WorldWideScience

Sample records for resistance genes carried

  1. Plasmids carrying antimicrobial resistance genes in Enterobacteriaceae

    NARCIS (Netherlands)

    Rozwandowicz, M.; Brouwer, M.S.M.; Fischer, J.; Wagenaar, J.A.; Gonzalez-Zorn, B.; Guerra, B.; Mevius, D.J.; Hordijk, J.

    2018-01-01

    Bacterial antimicrobial resistance (AMR) is constantly evolving and horizontal gene transfer through plasmids plays a major role. The identification of plasmid characteristics and their association with different bacterial hosts provides crucial knowledge that is essential to understand the

  2. Plant agricultural streptomycin formulations do not carry antibiotic resistance genes.

    Science.gov (United States)

    Rezzonico, Fabio; Stockwell, Virginia O; Duffy, Brion

    2009-07-01

    Streptomycin is used in plant agriculture for bacterial disease control, particularly against fire blight in pome fruit orchards. Concerns that this may increase environmental antibiotic resistance have led to bans or restrictions on use. Experience with antibiotic use in animal feeds raises the possible influence of formulation-delivered resistance genes. We demonstrate that agricultural streptomycin formulations do not carry producer organism resistance genes. By using an optimized extraction procedure, Streptomyces 16S rRNA genes and the streptomycin resistance gene strA were not detected in agricultural streptomycin formulations. This diminishes the likelihood for one potential factor in resistance development due to streptomycin use.

  3. Identification of virulence genes carried by bacteriophages obtained from clinically isolated methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Karasartova, Djursun; Cavusoglu, Zeynep Burcin; Turegun, Buse; Ozsan, Murat T; Şahin, Fikret

    2016-12-01

    Bacteriophages play an important role in the pathogenicity of Staphylococcus aureus (S. aureus) either by carrying accessory virulence factors or several superantigens. Despite their importance, there are not many studies showing the actual distribution of the virulence genes carried by the prophages obtained from the clinically isolated Staphylococcus. In this study, we investigated prophages obtained from methicillin-resistant S. aureus (MRSA) strains isolated from hospital- and community-associated (HA-CA) infections for the virulence factors. In the study, 43 phages isolated from 48 MRSA were investigated for carrying toxin genes including the sak, eta, lukF-PV, sea, selp, sek, seg, seq chp, and scn virulence genes using polymerase chain reaction (PCR) and Southern blot. Restriction fragment length polymorphism was used to analyze phage genomes to investigate the relationship between the phage profiles and the toxin genes' presence. MRSA strains isolated from HA infections tended to have higher prophage presence than the MRSA strains obtained from the CA infections (97% and 67%, respectively). The study showed that all the phages with the exception of one phage contained one or more virulence genes in their genomes with different combinations. The most common toxin genes found were sea (83%) followed by sek (77%) and seq (64%). The study indicates that prophages encode a significant proportion of MRSA virulence factors.

  4. Housefly (Musca domestica) and Blow Fly (Protophormia terraenovae) as Vectors of Bacteria Carrying Colistin Resistance Genes.

    Science.gov (United States)

    Zhang, Jilei; Wang, Jiawei; Chen, Li; Yassin, Afrah Kamal; Kelly, Patrick; Butaye, Patrick; Li, Jing; Gong, Jiansen; Cattley, Russell; Qi, Kezong; Wang, Chengming

    2018-01-01

    Flies have the capacity to transfer pathogens between different environments, acting as one of the most important vectors of human diseases worldwide. In this study, we trapped flies on a university campus and tested them for mobile resistance genes against colistin, a last-resort antibiotic in human medicine for treating clinical infections caused by multidrug-resistant Gram-negative bacteria. Quantitative PCR assays we developed showed that 34.1% of Musca domestica (86/252) and 51.1% of Protophormia terraenovae (23/45) isolates were positive for the mcr-1 gene, 1.2% of M. domestica (3/252) and 2.2% of P. terraenovae (2.2%, 1/45) isolates were positive for mcr-2 , and 5.2% of M. domestica (13/252) and 44.4% of P. terraenovae (20/45) isolates were positive for mcr-3 Overall, 4.8% (9/189) of bacteria isolated from the flies were positive for the mcr-1 gene ( Escherichia coli : 8.3%, 4/48; Enterobacter cloacae : 12.5%, 1/8; Providencia alcalifaciens : 11.8%, 2/17; Providencia stuartii : 4.9%, 2/41), while none were positive for mcr-2 and mcr-3 Four mcr-1 -positive isolates (two P. stuartii and two P. alcalifaciens ) from blow flies trapped near a dumpster had a MIC for colistin above 4 mg/ml. This study reports mcr-1 carriage in Providencia spp. and detection of mcr-2 and mcr-3 after their initial identification in Belgium and China, respectively. This study suggests that flies might contribute significantly to the dissemination of bacteria, carrying these genes into a large variety of ecological niches. Further studies are warranted to explore the roles that flies might play in the spread of colistin resistance genes. IMPORTANCE Antimicrobial resistance is recognized as one of the most serious global threats to human health. An option for treatment of the Gram-negative ESKAPE ( Enterococcus faecium , Staphylococcus aureus , Klebsiella pneumoniae , Acinetobacter baumannii , Pseudomonas aeruginosa , and Enterobacter species) bacteria with multiple drug resistance was

  5. Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human

    DEFF Research Database (Denmark)

    Shuyu, Wu; Dalsgaard, A.; Hammerum, A. M.

    2010-01-01

    involved in the mobility of sul genes. Methods A total of 501 E. coli isolates from pig feces, pig carcasses and human stools were tested for their susceptibility to selected antimicrobial. Multiplex PCR was conducted to detect the presence of three sul genes among the sulfonamide-resistant E. coli......Background Sulfonamide resistance is very common in Escherichia coli. The aim of this study was to characterize plasmids carrying sulfonamide resistance genes (sul1, sul2 and sul3) in E. coli isolated from pigs and humans with a specific objective to assess the genetic diversity of plasmids...... carrying sul genes were characterized by PCR-based replicon typing to allow a comparison of the types of sul genes, the reservoir and plasmid present. Results A total of 109/501 isolates exhibited sulfonamide resistance. The relative prevalences of sul genes from the three reservoirs (pigs, pig carcasses...

  6. Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human.

    Science.gov (United States)

    Wu, Shuyu; Dalsgaard, Anders; Hammerum, Anette M; Porsbo, Lone J; Jensen, Lars B

    2010-07-30

    Sulfonamide resistance is very common in Escherichia coli. The aim of this study was to characterize plasmids carrying sulfonamide resistance genes (sul1, sul2 and sul3) in E. coli isolated from pigs and humans with a specific objective to assess the genetic diversity of plasmids involved in the mobility of sul genes. A total of 501 E. coli isolates from pig feces, pig carcasses and human stools were tested for their susceptibility to selected antimicrobial. Multiplex PCR was conducted to detect the presence of three sul genes among the sulfonamide-resistant E. coli isolates. Fifty-seven sulfonamide-resistant E. coli were selected based on presence of sul resistance genes and subjected to conjugation and/or transformation experiments. S1 nuclease digestion followed by pulsed-field gel electrophoresis was used to visualize and determine the size of plasmids. Plasmids carrying sul genes were characterized by PCR-based replicon typing to allow a comparison of the types of sul genes, the reservoir and plasmid present. A total of 109/501 isolates exhibited sulfonamide resistance. The relative prevalences of sul genes from the three reservoirs (pigs, pig carcasses and humans) were 65%, 45% and 12% for sul2, sul1, and sul3, respectively. Transfer of resistance through conjugation was observed in 42/57 isolates. Resistances to streptomycin, ampicillin and trimethoprim were co-transferred in most strains. Class 1 integrons were present in 80% of sul1-carrying plasmids and 100% of sul3-carrying plasmids, but only in 5% of sul2-carrying plasmids. The sul plasmids ranged from 33 to 160-kb in size and belonged to nine different incompatibility (Inc) groups: FII, FIB, I1, FIA, B/O, FIC, N, HI1 and X1. IncFII was the dominant type in sul2-carrying plasmids (52%), while IncI1 was the most common type in sul1 and sul3-carrying plasmids (33% and 45%, respectively). Multireplicons were found associated with all three sul genes. Sul genes were distributed widely in E. coli isolated

  7. Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human

    Directory of Open Access Journals (Sweden)

    Hammerum Anette M

    2010-07-01

    Full Text Available Abstract Background Sulfonamide resistance is very common in Escherichia coli. The aim of this study was to characterize plasmids carrying sulfonamide resistance genes (sul1, sul2 and sul3 in E. coli isolated from pigs and humans with a specific objective to assess the genetic diversity of plasmids involved in the mobility of sul genes. Methods A total of 501 E. coli isolates from pig feces, pig carcasses and human stools were tested for their susceptibility to selected antimicrobial. Multiplex PCR was conducted to detect the presence of three sul genes among the sulfonamide-resistant E. coli isolates. Fifty-seven sulfonamide-resistant E. coli were selected based on presence of sul resistance genes and subjected to conjugation and/or transformation experiments. S1 nuclease digestion followed by pulsed-field gel electrophoresis was used to visualize and determine the size of plasmids. Plasmids carrying sul genes were characterized by PCR-based replicon typing to allow a comparison of the types of sul genes, the reservoir and plasmid present. Results A total of 109/501 isolates exhibited sulfonamide resistance. The relative prevalences of sul genes from the three reservoirs (pigs, pig carcasses and humans were 65%, 45% and 12% for sul2, sul1, and sul3, respectively. Transfer of resistance through conjugation was observed in 42/57 isolates. Resistances to streptomycin, ampicillin and trimethoprim were co-transferred in most strains. Class 1 integrons were present in 80% of sul1-carrying plasmids and 100% of sul3-carrying plasmids, but only in 5% of sul2-carrying plasmids. The sul plasmids ranged from 33 to 160-kb in size and belonged to nine different incompatibility (Inc groups: FII, FIB, I1, FIA, B/O, FIC, N, HI1 and X1. IncFII was the dominant type in sul2-carrying plasmids (52%, while IncI1 was the most common type in sul1 and sul3-carrying plasmids (33% and 45%, respectively. Multireplicons were found associated with all three sul genes

  8. Prevalence and molecular typing of methicillin-resistant Staphylococcus aureus carrying Panton-Valentine leukocidin gene.

    Science.gov (United States)

    Hesari, Maryam Rahimpour; Salehzadeh, Ali; Darsanaki, Reza Kazemi

    2018-03-01

    Panton-Valentine leukocidin (pvl) toxin is an important virulence factor of Staphylococcus aureus. The main genes are coa and spa for distinguishing and typing of S. aureus isolates. The aim of this study was to investigate antibiotic resistance, presence of mecA and pvl genes, as well as epidemiological typing of these isolates according to polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method in clinical sample isolated from Rasht city, Iran. A total of 250 clinical samples have been isolated from different hospitals. First, isolates of S. aureus were identified through microbiological methods and their antibiotic sensitivity was determined by disk diffusion agar based on a standard method of Clinical and Laboratory Standards Institute. DNA was extracted by boiling and presence of pvl and mecA genes was investigated by PCR using specific primers. To type these isolates, amplification of fragments of coa and spa genes was done and restriction enzyme digestion pattern was determined by PCR-RFLP method. Among the 250 samples, 50 isolates belonged to S. aureus and results of antibiotic sensitivity showed that 68% (34 samples) of isolates were methicillin resistant. Frequency of mecA and pvl genes among S. aureus isolates were 60% (30 samples) and 20% (10 samples). The PCR of coa gene showed three patterns whereas that of spa gene showed two patterns for enzyme digestion. Result of PCR-RFLP using HaeIII enzymes for coa gene and Bsp1431 for spa gene showed three patterns for enzyme digestion. Recent studies indicated increase in the resistance of S. aureus to different antibiotics, which is a serious problem in the treatment of infections resulting from S. aureus in this region. The result of PCR of pvl showed high frequency of this gene in this region, and coa and spa typing by PCR-RFLP was a useful tool for typing of S. aureus isolates.

  9. Molecular and cytogenetic characterization of wheat introgression lines carrying the stem rust resistance gene Sr39.

    Science.gov (United States)

    Stem rust, caused by Puccinia graminis Pers.:Pers. f.sp. tritici Eriks. and Henn., poses a serious threat to global wheat production because of the emergence of Pgt-TTKSK (Ug99). The TTKSK resistant gene Sr39 was derived from Aegilops speltoides through chromosome translocation. In this study, we ch...

  10. ICESag37, a Novel Integrative and Conjugative Element Carrying Antimicrobial Resistance Genes and Potential Virulence Factors in Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Kaixin Zhou

    2017-10-01

    Full Text Available ICESag37, a novel integrative and conjugative element carrying multidrug resistance and potential virulence factors, was characterized in a clinical isolate of Streptococcus agalactiae. Two clinical strains of S. agalactiae, Sag37 and Sag158, were isolated from blood samples of new-borns with bacteremia. Sag37 was highly resistant to erythromycin and tetracycline, and susceptible to levofloxacin and penicillin, while Sag158 was resistant to tetracycline and levofloxacin, and susceptible to erythromycin. Transfer experiments were performed and selection was carried out with suitable antibiotic concentrations. Through mating experiments, the erythromycin resistance gene was found to be transferable from Sag37 to Sag158. SmaI-PFGE revealed a new SmaI fragment, confirming the transfer of the fragment containing the erythromycin resistance gene. Whole genome sequencing and sequence analysis revealed a mobile element, ICESag37, which was characterized using several molecular methods and in silico analyses. ICESag37 was excised to generate a covalent circular intermediate, which was transferable to S. agalactiae. Inverse PCR was performed to detect the circular form. A serine family integrase mediated its chromosomal integration into rumA, which is a known hotspot for the integration of streptococcal ICEs. The integration site was confirmed using PCR. ICESag37 carried genes for resistance to multiple antibiotics, including erythromycin [erm(B], tetracycline [tet(O], and aminoglycosides [aadE, aphA, and ant(6]. Potential virulence factors, including a two-component signal transduction system (nisK/nisR, were also observed in ICESag37. S1-PFGE analysis ruled out the existence of plasmids. ICESag37 is the first ICESa2603 family-like element identified in S. agalactiae carrying both resistance and potential virulence determinants. It might act as a vehicle for the dissemination of multidrug resistance and pathogenicity among S. agalactiae.

  11. ICESag37, a Novel Integrative and Conjugative Element Carrying Antimicrobial Resistance Genes and Potential Virulence Factors in Streptococcus agalactiae

    Science.gov (United States)

    Zhou, Kaixin; Xie, Lianyan; Han, Lizhong; Guo, Xiaokui; Wang, Yong; Sun, Jingyong

    2017-01-01

    ICESag37, a novel integrative and conjugative element carrying multidrug resistance and potential virulence factors, was characterized in a clinical isolate of Streptococcus agalactiae. Two clinical strains of S. agalactiae, Sag37 and Sag158, were isolated from blood samples of new-borns with bacteremia. Sag37 was highly resistant to erythromycin and tetracycline, and susceptible to levofloxacin and penicillin, while Sag158 was resistant to tetracycline and levofloxacin, and susceptible to erythromycin. Transfer experiments were performed and selection was carried out with suitable antibiotic concentrations. Through mating experiments, the erythromycin resistance gene was found to be transferable from Sag37 to Sag158. SmaI-PFGE revealed a new SmaI fragment, confirming the transfer of the fragment containing the erythromycin resistance gene. Whole genome sequencing and sequence analysis revealed a mobile element, ICESag37, which was characterized using several molecular methods and in silico analyses. ICESag37 was excised to generate a covalent circular intermediate, which was transferable to S. agalactiae. Inverse PCR was performed to detect the circular form. A serine family integrase mediated its chromosomal integration into rumA, which is a known hotspot for the integration of streptococcal ICEs. The integration site was confirmed using PCR. ICESag37 carried genes for resistance to multiple antibiotics, including erythromycin [erm(B)], tetracycline [tet(O)], and aminoglycosides [aadE, aphA, and ant(6)]. Potential virulence factors, including a two-component signal transduction system (nisK/nisR), were also observed in ICESag37. S1-PFGE analysis ruled out the existence of plasmids. ICESag37 is the first ICESa2603 family-like element identified in S. agalactiae carrying both resistance and potential virulence determinants. It might act as a vehicle for the dissemination of multidrug resistance and pathogenicity among S. agalactiae. PMID:29051752

  12. A large conjugative Acinetobacter baumannii plasmid carrying the sul2 sulphonamide and strAB streptomycin resistance genes.

    Science.gov (United States)

    Hamidian, Mohammad; Ambrose, Stephanie J; Hall, Ruth M

    Acinetobacter baumannii is an important nosocomial pathogen that often complicates treatment because of its high level of resistance to antibiotics. Though plasmids can potentially introduce various genes into bacterial strains, compared to other Gram-negative bacteria, information about the unique A. baumannii plasmid repertoire is limited. Here, whole genome sequence data was used to determine the plasmid content of strain A297 (RUH875), the reference strain for the globally disseminated multiply resistant A. baumannii clone, global clone 1(GC1). A297 contains three plasmids. Two known plasmids were present; one, pA297-1 (pRAY*), carries the aadB gentamicin, kanamycin and tobramycin resistance gene and another is an 8.7kb cryptic plasmid often found in GC1 isolates. The third plasmid, pA297-3, is 200kb and carries the sul2 sulphonamide resistance gene and strAB streptomycin resistance gene within Tn6172 and a mer mercuric ion resistance module elsewhere. pA297-3 transferred sulphonamide, streptomycin and mercuric ion resistance at high frequency to a susceptible A. baumannii recipient, and contains several genes potentially involved in conjugative transfer. However, a relaxase gene was not found. It also includes several genes encoding proteins involved in DNA metabolism such as partitioning. However, a gene encoding a replication initiation protein could not be found. pA297-3 includes two copies of a Miniature Inverted-Repeat Transposable Element (MITE), named MITE-297, bracketing a 77.5kb fragment, which contains several IS and the mer module. Several plasmids related to but smaller than pA297-3 were found in the GenBank nucleotide database. They were found in different A. baumannii clones and are wide spread. They all contain either Tn6172 or a variant in the same position in the backbone as Tn6172 in pA297-3. Some related plasmids have lost the segment between the MITE-297 copies and retain only one MITE-297. Others have segments of various lengths between

  13. Assessment of antibiotic resistance pattern in Acinetobacter bumannii carrying bla oxA type genes isolated from hospitalized patients

    Directory of Open Access Journals (Sweden)

    Hossein Goudarzi

    2013-11-01

    Full Text Available AbstractPlease cite this article as: Goudarzi H, Douraghi M, Ghalavand Z, Goudarzi M. Assessment of antibiotic resistance pattern in Acinetobacter baumannii carrying bla oxA type genes isolated from hospitalized patients. Novel Biomed 2013;1(2:54-61.Introduction: Acinetobacter baumannii is a Gram-negative coccobacillus and one of the most opportunistic pathogens responsible for serious infections in hospitalized patients.Methods: During a 12 month study, 221 clinical isolates and 22 environmental Acinetobacter baumannii isolates were collected. In vitro susceptibility of Acinetobacter baumannii isolates to 13 antimicrobial agents amikacin; cefepime; ceftazidime; ciprofloxacin; meropenem; piperacillin/tazobactam; sulfamethoxazole/ trimethoprim; imipenem; tigecycline; colistin; gentamycin; ceftriaxone; levofloxacin was performed by the disk diffusion method and Minimum Inhibitory Concentration(MICs of imipenem; levofloxacin and cefepime.was done by the E-test according to Clinical and Laboratory Standards Institute (CLSI criteria. blaOXA-23, blaOXA-24, blaOXA-58, blaOXA-51genes were detected by polymerase chain reaction and sequencing.Results: The result of antimicrobial susceptibility test of clinical isolates by the disk diffusion method revealed that that all strains of Acinetobacter baumannii were resistant to piperacillin/tazobactam. The rates of resistance to the majority of antibiotics tested varied between 69% and 100 %, with the exception of tigecycline and colistin. Of 221 isolates tested 99(44.8% were XDR. All strains carry a blaOXA-51-like gene. blaOXA-23gene was the most prevalence among blaOXA-types.Conclusion: colistin and tigecycline can be effective drugs for treatment of Acinetobacter baumannii infections. Continuous Surveillance for Acinetobacter baumannii multidrug-resistant strains is necessary to prevent the further spread of resistant isolates.

  14. Bacteraemia due to meticillin-resistant Staphylococcus aureus carrying the mecC gene in a patient with urothelial carcinoma.

    Science.gov (United States)

    Romero-Gómez, María Pilar; Mora-Rillo, Marta; Lázaro-Perona, Fernando; Gómez-Gil, María Rosa; Mingorance, Jesús

    2013-12-01

    We present a case of bacteraemia due to meticillin-resistant Staphylococcus aureus (MRSA) carrying the mecC gene. The susceptibility to meticillin of Staphylococcus aureus was investigated directly from one blood culture bottle using GenomEra MRSA/SA (Abacus Diagnostica Oy) test. This test identified S. aureus but the presence of the mecA gene result was negative, and the isolate was reported as meticillin-sensitive Staphylococcus aureus (MSSA). Susceptibility studies were done using VITEK 2 AST-P588 susceptibility cards (bioMérieux). The strain was identified as MRSA by the VITEK 2 system, although oxacillin MIC was low (0.5 µg ml(-1)). In view of these results, the isolate was tested for the presence of the mecC gene by a specific PCR and was verified as MRSA carrying mecC. The emergence of this new mecA homologue could have important consequences for the detection of MRSA when routine PCR methods are used as an identification method or provisional detection of MRSA, as in the case reported in this article, because S. aureus carrying the mecC gene will be wrongly diagnosed as meticillin susceptible. Negative results must be interpreted with caution and should be followed by conventional culture, and antimicrobial susceptibility testing or detection of mecC gene by a specific PCR.

  15. Resistance to classical scrapie in experimentally challenged goats carrying mutation K222 of the prion protein gene

    Directory of Open Access Journals (Sweden)

    Acutis Pier Luigi

    2012-02-01

    Full Text Available Abstract Susceptibility of sheep to scrapie, a transmissible spongiform encephalopathy of small ruminants, is strongly influenced by polymorphisms of the prion protein gene (PRNP. Breeding programs have been implemented to increase scrapie resistance in sheep populations; though desirable, a similar approach has not yet been applied in goats. European studies have now suggested that several polymorphisms can modulate scrapie susceptibility in goats: in particular, PRNP variant K222 has been associated with resistance in case-control studies in Italy, France and Greece. In this study we investigated the resistance conferred by this variant using a natural Italian goat scrapie isolate to intracerebrally challenge five goats carrying genotype Q/Q 222 (wild type and five goats carrying genotype Q/K 222. By the end of the study, all five Q/Q 222 goats had died of scrapie after a mean incubation period of 19 months; one of the five Q/K 222 goats died after 24 months, while the other four were alive and apparently healthy up to the end of the study at 4.5 years post-challenge. All five of these animals were found to be scrapie negative. Statistical analysis showed that the probability of survival of the Q/K 222 goats versus the Q/Q 222 goats was significantly higher (p = 0.002. Our study shows that PRNP gene mutation K222 is strongly associated with resistance to classical scrapie also in experimental conditions, making it a potentially positive target for selection in the frame of breeding programs for resistance to classical scrapie in goats.

  16. Development and characterization of wheat lines carrying stem rust resistance gene Sr43 derived from Thinopyrum ponticum.

    Science.gov (United States)

    Niu, Z; Klindworth, D L; Yu, G; L Friesen, T; Chao, S; Jin, Y; Cai, X; Ohm, J-B; Rasmussen, J B; Xu, Steven S

    2014-04-01

    Wheat lines carrying Ug99-effective stem rust resistance gene Sr43 on shortened alien chromosome segments were produced using chromosome engineering, and molecular markers linked to Sr43 were identified for marker-assisted selection. Stem rust resistance gene Sr43, transferred into common wheat (Triticum aestivum) from Thinopyrum ponticum, is an effective gene against stem rust Ug99 races. However, this gene has not been used in wheat breeding because it is located on a large Th. ponticum 7el(2) chromosome segment, which also harbors genes for undesirable traits. The objective of this study was to eliminate excessive Th. ponticum chromatin surrounding Sr43 to make it usable in wheat breeding. The two original translocation lines KS10-2 and KS24-1 carrying Sr43 were first analyzed using simple sequence repeat (SSR) markers and florescent genomic in situ hybridization. Six SSR markers located on wheat chromosome arm 7DL were identified to be associated with the Th. ponticum chromatin in KS10-2 and KS24-1. The results confirmed that KS24-1 is a 7DS·7el(2)L Robertsonian translocation as previously reported. However, KS10-2, which was previously designated as a 7el(2)S·7el(2)L-7DL translocation, was identified as a 7DS-7el(2)S·7el(2)L translocation. To reduce the Th. ponticum chromatin carrying Sr43, a BC(2)F(1) population (Chinese Spring//Chinese Spring ph1bph1b*2/KS10-2) containing ph1b-induced homoeologous recombinants was developed, tested with stem rust, and genotyped with the six SSR markers identified above. Two new wheat lines (RWG33 and RWG34) carrying Sr43 on shortened alien chromosome segments (about 17.5 and 13.7 % of the translocation chromosomes, respectively) were obtained, and two molecular markers linked to Sr43 in these lines were identified. The new wheat lines with Sr43 and the closely linked markers provide new resources for improving resistance to Ug99 and other races of stem rust in wheat.

  17. Emergence of a Staphylococcus aureus Clone Resistant to Mupirocin and Fusidic Acid Carrying Exotoxin Genes and Causing Mainly Skin Infections.

    Science.gov (United States)

    Doudoulakakis, Anastassios; Spiliopoulou, Iris; Spyridis, Nikolaos; Giormezis, Nikolaos; Kopsidas, John; Militsopoulou, Maria; Lebessi, Evangelia; Tsolia, Maria

    2017-08-01

    Skin and soft tissue infections (SSTIs) caused by mupirocin-resistant Staphylococcus aureus strains have recently increased in number in our settings. We sought to evaluate the characteristics of these cases over a 43-month period. Data for all community-acquired staphylococcal infections caused by mupirocin-resistant strains were retrospectively reviewed. Genes encoding products producing high-level resistance (HLR) to mupirocin ( mupA ), fusidic acid resistance ( fusB ), resistance to macrolides and lincosamides ( ermC and ermA ), Panton-Valentine leukocidin (PVL) ( lukS/lukF -PV), exfoliative toxins ( eta and etb ), and fibronectin binding protein A ( fnbA ) were investigated by PCRs in 102 selected preserved strains. Genotyping was performed by SCC mec and agr typing, whereas clonality was determined by pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). A total of 437 cases among 2,137 staphylococcal infections were recorded in 2013 to 2016; they were all SSTIs with the exception of 1 case of primary bacteremia. Impetigo was the predominant clinical entity (371 cases [84.9%]), followed by staphylococcal scalded skin syndrome (21 cases [4.8%]), and there were no abscesses. The number of infections detected annually increased during the study years. All except 3 isolates were methicillin susceptible. The rates of HLR to mupirocin and constitutive resistance to clindamycin were 99% and 20.1%, respectively. Among the 102 tested strains, 100 (98%) were mupA positive and 97 (95%) were fusB positive, 26/27 clindamycin-resistant strains (96.3%) were ermA positive, 83 strains (81.4%) were lukS/lukF positive, 95 (93%) carried both eta and etb genes, and 99 (97%) were fnbA positive. Genotyping of methicillin-sensitive S. aureus (MSSA) strains revealed that 96/99 (96.7%) belonged to one main pulsotype, pulsotype 1, classified as sequence type 121 (ST121). The emergence of a single MSSA clone (ST121) causing impetigo was documented. Resistance to

  18. DNA polymorphism among barley NILs of cv. Pallas, carrying genes for resistance to powdery mildew (Blumeria graminis f. sp. hordei).

    Science.gov (United States)

    Czembor, Paweł Cz; Czembor, Jerzy H

    2004-01-01

    Barley powdery mildew, caused by the pathogen Blumeria graminis f. sp. hordei is an important disease of barley (Hordeum vulgare L.). The random amplified polymorphic DNA (RAPD) method was used to detect DNA polymorphism among 7 Pallas near-isogenic lines (NILs) carrying Mla3, Mla12, Mlk, Mlp, Mlat, Mlg and MlLa genes for resistance to B. graminis f. sp. hordei. From among 500 random 10-mer primers tested, 3 were specific for NIL P2 (Mla3), 1 for P10 (Mla12), 6 for P17 (Mlk), 46 for P19 (Mlp), 4 for P20 (Mlat), 6 for P21 (Mlg), and 4 for P23 (MlLa). The results of this study demonstrated that the RAPD technique is a useful tool for detecting DNA polymorphism among Pallas NILs.

  19. Resistance of transgenic eggplant carrying the oryzacystatin gene to Mechanitis polymnia and Mechanitis lysimnia - DOI: 10.4025/actasciagron.v27i4.1345

    OpenAIRE

    Ribeiro, Ana Paula de Oliveira; UFV; Otoni, Wagner Campos; UFV; Picanço, Marcelo Coutinho; Universidade Federal de Viçosa, Centro de Ciências Biológicas e da Saúde; Galvan, Tederson Luiz; UFV; Pereira, Eliseu José Guedes; UFV; Picoli, Edgard Augusto de Toledo; UFV; Silva, Derly José Henriques da; UFV

    2008-01-01

    This research aimed to evaluate the resistance of transgenic eggplant (Solanum melongena) carrying the oryzacystatin gene to Mechanitis polymnia L. and Mechanitis lysimnia Fabr. (Lepidoptera: Nymphalidae). The leaf area consumed, the mortality and duration of the larval and pupal phases of M. polymnia and M. lysimnia were evaluated. Results showed the transgenic eggplant is not resistant to Lepidoptera M. polymnia and M. lysimnia Esta pesquisa objetivou avaliar a resistência da berinjela (...

  20. High-level fluoroquinolone resistant Salmonella enterica serovar Kentucky ST198 epidemic clone with IncA/C conjugative plasmid carrying bla(CTX-M-25) gene.

    Science.gov (United States)

    Wasyl, Dariusz; Kern-Zdanowicz, Izabela; Domańska-Blicharz, Katarzyna; Zając, Magdalena; Hoszowski, Andrzej

    2015-01-30

    Multidrug resistant Salmonella Kentucky strains have been isolated from turkeys in Poland since 2009. Multiple mutations within chromosomal genes gyrA and parC were responsible for high-level ciprofloxacin resistance. One of the isolates was extended spectrum β-lactamase- (ESBL) positive: the strain 1643/2010 carried a conjugative 167,779 bps plasmid of IncA/C family. The sequence analysis revealed that it carried a blaCTX-M-25 gene and an integron with another β-lactamase encoding gene-blaOXA-21. This is the first known report of a CTX-M-25 encoding gene both in Poland and in Salmonella Kentucky world-wide, as well as in the IncA/C plasmid. Analysis of the integron showed a novel arrangement of gene cassettes-aacA4, aacC-A1 and blaOXA-21 where the latter might result from an intergeneric gene transfer. The study confirmed Salmonella Kentucky population isolated in Poland belongs to global epidemics of high level fluoroquinolone resistant clone ST198 that can carry rare β-lactamase genes. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Environmental emission of multiresistant Escherichia coli carrying the colistin resistance gene mcr-1 from German swine farms.

    Science.gov (United States)

    Guenther, Sebastian; Falgenhauer, Linda; Semmler, Torsten; Imirzalioglu, Can; Chakraborty, Trinad; Roesler, Uwe; Roschanski, Nicole

    2017-05-01

    Pigs have been the focus of the worldwide spread of colistin resistance. However, there is little information on the transmission of mcr-1 -containing bacteria into the environment of pig farms. We therefore rescreened environmental Escherichia coli isolates from the surrounding farm areas of three previously mcr-1 -positive swine herds in Germany. Thirty-five mixed bacterial cultures obtained from boot swabs, flies, dog faeces and manure from three pig farms in Germany in 2011-12 were non-selectively recultivated and the presence of the mcr-1 gene was checked by real-time PCR. After separation, single E. coli colonies were subsequently isolated and the presence of mcr-1 was confirmed by PCR and sequencing. In addition, phenotypic antimicrobial resistance screening and WGS followed by phylogenetic analysis and resistance genotyping as well as plasmid typing were performed. Seven mcr-1 -positive E. coli strains originating from environmental boot swabs, dog faeces, stable flies and manure were found. The isolates belonged to five different STs (ST10, ST1011, ST1140, ST5281 and ST342) and harboured extensive additional resistance genes. Comparative plasmid analysis predominantly located mcr-1 on IncX4 plasmids, which are strongly related to a recently described plasmid of human clinical origin (pICBEC72Hmcr). WGS-based analysis of the environmental E. coli isolates of farm surroundings showed clear links to mcr-1 -harbouring E. coli recovered from pig production in Europe as well as from human clinical isolates worldwide, presenting another piece of the puzzle, which further complicates the rapidly evolving epidemiology of plasmid-mediated colistin-resistant E. coli strains. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  2. Mapping the regions carrying the three contiguous antibiotic resistance genes aadE, sat4, and aphA-3 in the genomes of staphylococci.

    Science.gov (United States)

    Derbise, A; Aubert, S; El Solh, N

    1997-01-01

    Tn5405 (12 kb) is a staphylococcal composite transposon delimited by two inverted copies of IS1182, one of which contains IS1181. The internal part of this transposon carries three antibiotic resistance genes, aphA-3, aadE, and sat4, and three open reading frames (ORFs), orfx, orfy, and orfz, of unknown function. The dispersion of Tn5405 and the genes and ORFs included in this transposon were investigated in 50 epidemiologically unrelated staphylococci carrying aphA-3. Twenty-three maps, distinguishable by the presence or absence of the investigated genes or ORFs and/or by the sizes of the restriction fragments carrying them, were identified. Four isolates carried Tn5405, and 15 other isolates contained a Tn5405-related element. IS1182 was not detected in the aphA-3 regions mapped in 31 isolates which carried the following combinations: orfx, orfy, aadE, sat4, and aphA-3 +/- orfz; orfy, aadE, sat4, and aphA-3 +/- orfz; and aadE, sat4, aphA-3, and orfz. In all isolates, the genes and ORFs investigated were in relative positions similar to those in Tn5405. Thus, the internal part of Tn5405 appeared to be partially conserved with the maintenance, in all of the isolates, of at least the three antibiotic resistance genes. PMID:9145863

  3. Ventilator-associated pneumonia caused by carbapenem-resistant Enterobacteriaceae carrying multiple metallo-beta-lactamase genes

    Directory of Open Access Journals (Sweden)

    Dwivedi Mayank

    2009-07-01

    Full Text Available Context: Ventilator-associated pneumonia (VAP is a leading nosocomial infection in the intensive care unit (ICU. Members of Enterobacteriaceae are the most common causative agents and carbapenems are the most commonly used antibiotics. Metallo-beta-lactamase (MBL production leading to treatment failure may go unnoticed by routine disc diffusion susceptibility testing. Moreover, there is not much information on association of MBL-producing Enterobacteriaceae with ICU-acquired VAP. Therefore, a study was undertaken to find out the association of MBL-producing Enterobacteriaceae with VAP. Settings: This study was conducted in a large tertiary care hospital of North India with an eight-bed critical care unit. Materials and Methods: The respiratory samples (bronchoalveolar lavage, protected brush catheter specimens and endotracheal or transtracheal aspirates obtained from VAP patients (during January 2005-December 2006 were processed, isolated bacteria identified and their antibiotic susceptibilities tested as per standard protocols. The isolates of Enterobacteriaceae resistant to carbapenem were subjected to phenotypic and genotypic tests for the detection of MBLs. Results: Twelve of 64 isolates of Enterobacteriaceae were detected as MBL producers, bla IMP being the most prevalent gene. Additionally, in three strains, simultaneous coexistence of multiple MBL genes was detected. Conclusion: The coexistence of multiple MBL genes in Enterobacteriaceae is an alarming situation. As MBL genes are associated with integrons that can be embedded in transposons, which in turn can be accommodated on plasmids thereby resulting in a highly mobile genetic apparatus, the further spread of these genes in different pathogens is likely to occur.

  4. Cytogenetic analysis and mapping of leaf rust resistance in Aegilops speltoides Tausch derived bread wheat line Selection2427 carrying putative gametocidal gene(s).

    Science.gov (United States)

    Niranjana, M; Vinod; Sharma, J B; Mallick, Niharika; Tomar, S M S; Jha, S K

    2017-12-01

    Leaf rust (Puccinia triticina) is a major biotic stress affecting wheat yields worldwide. Host-plant resistance is the best method for controlling leaf rust. Aegilops speltoides is a good source of resistance against wheat rusts. To date, five Lr genes, Lr28, Lr35, Lr36, Lr47, and Lr51, have been transferred from Ae. speltoides to bread wheat. In Selection2427, a bread wheat introgresed line with Ae. speltoides as the donor parent, a dominant gene for leaf rust resistance was mapped to the long arm of chromosome 3B (LrS2427). None of the Lr genes introgressed from Ae. speltoides have been mapped to chromosome 3B. Since none of the designated seedling leaf rust resistance genes have been located on chromosome 3B, LrS2427 seems to be a novel gene. Selection2427 showed a unique property typical of gametocidal genes, that when crossed to other bread wheat cultivars, the F 1 showed partial pollen sterility and poor seed setting, whilst Selection2427 showed reasonable male and female fertility. Accidental co-transfer of gametocidal genes with LrS2427 may have occurred in Selection2427. Though LrS2427 did not show any segregation distortion and assorted independently of putative gametocidal gene(s), its utilization will be difficult due to the selfish behavior of gametocidal genes.

  5. Imipenem-resistant Pseudomonas aeruginosa strains carry metallo-beta-lactamase gene bla(VIM) in a level I Iranian burn hospital.

    Science.gov (United States)

    Bahar, Mohammad Ali; Jamali, Shohreh; Samadikuchaksaraei, Ali

    2010-09-01

    In this study, we aimed to determine the distribution of bla(VIM) and bla(IMP) transferable genes in Pseudomonas aeruginosa isolates from infected burn wounds in an Iranian level I burn care center. These genes confer imipenem resistance and increase the mortality rate of burn patients. P. aeruginosa isolates from burn patients were tested for antibiotic susceptibility with Kirby-Bauer disk diffusion method and for production of metallo-beta-lactamase (MBL) by EDTA disk method. DNA was purified from isolates with positive MBL results and underwent PCR for detection of bla(VIM) and bla(IMP) genes. MBL was produced by 23 imipenem-resistant isolates and bla(VIM) gene was detected in all of these isolates. None of the isolates carried bla(IMP) gene. Mortality rate of infection with MBL-producing Pseudomonas strains was 82.6% in this hospital while the mortality rate for non-MBL-producing Pseudomonas was 22.7%. We found that all MBL-producing isolates in this hospital carry bla(VIM) gene. This result is similar to the previous Iranian study and emphasizes the importance of VIM family of MBLs in Iran. Timely identification of these strains and strict isolation methods can prevent spread of this transferable gene to other Gram-negative bacteria and prevent the subsequent outbreak of high mortality. 2009 Elsevier Ltd and ISBI. All rights reserved.

  6. Imipenem-resistant Acinetobacter baumannii carrying the ISAba1-bla OXA-23, 51 and ISAba1-bla ADC-7 genes in Monteria, Colombia

    Directory of Open Access Journals (Sweden)

    Pedro Martínez

    2012-12-01

    Full Text Available The purpose of this study was to identify the genes coding for resistance to ceftazidime and imipenem and describe the molecular epidemiology of A. baumannii strains isolated from a clinical center in Colombia. Twenty isolates of imipenem-resistant A. baumannii from an equal number of patients with nosocomial infections were obtained. Primers were used to amplify genes bla IMP, bla VIM, bla OXA-23, bla OXA-24, bla OXA-58, bla OXA-51 and bla ADC-7. To detect insertion sequences ISAba1/bla OXA-23, ISAba1/bla OXA-51 and ISAba1/bla ADC-7, mapping by PCR using combinations of reverse primers ISAba1 and reverse primers of bla OXA-23, bla OXA-51 and bla ADC-7 were used. The amplification products were purified and cloned into PCR 2.1-TOPO vector and transformed into chemically competent Escherichia coli TOP10. These amplicons were then sequenced. PFGE was performed on DNA of A. baumannii isolates digested with ApaI. Results. The DNA profiles obtained included 9 clusters with, four 2-7 isolates per profile, and 5 single-isolate profiles. Of the 20 isolates resistant to imipenem, 15 carried bla OXA-23 gene, 4 contained ISAba1 upstream of bla OXA-51 gene, and 6 contained ISAba1 upstream of bla OXA-23 gene. Eighteen of these isolates carried the bla ADC-7 gene, with 9 of the isolates having ISAba1 located upstream of this gene. This is the first report of the ISAba1 /ADC-7 associated with OXAs genes in A. baumannii isolates from Colombia.

  7. Imipenem-resistant Acinetobacter baumannii carrying the ISAba1-bla OXA-23,51 and ISAba1-bla ADC-7 genes in Monteria, Colombia.

    Science.gov (United States)

    Martínez, Pedro; Mattar, Salim

    2012-10-01

    The purpose of this study was to identify the genes coding for resistance to ceftazidime and imipenem and describe the molecular epidemiology of A. baumannii strains isolated from a clinical center in Colombia. Twenty isolates of imipenem-resistant A. baumannii from an equal number of patients with nosocomial infections were obtained. Primers were used to amplify genes bla IMP, bla VIM, bla OXA-23, bla OXA-24, bla OXA-58, bla OXA-51 and bla ADC-7. To detect insertion sequences ISAba1/bla OXA-23, ISAba1/bla OXA-51 and ISAba1/bla ADC-7, mapping by PCR using combinations of reverse primers ISAba1 and reverse primers of bla OXA-23, bla OXA-51 and bla ADC-7 were used. The amplification products were purified and cloned into PCR 2.1-TOPO vector and transformed into chemically competent Escherichia coli TOP10. These amplicons were then sequenced. PFGE was performed on DNA of A. baumannii isolates digested with ApaI. Results. The DNA profiles obtained included 9 clusters with, four 2-7 isolates per profile, and 5 single-isolate profiles. Of the 20 isolates resistant to imipenem, 15 carried bla OXA-23 gene, 4 contained ISAba1 upstream of bla OXA-51 gene, and 6 contained ISAba1 upstream of bla OXA-23 gene. Eighteen of these isolates carried the bla ADC-7 gene, with 9 of the isolates having ISAba1 located upstream of this gene. This is the first report of the ISAba1/ADC-7 associated with OXAs genes in A. baumannii isolates from Colombia.

  8. Construction of Double Right-Border Binary Vector Carrying Non-Host Gene Rxo1 Resistant to Bacterial Leaf Streak of Rice

    Directory of Open Access Journals (Sweden)

    Mei-rong XU

    2008-09-01

    Full Text Available Rxo1 cloned from maize is a non-host gene resistant to bacterial leaf streak of rice. pCAMBIA1305-1 with Rxo1 was digested with Sca I and NgoM IV and the double right-border binary vector pMNDRBBin6 was digested with Hpa I and Xma I. pMNDRBBin6 carrying the gene Rxo1 was acquired by ligation of blunt-end and cohesive end. The results of PCR, restriction enzyme analysis and sequencing indicated that the Rxo1 gene had been cloned into pMNDRBBin6. This double right-border binary vector, named as pMNDRBBin6-Rxo1, will play a role in breeding marker-free plants resistant to bacterial leaf streak of rice by genetic transformation.

  9. Plant Agricultural Streptomycin Formulations Do Not Carry Antibiotic Resistance Genes▿

    OpenAIRE

    Rezzonico, Fabio; Stockwell, Virginia O.; Duffy, Brion

    2009-01-01

    Streptomycin is used in plant agriculture for bacterial disease control, particularly against fire blight in pome fruit orchards. Concerns that this may increase environmental antibiotic resistance have led to bans or restrictions on use. Experience with antibiotic use in animal feeds raises the possible influence of formulation-delivered resistance genes. We demonstrate that agricultural streptomycin formulations do not carry producer organism resistance genes. By using an optimized extracti...

  10. Whole Genome Sequencing and Plasmid Genomics of Antimicrobial Resistance – Salmonella’s mobile genetic elements and the antimicrobial resistance genes they carry

    Science.gov (United States)

    With the emergence of antibiotic resistance (AR), multidrug resistance (MDR), and carbapenem resistant Enterobacteriaceae (CRE), the specter of widespread untreatable bacterial infections threatens human and animal health. The ability of these emerging resistances to transfer between bacteria on mob...

  11. Mechanism for transfer of transposon Tn2010 carrying macrolide resistance genes in Streptococcus pneumoniae and its effects on genome evolution.

    Science.gov (United States)

    Zhou, Wenqing; Yao, Kaihu; Zhang, Gang; Yang, Yonghong; Li, Yun; Lv, Yuan; Feng, Jie

    2014-06-01

    The objective of this study was to identify the mechanism responsible for the horizontal transfer of transposon Tn2010 in Streptococcus pneumoniae, and the genomic alterations introduced by the transfer process. Tn2010 was identified using PCR in 15 clinical isolates of S. pneumoniae with erythromycin resistance. S. pneumoniae and Enterococcus faecalis isolates were used as recipient cells in mating and transformation experiments to test the conjugative transferability and transformability of Tn2010. Whole-genome sequencing was used to assess the effects of the Tn2010 transfer on recipient genomes. The biological cost of the horizontal acquisition of Tn2010 and additional genomic changes was investigated by growth competition experiments. Tn2010 was transformed at a frequency of 3 × 10(-7) transformants per cfu, whereas no transconjugants were detected using S. pneumoniae or E. faecalis as recipient cells. Genome analysis showed that many other recombinations were scattered throughout the genome of the transformants in addition to transposon Tn2010. The transformants demonstrated a negligible fitness cost compared with the wild-type strain. Tn2010 tended to be transferred by transformation rather than conjugation in S. pneumoniae, and the spread of Tn2010 could have a profound effect on the evolution of the genome. The acquisition of Tn2010 with negligible fitness cost may facilitate spread of the transposon. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  12. Prevalence and diversity of IncX plasmids carrying fluoroquinolone and β-lactam resistance genes in Escherichia coli originating from diverse sources and geographical areas.

    Science.gov (United States)

    Dobiasova, Hana; Dolejska, Monika

    2016-08-01

    To describe the prevalence and diversity of IncX plasmids with antibiotic resistance genes in Enterobacteriaceae and to identify the most disseminated lineages of the plasmid family. IncX plasmids were screened in 1894 Enterobacteriaceae isolates resistant to cefotaxime (2 mg/L) or with reduced susceptibility to ciprofloxacin (0.05 mg/L) obtained from various sources in five continents using PCR. IncX plasmid-harbouring isolates were identified using MALDI-TOF or biochemical tests, and screened for antibiotic resistance genes using PCR and sequencing; their clonality was determined by PFGE. Horizontal transfer of plasmids was tested using transformation and conjugation. IncX plasmids were characterized by S1-nuclease and PFGE, RFLP and hybridization. A total of 164 Escherichia coli isolates (8.7%, n = 1894) carried at least one IncX subgroup. Seven isolates harboured two distinct subgroups. IncX1 subgroup was found in 93 isolates, followed by IncX2 (35 isolates), IncX4 (28) and IncX3 (15). IncX4 plasmids were not transferred horizontally as single plasmids and therefore excluded from further analysis. The most disseminated lineages of IncX plasmids included IncX1 harbouring qnrS1 and blaTEM-1,-135 found in 36 E. coli from different sources in Europe and Australia and IncX2 carrying qnrS1 and tet(A) detected in nine E. coli from wildlife in Europe. IncX3 plasmids harboured predominantly blaSHV-12 and qnrS1 or qnrB7. IncX plasmids were widely distributed in E. coli from wildlife in Europe and were predominantly associated with fluoroquinolone resistance genes. Plasmids showing indistinguishable restriction profiles were identified in E. coli from different sources and countries suggesting wide dissemination of certain plasmid lineages. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  13. Quantitative and Qualitative Involvement of P3N-PIPO in Overcoming Recessive Resistance against Clover Yellow Vein Virus in Pea Carrying the cyv1 Gene

    Science.gov (United States)

    Choi, Sun Hee; Hagiwara-Komoda, Yuka; Atsumi, Go; Shimada, Ryoko; Hisa, Yusuke; Naito, Satoshi

    2013-01-01

    In pea carrying cyv1, a recessive gene for resistance to Clover yellow vein virus (ClYVV), ClYVV isolate Cl-no30 was restricted to the initially infected cells, whereas isolate 90-1 Br2 overcame this resistance. We mapped the region responsible for breaking of cyv1-mediated resistance by examining infection of cyv1 pea with chimeric viruses constructed from parts of Cl-no30 and 90-1 Br2. The breaking of resistance was attributed to the P3 cistron, which is known to produce two proteins: P3, from the main open reading frame (ORF), and P3N-PIPO, which has the N-terminal part of P3 fused to amino acids encoded by a small open reading frame (ORF) called PIPO in the +2 reading frame. We introduced point mutations that were synonymous with respect to the P3 protein but nonsynonymous with respect to the P3N-PIPO protein, and vice versa, into the chimeric viruses. Infection of plants with these mutant viruses revealed that both P3 and P3N-PIPO were involved in overcoming cyv1-mediated resistance. Moreover, P3N-PIPO quantitatively affected the virulence of Cl-no30 in cyv1 pea. Additional expression in trans of the P3N-PIPO derived from Cl-no30, using White clover mosaic virus as a vector, enabled Cl-no30 to move to systemic leaves in cyv1 pea. Susceptible pea plants infected with chimeric ClYVV possessing the P3 cistron of 90-1 Br2, and which were therefore virulent toward cyv1 pea, accumulated more P3N-PIPO than did those infected with Cl-no30, suggesting that the higher level of P3N-PIPO in infected cells contributed to the breaking of resistance by 90-1 Br2. This is the first report showing that P3N-PIPO is a virulence determinant in plants resistant to a potyvirus. PMID:23616656

  14. Detection of methicillin-resistant Staphylococcus aureus strains resistant to multiple antibiotics and carrying the Panton-Valentine leukocidin genes in an Algiers hospital.

    Science.gov (United States)

    Ramdani-Bouguessa, Nadjia; Bes, Michèle; Meugnier, Hélène; Forey, Françoise; Reverdy, Marie-Elisabeth; Lina, Gerard; Vandenesch, François; Tazir, Mohamed; Etienne, Jerome

    2006-03-01

    Forty-five Panton-Valentine leukocidin (PVL)-positive, methicillin-resistant Staphylococcus aureus strains were isolated in Algeria between 2003 and 2004; 18 isolates were isolated in the community and 27 in a hospital. Five PVL-positive hospital isolates were resistant to multiple antibiotics, including ofloxacin and gentamicin for three isolates.

  15. Dissemination of the Fosfomycin Resistance Gene fosA3 with CTX-M β-Lactamase Genes and rmtB Carried on IncFII Plasmids among Escherichia coli Isolates from Pets in China

    Science.gov (United States)

    Hou, Jianxia; Huang, Xianhui; Deng, Yuting; He, Liangying; Yang, Tong; Zeng, Zhenling; Chen, Zhangliu

    2012-01-01

    The presence and characterization of plasmid-mediated fosfomycin resistance determinants among Escherichia coli isolates collected from pets in China between 2006 and 2010 were investigated. Twenty-nine isolates (9.0%) were positive for fosA3, and all of them were CTX-M producers. The fosA3 genes were flanked by IS26 and were localized on F2:A−:B− plasmids or on very similar F33:A−:B− plasmids carrying both blaCTX-M-65 and rmtB. These findings indicate that the fosA3 gene may be coselected by antimicrobials other than fosfomycin. PMID:22232290

  16. The novel kasugamycin 2'-N-acetyltransferase gene aac(2')-IIa, carried by the IncP island, confers kasugamycin resistance to rice-pathogenic bacteria.

    Science.gov (United States)

    Yoshii, Atsushi; Moriyama, Hiromitsu; Fukuhara, Toshiyuki

    2012-08-01

    Kasugamycin (KSM), a unique aminoglycoside antibiotic, has been used in agriculture for many years to control not only rice blast caused by the fungus Magnaporthe grisea but also rice bacterial grain and seedling rot or rice bacterial brown stripe caused by Burkholderia glumae or Acidovorax avenae subsp. avenae, respectively. Since both bacterial pathogens are seed-borne and cause serious injury to rice seedlings, the emergence of KSM-resistant B. glumae and A. avenae isolates highlights the urgent need to understand the mechanism of resistance to KSM. Here, we identified a novel gene, aac(2')-IIa, encoding a KSM 2'-N-acetyltransferase from both KSM-resistant pathogens but not from KSM-sensitive bacteria. AAC(2')-IIa inactivates KSM, although it reveals no cross-resistance to other aminoglycosides. The aac(2')-IIa gene from B. glumae strain 5091 was identified within the IncP genomic island inserted into the bacterial chromosome, indicating the acquisition of this gene by horizontal gene transfer. Although excision activity of the IncP island and conjugational gene transfer was not detected under the conditions tested, circular intermediates containing the aac(2')-IIa gene were detected. These results indicate that the aac(2')-IIa gene had been integrated into the IncP island of a donor bacterial species. Molecular detection of the aac(2')-IIa gene could distinguish whether isolates are resistant or susceptible to KSM. This may contribute to the production of uninfected rice seeds and lead to the effective control of these pathogens by KSM.

  17. Multidrug-resistant Acinetobacter baumannii strains carrying the bla(OxA-23) and the bla(GES-11) genes in a neonatology center in Tunisia.

    Science.gov (United States)

    Charfi-Kessis, Karama; Mansour, Wejdene; Ben Haj Khalifa, Anis; Mastouri, Maha; Nordmann, Patrice; Aouni, Mahjoub; Poirel, Laurent

    2014-09-01

    Multidrug-resistant and difficult-to-treat Acinetobacter baumannii may be responsible for nosocomial infections. The production of carbapenem-hydrolyzing class D β-lactamases (CHDLs) and extended-spectrum β-lactamase (ESBLs) of the GES type possessing a carbapenemase activity has been increasingly reported worldwide in A. baumannii. The aim of this study was to analyze the resistance mechanisms of two carbapenem resistant A. baumannii clinical isolates recovered in a neonatology center in the center-east of Tunisia. Two carbapenem resistant A. baumannii isolates were recovered. The first isolate co-harbored the blaGES-11 ESBL gene and the blaOxA-23 CHDL gene. Analyses of the genetic location indicated that the blaGES-11 gene was plasmid located (Gr6). However, the blaOxA-23 gene was located on the chromosome. The second strain had only the blaOxA-23 CHDL gene, which was plasmid located. This study showed the first description of the GES-type β-lactamase in A. baumannii in Tunisia. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Prevalence of Methicillin-Resistant Staphylococcus Aureus Carrying Panton-Valentine Leukocidin Gene in Cutaneous Infections in the City of Isfahan

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Pourmand

    2012-03-01

    Full Text Available Background: Methicillin-Resistant Staphylococcus aureus (MRSA is a major cause of Nosocomial and community infections that are becoming increasingly difficult to combat, because of emerging resistance to all classes of antibiotics. Moreover Panton-Valentine leukocidin (PVL is an important virulence factor in S. aureus and causes white blood cell destruction, necrosis and accelerated apoptosis. The aim of this study was to determine the frequency of PVL-positive MRSA in cutaneous infections, for epidemiological purposes and also to determine antibiotic resistance of the isolates.Methods: Collectively, 56 isolates of S. aureus were obtained from Isfahan University of Medical sciences affiliated hospitals and confirmed with biochemical tests (coagulase, mannitol fermentation, and DNase. Then polymerase chain reaction (PCR was used to detect pvl gene. Coagulase gene was used as internal control. The antibiotic susceptibility of all isolates to methicillin was determined using disk diffusion method.Results: Out of 56 isolates 14.3% were PVL positive that 37.5% were from abscess and 62.5% were from wound. Among all of these isolates 67.8% were MRSA and also 75% of PVL-positive isolates were MRSA.Conclusion: The prevalence of PVL positive MRSA in cutaneous isolates is high. Future works are necessary for a more complete understanding of distribution of these virulent isolates in nasal carriers to decrease the risk of infections.

