogenase were significantly more resistant to cercosporin. Expression of the transgene and enzyme activity did not correlate with resistance, however. We conclude that although the genes tested in this study are important in (1)O(2) resistance in R. sphaeroides, their Cercospora homologs are not involved in resistance to (1)O(2) generated from cercosporin. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Induced multiple disease resistance in wheat

International Nuclear Information System (INIS)

Borojevic, K.; Worland, A.J.

1990-01-01

Full text: The existence of genes suppressing resistance to leaf rust, stem rust and yellow rust in hexaploid wheat has been suggested. If such genes are deleted or inactivated, a more resistant variety may be obtained. In mutant lines of the wheat variety San Pastore, selected after treatment with 20,000 rad of gamma-rays, resistance to leaf rust, yellow rust, stem rust, and to some extent to Erysiphe graminis was determined. The mutants responded to infection by producing necrotic flecks in the presence of high level of disease inoculum. Similar flecks develop under stress condition. It is likely that the mother variety San Pastore carries genes for resistance which are masked by suppressor genes. Irradiation inactivates suppressors so that resistance genes which were previously masked are expressed. The first results of monosomic analysis indicate that chromosomes of groups 4 and 5 or possibly 7 may be critical for expression of resistance in the mutant lines. (author)

Mapping fusiform rust resistance genes within a complex mating design of loblolly pine

Science.gov (United States)

Tania Quesada; Marcio F.R. Resende Jr.; Patricio Munoz; Jill L. Wegrzyn; David B. Neale; Matias Kirst; Gary F. Peter; Salvador A. Gezan; C.Dana Nelson; John M. Davis

2014-01-01

Fusiform rust resistance can involve gene-for-gene interactions where resistance (Fr) genes in the host interact with corresponding avirulence genes in the pathogen, Cronartium quercuum f.sp. fusiforme (Cqf). Here, we identify trees with Fr genes in a loblolly pine population derived from a complex mating design challenged with two Cqf inocula (one gall and 10 gall...

Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

Science.gov (United States)

Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

2017-12-19

WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

Antibiotic-resistant genes and antibiotic-resistant bacteria in the effluent of urban residential areas, hospitals, and a municipal wastewater treatment plant system.

Science.gov (United States)

Li, Jianan; Cheng, Weixiao; Xu, Like; Strong, P J; Chen, Hong

2015-03-01

In this study, we determined the abundance of 8 antibiotics (3 tetracyclines, 4 sulfonamides, and 1 trimethoprim), 12 antibiotic-resistant genes (10 tet, 2 sul), 4 antibiotic-resistant bacteria (tetracycline, sulfamethoxazole, and combined resistance), and class 1 integron integrase gene (intI1) in the effluent of residential areas, hospitals, and municipal wastewater treatment plant (WWTP) systems. The concentrations of total/individual targets (antibiotics, genes, and bacteria) varied remarkably among different samples, but the hospital samples generally had a lower abundance than the residential area samples. The WWTP demonstrated removal efficiencies of 50.8% tetracyclines, 66.8% sulfonamides, 0.5 logs to 2.5 logs tet genes, and less than 1 log of sul and intI1 genes, as well as 0.5 log to 1 log removal for target bacteria. Except for the total tetracycline concentration and the proportion of tetracycline-resistant bacteria (R (2) = 0.330, P antibiotics and the corresponding resistant bacteria (P > 0.05). In contrast, various relationships were identified between antibiotics and antibiotic resistance genes (P antibiotic-resistant bacteria (P < 0.01).

The NB-LRR gene Pm60 confers powdery mildew resistance in wheat.

Science.gov (United States)