  19. Profiles of phenotype resistance to antibiotic other than β-lactams in Klebsiella pneumoniae ESBLs-producers, carrying blaSHV genes

    Directory of Open Access Journals (Sweden)

    Pawel Sacha

    2010-04-01

    Full Text Available Extended spectrum β-lactamases production is one of the most common mechanism of resistance to extendedspectrum β-lactam antibiotics is increasing worldwide. Twenty five strains of Klebsiella pneumoniae isolated from clinicalspecimens were tested. Based on the phenotypic confirmatory test all these strains were defined as ESBL producers namedESBL(+. The plasmid DNA from each strains was used to investigate the presence of blaSHV genes responsible for extendedspectrum β-lactamases production. Moreover, susceptibility of these strains to antibiotic other than β-lactams in was tested.

  20. Molecular epidemiology of an outbreak of imipenem-resistant Acinetobacter baumannii carrying the ISAba1-bla(OXA-51-like) genes in a Korean hospital.

    Science.gov (United States)

    Chaulagain, Bidur Prasad; Jang, Sook Jin; Ahn, Gyuu Yeol; Ryu, So Yeon; Kim, Dong Min; Park, Geon; Kim, Won Yong; Shin, Jong Hee; Kook, Joong Ki; Kang, Seong-Ho; Moon, Dae Soo; Park, Young Jin

    2012-01-01

    Between January 2004 and December 2004, an outbreak of imipenem-resistant Acinetobacter baumannii (IRAB) in 2 intensive care units (ICU) of Chosun University Hospital, Korea affected 77 patients. A case-control study revealed that the time spent in the hospital and mechanical ventilation practices were risk factors. IRAB was isolated from the hands of 4% (5/124) of healthcare workers; 27.3% (21/77) of the samples obtained from the ICU environment. A pulsed-field gel electrophoresis analysis showed that 82.1% (23/28) of clinical IRAB isolates and 85.7% (6/7) of environmental IRAB isolates were type A. The ISAba1F/OXA-51-likeR PCR showed that 93.7% (30/32) of IRAB strains had the ISAba1 gene upstream of the bla(OXA-51-like) gene. Two ISAba1F/OXA-51-likeR PCR-negative IRAB strains were bla(IMP-1) positive. All of the IRAB strains tested by PCR were negative for bla(VIM), bla(SIM), bla(GIM-1), bla(SPM-1), bla(GES), bla(OXA-23-like), bla(OXA-24-like), and bla(OXA-58-like) carbapenemase genes. After implementing an infection control strategy, a steady reduction in the attack rate of IRAB infection was observed.

  1. Macrolide resistance gene erm(TR) and erm(TR)-carrying genetic elements in Streptococcus agalactiae: characterization of ICESagTR7, a new composite element containing IMESp2907.

    Science.gov (United States)

    Mingoia, Marina; Morici, Eleonora; Marini, Emanuela; Brenciani, Andrea; Giovanetti, Eleonora; Varaldo, Pietro E

    2016-03-01

    The objective of this study was to investigate macrolide-resistant Streptococcus agalactiae isolates harbouring erm(TR), an erm(A) gene subclass, with emphasis on their erm(TR)-carrying genetic elements. Four erm(TR)-carrying elements have been described to date: three closely related (ICE10750-RD.2, Tn1806 and ICESp1108) in Streptococcus pyogenes, Streptococcus pneumoniae and S. pyogenes, respectively; and one completely different (IMESp2907, embedded in ICESp2906 to form ICESp2905) in S. pyogenes. Seventeen macrolide-resistant erm(TR)-positive S. agalactiae isolates were phenotypically and genotypically characterized. Their erm(TR)-carrying elements were explored by analysing the distinctive recombination genes of known erm(TR)-carrying integrative and conjugative elements (ICEs) and by PCR mapping. The new genetic context and organization of IMESp2907 in S. agalactiae were explored using several experimental procedures and in silico analyses. Five isolates harboured ICE10750-RD.2/Tn1806, five isolates harboured ICESp1108 and five isolates bore unknown erm(TR)-carrying elements. The remaining two isolates, exhibiting identical serotypes and pulsotypes, harboured IMESp2907 in a new genetic environment, which was further investigated in one of the two isolates, SagTR7. IMESp2907 was circularizable in S. agalactiae, as described in S. pyogenes. The new IMESp2907 junctions were identified based on its site-specific integration; the att sites were almost identical to those in S. pyogenes. In strain SagTR7, erm(TR)-carrying IMESp2907 was embedded in an erm(TR)-less internal element related to ICE10750-RD.2/Tn1806, which, in turn, was embedded in an ICESde3396-like element. The resulting whole ICE, ICESagTR7 (∼129 kb), was integrated into the chromosome downstream of the rplL gene, and was excisable in circular form and transferable by conjugation. This is the first study exploring erm(TR)-carrying genetic elements in S. agalactiae. © The Author 2015. Published by

  2. High prevalence of methicillin-resistant Staphylococcus aureus (MRSA) carrying the mecC gene in a semi-extensive red deer (Cervus elaphus hispanicus) farm in Southern Spain.

    Science.gov (United States)

    Gómez, Paula; Lozano, Carmen; González-Barrio, David; Zarazaga, Myriam; Ruiz-Fons, Francisco; Torres, Carmen

    2015-06-12

    The objective was to determine the prevalence of Staphylococcus aureus nasal carriage in red deer of a semi-extensive farm and in humans in contact with the estate animals, and to characterize obtained isolates. Nasal swabs of 65 deer and 15 humans were seeded on mannitol-salt-agar and oxacillin-resistance-screening-agar-base. Isolates were identified by microbiological and molecular methods. Antimicrobial susceptibility profile was determined for 16 antibiotics by disk-diffusion and the presence of eight antibiotic resistance genes, seven virulence genes and genes of immune-evasion-cluster (IEC) was analyzed by PCR. S. aureus was typed by PFGE-SmaI, spa, agr, SCCmec and MLST. Isolates were detected in 16 deer (24.6%). Eleven S. aureus isolates were methicillin-resistant (MRSA), and five were methicillin-susceptible (MSSA). All MRSA harbored mecC gene and were agr-III/SCCmecXI/ST1945 (four spa-t843 and seven spa-t1535). All mecC-MRSA carried blaZ-SCCmecXI and etd2, were IEC-type-E, and belonged to the same PFGE pattern. The five MSSA were typed as spa-t2420/agr-I/ST133. Regarding humans, S. aureus was recovered from six samples (40%). The isolates were MSSA and were typed as spa-t002/agr-II, spa-t012/agr-III or spa-t822/agr-III and showed different IEC types (A, B, D and F). blaZ and erm(A) genes were detected, as well as cna and tst genes. As conclusion, red deer analyzed in this study are frequent carriers of mecC-MRSA CC130 (16.9%), they are characterized by few resistance and virulence determinants, and by the presence of IEC type-E. Deer could be a source of mecC-MRSA which could potentially be transmitted to other animals, or even to humans. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Carry

    DEFF Research Database (Denmark)

    Koijen, Ralph S.J.; Moskowitz, Tobias J.; Heje Pedersen, Lasse

    that include global equities, global bonds, currencies, commodities, US Treasuries, credit, and equity index options. This predictability underlies the strong returns to "carry trades" that go long high-carry and short low-carry securities, applied almost exclusively to currencies, but shown here...

  4. Role of the RS1 sequence of the cholera vibrio in amplification of the segment of plasmid DNA carrying the gene of resistance to tetracycline and the genes of cholera toxin

    Energy Technology Data Exchange (ETDEWEB)

    Fil' kova, S.L.; Il' ina, T.S.; Gintsburg, A.L.; Yanishevskii, N.V.; Smirnov, G.B.

    1988-11-01

    The hybrid plasmid pCO107, representing cointegrate 14(2)-5(2) of two plasmids, an F-derivative (pOX38) and a PBR322-derivative (pCT105) with an RS1 sequence of the cholera vibrio cloned in its makeup, contains two copes of RS1 at the sites of union of the two plasmids. Using a tetracycline resistance marker (Tc/sup R/) of the plasmid pCT105, clones were isolated which have an elevated level of resistance to tetracycline (an increase of from 4- to 30-fold). Using restriction analysis and the Southern blot method of hybridization it was shown that the increase in the level of resistance of tetracycline is associated with the amplification of pCT105 portion of the cointegrate, and that the process of amplification is governed by the presence of direct repeats of the RS1 sequence at its ends. The increase in the number of copies of the pCT105 segment, which contains in its composition the genes of cholera toxin (vct), is accompanied by an increase in toxin production.

  5. Role of the RS1 sequence of the cholera vibrio in amplification of the segment of plasmid DNA carrying the gene of resistance to tetracycline and the genes of cholera toxin

    International Nuclear Information System (INIS)

    Fil'kova, S.L.; Il'ina, T.S.; Gintsburg, A.L.; Yanishevskii, N.V.; Smirnov, G.B.

    1988-01-01

    The hybrid plasmid pCO107, representing cointegrate 14(2)-5(2) of two plasmids, an F-derivative (pOX38) and a PBR322-derivative (pCT105) with an RS1 sequence of the cholera vibrio cloned in its makeup, contains two copes of RS1 at the sites of union of the two plasmids. Using a tetracycline resistance marker (Tc R ) of the plasmid pCT105, clones were isolated which have an elevated level of resistance to tetracycline (an increase of from 4- to 30-fold). Using restriction analysis and the Southern blot method of hybridization it was shown that the increase in the level of resistance of tetracycline is associated with the amplification of pCT105 portion of the cointegrate, and that the process of amplification is governed by the presence of direct repeats of the RS1 sequence at its ends. The increase in the number of copies of the pCT105 segment, which contains in its composition the genes of cholera toxin (vct), is accompanied by an increase in toxin production

  6. Horizontol dissemination of TEM- and SHV-typr beta-lactamase genes-carrying resistance plasmids amongst clonical isolates of Enterobacteriaceae Disseminação horizontal de plasmídios de resistência contendo genes de beta-lactamase dos tipos TEM e SHV entre isolados clínicos de Enterobacteriaceae

    Directory of Open Access Journals (Sweden)

    Osman Birol Ozgumus

    2008-12-01

    Full Text Available The extended-spectrum β-lactamase (ESBL-producing bacteria have been isolated at increasing frequency worldwide. Expression of ESBL is often associated with multidrug resistance and dissemination by resistance plasmids. During a two-month period in 2000, 133 clinical isolates of enterobacterial strains were randomly collected from outpatients and inpatients at a university hospital in Turkey. The ESBL producing strains were determined by double-disk synergy (DDS testing. Twenty ESBL producing strains (15% including Escherichia coli (n = 9, Klebsiella pneumoniae (n = 7, Klebsiella oxytoca (n = 2 and Enterobacter aerogenes (n = 2 were detected and further analyzed for their resistance transfer features, plasmid profile and nature of the resistance genes. Plasmid transfer assays were performed using broth mating techniques. TEM- and SHV- genes were analyzed by polymerase chain reaction (PCR and hybridization using specific probes. EcoRI restriction enzyme analyses of R plasmids were used in the detection of epidemic plasmids. Fourteen plasmid profiles (A, B1, B2, C1, and C2 to L were obtained with EcoRI restriction enzyme analysis. Most of these plasmids were detected to carry both TEM- and SHV-derived genes by PCR, and confirmed by localizing each gene by hybridization assay. Epidemiological evidence indicated that there was an apparent horizontal dissemination of conjugative R plasmids among multidrug-resistant enterobacterial genera and species in this hospitalO isolamento de bactérias produtoras de beta-lactamases de espectro expandido (ESBL está aumentando no mundo todo. Freqüentemente, a expressão de ESBL está associada com resistência a múltiplas drogas e disseminação por plasmídios de resistência. Durante um período de dois meses em 2000, 133 isolados clínicos de cepas de enterobactérias foram obtidos aleatoriamente de pacientes internos e externos de um hospital universitário na Turquia. As cepas produtoras de ESBL foram

  7. Carry

    DEFF Research Database (Denmark)

    Koijen, Ralph S.J.; Moskowitz, Tobias; Pedersen, Lasse Heje

    2018-01-01

    -sectionally and in time series for a host of different asset classes, including global equities, global bonds, commodities, US Treasuries, credit, and options. Carry is not explained by known predictors of returns from these asset classes, and it captures many of these predictors, providing a unifying framework...... for return predictability. We reject a generalized version of Uncovered Interest Parity and the Expectations Hypothesis in favor of models with varying risk premia, in which carry strategies are commonly exposed to global recession, liquidity, and volatility risks, though none fully explains carry’s premium....

  8. Gene therapy of cancer by vaccines carrying inserted immunostimulatory genes

    Czech Academy of Sciences Publication Activity Database

    Bubeník, Jan

    2007-01-01

    Roč. 53, č. 3 (2007), s. 71-73 ISSN 0015-5500 Grant - others:EU-FP6 NoE Clinigene(XE) 018933; Liga proti rakovině, Praha(CZ) XX Institutional research plan: CEZ:AV0Z50520514 Keywords : gene therapy * immunostimulatory genes * vaccine Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.596, year: 2007

  9. The Novel Kasugamycin 2′-N-Acetyltransferase Gene aac(2′)-IIa, Carried by the IncP Island, Confers Kasugamycin Resistance to Rice-Pathogenic Bacteria

    Science.gov (United States)

    Moriyama, Hiromitsu; Fukuhara, Toshiyuki

    2012-01-01

    Kasugamycin (KSM), a unique aminoglycoside antibiotic, has been used in agriculture for many years to control not only rice blast caused by the fungus Magnaporthe grisea but also rice bacterial grain and seedling rot or rice bacterial brown stripe caused by Burkholderia glumae or Acidovorax avenae subsp. avenae, respectively. Since both bacterial pathogens are seed-borne and cause serious injury to rice seedlings, the emergence of KSM-resistant B. glumae and A. avenae isolates highlights the urgent need to understand the mechanism of resistance to KSM. Here, we identified a novel gene, aac(2′)-IIa, encoding a KSM 2′-N-acetyltransferase from both KSM-resistant pathogens but not from KSM-sensitive bacteria. AAC(2′)-IIa inactivates KSM, although it reveals no cross-resistance to other aminoglycosides. The aac(2′)-IIa gene from B. glumae strain 5091 was identified within the IncP genomic island inserted into the bacterial chromosome, indicating the acquisition of this gene by horizontal gene transfer. Although excision activity of the IncP island and conjugational gene transfer was not detected under the conditions tested, circular intermediates containing the aac(2′)-IIa gene were detected. These results indicate that the aac(2′)-IIa gene had been integrated into the IncP island of a donor bacterial species. Molecular detection of the aac(2′)-IIa gene could distinguish whether isolates are resistant or susceptible to KSM. This may contribute to the production of uninfected rice seeds and lead to the effective control of these pathogens by KSM. PMID:22660700

  10. Clonal expansion and emergence of environmental multiple-triazole-resistant Aspergillus fumigatus strains carrying the TR₃₄/L98H mutations in the cyp51A gene in India.

    Directory of Open Access Journals (Sweden)

    Anuradha Chowdhary

    Full Text Available Azole resistance is an emerging problem in Aspergillus which impacts the management of aspergillosis. Here in we report the emergence and clonal spread of resistance to triazoles in environmental Aspergillus fumigatus isolates in India. A total of 44 (7% A. fumigatus isolates from 24 environmental samples were found to be triazole resistant. The isolation rate of resistant A. fumigatus was highest (33% from soil of tea gardens followed by soil from flower pots of the hospital garden (20%, soil beneath cotton trees (20%, rice paddy fields (12.3%, air samples of hospital wards (7.6% and from soil admixed with bird droppings (3.8%. These strains showed cross-resistance to voriconazole, posaconazole, itraconazole and to six triazole fungicides used extensively in agriculture. Our analyses identified that all triazole-resistant strains from India shared the same TR(34/L98H mutation in the cyp51 gene. In contrast to the genetic uniformity of azole-resistant strains the azole-susceptible isolates from patients and environments in India were genetically very diverse. All nine loci were highly polymorphic in populations of azole-susceptible isolates from both clinical and environmental samples. Furthermore, all Indian environmental and clinical azole resistant isolates shared the same multilocus microsatellite genotype not found in any other analyzed samples, either from within India or from the Netherlands, France, Germany or China. Our population genetic analyses suggest that the Indian azole-resistant A. fumigatus genotype was likely an extremely adaptive recombinant progeny derived from a cross between an azole-resistant strain migrated from outside of India and a native azole-susceptible strain from within India, followed by mutation and then rapid dispersal through many parts of India. Our results are consistent with the hypothesis that exposure of A. fumigatus to azole fungicides in the environment causes cross-resistance to medical triazoles. The

  11. High Prevalence of Plasmid-Mediated Quinolone Resistance and IncQ Plasmids Carrying qnrS2 Gene in Bacteria from Rivers near Hospitals and Aquaculture in China.

    Directory of Open Access Journals (Sweden)

    Yanping Wen

    Full Text Available Effluents from hospital and aquaculture are considered important sources of quinolone resistance. However, little information is available on the impact of this effluent on nearby rivers. In this study, 188 ciprofloxacin-resistant bacterial isolates obtained from rivers near hospitals and aquaculture were screened for plasmid-mediated quinolone resistance (PMQR genes. Species identification, antibiotic susceptibility testing, and PMQR gene transferability assessment were conducted for PMQR-positive bacteria. Representative qnrS2-encoding plasmids were subsequently sequenced using a primer-walking approach. In total, 44 isolates (23.4% were positive for qnr genes (16 qnrB2, 3 qnrS1, and 25 qnrS2 and 32 isolates (17.0% were positive for aac(6'-Ib-cr. Other PMQR genes were not detected. The qnrB2 and aac(6'-Ib-cr genes had a higher prevalence in aquaculture samples than in hospital samples, and were significantly associated with Enterobacteriaceae (p < 0.05. In contrast, the prevalence of qnrS2 was not site-related, but was significantly associated with Aeromonas spp. (p < 0.05. All PMQR isolates were resistant to three or more classes of antibiotics. Eleven qnrS2-harboring plasmids from Aeromonas spp., including a novel conjugative plasmid pHP18, were selected for sequencing. These plasmids were small in size (6,388-16,197 bp and belonged to the IncQ or IncU plasmid family, with qnrS2 being part of a mobile insertion cassette. Taken together, our findings suggest that aquaculture is a possible source for aac(6'-Ib-cr and qnrB2 dissemination, and demonstrate the ubiquity of qnrS2 in aquatic environments. Finally, Aeromonas spp. served as vectors for qnrS2 with the help of IncQ-type plasmids.

  12. Multi-drug carbapenem-resistant Klebsiella pneumoniae infection carrying the OXA-48 gene and showing variations in outer membrane protein 36 causing an outbreak in a tertiary care hospital in Riyadh, Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Taher uz Zaman

    2014-11-01

    Conclusions: This is probably the first reported outbreak of multidrug/carbapenem-resistant Klebsiella infection involving the OXA-48 gene from Saudi Arabia. Although the presence of ESBLs such as OXA, CTX-M, TEM, and SHV are predictable reasons for resistance, variations in the Omp-36 gene might also have precipitated this phenomenon. Disruption of the Omp-36 sequence by large insertional elements, the insertion of two amino acids in a very crucial part of this protein, and the presence of a premature stop codon in one isolate might have rendered this protein incomplete and non-functional. The study also demonstrated that more than one type of clone was responsible for this reported apparent outbreak and that ST29, a clone not reported from this region before, was the major clone responsible.

  13. Emergence of Klebsiella pneumoniae carrying bla(VIM) and bla(KPC) genes.

    Science.gov (United States)

    Meletis, G; Tzampaz, E; Protonotariou, E; Sofianou, D

    2010-04-01

    A Klebsiella pneumoniae clinical isolate resistant to imipenem was recovered from a wound sample. The patient, a 57-year-old man, underwent a surgical resection of small bowel and sigmoid colon and was treated with multiple courses of antimicrobials. PCR analysis revealed that the clinical isolate was carrying simultaneously bla(VIM-1), bla(KPC-2), bla(SHV) and bla(TEM) genes. The concomitant presence of these genes is alarming and poses therapeutic as well as infection control problems.

  14. Outbreak caused by a multi-resistant Klebsiella pneumoniae strain of new sequence type ST341 carrying new genetic environments of aac(6')-Ib-cr and qnrS1 genes in a neonatal intensive care unit in Spain.

    Science.gov (United States)

    Ruiz, Elena; Rojo-Bezares, Beatriz; Sáenz, Yolanda; Olarte, Inés; Esteban, Inés; Rocha-Gracia, Rosa; Zarazaga, Myriam; Torres, Carmen

    2010-11-01

    An outbreak due to a Klebsiella pneumoniae clone occurred in a neonatal intensive care unit of a Spanish Hospital in which three newborns were infected (all with gestational age ≤29 weeks; two of them died) and seven were colonized (gestational age >32 weeks; none died). One K. pneumoniae strain per patient was further characterized. The 10 strains showed an indistinguishable pulsed-field-gel-electrophoresis pattern, were typed in the phylogenetic group KpI and were ascribed into a new sequence type registered as ST341. All 10 strains presented the same multiple-antibiotic-resistant phenotype, showed extended-spectrum-beta-lactamase production, and harbored the bla(CTX-M-15), bla(SHV-11), bla(OXA-1,)aac(6')-Ib-cr, qnrS1, aac(3)-II, aph(3')-Ia and aadA5 resistance genes. No class 1 or class 2 integrons were detected. The bla(CTX-M-15) gene presented the following genetic environment: ISEcp1-bla(CTX-M-15)-orf477. These strains contained two copies of the aac(6')-Ib-cr gene included in the following new genetic environments: aac(3)-II-IS26-aac(6')-Ib-cr-bla(OXA-1) and aac(3)-II-IS26-ΔcatB3-bla(OXA-1)-aac(6')-Ib-cr (registered at GenBank with accession numbers GQ438247 and GQ438248, respectively). The genetic environment of the qnrS1 gene (IS26-ΔISEcl2-qnrS1) (GenBank accession number GQ438249) was also not described previously. The aac(6')-Ib-cr, qnrS1, bla(CTX-M-15), aac(3)-II, and bla(OXA-1) genes, located in a plasmid of 33.5 kb, could be transferred to Escherichia coli by transformation. Copyright © 2010 Elsevier GmbH. All rights reserved.

  15. A Constitutively Mannose-Sensitive Agglutinating Salmonella enterica subsp. enterica Serovar Typhimurium Strain, Carrying a Transposon in the Fimbrial Usher Gene stbC, Exhibits Multidrug Resistance and Flagellated Phenotypes

    Directory of Open Access Journals (Sweden)

    Kuan-Hsun Wu

    2012-01-01

    Full Text Available Static broth culture favors Salmonella enterica subsp. enterica serovar Typhimurium to produce type 1 fimbriae, while solid agar inhibits its expression. A transposon inserted in stbC, which would encode an usher for Stb fimbriae of a non-flagellar Salmonella enterica subsp. enterica serovar Typhimurium LB5010 strain, conferred it to agglutinate yeast cells on both cultures. RT-PCR revealed that the expression of the fimbrial subunit gene fimA, and fimZ, a regulatory gene of fimA, were both increased in the stbC mutant when grown on LB agar; fimW, a repressor gene of fimA, exhibited lower expression. Flagella were observed in the stbC mutant and this phenotype was correlated with the motile phenotype. Microarray data and RT-PCR indicated that the expression of three genes, motA, motB, and cheM, was enhanced in the stbC mutant. The stbC mutant was resistant to several antibiotics, consistent with the finding that expression of yhcQ and ramA was enhanced. A complementation test revealed that transforming a recombinant plasmid possessing the stbC restored the mannose-sensitive agglutination phenotype to the stbC mutant much as that in the parental Salmonella enterica subsp. enterica serovar Typhimurium LB5010 strain, indicating the possibility of an interplay of different fimbrial systems in coordinating their expression.

  16. Recombination of strain O segments to HCpro-encoding sequence of strain N of Potato virus Y modulates necrosis induced in tobacco and in potatoes carrying resistance genes Ny or Nc.

    Science.gov (United States)

    Tian, Yan-Ping; Valkonen, Jari P T

    2015-09-01

    Hypersensitive resistance (HR) to strains O and C of Potato virus Y (PVY, genus Potyvirus) is conferred by potato genes Ny(tbr) and Nc(tbr), respectively; however, PVY N strains overcome these resistance genes. The viral helper component proteinases (HCpro, 456 amino acids) from PVY(N) and PVY(O) are distinguished by an eight-amino-acid signature sequence, causing HCpro to fold into alternative conformations. Substitution of only two residues (K269R and R270K) of the eight-amino-acid signature in PVY(N) HCpro was needed to convert the three-dimensional (3D) model of PVY(N) HCpro to a PVY(O) -like conformation and render PVY(N) avirulent in the presence of Ny(tbr), whereas four amino acid substitutions were necessary to change PVY(O) HCpro to a PVY(N) -like conformation. Hence, the HCpro conformation rather than other features ascribed to the sequence were essential for recognition by Ny(tbr). The 3D model of PVY(C) HCpro closely resembled PVY(O), but differed from PVY(N) HCpro. HCpro of all strains was structurally similar to β-catenin. Sixteen PVY(N) 605-based chimeras were inoculated to potato cv. Pentland Crown (Ny(tbr)), King Edward (Nc(tbr)) and Pentland Ivory (Ny(tbr)/Nc(tbr)). Eleven chimeras induced necrotic local lesions and caused no systemic infection, and thus differed from both parental viruses that infected King Edward systemically, and from PVY(N) 605 that infected Pentland Crown and Pentland Ivory systemically. These 11 chimeras triggered both Ny(tbr) and Nc(tbr) and, in addition, six induced veinal necrosis in tobacco. Further, specific amino acid residues were found to have an additive impact on necrosis. These results shed new light on the causes of PVY-related necrotic symptoms in potato. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  17. Detection of staphylococcal cassette chromosome mec type XI carrying highly divergent mecA, mecI, mecR1, blaZ, and ccr genes in human clinical isolates of clonal complex 130 methicillin-resistant Staphylococcus aureus.

    LENUS (Irish Health Repository)

    Shore, Anna C

    2011-08-01

    Methicillin resistance in staphylococci is mediated by penicillin binding protein 2a (PBP 2a), encoded by mecA on mobile staphylococcal cassette chromosome mec (SCCmec) elements. In this study, two clonal complex 130 (CC130) methicillin-resistant Staphylococcus aureus (MRSA) isolates from patients in Irish hospitals were identified that were phenotypically PBP 2a positive but lacked mecA by conventional PCR and by DNA microarray screening. The isolates were identified as methicillin-susceptible S. aureus using the GeneXpert real-time PCR assay. Whole-genome sequencing of one isolate (M10\\/0061) revealed a 30-kb SCCmec element encoding a class E mec complex with highly divergent blaZ-mecA-mecR1-mecI, a type 8 cassette chromosome recombinase (ccr) complex consisting of ccrA1-ccrB3, an arsenic resistance operon, and flanking direct repeats (DRs). The SCCmec element was almost identical to that of SCCmec type XI (SCCmec XI) identified by the Sanger Institute in sequence type 425 bovine MRSA strain LGA251 listed on the website of the International Working Group on the Classification of Staphylococcal Cassette Chromosome Elements. The open reading frames (ORFs) identified within SCCmec XI of M10\\/0061 exhibited 21 to 93% amino acid identity to ORFs in GenBank. A third DR was identified ca. 3 kb downstream of SCCmec XI, indicating the presence of a possible SCC remnant. SCCmec XI was also identified in the second CC130 MRSA isolate by PCR and sequencing. The CC130 MRSA isolates may be of animal origin as previously reported CC130 S. aureus strains were predominantly from bovine sources. The highly divergent nature of SCCmec XI relative to other SCCmec elements indicates that it may have originated in another taxon.

  18. Exploring Antibiotic Resistance Genes and Metal Resistance Genes in Plasmid Metagenomes from Wastewater Treatment Plants

    Directory of Open Access Journals (Sweden)

    An-Dong eLi

    2015-09-01

    Full Text Available Plasmids operate as independent genetic elements in microorganism communities. Through horizontal gene transfer, they can provide their host microorganisms with important functions such as antibiotic resistance and heavy metal resistance. In this study, six metagenomic libraries were constructed with plasmid DNA extracted from influent, activated sludge and digested sludge of two wastewater treatment plants. Compared with the metagenomes of the total DNA extracted from the same sectors of the wastewater treatment plant, the plasmid metagenomes had significantly higher annotation rates, indicating that the functional genes on plasmids are commonly shared by those studied microorganisms. Meanwhile, the plasmid metagenomes also encoded many more genes related to defense mechanisms, including ARGs. Searching against an antibiotic resistance genes (ARGs database and a metal resistance genes (MRGs database revealed a broad-spectrum of antibiotic (323 out of a total 618 subtypes and metal resistance genes (23 out of a total 23 types on these plasmid metagenomes. The influent plasmid metagenomes contained many more resistance genes (both ARGs and MRGs than the activated sludge and the digested sludge metagenomes. Sixteen novel plasmids with a complete circular structure that carried these resistance genes were assembled from the plasmid metagenomes. The results of this study demonstrated that the plasmids in wastewater treatment plants could be important reservoirs for resistance genes, and may play a significant role in the horizontal transfer of these genes.

  19. Hypersensitive response to Aphis gossypii Glover in melon genotypes carrying the Vat gene.

    Science.gov (United States)

    Villada, Emilio Sarria; González, Elisa Garzo; López-Sesé, Ana Isabel; Castiel, Alberto Fereres; Gómez-Guillamón, María Luisa

    2009-01-01

    Aphis gossypii Glover causes direct and indirect damage to Cucumis melo L. crops. To decrease the harmful effects of this pest, one of the most economically and environmentally acceptable options is to use genetically resistant melon varieties. To date, several sources of resistance carrying the Vat gene are used in melon breeding programmes that aim to prevent A. gossypii colonization and the subsequent aphid virus transmission. The results suggest that the resistance conferred by this gene is associated with a microscopic hypersensitive response specific against A. gossypii. Soon after aphid infestation, phenol synthesis, deposits of callose and lignin in the cell walls, damage to the plasmalemma, and a micro-oxidative burst were detected in genotypes carrying the Vat gene. According to electrical penetration graph experiments, this response seems to occur after aphid stylets puncture the plant cells and not during intercellular stylet penetration. This type of plant tissue reaction was not detected in melon plants infested with Bemisia tabaci Gennadius nor Myzus persicae Sulzer.

  20. Associations between Antimicrobial Resistance Phenotypes, Antimicrobial Resistance Genes, and Virulence Genes of Fecal Escherichia coli Isolates from Healthy Grow-Finish Pigs ▿

    OpenAIRE

    Rosengren, Leigh B.; Waldner, Cheryl L.; Reid-Smith, Richard J.

    2009-01-01

    Escherichia coli often carries linked antimicrobial resistance genes on transmissible genetic elements. Through coselection, antimicrobial use may select for unrelated but linked resistance or virulence genes. This study used unconditional statistical associations to investigate the relationships between antimicrobial resistance phenotypes and antimicrobial resistance genes in 151 E. coli isolates from healthy pigs. Phenotypic resistance to each drug was significantly associated with phenotyp...

  1. NDM 1 Gene Carrying Gram negative Bacteria Isolated from Rats ...

    African Journals Online (AJOL)

    In this study, we screened 56 Gram negative bacteria comprising: 3 isolates of Enterobacter ludwigii, 30 Pseudomonas aeruginosa, 22 Proteus mirabilis, and 1 Aeromonas caviae isolated from oral cavity and rectum of rats captured from commercial poultry houses in Ibadan, Oyo State, Nigeria that were resistant to at least ...

  2. Full-Genome Sequencing Identifies in the Genetic Background Several Determinants That Modulate the Resistance Phenotype in Methicillin-Resistant Staphylococcus aureus Strains Carrying the NovelmecCGene.

    Science.gov (United States)

    Milheiriço, Catarina; de Lencastre, Hermínia; Tomasz, Alexander

    2017-03-01

    Most methicillin-resistant Staphylococcus aureus (MRSA) strains are resistant to beta-lactam antibiotics due to the presence of the mecA gene, encoding an extra penicillin-binding protein (PBP2A) that has low affinity for virtually all beta-lactam antibiotics. Recently, a new resistance determinant-the mecC gene-was identified in S. aureus isolates recovered from humans and dairy cattle. Although having typically low MICs to beta-lactam antibiotics, MRSA strains with the mecC determinant are also capable of expressing high levels of oxacillin resistance when in an optimal genetic background. In order to test the impact of extensive beta-lactam selection on the emergence of mecC -carrying strains with high levels of antibiotic resistance, we exposed the prototype mecC -carrying MRSA strain, LGA251, to increasing concentrations of oxacillin. LGA251 was able to rapidly adapt to high concentrations of oxacillin in growth medium. In such laboratory mutants with increased levels of oxacillin resistance, we identified mutations in genes with no relationship to the mecC regulatory system, indicating that the genetic background plays an important role in the establishment of the levels of oxacillin resistance. Our data also indicate that the stringent stress response plays a critical role in the beta-lactam antibiotic resistance phenotype of MRSA strains carrying the mecC determinant. Copyright © 2017 American Society for Microbiology.

  3. Salmonella enterica Serovar Typhimurium Virulence-Resistance Plasmids Derived from the pSLT Carrying Nonconventional Class 1 Integrons with dfrA12 Gene in Their Variable Region and sul3 in the 3' Conserved Segment

    NARCIS (Netherlands)

    Beutlich, J.; Rodicio, M.R.; Mendoza, M.C.; Garcia, P.; Kirchner, M.; Luzzi, I.; Mevius, D.J.; Threllfall, J.; Helmuth, R.; Guerra, B.

    2013-01-01

    Drug-resistant derivatives of serovar-specific virulence plasmids, such as pSLT, in clinically-relevant Salmonella enterica serovar Typhimurium strains, represent a threat for human health. We have analysed 14 S. Typhimurium isolates recovered in Italy and the United Kingdom from swine and from

  4. Analysis of metal and biocides resistance genes in drug resistance and susceptible Salmonella enterica from food animals

    Science.gov (United States)

    Background Generally drug resistant bacteria carry antibiotic resistance genes and heavy metal and biocide resistance genes on large conjugative plasmids. The presence of these metal and biocide resistance genes in susceptible bacteria are not assessed comprehensively. Hence, WGS data of susceptib...

  5. The Novel Kasugamycin 2′-N-Acetyltransferase Gene aac(2′)-IIa, Carried by the IncP Island, Confers Kasugamycin Resistance to Rice-Pathogenic Bacteria

    OpenAIRE

    Yoshii, Atsushi; Moriyama, Hiromitsu; Fukuhara, Toshiyuki

    2012-01-01

    Kasugamycin (KSM), a unique aminoglycoside antibiotic, has been used in agriculture for many years to control not only rice blast caused by the fungus Magnaporthe grisea but also rice bacterial grain and seedling rot or rice bacterial brown stripe caused by Burkholderia glumae or Acidovorax avenae subsp. avenae, respectively. Since both bacterial pathogens are seed-borne and cause serious injury to rice seedlings, the emergence of KSM-resistant B. glumae and A. avenae isolates highlights the ...

  6. The novel Pseudomonas putida plasmid p12969-2 harbors an In127-carrying multidrug-resistant region.

    Science.gov (United States)

    Xu, Yang; Niu, Yong; Sun, Fengjun; Yang, Ying; Luo, Wenbo; Wang, Zhe

    2017-06-01

    This study aims to characterize a multidrug-resistant (MDR) plasmid p12969-2 coexistent with the previously reported one p12969-DIM in clinical Pseudomonas putida. The complete sequence of p12969-2 was determined using next-generation sequencing technology. p12969-2 contains a 29.2 kb MDR region, which carries In127 harboring three resistance genes aadA2, qacED1 and sul1. The MDR region is derived from the connection of Tn5041D and Tn5045, which is facilitated by two copies of miniature inverted-repeat transposable element. Conclusion & future perspective: p12969-2 represents a novel lineage with the highest but limited nucleotide sequence similarity with the plasmid pGRT1 that does not carry any of the resistance genes. This is the first report of coexistence of two MDR plasmids in P. putida.

  7. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome. 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS ...

  8. Coliform bacteria isolated from recreational lakes carry class 1 and class 2 integrons and virulence-associated genes.

    Science.gov (United States)

    Koczura, R; Krysiak, N; Taraszewska, A; Mokracka, J

    2015-08-01

    To characterize the integron-harbouring Gram-negative bacteria in recreational lakes, with focus on the genetic content of integrons, antimicrobial resistance profiles and virulence-associated genes. The presence and structure of integrons in coliform bacteria isolated from the water of four recreational lakes located in Poznań, Poland, was determined by PCR method. Antimicrobial resistance testing was done by disc diffusion method. Virulence-associated genes in integron-bearing Escherichia coli isolates were detected by PCR. A total of 155 integron-bearing strains of coliform bacteria were cultured. Sequence analysis showed the presence of dfrA7, aadA1, dfrA1-aadA1, dfrA17-aadA5 and dfrA12-orfF-aadA2 gene cassette arrays in class 1 integrons and dfrA1-sat2-aadA1 in class 2 integrons. Higher frequency of integron-positive bacteria and higher antimicrobial resistance ranges were noted in colder months (January and November) compared with spring and summer months. The integron-harbouring E. coli carried up to nine virulence-associated genes, with the highest frequency of kpsMT (84.6%) and traT (783%), coding for group 2 capsule and determining human serum resistance respectively. Integron-bearing multidrug resistant coliform bacteria carrying virulence genes are present in waters of recreational lakes. This study presents antimicrobial resistance and virulence-associated genes in integron-bearing coliform bacteria present in the waters of recreational lakes, which showed that multidrug resistant bacteria with virulence traits might pose a threat to public health. Moreover, the presence of genes typical for enterotoxigenic and Shiga toxin-producing E. coli is a concern. © 2015 The Society for Applied Microbiology.

  9. Antimicrobial synergism against different lineages of methicillin-resistant Staphylococcus aureus carrying SCCmec IV.

    Science.gov (United States)

    de Matos, P D M; Sedaca, S; Ferreira, D C; Iorio, N L; Toledo, V C S; Freitas, A I C; Coelho, F L; Sousa, C; Dos Santos, K R N; Pereira, M O

    2014-06-01

    To evaluate the synergistic activity of antimicrobial drugs against lineages of methicillin-resistant Staphylococcus aureus (MRSA) carrying SCCmec IV. The biofilm production and related genes were also detected. Forty two MRSA isolates were tested for biofilm production and related genes. Biofilm/biomass susceptibility to gentamicin (G), linezolid (L), rifampicin (R) and vancomycin (V) was determined for six isolates from three lineages prevalent in Rio de Janeiro hospitals in concentrations ranging from 0·25 to 64 μg ml(-1). Biomass was evaluated by microtitre plate test and number of viable cells (CFU cm(-2)) and inspected by epifluorescence microscopy. All isolates presented the icaA and sasG genes, but only 38% were biofilm producers. There were 50 and 45% biomass reductions when concentrations ≥4 μg ml(-1) of R or L and ≥16 μg ml(-1) of G or V, respectively, were used. Synergism tests produced a 55% biomass reduction with R(2μgml-1) + G(16μgml-1), R(2μgml-1) + L(2μgml-1), R(2μgml-1) + V(4μgml-1), and L(2μgml-1) + V(4μgml-1). Number of viable cells was reduced from 2 to 3 logs with R(2μgml-1) + L(2μgml-1) and R(2μgml-1) + V(4μgml-1). Synergisms involving R plus L and R plus V caused important reductions in biofilm/biomass and the number of viable cells. Drug combinations should be considered in the chemotherapies of MRSA-SCCmec IV infections. Biofilms in MRSA infections restrict the clinical choice of antimicrobials. Thus, knowledge of the best options for monotherapy and drug synergisms could improve clinical results. © 2014 The Society for Applied Microbiology.

  10. Obesity genes and insulin resistance.

    Science.gov (United States)

    Belkina, Anna C; Denis, Gerald V

    2010-10-01

    The exploding prevalence of insulin resistance and Type 2 diabetes (T2D) linked to obesity has become an alarming public health concern. Worldwide, approximately 171 million people suffer from obesity-induced diabetes and public health authorities expect this situation to deteriorate rapidly. An interesting clinical population of 'metabolically healthy but obese' (MHO) cases is relatively protected from T2D and its associated cardiovascular risk. The molecular basis for this protection is not well understood but is likely to involve reduced inflammatory responses. The inflammatory cells and pathways that respond to overnutrition are the primary subject matter for this review. The chance discovery of a genetic mutation in the Brd2 gene, which is located in the class II major histocompatibility complex and makes mice enormously fat but protects them from diabetes, offers revolutionary new insights into the cellular mechanisms that link obesity to insulin resistance and T2D. These Brd2-hypomorphic mice have reduced inflammation in fat that is normally associated with insulin resistance, and resemble MHO patients, suggesting novel therapeutic pathways for obese patients at risk for T2D. Deeper understanding of the functional links between genes that control inflammatory responses to diet-induced obesity is crucial to the development of therapies for obese, insulin-resistant patients.

  11. Exome mutation burden predicts clinical outcome in ovarian cancer carrying mutated BRCA1 and BRCA2 genes

    DEFF Research Database (Denmark)

    Birkbak, Nicolai Juul; Kochupurakkal, Bose; Gonzalez-Izarzugaza, Jose Maria

    2013-01-01

    Reliable biomarkers predicting resistance or sensitivity to anti-cancer therapy are critical for oncologists to select proper therapeutic drugs in individual cancer patients. Ovarian and breast cancer patients carrying germline mutations in BRCA1 or BRCA2 genes are often sensitive to DNA damaging...... drugs and relative to non-mutation carriers present a favorable clinical outcome following therapy. Genome sequencing studies have shown a high number of mutations in the tumor genome in patients carrying BRCA1 or BRCA2 mutations (mBRCA). The present study used exome-sequencing and SNP 6 array data...... had either germlines or somatic mutations of BRCA1 or BRCA2 genes. The results revealed that the Nmut was significantly lower in the chemotherapy-resistant mBRCA HGSOC defined by progression within 6 months after completion of first line platinum-based chemotherapy. We found a significant association...

  12. blaOXA-48 carrying clonal colistin resistant-carbapenem resistant Klebsiella pneumoniae in neonate intensive care unit, India.

    Science.gov (United States)

    Singh, Santosh Kumar; Gupta, Minakshi

    2016-11-01

    Bacteria resistant to colistin, a last resort antibiotic reflect the pre-antibiotic era. In this study, colistin resistance carbapenem-resistant K. pneumoniae (COL R - CRKP) strains from neonate's intensive care unit were evaluated. Molecular analysis showed that all the four colistin resistant K. pneumoniae isolates were clonally related with strong biofilm formation ability and harbored bla SHV-34 and bla OXA-48 genes. Our result suggested the need of proper surveillance and adequate infection control to limiting the spread of these organisms. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Distribution of Florfenicol Resistance Genes fexA and cfr among Chloramphenicol-Resistant Staphylococcus Isolates

    Science.gov (United States)

    Kehrenberg, Corinna; Schwarz, Stefan

    2006-01-01

    A total of 302 chloramphenicol-resistant Staphylococcus isolates were screened for the presence of the florfenicol/chloramphenicol resistance genes fexA and cfr and their localization on mobile genetic elements. Of the 114 isolates from humans, only a single Staphylococcus aureus isolate showed an elevated MIC to florfenicol, but did not carry either of the known resistance genes, cfr or fexA. In contrast, 11 of the 188 staphylococci from animal sources were considered florfenicol resistant and carried either cfr (one isolate), fexA (five isolates), or both resistance genes (five isolates). In nine cases we confirmed that these genes were carried on a plasmid. Five different types of plasmids could be differentiated on the basis of their sizes, restriction patterns, and resistance genes. The gene fexA, which has previously been shown to be part of the nonconjugative transposon Tn558, was identified in 10 of the 11 resistant isolates from animals. PCR assays were developed to detect different parts of this transposon as well as their physical linkage. Complete copies of Tn558 were found in five different isolates and shown by inverse PCR to be functionally active. Truncated copies of Tn558, in which the tnpA-tnpB area was in part deleted by the integration of a 4,674-bp segment including the gene cfr and a novel 2,446-bp IS21-like insertion sequence, were seen in a plasmid present in three staphylococcal isolates. PMID:16569824

  14. Emissions of Escherichia coli Carrying Extended-Spectrum β-Lactamase Resistance from Pig Farms to the Surrounding Environment

    Directory of Open Access Journals (Sweden)

    Lili Gao

    2015-04-01

    Full Text Available The dissemination of extended-spectrum β-lactamase (ESBL-producing Escherichia coli (E. coli from food-producing animals to the surrounding environment has attracted much attention. To determine the emissions of ESBL-producing E. coli from pig farms to the surrounding environment, fecal and environmental samples from six pig farms were collected. In total, 119 ESBL-producing E. coli were isolated from feces, air samples, water, sludge and soil samples. Antibiotic susceptibility testing showed that the ESBL-producing isolates were resistant to multiple antibiotics and isolates of different origin within the same farm showed similar resistance phenotypes. Both CTX-M and TEM ESBL-encoding genes were detected in these isolates. CTX-M-14 and CTX-M-15 were the predominant ESBL genes identified. ESBL producers from feces and environmental samples within the same farm carried similar CTX-M types. The results indicated that the ESBL-producing E. coli carrying multidrug resistance could readily disseminate to the surrounding environment.

  15. Emissions of Escherichia coli Carrying Extended-Spectrum β-Lactamase Resistance from Pig Farms to the Surrounding Environment

    Science.gov (United States)

    Gao, Lili; Tan, Yeke; Zhang, Xiaodan; Hu, Jiaqing; Miao, Zengmin; Wei, Liangmeng; Chai, Tongjie

    2015-01-01

    The dissemination of extended-spectrum β-lactamase (ESBL)-producing Escherichia coli (E. coli) from food-producing animals to the surrounding environment has attracted much attention. To determine the emissions of ESBL-producing E. coli from pig farms to the surrounding environment, fecal and environmental samples from six pig farms were collected. In total, 119 ESBL-producing E. coli were isolated from feces, air samples, water, sludge and soil samples. Antibiotic susceptibility testing showed that the ESBL-producing isolates were resistant to multiple antibiotics and isolates of different origin within the same farm showed similar resistance phenotypes. Both CTX-M and TEM ESBL-encoding genes were detected in these isolates. CTX-M-14 and CTX-M-15 were the predominant ESBL genes identified. ESBL producers from feces and environmental samples within the same farm carried similar CTX-M types. The results indicated that the ESBL-producing E. coli carrying multidrug resistance could readily disseminate to the surrounding environment. PMID:25893997

  16. Subtyping of Chilean Methicillin-Resistant Staphylococcus aureus strains carrying the staphylococcal cassette chromosome mec type I

    Directory of Open Access Journals (Sweden)

    Gustavo Medina

    2012-09-01

    Full Text Available The cassette chromosome mec (SCCmec present in methicillin-resistant Staphylococcus aureus (MRSA has two essential components, the ccr gene complex and the mec gene complex. Additionally, SCCmec has non-essential components called J regions which are used for MRSA subtyping. This study was performed to determine subtypes MRSA strains carrying SCCmec type I based on polymorphism of regions located downstream of the mecA gene. A total of 98 MRSA strains carrying SCCmec type I isolated from patients hospitalized at the County Hospital of Valdivia (Chile between May 2007 and May 2008, were analyzed by multiplex PCR designed to amplify the mecA gene and 7 DNA hypervariable regions located around the mecA gene. MRSA strains were classified into seventeen genotypes accordingly to amplification patterns of DNA hypervariable regions. Five genotypes showed amplification patterns previously described. The remaining twelve genotypes showed new amplification patterns. Genotypes 18 and Genotype 19 were the most frequently detected. Regions HVR, Ins117 and pI258 stand out as being present in more than 60% of tested isolates. The acquisition of hypervariable regions by MRSA is a continuous horizontal transfer process through which the SCCmec have been preserved intact, or even may give rise to new types and subtypes of SCCmec. Therefore it is possible to infer that most MRSA strains isolated at the County Hospital of Valdivia (Chile were originated from two local clones which correspond to Genotype 18 and Genotype 19.

  17. Nosocomial Outbreak of Extensively Drug-Resistant Acinetobacter baumannii Isolates ContainingblaOXA-237Carried on a Plasmid.

    Science.gov (United States)

    Hujer, Andrea M; Higgins, Paul G; Rudin, Susan D; Buser, Genevieve L; Marshall, Steven H; Xanthopoulou, Kyriaki; Seifert, Harald; Rojas, Laura J; Domitrovic, T Nicholas; Cassidy, P Maureen; Cunningham, Margaret C; Vega, Robert; Furuno, Jon P; Pfeiffer, Christopher D; Beldavs, Zintars G; Wright, Meredith S; Jacobs, Michael R; Adams, Mark D; Bonomo, Robert A

    2017-11-01

    Carbapenem antibiotics are among the mainstays for treating infections caused by Acinetobacter baumannii , especially in the Northwest United States, where carbapenem-resistant A. baumannii remains relatively rare. However, between June 2012 and October 2014, an outbreak of carbapenem-resistant A. baumannii occurred in 16 patients from five health care facilities in the state of Oregon. All isolates were defined as extensively drug resistant. Multilocus sequence typing revealed that the isolates belonged to sequence type 2 (international clone 2 [IC2]) and were >95% similar as determined by repetitive-sequence-based PCR analysis. Multiplex PCR revealed the presence of a bla OXA carbapenemase gene, later identified as bla OXA-237 Whole-genome sequencing of all isolates revealed a well-supported separate branch within a global A. baumannii phylogeny. Pacific Biosciences (PacBio) SMRT sequencing was also performed on one isolate to gain insight into the genetic location of the carbapenem resistance gene. We discovered that bla OXA-237 , flanked on either side by IS Aba1 elements in opposite orientations, was carried on a 15,198-bp plasmid designated pORAB01-3 and was present in all 16 isolates. The plasmid also contained genes encoding a TonB-dependent receptor, septicolysin, a type IV secretory pathway (VirD4 component, TraG/TraD family) ATPase, an integrase, a RepB family plasmid DNA replication initiator protein, an alpha/beta hydrolase, and a BrnT/BrnA type II toxin-antitoxin system. This is the first reported outbreak in the northwestern United States associated with this carbapenemase. Particularly worrisome is that bla OXA-237 was carried on a plasmid and found in the most prominent worldwide clonal group IC2, potentially giving pORAB01-3 great capacity for future widespread dissemination. Copyright © 2017 American Society for Microbiology.

  18. Identification and characterization of the first Escherichia coli strain carrying NDM-1 gene in China.

    Science.gov (United States)

    Liu, Zhiyuan; Li, Wei; Wang, Jie; Pan, Jian; Sun, Shipeng; Yu, Yanhua; Zhao, Bing; Ma, Yuzhi; Zhang, Tingju; Qi, Jie; Liu, Guijian; Lu, Fengmin

    2013-01-01

    New Delhi metallo-β-lactamase-1 (NDM-1), an acquired class B carbapenemase, is a significant clinical threat due to its extended hydrolysis of β-lactams including carbapenems. In this study, we identified the first confirmed clinical isolate of Escherichia coli BJ01 harboring bla(NDM-1) in China. The isolate is highly resistant to all tested antimicrobials except polymyxin. bla(NDM-1), bla(CTX-M-57), and bla TEM-1 were identified in the isolate. bla(NDM-1) was transferable to E. coli EC600 and DH5α in both plasmid conjugation experiments and plasmid transformation tests. BJ01 was identified as a new sequence type, ST224, by multilocus sequence typing. Analysis of genetic environment shows complex transposon-like structures surrounding the bla NDM-1 gene. Genetic analysis revealed that the region flanking bla(NDM-1) was very similar to previously identified NDM-positive Acinetobacter spp. isolated in China. The findings of this study raise attention to the emergence and spread of NDM-1-carrying Enterobacteriaceae in China.

  19. Identification and characterization of the first Escherichia coli strain carrying NDM-1 gene in China.

    Directory of Open Access Journals (Sweden)

    Zhiyuan Liu

    Full Text Available New Delhi metallo-β-lactamase-1 (NDM-1, an acquired class B carbapenemase, is a significant clinical threat due to its extended hydrolysis of β-lactams including carbapenems. In this study, we identified the first confirmed clinical isolate of Escherichia coli BJ01 harboring bla(NDM-1 in China. The isolate is highly resistant to all tested antimicrobials except polymyxin. bla(NDM-1, bla(CTX-M-57, and bla TEM-1 were identified in the isolate. bla(NDM-1 was transferable to E. coli EC600 and DH5α in both plasmid conjugation experiments and plasmid transformation tests. BJ01 was identified as a new sequence type, ST224, by multilocus sequence typing. Analysis of genetic environment shows complex transposon-like structures surrounding the bla NDM-1 gene. Genetic analysis revealed that the region flanking bla(NDM-1 was very similar to previously identified NDM-positive Acinetobacter spp. isolated in China. The findings of this study raise attention to the emergence and spread of NDM-1-carrying Enterobacteriaceae in China.

  20. High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil.

    Science.gov (United States)

    Spano, Liliana Cruz; da Cunha, Keyla Fonseca; Monfardini, Mariane Vedovatti; de Cássia Bergamaschi Fonseca, Rita; Scaletsky, Isabel Christina Affonso

    2017-12-18

    Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas. A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns. DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates. The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.

  1. A case of familial transmission of community-acquired methicillin-resistant Staphylococcus aureus carrying the lnu(A gene in Santa Fe city, Argentina Caso de transmisión familiar de Staphylococcus aureus resistente a la meticilina adquirido en la comunidad portador del gen lnu(A en la ciudad de Santa Fe, Argentina

    Directory of Open Access Journals (Sweden)

    Emilce de los A Méndez

    2012-12-01

    Full Text Available Community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA is increasingly recognized as an important pathogen causing skin and soft tissue infections as well as necrotizing pneumonia. We describe a case of familial transmission of CA-MRSA between a 6-month-old boy and his mother in Santa Fe City, Argentina. Both isolates showed an identical antimicrobial susceptibility profile, carried type IV SCCmec and harboured the pvl and the lnu(A genes. Isolates showed indistinguishable SmaI-PFGE patterns confirming their genetic relationship. These results corroborate the intrafamilial transmission of CA-MRSA and might associate this strain with the repetitive events of furunculosis within the family.Staphylococcus aureus resistente a la meticilina adquirido en la comunidad (SARM-AC es reconocido como un patógeno importante que causa infecciones de piel y partes blandas y neumonía necrotizante. Describimos un caso de transmisión familiar de SARM-AC entre un nino de 6 meses de edad y su madre en la ciudad de Santa Fe, Argentina. Ambos aislamientos mostraron idéntico perfil de sensibilidad a los antimicrobianos, tenían el SCCmec tipo IV, y contenían los genes pvl y lnu(A. Los aislamientos presentaron patrones de SmaI-PFGE indistinguibles entre sí, lo cual confirmó su relación genética. Estos resultados corroboran la transmisión intrafamiliar de SARM-AC; asimismo, este aislamiento podría asociarse con los eventos repetitivos de furunculosis en la familia.

  2. Determination of rust resistance genes in pakistani bread wheats

    International Nuclear Information System (INIS)

    Qamar, M.; Ahmad, S.D.; Rabbani, M.A.; Shinwari, Z.K.

    2014-01-01

    Stripe and leaf rusts are the major constraints to bread wheat production in Pakistan. Molecular markers were used to investigate the presence of leaf rust and stripe rust resistance gene cluster Lr34/Yr18 and stem rust resistance gene Sr2 in 52 Pakistani bread wheat cultivars/lines. PCR amplification of DNA fragments using DNA marker csLV-34 showed that 13 of the studied cultivars/lines, namely 03FJ26, NR 337, NR 339, NR 347, NR 350, Manthar, Margalla 99, Iqbal 2000, Saleem 2000, Wafaq 2001, Marwat 2001, Pirsabak 2004 and Fareed 2006 carry leaf rust and stripe rust resistance genes Lr34/Yr18. Stem rust resistance gene Sr2 was observed in 36 Pakistani spring wheat cultivars/lines using stm560.3tgag marker. The slow rusting gene Sr2 needs to be combined with additional stem rust resistance genes to establish durable resistance against Ug99 in modern wheat cultivars. Low frequency of Lr34/Yr18 was found in Pakistani wheats. This gene cluster needs to be incorporated into Pakistani wheats for durable rust resistance. (author)

  3. Methicillin-resistant Staphylococcus lugdunensis carrying SCCmec type V misidentified as MRSA

    Directory of Open Access Journals (Sweden)

    Eliezer Menezes Pereira

    Full Text Available Staphylococcus lugdunensis is a rare cause of severe infections and clinical manifestations are similar to those related to S. aureus infection. We describe a hospital-acquired bacteremia due to methicillin-resistant Staphylococcus lugdunensis, misidentified as methicillin-resistant S. aureus. The oxacillin MIC was 16 µg/mL and the mecA gene and SCCmec type V were determined by PCR. Although treatment had been appropriated, the patient died after rapid progressive respiratory failure and another nosocomial sepsis. It is important not only to identify S. lugdunensis in view of its clinical course, but also to determine its susceptibility to oxacillin by detecting the mecA gene or its product.

  4. Vancomycin-resistance phenotypes, vancomycin-resistance genes, and resistance to antibiotics of enterococci isolated from food of animal origin.

    Science.gov (United States)

    Gousia, Panagiota; Economou, Vangelis; Bozidis, Petros; Papadopoulou, Chrissanthy

    2015-03-01

    In the present study, 500 raw beef, pork, and chicken meat samples and 100 pooled egg samples were analyzed for the presence of vancomycin-resistant enterococci, vancomycin-resistance phenotypes, and resistance genes. Of 141 isolates of enterococci, 88 strains of Enterococcus faecium and 53 strains of E. faecalis were identified. The most prevalent species was E. faecium. Resistance to ampicillin (n = 93, 66%), ciprofloxacin (n = 74, 52.5%), erythromycin (n = 73, 51.8%), penicillin (n = 59, 41.8%) and tetracycline (n = 52, 36.9%) was observed, while 53.2% (n = 75) of the isolates were multiresistant and 15.6% (n = 22) were susceptible to all antibiotics. Resistance to vancomycin was exhibited in 34.1% (n = 30) of the E. faecium isolates (n = 88) and 1.9% (n = 1) of the E. faecalis isolates (n = 53) using the disc-diffusion test and the E-test. All isolates were tested for vanA and vanB using real-time polymerase chain reaction (PCR) and multiplex PCR, and for vanC, vanD, vanE, vanG genes using multiplex PCR only. Among E. faecalis isolates, no resistance genes were identified. Among the E. faecium isolates, 28 carried the vanA gene when tested by multiplex PCR and 29 when tested with real-time PCR. No isolate carrying the vanC, vanD, vanE, or vanG genes was identified. Melting-curve analysis of the positive real-time PCR E. faecium isolates showed that 22 isolates carried the vanA gene only, 2 isolates the vanB2,3 genes only, and seven isolates carried both the vanA and vanB2,3 genes. Enterococci should be considered a significant zoonotic pathogen and a possible reservoir of genes encoding resistance potentially transferred to other bacterial species.

  5. A targeted ultrasound contrast agent carrying gene and cell-penetrating peptide: preparation and gene transfection in vitro.

    Science.gov (United States)

    Ren, Jianli; Zhang, Ping; Tian, Ju; Zhou, Zhiyi; Liu, Xingzhao; Wang, Dong; Wang, Zhigang

    2014-09-01

    Targeted and high efficient gene delivery is a main issue in gene treatment. Taking advantage of ischemic memory target P-selectin and our previous study-synergistic effects of ultrasound-targeted microbubble destruction (UTMD) and TAT peptide on gene transfection, which were characterized by targeted aggregation and high efficient gene transfection, we set up a 'smart' gene delivery system-targeted ultrasound contrast agent (UCA) carrying gene and cell-permeable peptides (CPP). Such UCA had a strong binding force with DNA which was protected from being hydrolysed by nuclease. Moreover, synergistic effects of UTMD and TAT peptide increased gene transfection. Specifically, the UCA were reacted with an ischemic memory target P-selectin overexpressed by ischemic issues (including ischemic heart disease) and loaded with gene and CPP, which enabled targeted localization and gene delivery to ischemic cells overexpressing P-selectin. We demonstrated their targeting affinity for hypoxia human umbilical vein endothelial cell (HUVEC) and gene transfection in vitro. The results of confocal laser scanning microscopy (CLSM) showed that gene and CPP were distributed on the shell of UCA. Red fluorescence was observed on the surface of targeted UCA using immunofluorescent microscopy, which demonstrated that the antibody was successfully connected to the UCA. The targeted UCA was specifically and tightly binded to hypoxia HUVEC, while there were no or little non-targeted UCA binding around hypoxia HUVEC. 24h after transfection, gene transfection efficiency detected by FCM was higher in targeted group than non-targeted group. Overall, the targeted UCA carrying gene and CPP was prepared successfully. It had a strong target binding capacity to hypoxia HUVEC and high efficient gene transfection, which maybe provide a novel strategy for gene therapy. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Distribution and quantification of antibiotic resistance genes and bacteria across agricultural and non-agricultural metagenomes

    Science.gov (United States)

    There is concern that antibiotic resistance can potentially be transferred from animals to humans through the food chain. The relationship between specific antibiotic resistant bacteria and the genes they carry remains to be described and few details are known about how antibiotic resistance genes i...

  7. Gene interactions and genetics of blast resistance and yield

    Indian Academy of Sciences (India)

    Blast disease caused by the pathogen Pyricularia oryzae is a serious threat to rice production. Six generations viz., P1, P2, F1, F2, B1 and B2 of a cross between blast susceptible high-yielding rice cultivar ADT 43 and resistant near isogenic line (NIL) CT13432-3R, carrying four blast resistance genes Pi1, Pi2, Pi33 and Pi54 ...

  8. Investigation of diversity of plasmids carrying the blaTEM-52 gene

    DEFF Research Database (Denmark)

    Bielak, Eliza Maria; Bergenholtz, Rikke D.; Jørgensen, Mikael Skaanning

    2011-01-01

    OBJECTIVES: To investigate the diversity of plasmids that carry blaTEM-52 genes among Escherichia coli and Salmonella enterica originating from animals, meat products and humans. METHODS: A collection of 22 blaTEM-52-encoding plasmids was characterized by restriction fragment length polymorphism...... of self-transfer to a plasmid-free E. coli recipient. CONCLUSIONS: The blaTEM-52 gene found in humans could have been transmitted on transferable plasmids originating from animal sources. Some of the blaTEM-52 plasmids carry replicons that differ from the classical ones. Two novel replicons were detected...... (RFLP), replicon typing (by PCR or replicon sequencing), susceptibility testing, assessment of plasmid ability to self-transfer by conjugation and typing of the genetic environment of the blaTEM-52 gene. Detected IncI1 plasmids underwent further plasmid multilocus sequence typing. RESULTS: RFLP profiles...

  9. Genetic analysis and location of a resistance gene to Puccinia ...

    Indian Academy of Sciences (India)

    Administrator

    Electrophoresis was carried out at 1400. V for 1.0 - 1.5 h. Gel staining and visualization was done as previously described (Chen et al. 1998). Polymorphic markers were used to genotype the F2 population. Genotype data were used to construct a genetic map and locate the resistance gene. Mapping and Data analysis.

  10. Salmonella Typhimurium ST213 is associated with two types of IncA/C plasmids carrying multiple resistance determinants.

    Science.gov (United States)

    Wiesner, Magdalena; Calva, Edmundo; Fernández-Mora, Marcos; Cevallos, Miguel A; Campos, Freddy; Zaidi, Mussaret B; Silva, Claudia

    2011-01-11

    Salmonella Typhimurium ST213 was first detected in the Mexican Typhimurium population in 2001. It is associated with a multi-drug resistance phenotype and a plasmid-borne blaCMY-2 gene conferring resistance to extended-spectrum cephalosporins. The objective of the current study was to examine the association between the ST213 genotype and blaCMY-2 plasmids. The blaCMY-2 gene was carried by an IncA/C plasmid. ST213 strains lacking the blaCMY-2 gene carried a different IncA/C plasmid. PCR analysis of seven DNA regions distributed throughout the plasmids showed that these IncA/C plasmids were related, but the presence and absence of DNA stretches produced two divergent types I and II. A class 1 integron (dfrA12, orfF and aadA2) was detected in most of the type I plasmids. Type I contained all the plasmids carrying the blaCMY-2 gene and a subset of plasmids lacking blaCMY-2. Type II included all of the remaining blaCMY-2-negative plasmids. A sequence comparison of the seven DNA regions showed that both types were closely related to IncA/C plasmids found in Escherichia, Salmonella, Yersinia, Photobacterium, Vibrio and Aeromonas. Analysis of our Typhimurium strains showed that the region containing the blaCMY-2 gene is inserted between traA and traC as a single copy, like in the E. coli plasmid pAR060302. The floR allele was identical to that of Newport pSN254, suggesting a mosaic pattern of ancestry with plasmids from other Salmonella serovars and E. coli. Only one of the tested strains was able to conjugate the IncA/C plasmid at very low frequencies (10-7 to 10-9). The lack of conjugation ability of our IncA/C plasmids agrees with the clonal dissemination trend suggested by the chromosomal backgrounds and plasmid pattern associations. The ecological success of the newly emerging Typhimurium ST213 genotype in Mexico may be related to the carriage of IncA/C plasmids. We conclude that types I and II of IncA/C plasmids originated from a common ancestor and that the

  11. Enterobacteriaceae isolates carrying the New Delhi metallo-β-lactamase gene in Yemen.

    Science.gov (United States)

    Gharout-Sait, Alima; Alsharapy, Samer-Ahmed; Brasme, Lucien; Touati, Abdelaziz; Kermas, Rachida; Bakour, Sofiane; Guillard, Thomas; de Champs, Christophe

    2014-10-01

    Ten carbapenem-resistant Enterobacteriaceae (eight Klebsiella pneumoniae isolates and two Enterobacter cloacae) isolates from Yemen were investigated using in vitro antimicrobial susceptibility testing, phenotypic carbapenemase detection, multilocus sequence typing (MLST) and replicon typing. Carbapenemase, extended-spectrum β-lactamase (ESBL) and plasmid-mediated quinolone resistance determinant genes were identified using PCR and sequencing. All of the 10 carbapenem-resistant Enterobacteriaceae were resistant to β-lactams, tobramycin, ciprofloxacin and cotrimoxazole. Imipenem, doripenem and meropenem MICs ranged from 2 to >32 mg l(-1) and ertapenem MICs ranged from 6 to >32 mg l(-1). All of the K. pneumoniae isolates showed ESBL activity in phenotypic tests. Genes encoding blaNDM were detected in all strains. All K. pneumoniae strains produced CTX-M-15 ESBL and SHV β-lactamases. TEM-1 β-lactamase was detected in seven isolates. Nine isolates were qnr positive including QnrB1, QnrA1 and QnrS1, and six isolates produced AAC-6'-Ib-cr. MLST identified five different sequence types (STs): ST1399, ST147, ST29, ST405 and ST340. Replicon typing showed the presence of IncFII1K plasmids in four transformants. To the best of our knowledge, this is the first report of NDM-1-producing Enterobacteriaceae isolates in Yemen. © 2014 The Authors.

  12. Sources of diversity of carbapenem resistance levels in Klebsiella pneumoniae carrying blaVIM-1.

    Science.gov (United States)

    Loli, A; Tzouvelekis, L S; Tzelepi, E; Carattoli, A; Vatopoulos, A C; Tassios, P T; Miriagou, V

    2006-09-01

    To elucidate the mechanisms responsible for the diversity of beta-lactam resistance phenotypes among isolates of a VIM-1-producing Klebsiella pneumoniae (VPKP) strain that is endemic in Greek hospitals. Five VPKP clinical isolates were studied. MICs of beta-lactams were determined by agar dilution. PFGE of XbaI-digested genomic DNA was used for typing. Profiles of outer membrane proteins (OMPs) were determined by SDS-PAGE. Selected isolates were transformed with a plasmid encoding the Omp36K porin. beta-Lactamase activities were analysed by IEF and imipenem hydrolysis was assessed by spectrophotometry. VIM-1-encoding, self-transmissible plasmids were characterized by replicon typing, RFLP and hybridization with bla(VIM)- and IS26-specific probes. Characterization of integrons was performed by PCR, cloning and sequencing. Isolates exhibited highly similar PFGE patterns. Imipenem MICs were 2, 4, 16, 32 and 64 mg/L. The isolate with the highest imipenem MIC (Vipm-64) lacked a 36 kDa OMP. Expression of a cloned OmpK36 in this isolate reduced the imipenem MIC to susceptibility levels. Imipenem-hydrolysing activity was significantly higher in Vipm-16 as compared with the other isolates that expressed similar amounts of VIM-1. All isolates transferred beta-lactam resistance to Escherichia coli through conjugative, IncN plasmids that exhibited differences in the RFLP and hybridization patterns with bla(VIM)- and IS26-specific probes. The Vipm-16 plasmid, mediating the higher imipenem MICs among transconjugants, carried two copies of bla(VIM-1). Cloning and sequencing showed In-e541-like integrons truncated at the 5'CS by insertion of IS26 elements at two different positions. A VIM-1-producing strain of K. pneumoniae has evolved through OMP alterations and rearrangements in the bla(VIM-1)-carrying plasmid probably mediated by IS26, generating isolates with imipenem MICs ranging from susceptibility to resistance.

  13. Molecular characterisation and diversity in Enterobacter cloacae from Edinburgh and Egypt carrying bla(CTX-M-14) and bla(VIM-4) β-lactamase genes.

    Science.gov (United States)

    Dimude, J U; Amyes, S G B

    2013-06-01

    The purpose of this study was to compare the carbapenemases and extended-spectrum β-lactamases (ESBLs) associated with resistance, the genetic environment of these genes, and their location on plasmids among Enterobacter cloacae isolates from Edinburgh (UK) and Egypt. Nine E. cloacae isolates were obtained from Egypt (n=3) and Edinburgh (n=6). Antimicrobial susceptibility testing was performed by agar dilution. Molecular detection of carbapenemase genes, blaCTX-M-14 and the presence of integron structures was done by PCR and sequencing. Genotyping of the strains was performed by pulsed-field gel electrophoresis (PFGE) with XbaI restriction. Plasmids were extracted to determine the location of the resistance genes. PCR sequencing revealed that all of the isolates carried the blaCTX-M-14 ESBL gene, whilst two isolates also carried the blaVIM-4 metallo-β-lactamase gene. The blaCTX-M-14 genes in two isolates were associated with the ISEcp1 transposase. Analysis of the integrons found an intI1 integron associated with the complex ISCR1. The blaVIM-4 gene was identified in the form of a gene cassette within the class 1 integron, followed downstream by the resistance genes aacA7, dfrA1 and aadA2. PFGE revealed genetic relatedness among six isolates, whereas the others were diverse although related. Plasmid analysis revealed a single plasmid carrying both blaVIM-4 and blaCTX-M-14. In conclusion, the presence of insertion sequence ISEcp1 upstream of blaCTX-M-14 suggests its involvement in the expression and mobilisation of this gene. Linked carriage of blaVIM-4 and blaCTX-M-14 on the same plasmid in E. cloacae results in resistance to all β-lactams and limits antibiotic treatment options. Copyright © 2013 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  14. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  15. Predominance of carbapenem-resistant Pseudomonas aeruginosa isolates carrying blaIMP and blaVIM metallo-β-lactamases in a major hospital in Costa Rica.

    Science.gov (United States)

    Toval, Francisco; Guzmán-Marte, Anel; Madriz, Vivian; Somogyi, Teresita; Rodríguez, César; García, Fernando

    2015-01-01

    This study aimed to assess the molecular basis of the resistance to carbapenems in clinical isolates of Pseudomonas aeruginosa recovered from a tertiary-level health facility in San José, Costa Rica. A total of 198 non-duplicated isolates were evaluated for their susceptibility to β-lactams, aminoglycosides and fluoroquinolones. The production of metallo-β-lactamases (MBLs), the presence of MBL encoding genes (blaIMP, blaVIM and blaGIM-1) and the occurrence of these genes within class 1 integrons were investigated. In addition, an ERIC2 PCR fingerprinting method was used to elucidate the distribution of the detected MBL genes within the strain collection. Of the 198 isolates tested, 125 (63.1 %) were categorized as carbapenem-resistant. The majority (88.8 %) of the carbapemen-resistant isolates also showed resistance to ceftazidime, cefepime, aztreonam, ticarcillin/clavulanic acid, amikacin, gentamicin, tobramycin, ciprofloxacin and gatifloxacin. Among the carbapenem-resistant isolates, 102 (81.6 %) showed MBL activity. Strikingly, both blaIMP and blaVIM genes were simultaneously detected in most (94.1 %) of the 102 MBL producers. Five carbapenem-resistant MBL producers were positive only for blaIMP genes. Almost 70 % of the isolates examined harboured the intI1 gene, accompanied by the sul1 and qacEΔ1 genes in 136 (99 %) and 122 (89 %) isolates, respectively. The majority (94.4 %) of the carbapenem-resistant isolates carried the intI1 gene, in contrast to 26 % of the carbapenem-susceptible isolates. Ninety-three out of 96 (96.9 %) isolates carrying both blaIMP and blaVIM genes also harboured the intI1, sul1 and qacEΔ1 genes. Gene cassettes from carbapenem-susceptible and MBL-negative carbapenem-resistant isolates encoded aminoglycoside-resistance enzymes (aadA2, aadA4 and aadA6) as well as orfD and qacF genes. RAPD analysis distributed 126 of the isolates in 29 clusters. Eighty of the 90 blaIMP (+) blaVIM (+) isolates were sorted into 16

  16. Antibiotic resistance genes in anaerobic bacteria isolated from primary dental root canal infections.

    Science.gov (United States)

    Rôças, Isabela N; Siqueira, José F

    2012-12-01

    Fourty-one bacterial strains isolated from infected dental root canals and identified by 16S rRNA gene sequence were screened for the presence of 14 genes encoding resistance to beta-lactams, tetracycline and macrolides. Thirteen isolates (32%) were positive for at least one of the target antibiotic resistance genes. These strains carrying at least one antibiotic resistance gene belonged to 11 of the 26 (42%) infected root canals sampled. Two of these positive cases had two strains carrying resistance genes. Six out of 7 Fusobacterium strains harbored at least one of the target resistance genes. One Dialister invisus strain was positive for 3 resistance genes, and 4 other strains carried two of the target genes. Of the 6 antibiotic resistance genes detected in root canal strains, the most prevalent were blaTEM (17% of the strains), tetW (10%), and ermC (10%). Some as-yet-uncharacterized Fusobacterium and Prevotella isolates were positive for blaTEM, cfxA and tetM. Findings demonstrated that an unexpectedly large proportion of dental root canal isolates, including as-yet-uncharacterized strains previously regarded as uncultivated phylotypes, can carry antibiotic resistance genes. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Identification of acquired antimicrobial resistance genes

    DEFF Research Database (Denmark)

    Zankari, Ea; Hasman, Henrik; Cosentino, Salvatore

    2012-01-01

    ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic laborato......ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic...... laboratories and is anticipated to substitute traditional methods for resistance gene identification. Thus, the current challenge is to extract the relevant information from the large amount of generated data.MethodsWe developed a web-based method, ResFinder that uses BLAST for identification of acquired...... antimicrobial resistance genes in whole-genome data. As input, the method can use both pre-assembled, complete or partial genomes, and short sequence reads from four different sequencing platforms. The method was evaluated on 1862 GenBank files containing 1411 different resistance genes, as well as on 23 de...

  18. High chlorpyrifos resistance in Culex pipiens mosquitoes: strong synergy between resistance genes.

    Science.gov (United States)

    Alout, H; Labbé, P; Berthomieu, A; Makoundou, P; Fort, P; Pasteur, N; Weill, M

    2016-02-01

    We investigated the genetic determinism of high chlorpyrifos resistance (HCR), a phenotype first described in 1999 in Culex pipiens mosquitoes surviving chlorpyrifos doses ⩾1 mg l(-1) and more recently found in field samples from Tunisia, Israel or Indian Ocean islands. Through chlorpyrifos selection, we selected several HCR strains that displayed over 10 000-fold resistance. All strains were homozygous for resistant alleles at two main loci: the ace-1 gene, with the resistant ace-1(R) allele expressing the insensitive G119S acetylcholinesterase, and a resistant allele of an unknown gene (named T) linked to the sex and ace-2 genes. We constructed a strain carrying only the T-resistant allele and studied its resistance characteristics. By crossing this strain with strains harboring different alleles at the ace-1 locus, we showed that the resistant ace-1(R) and the T alleles act in strong synergy, as they elicited a resistance 100 times higher than expected from a simple multiplicative effect. This effect was specific to chlorpyrifos and parathion and was not affected by synergists. We also examined how HCR was expressed in strains carrying other ace-1-resistant alleles, such as ace-1(V) or the duplicated ace-1(D) allele, currently spreading worldwide. We identified two major parameters that influenced the level of resistance: the number and the nature of the ace-1-resistant alleles and the number of T alleles. Our data fit a model that predicts that the T allele acts by decreasing chlorpyrifos concentration in the compartment targeted in insects.

  19. Dissemination of metal resistance genes among animal methicillin-resistant coagulase-negative Staphylococci.

    Science.gov (United States)

    Argudín, M Angeles; Butaye, Patrick

    2016-04-01

    The use of metals as feed supplement has been recognized as a potential driver for co-selection of methicillin-resistant Staphylococcus aureus in pigs. However, the prevalence of these determinants in methicillin-resistant coagulase-negative staphylococci (MRCoNS) is largely unknown. In this study, a collection of 130 MRCoNS from pigs and veal calves were investigated for the presence of metal-resistance genes (czrC, copB, cadD, arsA) associated to SCCmec. Near half of the isolates carried metal resistance genes (czrC 5.4%, copB 38.5%, cadD 7.7%, arsA 26.2%) regardless of their SCCmec type. The increased use of metals in livestock animals, especially zinc in pigs in several European countries may co-select for methicillin-resistance in several staphylococcal species. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Influence of Soil Use on Prevalence of Tetracycline, Streptomycin, and Erythromycin Resistance and Associated Resistance Genes

    Science.gov (United States)

    Rzeczycka, Marzenna; Miernik, Antoni; Krawczyk-Balska, Agata; Walsh, Fiona; Duffy, Brion

    2012-01-01

    This study examined differences in antibiotic-resistant soil bacteria and the presence and quantity of resistance genes in soils with a range of management histories. We analyzed four soils from agricultural systems that were amended with manure from animals treated with erythromycin and exposed to streptomycin and/or oxytetracycline, as well as non-manure-amended compost and forest soil. Low concentrations of certain antibiotic resistance genes were detected using multiplex quantitative real-time PCR (qPCR), with tet(B), aad(A), and str(A) each present in only one soil and tet(M) and tet(W) detected in all soils. The most frequently detected resistance genes were tet(B), tet(D), tet(O), tet(T), and tet(W) for tetracycline resistance, str(A), str(B), and aac for streptomycin resistance, and erm(C), erm(V), erm(X), msr(A), ole(B), and vga for erythromycin resistance. Transposon genes specific for Tn916, Tn1549, TnB1230, Tn4451, and Tn5397 were detected in soil bacterial isolates. The MIC ranges of isolated bacteria for tetracycline, streptomycin, and erythromycin were 8 to >256 μg/ml, 6 to >1,024 μg/ml, and 0.094 to >256 μg/ml, respectively. Based on 16S rRNA gene similarity, isolated bacteria showed high sequence identity to genera typical of soil communities. Bacteria with the highest MICs were detected in manure-amended soils or soils from agricultural systems with a history of antibiotic use. Non-manure-amended soils yielded larger proportions of antibiotic-resistant bacteria, but these had lower MICs, carried fewer antibiotic resistance genes, and did not display multidrug resistance (MDR). PMID:22203596

  1. Influence of soil use on prevalence of tetracycline, streptomycin, and erythromycin resistance and associated resistance genes.

    Science.gov (United States)

    Popowska, Magdalena; Rzeczycka, Marzenna; Miernik, Antoni; Krawczyk-Balska, Agata; Walsh, Fiona; Duffy, Brion

    2012-03-01

    This study examined differences in antibiotic-resistant soil bacteria and the presence and quantity of resistance genes in soils with a range of management histories. We analyzed four soils from agricultural systems that were amended with manure from animals treated with erythromycin and exposed to streptomycin and/or oxytetracycline, as well as non-manure-amended compost and forest soil. Low concentrations of certain antibiotic resistance genes were detected using multiplex quantitative real-time PCR (qPCR), with tet(B), aad(A), and str(A) each present in only one soil and tet(M) and tet(W) detected in all soils. The most frequently detected resistance genes were tet(B), tet(D), tet(O), tet(T), and tet(W) for tetracycline resistance, str(A), str(B), and aac for streptomycin resistance, and erm(C), erm(V), erm(X), msr(A), ole(B), and vga for erythromycin resistance. Transposon genes specific for Tn916, Tn1549, TnB1230, Tn4451, and Tn5397 were detected in soil bacterial isolates. The MIC ranges of isolated bacteria for tetracycline, streptomycin, and erythromycin were 8 to >256 μg/ml, 6 to >1,024 μg/ml, and 0.094 to >256 μg/ml, respectively. Based on 16S rRNA gene similarity, isolated bacteria showed high sequence identity to genera typical of soil communities. Bacteria with the highest MICs were detected in manure-amended soils or soils from agricultural systems with a history of antibiotic use. Non-manure-amended soils yielded larger proportions of antibiotic-resistant bacteria, but these had lower MICs, carried fewer antibiotic resistance genes, and did not display multidrug resistance (MDR).

  2. Antibiotic resistance and virulence genes in coliform water isolates.

    Science.gov (United States)

    Stange, C; Sidhu, J P S; Tiehm, A; Toze, S

    2016-11-01

    Widespread fecal pollution of surface water may present a major health risk and a significant pathway for dissemination of antibiotic resistance bacteria. The River Rhine is one of the longest and most important rivers in Europe and an important raw water source for drinking water production. A total of 100 coliform isolates obtained from River Rhine (Germany) were examined for their susceptibility to seven antimicrobial agents. Resistances against amoxicillin, trimethoprim/sulfamethoxazole and tetracycline were detected in 48%, 11% and 9% of isolates respectively. The antibiotic resistance could be traced back to the resistance genes bla TEM , bla SHV , ampC, sul1, sul2, dfrA1, tet(A) and tet(B). Whereby, the ampC gene represents a special case, because its presence is not inevitably linked to a phenotypic antibiotic resistance. Multiple antibiotics resistance was often accompanied by the occurrence of class 1 or 2 integrons. E. coli isolates belonging to phylogenetic groups A and B1 (commensal) were more predominant (57%) compared to B2 and D groups (43%) which are known to carry virulent genes. Additionally, six E. coli virulence genes were also detected. However, the prevalence of virulence genes in the E. coli isolates was low (not exceeding 4.3% per gene) and no diarrheagenic E. coli pathotypes were detected. This study demonstrates that surface water is an important reservoir of ARGs for a number of antibiotic classes such as sulfonamide, trimethoprim, beta-lactam-antibiotics and tetracycline. The occurrence of antibiotic resistance in coliform bacteria isolated from River Rhine provides evidence for the need to develop management strategies to limit the spread of antibiotic resistant bacteria in aquatic environment. Copyright © 2016 Elsevier GmbH. All rights reserved.

  3. Resistance Genes in Global Crop Breeding Networks.

    Science.gov (United States)

    Garrett, K A; Andersen, K F; Asche, F; Bowden, R L; Forbes, G A; Kulakow, P A; Zhou, B

    2017-10-01

    Resistance genes are a major tool for managing crop diseases. The networks of crop breeders who exchange resistance genes and deploy them in varieties help to determine the global landscape of resistance and epidemics, an important system for maintaining food security. These networks function as a complex adaptive system, with associated strengths and vulnerabilities, and implications for policies to support resistance gene deployment strategies. Extensions of epidemic network analysis can be used to evaluate the multilayer agricultural networks that support and influence crop breeding networks. Here, we evaluate the general structure of crop breeding networks for cassava, potato, rice, and wheat. All four are clustered due to phytosanitary and intellectual property regulations, and linked through CGIAR hubs. Cassava networks primarily include public breeding groups, whereas others are more mixed. These systems must adapt to global change in climate and land use, the emergence of new diseases, and disruptive breeding technologies. Research priorities to support policy include how best to maintain both diversity and redundancy in the roles played by individual crop breeding groups (public versus private and global versus local), and how best to manage connectivity to optimize resistance gene deployment while avoiding risks to the useful life of resistance genes. [Formula: see text] Copyright © 2017 The Author(s). This is an open access article distributed under the CC BY 4.0 International license .

  4. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Science.gov (United States)

    Sahoo, Dipak K; Abeysekara, Nilwala S; Cianzio, Silvia R; Robertson, Alison E; Bhattacharyya, Madan K

    2017-01-01

    Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs) (F7 families) were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR)-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  5. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Directory of Open Access Journals (Sweden)

    Dipak K Sahoo

    Full Text Available Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs (F7 families were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  6. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Directory of Open Access Journals (Sweden)

    Colin W Hiebert

    Full Text Available Stem rust, caused by Puccinia graminis (Pgt, is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  7. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in 'Thatcher' Wheat.

    Science.gov (United States)

    Hiebert, Colin W; Kolmer, James A; McCartney, Curt A; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. 'Thatcher' wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in 'Thatcher' and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for 'Thatcher'-derived APR in several environments and this resistance was enhanced in the presence of Lr34.

  8. Major Gene for Field Stem Rust Resistance Co-Locates with Resistance Gene Sr12 in ‘Thatcher’ Wheat

    Science.gov (United States)

    Hiebert, Colin W.; Kolmer, James A.; McCartney, Curt A.; Briggs, Jordan; Fetch, Tom; Bariana, Harbans; Choulet, Frederic; Rouse, Matthew N.; Spielmeyer, Wolfgang

    2016-01-01

    Stem rust, caused by Puccinia graminis (Pgt), is a damaging disease of wheat that can be controlled by utilizing effective stem rust resistance genes. ‘Thatcher’ wheat carries complex resistance to stem rust that is enhanced in the presence of the resistance gene Lr34. The purpose of this study was to examine APR in ‘Thatcher’ and look for genetic interactions with Lr34. A RIL population was tested for stem rust resistance in field nurseries in Canada, USA, and Kenya. BSA was used to find SNP markers associated with reduced stem rust severity. A major QTL was identified on chromosome 3BL near the centromere in all environments. Seedling testing showed that Sr12 mapped to the same region as the QTL for APR. The SNP markers were physically mapped and the region carrying the resistance was searched for sequences with homology to members of the NB-LRR resistance gene family. SNP marker from one NB-LRR-like sequence, NB-LRR3 co-segregated with Sr12. Two additional populations, including one that lacked Lr34, were tested in field nurseries. NB-LRR3 mapped near the maximum LOD for reduction in stem rust severity in both populations. Lines from a population that segregated for Sr12 and Lr34 were tested for seedling Pgt biomass and infection type, as well as APR to field stem rust which showed an interaction between the genes. We concluded that Sr12, or a gene closely linked to Sr12, was responsible for ‘Thatcher’-derived APR in several environments and this resistance was enhanced in the presence of Lr34. PMID:27309724

  9. Gamma-T4 hybrid bacteriophage carrying the thymidine kinase gene of bacteriophage T4.

    OpenAIRE

    Mileham, A J; Murray, N E; Revel, H R

    1984-01-01

    Among 32 lambda-T4 recombinant phages selected for growth on a thymidylate synthetase-deficient (thyA) host, 2 were shown to carry the T4 thymidine kinase (tk) gene. The lambda-T4tk phages contain two T4 HindIII DNA fragments (2.0 and 1.5 kilobases) that hybridize to restriction fragments of T4 DNA, encompassing the tk locus at 60 kilobases on the T4 map. The T4tk insert compensates for the simultaneous host deficiencies of thymidine kinase and thymidylate synthetase in a thymidine kinase-def...

  10. Adenovirus carrying gene encoding Haliotis discus discus sialic acid binding lectin induces cancer cell apoptosis.

    Science.gov (United States)

    Yang, Xinyan; Wu, Liqin; Duan, Xuemei; Cui, Lianzhen; Luo, Jingjing; Li, Gongchu

    2014-06-30

    Lectins exist widely in marine bioresources such as bacteria, algae, invertebrate animals and fishes. Some purified marine lectins have been found to elicit cytotoxicity to cancer cells. However, there are few reports describing the cytotoxic effect of marine lectins on cancer cells through virus-mediated gene delivery. We show here that a replication-deficient adenovirus-carrying gene encoding Haliotis discus discus sialic acid binding lectin (Ad.FLAG-HddSBL) suppressed cancer cell proliferation by inducing apoptosis, as compared to the control virus Ad.FLAG. A down-regulated level of anti-apoptosis factor Bcl-2 was suggested to be responsible for the apoptosis induced by Ad.FLAG-HddSBL infection. Further subcellular localization studies revealed that HddSBL distributed in cell membrane, ER, and the nucleus, but not in mitochondria and Golgi apparatus. In contrast, a previously reported mannose-binding lectin Pinellia pedatisecta agglutinin entered the nucleus as well, but did not distribute in inner membrane systems, suggesting differed intracellular sialylation and mannosylation, which may provide different targets for lectin binding. Further cancer-specific controlling of HddSBL expression and animal studies may help to provide insights into a novel way of anti-cancer marine lectin gene therapy. Lectins may provide a reservoir of anti-cancer genes.

  11. Anthropogenic antibiotic resistance genes mobilization to the polar regions.

    Science.gov (United States)

    Hernández, Jorge; González-Acuña, Daniel

    2016-01-01

    Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL)-type CTX-M genes in which multilocus sequencing typing (MLST) showed different sequence types (STs), previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs) appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait) revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M) in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

  12. Anthropogenic antibiotic resistance genes mobilization to the polar regions

    Directory of Open Access Journals (Sweden)

    Jorge Hernández

    2016-12-01

    Full Text Available Anthropogenic influences in the southern polar region have been rare, but lately microorganisms associated with humans have reached Antarctica, possibly from military bases, fishing boats, scientific expeditions, and/or ship-borne tourism. Studies of seawater in areas of human intervention and proximal to fresh penguin feces revealed the presence of Escherichia coli strains least resistant to antibiotics in penguins, whereas E. coli from seawater elsewhere showed resistance to one or more of the following antibiotics: ampicillin, tetracycline, streptomycin, and trim-sulfa. In seawater samples, bacteria were found carrying extended-spectrum β-lactamase (ESBL-type CTX-M genes in which multilocus sequencing typing (MLST showed different sequence types (STs, previously reported in humans. In the Arctic, on the contrary, people have been present for a long time, and the presence of antibiotic resistance genes (ARGs appears to be much more wide-spread than was previously reported. Studies of E coli from Arctic birds (Bering Strait revealed reduced susceptibility to antibiotics, but one globally spreading clone of E. coli genotype O25b-ST131, carrying genes of ESBL-type CTX-M, was identified. In the few years between sample collections in the same area, differences in resistance pattern were observed, with E. coli from birds showing resistance to a maximum of five different antibiotics. Presence of resistance-type ESBLs (TEM, SHV, and CTX-M in E. coli and Klebsiella pneumoniae was also confirmed by specified PCR methods. MLST revealed that those bacteria carried STs that connect them to previously described strains in humans. In conclusion, bacteria previously related to humans could be found in relatively pristine environments, and presently human-associated, antibiotic-resistant bacteria have reached a high global level of distribution that they are now found even in the polar regions.

  13. Complete Sequences and Characterization of Two Novel Plasmids Carrying aac(6')-Ib-cr and qnrS Gene in Shigella flexneri.

    Science.gov (United States)

    Pu, Xiao-Ying; Pan, Jing-Cao; Gu, Ya-Ming; Zheng, Wei; Li, Jun; Yu, Hua

    2016-03-01

    The complete sequences of two previously reported plasmids carrying plasmid-mediated quinolone resistance genes from Shigella flexneri in China have not been available. The present study using the p5-C3 assembly method revealed that (1) the plasmid pSF07201 with aac(6')-Ib-cr had 75,335 bp with antibiotic resistance genes CTX-M-3, TEM-1, and FosA3; (2) seven fragments of pSF07201 had more than 99% homology with the seven corresponding plasmids; (3) the other plasmid pSF07202 with qnrS had 47,669 bp with antibiotic resistance gene TEM-1 and 99.95% homology with a segment of pKF362122, which has the qnrS gene from location 162,490 to 163,146. A conjugation and electrotransformation experiment suggested that these two plasmids might horizontally transfer between and coexist in Escherichia coli J53 and S. flexneri 2a 301. Either the aac(6')-Ib-cr or qnrS gene contributed to, but only the coexistence of the two genes conferred to the resistance to ciprofloxacin in these two strains. To the best of our knowledge, this is the first report of the complete sequences of the aac(6')-Ib-cr- and qnrS-positive plasmids in Shigella isolates. Our findings indicate that two genes probably evolve through horizontal plasmid transfer between the different bacterial types.

  14. Incidence of antimicrobial-resistance genes and integrons in antibiotic-resistant bacteria isolated from eels and aquaculture ponds.

    Science.gov (United States)

    Lin, Mao; Wu, Xiaomei; Yan, Qingpi; Ma, Ying; Huang, Lixing; Qin, Yingxue; Xu, Xiaojin

    2016-07-07

    The overuse of antimicrobials in aquaculture has promoted the selection of antimicrobial-resistant bacteria. Here we investigated the abundance of antimicrobial-resistance genes and integrons in 108 strains of antibiotic-resistant bacteria isolated from eels and aquaculture ponds in China. Conventional PCR was implemented to examine common antibiotic-resistance genes, integrons, and their gene cassette arrays. The results showed that the antibiotic-resistance genes blaTEM, tetC, sulI, aadA, floR, and qnrB were detected at high percentages, as were a number of other resistance genes. Class I integrons were present in 79.63% of the strains, and 10 out of 108 isolates carried class II integrons. Class III integrons were not detected. Three strains carried both class I and class II integrons, and 73.26% of the class I integron-positive isolates contained the qacEΔ1/sul1 gene. Fourteen types of integron cassette arrays were found among class I integron-positive isolates. A new array, dfrB4-catB3-blaOXA-10-aadA1, was discovered in this study. The gene cassette array dfrA12-orfF-aadA2 was the most widely distributed. In summary, 23 different gene cassettes encoding resistance to 8 classes of antibiotics were identified in the class I integrons, and the main cassettes contained genes encoding resistance to aminoglycosides (aad) and trimethoprim (dfr). All class II integron-positive strains had only a single gene cassette array, viz. dfrA1-catB2-sat2-aadA1. High levels of antimicrobial-resistance genes and integrons in eels and auqauculture ponds suggest that the overuse of antimicrobials should be strictly controlled and that the levels of bacterial antimicrobial-resistance genes in aquaculture should be monitored.

  15. Potyviral resistance derived from cultivars of Phaseolus vulgaris carrying bc-3 is associated with the homozygotic presence of a mutated eIF4E allele

    DEFF Research Database (Denmark)

    Naderpour, Masoud; Lund, Ole Søgaard; Larsen, Richard

    2010-01-01

    Eukaryotic translation initiation factors (eIFs) play a central role in potyviral infection. Accordingly, mutations in the gene encoding eIF4E have been identified as a source of recessive resistance in several plant species. In common bean, Phaseolus vulgaris, four recessive genes, bc-1, bc-2, bc......-3 and bc-u, have been proposed to control resistance to the potyviruses Bean common mosaic virus (BCMV) and Bean common mosaic necrosis virus. In order to identify molecular entities for these genes, we cloned and sequenced P. vulgaris homologues of genes encoding the eIF proteins eIF4E, eIF(iso)4E...... resistance and eIF4E genotype was subsequently analysed in an F2 population derived from the P. vulgaris all-susceptible genotype and a genotype carrying bc-3. F2 plants homozygous for the eIF4E mutant allele were found to display at least the same level of resistance to BCMV as the parental resistant...

  16. Host range of antibiotic resistance genes in wastewater treatment plant influent and effluent.

    Science.gov (United States)

    Hultman, Jenni; Tamminen, Manu; Pärnänen, Katariina; Cairns, Johannes; Karkman, Antti; Virta, Marko

    2018-04-01

    Wastewater treatment plants (WWTPs) collect wastewater from various sources for a multi-step treatment process. By mixing a large variety of bacteria and promoting their proximity, WWTPs constitute potential hotspots for the emergence of antibiotic resistant bacteria. Concerns have been expressed regarding the potential of WWTPs to spread antibiotic resistance genes (ARGs) from environmental reservoirs to human pathogens. We utilized epicPCR (Emulsion, Paired Isolation and Concatenation PCR) to detect the bacterial hosts of ARGs in two WWTPs. We identified the host distribution of four resistance-associated genes (tetM, int1, qacEΔ1and blaOXA-58) in influent and effluent. The bacterial hosts of these resistance genes varied between the WWTP influent and effluent, with a generally decreasing host range in the effluent. Through 16S rRNA gene sequencing, it was determined that the resistance gene carrying bacteria include both abundant and rare taxa. Our results suggest that the studied WWTPs mostly succeed in decreasing the host range of the resistance genes during the treatment process. Still, there were instances where effluent contained resistance genes in bacterial groups not carrying these genes in the influent. By permitting exhaustive profiling of resistance-associated gene hosts in WWTP bacterial communities, the application of epicPCR provides a new level of precision to our resistance gene risk estimates.

  17. Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China

    Science.gov (United States)

    Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.

    2011-01-01

    Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

  18. Characterisation of penA and tetM resistance genes of Neisseria ...

    African Journals Online (AJOL)

    This gene block, which was found in all the southern African areas studied, appears to predispose isolates to increased penicillin resistance. The 25,2 MDa conjugative plasmid carrying the tetM resistance determinant was readily demonstrated in 11 Botswana Namibia isolates exhibiting high-level resistance to tetracycline ...

  19. Characterisation of penA and tetM resistance genes of Neisseria ...

    African Journals Online (AJOL)

    appears to predispose isolates to increased penicillin resistance. The 25,2 MDa conjugative plasmid carrying the. tetM resistance determinant was readily demonstrated in. 11 Botswana! Namibia isolates exhibiting high-level resistance to tetracycline (MICs ? 16 IJg/ml). The tetM gene was shown to be of the American type.

  20. Generation and characterization of mice carrying a conditional allele of the Wwox tumor suppressor gene.

    Directory of Open Access Journals (Sweden)

    John H Ludes-Meyers

    2009-11-01

    Full Text Available WWOX, the gene that spans the second most common human chromosomal fragile site, FRA16D, is inactivated in multiple human cancers and behaves as a suppressor of tumor growth. Since we are interested in understanding WWOX function in both normal and cancer tissues we generated mice harboring a conditional Wwox allele by flanking Exon 1 of the Wwox gene with LoxP sites. Wwox knockout (KO mice were developed by breeding with transgenic mice carrying the Cre-recombinase gene under the control of the adenovirus EIIA promoter. We found that Wwox KO mice suffered from severe metabolic defect(s resulting in growth retardation and all mice died by 3 wk of age. All Wwox KO mice displayed significant hypocapnia suggesting a state of metabolic acidosis. This finding and the known high expression of Wwox in kidney tubules suggest a role for Wwox in acid/base balance. Importantly, Wwox KO mice displayed histopathological and hematological signs of impaired hematopoiesis, leukopenia, and splenic atrophy. Impaired hematopoiesis can also be a contributing factor to metabolic acidosis and death. Hypoglycemia and hypocalcemia was also observed affecting the KO mice. In addition, bone metabolic defects were evident in Wwox KO mice. Bones were smaller and thinner having reduced bone volume as a consequence of a defect in mineralization. No evidence of spontaneous neoplasia was observed in Wwox KO mice. We have generated a new mouse model to inactivate the Wwox tumor suppressor gene conditionally. This will greatly facilitate the functional analysis of Wwox in adult mice and will allow investigating neoplastic transformation in specific target tissues.

  1. Pyramiding B genes in cotton achieves broader but not always higher resistance to bacterial blight.

    Science.gov (United States)

    Essenberg, Margaret; Bayles, Melanie B; Pierce, Margaret L; Verhalen, Laval M

    2014-10-01

    Near-isogenic lines of upland cotton (Gossypium hirsutum) carrying single, race-specific genes B4, BIn, and b7 for resistance to bacterial blight were used to develop a pyramid of lines with all possible combinations of two and three genes to learn whether the pyramid could achieve broad and high resistance approaching that of L. A. Brinkerhoff's exceptional line Im216. Isogenic strains of Xanthomonas axonopodis pv. malvacearum carrying single avirulence (avr) genes were used to identify plants carrying specific resistance (B) genes. Under field conditions in north-central Oklahoma, pyramid lines exhibited broader resistance to individual races and, consequently, higher resistance to a race mixture. It was predicted that lines carrying two or three B genes would also exhibit higher resistance to race 1, which possesses many avr genes. Although some enhancements were observed, they did not approach the level of resistance of Im216. In a growth chamber, bacterial populations attained by race 1 in and on leaves of the pyramid lines decreased significantly with increasing number of B genes in only one of four experiments. The older lines, Im216 and AcHR, exhibited considerably lower bacterial populations than any of the one-, two-, or three-B-gene lines. A spreading collapse of spray-inoculated AcBIn and AcBInb7 leaves appears to be a defense response (conditioned by BIn) that is out of control.

  2. Expression Study of Banana Pathogenic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Fenny M. Dwivany

    2016-10-01

    Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.

  3. Characterization of Acinetobacter baumannii clinical isolates carrying bla(OXA-23) carbapenemase and 16S rRNA methylase armA genes in Yemen.

    Science.gov (United States)

    Bakour, Sofiane; Alsharapy, Samer Ahmed; Touati, Abdelaziz; Rolain, Jean-Marc

    2014-12-01

    The aim of this study was to investigate the molecular support of resistance to carbapenems, aminoglycosides, and fluoroquinolones in Acinetobacter baumannii clinical isolates collected from Yemen hospital. Three A. baumannii were isolated in February 2013 from three patients hospitalized at Al-Thawra University Hospital in Sana'a, Yemen. Antibiotic susceptibility testing was performed using the disk diffusion and E-test methods. Carbapenemase production was carried out by the modified Hodge test (MHT) and imipenem-ethylenediaminetetraacetic acid (EDTA) methods. Carbapenem, aminoglycoside, and fluoroquinolone resistance determinants were studied by polymerase chain reaction and sequencing. The epidemiological relatedness of the three strains was studied using multilocus sequence typing (MLST). The isolates were resistant to almost all antibiotics tested with very high imipenem, amikacin, and ciprofloxacin minimum inhibitory concentrations (>32, >256, and >32 mg/L, respectively). The microbiological tests showed that the three A. baumannii were MHT positive, besides, the activity of β-lactamases was not inhibited by EDTA. All the three isolates contained the naturally occurring bla(OXA-51)-like gene and the bla(OXA-23)-like carbapenemase-encoding gene. The 16S rRNA methylase armA gene was detected in the three isolates. In addition, screening for genes encoding the aminoglycoside-modifying enzymes (AMEs) demonstrated that one isolate contained the acetyltransferase gene aac(6')-Ib. Fluoroquinolone resistance was associated with a single mutation Ser83Leu in the quinolone resistance determining region of the gyrA gene in all isolates. The MLST showed that the sequence type (ST) obtained corresponds to ST2 for the three strains. Here we report the first identification of multidrug-resistant A. baumannii isolates harboring the bla(OXA-23)-like gene, AMEs [aac(6')-Ib], and the 16S rRNA methylase (armA) in the Yemen hospital.

  4. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    ... rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%.

  5. Detection and coexistence of six categories of resistance genes in Escherichia coli strains from chickens in Anhui Province, China

    Directory of Open Access Journals (Sweden)

    Lin Li

    2015-12-01

    Full Text Available The aim of this study was to characterise the prevalence of class 1 integrons and gene cassettes, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants in 184 Escherichia coli isolates from chickens in Anhui Province, China. Susceptibility to 15 antimicrobials was determined using broth micro-dilution. Polymerase chain reaction and DNA sequencing were used to characterise the molecular basis of the antibiotic resistance. High rates of antimicrobial resistance were observed; 131 out of the 184 (72.3% isolates were resistant to at least six antimicrobial agents. The prevalences of class 1 integrons, tetracycline-resistance genes, phenicol-resistance genes, 16S rRNA methylase genes, extended-spectrum β-lactamase genes and plasmid-mediated fluoroquinolone resistance determinants were 49.5, 17.4, 15.8, 0.5, 57.6 and 46.2%, respectively. In 82 isolates, 48 different kinds of coexistence of the different genes were identified. Statistical (χ2 analysis showed that the resistance to amoxicillin, doxycycline, florfenicol, ofloxacin and gentamicin had significant differences (P<0.01 or 0.01carried and did not carry the resistance genes, which showed a certain correlation between antimicrobial resistance and the presence of resistance genes.

  6. Heavy metal and disinfectant resistance genes among livestock-associated methicillin-resistant Staphylococcus aureus isolates

    DEFF Research Database (Denmark)

    Argudin, Maria Angeles; Lauzat, Birgit; Kraushaar, Britta

    2016-01-01

    substances with antimicrobial activity applied in animal feed, including metal-containing compounds might contribute to their selection. Some of these genes have been found in various novel SCCmec cassettes. The aim of this study was to assess the occurrence of metal-resistance genes among a LA-S. aureus...... collection [n = 554, including 542 MRSA and 12 methicillin-susceptible S. aureus (MSSA)] isolated from livestock and food thereof. Most LA-MRSA isolates (76%) carried at least one metal-resistance gene. Among the LA-MRSA CC398 isolates (n = 456), 4.8%, 0.2%, 24.3% and 71.5% were positive for arsA (arsenic......, 72% carried one metal-resistance gene, and the remaining harboured two or more in different combinations. Differences between LA-MRSA CC398 and non-CC398 were statistically significant for arsA and czrC. The czrC gene was almost exclusively found (98%) in the presence of SCCmec V in both CC398...

  7. Antibiotic-Resistance Genes in Waste Water.

    Science.gov (United States)

    Karkman, Antti; Do, Thi Thuy; Walsh, Fiona; Virta, Marko P J

    2018-03-01

    Waste water and waste water treatment plants can act as reservoirs and environmental suppliers of antibiotic resistance. They have also been proposed to be hotspots for horizontal gene transfer, enabling the spread of antibiotic resistance genes between different bacterial species. Waste water contains antibiotics, disinfectants, and metals which can form a selection pressure for antibiotic resistance, even in low concentrations. Our knowledge of antibiotic resistance in waste water has increased tremendously in the past few years with advances in the molecular methods available. However, there are still some gaps in our knowledge on the subject, such as how active is horizontal gene transfer in waste water and what is the role of the waste water treatment plant in the environmental resistome? The purpose of this review is to briefly describe some of the main methods for studying antibiotic resistance in waste waters and the latest research and main knowledge gaps on the issue. In addition, some future research directions are proposed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Self-assembled Nanoscale Coordination Polymers Carrying siRNAs and Cisplatin for Effective Treatment of Resistant Ovarian Cancer

    Science.gov (United States)

    He, Chunbai; Liu, Demin; Lin, Wenbin

    2014-01-01

    Resistance to the chemotherapeutic agent cisplatin is a major limitation for the successful treatment of many cancers. Development of novel strategies to overcome intrinsic and acquired resistance to chemotherapy is of critical importance to effective treatment of ovarian cancer and other types of cancers. We have sought to re-sensitize resistant ovarian cancer cells to chemotherapy by co-delivering chemotherapeutics and pooled siRNAs targeting multi-drug resistance (MDR) genes using self-assembled nanoscale coordination polymers (NCPs). In this work, NCP-1 particles with trigger release properties were first constructed by linking cisplatin prodrug-based bisphosphonate bridging ligands with Zn2+ metal-connecting points and then coated with a cationic lipid layer, followed by the adsorption of pooled siRNAs targeting three MDR genes including survivin, Bcl-2, and P-glycoprotein via electrostatic interactions. The resulting NCP-1/siRNA particles promoted cellular uptake of cisplatin and siRNA and enabled efficient endosomal escape in cisplatin-resistant ovarian cancer cells. By down-regulating the expression of MDR genes, NCP-1/siRNAs enhanced the chemotherapeutic efficacy as indicated by cell viability assay, DNA ladder, and flow cytometry. Local administration of NCP-1/siRNAs effectively reduced tumor sizes of cisplatin-resistant SKOV-3 subcutaneous xenografts. This work shows that the NCP-1/siRNA platform holds great promise in enhancing chemotherapeutic efficacy for the effective treatment of drug-resistant cancers. PMID:25315138

  9. Hospital clones of methicillin-resistant Staphylococcus aureus are carried by medical students even before healthcare exposure

    Directory of Open Access Journals (Sweden)

    Ido Orlin

    2017-01-01

    Full Text Available Abstract Background Methicillin-resistant Staphylococcus aureus (MRSA strains are prevalent in healthcare and the community. Few studies have examined MRSA carriage among medical students. The aim of this study is to examine Staphylococcus aureus (SA carriage, and particular MRSA, over time in cohort medical students Methods Prospective collection of nasal swabs from medical students in Israel and assessment of SA carriage. Three samples were taken per student in preclinical and clinical parts of studies. Antibiotic susceptibilities were recorded and MRSA typing was performed by staphylococcal cassette chromosome mec (SCCmec types, Panton Valentine Leukocidin (PVL encoding genes, and spa types. Clonality was assessed by pulsed-field gel electrophoresis. Results Among 58 students, SA carriage rates increased from 33% to 38% to 41% at baseline (preclinical studies, 13 and 19 months (clinical studies, respectively (p = 0.07. Methicillin-susceptible SA (MSSA carriage increased in the clinical studies period (22 to 41%, p = 0.01. Overall, seven students (12% carried 13 MRSA isolates. MRSA isolates were PVL negative and were characterized as SCCmecII-t002, SCCmecIV-t032, or t12435 with untypable SCCmec. MRSA carriage during the pre-clinical studies was evident in 4/7 students. Two students carried different MRSA clones at various times and persistent MRSA carriage was noted in one student. Simultaneous carriage of MRSA and MSSA was not detected. Conclusions MSSA carriage increased during the clinical part of studies in Israeli medical students. Compared with previous reports, higher rates of MRSA carriage were evident. MRSA strains were genotypically similar to Israeli healthcare-associated clones; however, carriage occurred largely before healthcare exposure, implying community-acquisition of hospital strains.

  10. Characterization of In3Mor, a new integron carrying VIM-1 metallo-beta-lactamase and sat1 gene, from Morganella morganii.