Zou, Shenghao; Wang, Huan; Li, Yiwen; Kong, Zhaosheng; Tang, Dingzhong

2018-04-01

Powdery mildew is one of the most devastating diseases of wheat. To date, few powdery mildew resistance genes have been cloned from wheat due to the size and complexity of the wheat genome. Triticum urartu is the progenitor of the A genome of wheat and is an important source for powdery mildew resistance genes. Using molecular markers designed from scaffolds of the sequenced T. urartu accession and standard map-based cloning, a powdery mildew resistance locus was mapped to a 356-kb region, which contains two nucleotide-binding and leucine-rich repeat domain (NB-LRR) protein-encoding genes. Virus-induced gene silencing, single-cell transient expression, and stable transformation assays demonstrated that one of these two genes, designated Pm60, confers resistance to powdery mildew. Overexpression of full-length Pm60 and two allelic variants in Nicotiana benthamiana leaves induced hypersensitive cell death response, but expression of the coiled-coil domain alone was insufficient to induce hypersensitive response. Yeast two-hybrid, bimolecular fluorescence complementation and luciferase complementation imaging assays showed that Pm60 protein interacts with its neighboring NB-containing protein, suggesting that they might be functionally related. The identification and cloning of this novel wheat powdery mildew resistance gene will facilitate breeding for disease resistance in wheat. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

Environmental factors responsible for the incidence of antibiotic resistance genes in pristine Crassostrea virginica reefs

International Nuclear Information System (INIS)

Barkovskii, Andrei L.; Thomas, Michael; Hurley, Dorset; Teems, Clifford

2012-01-01

Highlights: ► Estuary was the major source of antibiotic resistance genes (ARG) for tidal creeks. ► Watersheds were the secondary source of ARG for tidal creeks. ► Watershed contribution corresponded to the degree of its anthropogenic disturbance. ► ARG in tidal creeks were carried by native hosts preferring low termohaline niches. ► ARG incidence was the highest in oysters implying ARG bioaccumulation/proliferation. - Abstract: The occurrence of tetracycline resistance (TRG) and integrase (INT) genes were monitored in Crassostrea virginica oyster reefs of three pristine creeks (SINERR, Georgia, USA). Their profiles revealed 85% similarity with the TRG/INT profiles observed in the adjacent to the SINERR and contaminated Altamaha River estuary (Barkovskii et al., 2010). The TRG/INT spectra and incidence frequencies corresponded to the source of oceanic input and to run-offs from creeks’ watersheds. The highest incidence frequencies and concentrations were observed in oysters. TRG/INT incidences correlated positively (Spearman Rank = 0.88), and negatively correlated (−0.63 to −0.79) with creek salinity, conductivity, dissolved solids, and temperature. Coliform incidence positively correlated with temperature, and not with the TRG/INT incidence. The Altamaha River estuary was the primary TRG/INT source for the reefs with contributions from creek’s watersheds. TRG/INT were carried by non-coliforms with a preference for low-to-temperate thermohaline environments coupled with bioaccumulation by oysters.

Genetic analysis of a novel broad-spectrum powdery mildew resistance gene from the wheat-Agropyron cristatum introgression line Pubing 74.

Science.gov (United States)

Lu, Yuqing; Yao, Miaomiao; Zhang, Jinpeng; Song, Liqiang; Liu, Weihua; Yang, Xinming; Li, Xiuquan; Li, Lihui

2016-09-01

A novel broad-spectrum powdery mildew resistance gene PmPB74 was identified in wheat- Agropyron cristatum introgression line Pubing 74. Development of wheat cultivars with broad-spectrum, durable resistance to powdery mildew has been restricted by lack of superior genetic resources. In this study, a wheat-A. cristatum introgression line Pubing 74, originally selected from a wide cross between the common wheat cultivar Fukuhokomugi (Fukuho) and Agropyron cristatum (L.) Gaertn (2n = 4x = 28; genome PPPP), displayed resistance to powdery mildew at both the seedling and adult stages. The putative alien chromosomal fragment in Pubing 74 was below the detection limit of genomic in situ hybridization (GISH), but evidence for other non-GISH-detectable introgressions was provided by the presence of three STS markers specific to A. cristatum. Genetic analysis indicated that Pubing 74 carried a single dominant gene for powdery mildew resistance, temporarily designated PmPB74. Molecular mapping showed that PmPB74 was located on wheat chromosome arm 5DS, and flanked by markers Xcfd81 and HRM02 at genetic distances of 2.5 and 1.7 cM, respectively. Compared with other lines with powdery mildew resistance gene(s) on wheat chromosome arm 5DS, Pubing 74 was resistant to all 28 Blumeria graminis f. sp tritici (Bgt) isolates from different wheat-producing regions of northern China. Allelism tests indicated that PmPB74 was not allelic to PmPB3558 or Pm2. Our work showed that PmPB74 is a novel gene with broad resistance to powdery mildew, and hence will be helpful in broadening the genetic basis of powdery mildew resistance in wheat.

Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

Science.gov (United States)

Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian

2013-01-01

We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

Directory of Open Access Journals (Sweden)

Peter Schierack

Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

DNA sequence analysis of plasmids from multidrug resistant Salmonella enterica serotype Heidelberg isolates.

Directory of Open Access Journals (Sweden)

Jing Han

Full Text Available Salmonella enterica serovar Heidelberg is among the most detected serovars in swine and poultry, ranks among the top five serotypes associated with human salmonellosis and is disproportionately associated with invasive infections and mortality in humans. Salmonella are known to carry plasmids associated with antimicrobial resistance and virulence. To identify plasmid-associated genes in multidrug resistant S. enterica serovar Heidelberg, antimicrobial resistance plasmids from five isolates were sequenced using the 454 LifeSciences pyrosequencing technology. Four of the isolates contained incompatibility group (Inc A/C multidrug resistance plasmids harboring at least eight antimicrobial resistance genes. Each of these strains also carried a second resistance plasmid including two IncFIB, an IncHI2 and a plasmid lacking an identified Inc group. The fifth isolate contained an IncI1 plasmid, encoding resistance to gentamicin, streptomycin and sulfonamides. Some of the IncA/C plasmids lacked the full concert of transfer genes and yet were able to be conjugally transferred, likely due to the transfer genes carried on the companion plasmids in the strains. Several non-IncA/C resistance plasmids also carried putative virulence genes. When the sequences were compared to previously sequenced plasmids, it was found that while all plasmids demonstrated some similarity to other plasmids, they were unique, often due to differences in mobile genetic elements in the plasmids. Our study suggests that Salmonella Heidelberg isolates harbor plasmids that co-select for antimicrobial resistance and virulence, along with genes that can mediate the transfer of plasmids within and among other bacterial isolates. Prevalence of such plasmids can complicate efforts to control the spread of S. enterica serovar Heidelberg in food animal and human populations.

Antimicrobial susceptibility and occurrence of resistance genes among Salmonella enterica serovar Weltevreden from different countries

DEFF Research Database (Denmark)

Aarestrup, Frank Møller; Lertworapreecha, M.; Evans, M.C.

2003-01-01

and gentamicin. All nine ampicillin-resistant isolates contained a sequence similar to the bla(TEM-1b) gene, one of the eight chloramphenicol-resistant isolates a sequence similar to the catA1 gene, all three neomycin-resistant isolates a sequence similar to the aphA-2 gene, 16 (73%) of the 22 streptomycin...... isolates were examined for susceptibility to antimicrobial agents, and resistant isolates were examined for the presence of selected resistance genes by PCR. Results: Only 48 (9.5%) of the isolates were resistant to one or more of the antimicrobial agents tested. A low frequency of resistance was found...

Genome-Wide Association Study for Identification and Validation of Novel SNP Markers for Sr6 Stem Rust Resistance Gene in Bread Wheat.

Science.gov (United States)

Mourad, Amira M I; Sallam, Ahmed; Belamkar, Vikas; Wegulo, Stephen; Bowden, Robert; Jin, Yue; Mahdy, Ezzat; Bakheit, Bahy; El-Wafaa, Atif A; Poland, Jesse; Baenziger, Peter S

2018-01-01

Stem rust (caused by Puccinia graminis f. sp. tritici Erikss. & E. Henn.), is a major disease in wheat ( Triticum aestivium L.). However, in recent years it occurs rarely in Nebraska due to weather and the effective selection and gene pyramiding of resistance genes. To understand the genetic basis of stem rust resistance in Nebraska winter wheat, we applied genome-wide association study (GWAS) on a set of 270 winter wheat genotypes (A-set). Genotyping was carried out using genotyping-by-sequencing and ∼35,000 high-quality SNPs were identified. The tested genotypes were evaluated for their resistance to the common stem rust race in Nebraska (QFCSC) in two replications. Marker-trait association identified 32 SNP markers, which were significantly (Bonferroni corrected P < 0.05) associated with the resistance on chromosome 2D. The chromosomal location of the significant SNPs (chromosome 2D) matched the location of Sr6 gene which was expected in these genotypes based on pedigree information. A highly significant linkage disequilibrium (LD, r 2 ) was found between the significant SNPs and the specific SSR marker for the Sr6 gene ( Xcfd43 ). This suggests the significant SNP markers are tagging Sr6 gene. Out of the 32 significant SNPs, eight SNPs were in six genes that are annotated as being linked to disease resistance in the IWGSC RefSeq v1.0. The 32 significant SNP markers were located in nine haplotype blocks. All the 32 significant SNPs were validated in a set of 60 different genotypes (V-set) using single marker analysis. SNP markers identified in this study can be used in marker-assisted selection, genomic selection, and to develop KASP (Kompetitive Allele Specific PCR) marker for the Sr6 gene. Novel SNPs for Sr6 gene, an important stem rust resistant gene, were identified and validated in this study. These SNPs can be used to improve stem rust resistance in wheat.