    Science.gov (United States)

    Tsakris, Athanassios; Ikonomidis, Alexandros; Spanakis, Nicholas; Poulou, Aggeliki; Pournaras, Spyros

    2007-04-01

    A carbapenem-resistant Morganella morganii clinical isolate that was phenotypically metallo-beta-lactamase (MBL)-positive was recovered from a Greek patient. The aim of the study was to analyse the structure of the integron containing the MBL gene. MICs were determined by the broth microdilution method. PCR assays and nucleotide sequencing were used for identification of bla gene types and mapping of the integron carrying the MBL gene. The location of the MBL allele was investigated by mating experiments and plasmid analysis as well as by Southern blotting of the plasmid extract and gene-specific hybridization with a bla(VIM-1) probe. The strain contained In3Mor, a novel class 1 integron carrying a carbapenemase gene (bla(VIM-1)) associated with a trimethoprim (dfrA1), a streptothricin (sat1) and two aminoglycoside resistance genes (aacA7 and aadA1). Conjugation experiments failed to detect a transferable MBL determinant and plasmid DNA was not visualized. The chromosomal location of bla(VIM-1) was confirmed after hybridization of the chromosomal band with the bla(VIM-1) probe. Production of a VIM-type MBL in a M. morganii clinical isolate is documented in this study for the first time. Also, the dfrA1-sat1-aadA1 array which is typically described in the variable region of class 2 integrons consistent with that on Tn7 transposons, is originally detected herein in a class 1 integron.

  11. Effect of Vandetanib on Lung Tumorigenesis in Transgenic Mice Carrying an Activating Egfr Gene Mutation.

    Science.gov (United States)

    Osawa, Masahiro; Ohashi, Kadoaki; Kubo, Toshio; Ichihara, Eiki; Takata, Saburo; Takigawa, Nagio; Takata, Minoru; Tanimoto, Mitsune; Kiura, Katsuyuki

    2016-08-01

    Vandetanib (ZactimaTM) is a novel, orally available inhibitor of both vascular endothelial growth factor receptor-2 (VEGFR-2) and epidermal growth factor receptor (EGFR) tyrosine kinase. In the present study, a line of transgenic mice with a mouse Egfr gene mutation (delE748-A752) corresponding to a human EGFR mutation (delE746-A750) was established. The transgenic mice developed atypical adenomatous hyperplasia to adenocarcinoma of the lung at around 5 weeks of age and died of lung tumors at approximately 17 weeks of age. In the mice treated with vandetanib (6mg/kg/day), these lung tumors disappeared and the phosphorylations of EGFR and VEGFR-2 were reduced in lung tissues to levels comparable to those of non-transgenic control mice. The median overall survival time of the transgenic mice was 28 weeks in the vandetanib-treated group and 17 weeks in the vehicle-treated group. Vandetanib significantly prolonged the survival of the transgenic mice (log-rank test, p< 0.01); resistance to vandetanib occurred at 20 weeks of age and the animals died from their lung tumors at about 28 weeks of age. These data suggest that vandetanib could suppress the progression of tumors harboring an activating EGFR mutation.

  12. Characteristics of Pollen from Transgenic Lines of Apple Carrying the Exogenous CpTI Gene

    Directory of Open Access Journals (Sweden)

    Shi Xiaoxin

    2015-07-01

    Full Text Available It is fundamental for gene transformation and ecosystem hazard evaluation to study the pollen characteristics of transgenic plants. In this research, the characteristics of pollen from 7- or 8-year-old transgenic apple plants carrying an exogenous CpTI gene were analyzed. The results showed that there was no significant difference in terms of size, morphology, or exine ornamentation between the pollen of the transgenic plants and the non-transgenic control. However, the transgenic plants had more abnormal pollen grains. Of the 13 transgenic lines tested, 12 had a significantly lower amount of pollen and six exhibited a significantly lower germination rate when cultured in vitro. The pollen viability of three transgenic lines was determined, with two showing significantly lower viability than the control. The transgenic Gala apple pollen grains germinated normally via controlled pollination on Fuji apple stigmas. However, the pollen tubes extended relatively slowly during the middle and late development stages, and another 8 h were needed to reach the ovules compared with the control. The gibberellic acid concentration in transgenic Gala apple flowers was lower than in the non-transgenic control during all development stages tested. The abscisic acid concentration in the transgenic flowers was lower during the pink stage, and higher during the ball and fully open stages. Microscopic observation of the anther structure showed no difference. The tapetum of the pollen sac wall in transgenic plants decomposed late and affected pollen grain development, which could be one of the reasons for the lower number of pollen grains and poor viability in the transgenic plants.

  13. Isolation of Enterobacter aerogenes carrying blaTEM-1 and blaKPC-3 genes recovered from a hospital Intensive Care Unit.

    Science.gov (United States)

    Pulcrano, Giovanna; Pignanelli, Salvatore; Vollaro, Adriana; Esposito, Matilde; Iula, Vita Dora; Roscetto, Emanuela; Soriano, Amata Amy; Catania, Maria Rosaria

    2016-06-01

    Enterobacter aerogenes has recently emerged as an important hospital pathogen. In this study, we showed the emergence of E. aerogenes isolates carrying the blaKPC gene in patients colonized by carbapenem-resistant Klebsiella pneumoniae strains. Two multiresistant E. aerogenes isolates were recovered from bronchial aspirates of two patients hospitalized in the Intensive Care Unit at the "Santa Maria della Scaletta" Hospital, Imola. The antimicrobial susceptibility test showed the high resistance to carbapenems and double-disk synergy test confirmed the phenotype of KPC and AmpC production. Other investigation revealed that ESBL and blaKPC genes were carried on the conjugative pKpQIL plasmid. This is a relevant report in Italy that describes a nosocomial infection due to the production of KPC beta-lactamases by an E. aerogenes isolate in patients previously colonized by K. pneumoniae carbapenem-resistant. In conclusion, it's necessary a continuous monitoring of multidrug-resistant strains for the detection of any KPC-producing bacteria that could expand the circulation of carbapenem-resistant pathogens. © 2016 APMIS. Published by John Wiley & Sons Ltd.

  14. Distribution of the Multidrug Resistance Gene cfr in Staphylococcus Species Isolates from Swine Farms in China

    Science.gov (United States)

    Wang, Yang; Zhang, Wanjiang; Wang, Juan; Wu, Congming; Shen, Zhangqi; Fu, Xiao; Yan, Yang; Zhang, Qijing

    2012-01-01

    A total of 149 porcine Staphylococcus isolates with florfenicol MICs of ≥16 μg/ml were screened for the presence of the multiresistance gene cfr, its location on plasmids, and its genetic environment. In total, 125 isolates carried either cfr (16 isolates), fexA (92 isolates), or both genes (17 isolates). The 33 cfr-carrying staphylococci, which included isolates of the species Staphylococcus cohnii, S. arlettae, and S. saprophyticus in which the cfr gene has not been described before, exhibited a wide variety of SmaI pulsed-field gel electrophoresis patterns. In 18 cases, the cfr gene was located on plasmids. Four different types of cfr-carrying plasmids—pSS-01 (n = 2; 40 kb), pSS-02 (n = 3; 35.4 kb), pSS-03 (n = 10; 7.1 kb), and pBS-01 (n = 3; 16.4 kb)—were differentiated on the basis of their sizes, restriction patterns, and additional resistance genes. Sequence analysis revealed that in plasmid pSS-01, the cfr gene was flanked in the upstream part by a complete aacA-aphD-carrying Tn4001-like transposon and in the downstream part by a complete fexA-carrying transposon Tn558. In plasmid pSS-02, an insertion sequence IS21-558 and the cfr gene were integrated into transposon Tn558 and thereby truncated the tnpA and tnpB genes. The smallest cfr-carrying plasmid pSS-03 carried the macrolide-lincosamide-streptogramin B resistance gene erm(C). Plasmid pBS-01, previously described in Bacillus spp., harbored a Tn917-like transposon, including the macrolide-lincosamide-streptogramin B resistance gene erm(B) in the cfr downstream region. Plasmids, which in part carry additional resistance genes, seem to play an important role in the dissemination of the gene cfr among porcine staphylococci. PMID:22183168

  15. Detection and Characterizations of Genes Resistant to Tetracycline and Sulfa among the Bacteria in Mariculture Water

    Science.gov (United States)

    Qu, L.; Li, Y.; Zhu, P.

    2013-12-01

    One hundred and thirty-five bacteria from maricultural environments were tested for sensitivity to tetracycline and sulfa. Result show that 72% of the bacteria were sulfa-resistant, 36% of the bacteria were tetracycline-resistant, and 16.5% of bacteria showed resistance to both tetracyclines and sulfa ,indicating that the proportion of sulfa and tetracycline resistance bacteria isvery large in the maricultural environments. PCR methods were used to detect if these resistant bacteria carry tetracycline and sulfa resistance genes. Out of the 33 tetracycline-resistant bacteria screened, 3 were positive for tetA, 6 were positive for tetB and no isolate wasboth positive for tetA and tetB. Of the 97 sulfa-resistant bacteria screened, 9 were positive for sul2, 6 were positive for sul1, 1 isolate was positive for bothsul1 and sul2. The minimum inhibitory concentration (MIC) of tetracycline for tetA-carrying isolates were higher than those tetB-carrying isolates.while The MIC of sulfa for sul2-carrying isolates were higher than those sul1-carrying isolates. Indicating that tetA and sul2 gene may play ubknown roles in resisting tetracycline and sulfa than tetB and sul1 genes. The results showed the 4 kinds of genes (tetA,tetB,sul1,sul2) has no host specificity. All these 16S sequence are from the isolates which are positive for the above genes, it indicated the above antibiotic resistance genes are widespread in the environment regardless of the host. While the DNA sequence of these four genes showed tetA, sul1, sul2 genes are conservative in different bacteria , etB gene conserved poorly. The research aim is to get a preliminary understanding of resistance mechanism related to the resistant bacteria and the resistance genes in marine aquaculture environment through the analysis of resistant genes, providing research base for the prevention and treatment of drug-resistant bacteria so as to reduce the threat to the ecological environment, aquaculture and human health.

  16. Progressive resistance training increases strength after stroke but this may not carry over to activity: a systematic review.

    Science.gov (United States)

    Dorsch, Simone; Ada, Louise; Alloggia, Daniella

    2018-04-01

    Does progressive resistance training improve strength and activity after stroke? Does any increase in strength carry over to activity? Systematic review of randomised trials with meta-analysis. Adults who have had a stroke. Progressive resistance training compared with no intervention or placebo. The primary outcome was change in strength. This measurement had to be of maximum voluntary force production and performed in muscles congruent with the muscles trained in the intervention. The secondary outcome was change in activity. This measurement had to be a direct measure of performance that produced continuous or ordinal data, or with scales that produced ordinal data. Eleven studies involving 370 participants were included in this systematic review. The overall effect of progressive resistance training on strength was examined by pooling change scores from six studies with a mean PEDro score of 5.8, representing medium quality. The effect size of progressive resistance training on strength was 0.98 (95% CI 0.67 to 1.29, I 2 =0%). The overall effect of progressive resistance training on activity was examined by pooling change scores from the same six studies. The effect size of progressive resistance training on activity was 0.42 (95% CI -0.08 to 0.91, I 2 =54%). After stroke, progressive resistance training has a large effect on strength compared with no intervention or placebo. There is uncertainty about whether these large increases in strength carry over to improvements in activity. PROSPERO CRD42015025401. [Dorsch S, Ada L, Alloggia D (2018) Progressive resistance training increases strength after stroke but this may not carry over to activity: a systematic review. Journal of Physiotherapy 64: 84-90]. Copyright © 2018 Australian Physiotherapy Association. Published by Elsevier B.V. All rights reserved.

  17. Transposon Tn5393e carrying the aphA1-containing transposon Tn6023 upstream of strAB does not confer resistance to streptomycin.

    Science.gov (United States)

    Cain, Amy K; Hall, Ruth M

    2011-09-01

    The simplest form of transposon Tn5393 carries the strA and strB genes that confer resistance to streptomycin, in addition to its transposition determinants. Tn5393e, made up of Tn5393 and a second transposon, Tn6023, was found in an IncHI2 plasmid, pSRC125, recovered from a multiply antibiotic-resistant Salmonella enterica serovar Typhimurium isolate of bovine origin. Tn6023 is made up of the aphA1b gene flanked by two inversely oriented copies of insertion sequence (IS) IS26 and is flanked by an 8 bp duplication. It is related to several other transposons that carry aphA1b in fragments of differing length, also flanked by copies of IS26. Tn6023 is located in the tnpR gene of Tn5393, which lies upstream of the strA and strB genes, and the combined structure was designated Tn5393e. Although neither strA nor strB contain any mutations that would inactivate them, pSRC125 does not confer resistance to streptomycin, indicating that the strA and strB genes are not expressed. In Tn5393, strA and strB are transcribed from the tnpR promoter, and in Tn5393e neither this transcript nor the transcript from the aphA1b promoter in Tn6023 must reach strAB. Tn5393e was previously found in different locations in Corynebacteria, indicating that it can move and suggesting a wide distribution. The structures of several further variants of Tn5393 found in GenBank were analyzed and assigned variant designations Tn5393f-Tn5393i.

  18. A novel resistance gene, lnu(H), conferring resistance to lincosamides in Riemerella anatipestifer CH-2.

    Science.gov (United States)

    Luo, Hong-Yan; Liu, Ma-Feng; Wang, Ming-Shu; Zhao, Xin-Xin; Jia, Ren-Yong; Chen, Shun; Sun, Kun-Feng; Yang, Qiao; Wu, Ying; Chen, Xiao-Yue; Biville, Francis; Zou, Yuan-Feng; Jing, Bo; Cheng, An-Chun; Zhu, De-Kang

    2018-01-01

    The Gram-negative bacterium Riemerella anatipestifer CH-2 is resistant to lincosamides, having a lincomycin (LCM) minimum inhibitory concentration (MIC) of 128 µg/mL. The G148_1775 gene of R. anatipestifer CH-2, designated lnu(H), encodes a 260-amino acid protein with ≤41% identity to other reported lincosamide nucleotidylyltransferases. Escherichia coli Rosetta TM (DE3) containing the pBAD24-lnu(H) plasmid showed four- and two-fold increases in the MICs of LCM and clindamycin (CLI), respectively. A kinetic assay of the purified Lnu(H) enzyme for LCM and CLI showed that the protein could inactive lincosamides. Mass spectrometry analysis demonstrated that the Lnu(H) enzyme catalysed adenylylation of lincosamides. In addition, an lnu(H) gene deletion strain exhibited 512- and 32-fold decreases in LCM and CLI MICs, respectively. The wild-type level of lincosamide resistance could be restored by complementation with a shuttle plasmid carrying the lnu(H) gene. The transformant R. anatipestifer ATCC 11845 [lnu(H)] acquired by natural transformation also exhibited high-level lincosamide resistance. Moreover, among 175 R. anatipestifer field isolates, 56 (32.0%) were positive for the lnu(H) gene by PCR. In conclusion, Lnu(H) is a novel lincosamide nucleotidylyltransferase that inactivates LCM and CLI by nucleotidylylation, thus conferring high-level lincosamide resistance to R. anatipestifer CH-2. Copyright © 2017. Published by Elsevier B.V.

  19. Potential of Staphylococcus aureus isolates carrying different PBP2a alleles to develop resistance to ceftaroline.

    Science.gov (United States)

    Lahiri, Sushmita D; Alm, Richard A

    2016-01-01

    Infections caused by MRSA continue to cause significant morbidity worldwide. Ceftaroline (the active metabolite of the prodrug ceftaroline fosamil) is a cephalosporin that possesses activity against MRSA due to its having high affinity for PBP2a while maintaining activity against the other essential PBPs. PBP2a sequence variations, including some outside of the transpeptidase binding pocket, impact ceftaroline susceptibility. This study evaluated the potential of ceftaroline to select for resistant Staphylococcus aureus clones in isolates containing a variety of PBP2a alleles and with a range of ceftaroline MIC values from different MLST lineages. Direct resistance selection experiments were performed by plating 20 S. aureus isolates (18 MRSA and 2 MSSA) on agar plates containing increasing concentrations of ceftaroline. Colonies that emerged were tested by standard broth microdilution for changes in ceftaroline susceptibility and genetically characterized. The frequency of spontaneous resistance to ceftaroline was low for all isolates and, although resistant variants were not obtained on plates containing ≥4-fold the MIC of ceftaroline, six MRSA isolates had a small number of colonies emerge on plates containing 2-fold the MIC of ceftaroline and had a 2- to 8-fold elevation of the ceftaroline MIC, while also impacting the MIC of methicillin compared with the parental isolate. Additional PBP2a mutations located in the ceftaroline-binding pocket, Y446N or A601S, were observed in several of the resistant isolates. These studies demonstrate that there is a low risk of generating ceftaroline-resistant MRSA isolates, which appears independent of any pre-existing variation in the PBP2a protein sequence or initial ceftaroline MIC. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. Fate of antibiotic resistance genes and metal resistance genes during thermophilic aerobic digestion of sewage sludge.

    Science.gov (United States)

    Jang, Hyun Min; Lee, Jangwoo; Kim, Young Beom; Jeon, Jong Hun; Shin, Jingyeong; Park, Mee-Rye; Kim, Young Mo

    2018-02-01

    This study examines the fate of twenty-three representative antibiotic resistance genes (ARGs) encoding tetracyclines, sulfonamides, quinolones, β-lactam antibiotics, macrolides, florfenicol and multidrug resistance during thermophilic aerobic digestion (TAD) of sewage sludge. The bacterial community, class 1 integrons (intI1) and four metal resistance genes (MRGs) were also quantified to determine the key drivers of changes in ARGs during TAD. At the end of digestion, significant decreases in the quantities of ARGs, MRGs and intI1 as well as 16S rRNA genes were observed. Partial redundancy analysis (RDA) showed that shifts in temperature were the key factors affecting a decrease in ARGs. Shifts in temperature led to decreased amounts of ARGs by reducing resistome and bacterial diversity, rather than by lowering horizontal transfer potential via intI1 or co-resistance via MRGs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Plant resistance genes : their structure, function and evolution

    NARCIS (Netherlands)

    Takken, F.L.W.; Joosten, M.H.A.J.

    2000-01-01

    Plants have developed efficient mechanisms to avoid infection or to mount responses that render them resistant upon attack by a pathogen. One of the best-studied defence mechanisms is based on gene-for-gene resistance through which plants, harbouring specific resistance (R) genes, specifically

  2. Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

    Directory of Open Access Journals (Sweden)

    Chen Tingfu

    2010-07-01

    Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

  3. Spontaneous deletion of a 20-kilobase DNA segment carrying genes specifying isopropylbenzene metabolism in Pseudomonas putida RE204.

    OpenAIRE

    Eaton, R W; Timmis, K N

    1986-01-01

    The genes encoding isopropylbenzene metabolism in Pseudomonas putida RE204 are readily lost in two ways: by loss (curing) of plasmid pRE4 which specifies the catabolic pathway and by deletion from pRE4 of an approximately 20-kilobase segment of DNA carrying the catabolic genes. The presence of DNA sequences at the ends of the catabolic gene region sharing homology with one another suggests that the deletions result from recombination events between these homologous sequences.

  4. Seroprevalence and molecular epidemiology of EAST1 gene-carrying Escherichia coli from diarrheal patients and raw meats.

    Science.gov (United States)

    Sukkua, Kannika; Manothong, Somruthai; Sukhumungoon, Pharanai

    2017-03-31

    Several Escherichia coli pathotypes have been reported in Thailand; however, information on enteroaggregative heat-stable enterotoxin 1 (EAST1)-carrying E. coli (EAST1-EC) is insufficient. Previous reports show that consumption of raw meats causes diarrheagenic E. coli infections. In this study, we investigated the seroprevalence and genetic relationship of EAST1-EC from clinical and raw meat samples. Diarrheal patients and raw meat samples were investigated for the presence of EAST1-EC by performing polymerase chain reaction (PCR) to detect astA. Serotyping, antimicrobial susceptibility tests, and PCR-based phylogenetic group assay were performed. Molecular epidemiology of E. coli strains from clinical and raw meat samples was determined using repetitive element-PCR typing, BOX-PCR, and ERIC2-PCR. Results showed that 11.2% (17/152) of clinical samples and 53.3% (16/30) of raw meat samples had EAST1-EC. In all, 24 and 36 EAST1-EC strains were successfully isolated from 17 clinical and 16 raw meat samples, respectively. These strains had astA but did not possess the indicative genes of other E. coli pathotypes and were therefore classified as EAST1-EC. Most of these strains were multidrug resistant and were classified into nine serogroups. Molecular genotyping showed identical DNA fingerprint among EAST1-EC serotype O15 strains from clinical and raw chicken samples, suggesting that they were derived from the same bacterial clone. Our results indicated a high prevalence of multidrug-resistant EAST1-EC strains in clinical and environmental samples in Thailand belonging to nine serogroups. Moreover, the study highlighted the close association between infections caused by EAST1-EC serotype O15 and raw meat consumption.

  5. Resistance Genes and Genetic Elements Associated with Antibiotic Resistance in Clinical and Commensal Isolates of Streptococcus salivarius.

    Science.gov (United States)

    Chaffanel, Fanny; Charron-Bourgoin, Florence; Libante, Virginie; Leblond-Bourget, Nathalie; Payot, Sophie

    2015-06-15

    The diversity of clinical (n = 92) and oral and digestive commensal (n = 120) isolates of Streptococcus salivarius was analyzed by multilocus sequence typing (MLST). No clustering of clinical or commensal strains can be observed in the phylogenetic tree. Selected strains (92 clinical and 46 commensal strains) were then examined for their susceptibilities to tetracyclines, macrolides, lincosamides, aminoglycosides, and phenicol antibiotics. The presence of resistance genes tet(M), tet(O), erm(A), erm(B), mef(A/E), and catQ and associated genetic elements was investigated by PCR, as was the genetic linkage of resistance genes. High rates of erythromycin and tetracycline resistance were observed among the strains. Clinical strains displayed either the erm(B) (macrolide-lincosamide-streptogramin B [MLSB] phenotype) or mef(A/E) (M phenotype) resistance determinant, whereas almost all the commensal strains harbored the mef(A/E) resistance gene, carried by a macrolide efflux genetic assembly (MEGA) element. A genetic linkage between a macrolide resistance gene and genes of Tn916 was detected in 23 clinical strains and 5 commensal strains, with a predominance of Tn3872 elements (n = 13), followed by Tn6002 (n = 11) and Tn2009 (n = 4) elements. Four strains harboring a mef(A/E) gene were also resistant to chloramphenicol and carried a catQ gene. Sequencing of the genome of one of these strains revealed that these genes colocalized on an IQ-like element, as already described for other viridans group streptococci. ICESt3-related elements were also detected in half of the isolates. This work highlights the potential role of S. salivarius in the spread of antibiotic resistance genes both in the oral sphere and in the gut. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  6. Incorporation of Bacterial Blight Resistance Genes Into Lowland Rice Cultivar Through Marker-Assisted Backcross Breeding.

    Science.gov (United States)

    Pradhan, Sharat Kumar; Nayak, Deepak Kumar; Pandit, Elssa; Behera, Lambodar; Anandan, Annamalai; Mukherjee, Arup Kumar; Lenka, Srikanta; Barik, Durga Prasad

    2016-07-01

    Bacterial blight (BB) of rice caused by Xanthomonas oryzae pv. oryzae is a major disease of rice in many rice growing countries. Pyramided lines carrying two BB resistance gene combinations (Xa21+xa13 and Xa21+xa5) were developed in a lowland cultivar Jalmagna background through backcross breeding by integrating molecular markers. In each backcross generation, markers closely linked to the disease resistance genes were used to select plants possessing the target genes. Background selection was continued in those plants carrying resistant genes until BC(3) generation. Plants having the maximum contribution from the recurrent parent genome were selected in each generation and hybridized with the recipient parent. The BB-pyramided line having the maximum recipient parent genome recovery of 95% was selected among BC3F1 plants and selfed to isolate homozygous BC(3)F(2) plants with different combinations of BB resistance genes. Twenty pyramided lines with two resistance gene combinations exhibited high levels of tolerance against the BB pathogen. In order to confirm the resistance, the pyramided lines were inoculated with different X. oryzae pv. oryzae strains of Odisha for bioassay. The genotypes with combination of two BB resistance genes conferred high levels of resistance to the predominant X. oryzae pv. oryzae isolates prevalent in the region. The pyramided lines showed similarity with the recipient parent with respect to major agro-morphologic traits.

  7. A GC1 Acinetobacter baumannii isolate carrying AbaR3 and the aminoglycoside resistance transposon TnaphA6 in a conjugative plasmid.

    Science.gov (United States)

    Hamidian, Mohammad; Holt, Kathryn E; Pickard, Derek; Dougan, Gordon; Hall, Ruth M

    2014-04-01

    To locate the acquired antibiotic resistance genes, including the amikacin resistance transposon TnaphA6, in the genome of an Australian isolate belonging to Acinetobacter baumannii global clone 1 (GC1). A multiply antibiotic-resistant GC1 isolate harbouring TnaphA6 was sequenced using Illumina HiSeq, and reads were used to generate a de novo assembly and determine multilocus sequence types (STs). PCR was used to assemble the AbaR chromosomal resistance island and a large plasmid carrying TnaphA6. Plasmid DNA sequences were compared with ones available in GenBank. Conjugation experiments were conducted. The A. baumannii GC1 isolate G7 was shown to include the AbaR3 antibiotic resistance island. It also contains an 8.7 kb cryptic plasmid, pAb-G7-1, and a 70,100 bp plasmid, pAb-G7-2, carrying TnaphA6. pAb-G7-2 belongs to the Aci6 Acinetobacter plasmid family. It encodes transfer functions and was shown to conjugate. Plasmids related to pAb-G7-2 were detected in further amikacin-resistant GC1 isolates using PCR. From the genome sequence, isolate G7 was ST1 (Institut Pasteur scheme) and ST231 (Oxford scheme). Using Oxford scheme PCR-based methods, the isolate was ST109 and this difference was traced to a single base difference resulting from the inclusion of the original primers in the gpi segment analysed. The multiply antibiotic-resistant GC1 isolate G7 carries most of its resistance genes in AbaR3 located in the chromosome. However, TnaphA6 is on a conjugative plasmid, pAb-G7-2. Primers developed to locate TnaphA6 in pAb-G7-2 will simplify the detection of plasmids related to pAb-G7-2 in A. baumannii isolates.

  8. The replication of Bangladeshi H9N2 avian influenza viruses carrying genes from H7N3 in mammals.

    Science.gov (United States)

    Shanmuganatham, Karthik K; Jones, Jeremy C; Marathe, Bindumadhav M; Feeroz, Mohammed M; Jones-Engel, Lisa; Walker, David; Turner, Jasmine; Rabiul Alam, S M; Kamrul Hasan, M; Akhtar, Sharmin; Seiler, Patrick; McKenzie, Pamela; Krauss, Scott; Webby, Richard J; Webster, Robert G

    2016-04-20

    H9N2 avian influenza viruses are continuously monitored by the World Health Organization because they are endemic; they continually reassort with H5N1, H7N9 and H10N8 viruses; and they periodically cause human infections. We characterized H9N2 influenza viruses carrying internal genes from highly pathogenic H7N3 viruses, which were isolated from chickens or quail from live-bird markets in Bangladesh between 2010 and 2013. All of the H9N2 viruses used in this study carried mammalian host-specific mutations. We studied their replication kinetics in normal human bronchoepithelial cells and swine tracheal and lung explants, which exhibit many features of the mammalian airway epithelium and serve as a mammalian host model. All H9N2 viruses replicated to moderate-to-high titers in the normal human bronchoepithelial cells and swine lung explants, but replication was limited in the swine tracheal explants. In Balb/c mice, the H9N2 viruses were nonlethal, replicated to moderately high titers and the infection was confined to the lungs. In the ferret model of human influenza infection and transmission, H9N2 viruses possessing the Q226L substitution in hemagglutinin replicated well without clinical signs and spread via direct contact but not by aerosol. None of the H9N2 viruses tested were resistant to the neuraminidase inhibitors. Our study shows that the Bangladeshi H9N2 viruses have the potential to infect humans and highlights the importance of monitoring and characterizing this influenza subtype to better understand the potential risk these viruses pose to humans.

  9. Distribution of genes encoding resistance to streptogramin A and related compounds among staphylococci resistant to these antibiotics.

    Science.gov (United States)

    Allignet, J; Aubert, S; Morvan, A; el Solh, N

    1996-01-01

    The levels of resistance to pristinamycin (Pt) and to its major constituents, pristinamycin IIA and IB (PIIA and PIB, respectively; classified as streptogramins A and B, respectively) were determined for 126 staphylococcal isolates. The results suggest tentative susceptibility breakpoints of or = 4 micrograms of PIIA per ml were investigated for the presence of staphylococcal genes encoding resistance to PIIA (vga, vat, and vatB) and PIB (vgb). None of these genes was found in the 4 isolates inhibited by 4 micrograms of PIIA per ml or in 4 of the other 52 isolates tested. The remaining 48 isolates harbored plasmids carrying vatB and vga or combinations of genes (vga-vat-vgb or vga-vat). The absence of any known PIIA resistance gene from the four Staphylococcus aureus isolates inhibited by > or = 8 micrograms of PIIA per ml suggests that there is at least one PIIA resistance mechanism in staphylococci that has not yet been characterized. PMID:8913457

  10. Outbreaks in distinct regions due to a single Klebsiella pneumoniae clone carrying a bla VIM-1 metallo-{beta}-lactamase gene.

    Science.gov (United States)

    Ikonomidis, Alexandros; Tokatlidou, Despina; Kristo, Ioulia; Sofianou, Danai; Tsakris, Athanassios; Mantzana, Paraskevi; Pournaras, Spyros; Maniatis, Antonios N

    2005-10-01

    From December 2004 to March 2005, 27 Klebsiella pneumoniae clinical isolates that were positive by the imipenem-EDTA double-disk synergy test and that exhibited a single macro-restriction pattern were recovered in two distinct Greek hospitals. The isolates carried a transferable bla(VIM-1) metallo-beta-lactamase gene in a class 1 integron. Reverse transcriptase PCR showed that the gene was similarly expressed in low- and high-level carbapenem-resistant isolates, indicating the existence of additional resistance mechanisms. The clonal spread of VIM-1-producing K. pneumoniae strains in distinct regions where up to now bla(VIM-2) and bla(VIM-4) alleles were common is worrisome.

  11. Rapid cloning of disease-resistance genes in plants using mutagenesis and sequence capture

    Science.gov (United States)

    Genetic solutions to protect crops against pests and pathogens are preferable to agrichemicals 1. Wild crop relatives carry immense diversity of disease resistance (R) genes that could enable more sustainable disease control. However, recruiting R genes for crop improvement typically involves long b...

  12. Exploring antibiotic resistance genes and metal resistance genes in plasmid metagenomes from wastewater treatment plants

    OpenAIRE

    Li, An-Dong; Li, Li-Guan; Zhang, Tong

    2015-01-01

    Plasmids operate as independent genetic elements in microorganism communities. Through horizontal gene transfer, they can provide their host microorganisms with important functions such as antibiotic resistance and heavy metal resistance. In this study, six metagenomic libraries were constructed with plasmid DNA extracted from influent, activated sludge and digested sludge of two wastewater treatment plants. Compared with the metagenomes of the total DNA extracted from the same sectors of the...

  13. Inactivation Effect of Antibiotic-Resistant Gene Using Chlorine Disinfection

    Directory of Open Access Journals (Sweden)

    Takashi Furukawa

    2017-07-01

    Full Text Available The aim of this study was to elucidate the inactivation effects on the antibiotic-resistance gene (vanA of vancomycin-resistant enterococci (VRE using chlorination, a disinfection method widely used in various water treatment facilities. Suspensions of VRE were prepared by adding VRE to phosphate-buffered saline, or the sterilized secondary effluent of a wastewater treatment plant. The inactivation experiments were carried out at several chlorine concentrations and stirring time. Enterococci concentration and presence of vanA were determined. The enterococci concentration decreased as chlorine concentrations and stirring times increased, with more than 7.0 log reduction occurring under the following conditions: 40 min stirring at 0.5 mg Cl2/L, 20 min stirring at 1.0 mg Cl2/L, and 3 min stirring at 3.0 mg Cl2/L. In the inactivation experiment using VRE suspended in secondary effluent, the culturable enterococci required much higher chlorine concentration and longer treatment time for complete disinfection than the cases of suspension of VRE. However, vanA was detected in all chlorinated suspensions of VRE, even in samples where no enterococcal colonies were present on the medium agar plate. The chlorine disinfection was not able to destroy antibiotic-resistance genes, though it can inactivate and decrease bacterial counts of antibiotic-resistant bacteria (ARB. Therefore, it was suggested that remaining ARB and/or antibiotic-resistance gene in inactivated bacterial cells after chlorine disinfection tank could be discharged into water environments.

  14. Obtaining of transgenic papaya plants var. Maradol roja that carry out the rice oryzacystatin gene

    Directory of Open Access Journals (Sweden)

    Milady F. Mendoza

    2004-10-01

    Full Text Available Papaya (Carica papaya L., is severely affected by Papaya Ringspot virus, which belongs to plant potyvirus group. A recent strategy for pest control produced by this virus is the transformation with genes encoding cysteine proteinase inhibitors. Rice oryzacistatin gene encoding for cystatins, was inserted in a pCAMBIA binary vector, for genetic transformation of papaya somatic embryos var. Maradol roja, mediated by gene gun. Gene integration was confirmed by means of polimerase chain reaction using the primers designed from gene bar sequence. Forty out of eighty in vitro transgenic papaya lines amplified a 402 fragment which correspond to the expecting size. Key words: Carica papaya, genetic engineering, potyvirus, proteinase inhibitor

  15. First description in Europe of the emergence of Enterococcus faecium ST117 carrying both vanA and vanB genes, isolated in Greece.

    Science.gov (United States)

    Papagiannitsis, C C; Malli, E; Florou, Z; Medvecky, M; Sarrou, S; Hrabak, J; Petinaki, E

    2017-12-01

    An Enterococcus faecium isolate (Efa-125) carrying both the vanA and vanB genes was recovered from a patient with bacteraemia treated in a Greek hospital. Since this is the first description in Europe of E. faecium carrying both vanA and vanB genes, the isolate was further studied. Susceptibility to several antibiotics was determined using the VITEK ® 2 automated system. The isolate was typed by multilocus sequence typing (MLST). To define the genetic units of the vanA and vanB genes, the plasmid content of Efa-125 was analysed by pulsed-field gel electrophoresis (PFGE) of total DNA digested with S1 nuclease followed by hybridisation with digoxigenin-labelled vanA and vanB probes. In addition, plasmids and chromosomes were sequenced using the Illumina MiSeq platform. E. faecium Efa-125 belonged to ST117 and expressed resistance both to vancomycin and teicoplanin, with minimum inhibitory concentrations (MICs) for both of 256mg/L. The vanA gene was carried on a 29 320-bp plasmid exhibiting high similarity to pA6981 previously characterised from Enterococcus gallinarum A6981, whereas vanB was part of a Tn1549-like transposon integrated into the chromosome. Expression of the VanA phenotype was correlated with the presence of intact vanZ and vanS genes. This is the first detection in Greece of vanA-vanB genotype/VanA phenotype E. faecium and indicates an evolving epidemiology of vancomycin-resistant enterococci. Copyright © 2017 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

  16. Effect of Shear Resistance on Flexural Debonding Load-Carrying Capacity of RC Beams Strengthened with Externally Bonded FRP Composites

    Directory of Open Access Journals (Sweden)

    Guibing Li

    2014-05-01

    Full Text Available Debonding failure is the main failure mode in flexurally strengthened reinforced concrete beams by externally bonded or near surface mounted fibre reinforced polymer (FRP composites. It is believed that FRP debonding will be initiated if the shear stress on the concrete-FRP interface reaches the tensile strength of concrete. However, it was found through experimental and analytical studies that the debonding mechanism of FRP composites has the potential of shear failure in combination with debonding failure. Moreover, the shear failure probably influences the debonding failure. Presently, there are very little experimental and analytical studies to investigate the influence of shear resistance of reinforced concrete (RC beam on FRP debonding failure. The current study investigates and analyzes the effect of shear resistance on FRP debonding failure based on test results. The analytical results show that the shear resistance of RC beam has a great effect on flexural debonding load-carrying capacity of FRP-strengthened RC beam. The influence of shear resistance on flexural debonding load-carrying capacity must be fully considered in flexural strengthening design of RC beams.

  17. Identification and characterization of antibiotic resistance genes in Lactobacillus reuteri and Lactobacillus plantarum.

    Science.gov (United States)

    Egervärn, M; Roos, S; Lindmark, H

    2009-11-01

    The study aimed to identify the resistance genes mediating atypical minimum inhibitory concentrations (MICs) for tetracycline, erythromycin, clindamycin and chloramphenicol within two sets of representative strains of the species Lactobacillus reuteri and Lactobacillus plantarum and to characterize identified genes by means of gene location and sequencing of flanking regions. A tet(W) gene was found in 24 of the 28 Lact. reuteri strains with atypical MIC for tetracycline, whereas four of the six strains with atypical MIC for erythromycin were positive for erm(B) and one strain each was positive for erm(C) and erm(T). The two Lact. plantarum strains with atypical MIC for tetracycline harboured a plasmid-encoded tet(M) gene. The majority of the tet(W)-positive Lact. reuteri strains and all erm-positive Lact. reuteri strains carried the genes on plasmids, as determined by Southern blot and a real-time PCR method developed in this study. Most of the antibiotic-resistant strains of Lact. reuteri and Lact. plantarum harboured known plasmid-encoded resistance genes. Examples of putative transfer machineries adjacent to both plasmid- and chromosome-located resistance genes were also demonstrated. These data provide some of the knowledge required for assessing the possible risk of using Lact. reuteri and Lact. plantarum strains carrying antibiotic resistance genes as starter cultures and probiotics.

  18. Isolation and characterization of NBS-LRR- resistance gene candidates in turmeric (Curcuma longa cv. surama).

    Science.gov (United States)

    Joshi, R K; Mohanty, S; Subudhi, E; Nayak, S

    2010-09-08

    Turmeric (Curcuma longa), an important asexually reproducing spice crop of the family Zingiberaceae is highly susceptible to bacterial and fungal pathogens. The identification of resistance gene analogs holds great promise for development of resistant turmeric cultivars. Degenerate primers designed based on known resistance genes (R-genes) were used in combinations to elucidate resistance gene analogs from Curcuma longa cultivar surama. The three primers resulted in amplicons with expected sizes of 450-600 bp. The nucleotide sequence of these amplicons was obtained through sequencing; their predicted amino acid sequences compared to each other and to the amino acid sequences of known R-genes revealed significant sequence similarity. The finding of conserved domains, viz., kinase-1a, kinase-2 and hydrophobic motif, provided evidence that the sequences belong to the NBS-LRR class gene family. The presence of tryptophan as the last residue of kinase-2 motif further qualified them to be in the non-TIR-NBS-LRR subfamily of resistance genes. A cluster analysis based on the neighbor-joining method was carried out using Curcuma NBS analogs together with several resistance gene analogs and known R-genes, which classified them into two distinct subclasses, corresponding to clades N3 and N4 of non-TIR-NBS sequences described in plants. The NBS analogs that we isolated can be used as guidelines to eventually isolate numerous R-genes in turmeric.

  19. Marker mapping and resistance gene associations in soybean

    OpenAIRE

    2011-01-01

    The invention provides novel molecular genetic markers in soybean, where the markers are useful, for example, in the marker-assisted selection of gene alleles that impart disease-resistance, thereby allowing the identification and selection of a disease-resistant plant. The markers also find use in positional cloning of disease-resistance genes.

  20. Unexpected detection of porcine rotavirus C strains carrying human origin VP6 gene.

    Science.gov (United States)

    Kattoor, Jobin Jose; Saurabh, Sharad; Malik, Yashpal Singh; Sircar, Shubhankar; Dhama, Kuldeep; Ghosh, Souvik; Bányai, Krisztián; Kobayashi, Nobumichi; Singh, Raj Kumar

    2017-12-01

    Rotavirus C (RVC), a known etiological agent of diarrheal outbreaks, mainly inflicts swine population globally with sporadic incidence in human, cattle, ferret, mink and dog. To demonstrate the presence of RVC in Indian swine population and characterization of its selected structural (VP6) and non-structural (NSP4 and NSP5) genes. A total of 108 diarrheic samples from different regions of India were used. Isolated RNA was loaded onto polyacrylamide gel to screen for the presence of RVs through the identification of specific electrophoretic genomic migration pattern. To characterize the RVC strains, VP6 gene and NSP4 and NSP5 genes were amplified, sequenced and analyzed. Based on VP6 gene specific diagnostic RT-PCR, the presence of RVC was confirmed in 12.0% (13/108) piglet fecal specimens. The nucleotide sequence analysis of VP6 gene, encoding inner capsid protein, from selected porcine RVC (PoRVC) strains revealed more than 93% homologies to human RVC strains (HuRVC) of Eurasian origin. These strains were distant from hitherto reported PoRVCs and clustered with HuRVCs, owning I2 genotype. However, the two non-structural genes, i.e. NSP4 and NSP5, of these strains were found to be of swine type, signifying a re-assortment event that has occurred in the Indian swine population. The findings indicate the presence of human-like RVC in Indian pigs and division of RVC clade with I2 genotype into further sub-clades. To the best of our knowledge, this appears to be the first report of RVC in Indian swine population. Incidence of human-like RVC VP6 gene in swine supports its subsequent zoonotic prospective.

  1. Community-acquired methicillin-resistant Staphylococcus aureus carrying SCCmec type IV and V isolated from healthy children attending public daycares in northeastern Brazil

    Directory of Open Access Journals (Sweden)

    Suzi P. de Carvalho

    2017-07-01

    Full Text Available Nasal colonization with methicillin-resistant Staphylococcus aureus (MRSA have increasingly been reported in healthy communities. This study aimed to assess the rate of S. aureus in general and MRSA in particular from nasal secretion of children in daycare centers in Vitória da Conquista, Brazil. The isolates were identified based on morphology, biochemical tests and by PCR. Detection of virulence genes, biofilm production, and susceptibility test by disk diffusion agar were performed. MRSA isolates were characterized by spa, SCCmec, and multilocus sequence typing (MLST. S. aureus were recovered from 70 (47.3% of 148 children. Among the 11 MRSA strains (15.7%, two SCCmec types (IV and V were detected. MLST identified four STs related to three clonal complexes (CC: 5, 45, and 398. Four spa types were found circulating in this setting. Resistance of S. aureus isolates to ampicillin, erythromycin, ciprofloxacin, clindamycin, and tetracycline was 80%, 32.8%, 7.1%, 7.1% and 4.3%, respectively. One isolate presented intermediate resistance to vancomycin detected by Etest methodology. All strains were biofilm producers. The virulence genes seb, sec, spa, and pvl were detected in some isolates. This study revealed a high rate of children carrying MRSA among healthy attendees in daycare centers in Vitória da Conquista, Brazil.

  2. Characterization of Antibiotic Resistance Genes from Lactobacillus Isolated from Traditional Dairy Products.

    Science.gov (United States)

    Guo, Huiling; Pan, Lin; Li, Lina; Lu, Jie; Kwok, Laiyu; Menghe, Bilige; Zhang, Heping; Zhang, Wenyi

    2017-03-01

    Lactobacilli are widely used as starter cultures or probiotics in yoghurt, cheese, beer, wine, pickles, preserved food, and silage. They are generally recognized as safe (GRAS). However, recent studies have shown that some lactic acid bacteria (LAB) strains carry antibiotic resistance genes and are resistant to antibiotics. Some of them may even transfer their intrinsic antibiotic resistance genes to other LAB or pathogens via horizontal gene transfer, thus threatening human health. A total of 33 Lactobacillus strains was isolated from fermented milk collected from different areas of China. We analyzed (1) their levels of antibiotic resistance using a standardized dilution method, (2) their antibiotic resistance gene profiles by polymerase chain reaction (PCR) using gene-specific primers, and (3) the transferability of some of the detected resistance markers by a filter mating assay. All Lactobacillus strains were found to be resistant to vancomycin, but susceptible to gentamicin, linezolid, neomycin, erythromycin, and clindamycin. Their susceptibilities to tetracycline, kanamycin, ciprofloxacin, streptomycin, quinupristin/dalfopristin, trimethoprim, ampicillin, rifampicin, and chloramphenicol was different. Results from our PCR analysis revealed 19 vancomycin, 10 ciprofloxacin, and 1 tetracycline-resistant bacteria that carried the van(X), van(E), gyr(A), and tet(M) genes, respectively. Finally, no transferal of the monitored antibiotic resistance genes was observed in the filter mating assay. Taken together, our study generated the antibiotic resistance profiles of some milk-originated lactobacilli isolates and preliminarily assessed their risk of transferring antibiotic gene to other bacteria. The study may provide important data concerning the safe use of LAB. © 2017 Institute of Food Technologists®.

  3. Mechanisms of Streptomycin Resistance: Selection of Mutations in the 16S rRNA Gene Conferring Resistance

    Science.gov (United States)

    Springer, Burkhard; Kidan, Yishak G.; Prammananan, Therdsak; Ellrott, Kerstin; Böttger, Erik C.; Sander, Peter

    2001-01-01

    Chromosomally acquired streptomycin resistance is frequently due to mutations in the gene encoding the ribosomal protein S12, rpsL. The presence of several rRNA operons (rrn) and a single rpsL gene in most bacterial genomes prohibits the isolation of streptomycin-resistant mutants in which resistance is mediated by mutations in the 16S rRNA gene (rrs). Three strains were constructed in this investigation: Mycobacterium smegmatis rrnB, M. smegmatis rpsL3+, and M. smegmatis rrnB rpsL3+. M. smegmatis rrnB carries a single functional rrn operon, i.e., rrnA (comprised of 16S, 23S, and 5S rRNA genes) and a single rpsL+ gene; M. smegmatis rpsL3+ is characterized by the presence of two rrn operons (rrnA and rrnB) and three rpsL+ genes; and M. smegmatis rrnB rpsL3+ carries a single functional rrn operon (rrnA) and three rpsL+ genes. By genetically altering the number of rpsL and rrs alleles in the bacterial genome, mutations in rrs conferring streptomycin resistance could be selected, as revealed by analysis of streptomycin-resistant derivatives of M. smegmatis rrnB rpsL3+. Besides mutations well known to confer streptomycin resistance, novel streptomycin resistance conferring mutations were isolated. Most of the mutations were found to map to a functional pseudoknot structure within the 530 loop region of the 16S rRNA. One of the mutations observed, i.e., 524G→C, severely distorts the interaction between nucleotides 524G and 507C, a Watson-Crick interaction which has been thought to be essential for ribosome function. The use of the single rRNA allelic M. smegmatis strain should help to elucidate the principles of ribosome-drug interactions. PMID:11557484

  4. Identification of novel linear megaplasmids carrying a ß-lactamase gene in neurotoxigenic Clostridium butyricum type E strains.

    Directory of Open Access Journals (Sweden)

    Giovanna Franciosa

    Full Text Available Since the first isolation of type E botulinum toxin-producing Clostridium butyricum from two infant botulism cases in Italy in 1984, this peculiar microorganism has been implicated in different forms of botulism worldwide. By applying particular pulsed-field gel electrophoresis run conditions, we were able to show for the first time that ten neurotoxigenic C. butyricum type E strains originated from Italy and China have linear megaplasmids in their genomes. At least four different megaplasmid sizes were identified among the ten neurotoxigenic C. butyricum type E strains. Each isolate displayed a single sized megaplasmid that was shown to possess a linear structure by ATP-dependent exonuclease digestion. Some of the neurotoxigenic C. butyricum type E strains possessed additional smaller circular plasmids. In order to investigate the genetic content of the newly identified megaplasmids, selected gene probes were designed and used in Southern hybridization experiments. Our results revealed that the type E botulinum neurotoxin gene was chromosome-located in all neurotoxigenic C. butyricum type E strains. Similar results were obtained with the 16S rRNA, the tetracycline tet(P and the lincomycin resistance protein lmrB gene probes. A specific mobA gene probe only hybridized to the smaller plasmids of the Italian C. butyricum type E strains. Of note, a ß-lactamase gene probe hybridized to the megaplasmids of eight neurotoxigenic C. butyricum type E strains, of which seven from clinical sources and the remaining one from a food implicated in foodborne botulism, whereas this ß-lactam antibiotic resistance gene was absent form the megaplasmids of the two soil strains examined. The widespread occurrence among C. butyricum type E strains associated to human disease of linear megaplasmids harboring an antibiotic resistance gene strongly suggests that the megaplasmids could have played an important role in the emergence of C. butyricum type E as a human

  5. The genetics of resistance to powdery mildew in cultivated oats (Avena sativa L.): current status of major genes.

    Science.gov (United States)

    Hsam, Sai L K; Mohler, Volker; Zeller, Friedrich J

    2014-05-01

    The genetics of resistance to powdery mildew caused by Blumeria graminis f. sp. avenae of four cultivated oats was studied using monosomic analysis. Cultivar 'Bruno' carries a gene (Pm6) that shows a recessive mode of inheritance and is located on chromosome 10D. Cultivar 'Jumbo' possesses a dominant resistance gene (Pm1) on chromosome 1C. In cultivar 'Rollo', in addition to the gene Pm3 on chromosome 17A, a second dominant resistance gene (Pm8) was identified and assigned to chromosome 4C. In breeding line APR 122, resistance was conditioned by a dominant resistance gene (Pm7) that was allocated to chromosome 13A. Genetic maps established for resistance genes Pm1, Pm6 and Pm7 employing amplified fragment length polymorphism (AFLP) markers indicated that these genes are independent of each other, supporting the results from monosomic analysis.

  6. Lactose carrier protein of Escherichia coli. Structure and expression of plasmids carrying the Y gene of the lac operon.

    Science.gov (United States)

    Teather, R M; Bramhall, J; Riede, I; Wright, J K; Fürst, M; Aichele, G; Wilhelm, U; Overath, P

    1980-01-01

    The previously described hybrid plasmid pC7 which carries lacI+O+delta(Z)Y+A+ on a 12.3 X 10(6)-Mr DNA fragment [Teather et al. (1978) Mol. Gen. Genet. 159, 239-248] was partially digested with the restriction endonuclease EcoRI under conditions reducing the recognition sequence to d(A-A-T-T) and ligated to the vector pB322. lac Y-carrying inserts of various sized (Mr 1.5-4.7 X 10(6)) were obtained. Hybrid plasmid pTE18 (2300-base-pair insert) carries part of the I (repressor) gene, the promotor-operator region, part of the Z (beta-galactosidase) gene, the Y (lactose carrier) gene and part of the A (transacetylase) gene. Upon induction of pTE18-harbouring strains the Y-gene product is expressed at a nearly constant rate for several generations and accumulates to a level of 12-16% of the total cytoplasmic membrane protein. Integration into the membrane leads to active carrier as judged by binding and transport measurements.

  7. Overexpression of the bacterial ipt gene in developing Arabidopsis seedlins carrying auxin reporters

    Czech Academy of Sciences Publication Activity Database

    Kuderová, Alena; Brzobohatý, Břetislav

    2005-01-01

    Roč. 49, - (2005), S23 [2nd International Symposium Auxins and Cytokinins in Plant Development. 07.07.2005-12.07.2005, Prague] R&D Projects: GA AV ČR(CZ) IAA600380507 Institutional research plan: CEZ:AV0Z50040507 Keywords : ipt gene * auxin Subject RIV: BO - Biophysics

  8. Silencing of SPRY1 Triggers Complete Regression of Rhabdomyosarcoma Tumors Carrying a Mutated RAS Gene

    NARCIS (Netherlands)

    Schaaf, Gerben; Hamdi, Mohamed; Zwijnenburg, Danny; Lakeman, Arjan; Geerts, Dirk; Versteeg, Rogier; Kool, Marcel

    2010-01-01

    RAS oncogenes are among the most frequently mutated genes in human cancer, but effective strategies for therapeutic inhibition of the RAS pathway have been elusive. Sprouty1 (SPRY1) is an upstream antagonist of RAS that is activated by extracellular signal-related kinase (ERK), providing a negative

  9. Differential expression of TIR-like genes embedded in the M1-1 gene cluster in nematode-resistant and -susceptible tomato roots

    NARCIS (Netherlands)

    Seifi Abdolabad, A.R.; Visser, R.G.F.; Bai, Y.

    2011-01-01

    Transport inhibitor 1 (TIR1) is an auxin receptor that plays a pivotal role in auxin signaling. It has been reported that TIR-like genes are present in a gene cluster carrying the Mi-1 gene which confers resistance to nematodes, aphids and whiteflies. Since auxin is involved in the pathogenicity of

  10. Genetic analysis and molecular mapping of resistance gene to Phakopsora pachyrhizi in soybean germplasm SX6907.

    Science.gov (United States)

    Chen, Haifeng; Zhao, Sheng; Yang, Zhonglu; Sha, Aihua; Wan, Qiao; Zhang, Chanjuan; Chen, Limiao; Yuan, Songli; Qiu, Dezhen; Chen, Shuilian; Shan, Zhihui; Zhou, Xin-an

    2015-04-01

    In this study, Rpp6907, a novel resistance gene/allele to Phakopsora pachyrhizi in soybean, was mapped in a 111.9-kb region, including three NBS-LRR type predicted genes, on chromosome 18. Soybean rust caused by Phakopsora pachyrhizi Sydow has been reported in numerous soybean-growing regions worldwide. The development of rust-resistant varieties is the most economical and environmentally safe method to control the disease. The Chinese soybean germplasm SX6907 is resistant to P. pachyrhizi and exhibits immune reaction compared with the known Rpp genes. These characteristics suggest that SX6907 may carry at least one novel Rpp gene/allele. Three F2 populations from the crosses of SX6907 (resistant) and Tianlong 1, Zhongdou40, and Pudou11 (susceptible) were used to map the Rpp gene. Three resistance responses (immune, red-brown, and tan-colored lesion) were observed from the F2 individuals. The segregation follows a ratio of 1(resistance):2(heterozygous):1(susceptible), indicating that the resistance in SX6907 is controlled by a single incomplete dominant gene (designated as Rpp6907). Results showed that Rpp6907 was mapped on soybean chromosome 18 (molecular linkage group G, MLG G) flanked by simple sequence repeat (SSR) markers SSR24 and SSR40 at a distance of 111.9 kb. Among the ten genes marked within this 111.9-kb region between the two markers, three genes (Glyma18g51930, Glyma18g51950, and Glyma18g51960) are nucleotide-binding site and leucine-rich repeat-type genes. These genes may be involved in recognizing the presence of pathogens and ultimately conferring resistance. Based on resistance spectrum analysis and mapping results, we inferred that Rpp6907 is a novel gene different from Rpp1 in PI 200492, PI 561356, PI 587880A, PI 587886, and PI 594538A, or a new Rpp1-b allele.

  11. Molecular basis of resistance to macrolides and other antibiotics in commensal viridans group streptococci and Gemella spp. and transfer of resistance genes to Streptococcus pneumoniae.

    Science.gov (United States)

    Cerdá Zolezzi, Paula; Laplana, Leticia Millán; Calvo, Carmen Rubio; Cepero, Pilar Goñi; Erazo, Melisa Canales; Gómez-Lus, Rafael

    2004-09-01

    We assessed the mechanisms of resistance to macrolide-lincosamide-streptogramin B (MLS(B)) antibiotics and related antibiotics in erythromycin-resistant viridans group streptococci (n = 164) and Gemella spp. (n = 28). The macrolide resistance phenotype was predominant (59.38%); all isolates with this phenotype carried the mef(A) or mef(E) gene, with mef(E) being predominant (95.36%). The erm(B) gene was always detected in strains with constitutive and inducible MLS(B) resistance and was combined with the mef(A/E) gene in 47.44% of isolates. None of the isolates carried the erm(A) subclass erm(TR), erm(A), or erm(C) genes. The mel gene was detected in all but four strains carrying the mef(A/E) gene. The tet(M) gene was found in 86.90% of tetracycline-resistant isolates and was strongly associated with the presence of the erm(B) gene. The cat(pC194) gene was detected in seven chloramphenicol-resistant Streptococcus mitis isolates, and the aph(3')-III gene was detected in four viridans group streptococcal isolates with high-level kanamycin resistance. The intTn gene was found in all isolates with the erm(B), tet(M), aph(3')-III, and cat(pC194) gene. The mef(E) and mel genes were successfully transferred from both groups of bacteria to Streptococcus pneumoniae R6 by transformation. Viridans group streptococci and Gemella spp. seem to be important reservoirs of resistance genes.

  12. Impact of pre-application treatment on municipal sludge composition, soil dynamics of antibiotic resistance genes, and abundance of antibiotic-resistance genes on vegetables at harvest.

    Science.gov (United States)

    Lau, Calvin Ho-Fung; Li, Bing; Zhang, Tong; Tien, Yuan-Ching; Scott, Andrew; Murray, Roger; Sabourin, Lyne; Lapen, David R; Duenk, Peter; Topp, Edward

    2017-06-01

    In many jurisdictions sludge recovered from the sewage treatment process is a valued fertilizer for crop production. Pre-treatment of sewage sludge prior to land application offers the potential to abate enteric microorganisms that carry genes conferring resistance to antibiotics. Pre-treatment practices that accomplish this should have the desirable effect of reducing the risk of contamination of crops or adjacent water with antibiotic resistance genes carried in these materials. In the present study, we obtained municipal sludge that had been subjected to one of five treatments. There were, anaerobic-digestion or aerobic-digestion, in both instances with and without dewatering; and heat-treatment and pelletization. Each of the five types of biosolids was applied to an agricultural field at commercial rates, following which lettuce, carrots and radishes were planted. Based on qPCR, the estimated antibiotic gene loading rates were comparable with each of the five biosolids. However, the gene abundance in soil following application of the pelletized biosolids was anomalously lower than expected. Following application, the abundance of antibiotic resistance genes decreased in a generally coherent fashion, except sul1 which increased in abundance during the growing season in the soil fertilized with pelletized biosolids. Based on qPCR and high throughput sequencing evidence for transfer of antibiotic resistance genes from the biosolids to the vegetables at harvest was weak. Clostridia were more abundant in soils receiving any of the biosolids except the pelletized. Overall, the behavior of antibiotic resistance genes in soils receiving aerobically or anaerobically-digested biosolids was consistent and coherent with previous studies. However, dynamics of antibiotic resistance genes in soils receiving the heat treated pelletized biosolids were very different, and the underlying mechanisms merit investigation. Crown Copyright © 2017. Published by Elsevier B.V. All

  13. Evolution of IncA/C blaCMY-₂-carrying plasmids by acquisition of the blaNDM-₁ carbapenemase gene.

    Science.gov (United States)

    Carattoli, Alessandra; Villa, Laura; Poirel, Laurent; Bonnin, Rémy A; Nordmann, Patrice

    2012-02-01

    The bla(NDM-1) gene has been reported to be often located on broad-host-range plasmids of the IncA/C type in clinical but also environmental bacteria recovered from the New Delhi, India, area. IncA/C-type plasmids are the main vehicles for the spread of the cephalosporinase gene bla(CMY-2), frequently identified in the United States, Canada, and Europe. In this study, we completed the sequence of IncA/C plasmid pNDM-KN carrying the bla(NDM-1) gene, recovered from a Klebsiella pneumoniae isolate from Kenya. This sequence was compared with those of three IncA/C-type reference plasmids from Escherichia coli, Yersinia ruckeri, and Photobacterium damselae. Comparative analysis showed that the bla(NDM-1) gene was located on a widely diffused plasmid scaffold known to be responsible for the spread of bla(CMY-2)-like genes and consequently for resistance to broad-spectrum cephalosporins. Considering that IncA/C plasmids possess a broad host range, this scaffold might support a large-scale diffusion of the bla(NDM-1) gene among Gram-negative rods.

  14. Analysis of Aminoglycoside Modifying Enzyme Genes Responsible for High-Level Aminoglycoside Resistance among Enterococcal Isolates

    Directory of Open Access Journals (Sweden)

    Vishal Shete

    2017-01-01

    Full Text Available Enzymatic modification results in high-level resistance to aminoglycoside (HLAR, which eliminates the synergistic bactericidal effect of combined exposure to a cell wall-active agent and an aminoglycoside. So aim of the study was to determine prevalence of HLAR enterococcal isolate and to study distribution of aminoglycoside modifying enzyme genes in them. A total of 100 nonrepeat isolates of enterococci from various clinical samples were analyzed. As per Clinical and Laboratory Standards Institute guidelines enterococci were screened for HLAR by Kirby-Bauer disc diffusion method. Minimum inhibitory concentration of all isolates for gentamicin and streptomycin was determined by E-test. Multiplex polymerase chain reaction (PCR was carried out for HLAR enterococcal isolates to identify aminoglycoside modifying enzymes genes responsible for resistance. 60% isolates were found to be high-level gentamicin resistant (HLGR whereas 45% isolates were found to be high-level streptomycin resistant (HLSR. By multiplex PCR 80% HLGR isolates carried bifunctional aminoglycoside modifying enzyme gene aac(6′-Ie-aph(2′′-Ia whereas 18 out of 45 high-level streptomycin resistant, that is, 40%, isolates carried aph(3′-IIIa. However, aph(2′′-Ib, aph(2′′-Ic, aph(2′′-Id, and ant(4′-Ia genes which encode other aminoglycosides modifying enzymes were not detected. Bifunctional aminoglycoside modifying enzyme gene aac(6′-Ie-aph(2′′-Ia is the predominant gene responsible for HLAR.

  15. Mapping of stripe rust resistance gene in an Aegilops caudate introgression line in wheat and its genetic association with leaf rust resistance.

    Science.gov (United States)

    Toor, Puneet Inder; Kaur, Satinder; Bansal, Mitaly; Yadav, Bharat; Chhuneja, Parveen

    2016-12-01

    A pair of stripe rust and leaf rust resistance genes was introgressed from Aegilops caudata, a nonprogenitor diploid species with the CC genome, to cultivated wheat. Inheritance and genetic mapping of stripe rust resistance gene in backcrossrecombinant inbred line (BC-RIL) population derived from the cross of a wheat-Ae. caudata introgression line (IL) T291- 2(pau16060) with wheat cv. PBW343 is reported here. Segregation of BC-RILs for stripe rust resistance depicted a single major gene conditioning adult plant resistance (APR) with stripe rust reaction varying from TR-20MS in resistant RILs signifying the presence of some minor genes as well. Genetic association with leaf rust resistance revealed that two genes are located at a recombination distance of 13%. IL T291-2 had earlier been reported to carry introgressions on wheat chromosomes 2D, 3D, 4D, 5D, 6D and 7D. Genetic mapping indicated the introgression of stripe rust resistance gene on wheat chromosome 5DS in the region carrying leaf rust resistance gene LrAc, but as an independent introgression. Simple sequence repeat (SSR) and sequence-tagged site (STS) markers designed from the survey sequence data of 5DS enriched the target region harbouring stripe and leaf rust resistance genes. Stripe rust resistance locus, temporarily designated as YrAc, mapped at the distal most end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. LrAc mapped at a distance of 9.0 cM from the YrAc and at 2.8 cM from RGA-STS marker Ta5DS_2737450, YrAc and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance.

  16. Molecular epidemiology of outbreak-related pseudomonas aeruginosa strains carrying the novel variant blaVIM-17 metallo-beta-lactamase gene.

    Science.gov (United States)

    Siarkou, Victoria I; Vitti, Danai; Protonotariou, Efthimia; Ikonomidis, Alexandros; Sofianou, Danai

    2009-04-01

    A study was designed to investigate the molecular epidemiological characteristics of multidrug-resistant outbreak-related Pseudomonas aeruginosa isolates collected in a university hospital in northern Greece. Of 29 nonreplicate P. aeruginosa isolates resistant to carbapenems and ceftazidime, 14 were positive for metallo-beta-lactamase production. PCR analyses with primers specific for bla(VIM) and bla(IMP) revealed that 13 isolates carried a novel bla(VIM-2) gene variant, designated bla(VIM-17), and only 1 isolate carried bla(VIM-2), a gene predominant among P. aeruginosa strains in Greek hospitals. Pulsed-field gel electrophoresis of XbaI-digested genomic DNAs showed a close genetic relationship for 12 of 13 bla(VIM-17)-carrying outbreak-related isolates, which were of the O11 serotype; the clonally unrelated isolate carrying bla(VIM-17) was of the O12 serotype. PCR mapping strategies for the detection of class 1 integrons and sequencing approaches revealed the presence of integrons containing one bla(VIM) cassette flanked by two aacA29 cassettes. These integrons were similar but not identical to In59 (GenBank accession number AF263519) initially described in France. All isolates carrying bla(VIM-17), regardless of their genetic profile, had an identical integron, named In59.3, indicating that although the hospital outbreak was mainly due to clonal dissemination, the horizontal transmission of the bla(VIM-17)-containing integron among P. aeruginosa isolates should also have occurred. An outbreak-related isolate and a control strain, both of which carried the bla(VIM-2) gene but which were clonally distinct, had an identical integron, named In59.2, which differed only at the level of the bla(VIM) gene from In59.3 integrons, suggesting a common ancestry. The spread of the bla(VIM-17)-containing integron in clonally unrelated P. aeruginosa isolates without any evidence of plasmid carriage is probably associated with a transposon.

  17. Birds Generally Carry a Small Repertoire of Bitter Taste Receptor Genes.

    Science.gov (United States)

    Wang, Kai; Zhao, Huabin

    2015-09-04

    As they belong to the most species-rich class of tetrapod vertebrates, birds have long been believed to possess an inferior taste system. However, the bitter taste is fundamental in birds to recognize dietary toxins (which are typically bitter) in potential food sources. To characterize the evolution of avian bitter taste receptor genes (Tas2rs) and to test whether dietary toxins have shaped the repertoire size of avian Tas2rs, we examined 48 genomes representing all but 3 avian orders. The total number of Tas2r genes was found to range from 1 in the domestic pigeon to 12 in the bar-tailed trogon, with an average of 4, which suggested that a much smaller Tas2r gene repertoire exists in birds than in other vertebrates. Furthermore, we uncovered a positive correlation between the number of putatively functional Tas2rs and the abundance of potential toxins in avian diets. Because plant products contain more toxins than animal tissues and insects release poisonous defensive secretions, we hypothesized that herbivorous and insectivorous birds may demand more functional Tas2rs than carnivorous birds feeding on noninsect animals. Our analyses appear to support this hypothesis and highlight the critical role of taste perception in birds. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China.

    Science.gov (United States)

    Zhao, Yongda; Guo, Lili; Li, Jie; Huang, Xianhui; Fang, Binghu

    2018-01-01

    Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase ( gyrA and gyrB ) and topoisomerase IV ( parC and parE ). The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%), levofloxacin (20.28%), norfloxacin (22.38%), ciprofloxacin (23.78%), however, high resistance levels were found to nalidixic acid (82.52%) and enrofloxacin (55.94%). In addition, we found 14 antimicrobial resistance genes were present in these isolates, including bla TEM-1 , bla ROB-1 , ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3')-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes ( tetB, tetC, flor, rmtB, sul1 ). The genes tetB , rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G) were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target gene mutations. These data provide novel

  19. High blood pressure in transgenic mice carrying the rat angiotensinogen gene.

    Science.gov (United States)

    Kimura, S; Mullins, J J; Bunnemann, B; Metzger, R; Hilgenfeldt, U; Zimmermann, F; Jacob, H; Fuxe, K; Ganten, D; Kaling, M

    1992-01-01

    Transgenic mice were generated by injecting the entire rat angiotensinogen gene into the germline of NMRI mice. The resulting transgenic animals were characterized with respect to hemodynamics, parameters of the renin angiotension system, and expression of the transgene. The transgenic line TGM(rAOGEN)123 developed hypertension with a mean arterial blood pressure of 158 mmHg in males and 132 mmHg in females. In contrast, the transgenic line TGM(rAOGEN)92 was not hypertensive. Rat angiotensinogen was detectable only in plasma of animals of line 123. Total plasma angiotensinogen and plasma angiotensin II concentrations were about three times as high as those of negative control mice. In TGM(rAOGEN)123 the transgene was highly expressed in liver and brain. Transcripts were also detected in heart, kidney and testis. In TGM(rAOGEN)92 the brain was the main expressing organ. In situ hybridization revealed an mRNA distribution in the brain of TGM(rAOGEN)123 similar to the one in rat. In TGM(rAOGEN)92 the expression pattern in the brain was aberrant. These data indicate that overexpression of the angiotensinogen gene in liver and brain leads to the development of hypertension in transgenic mice. The TGM(rAOGEN)123 constitutes a high angiotensin II type of hypertension and may provide a new experimental animal model to study the kinetics and function of the renin angiotensin system. Images PMID:1547785

  20. Genomic characterization of a large plasmid containing a blaNDM-1gene carried on Salmonella enterica serovar Indiana C629 isolate from China.

    Science.gov (United States)

    Wang, Wei; Baloch, Zulqarnain; Peng, Zixin; Hu, Yujie; Xu, Jin; Fanning, Séamus; Li, Fengqin

    2017-07-07

    The bla NDM-1 gene in Salmonella species is mostly reported in clinical cases, but is rarely isolated from red and white meat in China. A Salmonella Indiana (S. Indiana) isolate was cultured from a chicken carcass procured from a slaughterhouse in China. Antimicrobial susceptibility was tested against a panel of agents. Whole-genome sequencing of the isolate was carried out and data was analyzed. A large plasmid, denoted as plasmid pC629 (210,106 bp), containing a composite cassette, consisting of IS26-bla NDM-1 -ble MBL -△trpF-tat-cutA-ISCR1-sul1-qacE△1-aadA2-dfrA12-intI1-IS26 was identified. The latter locus was physically linked with bla OXA-1 , bla CTX-M-65 , bla TEM-1 -encoding genes. A mercury resistance operon merACDEPTR was also identified; it was flanked on the proximal side, among IS26 element and the distally located on the bla NDM-1 gene. Plasmid pC629 also contained 21 other antimicrobial resistance-encoding genes, such as aac(6')-Ib-cr, aac(3)-VI, aadA5, aph(4)-Ia, arr-3, blmS, brp, catB3, dfrA17, floR, fosA, mph(A), mphR, mrx, nimC/nimA, oqxA, oqxB, oqxR, rmtB, sul1, sul2. Two virulence genes were also identified on plasmid pC629. To the best of our knowledge, this is the first report of bla NDM-1 gene being identified from a plasmid in a S. Indiana isolate cultured from chicken carcass in China.

  1. Generation of KCL025 research grade human embryonic stem cell line carrying a mutation in NF1 gene

    Directory of Open Access Journals (Sweden)

    Heema Hewitson

    2016-03-01

    Full Text Available The KCL025 human embryonic stem cell line was derived from an embryo donated for research that carried an autosomal dominant mutation in the NF1 gene encoding neurofibromin (c.3739–3742 ΔTTTG. Mutations in this gene have been linked to neurofibromatosis type 1, juvenile myelomonocytic leukemia and Watson syndrome. The ICM was isolated using laser microsurgery and plated on γ-irradiated human foreskin fibroblasts. Both the derivation and cell line propagation were performed in an animal product-free environment. Pluripotent state and differentiation potential were confirmed by in vitro assays.

  2. Gene-carried hepatoma targeting complex induced high gene transfection efficiency with low toxicity and significant antitumor activity

    Directory of Open Access Journals (Sweden)

    Zhao QQ

    2012-06-01

    Full Text Available Qing-Qing Zhao,1,2 Yu-Lan Hu,1 Yang Zhou,3 Ni Li,1 Min Han,1 Gu-Ping Tang,4 Feng Qiu,2 Yasuhiko Tabata,5 Jian-Qing Gao,11Institute of Pharmaceutics, Zhejiang University, Hangzhou, China; 2Department of Pharmacy, The First Affiliated Hospital of Chongqing Medical University, Chongqing, China; 3Institute of Biochemistry, Iowa State University, Ames, IA, USA; 4Institute of Chemical Biology and Pharmaceutical Chemistry, Zhejiang University, Hangzhou, China; 5Institute for Frontier Medical Sciences, Kyoto University, Kyoto, JapanBackground: The success of gene transfection is largely dependent on the development of a vehicle or vector that can efficiently deliver a gene to cells with minimal toxicity.Methods: A liver cancer-targeted specific peptide (FQHPSF sequence was successfully synthesized and linked with chitosan-linked polyethylenimine (CP to form a new targeted gene delivery vector called CPT (CP/peptide. The structure of CPT was confirmed by 1H nuclear magnetic resonance spectroscopy and ultraviolet spectrophotometry. The particle size of CPT/DNA complexes was measured using laser diffraction spectrometry and the cytotoxicity of the copolymer was evaluated by methylthiazol tetrazolium method. The transfection efficiency evaluation of the CP copolymer was performed using luciferase activity assay. Cellular internalization of the CP/DNA complex was observed under confocal laser scanning microscopy. The targeting specificity of the polymer coupled to peptide was measured by competitive inhibition transfection study. The liver targeting specificity of the CPT copolymer in vivo was demonstrated by combining the copolymer with a therapeutic gene, interleukin-12, and assessed by its abilities in suppressing the growth of ascites tumor in mouse model.Results: The results showed that the liver cancer-targeted specific peptide was successfully synthesized and linked with CP to form a new targeted gene delivery vector called CPT. The composition of CPT

  3. Characterization of plasmids carrying the blaOXA-24/40 carbapenemase gene and the genes encoding the AbkA/AbkB proteins of a toxin/antitoxin system.

    Science.gov (United States)

    Mosqueda, Noraida; Gato, Eva; Roca, Ignasi; López, María; de Alegría, Carlos Ruíz; Fernández Cuenca, Felipe; Martínez-Martínez, Luis; Pachón, Jerónimo; Cisneros, José Miguel; Rodríguez-Baño, Jesús; Pascual, Alvaro; Vila, Jordi; Bou, Germán; Tomás, María

    2014-10-01

    Carbapenem-resistant Acinetobacter baumannii (CRAb) is a major source of nosocomial infections in Spain associated with the production of OXA-58-like or OXA-24/40-like β-lactamase enzymes. We analysed the plasmids carrying the bla(OXA-24/40)-like gene in CRAb isolates obtained a decade apart. The presence of β-lactamases was screened for by PCR (metallo-β-lactamases, carbapenem-hydrolysing class D β-lactamases, GES and KPC) in 101 CRAb isolates obtained in two multicentre studies (GEIH/REIPI-Ab-2000 and GEIH/REIPI-Ab-2010; n = 493 Acinetobacter spp). We analysed the distribution and characterization of the plasmids carrying the bla(OXA-24/40)-like gene and sequenced two plasmids, AbATCC223p (2000) and AbATCC329p (2010) from A. baumannii ATCC 17978 transformants. Acquisition of the bla(OXA-24/40)-like gene was the main mechanism underlying resistance to carbapenems (48.7% in 2000 compared with 51.6% in 2010). This gene was mainly isolated in ST2 A. baumannii strains in both studies, although some novel STs (ST79 and ST80) appeared in 2010. The gene was located in plasmids (8-12 kbp) associated with the repAci2 or repAci2/repGR12 types. The sequences of AbATCC223p (8840 bp) and AbATCC329p (8842 bp) plasmids were similar, particularly regarding the presence of the genes encoding the AbkA/AbkB proteins associated with the toxin/antitoxin system. Moreover, the abkA/abkB gene sequences (>96% identity) were also located in plasmids harbouring the bla(OXA-58)-like gene. The action of OXA-24/40 and OXA-58 β-lactamase-like enzymes represents the main mechanism underlying resistance to carbapenems in Spain in the last decade. AbkA/AbkB proteins in the toxin/antitoxin system may be involved in the successful dissemination of plasmids carrying the bla(OXA-24/40)-like gene, and probably also the bla(OXA-58)-like gene, thus contributing to the plasmid stability. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial

  4. [Establishment of 5 resistant ovarian cancer cell strains and expression of resistance-related genes].

    Science.gov (United States)

    Luan, Ying-zi; Li, Li; Li, Dang-rong; Zhang, Wei; Tang, Bu-jian

    2004-06-01

    To investigate expression difference of several drug resistance related genes between sensitive and resistant ovarian carcinoma cells. Cell lines resistant to cisplatin, carboplatin and taxol were established from ovarian carcinoma cell lines of SKOV3 and A2780, and their biological features were detected. The expressions of several genes related to drug resistance were measured by RT-PCR method. (1) The values of resistance index (RI) of resistant cells to relevant drugs were elevated 3 times or more, with different degrees of cross-resistance to several other drugs (RI 2 approximately 20). They grew more slowly than primary cells (Td elongated 1.4 approximately 2.4 times, P 0.05). Intracellular concentrations of relevant drugs were reduced 2.0 approximately 8.5 times in resistant cells (P p53, lung resistance protein-1 (LRP-1), multiple drug resistance related protein-1 (MRP-1) genes were expressed at lower levels in resistant cells than in sensitive cells; while protein kinase C (PKC), topoisomerase (topo) I, and topo II beta were expressed higher, no obvious alterations were found concerning glutathione S transferase-pi (GST-pi), and topo II alpha. Expression of multiple drug resistance-1 (MDR-1) gene was either elevated or reduced in different cells. The expressions of resistance related genes were widely different in different kinds of resistant cells, suggesting more than one pathway leading to resistance transformation. This adds more difficulties for clinical management.

  5. Generation of KCL035 research grade human embryonic stem cell line carrying a mutation in HBB gene

    Directory of Open Access Journals (Sweden)

    Heema Hewitson

    2016-03-01

    Full Text Available The KCL035 human embryonic stem cell line was derived from an embryo donated for research that carried a mutation in the HBB gene, which is linked to the β-thalassemia syndrome. The ICM was isolated using laser microsurgery and plated on γ-irradiated human foreskin fibroblasts. Both the derivation and cell line propagation were performed in an animal product-free environment. Pluripotent state and differentiation potential were confirmed by in vitro assays.

  6. High Level Aminoglycoside Resistance and Distribution of Aminoglycoside Resistant Genes among Clinical Isolates of Enterococcus Species in Chennai, India

    Directory of Open Access Journals (Sweden)

    Elango Padmasini

    2014-01-01

    Full Text Available Enterococci are nosocomial pathogen with multiple-drug resistance by intrinsic and extrinsic mechanisms. Aminoglycosides along with cell wall inhibitors are given clinically for treating enterococcal infections. 178 enterococcal isolates were analyzed in this study. E. faecalis is identified to be the predominant Enterococcus species, along with E. faecium, E. avium, E. hirae, E. durans, E. dispar and E. gallinarum. High level aminoglycoside resistance (HLAR by MIC for gentamicin (GM, streptomycin (SM and both (GM + SM antibiotics was found to be 42.7%, 29.8%, and 21.9%, respectively. Detection of aminoglycoside modifying enzyme encoding genes (AME in enterococci was identified by multiplex PCR for aac(6′-Ie-aph(2′′-Ia; aph(2′′-Ib; aph(2′′-Ic; aph(2′′-Id and aph(3′-IIIa genes. 38.2% isolates carried aac(6′-Ie-aph(2′′-Ia gene and 40.4% isolates carried aph(3′-IIIa gene. aph(2′′-Ib; aph(2′′-Ic; aph(2′′-Id were not detected among our study isolates. aac(6′-Ie-aph(2′′-Ia and aph(3′-IIIa genes were also observed in HLAR E. durans, E. avium, E. hirae, and E. gallinarum isolates. This indicates that high level aminoglycoside resistance genes are widely disseminated among isolates of enterococci from Chennai.

  7. Efficacy of a DNA vaccine carrying Eimeria maxima Gam56 antigen gene against coccidiosis in chickens.

    Science.gov (United States)

    Xu, Jinjun; Zhang, Yan; Tao, Jianping

    2013-04-01

    To control coccidiosis without using prophylactic medications, a DNA vaccine targeting the gametophyte antigen Gam56 from Eimeria maxima in chickens was constructed, and the immunogenicity and protective effects were evaluated. The ORF of Gam56 gene was cloned into an eukaryotic expression vector pcDNA3.1(zeo)+. Expression of Gam56 protein in COS-7 cells transfected with recombinant plasmid pcDNA-Gam56 was confirmed by indirect immunofluorescence assay. The DNA vaccine was injected intramuscularly to yellow feathered broilers of 1-week old at 3 dosages (25, 50, and 100 µg/chick). Injection was repeated once 1 week later. One week after the second injection, birds were challenged orally with 5×10(4) sporulated oocysts of E. maxima, then weighed and killed at day 8 post challenge. Blood samples were collected and examined for specific peripheral blood lymphocyte proliferation activity and serum antibody levels. Compared with control groups, the administration of pcDNA-Gam56 vaccine markedly increased the lymphocyte proliferation activity (Pcoccidiosis control.

  8. Indigo production by Escherichia coli carrying the phenol hydroxylase gene from Acinetobacter sp strain ST-550 in a water-organic solvent two-phase system.

    Science.gov (United States)

    Doukyu, N; Toyoda, K; Aono, R

    2003-02-01

    Acinetobacter sp. strain ST-550 produces indigo from indole in the presence of a large volume of diphenylmethane and a high level of indole. Particular proteins increased remarkably in strain ST-550 grown in the two-phase culture system for indigo production. One of the proteins showed a N-terminal amino acid sequence that was identical to that of the largest subunit of phenol hydroxylase (MopN) from A. calcoaceticus NCBI8250. The indigo-producing activity was strongly induced when ST-550 was grown with phenol as a sole carbon source. Genes coding for the multicomponent phenol hydroxylase were cloned, based on the homology with mopKLMOP from A. calcoaceticus NCBI8250. Escherichia coli carrying the genes produced indigo from indole. E. coli JA300 and its cyclohexane-resistant mutant, OST3410, carrying the hydroxylase genes and the NADH regeneration system were grown in the two-phase culture system for indigo production. The OST3410 recombinant produced 52 microg indigo ml(-1) of medium in the presence of diphenylmethane. This productivity was 4.3-fold higher than that of the JA300 recombinant.

  9. Microarray-based Detection of Antibiotic Resisteance Genes in Salmonella

    NARCIS (Netherlands)

    Hoek, van A.H.A.M.; Aarts, H.J.M.

    2008-01-01

    In the presented study, 143 Salmonella isolates belonging to 26 different serovars were screened for the presence of antibiotic resistance genes by microarray analysis. The microarray contained a total of 223 oligonucleotides representing genes encoding for resistance to the following antibiotic

  10. Gene interactions and genetics of blast resistance and yield ...

    Indian Academy of Sciences (India)

    2016-08-26

    Oryza sativa L.) ... four blast resistance genes Pi1, Pi2, Pi33 and Pi54 in combination were used to study the nature and magnitude of gene action for disease resistance and yield attributes. ... Please take note of this change.

  11. Molecular detection of disease resistance genes to powdery mildew ...

    African Journals Online (AJOL)

    A study was conducted to detect the presence of disease resistance genes to infection of wheat powdery mildew (Blumeria graminis f. sp. tritici) in selected wheat cultivars from China using molecular markers. Genomic DNA of sixty cultivars was extracted and tested for the presence of selected prominent resistance genes to ...

  12. Codon-optimized antibiotic resistance gene improves efficiency of ...

    Indian Academy of Sciences (India)

    Success rate of transient transformation and cell growth in selective culture were significantly increased by use of fgmR instead of a native gentamicin resistance gene, suggesting that codon optimization improved translation efficiency of the marker gene and increased antibiotic resistance. Our result shows that similarity in ...

  13. Genome scanning for identification of resistance gene analogs (RGAs)

    African Journals Online (AJOL)

    Disease resistance in plants is a desirable economic trait. Many disease resistance genes from various plants have been cloned so far. The gene products of some of these can be distinguished by the presence of an N terminal nucleotide binding site and a C-terminal stretch of leucine-rich repeats. Oligonucleotides already ...

  14. PCR Screening of Antibiotic Resistance Genes in Faecal Samples from Australian and Chinese Children.

    Science.gov (United States)

    Ravensdale, Joshua T; Xian, Darren Ten Wei; Wei, Chooi Ming; Lv, Quanjun; Wen, Xiajian; Guo, Jing; Coorey, Ranil; LeSouëf, Peter; Lu, Fengmin; Zhang, Brad; Dykes, Gary A

    2018-03-31

    Recent public awareness campaigns on the risk of antibiotic resistance in pathogenic microbes has placed pressure on governments to enforce stricter antimicrobial stewardship policies on the hospital and agricultural industry. This study aimed to screen faecal samples from Australian and Chinese children for the presence of antibiotic resistance genes to identify demographics at risk of carriage of these genes and examine antimicrobial stewardship policies from the two countries which may influence carriage. Faecal samples from 46 Australian and 53 Chinese children were screened for the presence of six clinically relevant antibiotic resistance genes using PCR. Clinical and demographic data was also collected from each patient. Over 90% of faecal samples from Chinese children tested positive for β-lactam, macrolide, tetracycline, and aminoglycoside resistance genes, which was substantially higher than Australian samples. Besides country of origin, no clear trend could be seen to predict carriage of resistance genes. The exception to this was Chinese born children who immigrated to Australia having higher rates of carriage for bla TEM and tetM genes than children born and still living in Australia. These data indicated that Chinese children were more likely to carry certain antibiotic resistance genes than Australian children. The Chinese government has recently implemented strict policies to control the overuse of antibiotics in hospitals. However, many of these policies do not extend to the agricultural industry which could explain the differences seen in this study. Copyright © 2018. Published by Elsevier Ltd.

  15. [A recombinant adenovirus vector carrying murine interleukin-21 gene controls chronic HBV infection in mice].

    Science.gov (United States)

    Gao, Xue-Ping; Zhou, Yang; Zheng, Xin-Chun; Yi, Xuan; Tang, Li-Bo; Hou, Jin-Lin; Li, Yong-Yin

    2017-11-20

    To investigate the effect of an adenovirus vector containing murine interleukin-21 gene (Ad-GFP-mIL-21) in virus clearance and on the production of HBV-specific antibodies in mice with persistent HBV infection. ELISA and Western blot analysis were used to detect the expression of mIL-21 in the supernatant and cytoplasm of cultured HepG2.2.15 cells after infection by Ad-GFP-mIL-21. Mouse models of chronic HBV infection established by in vivo transduction with rAAV8-1.3HBV were divided into 3 groups for treatment 12 weeks later with injection of Ad-GFP-mIL-21, GFP recombinant adenovirus or PBS via the tail vein. Serum levels of HBsAg, HBsAb, HBcAb, and mIL-21 in the mice were detected using ELISA, and the expression of Ad-GFP-mIL-21 in the organs was observed by fluorescent microscopy at different time points after the injection. Ad-GFP-mIL-21 was capable of infecting HepG2.2.15 cells in vitro, and the levels of mIL-21 in the supernatant were correlated with the titers of adenovirus administered and the infection time. In the mice with persistent HBV infection, green fluorescence expression was observed almost exclusively in the liver on day 4 after injection of Ad-GFP-mIL21, and serum levels of IL-21 increased significantly compared with the level before treatment (PHBcAb was detected in the mice with Ad-GFP-mIL21 injection (PHBcAb production, suggesting its efficacy in controlling chronic HBV infection.

  16. A novel Capsicum gene inhibits host-specific disease resistance to Phytophthora capsici.

    Science.gov (United States)

    Reeves, Gregory; Monroy-Barbosa, Ariadna; Bosland, Paul W

    2013-05-01

    A novel disease resistance inhibitor gene (inhibitor of P. capsici resistance [Ipcr]), found in the chile pepper (Capsicum annuum) variety 'New Mexico Capsicum Accession 10399' (NMCA10399), inhibits resistance to Phytophthora capsici but not to other species of Phytophthora. When a highly P. capsici-resistant variety was hybridized with NMCA10399, the resultant F1 populations, when screened, were completely susceptible to P. capsici for root rot and foliar blight disease syndromes, despite the dominance inheritance of P. capsici resistance in chile pepper. The F2 population displayed a 3:13 resistant-to-susceptible (R:S) ratio. The testcross population displayed a 1:1 R:S ratio, and a backcross population to NMCA10399 displayed complete susceptibility. These results demonstrate the presence of a single dominant inhibitor gene affecting P. capsici resistance in chile pepper. Moreover, when lines carrying the Ipcr gene were challenged against six Phytophthora spp., the nonhost resistance was not overcome. Therefore, the Ipcr gene is interfering with host-specific resistance but not the pathogen- or microbe-associated molecular pattern nonhost responses.

  17. New resistance genes in the Zea mays: exserohilum turcicum pathosystem

    Directory of Open Access Journals (Sweden)

    Juliana Bernardi Ogliari

    2005-09-01

    Full Text Available The use of monogenic race-specific resistance is widespread for the control of maize (Zea mays L. helminthosporiosis caused by Exserohilum turcicum. Inoculation of 18 Brazilian isolates of E. turcicum onto elite maize lines containing previously identified resistance genes and onto differential near-isogenic lines allowed the identification of new qualitative resistance genes. The inoculation of one selected isolate on differential near-isogenic lines, F1 generations and a BC1F1 population from the referred elite lines enabled the characterization of the resistance spectrum of three new genes, one dominant (HtP, one recessive (rt and a third with non-identified genetic action. Three physiological races of the pathogen were also identified including two with new virulence factors capable of overcoming the resistance of one of the resistance genes identified here (rt.

  18. Occurrence of integrons and resistance genes among sulphonamide-resistant Shigella spp. from Brazil

    DEFF Research Database (Denmark)

    Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller

    2005-01-01

    Objectives: To determine the occurrence of class 1 and 2 integrons and antimicrobial resistance genes among sulphonamide-resistant Shigella strains isolated in Brazil during 1999-2003. Methods: Sixty-two Shigella (Shigella flexneri, n = 47 and Shigella sonnei, n = 15) were tested against 21....... Conclusions: The detection of class 1 and 2 integrons and additional antimicrobial resistance genes allowed us to identify the most frequent antimicrobial resistance patterns of Shigella spp. isolated in Brazil....

  19. Barley Stem Rust Resistance Genes: Structure and Function

    Directory of Open Access Journals (Sweden)

    Andris Kleinhofs

    2009-07-01

    Full Text Available Rusts are biotrophic pathogens that attack many plant species but are particularly destructive on cereal crops. The stem rusts (caused by have historically caused severe crop losses and continue to threaten production today. Barley ( L. breeders have controlled major stem rust epidemics since the 1940s with a single durable resistance gene . As new epidemics have threatened, additional resistance genes were identified to counter new rust races, such as the complex locus against races QCCJ and TTKSK. To understand how these genes work, we initiated research to clone and characterize them. The gene encodes a unique protein kinase with dual kinase domains, an active kinase, and a pseudokinase. Function of both domains is essential to confer resistance. The and genes are closely linked and function coordinately to confer resistance to several wheat ( L. stem rust races, including the race TTKSK (also called Ug99 that threatens the world's barley and wheat crops. The gene encodes typical resistance gene domains NBS, LRR, and protein kinase but is unique in that all three domains reside in a single gene, a previously unknown structure among plant disease resistance genes. The gene encodes an actin depolymerizing factor that functions in cytoskeleton rearrangement.

  20. Transfer of tetracycline resistance gene (tetr) between replicons in ...

    African Journals Online (AJOL)

    Antimicrobial susceptibility testing among the isolates showed resistance to amoxicillin (92%), amoxicillin-clavulanic acid (84.4%), tetracycline (71.4%), gentamycin (43.5%), nalidixic acid (38.3%) and nitrofurantoin (7.9%). E. coli showed the highest resistance to most of the antibiotics. Tetracycline resistance gene was ...

  1. Complex Interactions between Fungal Avirulence Genes and Their Corresponding Plant Resistance Genes and Consequences for Disease Resistance Management

    Directory of Open Access Journals (Sweden)

    Yohann Petit-Houdenot

    2017-06-01

    Full Text Available During infection, pathogens secrete an arsenal of molecules, collectively called effectors, key elements of pathogenesis which modulate innate immunity of the plant and facilitate infection. Some of these effectors can be recognized directly or indirectly by resistance (R proteins from the plant and are then called avirulence (AVR proteins. This recognition usually triggers defense responses including the hypersensitive response and results in resistance of the plant. R—AVR gene interactions are frequently exploited in the field to control diseases. Recently, the availability of fungal genomes has accelerated the identification of AVR genes in plant pathogenic fungi, including in fungi infecting agronomically important crops. While single AVR genes recognized by their corresponding R gene were identified, more and more complex interactions between AVR and R genes are reported (e.g., AVR genes recognized by several R genes, R genes recognizing several AVR genes in distinct organisms, one AVR gene suppressing recognition of another AVR gene by its corresponding R gene, two cooperating R genes both necessary to recognize an AVR gene. These complex interactions were particularly reported in pathosystems showing a long co-evolution with their host plant but could also result from the way agronomic crops were obtained and improved (e.g., through interspecific hybridization or introgression of resistance genes from wild related species into cultivated crops. In this review, we describe some complex R—AVR interactions between plants and fungi that were recently reported and discuss their implications for AVR gene evolution and R gene management.

  2. Antimicrobial Resistance Genes in Pigeons from Public Parks in Costa Rica.

    Science.gov (United States)

    Blanco-Peña, K; Esperón, F; Torres-Mejía, A M; de la Torre, A; de la Cruz, E; Jiménez-Soto, M

    2017-11-01

    Antimicrobial resistance is known to be an emerging problem, but the extent of the issue remains incomplete. The aim of this study was to determine the presence or absence of nine resistance genes (bla TEM , catI, mecA, qnrS, sulI, sulII, tet(A), tet(Q), vanA) in the faeces of 141 pigeons from four urban parks in Alajuela, Guadalupe, Tres Ríos and San José in Costa Rica. The genes were identified by real-time PCR directly from enema samples. About 30% of the samples were positive for genes catI and sulI; between 13% and 17% were positive for qnrS, sulII, tet(A) and tet(Q); and 4% were positive for bla TEM . The mecA and vanA genes were not detected. The average of antimicrobial resistance genes detected per pigeon was 2. Eight different patterns of resistance were identified, without differences in the sampling areas, being the most common pattern 2 (sulII positive samples). During rainy season, the genes more frequently found were sulI and tet(A). In conclusion, the urban inhabiting pigeons tested are currently carrying antimicrobial resistance genes, potentially acting as reservoirs of resistant bacteria and vectors to humans. To the authors' knowledge, this is the first study carried out on direct detection of resistance genes in the digestive metagenomes of pigeons. © 2017 The Authors. Zoonoses and Public Health Published by Blackwell Verlag GmbH.

  3. Mapping of stripe rust resistance gene in an Aegilops caudata ...

    Indian Academy of Sciences (India)

    PUNEET INDER TOOR

    end of 5DS linked with a group of four colocated SSRs and two resistance gene analogue (RGA)-STS markers at a distance of 5.3 cM. ... and LrAc appear to be the candidate genes for marker-assisted enrichment of the wheat gene pool for rust resistance. [Toor P. I., Kaur S., Bansal ..... stocks with reduced alien chromatin.

  4. Co-occurrence of resistance genes to antibiotics, biocides and metals reveals novel insights into their co-selection potential.

    Science.gov (United States)

    Pal, Chandan; Bengtsson-Palme, Johan; Kristiansson, Erik; Larsson, D G Joakim

    2015-11-17

    Antibacterial biocides and metals can co-select for antibiotic resistance when bacteria harbour resistance or tolerance genes towards both types of compounds. Despite numerous case studies, systematic and quantitative data on co-occurrence of such genes on plasmids and chromosomes is lacking, as is knowledge on environments and bacterial taxa that tend to carry resistance genes to such compounds. This effectively prevents identification of risk scenarios. Therefore, we aimed to identify general patterns for which biocide/metal resistance genes (BMRGs) and antibiotic resistance genes (ARGs) that tend to occur together. We also aimed to quantify co-occurrence of resistance genes in different environments and taxa, and investigate to what extent plasmids carrying both types of genes are conjugative and/or are carrying toxin-antitoxin systems. Co-occurrence patterns of resistance genes were derived from publicly available, fully sequenced bacterial genomes (n = 2522) and plasmids (n = 4582). The only BMRGs commonly co-occurring with ARGs on plasmids were mercury resistance genes and the qacE∆1 gene that provides low-level resistance to quaternary ammonium compounds. Novel connections between cadmium/zinc and macrolide/aminoglycoside resistance genes were also uncovered. Several clinically important bacterial taxa were particularly prone to carry both BMRGs and ARGs. Bacteria carrying BMRGs more often carried ARGs compared to bacteria without (p bacterial genomes, and co-occurred with ARGs in 17 % of the cases. In contrast, co-occurrences of BMRGs and ARGs were rare on plasmids from all external environments (resistance genes. This is the first large-scale identification of compounds, taxa and environments of particular concern for co-selection of resistance against antibiotics, biocides and metals. Genetic co-occurrences suggest that plasmids provide limited opportunities for biocides and metals to promote horizontal transfer of antibiotic resistance through co

  5. Structure of the neutral capsular polysaccharide of Acinetobacter baumannii NIPH146 that carries the KL37 capsule gene cluster.

    Science.gov (United States)

    Arbatsky, Nikolay P; Shneider, Mikhail M; Kenyon, Johanna J; Shashkov, Alexander S; Popova, Anastasiya V; Miroshnikov, Konstantin A; Volozhantsev, Nikolay V; Knirel, Yuriy A

    2015-09-02

    Capsular polysaccharide (CPS) was isolated from Acinetobacter baumannii NIPH146, and the following structure of branched pentasaccharide repeating unit was established by sugar analyses along with 1D and 2D NMR spectroscopy: In comparison to most other known capsular polysaccharides of A. baumannii, the CPS studied is neutral and lacks any specific monosaccharide component. The synthesis, assembly and export of this structure could be attributed to genes in a novel capsule biosynthesis gene cluster, designated KL37, which was found in the NIPH146 genome. The CPS of A. baumannii NIPH146 shares the α-d-Galp-(1→6)-β-d-Glcp-(1→3)-d-GalpNAc-(1→ trisaccharide fragment with the CPS units of several A. baumannii strains, including ATCC 17978 and LUH 5537 that carry the KL3 and KL22 gene clusters, respectively. KL37 contains two genes for glycosyltransferases that are related to two glycosyltransferase genes present in both KL3 and KL22, and the encoded proteins could be tentatively assigned to linkages between sugars in the CPS repeat. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Presence of the optrA Gene in Methicillin-Resistant Staphylococcus sciuri of Porcine Origin.

    Science.gov (United States)

    Fan, Run; Li, Dexi; Wang, Yang; He, Tao; Feßler, Andrea T; Schwarz, Stefan; Wu, Congming

    2016-12-01

    A total of 57 methicillin-resistant Staphylococcus aureus (MRSA) isolates and 475 methicillin-resistant coagulase-negative staphylococci (MRCoNS) collected from pigs in the Guangdong province of China in 2014 were investigated for the presence of the novel oxazolidinone-phenicol resistance gene optrA The optrA gene was detected in 6.9% (n = 33) of the MRCoNS, all of which were Staphylococcus sciuri isolates, but in none of the MRSA isolates. Five optrA-carrying methicillin-resistant (MR) S. sciuri isolates also harbored the multiresistance gene cfr Pulsed-field gel electrophoresis (PFGE) and dru typing of the 33 optrA-carrying MR S. sciuri isolates revealed 25 patterns and 5 sequence types, respectively. S1 nuclease PFGE and Southern blotting confirmed that optrA was located in the chromosomal DNAs of 29 isolates, including 1 cfr-positive isolate. The remaining four isolates harbored a ∼35-kb pWo28-3-like plasmid on which optrA and cfr were located together with other resistance genes, as confirmed by sequence analysis. Six different types of genetic environments (types I to VI) of the chromosome-borne optrA genes were identified; these types had the optrA gene and its transcriptional regulator araC in common. Tn558 was found to be associated with araC-optrA in types II to VI. The optrA gene in types II and III was found in close proximity to the ccr gene complex of the respective staphylococcal cassette chromosome mec element (SCCmec). Since oxazolidinones are last-resort antimicrobial agents for the control of serious infections caused by methicillin-resistant staphylococci in humans, the location of the optrA gene close to the ccr complex is an alarming observation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  7. fexA, a Novel Staphylococcus lentus Gene Encoding Resistance to Florfenicol and Chloramphenicol

    OpenAIRE

    Kehrenberg, Corinna; Schwarz, Stefan

    2004-01-01

    The Staphylococcus lentus plasmid pSCFS2 carries a novel florfenicol-chloramphenicol resistance gene, designated fexA, encoding a protein of 475 amino acids with 14 transmembrane domains. The FexA protein differs from all previously known proteins involved in the efflux of chloramphenicol and florfenicol. Induction of fexA expression by chloramphenicol and florfenicol occurs via translational attenuation.

  8. The Brassicaceae family displays divergent, shoot-skewed NLR resistance gene expression

    DEFF Research Database (Denmark)

    Munch, David; Gupta, Vikas; Bachmann, Asger

    2018-01-01

    Nucleotide-binding site leucine-rich repeat resistance genes (NLRs) allow plants to detect microbial effectors. We hypothesized that NLR expression patterns could reflect organ-specific differences in effector challenge and tested this by carrying out a meta-analysis of expression data for 1,235 ...

  9. The anti-tumour effect of a DNA vaccine carrying a fusion gene of human VEGFR2 and IL-12

    Directory of Open Access Journals (Sweden)

    Sha Wen

    2016-09-01

    Full Text Available Because of tumour dependence on angiogenesis, anti-angiogenic therapy has become the most attractive area of basic and clinical study in the field of cancer research. In order to create a synergistic effect on angiogenesis and immune regulation, we designed and constructed a new type of DNA vaccine that can express VEGFR2 (vascular endothelial growth factor receptor 2 and the prostate cancer antigen IL-12 (interleukin 12 in the same reading frame. The aim of this study was to investigate the anti-tumour activity of a eukaryotic expression plasmid carrying a fusion gene of human VEGFR2 and IL-12. According to the gene sequences in GenBank, we synthesized the human VEGFR2 and IL-12 genes. VEGFR2 and IL-12 were joined by a sequence encoding a Furin recognition site and a 2A cleavage site, and the resulting fusion gene was cloned into the eukaryotic expression vector pVAX1 to construct the expression plasmid pVAX1-VEGFR2-F2A-IL-12. The expression of VEGFR2 and IL-12 could be detected in 293T cells transfected with pVAX1-VEGFR2-F2A-IL-12 by enzyme-linked immunosorbent assay. Each of these proteins, and in particular co-expression of both proteins, can result in humoral and cellular immune responses in C57BL/6 mice. After injection into the tumour-bearing mouse model, the plasmid showed stronger inhibition of tumour growth than a plasmid expressing VEGFR2 alone. Our results demonstrate that a DNA vaccine carrying a fusion gene of human VEGFR2 and IL-12 could represent a promising approach for tumour immunotherapy.

  10. Overexpression of antibiotic resistance genes in hospital effluents over time.

    Science.gov (United States)

    Rowe, Will P M; Baker-Austin, Craig; Verner-Jeffreys, David W; Ryan, Jim J; Micallef, Christianne; Maskell, Duncan J; Pearce, Gareth P

    2017-06-01

    Effluents contain a diverse abundance of antibiotic resistance genes that augment the resistome of receiving aquatic environments. However, uncertainty remains regarding their temporal persistence, transcription and response to anthropogenic factors, such as antibiotic usage. We present a spatiotemporal study within a river catchment (River Cam, UK) that aims to determine the contribution of antibiotic resistance gene-containing effluents originating from sites of varying antibiotic usage to the receiving environment. Gene abundance in effluents (municipal hospital and dairy farm) was compared against background samples of the receiving aquatic environment (i.e. the catchment source) to determine the resistome contribution of effluents. We used metagenomics and metatranscriptomics to correlate DNA and RNA abundance and identified differentially regulated gene transcripts. We found that mean antibiotic resistance gene and transcript abundances were correlated for both hospital ( ρ  = 0.9, two-tailed P  resistance genes ( bla GES and bla OXA ) were overexpressed in all hospital effluent samples. High β-lactam resistance gene transcript abundance was related to hospital antibiotic usage over time and hospital effluents contained antibiotic residues. We conclude that effluents contribute high levels of antibiotic resistance genes to the aquatic environment; these genes are expressed at significant levels and are possibly related to the level of antibiotic usage at the effluent source. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy.

  11. Generation of novel resistance genes using mutation and targeted gene editing

    Science.gov (United States)

    Classical breeding for virus resistance is a lengthy process and is restricted by the availability of resistance genes. Precise genome editing is a "dream technology" to improve plants for virus resistance and these tools have opened new and very promising ways to generate virus resistant plants by ...

  12. Methicillin-resistant Staphylococcus aureus in minas frescal cheese: evaluation of classic enterotoxin genes, antimicrobial resistance and clonal diversity.

    Science.gov (United States)

    Gonzalez, Alice Gonçalves Martins; Marques, Leila Márcia Peres; Gomes, Marcel da Silva Amorim; Beltrão, Jhonathan Campos do Couto; Pinheiro, Marcos Gabriel; Esper, Luciana Maria Ramires; Paula, Geraldo Renato de; Teixeira, Lenise Arneiro; Aguiar-Alves, Fábio

    2017-12-15

    This study aimed to investigate classical enterotoxin (sea to see) and mecA genes, by polymerase chain reaction and anitimicrobial susceptibility, by disk diffusion test of Staphylococcus aureus isolated from minas frescal cheese (MFC). All methicillin-resistant S. aureus (MRSA) isolates were investigated for the presence of Panton-Valentine leukocidin (PVL) genes and clonal diversity. Thirty-one S. aureus were isolated from four MFC samples. Seven (22.6%) S. aureus carried mecA gene and two of them carried enterotoxin genes seb/sec and sea/seb. Five (16.1%) S. aureus isolates showed induced resistance to clindamycin and nine (29%) were resistant to multiple -antibiotics (MDR), among these, six were MRSA. No MRSA isolates presented the PVL genes. Four MRSA were grouped into three clones and three isolates were not typable by pulsed field gel electrophoresis. MRSA isolates showed, by multilocus sequence typing, sequence types ST1, ST5, ST72 and ST4304 (new ST) and S. aureus protein A (spa type) t127, t568 and t2703. These data suggest that MFC may constitute a risk to the consumer because of its potential for staphylococcal food poisoning; however it might, also, become one of MRSA and MDR strains disseminator, including clones usually found in the hospital environment. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Influence of tra genes of IncP and F plasmids on the mobilization of small Kanamycin resistance ColE1-Like plasmids in bacterial biofilms

    Science.gov (United States)

    Background: Horizontal gene transfer is a mechanism for movement of antibiotic resistance genes among bacteria. Some small kanamycin resistance (KanR) ColE1-like plasmids isolated from different serotypes of Salmonella enterica were shown to carry mobilization genes; although not self-transmissibl...

  14. Codon-optimized antibiotic resistance gene improves efficiency of ...

    Indian Academy of Sciences (India)

    2013-10-01

    Oct 1, 2013 ... native gentamicin resistance gene, suggesting that codon optimization improved translation efficiency of the marker gene and ... to be taken into account when exogenous transgenes are expressed in Frankia cells. [Kucho K, Kakoi K, ..... gene coding for the green fluorescent protein (GFP) is a versatile ...

  15. The cfr and cfr-like multiple resistance genes

    DEFF Research Database (Denmark)

    Vester, Birte

    2018-01-01

    . The cfr gene is found in various bacteria in many geographical locations and placed on plasmids or associated with transposons. Cfr-related genes providing similar resistance have been identified in Bacillales, and now also in the pathogens Clostridium difficile and Enterococcus faecium. In addition......, the presence of the cfr gene has been detected in harbours and food markets....

  16. Linking microbial community structure and function to characterize antibiotic resistant bacteria and antibiotic resistant genes from cattle feces

    Science.gov (United States)

    There is widespread interest in monitoring the development of antibiotic resistant bacteria and antibiotic resistance genes in agriculturally impacted environments, however little is known about the relationships between bacterial community structure, and antibiotic resistance gene profiles. Cattl...

  17. Identification of a second Asian soybean rust resistance gene in Hyuuga soybean.

    Science.gov (United States)

    Kendrick, Mandy D; Harris, Donna K; Ha, Bo-Keun; Hyten, David L; Cregan, Perry B; Frederick, Reid D; Boerma, H Roger; Pedley, Kerry F

    2011-05-01

    ABSTRACT Asian soybean rust (ASR) is an economically significant disease caused by the fungus Phakopsora pachyrhizi. The soybean genes Rpp3 and Rpp?(Hyuuga) confer resistance to specific isolates of the pathogen. Both genes map to chromosome 6 (Gm06) (linkage group [LG] C2). We recently identified 12 additional soybean accessions that harbor ASR resistance mapping to Gm06, within 5 centimorgans of Rpp3 and Rpp?(Hyuuga). To further characterize genotypes with resistance on Gm06, we used a set of eight P. pachyrhizi isolates collected from geographically diverse areas to inoculate plants and evaluate them for differential phenotypic responses. Three isolates elicited different responses from soybean accessions PI 462312 (Ankur) (Rpp3) and PI 506764 (Hyuuga) (Rpp?[Hyuuga]). In all, 11 of the new accessions yielded responses identical to either PI 462312 or Hyuuga and 1 of the new accessions, PI 417089B (Kuro daizu), differed from all others. Additional screening of Hyuuga-derived recombinant inbred lines indicated that Hyuuga carries two resistance genes, one at the Rpp3 locus on Gm06 and a second, unlinked ASR resistance gene mapping to Gm03 (LG-N) near Rpp5. These findings reveal a natural case of gene pyramiding for ASR resistance in Hyuuga and underscore the importance of utilizing multiple isolates of P. pachyrhizi when screening for ASR resistance.

  18. Mobile antibiotic resistance – the spread of genes determining the resistance of bacteria through food products

    Directory of Open Access Journals (Sweden)

    Jolanta Godziszewska

    2016-07-01

    Full Text Available In recent years, more and more antibiotics have become ineffective in the treatment of bacterial nfections. The acquisition of antibiotic resistance by bacteria is associated with circulation of genes in the environment. Determinants of antibiotic resistance may be transferred to pathogenic bacteria. It has been shown that conjugation is one of the key mechanisms responsible for spread of antibiotic resistance genes, which is highly efficient and allows the barrier to restrictions and modifications to be avoided. Some conjugative modules enable the transfer of plasmids even between phylogenetically distant bacterial species. Many scientific reports indicate that food is one of the main reservoirs of these genes. Antibiotic resistance genes have been identified in meat products, milk, fruits and vegetables. The reason for such a wide spread of antibiotic resistance genes is the overuse of antibiotics by breeders of plants and animals, as well as by horizontal gene transfer. It was shown, that resistance determinants located on mobile genetic elements, which are isolated from food products, can easily be transferred to another niche. The antibiotic resistance genes have been in the environment for 30 000 years. Their removal from food products is not possible, but the risks associated with the emergence of multiresistant pathogenic strains are very large. The only option is to control the emergence, selection and spread of these genes. Therefore measures are sought to prevent horizontal transfer of genes. Promising concepts involve the combination of developmental biology, evolution and ecology in the fight against the spread of antibiotic resistance.