Paradoxical DNA repair and peroxide resistance gene conservation in Bacillus pumilus SAFR-032.

Directory of Open Access Journals (Sweden)

Jason Gioia

Full Text Available BACKGROUND: Bacillus spores are notoriously resistant to unfavorable conditions such as UV radiation, gamma-radiation, H2O2, desiccation, chemical disinfection, or starvation. Bacillus pumilus SAFR-032 survives standard decontamination procedures of the Jet Propulsion Lab spacecraft assembly facility, and both spores and vegetative cells of this strain exhibit elevated resistance to UV radiation and H2O2 compared to other Bacillus species. PRINCIPAL FINDINGS: The genome of B. pumilus SAFR-032 was sequenced and annotated. Lists of genes relevant to DNA repair and the oxidative stress response were generated and compared to B. subtilis and B. licheniformis. Differences in conservation of genes, gene order, and protein sequences are highlighted because they potentially explain the extreme resistance phenotype of B. pumilus. The B. pumilus genome includes genes not found in B. subtilis or B. licheniformis and conserved genes with sequence divergence, but paradoxically lacks several genes that function in UV or H2O2 resistance in other Bacillus species. SIGNIFICANCE: This study identifies several candidate genes for further research into UV and H2O2 resistance. These findings will help explain the resistance of B. pumilus and are applicable to understanding sterilization survival strategies of microbes.

Prevalence and characteristics of extended-spectrum β-lactamase and plasmid-mediated fluoroquinolone resistance genes in Escherichia coli isolated from chickens in Anhui province, China.

Directory of Open Access Journals (Sweden)

Lin Li

Full Text Available The aim of this study was to characterize the prevalence of extended-spectrum β-lactamase (ESBL genes and plasmid-mediated fluoroquinolone resistance (PMQR determinants in 202 Escherichia coli isolates from chickens in Anhui Province, China, and to determine whether ESBL and PMQR genes co-localized in the isolates. Antimicrobial susceptibility for 12 antimicrobials was determined by broth microdilution. Polymerase chain reactions (PCRs, DNA sequencing, and pulsed field gel electrophoresis (PFGE were employed to characterize the molecular basis for β-lactam and fluoroquinolone resistance. High rates of antimicrobial resistance were observed, 147 out of the 202 (72.8% isolates were resistant to at least 6 antimicrobial agents and 28 (13.9% of the isolates were resistant to at least 10 antimicrobials. The prevalence of blaCTX-M, blaTEM-1 and blaTEM-206 genes was 19.8%, 24.3% and 11.9%, respectively. Seventy-five out of the 202 (37.1% isolates possessed a plasmid-mediated quinolone resistance determinant in the form of qnrS (n = 21; this determinant occurred occasionally in combination with aac(6'-1b-cr (n = 65. Coexistence of ESBL and/or PMQR genes was identified in 31 of the isolates. Two E. coli isolates carried blaTEM-1, blaCTX-M and qnrS, while two others carried blaCTX-M, qnrS and aac(6'-1b-cr. In addition, blaTEM-1, qnrS and aac(6'-1b-cr were co-located in two other E. coli isolates. PFGE analysis showed that these isolates were not clonally related and were genetically diverse. To the best of our knowledge, this study is the first to describe detection of TEM-206-producing E. coli in farmed chickens, and the presence of blaTEM-206, qnrS and aac(6'-1b-cr in one of the isolates.

Effective genes for resistance to stripe rust and virulence of Puccinia ...

African Journals Online (AJOL)

The results revealed that stripe rust resistance genes Yr3, Yr5, Yr10, Yr15, Yr26, YrSP and YrCV were resistant, while Yr18 showed moderate susceptibility at all locations. Genes YrA-, Yr2, Yr6, Yr7, Yr8, Yr9, Yr17, Yr27 and gene combinations Opata (Yr27+Yr18) and Super Kauz (Yr9, Yr27, Yr18) were found susceptible.

High prevalence of multidrug-resistant tuberculosis among patients with rifampicin resistance using GeneXpert Mycobacterium tuberculosis/rifampicin in Ghana.

Science.gov (United States)

Boakye-Appiah, Justice K; Steinmetz, Alexis R; Pupulampu, Peter; Ofori-Yirenkyi, Stephen; Tetteh, Ishmael; Frimpong, Michael; Oppong, Patrick; Opare-Sem, Ohene; Norman, Betty R; Stienstra, Ymkje; van der Werf, Tjip S; Wansbrough-Jones, Mark; Bonsu, Frank; Obeng-Baah, Joseph; Phillips, Richard O

2016-06-01

Drug-resistant strains of tuberculosis (TB) represent a major threat to global TB control. In low- and middle-income countries, resource constraints make it difficult to identify and monitor cases of resistance using drug susceptibility testing and culture. Molecular assays such as the GeneXpert Mycobacterium tuberculosis/rifampicin may prove to be a cost-effective solution to this problem in these settings. The objective of this study is to evaluate the use of GeneXpert in the diagnosis of pulmonary TB since it was introduced into two tertiary hospitals in Ghana in 2013. A 2-year retrospective audit of clinical cases involving patients who presented with clinically suspected TB or documented TB not improving on standard therapy and had samples sent for GeneXpert testing. GeneXpert identified 169 cases of TB, including 17 cases of rifampicin-resistant TB. Of the seven cases with final culture and drug susceptibility testing results, six demonstrated further drug resistance and five of these were multidrug-resistant TB. These findings call for a scale-up of TB control in Ghana and provide evidence that the expansion of GeneXpert may be an optimal means to improve case finding and guide treatment of drug-resistant TB in this setting. Copyright © 2016. Published by Elsevier Ltd.

Resistance genes in barley (Hordeum vulgare L.) and their identification with molecular markers.

Science.gov (United States)

Chełkowski, Jerzy; Tyrka, Mirosław; Sobkiewicz, Andrzej

2003-01-01

Current information on barley resistance genes available from scientific papers and on-line databases is summarised. The recent literature contains information on 107 major resistance genes (R genes) against fungal pathogens (excluding powdery mildew), pathogenic viruses and aphids identified in Hordeum vulgare accessions. The highest number of resistance genes was identified against Puccinia hordei, Rhynchosporium secalis, and the viruses BaYMV and BaMMV, with 17, 14 and 13 genes respectively. There is still a lot of confusion regarding symbols for R genes against powdery mildew. Among the 23 loci described to date, two regions Mla and Mlo comprise approximately 31 and 25 alleles. Over 50 R genes have already been localised and over 30 mapped on 7 barley chromosomes. Four barley R genes have been cloned recently: Mlo, Rpg1, Mla1 and Mla6, and their structures (sequences) are available. The paper presents a catalogue of barley resistance gene symbols, their chromosomalocation and the list of available DNA markers useful in characterising cultivars and breeding accessions.

The presence of plasmid-mediated resistance genes among uropathogenes isolated from diabetic and non-diabetic patients with chronic pyelonephritis

Directory of Open Access Journals (Sweden)

O.I. Chub

2014-10-01

Full Text Available Increased multidrug resistance of extended-spectrum beta-lactamases (ESBLs compromises the efficacy of treatment of urinary tract infections. The objective of this study is to determine the prevalence of ESBL-producing uropathogens from patients with chronic pyelonephritis (CP and to evaluate the risk factors of these types of infections. Screening for the presence of plasmid-mediated ESBL was performed by polymerase chain reaction. Out of 105 patients, 22 (20.9% revealed strains with resistance genes: 11 (36.7%, 11 (36.7% and 8 (26.7% were identified to carry bla(TEM, bla(SHV and bla(CTX-M beta-lactamase genes, respectively. We have demonstrated that prevalence of the resistance among patients with CP combined with type 2 DM was 31.3%, while among patients with CP without type 2 DM was 27.4%; however the difference between these groups was not significant. The main factors related with appearance of plasmid-mediated resistance genes were age range above 55 years, Chronic Kidney Disease stage ІІІ and ІV, in-patient treatment history, history of using antibiotics last year. Isolation and detection of ESBL-producing strains are essential fоr the sеlection оf the mоst effеctive antibiоtic for the empiric trеatment.