  19. Mobile antibiotic resistance - the spread of genes determining the resistance of bacteria through food products.

    Science.gov (United States)

    Godziszewska, Jolanta; Guzek, Dominika; Głąbski, Krzysztof; Wierzbicka, Agnieszka

    2016-07-07

    In recent years, more and more antibiotics have become ineffective in the treatment of bacterial nfections. The acquisition of antibiotic resistance by bacteria is associated with circulation of genes in the environment. Determinants of antibiotic resistance may be transferred to pathogenic bacteria. It has been shown that conjugation is one of the key mechanisms responsible for spread of antibiotic resistance genes, which is highly efficient and allows the barrier to restrictions and modifications to be avoided. Some conjugative modules enable the transfer of plasmids even between phylogenetically distant bacterial species. Many scientific reports indicate that food is one of the main reservoirs of these genes. Antibiotic resistance genes have been identified in meat products, milk, fruits and vegetables. The reason for such a wide spread of antibiotic resistance genes is the overuse of antibiotics by breeders of plants and animals, as well as by horizontal gene transfer. It was shown, that resistance determinants located on mobile genetic elements, which are isolated from food products, can easily be transferred to another niche. The antibiotic resistance genes have been in the environment for 30 000 years. Their removal from food products is not possible, but the risks associated with the emergence of multiresistant pathogenic strains are very large. The only option is to control the emergence, selection and spread of these genes. Therefore measures are sought to prevent horizontal transfer of genes. Promising concepts involve the combination of developmental biology, evolution and ecology in the fight against the spread of antibiotic resistance.

  20. Occurrence and Diversity of Tetracycline Resistance Genes in Lagoons and Groundwater Underlying Two Swine Production Facilities

    Science.gov (United States)

    Chee-Sanford, J. C.; Aminov, R.I.; Krapac, I.J.; Garrigues-Jeanjean, N.; Mackie, R.I.

    2001-01-01

    In this study, we used PCR typing methods to assess the presence of tetracycline resistance determinants conferring ribosomal protection in waste lagoons and in groundwater underlying two swine farms. All eight classes of genes encoding this mechanism of resistance [tet(O), tet(Q), tet(W), tet(M), tetB(P), tet(S), tet(T), and otrA] were found in total DNA extracted from water of two lagoons. These determinants were found to be seeping into the underlying groundwater and could be detected as far as 250 m downstream from the lagoons. The identities and origin of these genes in groundwater were confirmed by PCR-denaturing gradient gel electrophoresis and sequence analyses. Tetracycline-resistant bacterial isolates from groundwater harbored the tet(M) gene, which was not predominant in the environmental samples and was identical to tet(M) from the lagoons. The presence of this gene in some typical soil inhabitants suggests that the vector of antibiotic resistance gene dissemination is not limited to strains of gastrointestinal origin carrying the gene but can be mobilized into the indigenous soil microbiota. This study demonstrated that tet genes occur in the environment as a direct result of agriculture and suggested that groundwater may be a potential source of antibiotic resistance in the food chain.

  1. [ISOLATION OF ANTIBIOTICS RESISTANCE GENES IN VIBRIO CHOLERAE O1 AND O139 SEROGROUP STRAINS].

    Science.gov (United States)

    Zadnova, S P; Smirnova, N I

    2015-01-01

    Determination of sensitivity of V. cholerae O1 serogroup El Tor biovar and O139 serogroup strains to antibiotics and determination of the presence of antibiotics resistance genes in their genome. The studies were carried out in 75 V. cholerae O1 and O139 serogroup strains. Sensitivity of cultures to antibiotics was determined by disc-diffusion method. DNA isolation was carried out in the presence of 6M guanidine thiocyanate. PCR was carried out in multi-channel amplificator Tercyc. A multiplex PCR was constructed, that includes 5 primer pairs for the detection of O1 and O139 serogroup resistance genes of vibrios to sulfame- thoxazolum, streptomycin B, trimethoprim, the presence of SXT element, an amplification program was developed. Using the developed PCR, V. cholerae O1 serogroup El Tor biovar strains with multiple drug resistance were established to be imported into Russia in 1993. The presence of SXT elements with genes of resistance to 4 antibiotics simultaneously was detected precisely in these strains, that belong to toxigenic genovariants of V. cholerae El Tor biovar. All the El Tor vibrio strains imported in the subsequent years were shown to stably preserve SXT element, this indicates its important role in biology of cholera vibrios. O139 serogroup strains with intact SXT element and having a deletion of the gene coding trimethoprim resistance were isolated. The data obtained may be used to establish molecular-genetic mechanisms of emergence of antibiotics resistant strains of cholera vibrio, construction of novel gene diagnostic test-systems and carrying out passportization of strains that are stored in the State collection of pathogenic bacteria.

  2. Generation of KCL028 research grade human embryonic stem cell line carrying a mutation in the HTT gene

    Directory of Open Access Journals (Sweden)

    Laureen Jacquet

    2016-03-01

    Full Text Available The KCL028 human embryonic stem cell line was derived from an embryo donated for research that carried an autosomal dominant mutation affecting one allele of the HTT gene encoding huntingtin (43 trinucleotide repeats; 21 for the normal allele. The ICM was isolated using laser microsurgery and plated on γ-irradiated human foreskin fibroblasts. Both the derivation and cell line propagation were performed in an animal product-free environment. Pluripotent state and differentiation potential were confirmed by in vitro and in vivo assays.

  3. Confirmation of root-knot nematode resistant gene Rmi1 using SSR markers

    Directory of Open Access Journals (Sweden)

    Musarrat Ramzan

    2017-02-01

    Full Text Available Background: The Root Knot Nematode (RKN is a serious economic threat to various cultivated crops worldwide. It is a devastating pest of soybean and responsible to cause severe yield loss in Pakistan. The cultivation of resistant soybean varieties against this pest is the sustainable strategy to manage the heavy loss and increase yield. There is an utmost need to identify RKN resistant varieties of soybean against cultivated in Pakistan. The presented study is an attempt to identify and confirm the presence of resistant gene Rmi1 in soybean. Method: Molecular studies have been done using Simple Sequence Repeat (SSR marker system to identify resistant soybean varieties against Root Knot Nematode (RKN using fifteen (15 indigenous cultivars and four (4 US cultivars. DNA was isolated, purified, quantified and then used to employ various SSR markers. The amplified product is observed using gel documentation system after electrophoresis. Results: Diagnostic SSR markers Satt-358 and Satt-492 have shown the presence of Rmi1 gene in all resistance carrying genotypes. Satt-358 amplified the fragment of 200 bp and Satt-492 generated 232 bp bands in all resistant genotypes. This study confirmed the Rmi gene locus (G248A-1 in all internationally confirmed resistant including six (6 native varieties. Conclusion: These investigations have identified six (6 resistant cultivars revealing the effective and informative sources that can be utilized in breeding programs for the selection of RKN resistance soybean genotypes in Pakistan.

  4. Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

    Directory of Open Access Journals (Sweden)

    Qing-Bin Yuan

    Full Text Available This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L. The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L. By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L. However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

  5. Fate of antibiotic resistant bacteria and genes during wastewater chlorination: implication for antibiotic resistance control.

    Science.gov (United States)

    Yuan, Qing-Bin; Guo, Mei-Ting; Yang, Jian

    2015-01-01

    This study investigated fates of nine antibiotic-resistant bacteria as well as two series of antibiotic resistance genes in wastewater treated by various doses of chlorine (0, 15, 30, 60, 150 and 300 mg Cl2 min/L). The results indicated that chlorination was effective in inactivating antibiotic-resistant bacteria. Most bacteria were inactivated completely at the lowest dose (15 mg Cl2 min/L). By comparison, sulfadiazine- and erythromycin-resistant bacteria exhibited tolerance to low chlorine dose (up to 60 mg Cl2 min/L). However, quantitative real-time PCRs revealed that chlorination decreased limited erythromycin or tetracycline resistance genes, with the removal levels of overall erythromycin and tetracycline resistance genes at 0.42 ± 0.12 log and 0.10 ± 0.02 log, respectively. About 40% of erythromycin-resistance genes and 80% of tetracycline resistance genes could not be removed by chlorination. Chlorination was considered not effective in controlling antimicrobial resistance. More concern needs to be paid to the potential risk of antibiotic resistance genes in the wastewater after chlorination.

  6. Genetic characterization and fine mapping of the novel Phytophthora resistance gene in a Chinese soybean cultivar.

    Science.gov (United States)

    Zhang, Jiqing; Xia, Changjian; Wang, Xiaoming; Duan, Canxing; Sun, Suli; Wu, Xiaofei; Zhu, Zhendong

    2013-06-01

    Phytophthora root rot (PRR), caused by Phytophthora sojae Kaufmann & Gerdemann, is one of the most destructive diseases of soybean [Glycine max (L.) Merr.]. Deployment of resistance genes is the most economical and effective way of controlling the disease. The soybean cultivar 'Yudou 29' is resistant to many P. sojae isolates in China. The genetic basis of the resistance in 'Yudou 29' was elucidated through an inheritance study and molecular mapping. In response to 25 P. sojae isolates, 'Yudou 29' displayed a new resistance reaction pattern distinct from those of differentials carrying known Rps genes. A population of 214 F2:3 families from a cross between 'Jikedou 2' (PRR susceptible) and 'Yudou 29' was used for Rps gene mapping. The segregation fit a ratio of 1:2:1 for resistance:segregation:susceptibility within this population, indicating that resistance in 'Yudou 29' is controlled by a single dominant gene. This gene was temporarily named RpsYD29 and mapped on soybean chromosome 03 (molecular linkage group N; MLG N) flanked by SSR markers SattWM82-50 and Satt1k4b at a genetic distance of 0.5 and 0.2 cM, respectively. Two nucleotide binding site-leucine rich repeat (NBS-LRR) type genes were detected in the 204.8 kb region between SattWM82-50 and Satt1k4b. These two genes showed high similarity to Rps1k in amino acid sequence and could be candidate genes for PRR resistance. Based on the phenotype reactions and the physical position on soybean chromosome 03, RpsYD29 might be a novel allele at, or a novel gene tightly linked to, the Rps1 locus.

  7. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters

    OpenAIRE

    Miller, Jennifer H.; Novak, John T.; Knocke, William R.; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) versus their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1- a Pseudomonas sp.) and thermophilic (Iso T10- a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts ...

  8. Sponge Microbiota are a Reservoir of Functional Antibiotic Resistance Genes

    DEFF Research Database (Denmark)

    Versluis, Dennis; de Evgrafov, Mari Cristina Rodriguez; Sommer, Morten Otto Alexander

    2016-01-01

    Wide application of antibiotics has contributed to the evolution of multi-drug resistant human pathogens, resulting in poorer treatment outcomes for infections. In the marine environment, seawater samples have been investigated as a resistance reservoir; however, no studies have methodically...... examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional......). Fifteen of 37 inserts harbored resistance genes that shared resistance gene could be identified with high confidence, in which case we predicted resistance to be mainly mediated by antibiotic efflux. One marine-specific ampicillin-resistance...

  9. Emergence of plasmid-mediated colistin resistance and New Delhi metallo-β-lactamase genes in extensively drug-resistant Escherichia coli isolated from a patient in Thailand.

    Science.gov (United States)

    Paveenkittiporn, Wantana; Kerdsin, Anusak; Chokngam, Sukanya; Bunthi, Charatdao; Sangkitporn, Somchai; Gregory, Christopher J

    2017-02-01

    We reported a case of Escherichia coli with colistin resistance and an extensively drug-resistant phenotype. Molecular analysis revealed that the isolate carried mcr-1 and multiple β-lactamase genes includingbla NDM1 , bla CTX-M-15 , bla TEM1 , and bla CMY-2 . This is the first report of a clinical mcr-1 isolate in Thailand highlighting the urgent need for a comprehensive antimicrobial resistance containment strategy to prevent further spread. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Deletion analysis of the expression of rRNA genes and associated tRNA genes carried by a lambda transducing bacteriophage

    International Nuclear Information System (INIS)

    Morgan, E.A.; Nomura, M.

    1979-01-01

    Transducing phage lambda ilv5 carries genes for rRNA's, spacer tRNA's (tRNA 1 /sup Ile/ and tRNA/sub 1B//sup Ala/), and two other tRNA's (tRNA 1 /sup Asp/ and tRNA/sup Trp/). We have isolated a mutant of lambda ilv5, lambda ilv5su7, which carries an amber suppressor mutation in the tRNA/sup Trp/ gene. A series of deletion mutants were isolated from the lambda ilv5su7 phage. Genetic and biochemical analyses of these deletion mutants have confirmed our previous conclusion that the genes for tRNA 1 /sup Asp/ and tRNA/sup Trp/ located at the distal end of the rRNA operon (rrnC) are cotranscribed with other rRNA genes in that operon. In addition, these deletions were used to define roughly the physical location of the promoter(s) of the rRNA operon carried by the lambda ilv5su7 transducing phage

  11. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  12. Detection of Multidrug-Resistant Salmonella enterica Serotype typhimurium DT104 Based on a Gene Which Confers Cross-Resistance to Florfenicol and Chloramphenicol

    Science.gov (United States)

    Bolton, Lance F.; Kelley, Lynda C.; Lee, Margie D.; Fedorka-Cray, Paula J.; Maurer, John J.

    1999-01-01

    Salmonella enterica serotype typhimurium (S. typhimurium) DT104 (DT104) first emerged as a major pathogen in Europe and is characterized by its pentadrug-resistant pattern. It has also been associated with outbreaks in the United States. The organism typically carries resistance to ampicillin, chloramphenicol, streptomycin, sulfonamides, and tetracycline. The mechanism of chloramphenicol resistance in DT104 was determined by producing antibiotic-resistant Escherichia coli host strain clones from DT104 DNA. DNA from chloramphenicol-resistant clones was sequenced, and probes specific for the genes floS. typhimurium (floSt), int, invA, and spvC were produced for colony blot hybridizations. One hundred nine Salmonella isolates, including 44 multidrug-resistant DT104 isolates, were tested to evaluate the specificities of the probes. The gene floSt, reported in this study, confers chloramphenicol and florfenicol resistance on S. typhimurium DT104. Florfenicol resistance is unique to S. typhimurium DT104 and multidrug-resistant S. typhimurium isolates with the same drug resistance profile among all isolates evaluated. Of 44 DT104 isolates tested, 98% were detected based on phenotypic florfenicol resistance and 100% had the floSt-positive genotype. Resistances to florfenicol and chloramphenicol are conferred by the gene floSt, described in this paper. Presumptive identification of S. typhimurium DT104 can be made rapidly based on the presence of the floSt gene or its resulting phenotype. PMID:10203484

  13. Rpr1, a gene required for Rpg1-dependent resistance to stem rust in barley.

    Science.gov (United States)

    Zhang, L; Fetch, T; Nirmala, J; Schmierer, D; Brueggeman, R; Steffenson, B; Kleinhofs, A

    2006-09-01

    Rpg1 is a stem rust resistance gene that has protected barley from severe losses for over 60 years in the US and Canada. It confers resistance to many, but not all, pathotypes of the stem rust fungus Puccinia graminis f. sp. tritici. A fast neutron induced deletion mutant, showing susceptibility to stem rust pathotype Pgt-MCC, was identified in barley cv. Morex, which carries Rpg1. Genetic and Rpg1 mRNA and protein expression level analyses showed that the mutation was a suppressor of Rpg1 and was designated Rpr1 (Required for P. graminis resistance). Genome-wide expression profiling, using the Affymetrix Barley1 GeneChip containing approximately 22,840 probe sets, was conducted with Morex and the rpr1 mutant. Of the genes represented on the Barley1 microarray, 20 were up-regulated and 33 were down-regulated by greater than twofold in the mutant, while the Rpg1 mRNA level remained constant. Among the highly down-regulated genes (greater than fourfold), genomic PCR, RT-PCR and Southern analyses identified that three genes (Contig4901_s_at, HU03D17U_s_at, and Contig7061_s_at), were deleted in the rpr1 mutant. These three genes mapped to chromosome 4(4H) bin 5 and co-segregated with the rpr1-mediated susceptible phenotype. The loss of resistance was presumed to be due to a mutation in one or more of these genes. However, the possibility exists that there are other genes within the deletions, which are not represented on the Barley1 GeneChip. The Rpr1 gene was not required for Rpg5- and rpg4-mediated stem rust resistance, indicating that it shows specificity to the Rpg1-mediated resistance pathway.

  14. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA.

    Science.gov (United States)

    Teixeira, Bertinellys; Rodulfo, Hectorina; Carreño, Numirin; Guzmán, Militza; Salazar, Elsa; De Donato, Marcos

    2016-01-01

    The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC), aminoglycoside-adenyltransferases (AAD), and aminoglycoside-phosphotransferases (APH), is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA) were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137) were identified from the Intensive Care Unit (ICU), mainly from discharges (96/137). The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively). Phenotype VI, resistant to these antibiotics, was the most frequent (14/49), followed by phenotype I, resistant to all the aminoglycosides tested (12/49). The aac(6´)-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´)-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  15. Genetic engineering in insects: Cloning and transformation of genes conferring resistance to insecticides

    International Nuclear Information System (INIS)

    Mouches, C.

    1988-01-01

    Genetic engineering and transformation offer the possibility of modifying the genetic material of insects. These techniques will make it possible, for example, to transfer genes conferring resistance to insecticides into the genome of beneficial species, or to develop new methods of combating insect pests and disease carrying insects. We cloned two genes which contain the code for proteins that detoxify insecticides. The first, esterase B1 from Culex quinquefasciatus, is amplified approximately 250 times in Californian mosquitoes resistant to organic phosphate insecticides. A second esterase gene was cloned from bacteria which break down various organic phosphates. Experiments are in progress to transfer these genes to Drosophila and beneficial insects. These same genes could also serve as selection markers for the purpose of developing transformation techniques for different insects whose genome one wishes to modify using genetic engineering techniques. (author). 5 refs

  16. Detection of bacterial blight resistance genes in basmati rice landraces.

    Science.gov (United States)

    Ullah, I; Jamil, S; Iqbal, M Z; Shaheen, H L; Hasni, S M; Jabeen, S; Mehmood, A; Akhter, M

    2012-07-20

    Aromatic basmati rice is vulnerable to bacterial blight disease. Genes conferring resistance to bacterial blight have been identified in coarse rice; however, their incorporation into basmati varieties compromises the prized basmati aroma. We identified bacterial blight resistance genes Xa4, xa5, Xa7, and xa13 in 52 basmati landraces and five basmati cultivars using PCR markers. The Xa7 gene was found to be the most prevalent among the cultivars and landraces. The cultivars Basmati-385 and Basmati-2000 also contained the Xa4 gene; however, xa5 and xa13 were confined to landraces only. Ten landraces were found to have multiple resistance genes. Landraces Basmati-106, Basmati-189 and Basmati-208 contained Xa4 and Xa7 genes. Whereas, landraces Basmati-122, Basmati-427, Basmati-433 were observed to have xa5 and Xa7 genes. Landraces Basmati-48, Basmati-51A, Basmati-334, and Basmati-370A possessed Xa7 and xa13 genes. The use of landraces containing recessive genes xa5 and xa13 as donor parents in hybridization with cultivars Basmati-385 and Basmati-2000, which contain the genes Xa4 and Xa7, will expedite efforts to develop bacterial blight-resistant basmati rice cultivars through marker assisted selection, based on a pyramiding approach, without compromising aroma and grain quality.

  17. vanI: a novel d-Ala-d-Lac vancomycin resistance gene cluster found in Desulfitobacterium hafniense

    NARCIS (Netherlands)

    Kruse, T.; Levisson, M.; Vos, de W.M.; Smidt, H.

    2014-01-01

    The glycopeptide vancomycin was until recently considered a drug of last resort against Gram-positive bacteria. Increasing numbers of bacteria, however, are found to carry genes that confer resistance to this antibiotic. So far, 10 different vancomycin resistance clusters have been described. A

  18. Postulation of rust resistance genes in Nordic spring wheat genotypes and identification of widely effective sources of resistance against the Australian rust flora.

    Science.gov (United States)

    Randhawa, Mandeep; Bansal, Urmil; Lillemo, Morten; Miah, Hanif; Bariana, Harbans

    2016-11-01

    Wild relatives, landraces and cultivars from different geographical regions have been demonstrated as the sources of genetic variation for resistance to rust diseases. This study involved assessment of diversity for resistance to three rust diseases among a set of Nordic spring wheat cultivars. These cultivars were tested at the seedling stage against several pathotypes of three rust pathogens in the greenhouse. All stage stem rust resistance genes Sr7b, Sr8a, Sr12, Sr15, Sr17, Sr23 and Sr30, and leaf rust resistance genes Lr1, Lr3a, Lr13, Lr14a, Lr16 and Lr20 were postulated either singly or in different combinations among these cultivars. A high proportion of cultivars were identified to carry linked rust resistance genes Sr15 and Lr20. Although 51 cultivars showed variation against Puccinia striiformis f. sp. tritici (Pst) pathotypes used in this study, results were not clearly contrasting to enable postulation of stripe rust resistance genes in these genotypes. Stripe rust resistance gene Yr27 was postulated in four cultivars and Yr1 was present in cultivar Zebra. Cultivar Tjalve produced low stripe rust response against all Pst pathotypes indicating the presence either of a widely effective resistance gene or combination of genes with compensating pathogenic specificities. Several cultivars carried moderate to high level of APR to leaf rust and stripe rust. Seedling stem rust susceptible cultivar Aston exhibited moderately resistant to moderately susceptible response, whereas other cultivars belonging to this class were rated moderately susceptible or higher. Molecular markers linked with APR genes Yr48, Lr34/Yr18/Sr57, Lr68 and Sr2 detected the presence of these genes in some genotypes.

  19. Suppression of plant resistance gene-based immunity by a fungal effector.

    Directory of Open Access Journals (Sweden)

    Petra M Houterman

    2008-05-01

    Full Text Available The innate immune system of plants consists of two layers. The first layer, called basal resistance, governs recognition of conserved microbial molecules and fends off most attempted invasions. The second layer is based on Resistance (R genes that mediate recognition of effectors, proteins secreted by pathogens to suppress or evade basal resistance. Here, we show that a plant-pathogenic fungus secretes an effector that can both trigger and suppress R gene-based immunity. This effector, Avr1, is secreted by the xylem-invading fungus Fusarium oxysporum f.sp. lycopersici (Fol and triggers disease resistance when the host plant, tomato, carries a matching R gene (I or I-1. At the same time, Avr1 suppresses the protective effect of two other R genes, I-2 and I-3. Based on these observations, we tentatively reconstruct the evolutionary arms race that has taken place between tomato R genes and effectors of Fol. This molecular analysis has revealed a hitherto unpredicted strategy for durable disease control based on resistance gene combinations.

  20. [Construction of retroviral vector carrying Twist gene and its induction of epithelial-mesenchymal transition in human mammary epithelial cells].

    Science.gov (United States)

    Yang, Jiajia; Hu, Ping; Zhou, Mingli; Huang, Jietao; Liu, Manran

    2013-09-01

    To construct a retroviral vector carrying Twist gene and investigate its effect on human mammary MCF10A epithelial cells. Myc-Twist was digested from pcDNA3/myc-Twist and subcloned into the retroviral vector pBABE-puro to construct a recombinant plasmid (pBABE-myc-Twist). The inserted Twist gene was confirmed by restriction enzyme digestion and DNA sequencing. The plasmid pBABE-myc-Twist and the packaging plasmid pAmpho were co-transfected into HEK293T cells for packaging of retrovirus. Meanwhile, the control plasmid pBABE-puro and the packaging plasmid were co-transfected into the other HEK293T cells as a control group. Human mammary MCF10A epithelial cells were infected with the retroviruses carrying Twist gene or the controls, and selected by puromycin. The expression of Twist in the MCF10A-Twist and MCF10A-Vector cells was determined by RT-PCR and Western blotting. The expressions of epithelial-mesenchymal transition (EMT) marker proteins induced by Twist in MCF10A cells were detected using immunofluorescence cytochemistry and Western blotting. Cell migration and invasion abilities were analyzed by Transwell(R); assay. The myc-tagged Twist gene was correctly inserted into the retroviral expression vector as a recombinant plasmid (pBABE-myc-Twist) as identified by restriction analysis and DNA sequencing. The Twist gene was efficiently delivered into human mammary MCF10A epithelial cells by the retrovirus, resulting in the stable expression of Twist mRNA and myc-tagged Twist protein as shown by RT-PCR and Western blotting, respectively. The expression of the epithelial biomarker E-cadherin was downregulated whereas, the mesenchymal marker vimentin upregulated in MCF10A-Twist cells as shown by immunofluorescence cytochemistry and Western blotting. Cell migration and invasion abilities were enhanced notably in MCF10A-Twist cells as compared with MCF10A-Vector control cells (PMCF10A cells and plays an important role in the promotion of cell migration and invasion.

  1. Antimicrobial Peptide Resistance Genes in the Plant Pathogen Dickeya dadantii.

    Science.gov (United States)

    Pandin, Caroline; Caroff, Martine; Condemine, Guy

    2016-11-01

    Modification of teichoic acid through the incorporation of d-alanine confers resistance in Gram-positive bacteria to antimicrobial peptides (AMPs). This process involves the products of the dltXABCD genes. These genes are widespread in Gram-positive bacteria, and they are also found in a few Gram-negative bacteria. Notably, these genes are present in all soft-rot enterobacteria (Pectobacterium and Dickeya) whose dltDXBAC operons have been sequenced. We studied the function and regulation of these genes in Dickeya dadantii dltB expression was induced in the presence of the AMP polymyxin. It was not regulated by PhoP, which controls the expression of some genes involved in AMP resistance, but was regulated by ArcA, which has been identified as an activator of genes involved in AMP resistance. However, arcA was not the regulator responsible for polymyxin induction of these genes in this bacterium, which underlines the complexity of the mechanisms controlling AMP resistance in D. dadantii Two other genes involved in resistance to AMPs have also been characterized, phoS and phoH dltB, phoS, phoH, and arcA but not dltD mutants were more sensitive to polymyxin than the wild-type strain. Decreased fitness of the dltB, phoS, and phoH mutants in chicory leaves indicates that their products are important for resistance to plant AMPs. Gram-negative bacteria can modify their lipopolysaccharides (LPSs) to resist antimicrobial peptides (AMPs). Soft-rot enterobacteria (Dickeya and Pectobacterium spp.) possess homologues of the dlt genes in their genomes which, in Gram-positive bacteria, are involved in resistance to AMPs. In this study, we show that these genes confer resistance to AMPs, probably by modifying LPSs, and that they are required for the fitness of the bacteria during plant infection. Two other new genes involved in resistance were also analyzed. These results show that bacterial resistance to AMPs can occur in bacteria through many different mechanisms that need to be

  2. Distribution of tetracycline and streptomycin resistance genes and class 1 integrons in Enterobacteriaceae isolated from dairy and nondairy farm soils.

    Science.gov (United States)

    Srinivasan, Velusamy; Nam, Hyang-Mi; Sawant, Ashish A; Headrick, Susan I; Nguyen, Lien T; Oliver, Stephen P

    2008-02-01

    The prevalence of selected tetracycline and streptomycin resistance genes and class 1 integrons in Enterobacteriaceae (n = 80) isolated from dairy farm soil and nondairy soils was evaluated. Among 56 bacteria isolated from dairy farm soils, 36 (64.3%) were resistant to tetracycline, and 17 (30.4%) were resistant to streptomycin. Lower frequencies of tetracycline (9 of 24 or 37.5%) and streptomycin (1 of 24 or 4.2%) resistance were observed in bacteria isolated from nondairy soils. Bacteria (n = 56) isolated from dairy farm soil had a higher frequency of tetracycline resistance genes including tetM (28.6%), tetA (21.4%), tetW (8.9%), tetB (5.4%), tetS (5.4%), tetG (3.6%), and tetO (1.8%). Among 24 bacteria isolated from nondairy soils, four isolates carried tetM, tetO, tetS, and tetW in different combinations; whereas tetA, tetB, and tetG were not detected. Similarly, a higher prevalence of streptomycin resistance genes including strA (12.5%), strB (12.5%), ant(3'') (12.5), aph(6)-1c (12.5%), aph(3'') (10.8%), and addA (5.4%) was detected in bacteria isolated from dairy farm soils than in nondairy soils. None of the nondairy soil isolates carried aadA gene. Other tetracycline (tetC, tetD, tetE, tetK, tetL, tetQ, and tetT) and streptomycin (aph(6)-1c and ant(6)) resistance genes were not detected in both dairy and nondairy soil isolates. A higher distribution of multiple resistance genes was observed in bacteria isolated from dairy farm soil than in nondairy soil. Among 36 tetracycline- and 17 streptomycin-resistant isolates from dairy farm soils, 11 (30.6%) and 9 (52.9%) isolates carried multiple resistance genes encoding resistance to tetracycline and streptomycin, respectively, which was higher than in bacteria isolated from nondairy soils. One strain each of Citrobacter freundii and C. youngae isolated from dairy farm soils carried class 1 integrons with different inserted gene cassettes. Results of this small study suggest that the presence of multiple

  3. Complete Genome Sequence of a Human-Invasive Salmonella enterica Serovar Typhimurium Strain of the Emerging Sequence Type 213 Harboring a Multidrug Resistance IncA/C Plasmid and a blaCMY-2-Carrying IncF Plasmid.

    Science.gov (United States)

    Silva, Claudia; Calva, Edmundo; Calva, Juan J; Wiesner, Magdalena; Fernández-Mora, Marcos; Puente, José L; Vinuesa, Pablo

    2015-11-12

    Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 was isolated in Mexico City, Mexico, from a patient with a systemic infection, and its complete genome sequence was determined using PacBio single-molecule real-time technology. Strain 33676 harbors an IncF plasmid carrying the extended-spectrum cephalosporin gene blaCMY-2 and a multidrug resistance IncA/C plasmid. Copyright © 2015 Silva et al.

  4. Resistance gene management: concepts and practice

    Science.gov (United States)

    Christopher C. Mundt

    2012-01-01

    There is now a very long history of genetics/breeding for disease resistance in annual crops. These efforts have resulted in conceptual advances and frustrations, as well as practical successes and failures. This talk will review this history and its relevance to the genetics of resistance in forest species. All plant breeders and pathologists are familiar with boom-...

  5. Skin Commensal Staphylococci May Act as Reservoir for Fusidic Acid Resistance Genes.

    Science.gov (United States)

    Hung, Wei-Chun; Chen, Hsiao-Jan; Lin, Yu-Tzu; Tsai, Jui-Chang; Chen, Chiao-Wei; Lu, Hsiao-Hung; Tseng, Sung-Pin; Jheng, Yao-Yu; Leong, Kin Hong; Teng, Lee-Jene

    2015-01-01

    We analyzed the occurrence and mechanisms of fusidic acid resistance present in staphylococci isolated from 59 healthy volunteers. The fingers of the volunteers were screened for the presence of staphylococci, and the collected isolates were tested for resistance to fusidic acid. A total of 34 fusidic acid resistant staphylococcal strains (all were coagulase-negative) were isolated from 22 individuals (22/59, 37.3%). Examination of the resistance genes revealed that acquired fusB or fusC was present in Staphylococcus epidermidis, Staphylococcus capitis subsp. urealyticus, Staphylococcus hominis subsp. hominis, Staphylococcus warneri and Staphylococcus haemolyticus. Resistance islands (RIs) carrying fusB were found in S. epidermidis and S. capitis subsp. urealyticus, while staphylococcal chromosome cassette (SCC)-related structures harboring fusC were found in S. hominis subsp. hominis. Genotypic analysis of S. epidermidis and S. hominis subsp. hominis indicated that the fus elements were disseminated in diverse genetic strain backgrounds. The fusC elements in S. hominis subsp. hominis strains were highly homologous to SCCfusC in the epidemic sequence type (ST) 239/SCCmecIII methicillin-resistant S. aureus (MRSA) or the pseudo SCCmec in ST779 MRSA. The presence of acquired fusidic acid resistance genes and their genetic environment in commensal staphylococci suggested that the skin commensal staphylococci may act as reservoir for fusidic acid resistance genes.

  6. Skin Commensal Staphylococci May Act as Reservoir for Fusidic Acid Resistance Genes.

    Directory of Open Access Journals (Sweden)

    Wei-Chun Hung

    Full Text Available We analyzed the occurrence and mechanisms of fusidic acid resistance present in staphylococci isolated from 59 healthy volunteers. The fingers of the volunteers were screened for the presence of staphylococci, and the collected isolates were tested for resistance to fusidic acid. A total of 34 fusidic acid resistant staphylococcal strains (all were coagulase-negative were isolated from 22 individuals (22/59, 37.3%. Examination of the resistance genes revealed that acquired fusB or fusC was present in Staphylococcus epidermidis, Staphylococcus capitis subsp. urealyticus, Staphylococcus hominis subsp. hominis, Staphylococcus warneri and Staphylococcus haemolyticus. Resistance islands (RIs carrying fusB were found in S. epidermidis and S. capitis subsp. urealyticus, while staphylococcal chromosome cassette (SCC-related structures harboring fusC were found in S. hominis subsp. hominis. Genotypic analysis of S. epidermidis and S. hominis subsp. hominis indicated that the fus elements were disseminated in diverse genetic strain backgrounds. The fusC elements in S. hominis subsp. hominis strains were highly homologous to SCCfusC in the epidemic sequence type (ST 239/SCCmecIII methicillin-resistant S. aureus (MRSA or the pseudo SCCmec in ST779 MRSA. The presence of acquired fusidic acid resistance genes and their genetic environment in commensal staphylococci suggested that the skin commensal staphylococci may act as reservoir for fusidic acid resistance genes.

  7. Widespread plasmid resistance genes among Proteus species in ...

    African Journals Online (AJOL)

    34% of the strains lost the antibiotic resistance plasmids marker after sodium dodecyl sulfate (SDS) mediated curing. The rest of the plasmid markers were non transferable. The results indicated that plasmids carry varied dissemination of antibiotics resistance markers to distant recipient cells, indicating clonal transfer ...

  8. The antimicrobial resistance crisis: management through gene monitoring

    Science.gov (United States)

    2016-01-01

    Antimicrobial resistance (AMR) is an acknowledged crisis for humanity. Its genetic origins and dire potential outcomes are increasingly well understood. However, diagnostic techniques for monitoring the crisis are currently largely limited to enumerating the increasing incidence of resistant pathogens. Being the end-stage of the evolutionary process that produces antimicrobial resistant pathogens, these measurements, while diagnostic, are not prognostic, and so are not optimal in managing this crisis. A better test is required. Here, using insights from an understanding of evolutionary processes ruling the changing abundance of genes under selective pressure, we suggest a predictive framework for the AMR crisis. We then discuss the likely progression of resistance for both existing and prospective antimicrobial therapies. Finally, we suggest that by the environmental monitoring of resistance gene frequency, resistance may be detected and tracked presumptively, and how this tool may be used to guide decision-making in the local and global use of antimicrobials. PMID:27831476

  9. Patients with genetically heterogeneous synchronous colorectal cancer carry rare damaging germline mutations in immune-related genes

    Science.gov (United States)

    Cereda, Matteo; Gambardella, Gennaro; Benedetti, Lorena; Iannelli, Fabio; Patel, Dominic; Basso, Gianluca; Guerra, Rosalinda F.; Mourikis, Thanos P.; Puccio, Ignazio; Sinha, Shruti; Laghi, Luigi; Spencer, Jo; Rodriguez-Justo, Manuel; Ciccarelli, Francesca D.

    2016-01-01

    Synchronous colorectal cancers (syCRCs) are physically separated tumours that develop simultaneously. To understand how the genetic and environmental background influences the development of multiple tumours, here we conduct a comparative analysis of 20 syCRCs from 10 patients. We show that syCRCs have independent genetic origins, acquire dissimilar somatic alterations, and have different clone composition. This inter- and intratumour heterogeneity must be considered in the selection of therapy and in the monitoring of resistance. SyCRC patients show a higher occurrence of inherited damaging mutations in immune-related genes compared to patients with solitary colorectal cancer and to healthy individuals from the 1,000 Genomes Project. Moreover, they have a different composition of immune cell populations in tumour and normal mucosa, and transcriptional differences in immune-related biological processes. This suggests an environmental field effect that promotes multiple tumours likely in the background of inflammation. PMID:27377421

  10. Mechanisms of multidrug resistance in HL60 cells. Analysis of resistance associated membrane proteins and levels of mdr gene expression.

    Science.gov (United States)

    McGrath, T; Latoud, C; Arnold, S T; Safa, A R; Felsted, R L; Center, M S

    1989-10-15

    HL60 cells isolated for resistance to Adriamycin do not contain P-glycoprotein, as determined with immunological probes. These cells, however, are multidrug resistant and defective in the cellular accumulation of drug. In view of these findings, we have examined in greater detail certain properties of the HL60/Adr cells and have compared these properties to an HL60 drug-resistant isolate (HL60/Vinc) which contains high levels of P-glycoprotein. The results of these studies demonstrated that verapamil induces a major increase in cellular drug accumulation in both HL60/Adr and HL60/Vinc isolates. An 125I-labeled photoaffinity analog of verapamil labeled P-glycoprotein contained in membranes of HL60/Vinc cells. In contrast, this agent did not label any protein selectively associated with drug resistance in membranes of the HL60/Adr isolate. The photoactive dihydropyridine calcium channel blocker [3H]azidopine and [125I]NASV, a photoaffinity analog of vinblastine, labelled P-glycoprotein in membranes from HL60/Vinc cells, whereas in experiments with the HL60/Adr isolate there was no detectable labeling of a drug resistance associated membrane protein. Additional studies have been carried out to analyze membrane proteins of HL60/Adr cells labeled with the photoaffinity agent 8-azido-alpha-[32P]ATP (AzATP32). The results demonstrate that this agent labeled a resistance associated membrane protein of 190 kilodaltons (P190). P190 is essentially absent in membranes of drug-sensitive cells. Labeling of P190 with AzATP32 in membranes of resistant cells was blocked completely when incubations were carried out in the presence of excess unlabeled ATP. Additional studies were carried out to analyze mdr gene amplification and expression in sensitive and resistant cells. Experiments carried out with human 5',mdr1 (1.1 kb) and mdr3 (1.0 kb) cDNAs demonstrate that both of these sequences were highly amplified in the HL60/Vinc isolate. Only the mrd1 gene sequence however, was

  11. The Number of Genes Controlling Resistance in Beans to Common ...

    African Journals Online (AJOL)

    Ten crosses were made between resistant (R), susceptible (S), RxS susceptible and Intermediate (I), SxI and RxR bean lines to common bacterial blight. The F1 were advanced to F2 and in each cross over 250 F2 plants were used to evaluate for the number of genes controlling resistance using Mendelian genetics and ...

  12. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    Prevalence, antibiotic-resistance properties and enterotoxin gene profile of Bacillus cereus strains isolated from milk-based baby foods. ... Conclusion: Considerable prevalence of resistant and toxigenic B. cereus and high consumption of milk-based infant foods in Iran, represent an important public health issue which ...

  13. Occurrence and reservoirs of antibiotic resistance genes in the environment

    NARCIS (Netherlands)

    Seveno, N.; Kallifidas, D.; Smalla, K.; Elsas, van J.D.; Collard, J.M.; Karagouni, A.; Wellington, E.M.H.

    2002-01-01

    Antibiotic resistance genes have become highly mobile since the development of antibiotic chemotherapy. A considerable body of evidence exists proving the link between antibiotic use and the significant increase in drug-resistant human bacterial pathogens. The application of molecular detection and

  14. Identification of bacterial blight resistance genes Xa4 in Pakistani ...

    African Journals Online (AJOL)

    Identification of bacterial blight resistance genes Xa4 in Pakistani rice germplasm using PCR. M Arif, M Jaffar, M Babar, MA Sheikh, S Kousar, A Arif, Y Zafar. Abstract. Bacterial blight (BB) caused by Xanthomonas oryzae pv oryzae (Xoo) is a major biotic constraint in the irrigated rice belts. Genetic resistance is the most ...

  15. Spread of tetracycline resistance genes at a conventional dairy farm

    NARCIS (Netherlands)

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, Heike; Elhottová, Dana

    2015-01-01

    The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of

  16. gene effects for resistance to groundnut rossette disease in exotic ...

    African Journals Online (AJOL)

    ACSS

    2016-02-25

    Feb 25, 2016 ... Opposite and significant signs of dominance [d] and dominance × dominance [l] components indicated the importance of duplicate epitasis in the latter crosses in the control of GRD resistance, which revealed a complex nature of inheritance of GRD resistance. Key Words: Arachis hypogaea, gene effects, ...

  17. Progress on introduction of rust resistance genes into confection sunflower

    Science.gov (United States)

    Sunflower rust (Puccinia helianthi) emerged as a serious disease in the last few years. Confection sunflower is particularly vulnerable to the disease due to the lack of resistance sources. The objectives of this project are to transfer rust resistance genes from oil sunflower to confectionery sunfl...

  18. Isolation and characterization of a candidate gene for resistance to ...

    African Journals Online (AJOL)

    ARC) domain, and a leucine-rich repeat (LRR) domain, all of which are typical characteristics of resistance genes. We proposed the resistance mechanism of CreV8 based on functional analysis and predictions from its conserved domains and ...

  19. Abundance of antibiotic resistance genes in environmental bacteriophages.

    Science.gov (United States)

    Anand, Taruna; Bera, Bidhan Ch; Vaid, Rajesh K; Barua, Sanjay; Riyesh, Thachamvally; Virmani, Nitin; Hussain, Mubarik; Singh, Raj K; Tripathi, Bhupendra N

    2016-12-01

    The ecosystem is continuously exposed to a wide variety of antimicrobials through waste effluents, agricultural run-offs and animal-related and anthropogenic activities, which contribute to the spread of antibiotic resistance genes (ARGs). The contamination of ecosystems with ARGs may create increased opportunities for their transfer to naive microbes and eventually lead to entry into the human food chain. Transduction is a significant mechanism of horizontal gene transfer in natural environments, which has traditionally been underestimated as compared to transformation. We explored the presence of ARGs in environmental bacteriophages in order to recognize their contribution in the spread of ARGs in environmental settings. Bacteriophages were isolated against environmental bacterial isolates, purified and bulk cultured. They were characterized, and detection of ARG and intI genes including blaTEM, blaOXA-2, intI1, intI2, intI3, tetA and tetW was carried out by PCR. This study revealed the presence of various genes [tetA (12.7 %), intI1 (10.9 %), intI2 (10.9 %), intI3 (9.1 %), tetW (9.1 %) and blaOXA-2 (3.6 %)] and blaTEM in a significantly higher proportion (30.9 %). blaSHV, blaOXA-1, tetO, tetB, tetG, tetM and tetS were not detected in any of the phages. Soil phages were the most versatile in terms of ARG carriage. Also, the relative abundance of tetA differed significantly vis-à-vis source. The phages from organized farms showed varied ARGs as compared to the unorganized sector, although blaTEM ARG incidences did not differ significantly. The study reflects on the role of phages in dissemination of ARGs in environmental reservoirs, which may provide an early warning system for future clinically relevant resistance mechanisms.

  20. Gene pyramiding enhances durable blast disease resistance in rice

    OpenAIRE

    Fukuoka, Shuichi; Saka, Norikuni; Mizukami, Yuko; Koga, Hironori; Yamanouchi, Utako; Yoshioka, Yosuke; Hayashi, Nagao; Ebana, Kaworu; Mizobuchi, Ritsuko; Yano, Masahiro

    2015-01-01

    Effective control of blast, a devastating fungal disease of rice, would increase and stabilize worldwide food production. Resistance mediated by quantitative trait loci (QTLs), which usually have smaller individual effects than R-genes but confer broad-spectrum or non-race-specific resistance, is a promising alternative to less durable race-specific resistance for crop improvement, yet evidence that validates the impact of QTL combinations (pyramids) on the durability of plant disease resista...

  1. Cloning of genes responsible for acetic acid resistance in Acetobacter aceti.

    Science.gov (United States)

    Fukaya, M; Takemura, H; Okumura, H; Kawamura, Y; Horinouchi, S; Beppu, T

    1990-04-01

    Five acetic acid-sensitive mutants of Acetobacter aceti subsp. aceti no. 1023 were isolated by mutagenesis with N-methyl-N'-nitro-N-nitrosoguanidine. Three recombinant plasmids that complemented the mutations were isolated from a gene bank of the chromosome DNA of the parental strain constructed in Escherichia coli by using cosmid vector pMVC1. One of these plasmids (pAR1611), carrying about a 30-kilobase-pair (kb) fragment that conferred acetic acid resistance to all five mutants, was further analyzed. Subcloning experiments indicated that a 8.3-kb fragment was sufficient to complement all five mutations. To identify the mutation loci and genes involved in acetic acid resistance, insertional inactivation was performed by insertion of the kanamycin resistance gene derived from E. coli plasmid pACYC177 into the cloned 8.3-kb fragment and successive integration into the chromosome of the parental strain. The results suggested that three genes, designated aarA, aarB, and aarC, were responsible for expression of acetic acid resistance. Gene products of these genes were detected by means of overproduction in E. coli by use of the lac promoter. The amino acid sequence of the aarA gene product deduced from the nucleotide sequence was significantly similar to those of the citrate synthases (CSs) of E. coli and other bacteria. The A. aceti mutants defective in the aarA gene were found to lack CS activity, which was restored by introduction of a plasmid containing the aarA gene. A mutation in the CS gene of E. coli was also complemented by the aarA gene. These results indicate that aarA is the CS gene.

  2. Characterisation of integrons and antibiotic resistance genes in Danish multiresistant Salmonella enterica Typhimurium DT104

    DEFF Research Database (Denmark)

    Sandvang, Dorthe; Aarestrup, Frank Møller; Jensen, Lars Bogø

    1997-01-01

    The presence and genetic content of integrons was investigated in eight Salmonella enterica Typhimurium DT104 isolates from different pig herds in Denmark. Two different integrons were identified using PCR and sequencing. Each of the integrons carried a single resistance cassette in addition...... to the sul1 and qacE Delta 1 genes characteristic of integrons. The first integron encoded the ant (3 ")-Ia gene that specified resistance to spectinomycin and streptomycin. The second contained the pse-l beta-lactamase gene. All the multiresistant strains contained both integrons. The presence of these two...... integrons did not account for the total phenotypic resistance of all the isolates and does not exclude the presence of other mobile DNA elements....

  3. Characterisation of integrons and antibiotic resistance genes in Danish multiresistant Salmonella enterica Typhimurium DT104

    DEFF Research Database (Denmark)

    Sandvang, Dorthe; Aarestrup, Frank Møller; Jensen, Lars Bogø

    1998-01-01

    The presence and genetic content of integrons was investigated in eight Salmonella enteritica Typhimurium DT104 isolates from different pig herds in Denmark. Two different integrons were identified using PCR and sequencing. Each of the integrons carried a single resistance cassette in addition...... to the sul1 and qacE Delta 1 genes characteristic of integrons. The first integron encoded the ant (3")-Ia gene that specified resistance to spectinomycin and streptomycin. The second contained the pse-1 beta-lactamase gene. All the multiresistant strains contained both integrons. The presence of these two...... integrons did not account for the total phenotypic resistance of all the isolates and does not exclude the presence of other mobile DNA elements....

  4. Transcriptome analysis of Brassica rapa near-isogenic lines carrying clubroot-resistant and –susceptible alleles in response to Plasmodiophora brassicae during early infection

    Directory of Open Access Journals (Sweden)

    Jingjing eChen

    2016-01-01

    Full Text Available Although Plasmodiophora brassicae is one of the most common pathogens worldwide, the causal agent of clubroot disease in Brassica crops, resistance mechanisms to it are still only poorly understood. To study the early defense response induced by P. brassicae infection, a global transcriptome profiling of the roots of two near-isogenic lines (NILs of clubroot-resistant (CR BJN3-2 and clubroot-susceptible (BJN3-2 Chinese cabbage (Brassica rapa was performed by RNA-seq. Among the 42,730 unique genes mapped to the reference genome of B. rapa, 1,875 and 2,103 genes were found to be up- and down-regulated between CR BJN3-2 and BJN3-2, respectively, at 0, 12, 72, and 96 hours after inoculation (hai. Functional annotation showed that most of the differently expressed genes are involved in metabolism, transport, signal transduction, and defense. Of the genes assigned to plant-pathogen interactions, 151 showed different expression patterns between two NILs, including genes associated with pathogen-associated molecular patterns (PAMPs and effectors recognition, calcium ion influx, hormone signaling, pathogenesis-related (PR genes, transcription factors, and cell wall modification. In particular, the expression level of effector receptors (resistance proteins, PR genes involved in salicylic acid (SA signaling pathway, were higher in clubroot-resistant NIL, while half of the PAMP receptors were suppressed in CR BJN3-2. This suggests that there was a more robust effector-triggered immunity (ETI response in CR BJN3-2 and that SA signaling was important to clubroot resistance. The dataset generated by our transcriptome profiling may prove invaluable for further exploration of the different responses to P. brassicae between clubroot-resistant and clubroot-susceptible genotypes, and it will strongly contribute to a better understanding of the molecular mechanisms of resistance genes of B. rapa against P. brassicae infection.

  5. Validation of candidate genes putatively associated with resistance to SCMV and MDMV in maize (Zea mays L.) by expression profiling.

    Science.gov (United States)

    Uzarowska, Anna; Dionisio, Giuseppe; Sarholz, Barbara; Piepho, Hans-Peter; Xu, Mingliang; Ingvardsen, Christina Rønn; Wenzel, Gerhard; Lübberstedt, Thomas

    2009-02-02

    The potyviruses sugarcane mosaic virus (SCMV) and maize dwarf mosaic virus (MDMV) are major pathogens of maize worldwide. Two loci, Scmv1 and Scmv2, have ealier been shown to confer complete resistance to SCMV. Custom-made microarrays containing previously identified SCMV resistance candidate genes and resistance gene analogs were utilised to investigate and validate gene expression and expression patterns of isogenic lines under pathogen infection in order to obtain information about the molecular mechanisms involved in maize-potyvirus interactions. By employing time course microarray experiments we identified 68 significantly differentially expressed sequences within the different time points. The majority of differentially expressed genes differed between the near-isogenic line carrying Scmv1 resistance locus at chromosome 6 and the other isogenic lines. Most differentially expressed genes in the SCMV experiment (75%) were identified one hour after virus inoculation, and about one quarter at multiple time points. Furthermore, most of the identified mapped genes were localised outside the Scmv QTL regions. Annotation revealed differential expression of promising pathogenesis-related candidate genes, validated by qRT-PCR, coding for metallothionein-like protein, S-adenosylmethionine synthetase, germin-like protein or 26S ribosomal RNA. Our study identified putative candidate genes and gene expression patterns related to resistance to SCMV. Moreover, our findings support the effectiveness and reliability of the combination of different expression profiling approaches for the identification and validation of candidate genes. Genes identified in this study represent possible future targets for manipulation of SCMV resistance in maize.

  6. Herbicide resistance-endowing ACCase gene mutations in hexaploid wild oat (Avena fatua): insights into resistance evolution in a hexaploid species

    Science.gov (United States)

    Yu, Q; Ahmad-Hamdani, M S; Han, H; Christoffers, M J; Powles, S B

    2013-01-01

    Many herbicide-resistant weed species are polyploids, but far too little about the evolution of resistance mutations in polyploids is understood. Hexaploid wild oat (Avena fatua) is a global crop weed and many populations have evolved herbicide resistance. We studied plastidic acetyl-coenzyme A carboxylase (ACCase)-inhibiting herbicide resistance in hexaploid wild oat and revealed that resistant individuals can express one, two or three different plastidic ACCase gene resistance mutations (Ile-1781-Leu, Asp-2078-Gly and Cys-2088-Arg). Using ACCase resistance mutations as molecular markers, combined with genetic, molecular and biochemical approaches, we found in individual resistant wild-oat plants that (1) up to three unlinked ACCase gene loci assort independently following Mendelian laws for disomic inheritance, (2) all three of these homoeologous ACCase genes were transcribed, with each able to carry its own mutation and (3) in a hexaploid background, each individual ACCase resistance mutation confers relatively low-level herbicide resistance, in contrast to high-level resistance conferred by the same mutations in unrelated diploid weed species of the Poaceae (grass) family. Low resistance conferred by individual ACCase resistance mutations is likely due to a dilution effect by susceptible ACCase expressed by homoeologs in hexaploid wild oat and/or differential expression of homoeologous ACCase gene copies. Thus, polyploidy in hexaploid wild oat may slow resistance evolution. Evidence of coexisting non-target-site resistance mechanisms among wild-oat populations was also revealed. In all, these results demonstrate that herbicide resistance and its evolution can be more complex in hexaploid wild oat than in unrelated diploid grass weeds. Our data provide a starting point for the daunting task of understanding resistance evolution in polyploids. PMID:23047200

  7. Herbicide resistance-endowing ACCase gene mutations in hexaploid wild oat (Avena fatua): insights into resistance evolution in a hexaploid species.

    Science.gov (United States)

    Yu, Q; Ahmad-Hamdani, M S; Han, H; Christoffers, M J; Powles, S B

    2013-03-01

    Many herbicide-resistant weed species are polyploids, but far too little about the evolution of resistance mutations in polyploids is understood. Hexaploid wild oat (Avena fatua) is a global crop weed and many populations have evolved herbicide resistance. We studied plastidic acetyl-coenzyme A carboxylase (ACCase)-inhibiting herbicide resistance in hexaploid wild oat and revealed that resistant individuals can express one, two or three different plastidic ACCase gene resistance mutations (Ile-1781-Leu, Asp-2078-Gly and Cys-2088-Arg). Using ACCase resistance mutations as molecular markers, combined with genetic, molecular and biochemical approaches, we found in individual resistant wild-oat plants that (1) up to three unlinked ACCase gene loci assort independently following Mendelian laws for disomic inheritance, (2) all three of these homoeologous ACCase genes were transcribed, with each able to carry its own mutation and (3) in a hexaploid background, each individual ACCase resistance mutation confers relatively low-level herbicide resistance, in contrast to high-level resistance conferred by the same mutations in unrelated diploid weed species of the Poaceae (grass) family. Low resistance conferred by individual ACCase resistance mutations is likely due to a dilution effect by susceptible ACCase expressed by homoeologs in hexaploid wild oat and/or differential expression of homoeologous ACCase gene copies. Thus, polyploidy in hexaploid wild oat may slow resistance evolution. Evidence of coexisting non-target-site resistance mechanisms among wild-oat populations was also revealed. In all, these results demonstrate that herbicide resistance and its evolution can be more complex in hexaploid wild oat than in unrelated diploid grass weeds. Our data provide a starting point for the daunting task of understanding resistance evolution in polyploids.

  8. Characterization of a new metallo-beta-lactamase gene, bla(NDM-1), and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India.