Identification and characterization of potential NBS-encoding resistance genes and induction kinetics of a putative candidate gene associated with downy mildew resistance in Cucumis

Directory of Open Access Journals (Sweden)

Wan Hongjian

2010-08-01

Full Text Available Abstract Background Due to the variation and mutation of the races of Pseudoperonospora cubensis, downy mildew has in recent years become the most devastating leaf disease of cucumber worldwide. Novel resistance to downy mildew has been identified in the wild Cucumis species, C. hystrix Chakr. After the successful hybridization between C. hystrix and cultivated cucumber (C. sativus L., an introgression line (IL5211S was identified as highly resistant to downy mildew. Nucleotide-binding site and leucine-rich repeat (NBS-LRR genes are the largest class of disease resistance genes cloned from plant with highly conserved domains, which can be used to facilitate the isolation of candidate genes associated with downy mildew resistance in IL5211S. Results Degenerate primers that were designed based on the conserved motifs in the NBS domain of resistance (R proteins were used to isolate NBS-type sequences from IL5211S. A total of 28 sequences were identified and named as cucumber (C. sativus = CS resistance gene analogs as CSRGAs. Polygenetic analyses separated these sequences into four different classes. Quantitative real-time polymerase chain reaction (qRT-PCR analysis showed that these CSRGAs expressed at different levels in leaves, roots, and stems. In addition, introgression from C. hystrix induced expression of the partial CSRGAs in cultivated cucumber, especially CSRGA23, increased four-fold when compared to the backcross parent CC3. Furthermore, the expression of CSRGA23 under P. cubensis infection and abiotic stresses was also analyzed at different time points. Results showed that the P. cubensis treatment and four tested abiotic stimuli, MeJA, SA, ABA, and H2O2, triggered a significant induction of CSRGA23 within 72 h of inoculation. The results indicate that CSRGA23 may play a critical role in protecting cucumber against P. cubensis through a signaling the pathway triggered by these molecules. Conclusions Four classes of NBS-type RGAs were

Induced mutations of rust resistance genes in wheat

International Nuclear Information System (INIS)

McIntosh, R.A.

1983-01-01

Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

Overexpression of antibiotic resistance genes in hospital effluents over time

OpenAIRE

Rowe, Will P. M.; Baker-Austin, Craig; Verner-Jeffreys, David W.; Ryan, Jim J.; Micallef, Christianne; Maskell, Duncan J.; Pearce, Gareth P.

2017-01-01

$\\textbf{Objectives}$: Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varyi...

Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

Science.gov (United States)

Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

2007-07-10

Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

QTL mapping and transcriptome analysis of cowpea reveals candidate genes for root-knot nematode resistance.

Science.gov (United States)

Santos, Jansen Rodrigo Pereira; Ndeve, Arsenio Daniel; Huynh, Bao-Lam; Matthews, William Charles; Roberts, Philip Alan

2018-01-01

Cowpea is one of the most important food and forage legumes in drier regions of the tropics and subtropics. However, cowpea yield worldwide is markedly below the known potential due to abiotic and biotic stresses, including parasitism by root-knot nematodes (Meloidogyne spp., RKN). Two resistance genes with dominant effect, Rk and Rk2, have been reported to provide resistance against RKN in cowpea. Despite their description and use in breeding for resistance to RKN and particularly genetic mapping of the Rk locus, the exact genes conferring resistance to RKN remain unknown. In the present work, QTL mapping using recombinant inbred line (RIL) population 524B x IT84S-2049 segregating for a newly mapped locus and analysis of the transcriptome changes in two cowpea near-isogenic lines (NIL) were used to identify candidate genes for Rk and the newly mapped locus. A major QTL, designated QRk-vu9.1, associated with resistance to Meloidogyne javanica reproduction, was detected and mapped on linkage group LG9 at position 13.37 cM using egg production data. Transcriptome analysis on resistant and susceptible NILs 3 and 9 days after inoculation revealed up-regulation of 109 and 98 genes and down-regulation of 110 and 89 genes, respectively, out of 19,922 unique genes mapped to the common bean reference genome. Among the differentially expressed genes, four and nine genes were found within the QRk-vu9.1 and QRk-vu11.1 QTL intervals, respectively. Six of these genes belong to the TIR-NBS-LRR family of resistance genes and three were upregulated at one or more time-points. Quantitative RT-PCR validated gene expression to be positively correlated with RNA-seq expression pattern for eight genes. Future functional analysis of these cowpea genes will enhance our understanding of Rk-mediated resistance and identify the specific gene responsible for the resistance.