    Science.gov (United States)

    Yong, Dongeun; Toleman, Mark A; Giske, Christian G; Cho, Hyun S; Sundman, Kristina; Lee, Kyungwon; Walsh, Timothy R

    2009-12-01

    A Swedish patient of Indian origin traveled to New Delhi, India, and acquired a urinary tract infection caused by a carbapenem-resistant Klebsiella pneumoniae strain that typed to the sequence type 14 complex. The isolate, Klebsiella pneumoniae 05-506, was shown to possess a metallo-beta-lactamase (MBL) but was negative for previously known MBL genes. Gene libraries and amplification of class 1 integrons revealed three resistance-conferring regions; the first contained bla(CMY-4) flanked by ISEcP1 and blc. The second region of 4.8 kb contained a complex class 1 integron with the gene cassettes arr-2, a new erythromycin esterase gene; ereC; aadA1; and cmlA7. An intact ISCR1 element was shown to be downstream from the qac/sul genes. The third region consisted of a new MBL gene, designated bla(NDM-1), flanked on one side by K. pneumoniae DNA and a truncated IS26 element on its other side. The last two regions lie adjacent to one another, and all three regions are found on a 180-kb region that is easily transferable to recipient strains and that confers resistance to all antibiotics except fluoroquinolones and colistin. NDM-1 shares very little identity with other MBLs, with the most similar MBLs being VIM-1/VIM-2, with which it has only 32.4% identity. As well as possessing unique residues near the active site, NDM-1 also has an additional insert between positions 162 and 166 not present in other MBLs. NDM-1 has a molecular mass of 28 kDa, is monomeric, and can hydrolyze all beta-lactams except aztreonam. Compared to VIM-2, NDM-1 displays tighter binding to most cephalosporins, in particular, cefuroxime, cefotaxime, and cephalothin (cefalotin), and also to the penicillins. NDM-1 does not bind to the carbapenems as tightly as IMP-1 or VIM-2 and turns over the carbapenems at a rate similar to that of VIM-2. In addition to K. pneumoniae 05-506, bla(NDM-1) was found on a 140-kb plasmid in an Escherichia coli strain isolated from the patient's feces, inferring the

  9. Distribution of genes related to antimicrobial resistance in different oral environments: a systematic review.

    Science.gov (United States)

    Moraes, Ludmila Coutinho; Só, Marcus Vinícius Reis; Dal Pizzol, Tatiane da Silva; Ferreira, Maria Beatriz Cardoso; Montagner, Francisco

    2015-04-01

    The oral cavity is the main source of microorganisms for odontogenic infections. It is important to perform an extensive analysis regarding the reports on the presence of bacteria that carry resistance genes to antimicrobial agents. The aim of the study was to verify the reports on the distribution of genes associated with resistance to antibiotics prescribed in dentistry in different human oral sites. A systematic review was conducted in electronic databases and gray literature to analyze clinical studies that detected genes of bacterial resistance to antibiotics in saliva, supragingival biofilm, and endodontic infections. Data regarding the research group, geographic location, sample source, number of subjects, methods for sample analysis, the targeted gene groups, and the detection rates were collected. Descriptive data analysis was performed. Preliminary analysis was performed in 152 titles; 50 abstracts were reviewed, and 29 full texts were obtained. Nine articles matched the inclusion criteria (saliva = 2, supragingival biofilm = 1, and endodontic infections = 6). The presence of 33 different targeted genes was evaluated. The most frequently investigated groups of genes were tetracycline and lactamics (tetM, tetQ, tetW, and cfxA). There was a wide range for the detection rates of each resistance gene among studies and for each specific gene group. This systematic review highlights the presence of resistance genes to antimicrobial agents in saliva, dental biofilm, and endodontic infections, especially for tetracycline and lactamics. There is a lack of reports on the presence of genes and resulting outcomes obtained through the therapeutic approaches for infection control. Copyright © 2015 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  10. The New Macrolide-Lincosamide-Streptogramin B Resistance Gene erm(45) Is Located within a Genomic Island in Staphylococcus fleurettii

    DEFF Research Database (Denmark)

    Wipf, Juliette R K; Schwendener, Sybille; Nielsen, Jesper Boye

    2015-01-01

    Genome alignment of a macrolide, lincosamide, and streptogramin B (MLSB)-resistant Staphylococcus fleurettii strain with an MLSB-susceptible S. fleurettii strain revealed a novel 11,513-bp genomic island carrying the new erythromycin resistance methylase gene erm(45). This gene was shown to confer...... inducible MLSB resistance when cloned into Staphylococcus aureus. The erm(45)-containing island was integrated into the housekeeping gene guaA in S. fleurettii and was able to form a circular intermediate but was not transmissible to S. aureus....

  11. Induced mutations of rust resistance genes in wheat

    International Nuclear Information System (INIS)

    McIntosh, R.A.

    1983-01-01

    Induced mutations are being used as a tool to study genes for resistance in wheat. It was found that Pm1 can be separated from Lr20 and Sr15, but these two react like a single pleiotropic gene. Mutants were further examined in crosses and backmutations have been attempted. (author)

  12. Characterization of genomic sequence of a drought-resistant gene ...

    Indian Academy of Sciences (India)

    Characterization of genomic sequence of a drought-resistant gene. TaSnRK2.7 in wheat species. HONG YING ZHANG1,2, WEI LI3, XIN GUO MAO1 and RUI LIAN JING1∗. 1The National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science,. Chinese Academy of Agricultural Sciences, ...

  13. Testing of disease-resistance of pokeweed antiviral protein gene ...

    African Journals Online (AJOL)

    Transformation of pokeweed antiviral protein gene (PAP) into plants was shown to improve plant resistance to several viruses or fungi pathogens with no much negative effect on plant growth. The non-virulent defective PAP inhibits only the virus but does not interfere with the host. A non-virulent defective PAP gene ...

  14. Isolation and characterization of a candidate gene for resistance to ...

    African Journals Online (AJOL)

    xudelin

    2012-05-17

    May 17, 2012 ... Cereal cyst nematode (CCN) (Heterodera avenae Woll.) is one of the most economically damaging endoparasite pests of wheat worldwide. We isolated and characterized a novel cereal CCN resistance candidate gene, CreV8, from Aegilops variabilis (2n = 28, UUSvSv). The gene was 3,568 bp long and.

  15. Expansion of the clinical ocular spectrum of Wolfram Syndrome in a family carrying a novel WFS1 gene deletion.

    Science.gov (United States)

    Chacón-Camacho, Oscar; Arce-Gonzalez, Rocio; Granillo-Alvarez, Mariella; Flores-Limas, Sanjuanita; Ramírez, Magdalena; Zenteno, Juan C

    2013-12-01

    To present the results of the clinical and molecular analyses of a familial case of Wolfram Syndrome (WFS) associated with a novel ocular anomaly. Full ophthalmologic examination was performed in two WFS siblings. Visante OCT imaging was used for assessing anterior segment anomalies. Genetic analysis included PCR amplification and exon-by-exon nucleotide sequencing of the WFS1 gene. Ocular anomalies in both affected siblings included congenital cataract, glaucoma, and optic atrophy. Interestingly, microspherophakia, a feature that has not been previously associated with WFS, was observed in both siblings. Genetic analysis disclosed a novel c.1525_1539 homozygous deletion in exon 8 of WFS1 in DNA from both affected patients. The recognition of microspherophakia in two siblings carrying a novel WFS1 mutation expands the clinical and molecular spectrum of Wolfram syndrome.

  16. Fine Mapping and Characterization of Candidate Genes that Control Resistance to Cercospora sojina K. Hara in Two Soybean Germplasm Accessions.

    Directory of Open Access Journals (Sweden)

    Anh-Tung Pham

    Full Text Available Frogeye leaf spot (FLS, caused by the fungus Cercospora sojina K. Hara, may cause a significant yield loss to soybean growers in regions with a warm and humid climate. Two soybean accessions, PI 594891 and PI 594774, were identified to carry a high level of resistance similar to that conditioned by the Rcs3 gene in 'Davis'. Previously, we reported that the resistance to FLS in these two plant introductions (PIs was controlled by a novel gene (s on chromosome 13 that is different from Rcs3. To fine-map the novel FLS resistance gene(s in these two PIs, F2: 3 seeds from the crosses between PI 594891 and PI 594774, and the FLS susceptible genotype 'Blackhawk' were genotyped with SNP markers that were designed based on the SoySNP50k iSelect BeadChip data to identify recombinant events and locate candidate genes. Analysis of lines possessing key recombination events helped narrow down the FLS-resistance genomic region in PI 594891 from 3.3 Mb to a 72.6 kb region with five annotated genes. The resistance gene in PI 594774 was fine-mapped into a 540 kb region that encompasses the 72.6 kb region found in PI 594891. Sequencing five candidate genes in PI 594891 identified three genes that have several mutations in the promoter, intron, 5', and 3' UTR regions. qPCR analysis showed a difference in expression levels of these genes in both lines compared to Blackhawk in the presence of C. sojina. Based on phenotype, genotype and haplotype analysis results, these two soybean accessions might carry different resistance alleles of the same gene or two different gene(s. The identified SNPs were used to develop Kompetitive Allele Specific PCR (KASP assays to detect the resistance alleles on chromosome 13 from the two PIs for marker-assisted selection.

  17. Molecular mapping of soybean rust (Phakopsora pachyrhizi) resistance genes: discovery of a novel locus and alleles.

    Science.gov (United States)

    Garcia, Alexandre; Calvo, Eberson Sanches; de Souza Kiihl, Romeu Afonso; Harada, Arlindo; Hiromoto, Dario Minoru; Vieira, Luiz Gonzaga Esteves

    2008-08-01

    Soybean production in South and North America has recently been threatened by the widespread dissemination of soybean rust (SBR) caused by the fungus Phakopsora pachyrhizi. Currently, chemical spray containing fungicides is the only effective method to control the disease. This strategy increases production costs and exposes the environment to higher levels of fungicides. As a first step towards the development of SBR resistant cultivars, we studied the genetic basis of SBR resistance in five F2 populations derived from crossing the Brazilian-adapted susceptible cultivar CD 208 to each of five different plant introductions (PI 200487, PI 200526, PI 230970, PI 459025, PI 471904) carrying SBR-resistant genes (Rpp). Molecular mapping of SBR-resistance genes was performed in three of these PIs (PI 459025, PI 200526, PI 471904), and also in two other PIs (PI 200456 and 224270). The strategy mapped two genes present in PI 230970 and PI 459025, the original sources of Rpp2 and Rpp4, to linkage groups (LG) J and G, respectively. A new SBR resistance locus, rpp5 was mapped in the LG-N. Together, the genetic and molecular analysis suggested multiple alleles or closely linked genes that govern SBR resistance in soybean.

  18. Diversity of Antibiotic Resistance Genes in Enterococcus Strains Isolated from Ready-to-Eat Meat Products.

    Science.gov (United States)

    Chajęcka-Wierzchowska, Wioleta; Zadernowska, Anna; Łaniewska-Trokenheim, Łucja

    2016-10-25

    The objective of the study was to answer the question of whether the ready-to-eat meat products can pose indirect hazard for consumer health serving as reservoir of Enterococcus strains harboring tetracyclines, aminoglycosides, and macrolides resistance genes. A total of 390 samples of ready-to-eat meat products were investigated. Enterococcus strains were found in 74.1% of the samples. A total of 302 strains were classified as: Enterococcus faecalis (48.7%), Enterococcus faecium (39.7%), Enterococcus casseliflavus (4.3%), Enterococcus durans (3.0%), Enterococcus hirae (2.6%), and other Enterococcus spp. (1.7%). A high percentage of isolates were resistant to streptomycin high level (45%) followed by erythromycin (42.7%), fosfomycin (27.2%), rifampicin (19.2%), tetracycline (36.4%), tigecycline (19.9%). The ant(6')-Ia gene was the most frequently found gene (79.6%). Among the other genes that encode aminoglycosides-modifying enzymes, the highest portion of the strains had the aac(6')-Ie-aph(2'')-Ia (18.5%) and aph(3'')-IIIa (16.6%), but resistance of isolates from food is also an effect of the presence of aph(2'')-Ib, aph(2'')-Ic, aph(2'')-Id genes. Resistance to tetracyclines was associated with the presence of tetM (43.7%), tetL (32.1%), tetK (14.6%), tetW (0.7%), and tetO (0.3%) genes. The ermB and ermA genes were found in 33.8% and 18.9% of isolates, respectively. Nearly half of the isolates contained a conjugative transposon of the Tn916/Tn1545 family. Enterococci are widely present in retail ready-to-eat meat products. Many isolated strains (including such species as E. casseliflavus, E. durans, E. hirae, and Enterococcus gallinarum) are antibiotic resistant and carry transferable resistance genes. © 2016 Institute of Food Technologists®.

  19. Glioma stem cells targeted by oncolytic virus carrying endostatin-angiostatin fusion gene and the expression of its exogenous gene in vitro.

    Science.gov (United States)

    Zhu, Guidong; Su, Wei; Jin, Guishan; Xu, Fujian; Hao, Shuyu; Guan, Fangxia; Jia, William; Liu, Fusheng

    2011-05-16

    The development of the cancer stem cell (CSCs) niche theory has provided a new target for the treatment of gliomas. Gene therapy using oncolytic viral vectors has shown great potential for the therapeutic targeting of CSCs. To explore whether a viral vector carrying an exogenous Endo-Angio fusion gene (VAE) can infect and kill glioma stem cells (GSCs), as well as inhibit their vascular niche in vitro, we have collected surgical specimens of human high-grade glioma (world health organization, WHO Classes III-VI) from which we isolated and cultured GSCs under conditions originally designed for the selective expansion of neural stem cells. Our results demonstrate the following: (1) Four lines of GSCs (isolated from 20 surgical specimens) could grow in suspension, were multipotent, had the ability to self-renew and expressed the neural stem cell markers, CD133 and nestin. (2) VAE could infect GSCs and significantly inhibit their viability. (3) The Endo-Angio fusion gene was expressed in GSCs 48 h after VAE infection and could inhibit the proliferation of human brain microvascular endothelial cells (HBMEC). (4) Residual viable cells lose the ability of self-renewal and adherent differentiation. In conclusion, VAE can significantly inhibit the activity of GSCs in vitro and the expression of exogenous Endo-Angio fusion gene can inhibit HBMEC proliferation. VAE can be used as a novel virus-gene therapy strategy for glioma. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Isolation of murine peritoneal macrophages to carry out gene expression analysis upon Toll-like receptors stimulation.

    Science.gov (United States)

    Layoun, Antonio; Samba, Macha; Santos, Manuela M

    2015-04-29

    During infection and inflammation, circulating monocytes leave the bloodstream and migrate into tissues, where they differentiate into macrophages. Macrophages express surface Toll-like receptors (TLRs), which recognize molecular patterns conserved through evolution in a wide range of microorganisms. TLRs play a central role in macrophage activation which is usually associated with gene expression alteration. Macrophages are critical in many diseases and have emerged as attractive targets for therapy. In the following protocol, we describe a procedure to isolate murine peritoneal macrophages using Brewer's thioglycollate medium. The latter will boost monocyte migration into the peritoneum, accordingly this will raise macrophage yield by 10-fold. Several studies have been carried out using bone marrow, spleen or peritoneal derived macrophages. However, peritoneal macrophages were shown to be more mature upon isolation and are more stable in their functionality and phenotype. Thus, macrophages isolated from murine peritoneal cavity present an important cell population that can serve in different immunological and metabolic studies. Once isolated, macrophages were stimulated with different TLR ligands and consequently gene expression was evaluated.

  1. Prevalence of tetracycline resistance genes among multi-drug resistant bacteria from selected water distribution systems in southwestern Nigeria.

    Science.gov (United States)

    Adesoji, Ayodele T; Ogunjobi, Adeniyi A; Olatoye, Isaac O; Call, Douglas R; Douglas, Douglas R

    2015-06-25

    Antibiotic resistance genes [ARGs] in aquatic systems have drawn increasing attention they could be transferred horizontally to pathogenic bacteria. Water treatment plants (WTPs) are intended to provide quality and widely available water to the local populace they serve. However, WTPs in developing countries may not be dependable for clean water and they could serve as points of dissemination for antibiotic resistant bacteria. Only a few studies have investigated the occurrence of ARGs among these bacteria including tetracycline resistance genes in water distribution systems in Nigeria. Multi-drug resistant (MDR) bacteria, including resistance to tetracycline, were isolated from treated and untreated water distribution systems in southwest Nigeria. MDR bacteria were resistant to >3 classes of antibiotics based on break-point assays. Isolates were characterized using partial 16S rDNA sequencing and PCR assays for six tetracycline-resistance genes. Plasmid conjugation was evaluated using E. coli strain DH5α as the recipient strain. Out of the 105 bacteria, 85 (81 %) and 20 (19 %) were Gram- negative or Gram- positive, respectively. Twenty-nine isolates carried at least one of the targeted tetracycline resistance genes including strains of Aeromonas, Alcaligenes, Bacillus, Klebsiella, Leucobacter, Morganella, Proteus and a sequence matching a previously uncultured bacteria. Tet(A) was the most prevalent (16/29) followed by tet(E) (4/29) and tet30 (2/29). Tet(O) was not detected in any of the isolates. Tet(A) was mostly found with Alcaligenes strains (9/10) and a combination of more than one resistance gene was observed only amongst Alcaligenes strains [tet(A) + tet30 (2/10), tet(A) + tet(E) (3/10), tet(E) + tet(M) (1/10), tet(E) + tet30 (1/10)]. Tet(A) was transferred by conjugation for five Alcaligenes and two E. coli isolates. This study found a high prevalence of plasmid-encoded tet(A) among Alcaligenes isolates, raising the possibility that this

  2. Influence of mutations in some structural genes of heat-shock proteins on radiation resistance of Escherichia coli

    International Nuclear Information System (INIS)

    Verbenko, V.N.; Kuznetsova, L.V.; Bikineeva, E.G.; Kalinin, V.L.

    1992-01-01

    Lethal effects of γ-irradiation were studied in Escherichia coli strains with normal repair genotype and in radiation-resistant Gam r strains, both carrying additional mutations in the structural genes dnaK, grpE, groES or groEL. The null mutation ΔdnaK52::Cm r enhanced radiation sensitivity of wild-type cells and abolished the effect of heat induced rediation-resistance (ETIRR) and elevated radiation resistance of the Gam r strains

  3. L-malate enhances the gene expression of carried proteins and antioxidant enzymes in liver of aged rats.

    Science.gov (United States)

    Zeng, X; Wu, J; Wu, Q; Zhang, J

    2015-01-01

    Previous studies in our laboratory reported L-malate as a free radical scavenger in aged rats. To investigate the antioxidant mechanism of L-malate in the mitochondria, we analyzed the change in gene expression of two malate-aspartate shuttle (MAS)-related carried proteins (AGC, aspartate/glutamate carrier and OMC, oxoglutarate/malate carrier) in the inner mitochondrial membrane, and three antioxidant enzymes (CAT, SOD, and GSH-Px) in the mitochondria. The changes in gene expression of these proteins and enzymes were examined by real-time RT-PCR in the heart and liver of aged rats treated with L-malate. L-malate was orally administered in rats continuously for 30 days using a feeding atraumatic needle. We found that the gene expression of OMC and GSH-Px mRNA in the liver increased by 39 % and 38 %, respectively, in the 0.630 g/kg L-malate treatment group than that in the control group. The expression levels of SOD mRNA in the liver increased by 39 %, 56 %, and 78 % in the 0.105, 0.210, and 0.630 g/kg L-malate treatment groups, respectively. No difference were observed in the expression levels of AGC, OMC, CAT, SOD, and GSH-Px mRNAs in the heart of rats between the L-malate treatment and control groups. These results predicted that L-malate may increase the antioxidant capacity of mitochondria by enhancing the expression of mRNAs involved in the MAS and the antioxidant enzymes.

  4. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  5. Interspecies gene transfer provides soybean resistance to a fungal pathogen.

    Science.gov (United States)

    Langenbach, Caspar; Schultheiss, Holger; Rosendahl, Martin; Tresch, Nadine; Conrath, Uwe; Goellner, Katharina

    2016-02-01

    Fungal pathogens pose a major challenge to global crop production. Crop varieties that resist disease present the best defence and offer an alternative to chemical fungicides. Exploiting durable nonhost resistance (NHR) for crop protection often requires identification and transfer of NHR-linked genes to the target crop. Here, we identify genes associated with NHR of Arabidopsis thaliana to Phakopsora pachyrhizi, the causative agent of the devastating fungal disease called Asian soybean rust. We transfer selected Arabidopsis NHR-linked genes to the soybean host and discover enhanced resistance to rust disease in some transgenic soybean lines in the greenhouse. Interspecies NHR gene transfer thus presents a promising strategy for genetically engineered control of crop diseases. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  6. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    Energy Technology Data Exchange (ETDEWEB)

    Makarova, Kira S. [National Center for Biotechnology Information; Omelchenko, Marina [National Center for Biotechnology Information; Gaidamakova, Elena [Uniformed Services University of the Health Sciences (USUHS); Matrosova, Vera [Uniformed Services University of the Health Sciences (USUHS); Vasilenko, Alexander [Uniformed Services University of the Health Sciences (USUHS); Zhai, Min [Uniformed Services University of the Health Sciences (USUHS); Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Copeland, A [U.S. Department of Energy, Joint Genome Institute; Kim, Edwin [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Pitluck, Samual [U.S. Department of Energy, Joint Genome Institute; Richardson, P M [U.S. Department of Energy, Joint Genome Institute; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Brettin, Tom [Los Alamos National Laboratory (LANL); Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Lai, Barry [Argonne National Laboratory (ANL); Ravel, Bruce [Argonne National Laboratory (ANL); Kemner, Kenneth M [Argonne National Laboratory (ANL); Wolf, Yuri [National Center for Biotechnology Information; Sorokin, Alexei [Genetique Microbienne; Gerasimova, Anna [Research Institute of Genetics and Selection of Industrial Microorganisms, Mosco; Gelfand, Mikhail [Moscow State University; Fredrickson, James K [Pacific Northwest National Laboratory (PNNL); Koonin, Eugene [National Center for Biotechnology Information; Daly, Michael [Uniformed Services University of the Health Sciences (USUHS)

    2007-01-01

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at its optimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  7. Deinococcus geothermalis: The Pool of Extreme Radiation Resistance Genes Shrinks

    Energy Technology Data Exchange (ETDEWEB)

    Makarova, Kira S.; Omelchenko, Marina V.; Gaidamakova, Elena K.; Matrosova, Vera Y.; Vasilenko, Alexander; Zhai, Min; Lapidus, Alla; Copeland, Alex; Kim, Edwin; Land, Miriam; Mavrommatis, Konstantinos; Pitluck, Samuel; Richardson, Paul M.; Detter, Chris; Brettin, Thomas; Saunders, Elizabeth; Lai, Barry; Ravel, Bruce; Kemner, Kenneth M.; Wolf, Yuri I.; Sorokin, Alexander; Gerasimova, Anna V.; Gelfand, Mikhail S.; Fredrickson, James K.; Koonin, Eugene V.; Daly, Michael J.

    2007-07-24

    Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR), ultraviolet light (UV) and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at itsoptimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and contribute to

  8. Deinococcus geothermalis: the pool of extreme radiation resistance genes shrinks.

    Directory of Open Access Journals (Sweden)

    Kira S Makarova

    2007-09-01

    Full Text Available Bacteria of the genus Deinococcus are extremely resistant to ionizing radiation (IR, ultraviolet light (UV and desiccation. The mesophile Deinococcus radiodurans was the first member of this group whose genome was completely sequenced. Analysis of the genome sequence of D. radiodurans, however, failed to identify unique DNA repair systems. To further delineate the genes underlying the resistance phenotypes, we report the whole-genome sequence of a second Deinococcus species, the thermophile Deinococcus geothermalis, which at its optimal growth temperature is as resistant to IR, UV and desiccation as D. radiodurans, and a comparative analysis of the two Deinococcus genomes. Many D. radiodurans genes previously implicated in resistance, but for which no sensitive phenotype was observed upon disruption, are absent in D. geothermalis. In contrast, most D. radiodurans genes whose mutants displayed a radiation-sensitive phenotype in D. radiodurans are conserved in D. geothermalis. Supporting the existence of a Deinococcus radiation response regulon, a common palindromic DNA motif was identified in a conserved set of genes associated with resistance, and a dedicated transcriptional regulator was predicted. We present the case that these two species evolved essentially the same diverse set of gene families, and that the extreme stress-resistance phenotypes of the Deinococcus lineage emerged progressively by amassing cell-cleaning systems from different sources, but not by acquisition of novel DNA repair systems. Our reconstruction of the genomic evolution of the Deinococcus-Thermus phylum indicates that the corresponding set of enzymes proliferated mainly in the common ancestor of Deinococcus. Results of the comparative analysis weaken the arguments for a role of higher-order chromosome alignment structures in resistance; more clearly define and substantially revise downward the number of uncharacterized genes that might participate in DNA repair and

  9. Expression and loss of alleles in cultured mouse embryonic fibroblasts and stem cells carrying allelic fluorescent protein genes

    Directory of Open Access Journals (Sweden)

    Stringer Saundra L

    2006-10-01

    Full Text Available Abstract Background Loss of heterozygosity (LOH contributes to many cancers, but the rate at which these events occur in normal cells of the body is not clear. LOH would be detectable in diverse cell types in the body if this event were to confer an obvious cellular phenotype. Mice that carry two different fluorescent protein genes as alleles of a locus would seem to be a useful tool for addressing this issue because LOH would change a cell's phenotype from dichromatic to monochromatic. In addition, LOH caused by mitotic crossing over might be discernable in tissues because this event produces a pair of neighboring monochromatic cells that are different colors. Results As a step in assessing the utility of this approach, we derived primary embryonic fibroblast populations and embryonic stem cell lines from mice that carried two different fluorescent protein genes as alleles at the chromosome 6 locus, ROSA26. Fluorescence activated cell sorting (FACS showed that the vast majority of cells in each line expressed the two marker proteins at similar levels, and that populations exhibited expression noise similar to that seen in bacteria and yeast. Cells with a monochromatic phenotype were present at frequencies on the order of 10-4 and appeared to be produced at a rate of approximately 10-5 variant cells per mitosis. 45 of 45 stably monochromatic ES cell clones exhibited loss of the expected allele at the ROSA26 locus. More than half of these clones retained heterozygosity at a locus between ROSA26 and the centromere. Other clones exhibited LOH near the centromere, but were disomic for chromosome 6. Conclusion Allelic fluorescent markers allowed LOH at the ROSA26 locus to be detected by FACS. LOH at this locus was usually not accompanied by LOH near the centromere, suggesting that mitotic recombination was the major cause of ROSA26 LOH. Dichromatic mouse embryonic cells provide a novel system for studying genetic/karyotypic stability and factors

  10. Genes involved in barley yellow dwarf virus resistance of maize.

    Science.gov (United States)

    Horn, Frederike; Habekuß, Antje; Stich, Benjamin

    2014-12-01

    The results of our study suggest that genes involved in general resistance mechanisms of plants contribute to variation of BYDV resistance in maize. With increasing winter temperatures in Europe, Barley yellow dwarf virus (BYDV) is expected to become a prominent problem in maize cultivation. Breeding for resistance is the best strategy to control the disease and break the transmission cycle of the virus. The objectives of our study were (1) to determine genetic variation with respect to BYDV resistance in a broad germplasm set and (2) to identify single nucleotide polymorphism (SNP) markers linked to genes that are involved in BYDV resistance. An association mapping population with 267 genotypes representing the world's maize gene pool was grown in the greenhouse. Plants were inoculated with BYDV-PAV using viruliferous Rhopalosiphum padi. In the association mapping population, we observed considerable genotypic variance for the trait virus extinction as measured by double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) and the infection rate. In a genome-wide association study, we observed three SNPs significantly [false discovery rate (FDR) = 0.05] associated with the virus extinction on chromosome 10 explaining together 25 % of the phenotypic variance and five SNPs for the infection rate on chromosomes 4 and 10 explaining together 33 % of the phenotypic variance. The SNPs significantly associated with BYDV resistance can be used in marker assisted selection and will accelerate the breeding process for the development of BYDV resistant maize genotypes. Furthermore, these SNPs were located within genes which were in other organisms described to play a role in general resistance mechanisms. This suggests that these genes contribute to variation of BYDV resistance in maize.

  11. Mapping of a new stem rust resistance gene Sr49 in chromosome 5B of wheat.

    Science.gov (United States)

    Bansal, Urmil K; Muhammad, Sher; Forrest, Kerrie L; Hayden, Matthew J; Bariana, Harbans S

    2015-10-01

    A new stem rust resistance gene Sr49 was mapped to chromosome 5BL of wheat. Usefulness of the closely linked markers sun209 and sun479 for marker-assisted selection of Sr49 was demonstrated. Landrace AUS28011 (Mahmoudi), collected from Ghardimaou, Tunisia, produced low stem rust response against Australian pathotypes of Puccinia graminis f. sp. tritici (Pgt) carrying virulence for several stem rust resistance genes deployed in modern wheat cultivars. Genetic analysis based on a Mahmoudi/Yitpi F3 population indicated the involvement of a single all-stage stem rust resistance gene and it was temporarily named SrM. Bulked segregant analysis using multiplex-ready SSR technology located SrM on the long arm of chromosome 5B. Since there is no other all-stage stem rust resistance gene located in chromosome 5BL, SrM was permanently designated Sr49. The Mahmoudi/Yitpi F3 population was enhanced to generate F6 recombinant inbred line (RIL) population for detailed mapping of Sr49 using publicly available genomic resources. Markers sun209 and sun479 flanked Sr49 at 1.5 and 0.9 cM distally and proximally, respectively. Markers sun209 and sun479 amplified PCR products different than the Sr49-linked alleles in 146 and 145 common wheat cultivars, respectively. Six and seven cultivars, respectively, carried the resistance-linked marker alleles sun209 148bp and sun479 200bp ; however, none of the cultivars carried both resistance-linked alleles. These results demonstrated the usefulness of these markers for marker-assisted selection of Sr49 in breeding programs.

  12. Identifying resistance gene analogs associated with resistances to different pathogens in common bean.

    Science.gov (United States)

    López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe

    2003-01-01

    ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

  13. The relationship between codon usage bias and cold resistant genes

    International Nuclear Information System (INIS)

    Barozai, M.Y.; Din, M.

    2014-01-01

    This research is based on synonymous codon usage which has been well-known as a feature that affects typical expression level of protein in an organism. Different organisms prefer different codons for same amino acid and this is called Codon Usage Bias (CUB). The codon usage directly affects the level or even direction of changes in protein expression in responses to environmental stimuli. Cold stress is a major abiotic factor that limits the agricultural productivity of plants. In the recent study CUB has been studied in Arabidopsis thaliana cold resistant and housekeeping genes and their homologs in rice (Oryza sativa) to understand the cold stress and housekeeping genes relation with CUB. Six cold resistant and three housekeeping genes in Arabidopsis thaliana and their homologs in rice, were subjected to CUB analysis. The three cold resistant genes (DREB1B, RCI and MYB15) showed more than 50% (52%, 61% and 66% respectively) similar codon usage bias for Arabidopsis thaliana and rice. On the other hand three cold resistant genes (MPK3, ICE1 and ZAT12) showed less than 50% (38%, 38% and 47% respectively) similar codon usage bias for Arabidopsis thaliana and rice. The three housekeeping genes (Actin, Tubulin and Ubiquitin) showed 76% similar codon usage bias for Arabidopsis thaliana and rice. This study will help to manage the plant gene expression through codon optimization under the cold stress. (author)

  14. Seedling Resistance to Stem Rust and Molecular Marker Analysis of Resistance Genes in Wheat Cultivars of Yunnan, China.

    Science.gov (United States)

    Li, Tian Ya; Cao, Yuan Yin; Wu, Xian Xin; Xu, Xiao Feng; Wang, Wan Lin

    2016-01-01

    Stem rust is one of the most potentially harmful wheat diseases, but has been effectively controlled in China since 1970s. However, the interest in breeding wheat with durable resistance to stem rust has been renewed with the emergence of Ug99 (TTKSK) virulent to the widely used resistance gene Sr31, and by which the wheat stem rust was controlled for 40 years in wheat production area worldwide. Yunnan Province, located on the Southwest border of China, is one of the main wheat growing regions, playing a pivotal role in the wheat stem rust epidemic in China. This study investigated the levels of resistance in key wheat cultivars (lines) of Yunnan Province. In addition, the existence of Sr25, Sr26, Sr28, Sr31, Sr32, and Sr38 genes in 119 wheat cultivars was assessed using specific DNA markers. The results indicated that 77 (64.7%) tested wheat varieties showed different levels of resistance to all the tested races of Puccinia graminis f. sp. tritici. Using molecular markers, we identified the resistance gene Sr31 in 43 samples; Sr38 in 10 samples; Sr28 in 12 samples, and one sample which was resistant against Ug99 (avirulent to Sr32). No Sr25 or Sr26 (effective against Ug99) was identified in any cultivars tested. Furthermore, 5 out of 119 cultivars tested carried both Sr31 and Sr38 and eight contained both Sr31 and Sr28. The results enable the development of appropriate strategies to breed varieties resistant to stem rust.

  15. Seedling Resistance to Stem Rust and Molecular Marker Analysis of Resistance Genes in Wheat Cultivars of Yunnan, China.

    Directory of Open Access Journals (Sweden)

    Tian Ya Li

    Full Text Available Stem rust is one of the most potentially harmful wheat diseases, but has been effectively controlled in China since 1970s. However, the interest in breeding wheat with durable resistance to stem rust has been renewed with the emergence of Ug99 (TTKSK virulent to the widely used resistance gene Sr31, and by which the wheat stem rust was controlled for 40 years in wheat production area worldwide. Yunnan Province, located on the Southwest border of China, is one of the main wheat growing regions, playing a pivotal role in the wheat stem rust epidemic in China. This study investigated the levels of resistance in key wheat cultivars (lines of Yunnan Province. In addition, the existence of Sr25, Sr26, Sr28, Sr31, Sr32, and Sr38 genes in 119 wheat cultivars was assessed using specific DNA markers. The results indicated that 77 (64.7% tested wheat varieties showed different levels of resistance to all the tested races of Puccinia graminis f. sp. tritici. Using molecular markers, we identified the resistance gene Sr31 in 43 samples; Sr38 in 10 samples; Sr28 in 12 samples, and one sample which was resistant against Ug99 (avirulent to Sr32. No Sr25 or Sr26 (effective against Ug99 was identified in any cultivars tested. Furthermore, 5 out of 119 cultivars tested carried both Sr31 and Sr38 and eight contained both Sr31 and Sr28. The results enable the development of appropriate strategies to breed varieties resistant to stem rust.

  16. Multiplex single nucleotide polymorphism (SNP) assay for detection of soybean mosaic virus resistance genes in soybean.

    Science.gov (United States)

    Shi, Ainong; Chen, Pengyin; Vierling, Richard; Zheng, Cuming; Li, Dexiao; Dong, Dekun; Shakiba, Ehsan; Cervantez, Innan

    2011-02-01

    Soybean mosaic virus (SMV) is one of the most destructive viral diseases in soybean (Glycine max). Three independent loci for SMV resistance have been identified in soybean germplasm. The use of genetic resistance is the most effective method of controlling this disease. Marker assisted selection (MAS) has become very important and useful in the effort of selecting genes for SMV resistance. Single nucleotide polymorphism (SNP), because of its abundance and high-throughput potential, is a powerful tool in genome mapping, association studies, diversity analysis, and tagging of important genes in plant genomics. In this study, a 10 SNPs plus one insert/deletion (InDel) multiplex assay was developed for SMV resistance: two SNPs were developed from the candidate gene 3gG2 at Rsv1 locus, two SNPs selected from the clone N11PF linked to Rsv1, one 'BARC' SNP screened from soybean chromosome 13 [linkage group (LG) F] near Rsv1, two 'BARC' SNPs from probe A519 linked to Rsv3, one 'BARC' SNP from chromosome 14 (LG B2) near Rsv3, and two 'BARC' SNPs from chromosome 2 (LG D1b) near Rsv4, plus one InDel marker from expressed sequence tag (EST) AW307114 linked to Rsv4. This 11 SNP/InDel multiplex assay showed polymorphism among 47 diverse soybean germplasm, indicating this assay can be used to investigate the mode of inheritance in a SMV resistant soybean line carrying Rsv1, Rsv3, and/or Rsv4 through a segregating population with phenotypic data, and to select a specific gene or pyramid two or three genes for SMV resistance through MAS in soybean breeding program. The presence of two SMV resistance genes (Rsv1 and Rsv3) in J05 soybean was confirmed by the SNP assay.

  17. Epidemic Dissemination of a Carbapenem-Resistant Acinetobacter baumannii Clone Carrying armA Two Years After Its First Isolation in an Italian Hospital.

    Science.gov (United States)

    Milan, Annalisa; Furlanis, Linda; Cian, Franca; Bressan, Raffaela; Luzzati, Roberto; Lagatolla, Cristina; Deiana, Maria Luisa; Knezevich, Anna; Tonin, Enrico; Dolzani, Lucilla

    2016-12-01

    This study describes the dissemination of a carbapenem-resistant Acinetobacter baumannii (CRAB) strain in a university hospital in Northeast Italy. Characterization of the outbreak strain was combined with a retrospective analysis of all CRAB isolates collected in the same hospital during the 5 years preceding the outbreak, with the aim of elucidating the origin of the epidemic spread. The outbreak strain was shown to belong to the International Clone II and carry the bla OXA-23 gene, flanked by two ISAba1 sequences in opposite orientation (Tn2006 arrangement). The epidemic clone harbored also the bla OXA-66 allele of the carbapenemase intrinsic to A. baumannii, the determinant of ArmA 16S rRNA methylase and a class 1 integron, with the aacA4, catB8, and aadA1 cassette array. Genotype analysis, performed by macrorestriction analysis and VRBA, revealed that isolates related to outbreak strain had been sporadically collected from inpatients in the 2 years preceding outbreak start. Carriage of bla OXA-66 , armA, and the integron further supported relatedness of these isolates to the outbreak clone. Outbreak initially involved three medical wards, typically hosting elderly patients with a history of prolonged hospitalization. The study highlights the need to adopt strict infection control measures also when CRAB isolation appears to be a sporadic event.

  18. Genotypes, Virulence Factors and Antimicrobial Resistance Genes of Staphylococcus aureus Isolated in Bovine Subclinical Mastitis from Eastern China

    Directory of Open Access Journals (Sweden)

    Javed Memon§, Yongchun Yang§, Jam Kashifa, Muhammad Yaqoob, Rehana Buriroa, Jamila Soomroa, Wang Liping and Fan Hongjie*

    2013-11-01

    Full Text Available This study was carried out to determine the genotypes, virulence factors and antimicrobial resistance traits of 34 Staphylococcus aureus isolated from subclinical mastitis in Eastern China. Minimal inhibitory concentration (MIC results showed resistance to erythromycin in all isolates. A high frequency of Methicillin resistant S. aureus (MRSA; 29% was observed and these isolates were also highly resistant to penicillin, oxacillin, oxytetracycline and chloramphenicol than methicillin sensitive S. aureus (MSSA isolates. Thirteen pathogenic factors and seven resistance genes including mecA and blaZ gene were checked through PCR. The spaX gene was found in all isolates, whereas cna, spaIg, nuc, clfA, fnbpB, hlA, hlB and seA were present in 35, 79, 85, 59, 35, 85, 71 and 38% isolates, respectively. Nine isolates carried a group of 8 different virulence genes. Moreover, macrolide resistance genes ermB and ermC were present in all isolates. High resistance rate against methicillin was found but no isolate was positive for mecA gene, whereas blaZ and tetK were detected in 82 and 56% isolates, respectively. Genes; fnbpA, seB, seC, seD, dfrK and tetM were not found in any isolate. The statistical association between phenotypic resistance and virulence genes showed, clfA, fnbpB, hlB and seA, were potentially associated with penicillin G, ciprofloxacin, methicillin, chloramphenicol, trimethoprim and oxytetracycline resistance (P≤0.05. REP-PCR based genotyping showed seven distinct genotypes (A-G prevalent in this region. This study reports the presence of multidrug resistant S. aureus in sub-clinical mastitis which were also highly virulent that could be a major obstacle in the treatment of mastitis in this region of China.

  19. cor, a novel carbon monoxide resistance gene, is essential for Mycobacterium tuberculosis pathogenesis.

    Science.gov (United States)

    Zacharia, Vineetha M; Manzanillo, Paolo S; Nair, Vidhya R; Marciano, Denise K; Kinch, Lisa N; Grishin, Nick V; Cox, Jeffery S; Shiloh, Michael U

    2013-11-19

    Tuberculosis, caused by Mycobacterium tuberculosis, remains a devastating human infectious disease, causing two million deaths annually. We previously demonstrated that M. tuberculosis induces an enzyme, heme oxygenase (HO1), that produces carbon monoxide (CO) gas and that M. tuberculosis adapts its transcriptome during CO exposure. We now demonstrate that M. tuberculosis carries a novel resistance gene to combat CO toxicity. We screened an M. tuberculosis transposon library for CO-susceptible mutants and found that disruption of Rv1829 (carbon monoxide resistance, Cor) leads to marked CO sensitivity. Heterologous expression of Cor in Escherichia coli rescued it from CO toxicity. Importantly, the virulence of the cor mutant is attenuated in a mouse model of tuberculosis. Thus, Cor is necessary and sufficient to protect bacteria from host-derived CO. Taken together, this represents the first report of a role for HO1-derived CO in controlling infection of an intracellular pathogen and the first identification of a CO resistance gene in a pathogenic organism. Macrophages produce a variety of antimicrobial molecules, including nitric oxide (NO), hydrogen peroxide (H2O2), and acid (H+), that serve to kill engulfed bacteria. In addition to these molecules, human and mouse macrophages also produce carbon monoxide (CO) gas by the heme oxygenase (HO1) enzyme. We observed that, in contrast to other bacteria, mycobacteria are resistant to CO, suggesting that this might be an evolutionary adaptation of mycobacteria for survival within macrophages. We screened a panel of ~2,500 M. tuberculosis mutants to determine which genes are required for survival of M. tuberculosis in the presence of CO. Within this panel, we identified one such gene, cor, that specifically confers CO resistance. Importantly, we found that the ability of M. tuberculosis cells carrying a mutated copy of this gene to cause tuberculosis in a mouse disease model is significantly attenuated. This indicates that

  20. Typing of Panton-Valentine leukocidin-encoding phages carried by methicillin-susceptible and methicillin-resistant Staphylococcus aureus from Italy.

    Science.gov (United States)

    Sanchini, A; Del Grosso, M; Villa, L; Ammendolia, M G; Superti, F; Monaco, M; Pantosti, A

    2014-11-01

    Panton-Valentine leukocidin (PVL) is the hallmark of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) but can also be found in methicillin-susceptible S. aureus (MSSA) sharing pathogenic and epidemiological characteristics of CA-MRSA. PVL is encoded by two co-transcribed genes that are carried by different staphylococcal bacteriophages. We applied an extended PCR-based typing scheme for the identification of two morphological groups (elongated-head group and icosahedral-head group I phages) and specific PVL phage types in S. aureus isolates recovered in Italy. We examined 48 PVL-positive isolates (25 MSSA and 23 MRSA) collected from different hospital laboratories from April 2005 to May 2011. spa typing, multilocus sequence typing and staphylococcal cassette chromosome mec typing were applied to categorize the isolates. Phage typeability was 48.0% in MSSA and 91.3% in MRSA, highlighting the limitation of the PCR typing scheme when applied to PVL-positive MSSA. Five different PVL phages and two variants of a known phage were detected, the most prevalent being ΦSa2usa, recovered in 15 out of 48 (31.2%) isolates, and carried by both MSSA and MRSA belonging to CC8 and CC5. The recently described ΦTCH60 was recovered in four isolates. A PVL phage (ΦSa119) from an ST772 MRSA, that was not detected using the previous typing scheme, was sequenced, and new primers were designed for the identification of the icosahedral-head group II PVL phages present in ST772 and ST59 MRSA. A comprehensive PVL-phage typing can contribute to the understanding of the epidemiology and evolution of PVL-positive MSSA and MRSA. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  1. Molecular evolution of the nif gene cluster carrying nifI1 and nifI2 genes in the Gram-positive phototrophic bacterium Heliobacterium chlorum.

    Science.gov (United States)

    Enkh-Amgalan, Jigjiddorj; Kawasaki, Hiroko; Seki, Tatsuji

    2006-01-01

    A major nif cluster was detected in the strictly anaerobic, Gram-positive phototrophic bacterium Heliobacterium chlorum. The cluster consisted of 11 genes arranged within a 10 kb region in the order nifI1, nifI2, nifH, nifD, nifK, nifE, nifN, nifX, fdx, nifB and nifV. The phylogenetic position of Hbt. chlorum was the same in the NifH, NifD, NifK, NifE and NifN trees; Hbt. chlorum formed a cluster with Desulfitobacterium hafniense, the closest neighbour of heliobacteria based on the 16S rRNA phylogeny, and two species of the genus Geobacter belonging to the Deltaproteobacteria. Two nifI genes, known to occur in the nif clusters of methanogenic archaea between nifH and nifD, were found upstream of the nifH gene of Hbt. chlorum. The organization of the nif operon and the phylogeny of individual and concatenated gene products showed that the Hbt. chlorum nif operon carrying nifI genes upstream of the nifH gene was an intermediate between the nif operon with nifI downstream of nifH (group II and III of the nitrogenase classification) and the nif operon lacking nifI (group I). Thus, the phylogenetic position of Hbt. chlorum nitrogenase may reflect an evolutionary stage of a divergence of the two nitrogenase groups, with group I consisting of the aerobic diazotrophs and group II consisting of strictly anaerobic prokaryotes.

  2. Correlation of Minimum Inhibitory Concentration Breakpoints and Methicillin Resistance Gene Carriage in Clinical Isolates of Staphylococcus epidermidis

    Directory of Open Access Journals (Sweden)

    Fereshteh Eftekhar,

    2011-09-01

    Full Text Available Staphylococcus epidermidis is the most important member of coagulase negative staphylococci responsible for community and hospital acquired infections. Most clinical isolates of S. epidermidis are resistant to methicillin making these infections difficult to treat. In this study, correlation of methicillin resistance phenotype was compared with methicillin resistance (mecA gene carriage in 55 clinical isolates of S. epidermidis. Susceptibility was measured by disc diffusion using methicillin discs, and minimum inhibitory concentrations (MIC were measured using broth microdilution. Methicillin resistance gene (MecA gene carriage was detected by specific primers and PCR. Disc susceptibility results showed 90.9% resistance to methicillin. Considering a MIC of 4 µg/ml, 78.1% of the isolates were methicillin resistant, 76.36% of which carried the mecA gene. On the other hand, when a breakpoint of 0.5 µg/ml was used, 89.09% were methicillin resistant, of which 93.75% were mecA positive. There was a better correlation between MIC of 0.5 µg/ml with disc diffusion results and mecA gene carriage. The findings suggest that despite the usefulness of molecular methods for rapid diagnosis of virulence genes, gene carriage does not necessarily account for virulence phenotype. Ultimately, gene expression, which is controlled by the environment, would determine the outcome

  3. Development and evaluation of near-isogenic lines for major blast resistance gene(s) in Basmati rice.

    Science.gov (United States)

    Khanna, Apurva; Sharma, Vinay; Ellur, Ranjith K; Shikari, Asif B; Gopala Krishnan, S; Singh, U D; Prakash, G; Sharma, T R; Rathour, Rajeev; Variar, Mukund; Prashanthi, S K; Nagarajan, M; Vinod, K K; Bhowmick, Prolay K; Singh, N K; Prabhu, K V; Singh, B D; Singh, Ashok K

    2015-07-01

    A set of NILs carrying major blast resistance genes in a Basmati rice variety has been developed. Also, the efficacy of pyramids over monogenic NILs against rice blast pathogen Magnaporthe oryzae has been demonstrated. Productivity and quality of Basmati rice is severely affected by rice blast disease. Major genes and QTLs conferring resistance to blast have been reported only in non-Basmati rice germplasm. Here, we report incorporation of seven blast resistance genes from the donor lines DHMASQ164-2a (Pi54, Pi1, Pita), IRBLz5-CA (Pi2), IRBLb-B (Pib), IRBL5-M (Pi5) and IRBL9-W (Pi9) into the genetic background of an elite Basmati rice variety Pusa Basmati 1 (PB1). A total of 36 near-isogenic lines (NILs) comprising of 14 monogenic, 16 two-gene pyramids and six three-gene pyramids were developed through marker-assisted backcross breeding (MABB). Foreground, recombinant and background selection was used to identify the plants with target gene(s), minimize the linkage drag and increase the recurrent parent genome (RPG) recovery (93.5-98.6 %), respectively, in the NILs. Comparative analysis performed using 50,051 SNPs and 500 SSR markers revealed that the SNPs provided better insight into the RPG recovery. Most of the monogenic NILs showed comparable performance in yield and quality, concomitantly, Pusa1637-18-7-6-20 (Pi9), was significantly superior in yield and stable across four different environments as compared to recurrent parent (RP) PB1. Further, among the pyramids, Pusa1930-12-6 (Pi2+Pi5) showed significantly higher yield and Pusa1633-7-8-53-6-8 (Pi54+Pi1+Pita) was superior in cooking quality as compared to RP PB1. The NILs carrying gene Pi9 were found to be the most effective against the concoction of virulent races predominant in the hotspot locations for blast disease. Conversely, when analyzed under artificial inoculation, three-gene pyramids expressed enhanced resistance as compared to the two-gene and monogenic NILs.

  4. AMINOGLYCOSIDE RESISTANCE GENES IN Pseudomonas aeruginosa ISOLATES FROM CUMANA, VENEZUELA

    Directory of Open Access Journals (Sweden)

    Bertinellys TEIXEIRA

    2016-01-01

    Full Text Available The enzymatic modification of aminoglycosides by aminoglycoside-acetyltransferases (AAC, aminoglycoside-adenyltransferases (AAD, and aminoglycoside-phosphotransferases (APH, is the most common resistance mechanism in P. aeruginosa and these enzymes can be coded on mobile genetic elements that contribute to their dispersion. One hundred and thirty seven P. aeruginosa isolates from the University Hospital, Cumana, Venezuela (HUAPA were evaluated. Antimicrobial susceptibility was determined by the disk diffusion method and theaac, aadB and aph genes were detected by PCR. Most of the P. aeruginosa isolates (33/137 were identified from the Intensive Care Unit (ICU, mainly from discharges (96/137. The frequency of resistant P. aeruginosaisolates was found to be higher for the aminoglycosides tobramycin and amikacin (30.7 and 29.9%, respectively. Phenotype VI, resistant to these antibiotics, was the most frequent (14/49, followed by phenotype I, resistant to all the aminoglycosides tested (12/49. The aac(6´-Ib,aphA1 and aadB genes were the most frequently detected, and the simultaneous presence of several resistance genes in the same isolate was demonstrated. Aminoglycoside resistance in isolates ofP. aeruginosa at the HUAPA is partly due to the presence of the aac(6´-Ib, aphA1 andaadB genes, but the high rates of antimicrobial resistance suggest the existence of several mechanisms acting together. This is the first report of aminoglycoside resistance genes in Venezuela and one of the few in Latin America.

  5. Surveillance of multidrug resistance-associated genes in Acinetobacter baumannii isolates from elderly patients

    Directory of Open Access Journals (Sweden)

    Zhe DONG

    2012-03-01

    Full Text Available Objective To understand the status of multidrug resistance-associated genes carried by Acinetobacter baumannii isolates from elderly patients in our hospital in order to provide a basis for surveillance of drug-resistance and inflection control. Methods One hundred and twenty A. baumannii isolates were collected from elderly patients between 2008 and 2010. The mean age of the patients was 85 (65 to 95 years. Whonet 5.6 software was used to analyze the resistance rate of 16 antimicrobial agents. Polymerase chain reaction (PCR and the sequencing method were adopted to detect 10 kinds of resistance genes (blaOXA-51-like, blaOXA- 23-like, blaOXA-24-like, blaOXA-58-like, blaTEM, blaampC, armA, ISAba1, intI 1, and intI 2. The corresponding resistance gene profiling(RGP was analyzed and designated according to the status of resistance genes. Results The resistance rates to the remaining 15 kinds of antibiotics varied between 70.8% and 97.5%, with the exception of the sensitivity rate to polymyxin B by up to more than 90%. The positivity rates of blaOXA-51-like, blaOXA-23-like, blaOXA-58-like, blaTEM, blaampC, armA, ISAba1 and intI 1 were 100%, 81.7%, 0.8%, 10.8%, 91.7%, 81.7%, 86.7%, and 83.3% respectively. A total of 18 kinds of drug-resistant gene maps were found, but blaOXA-24-like and intI 2 were not detected. Among these gene maps, the rate of RGP1 (blaOXA-23-like+blaampC+armA+ISAba1+ intI 1 was as high as 60.8%. Conclusions A. baumannii isolates from elderly patients have a higher carrying rate of drug-resistant genes, resulting in severe multidrugresistant conditions. Therefore, full-time infection control personnel and clinical physicians should actively participate in the surveillance, prevention, and control of infections caused by A. baumannii in the elderly.

  6. Molecular Scree ning of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Liang Yan

    2017-01-01

    Full Text Available Molecular screening of major rice blast resistance genes was determined with molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2, in a collection of 32 accessions resistant to Magnaporthe oryzae. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive express. As the second dominant, Pi-b and Piz-t gene frequencies were 96.9% and 87.5%. And Pik-h and Pik-p gene frequencies were 43.8% and 28.1%, respectively. The molecular marker linkage to Pi-ta2 produced positive bands in eleven accessions, while the molecular marker linkage to Pi-36 and Pi-37 in only three and four accessions, respectively. The natural field evaluation analysis showed that 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Infection types were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and Pik-p, although the correlation coefficients were very little. These results are useful in identification and incorporation of functional resistance genes from these germplasms into elite cultivars through marker-assisted selection for improved blast resistance in China and worldwide.

  7. Prevalence of antibiotic resistance genes and bacterial pathogens in long-term manured greenhouse soils as revealed by metagenomic survey.

    Science.gov (United States)

    Fang, Hua; Wang, Huifang; Cai, Lin; Yu, Yunlong

    2015-01-20

    Antibiotic resistance genes (ARGs), human pathogenic bacteria (HPB), and HPB carrying ARGs pose a high risk to soil ecology and public health. Here, we used a metagenomic approach to investigate their diversity and abundance in chicken manures and greenhouse soils collected from Guli, Pulangke, and Hushu vegetable bases with different greenhouse planting years in Nanjing, Eastern China. There was a positive correlation between the levels of antibiotics, ARGs, HPB, and HPB carrying ARGs in manures and greenhouse soils. In total, 156.2–5001.4 μg/kg of antibiotic residues, 22 classes of ARGs, 32 HPB species, and 46 species of HPB carrying ARGs were found. The highest relative abundance was tetracycline resistance genes (manures) and multidrug resistance genes (greenhouse soils). The dominant HPB and HPB carrying ARGs in the manures were Bacillus anthracis, Bordetella pertussis, and B. anthracis (sulfonamide resistance gene, sul1), respectively. The corresponding findings in greenhouse soils were Mycobacterium tuberculosis and M. ulcerans, M. tuberculosis (macrolide-lincosamide-streptogramin resistance protein, MLSRP), and B. anthracis (sul1), respectively. Our findings confirmed high levels of antibiotics, ARGs, HPB, and HPB carrying ARGs in the manured greenhouse soils compared with those in the field soils, and their relative abundance increased with the extension of greenhouse planting years.

  8. The rpg4/Rpg5 stem rust resistance locus in barley: resistance genes and cytoskeleton dynamics.

    Science.gov (United States)

    Brueggeman, Robert; Steffenson, Brian J; Kleinhofs, Andris

    2009-04-01

    Two closely linked resistance genes, rpg4 and Rpg5, conferring resistance to several races of Puccinia graminis, were cloned and characterized. The Rpg5 gene confers resistance to an isolate of Puccinia graminis f. sp. secalis (Pgs), while rpg4 confers resistance to Puccinia graminis f. sp. tritici (Pgt). Rpg5 is a novel gene containing nucleotide binding site-leucine rich repeat domains in combination with a serine threonine protein kinase domain. High-resolution mapping plus allele and recombinant sequencing identified the rpg4 gene, which encodes an actin depolymerizing factor-like protein (ADF2). Resistance against the Pgt races QCCJ, MCCF, TTKSK (aka Ug99) and RCRS requires both Rpg5 and rpg4, while Rpg5 alone confers resistance to Pgs isolate 92-MN-90. The dependency on the actin modifying protein ADF2 indicates cytoskeleton reorganization or redirection plays a role in pathogen-host interactions. Rpg5 may interact with ADF2 to activate or deactivate its function in the resistance response. Alternatively, Rpg5 could initiate signal transduction leading to resistance in response to detecting ADF2 protein modification. Pgt may redirect the actin cytoskeleton by inducing modifications of ADF2. The redirection of actin could possibly enable the pathogen to develop a haustoria-plant cell cytoskeleton interface for acquisition of nutrients.