SolRgene: an online database to explore disease resistance genes in tuber-bearing Solanum species

Directory of Open Access Journals (Sweden)

Vleeshouwers Vivianne GAA

2011-08-01

Full Text Available Abstract Background The cultivated potato (Solanum tuberosum L. is an important food crop, but highly susceptible to many pathogens. The major threat to potato production is the Irish famine pathogen Phytophthora infestans, which causes the devastating late blight disease. Potato breeding makes use of germplasm from wild relatives (wild germplasm to introduce resistances into cultivated potato. The Solanum section Petota comprises tuber-bearing species that are potential donors of new disease resistance genes. The aim of this study was to explore Solanum section Petota for resistance genes and generate a widely accessible resource that is useful for studying and implementing disease resistance in potato. Description The SolRgene database contains data on resistance to P. infestans and presence of R genes and R gene homologues in Solanum section Petota. We have explored Solanum section Petota for resistance to late blight in high throughput disease tests under various laboratory conditions and in field trials. From resistant wild germplasm, segregating populations were generated and assessed for the presence of resistance genes. All these data have been entered into the SolRgene database. To facilitate genetic and resistance gene evolution studies, phylogenetic data of the entire SolRgene collection are included, as well as a tool for generating phylogenetic trees of selected groups of germplasm. Data from resistance gene allele-mining studies are incorporated, which enables detection of R gene homologs in related germplasm. Using these resources, various resistance genes have been detected and some of these have been cloned, whereas others are in the cloning pipeline. All this information is stored in the online SolRgene database, which allows users to query resistance data, sequences, passport data of the accessions, and phylogenic classifications. Conclusion Solanum section Petota forms the basis of the SolRgene database, which contains a

Cfr-mediated linezolid-resistance among methicillin-resistant coagulase-negative staphylococci from infections of humans.

Directory of Open Access Journals (Sweden)

Lanqing Cui

Full Text Available Four methicillin-resistant coagulase-negative staphylococci (MRCoNS, one Staphylococcus haemolyticus and three Staphylococcus cohnii, from infections of humans collected via the Ministry of Health National Antimicrobial Resistance Surveillance Net (Mohnarin program in China were identified as linezolid-resistant. These four isolates were negative for the 23S rRNA mutations, but positive for the gene cfr. Mutations in the gene for the ribosomal protein L3, which resulted in the amino acid exchanges Gly152Asp and Tyr158Phe, were identified in S. haemolyticus 09D279 and S. cohnii NDM113, respectively. In each isolate, the cfr gene was located on a plasmid of ca. 35.4 kb, as shown by S1 nuclease pulsed-field gel electrophoresis and Southern blotting experiments. This plasmid was indistinguishable from the previously described plasmid pSS-02 by its size, restriction pattern, and a sequenced 14-kb cfr-carrying segment. Plasmid pSS-02 was originally identified in staphylococci isolated from pigs. This is the first time that a cfr-carrying plasmid has been detected in MRCoNS obtained from intensive care patients in China. Based on the similarities to the cfr-carrying plasmid pSS-02 from porcine coagulase-negative staphylococci, a transmission of this cfr-carrying plasmid between staphylococci from pigs and humans appears to be likely.

Cfr-mediated linezolid-resistance among methicillin-resistant coagulase-negative staphylococci from infections of humans.

Science.gov (United States)

Cui, Lanqing; Wang, Yang; Li, Yun; He, Tao; Schwarz, Stefan; Ding, Yujing; Shen, Jianzhong; Lv, Yuan