  9. A novel gene of Kalanchoe daigremontiana confers plant drought resistance.

    Science.gov (United States)

    Wang, Li; Zhu, Chen; Jin, Lin; Xiao, Aihua; Duan, Jie; Ma, Luyi

    2018-02-07

    Kalanchoe (K.) daigremontiana is important for studying asexual reproduction under different environmental conditions. Here, we describe a novel KdNOVEL41 (KdN41) gene that may confer drought resistance and could thereby affect K. daigremontiana development. The detected subcellular localization of a KdN41/Yellow Fluorescent Protein (YFP) fusion protein was in the nucleus and cell membrane. Drought, salt, and heat stress treatment in tobacco plants containing the KdN41 gene promoter driving β-glucuronidase (GUS) gene transcription revealed that only drought stress triggered strong GUS staining in the vascular tissues. Overexpression (OE) of the KdN41 gene conferred improved drought resistance in tobacco plants compared to wild-type and transformed with empty vector plants by inducing higher antioxidant enzyme activities, decreasing cell membrane damage, increasing abscisic acid (ABA) content, causing reinforced drought resistance related gene expression profiles. The 3,3'-diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) staining results also showed less relative oxygen species (ROS) content in KdN41-overexpressing tobacco leaf during drought stress. Surprisingly, by re-watering after drought stress, KdN41-overexpressing tobacco showed earlier flowering. Overall, the KdN41 gene plays roles in ROS scavenging and osmotic damage reduction to improve tobacco drought resistance, which may increase our understanding of the molecular network involved in developmental manipulation under drought stress in K. daigremontiana.

  10. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    OpenAIRE

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

    2014-01-01

    Introduction: This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Methodology: Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. Results: A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resista...

  11. Potyviral resistance derived from cultivars of Phaseolus vulgaris carrying bc-3 co-segregates with homozygotic presence of a mutated eIF4E allele

    DEFF Research Database (Denmark)

    Naderpour, M; Lund, O Søgaard; Larsen, R

    2008-01-01

    In common bean, Phaseolus vulgaris, four recessive genes, bc-1, bc-2, bc-3 and bc-u control resistance to potyviruses Bean common mosaic virus (BCMV) and Bean common mosaic necrosis virus (BCMNV). To identify candidates for the bc-genes, we cloned and sequenced homologues of genes encoding cap...... in a segregating F2 population of P. vulgaris, BCMV resistance was found to co-segregate with homozygotic presence of the mutant eIF4E allele. , BCMV resistance was found to co-segregate with homozygotic presence of the mutant allele. Silent mutations were found in eIF(iso)4E, but without correspondence to P....... vulgaris response to BCMV and BCMNV. No differences were found in cDNA of nCBP....

  12. Antimicrobial resistance and resistance gene determinants in clinical Escherichia coli from different animal species in Switzerland.

    Science.gov (United States)

    Lanz, Roland; Kuhnert, Peter; Boerlin, Patrick

    2003-01-02

    Antimicrobial susceptibility testing was performed on a total of 581 clinical Escherichia coli isolates from diarrhea and edema disease in pigs, from acute mastitis in dairy cattle, from urinary tract infections in dogs and cats, and from septicemia in laying hens collected in Switzerland between 1999 and 2001. Among the 16 antimicrobial agents tested, resistance was most frequent for sulfonamides, tetracycline, and streptomycin. Isolates from swine presented significantly more resistance than those from the other animal species. The distribution of the resistance determinants for sulfonamides, tetracycline, and streptomycin was assessed by hybridization and PCR in resistant isolates. Significant differences in the distribution of resistance determinants for tetracycline (tetA, tetB) and sulfonamides (sulII) were observed between the isolates from swine and those from the other species. Resistance to sulfonamides could not be explained by known resistance mechanisms in more than a quarter of the sulfonamide-resistant and sulfonamide-intermediate isolates from swine, dogs and cats. This finding suggests that one or several new resistance mechanisms for sulfonamides may be widespread among E. coli isolates from these animal species. The integrase gene (intI) from class I integrons was detected in a large proportion of resistant isolates in association with the sulI and aadA genes, thus demonstrating the importance of integrons in the epidemiology of resistance in clinical E. coli isolates from animals.

  13. СRACK-RESISTANCE AND DURABILITY OF NUCLEAR-POWER STATION (NPS) LOAD-CARRYING STRUCTURES FROM FRACTURE MECHANICS POINT OF VIEW

    OpenAIRE

    S. N. Leonovich

    2009-01-01

    The paper presents calculations pertaining to survivability of NPS load-carrying elements with respect to crack-resistance. These calculations reflect their resistance ability to actions of mechanical, thermal, hydro-dynamic, electro-magnetic  loads in the case when there are defects in the elements (initially technological defects or operational ones). The most dangerous defects are micro- and macro-cracks that create maximum high concentration of stresses and deformations.

  14. GmSGT1 is differently required for soybean Rps genes-mediated and basal resistance to Phytophthora sojae.

    Science.gov (United States)

    Yan, Qiang; Cui, Xiaoxia; Su, Liming; Xu, Na; Guo, Na; Xing, Han; Dou, Daolong

    2014-08-01

    Using RNAi approach, we demonstrate that GmSGT1 is an essential component in soybean against Phytophthora sojae, but not required for Rps 2 or Rps 3a-mediated resistance. Utilization of disease resistance in soybean is a major approach to combat root and stem rot disease, which is caused by Phytophthora sojae and poses a growing threat to soybean safety production. The SGT1 protein is essential for disease resistance in many plant species. Here, we analyzed and characterized functions of GmSGT1 gene family in R protein-mediated resistance and basal defense in this important crop. Five candidate genes of GmSGT1 were identified and they were grouped into three clades. Transcriptional levels of all the tested genes were highly induced upon P. sojae infection in four soybean cultivars that confer different resistant levels. Using a gene silencing system in soybean cotyledons, we demonstrated that silencing GmSGT1 genes comprised race-specific resistance in soybean lines carrying genes at the following loci for race-specific resistance to P. sojae: Rps1a, Rps1c, Rps1d, Rps1k, and Rps8. In contrast, the resistance mediated by Rps2 or Rps3a was not affected. Silencing GmSGT1 genes in cotyledons also reduced resistance to this pathogen in a moderately partial resistant cultivar. We further showed that transient overexpression of GmSGT1-1 in Nicotiana benthamiana could enhance the resistance to P. capsici. These results suggest that GmSGT1 is an essential component for soybean in resisting the pathogen and pathways of Rps-mediated disease resistance are diverse in soybean.

  15. Simultaneous Mutations in Multi-Viral Proteins Are Required for Soybean mosaic virus to Gain Virulence on Soybean Genotypes Carrying Different R Genes

    Science.gov (United States)

    Chowda-Reddy, R. V.; Sun, Haiyue; Hill, John H.; Poysa, Vaino; Wang, Aiming

    2011-01-01

    Background Genetic resistance is the most effective and sustainable approach to the control of plant pathogens that are a major constraint to agriculture worldwide. In soybean, three dominant R genes, i.e., Rsv1, Rsv3 and Rsv4, have been identified and deployed against Soybean mosaic virus (SMV) with strain-specificities. Molecular identification of virulent determinants of SMV on these resistance genes will provide essential information for the proper utilization of these resistance genes to protect soybean against SMV, and advance knowledge of virus-host interactions in general. Methodology/Principal Findings To study the gain and loss of SMV virulence on all the three resistance loci, SMV strains G7 and two G2 isolates L and LRB were used as parental viruses. SMV chimeras and mutants were created by partial genome swapping and point mutagenesis and then assessed for virulence on soybean cultivars PI96983 (Rsv1), L-29 (Rsv3), V94-5152 (Rsv4) and Williams 82 (rsv). It was found that P3 played an essential role in virulence determination on all three resistance loci and CI was required for virulence on Rsv1- and Rsv3-genotype soybeans. In addition, essential mutations in HC-Pro were also required for the gain of virulence on Rsv1-genotype soybean. To our best knowledge, this is the first report that CI and P3 are involved in virulence on Rsv1- and Rsv3-mediated resistance, respectively. Conclusions/Significance Multiple viral proteins, i.e., HC-Pro, P3 and CI, are involved in virulence on the three resistance loci and simultaneous mutations at essential positions of different viral proteins are required for an avirulent SMV strain to gain virulence on all three resistance loci. The likelihood of such mutations occurring naturally and concurrently on multiple viral proteins is low. Thus, incorporation of all three resistance genes in a soybean cultivar through gene pyramiding may provide durable resistance to SMV. PMID:22140577

  16. Effect of swine manure application timing on the persistence and transport of antibiotic-resistant Enterococcus and resistance genes

    Science.gov (United States)

    Swine manure applied to agricultural fields may lead to the transport of antibiotic resistant bacteria and antibiotic resistance genes to freshwater systems. Enterococci were studied because they are fecal indicator bacteria associated with manure. Resistance genes include genes from live cells, dea...

  17. The IncI1 plasmid carrying the bla CTX-M-1 gene persists in in vitro culture of a Escherichia coli strain from broilers

    NARCIS (Netherlands)

    Fischer, E.A.J.; Dierikx, C.M.; Essen-Zandbergen, van A.; Roermund, van H.J.W.; Mevius, D.J.; Stegeman, A.; Klinkenberg, D.

    2014-01-01

    Commensal bacteria are a reservoir for antimicrobial-resistance genes. In the Netherlands, bacteria producing Extended Spectrum Beta-Lactamases (ESBL) are found on chicken-meat and in the gut of broilers at a high prevalence and the predominant ESBL-gene is the blaCTX-M-1 located on IncI1 plasmids.

  18. Antimicrobial resistance among invasive Haemophilus influenzae strains: results of a Brazilian study carried out from 1996 through 2000

    Directory of Open Access Journals (Sweden)

    Casagrande S.T.

    2002-01-01

    Full Text Available A total of 1712 strains of Haemophilus influenzae isolated from patients with invasive diseases were obtained from ten Brazilian states from 1996 to 2000. ß-Lactamase production was assessed and the minimum inhibitory concentrations (MIC of ampicillin, chloramphenicol, ceftriaxone and rifampin were determined using a method for broth microdilution of Haemophilus test medium. The prevalence of strains producing ß-lactamase ranged from 6.6 to 57.7%, with an overall prevalence of 18.4%. High frequency of ß-lactamase-mediated ampicillin resistance was observed in Distrito Federal (25%, São Paulo (21.7% and Paraná (18.5%. Of the 1712 strains analyzed, none was ß-lactamase negative, ampicillin resistant. A total of 16.8% of the strains were resistant to chloramphenicol, and 13.8% of these also presented resistance to ampicillin, and only 3.0% were resistant to chloramphenicol alone. All strains were susceptible to ceftriaxone and rifampin and the MIC90 were 0.015 µg/ml and 0.25 µg/ml, respectively. Ceftriaxone is the drug of choice for empirical treatment of bacterial meningitis in pediatric patients who have not been screened for drug susceptibility. The emergence of drug resistance is a serious challenge for the management of invasive H. influenzae disease, which emphasizes the fundamental role of laboratory-based surveillance for antimicrobial resistance.

  19. Antibiotic Resistance and Antibiotic Resistance Genes in Escherichia coli Isolates from Hospital Wastewater in Vietnam

    Science.gov (United States)

    Lan, Pham Thi; Chuc, Nguyen Thi Kim; Hoa, Nguyen Quynh; Nhung, Pham Hong; Thoa, Nguyen Thi Minh; Diwan, Vishal; Tamhankar, Ashok J.; Stålsby Lundborg, Cecilia

    2017-01-01

    The environmental spread of antibiotic-resistant bacteria has been recognised as a growing public health threat for which hospitals play a significant role. The aims of this study were to investigate the prevalence of antibiotic resistance and antibiotic resistance genes (ARGs) in Escherichia coli isolates from hospital wastewater in Vietnam. Wastewater samples before and after treatment were collected using continuous sampling every month over a year. Standard disk diffusion and E-test were used for antibiotic susceptibility testing. Extended-spectrum beta-lactamase (ESBL) production was tested using combined disk diffusion. ARGs were detected by polymerase chain reactions. Resistance to at least one antibiotic was detected in 83% of isolates; multidrug resistance was found in 32%. The highest resistance prevalence was found for co-trimoxazole (70%) and the lowest for imipenem (1%). Forty-three percent of isolates were ESBL-producing, with the blaTEM gene being more common than blaCTX-M. Co-harbouring of the blaCTX-M, blaTEM and qepA genes was found in 46% of isolates resistant to ciprofloxacin. The large presence of antibiotic-resistant E. coli isolates combined with ARGs in hospital wastewater, even post-treatment, poses a threat to public health. It highlights the need to develop effective processes for hospital wastewater treatment plants to eliminate antibiotic resistant bacteria and ARGs. PMID:28661465

  20. Antibiotic Resistance and Antibiotic Resistance Genes in Escherichia coli Isolates from Hospital Wastewater in Vietnam.

    Science.gov (United States)

    Lien, La Thi Quynh; Lan, Pham Thi; Chuc, Nguyen Thi Kim; Hoa, Nguyen Quynh; Nhung, Pham Hong; Thoa, Nguyen Thi Minh; Diwan, Vishal; Tamhankar, Ashok J; Stålsby Lundborg, Cecilia

    2017-06-29

    The environmental spread of antibiotic-resistant bacteria has been recognised as a growing public health threat for which hospitals play a significant role. The aims of this study were to investigate the prevalence of antibiotic resistance and antibiotic resistance genes (ARGs) in Escherichia coli isolates from hospital wastewater in Vietnam. Wastewater samples before and after treatment were collected using continuous sampling every month over a year. Standard disk diffusion and E-test were used for antibiotic susceptibility testing. Extended-spectrum beta-lactamase (ESBL) production was tested using combined disk diffusion. ARGs were detected by polymerase chain reactions. Resistance to at least one antibiotic was detected in 83% of isolates; multidrug resistance was found in 32%. The highest resistance prevalence was found for co-trimoxazole (70%) and the lowest for imipenem (1%). Forty-three percent of isolates were ESBL-producing, with the bla TEM gene being more common than bla CTX-M . Co-harbouring of the bla CTX-M , bla TEM and qepA genes was found in 46% of isolates resistant to ciprofloxacin. The large presence of antibiotic-resistant E. coli isolates combined with ARGs in hospital wastewater, even post-treatment, poses a threat to public health. It highlights the need to develop effective processes for hospital wastewater treatment plants to eliminate antibiotic resistant bacteria and ARGs.

  1. Cereal cyst nematode resistance conferred by the Cre7 gene from Aegilops triuncialis and its relationship with Cre genes from Australian wheat cultivars

    OpenAIRE

    Montes, Maria Jesus; Andrés, María Fe; Sin, E.; Lopez Braña, Isidoro; Martín-Sánchez, J.A.; Romero, M.D.; Delibes Castro, Angeles

    2008-01-01

    Cereal cyst nematode (CCN; Heterodera avenae Woll.) is a root pathogen of cereal crops that can cause severe yield losses in wheat (Triticum aestivum). Differential host–nematode interactions occur in wheat cultivars carrying different CCN resistance (Cre) genes. The objective of this study was to determine the CCN resistance conferred by the Cre7 gene from Aegilops triuncialis in a 42-chromosome introgression line and to assess the effects of the Cre1, Cre3, Cre4, and Cre8 genes present in A...

  2. fexA, a Novel Staphylococcus lentus Gene Encoding Resistance to Florfenicol and Chloramphenicol

    Science.gov (United States)

    Kehrenberg, Corinna; Schwarz, Stefan

    2004-01-01

    The Staphylococcus lentus plasmid pSCFS2 carries a novel florfenicol-chloramphenicol resistance gene, designated fexA, encoding a protein of 475 amino acids with 14 transmembrane domains. The FexA protein differs from all previously known proteins involved in the efflux of chloramphenicol and florfenicol. Induction of fexA expression by chloramphenicol and florfenicol occurs via translational attenuation.   PMID:14742219

  3. Vancomycin-resistant Enterococcus faecium with vanA gene isolated for the first time from wildlife in Slovakia.

    Science.gov (United States)

    Oravcova, Veronika; Hadelova, Daniela; Literak, Ivan

    2016-10-15

    Corvids have been identified as an important vector of vancomycin-resistant enterococci (VRE) in several European countries. The aim of this study was to assess the prevalence of VRE in wildlife in Slovakia and to characterize vanA-carrying VRE. At the beginning of 2013, we collected 287 fecal samples of common raven (Corvus corax) in Petrovce and 99 fecal samples of rooks (Corvus frugilegus) in Kosice. Samples were cultured selectively on Slanetz-Bartley agar with vancomycin and screened for vanA, other resistance genes, and virulence genes. PCR mapping of Tn1546 carrying vanA gene was performed. Multilocus sequence typing and pulsed-field gel electrophoresis were used to examine the genotypic diversity of vanA-containing VRE. The mobility of vancomycin resistance traits was tested in vitro, using filter mating experiments. VRE with the vanA gene were found in 4 (1.4%) of 287 raven samples and in one (1%) of 99 rook samples. All 5 isolates belonged to Enterococcus faecium and were multiresistant with resistance to erythromycin encoded by the erm(B) gene, tetracycline (tet(M) and tet(L) genes), and ampicillin (mutations in C-terminal region of pbp5 gene). Isolates from Petrovce also were resistant to chloramphenicol. Virulence genes were not proven. The vanA gene was carried by Tn1546 types E (combined with insertion sequence IS1216) or F5 (IS1251). One isolate from a rook in Kosice belonged to ST (sequence type) 6 and the remaining four from ravens in Petrovce belonged to new ST917 (a single locus variant of ST18). All tested VRE were able to transfer the vancomycin resistance trait. In conclusion, we identified clinically important enterococci with the vanA gene in corvids in Slovakia. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Androecious Genotype ‘Male 8’ Carries the CPCNA Gene Locus Controlling Natural Deastringency of Chinese PCNA Persimmons

    Directory of Open Access Journals (Sweden)

    Na ZHANG

    2016-11-01

    Full Text Available The androecious genotype of Diospyros spp. ‘Male 8’, which is distributed in Dabie Mountain area of the central China, was probably derived from the hybrids or natural variation of Chinese pollination constant and non-astringent (CPCNA persimmon. Its application potential as the breeding parent of pollination constant and non-astringent (PCNA is undefined. In this study, we identified the astringency type of a hybrid individual (H8-2 derived from the cross between ‘Huashi 1’ (pollination variant and astringent, PVA and ‘Male 8’. Through comparison with the known genotypes of CPCNA, Japanese PCNA (JPCNA and non-PCNA, the results of soluble/insoluble tannin content and tannin cell size measure showed that H8-2 was a PCNA genotype with the characteristic of natural deastringency of CPCNA. According to the currently known genetic features of PCNA persimmon, a new individual of PCNA may be generated in F1 population when two JPCNA genotypes are crossed or when the CPCNA genotype is used as a parent. Thus, the study verifies that androecious genotype ‘Male 8’ carries the dominant gene locus that controls the non-astringent trait of CPCNA, indicating its potential to be used as pollen donor for the genetic improvement of PCNA persimmon.

  5. Development of Gene-Pyramid Lines of the Elite Restorer Line, RPHR-1005 Possessing Durable Bacterial Blight and Blast Resistance.

    Science.gov (United States)

    Abhilash Kumar, V; Balachiranjeevi, C H; Bhaskar Naik, S; Rambabu, R; Rekha, G; Harika, G; Hajira, S K; Pranathi, K; Anila, M; Kousik, M; Vijay Kumar, S; Yugander, A; Aruna, J; Dilip Kumar, T; Vijaya Sudhakara Rao, K; Hari Prasad, A S; Madhav, M S; Laha, G S; Balachandran, S M; Prasad, M S; Viraktamath, B C; Ravindra Babu, V; Sundaram, R M

    2016-01-01

    RPHR-1005, the stable restorer line of the popular medium slender (MS) grain type rice hybrid, DRRH-3 was improved in this study for resistance against bacterial blight (BB) and blast diseases through marker-assisted backcross breeding (MABB). In this study, four major resistance genes (i.e., Xa21 and Xa33 for BB resistance and Pi2 and Pi54 for blast resistance) have been transferred to RPHR-1005 using RPBio Patho-1 (possessing Xa21 + Pi2), RPBio Patho-2 (possessing Xa21 + Pi54) and FBR1-15EM (possessing Xa33) as the donors. Foreground selection was carried out using PCR-based molecular markers specific for the target resistance genes and the major fertility restorer genes, Rf3 and Rf4, while background selection was carried out using a set of parental polymorphic rice SSR markers and backcrossing was continued uptoBC2 generation. At BC2F2, plants possessing the gene combination- Xa21 + Pi2, Xa21 + Pi54 and Xa33 in homozygous condition and with >92% recovery of the recurrent parent genome (RPG) were identified and intercrossed to combine all the four resistance genes. Twenty-two homozygous, pyramid lines of RPHR-1005 comprising of three single-gene containing lines, six 2-gene containing lines, eight 3-gene containing lines, and five 4-gene containing lines were identified among the double intercross lines at F3 generation (DICF3). They were then evaluated for their resistance against BB and blast, fertility restoration ability and for key agro-morphological traits. While single gene containing lines were resistant to either BB or blast, the 2-gene, 3-gene, and 4-gene pyramid lines showed good level of resistance against both and/or either of the two diseases. Most of the 2-gene, 3-gene, and 4-gene containing pyramid lines showed yield levels and other key agro-morphological and grain quality traits comparable to the original recurrent parent and showed complete fertility restoration ability, with a few showing higher yield as compared to RPHR-1005. Further, the

  6. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence

    OpenAIRE

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G.; Singh, Davinder; Park, Robert F.; Lagudah, Evans; Ayliffe, Michael

    2017-01-01

    Summary The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad?spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field?grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when ...

  7. Ceftriaxone-resistant Salmonella Typhi carries an IncI1-ST31 plasmid encoding CTX-M-15.

    Science.gov (United States)

    Djeghout, Bilal; Saha, Senjuti; Sajib, Mohammad Saiful Islam; Tanmoy, Arif Mohammad; Islam, Maksuda; Kay, Gemma L; Langridge, Gemma C; Endtz, Hubert P; Wain, John; Saha, Samir K

    2018-04-04

    Ceftriaxone is the drug of choice for typhoid fever and the emergence of resistant Salmonella Typhi raises major concerns for treatment. There are an increasing number of sporadic reports of ceftriaxone-resistant S. Typhi and limiting the risk of treatment failure in the patient and outbreaks in the community must be prioritized. This study describes the use of whole genome sequencing to guide outbreak identification and case management. An isolate of ceftriaxone-resistant S. Typhi from the blood of a child taken in 2000 at the Popular Diagnostic Center, Dhaka, Bangladesh was subjected to whole genome sequencing, using an Illumina NextSeq 500 and analysis using Geneious software.Results/Key findings. Comparison with other ceftriaxone-resistant S. Typhi revealed an isolate from the Democratic Republic of the Congo in 2015 as the closest relative but no evidence of an outbreak. A plasmid belonging to incompatibility group I1 (IncI1-ST31) which included blaCTX-M-15 (ceftriaxone resistance) associated with ISEcp-1 was identified. High similarity (90 %) was seen with pS115, an IncI1 plasmid from S. Enteritidis, and with pESBL-EA11, an incI1 plasmid from E. coli (99 %) showing that S. Typhi has access to ceftriaxone resistance through the acquisition of common plasmids. The transmission of ceftriaxone resistance from E. coli to S. Typhi is of concern because of clinical resistance to ceftriaxone, the main stay of typhoid treatment. Whole genome sequencing, albeit several years after the isolation, demonstrated the success of containment but clinical trials with alternative agents are urgently required.

  8. Comparative genome analysis and resistance gene mapping in grain legumes

    International Nuclear Information System (INIS)

    Young, N.D.

    1998-01-01

    Using, DNA markers and genome organization, several important disease resistance genes have been analyzed in mungbean (Vigna radiata), cowpea (Vigna unguiculata), common bean (Phaseolus vulgaris), and soybean (Glycine max). In the process, medium-density linkage maps consisting of restriction fragment length polymorphism (RFLP) markers were constructed for both mungbean and cowpea. Comparisons between these maps, as well as the maps of soybean and common bean, indicate that there is significant conservation of DNA marker order, though the conserved blocks in soybean are much shorter than in the others. DNA mapping results also indicate that a gene for seed weight may be conserved between mungbean and cowpea. Using the linkage maps, genes that control bruchid (genus Callosobruchus) and powdery mildew (Erysiphe polygoni) resistance in mungbean, aphid resistance in cowpea (Aphis craccivora), and cyst nematode (Heterodera glycines) resistance in soybean have all been mapped and characterized. For some of these traits resistance was found to be oligogenic and DNA mapping uncovered multiple genes involved in the phenotype. (author)

  9. Dissemination of antibiotic resistance genes from antibiotic producers to pathogens

    DEFF Research Database (Denmark)

    Jiang, Xinglin; Ellabaan, Mostafa M Hashim; Charusanti, Pep

    2017-01-01

    It has been hypothesized that some antibiotic resistance genes (ARGs) found in pathogenic bacteria derive from antibiotic-producing actinobacteria. Here we provide bioinformatic and experimental evidence supporting this hypothesis. We identify genes in proteobacteria, including some pathogens......, that appear to be closely related to actinobacterial ARGs known to confer resistance against clinically important antibiotics. Furthermore, we identify two potential examples of recent horizontal transfer of actinobacterial ARGs to proteobacterial pathogens. Based on this bioinformatic evidence, we propose...... results support the existence of ancient and, possibly, recent transfers of ARGs from antibiotic-producing actinobacteria to proteobacteria, and provide evidence for a defined mechanism....

  10. Erythromycin-resistant genes in group A β-haemolytic Streptococci in Chengdu, Southwestern China

    Directory of Open Access Journals (Sweden)

    W Zhou

    2014-01-01

    Full Text Available Context: The management of Group A β-haemolytic Streptococci (Streptococcus pyogenes or GAS infection include the use of penicillins, cephalosporins or macrolides for treatment. A general increase in macrolides resistance in GAS has been observed in recent years. Differences in rates of resistance to these agents have existed according to geographical location and investigators. Aims: To investigate the antibiotic pattern and erythromycin-resistant genes of GAS isolates associated with acute tonsillitis and scarlet fever in Chengdu, southwestern China. Settings and Design: To assess the macrolide resistance, phenotype, and genotypic characterization of GAS isolated from throat swabs of children suffering from different acute tonsillitis or scarlet fever between 2004 and 2011 in the city of Chengdu, located in the southwestern region of China. Materials and Methods: Minimal inhibitory concentration with seven antibiotics was performed on 127 GAS isolates. Resistance phenotypes of erythromycin-resistant GAS isolates were determined by the double-disk test. Their macrolide-resistant genes (mefA, ermB and ermTR were amplified by PCR. Results: A total of 98.4% (125/127 of the isolates exhibited resistance to erythromycin, clindamycin and tetracycline. All isolates were sensitive to penicillin G and cefotaxime. Moreover, 113 ermB-positive isolates demonstrating the cMLS phenotype of erythromycin resistance were predominant (90.4% and these isolates showed high-level resistance to both erythromycin and clindamycin (MIC 90 > 256 μg/ml; 12 (9.6% isolates demonstrating the MLS phenotype of erythromycin resistance carried the mefA gene, which showed low-level resistance to both erythromycin (MIC 90 = 8 μg/ml and clindamycin (MIC 90 = 0.5 μg/ml; and none of the isolates exhibited the M phenotype. Conclusions: The main phenotype is cMLS, and the ermB gene code is the main resistance mechanism against macrolides in GAS. Penicillin is the most beneficial

  11. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria.

    Science.gov (United States)

    Adelowo, Olawale O; Fagade, Obasola E; Agersø, Yvonne

    2014-09-12

    This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), strB (61%), catA1 (25%), cmlA1 (13%), tetA (21%) and tetB (17%). Class 1 and 2 integrons were found in five (14%) and six (17%) isolates, respectively, while one isolate was positive for both classes of integrons. Seven out of eight isolates with resistance to ciprofloxacin and MIC ≤ 32 mg/L to nalidixic acid contained qnrS genes. Our findings provided additional evidence that the poultry production environment in Nigeria represents an important reservoir of antibiotic resistance genes such as qnrS that may spread from livestock production farms to human populations via manure and water.

  12. Emergence of Plasmid-Borne dfrA14 Trimethoprim Resistance Gene in Shigella sonnei

    Directory of Open Access Journals (Sweden)

    ALFONSO MIRANDA

    2016-07-01

    Full Text Available The most common mechanism of trimethoprim (TMP-resistance is the acquisition of dihydrofolate reductase enzyme resistant to this drug. Previous molecular characterization of TMP-genes resistance in Chilean isolates of S. sonnei searching for dfrA1 and dfrA8, showed solely the presence of dfrA8 (formerly dhfrIIIc. However, these genetic markers were absent in S. sonnei strains further isolated during an outbreak in 2009. To identify the TMP-resistance gene in these strains, a genomic DNA library from a TMP-resistant (TMPR S. sonnei representative strain for the outbreak was used to clone, select and identify a TMP-resistance marker. The TMPR clone was sequenced by primer walking, identifying the presence of the dfrA14 gene in the sul2-strA’-dfrA14-‘strA-strB gene arrangement, harbored in a native 6,779-bp plasmid. The same plasmid was isolated by transforming with a ~4.2 MDa plasmid extracted from several TMPR S. sonnei strains into E. coli. This plasmid, named pABC-3, was present only in dfrA14-positive strains and was homologous to a previously described pCERC-1, but different due to the absence of an 11-bp repetitive unit. The distribution of dfrA1, dfrA8 and dfrA14 TMP-resistance genes was determined in 126 TMPR S. sonnei isolates. Most of the strains (96 % carried only one of the three TMP-resistance genes assessed. Thus, all strains obtained during the 2009-outbreak harbored only dfrA14, whereas, dfrA8 was the most abundant gene marker before outbreak and, after the outbreak dfrA1 seems have appeared in circulating strains. According to PFGE, dfrA14-positive strains were clustered in a genetically related group including some dfrA1- and dfrA8-positive strains; meanwhile other genetic group included most of the dfrA8-positive strains. This distribution also correlated with the isolation period, showing a dynamics of trimethoprim genetic markers prevalent in Chilean S. sonnei strains. To our knowledge, dfrA14 gene associated to a small

  13. Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

    Directory of Open Access Journals (Sweden)

    Masayoshi Hashimoto

    2016-10-01

    Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

  14. Spread of tetracycline resistance genes at a conventional dairy farm

    Directory of Open Access Journals (Sweden)

    Martina eKyselkova

    2015-05-01

    Full Text Available The use of antibiotics in animal husbandry contributes to the worldwide problem of increasing antibiotic resistance in animal and human pathogens. Intensive animal production is considered an important source of antibiotic resistance genes released to the environment, while the contribution of smaller farms remains to be evaluated. Here we monitor the spread of tetracycline resistance (TC-r genes at a middle-size conventional dairy farm, where chlortetracycline (CTC, as intrauterine suppository is prophylactically used after each calving. Our study has shown that animals at the farm acquired the TC-r genes in their early age (1-2 weeks, likely due to colonization with TC-resistant bacteria from their mothers and/or the farm environment. The relative abundance of the TC-r genes tet(W, tet(Q and tet(M in fresh excrements of calves was about 1-2 orders of magnitude higher compared to heifers and dairy cows, possibly due to the presence of antibiotic residues in milk fed to calves. The occurrence and abundance of TC-r genes in fresh excrements of heifers and adult cows remained unaffected by intrauterine CTC applications, with tet(O, tet(Q and tet(W representing a ‘core TC-resistome’ of the farm, and tet(A, tet(M, tet(Y and tet(X occurring occasionally. The genes tet(A, tet(M, tet(Y and tet(X were shown to be respectively harbored by Shigella, Lactobacillus and Clostridium, Acinetobacter, and Wautersiella. Soil in the farm proximity, as well as field soil to which manure from the farm was applied, was contaminated with TC-r genes occurring in the farm, and some of the TC-r genes persisted in the field over 3 months following the manure application. Concluding, our study shows that antibiotic resistance genes may be a stable part of the intestinal metagenome of cattle even if antibiotics are not used for growth stimulation, and that smaller dairy farms may also contribute to environmental pollution with antibiotic resistance genes.

  15. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria

    DEFF Research Database (Denmark)

    Adelowo, Olawale O.; Fagade, Obasola E.; Agersø, Yvonne

    2014-01-01

    Introduction: This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Methodology: Minimum inhibitory concentration (MIC) distributions of the isolates were determined using...... the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. Results: A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42......%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), str...

  16. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... plasmodiophoride-like fungus, Polymyxa betae Keskin. (1964) (Tamada and Richard, 1992). Source of resistance to rhizomania were found in Holly sugar beet company source (Lewellen, 1987). Resistance in Holly is simply inherited by a single dominant gene(Rz1). (Lewellen et al., 1987; Scholten et al., ...

  17. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    The rhizomania disease is one of the most important diseases in Iran and some other parts of the world which potentially could play a role in decreasing sugar yield in fields. One approach to combat with this disease is the use of resistance varieties. This varieties have been identified which are having resistance genes to ...

  18. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Science.gov (United States)

    Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian

    2013-01-01

    We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  19. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Directory of Open Access Journals (Sweden)

    Peter Schierack

    Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  20. Presence of the resistance genes vanC1 and pbp5 in phenotypically vancomycin and ampicillin susceptible Enterococcus faecalis.

    Science.gov (United States)

    Schwaiger, Karin; Bauer, Johann; Hörmansdorfer, Stefan; Mölle, Gabriele; Preikschat, Petra; Kämpf, Peter; Bauer-Unkauf, Ilse; Bischoff, Meike; Hölzel, Christina

    2012-08-01

    Ampicillin and vancomycin are important antibiotics for the therapy of Enterococcus faecalis infections. The ampicillin resistance gene pbp5 is intrinsic in Enterococcus faecium. The vanC1 gene confers resistance to vancomycin and serves as a species marker for Enterococcus gallinarum. Both genes are chromosomally located. Resistance to ampicillin and vancomycin was determined in 484 E. faecalis of human and porcine origin by microdilution. Since E. faecalis are highly skilled to acquire resistance genes, all strains were investigated for the presence of pbp5 (and, in positive strains, for the penicillin-binding protein synthesis repressor gene psr) and vanC1 (and, in positive strains, for vanXYc and vanT) by using polymerase chain reaction (PCR). One porcine and one human isolate were phenotypically resistant to ampicillin; no strain was vancomycin resistant. Four E. faecalis (3/1 of porcine/human origin) carried pbp5 (MIC=1 mg/L), and four porcine strains were vanC1 positive (minimum inhibitory concentration [MIC]=1 mg/L). Real-time reverse transcriptase (RT)-PCR revealed that the genes were not expressed. The psr gene was absent in the four pbp5-positive strains; the vanXYc gene was absent in the four vanC1-positive strains. However, vanT of the vanC gene cluster was detected in two vanC1-positive strains. To our knowledge, this is the first report on the presence of pbp5, identical with the "E. faecium pbp5 gene," and of vanC1/vanT in E. faecalis. Even if resistance is not expressed in these strains, this study shows that E. faecalis have a strong ability to acquire resistance genes-and potentially to spread them to other bacteria. Therefore, close monitoring of this species should be continued.

  1. Characterization of Resistance Genes and Plasmids from Outbreaks and Illness Clusters Caused by Salmonella Resistant to Ceftriaxone in the United States, 2011-2012.

    Science.gov (United States)

    Folster, Jason P; Grass, Julian E; Bicknese, Amelia; Taylor, Julia; Friedman, Cindy R; Whichard, Jean M

    2017-03-01

    Salmonella is an important cause of foodborne illness; however, quickly identifying the source of these infections can be difficult, and source identification is a crucial step in preventing additional illnesses. Although most infections are self-limited, invasive salmonellosis may require antimicrobial treatment. Ceftriaxone, an extended-spectrum cephalosporin, is commonly used for treatment of salmonellosis. Previous studies have identified a correlation between the food animal/retail meat source of ceftriaxone-resistant Salmonella and the type of resistance gene and plasmid it carries. In this study, we examined seven outbreaks of ceftriaxone-resistant Salmonella infections, caused by serotypes Typhimurium, Newport, Heidelberg, and Infantis. All isolates were positive for a plasmid-encoded bla CMY gene. Plasmid incompatibility typing identified five IncI1 and two IncA/C plasmids. Both outbreaks containing bla CMY -IncA/C plasmids were linked to consumption of cattle products. Three of five outbreaks with bla CMY -IncI1 (ST12) plasmids were linked to a poultry source. The remaining IncI1 outbreaks were associated with ground beef (ST20) and tomatoes (ST12). In addition, we examined isolates from five unsolved clusters of ceftriaxone-resistant Salmonella infections and used our plasmid-encoded gene findings to predict the source. Overall, we identified a likely association between the source of ceftriaxone-resistant Salmonella outbreaks and the type of resistance gene/plasmid it carries.

  2. Association mapping and gene-gene interaction for stem rust resistance in CIMMYT spring wheat germplasm.

    Science.gov (United States)

    Yu, Long-Xi; Lorenz, Aaron; Rutkoski, Jessica; Singh, Ravi P; Bhavani, Sridhar; Huerta-Espino, Julio; Sorrells, Mark E

    2011-12-01

    The recent emergence of wheat stem rust Ug99 and evolution of new races within the lineage threatens global wheat production because they overcome widely deployed stem rust resistance (Sr) genes that had been effective for many years. To identify loci conferring adult plant resistance to races of Ug99 in wheat, we employed an association mapping approach for 276 current spring wheat breeding lines from the International Maize and Wheat Improvement Center (CIMMYT). Breeding lines were genotyped with Diversity Array Technology (DArT) and microsatellite markers. Phenotypic data was collected on these lines for stem rust race Ug99 resistance at the adult plant stage in the stem rust resistance screening nursery in Njoro, Kenya in seasons 2008, 2009 and 2010. Fifteen marker loci were found to be significantly associated with stem rust resistance. Several markers appeared to be linked to known Sr genes, while other significant markers were located in chromosome regions where no Sr genes have been previously reported. Most of these new loci colocalized with QTLs identified recently in different biparental populations. Using the same data and Q + K covariate matrices, we investigated the interactions among marker loci using linear regression models to calculate P values for pairwise marker interactions. Resistance marker loci including the Sr2 locus on 3BS and the wPt1859 locus on 7DL had significant interaction effects with other loci in the same chromosome arm and with markers on chromosome 6B. Other resistance marker loci had significant pairwise interactions with markers on different chromosomes. Based on these results, we propose that a complex network of gene-gene interactions is, in part, responsible for resistance to Ug99. Further investigation may provide insight for understanding mechanisms that contribute to this resistance gene network.

  3. stem rust seedling resistance genes in ethiopian wheat cultivars

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    Stem rust caused by Puccinia graminis f. sp. tritici is one of the major biotic limiting factors for wheat production in Ethiopia. Host plant resistance is the best option to manage stem rust from its economic and environmental points of view. Wheat cultivars are released for production without carrying race specific tests against ...

  4. Stem rust seedling resistance genes in Ethiopian wheat cultivars ...

    African Journals Online (AJOL)

    Stem rust caused by Puccinia graminis f. sp. tritici is one of the major biotic limiting factors for wheat production in Ethiopia. Host plant resistance is the best option to manage stem rust from its economic and environmental points of view. Wheat cultivars are released for production without carrying race specific tests against ...

  5. Thioridazine affects transcription of genes involved in cell wall biosynthesis in methicillin-resistant Staphylococcus aureus

    DEFF Research Database (Denmark)

    Bonde, Mette; Højland, Dorte Heidi; Kolmos, Hans Jørn

    2011-01-01

    have previously shown that the expression of some resistance genes is abolished after treatment with thioridazine and oxacillin. To further understand the mechanism underlying the reversal of resistance, we tested the expression of genes involved in antibiotic resistance and cell wall biosynthesis...... reversal of resistance by thioridazine relies on decreased expression of specific genes involved in cell wall biosynthesis....

  6. Isolation of NBS-LRR class resistant gene (I2 gene) from tomato ...

    African Journals Online (AJOL)

    aghomotsegin

    2013-10-16

    Oct 16, 2013 ... Isolation of NBS-LRR class resistant gene (I2 gene) from tomato cultivar Heamsona ... avirulence protein or effector protein secreted by fungal pathogen during the host colonization in tomato. These effector proteins .... and efficient method for isolation of genomic DNA from plant tissue. J. Cell Tissue Res.

  7. Antimicrobial resistance and virulence-related genes of Streptococcus obtained from dairy cows with mastitis in Inner Mongolia, China.

    Science.gov (United States)

    Ding, Yuexia; Zhao, Junli; He, Xiuling; Li, Man; Guan, Hong; Zhang, Ziying; Li, Peifeng

    2016-01-01

    Mastitis is the most expensive disease in the dairy cattle industry and results in decreased reproductive performance. Streptococcus, especially Streptococcus agalactiae, possesses a variety of virulence factors that contribute to pathogenicity. Streptococcus isolated from mastitis was tested to assess the prevalence of antimicrobial resistance and distribution of antibiotic resistance- and virulence-related genes. Eighty-one Streptococcus isolates were phenotypically characterized for antimicrobial resistance against 15 antibiotics by determining minimum inhibitory concentrations (MIC) using a micro-dilution method. Resistance- and virulence-related genes were detected by PCR. High percentage of resistance to β-lactams, along with tetracycline and erythromycin, was found. Resistance to three or more of seven antimicrobial agents was observed at 88.9%, with penicillin-tetracycline-erythromycin-clindamycin as the major profile in Streptococcus isolates. Resistant genes were detected by PCR, the result showed that 86.4, 86.4, 81.5, and 38.3% of isolates were mainly carrying the pbp2b, tetL, tetM, and ermB genes, respectively. Nine virulence genes were investigated. Genes cyl, glnA, cfb, hylB, and scaA were found to be in 50% of isolates, while 3.7, 21, and 4.9% of isolates were positive for bca, lmb, and scpB, genes, respectively. None of the isolates carried the bac gene. This study suggests the need for prudent use of antimicrobial agents in veterinary clinical medicine to avoid the increase and dissemination of antimicrobial resistance arising from the use of antimicrobial drugs in animals.

  8. Localization of the Laevigatum powdery mildew resistance gene to barley chromosome 2 by the use of RFLP markers

    DEFF Research Database (Denmark)

    Giese, H.; Holm-Jensen, A.G.; Jensen, H.P.

    1993-01-01

    The powdery mildew disease resistance gene Ml(La) was found to belong to a locus on barely chromosome 2. We suggest that this locus be designated MlLa. Linkage analysis was carried out on 72 chromosome-doubled, spring-type progeny lines from a cross between the winter var 'Vogelsanger Gold' and t......' and the spring var 'Alf'. A map of chromosome 2 spanning 119 cM and flanked by two peroxidase gene loci was constructed. In addition to the Laevigatum resistance locus the map includes nine RFLP markers, the two peroxidase gene loci and the six-row locus in barley....

  9. Localization of the Laevigatum powdery mildew resistance gene to barley chromosome 2 by the use of RFLP markers

    DEFF Research Database (Denmark)

    Giese, H.; Holm-Jensen, A.G.; Jensen, H.P.

    1993-01-01

    The powdery mildew disease resistance gene Ml(La) was found to belong to a locus on barely chromosome 2. We suggest that this locus be designated MlLa. Linkage analysis was carried out on 72 chromosome-doubled, spring-type progeny lines from a cross between the winter var 'Vogelsanger Gold......' and the spring var 'Alf'. A map of chromosome 2 spanning 119 cM and flanked by two peroxidase gene loci was constructed. In addition to the Laevigatum resistance locus the map includes nine RFLP markers, the two peroxidase gene loci and the six-row locus in barley....

  10. Arsenic Resistance and Prevalence of Arsenic Resistance Genes in Campylobacter jejuni and Campylobacter coli Isolated from Retail Meats

    Directory of Open Access Journals (Sweden)

    Mohamed K. Fakhr

    2013-08-01

    Full Text Available Studies that investigate arsenic resistance in the foodborne bacterium Campylobacter are limited. A total of 552 Campylobacter isolates (281 Campylobacter jejuni and 271 Campylobacter coli isolated from retail meat samples were subjected to arsenic resistance profiling using the following arsenic compounds: arsanilic acid (4–2,048 μg/mL, roxarsone (4–2048 μg/mL, arsenate (16–8,192 μg/mL and arsenite (4–2,048 μg/mL. A total of 223 of these isolates (114 Campylobacter jejuni and 109 Campylobacter coli were further analyzed for the presence of five arsenic resistance genes (arsP, arsR, arsC, acr3, and arsB by PCR. Most of the 552 Campylobacter isolates were able to survive at higher concentrations of arsanilic acid (512–2,048 μg/mL, roxarsone (512–2,048 μg/mL, and arsenate (128–1,024 μg/mL, but at lower concentrations for arsenite (4–16 μg/mL. Ninety seven percent of the isolates tested by PCR showed the presence of arsP and arsR genes. While 95% of the Campylobacter coli isolates contained a larger arsenic resistance operon that has all of the four genes (arsP, arsR, arsC and acr3, 85% of the Campylobacter jejuni isolates carried the short operon (arsP, and arsR. The presence of arsC and acr3 did not significantly increase arsenic resistance with the exception of conferring resistance to higher concentrations of arsenate to some Campylobacter isolates. arsB was prevalent in 98% of the tested Campylobacter jejuni isolates, regardless of the presence or absence of arsC and acr3, but was completely absent in Campylobacter coli. To our knowledge, this is the first study to determine arsenic resistance and the prevalence of arsenic resistance genes in such a large number of Campylobacter isolates.

  11. Detection of New Methicillin-Resistant Staphylococcus aureus Strains That Carry a Novel Genetic Homologue and Important Virulence Determinants

    NARCIS (Netherlands)

    Sabat, Artur J.; Koksal, Mahir; Akkerboom-Likhuta, Vika; Monecke, Stefan; Kriegeskorte, Andre; Hendrix, Ron; Ehricht, Ralf; Köck, Robin; Becker, Karsten; Friedrich, Alexander W.

    2012-01-01

    In this study, 18 methicillin-resistant Staphylococcus aureus (MRSA) isolates harboring staphylococcal cassette chromosome mec (SCCmec) type XI, recovered in the Dutch-German Euregio, were characterized by DNA microarrays. In contrast to previous data, we found two MRSA strains of different clonal

  12. Multiple herbicide resistance in Lolium multiflorum and identification of conserved regulatory elements of herbicide resistance genes

    Directory of Open Access Journals (Sweden)

    Khalid Mahmood

    2016-08-01

    Full Text Available Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of L. multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR genes were also observed after herbicides exposure in the gene expression databases, indicating them a reliable marker. In order to get an overview of herbicidal resistance status of Lolium multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O.sativa and A.thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward towards a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management.

  13. Transfer of genes for stem rust resistance from Agropyron elongatum and imperial rye to durum wheat

    International Nuclear Information System (INIS)

    Prabhakara Rao, M.V.

    1977-01-01

    The Agropyron elongatum gene for stem rust resistance on chromosome 6A of Knott's Thatcher translocation line was transferred to a susceptible local durum wheat variety, Jaya, through a series of back-crosses. Plants heterozygous for the Agropyron translocation always show at least one open bivalent. Homozygotes have not been obtained, probably because of the absence of male transmission in durum background. Monotelosomic addition of the short arm of Imperial rye chromosome 3R (formerly ''G'' of Sears), which carries a gene(s) for resistance to wheat stem rust, was obtained in the local durum variety. Rust-resistant plants from parents having the added rye telocentric were irradiated with gamma rays just before meiosis, and the pollen obtained from the irradiated spikes was used to pollinate euploid plants. In addition, seeds harvested from 2n+1 resistant plants were irradiated with thermal neutrons and the resistant M 1 plants were selfed to raise M 2 families. Two durum-rye translocation lines were obtained following irradiation. DRT-1 was transmitted normally through the female gametes but showed no male transmission. As a result of this, homozygotes have not been obtained. Gametic transmission rates of DRT-2 are being tested. Alien translocations, which show normal gametic and zygotic transmissions in the hexaploid wheat, may behave differently in a tetraploid background. The results indicate that alien genetic transfers may be more difficult to obtain in durum wheat, probably owing to the reduced buffering effect of the tetraploid genome. (author)

  14. Antibiotic resistance and ndvB gene expression among biofilm ...

    African Journals Online (AJOL)

    A novel antibiotic resistant mechanism among biofilms is glucan-mediated sequestration in which ndvB gene encodes a glucosyltransferase involved in the formation of this glucans. We studied the biofilm formation and antibiotic susceptibility pattern of P. aeruginosa isolated from clinical samples, and measured the ...

  15. Gene pyramiding as a Bt resistance management strategy: How ...

    African Journals Online (AJOL)

    Reports on the emergence of insect resistance to Bacillus thuringiensis delta endotoxins have raised doubts on the sustainability of Bt-toxin based pest management technologies. Corporate industry has responded to this challenge with innovations that include gene pyramiding among others. Pyramiding entails stacking ...

  16. Determination and expression of genes for resistance to blast ...

    African Journals Online (AJOL)

    Determination and expression of genes for resistance to blast (Magnaporthe oryza) in Basmati and non-Basmati indica rices (Oryza sativa L.) Naveen Kumar, D Singh, S Gupta, A Sirohi, B Ramesh, Preeti Sirohi, Parul Sirohi, Atar Singh, N Kumar, A Kumar, Rajendra Kumar, R Kumar, J Singh, P. Kumar, P. Chauhan, ...

  17. Gene interactions and genetics of blast resistance and yield ...

    Indian Academy of Sciences (India)

    2014-08-11

    Aug 11, 2014 ... Keywords. blast; gene action; generation mean analysis; resistance; yield. Journal of Genetics, Vol. 93, No. .... Utilizing the variance of different generations, the variances of A, B, C and D scales were ...... Jia Y. 2003 Marker assisted selection for the control of rice blast disease. Pesticide Outlook 14 ...

  18. Evaluating antibiotic resistance genes in soils with applied manures

    Science.gov (United States)

    Antibiotics are commonly used in livestock production to promote growth and combat disease. Recent studies have shown the potential for spread of antibiotic resistance genes (ARG) to the environment following application of livestock manures. In this study, concentrations of bacteria with ARG in soi...

  19. Absence of meca gene in methicillin-resistant staphylococcus ...

    African Journals Online (AJOL)

    Methicillin-resistant Staphylococcus aureus has emerged as a serious threat to public health, causing both hospital and community-associated infections. The gold standard for MRSA detection is the amplification of the mecA gene that codes for the production of the altered penicillin-binding protein (PBP2a) responsible for ...

  20. Molecular Detection of Virulence Genes and Antibiotic Resistance ...

    African Journals Online (AJOL)

    Escherichia coli O157:H7 is an important food-borne pathogen that can cause diarrhea, haemorrhagic colitis and haemolytic uremic syndrome. This study was conducted to investigate the prevalence, virulence genes and antibiotic resistance patterns of E. coli O157:H7 in raw beef meat sold in Abeokuta, South west Nigeria ...

  1. Molecular detection of disease resistance genes to powdery mildew ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2017-01-04

    Jan 4, 2017 ... 2. State Key Laboratory of Biology for Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of. Agricultural Sciences, Beijing 100193, China. Received 10 October, 2016; Accepted 14 December, 2016. A study was conducted to detect the presence of disease resistance genes to ...

  2. Cloning of a carbendazim-resistant gene from Colletotrichum ...

    African Journals Online (AJOL)

    Cloning of a carbendazim-resistant gene from Colletotrichum gloeosporioides of mango in South China. ... Abstract. Mango anthracnose caused by Colletotrichum gloeosporioides is an important disease and prevalent in tropical regions of China. High carbendazim ... employed to further test the above results. It involved an ...

  3. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    biotech

    2013-07-03

    Jul 3, 2013 ... Resistance genes honologues I theobroma cacao as useful genetic markers. Theor. Appl. Gent. 107:191-202. Kumar S, Tamura K, Nei M (2004). MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform. 5:150-163. Lacock L, Niekerk CV, Loots S, ...

  4. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    biotech

    2013-07-03

    Jul 3, 2013 ... Full Length Research Paper. Cloning and characterization of NBS-LRR resistance gene analogues of Musa spp. and their expression profiling studies against Pratylenchus coffeae. S. Backiyarani*, S. Uma, G. Arunkumar, M. S. Saraswathi and P. Sundararaju. National Research Centre for Banana (ICAR), ...

  5. Prevalence, antibiotic-resistance properties and enterotoxin gene ...

    African Journals Online (AJOL)

    milk-based infant foods in Iran, represent an important public health issue which should be considered ... Keywords: Prevalence, Bacillus cereus, Antibiotic resistance, Enterotoxigenic genes, Milk-based infant food. Tropical Journal of Pharmaceutical Research is indexed by Science ..... and cereals collected in Korea.

  6. Codon-optimized antibiotic resistance gene improves efficiency of ...

    Indian Academy of Sciences (India)

    We generated a synthetic gentamicin resistance gene whose codon usage is optimized to Frankia (fgmR) and evaluated its usefulness as a selection marker using a transient transformation system. Success rate of transient transformation and cell growth in selective culture were significantly increased by use of fgmR ...

  7. Resistance-related gene transcription and antioxidant enzyme ...

    African Journals Online (AJOL)

    The two tobacco relatives of Nicotiana alata and Nicotiana longiflora display a high level of resistance against Colletotrichum nicotianae and the two genes NTF6 and NtPAL related to pathogen defense transcription were higher in N. alata and N. longiflora than the commercial cv. K326. Inoculation with C. nicotianae ...

  8. Functional screening of antibiotic resistance genes from human gut microbiota reveals a novel gene fusion.

    Science.gov (United States)

    Cheng, Gong; Hu, Yongfei; Yin, Yeshi; Yang, Xi; Xiang, Chunsheng; Wang, Baohong; Chen, Yanfei; Yang, Fengling; Lei, Fang; Wu, Na; Lu, Na; Li, Jing; Chen, Quanze; Li, Lanjuan; Zhu, Baoli

    2012-11-01

    The human gut microbiota has a high density of bacteria that are considered a reservoir for antibiotic resistance genes (ARGs). In this study, one fosmid metagenomic library generated from the gut microbiota of four healthy humans was used to screen for ARGs against seven antibiotics. Eight new ARGs were obtained: one against amoxicillin, six against d-cycloserine, and one against kanamycin. The new amoxicillin resistance gene encodes a protein with 53% identity to a class D β-lactamase from Riemerella anatipestifer RA-GD. The six new d-cycloserine resistance genes encode proteins with 73-81% identity to known d-alanine-d-alanine ligases. The new kanamycin resistance gene encodes a protein of 274 amino acids with an N-terminus (amino acids 1-189) that has 42% identity to the 6'-aminoglycoside acetyltransferase [AAC(6')] from Enterococcus hirae and a C-terminus (amino acids 190-274) with 35% identity to a hypothetical protein from Clostridiales sp. SSC/2. A functional study on the novel kanamycin resistance gene showed that only the N-terminus conferred kanamycin resistance. Our results showed that functional metagenomics is a useful tool for the identification of new ARGs. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  9. Antimicrobial resistance and virulence genes in Escherichia coli and enterococci from red foxes (Vulpes vulpes).

    Science.gov (United States)

    Radhouani, Hajer; Igrejas, Gilberto; Gonçalves, Alexandre; Pacheco, Rui; Monteiro, Ricardo; Sargo, Roberto; Brito, Francisco; Torres, Carmen; Poeta, Patrícia

    2013-10-01

    The aims of the study were to analyse the prevalence of antimicrobial resistance and the mechanisms implicated, as well as the virulence factors, in faecal Escherichia coli and Enterococcus spp. from red foxes. From 52 faecal samples, 22 E. coli (42.3%) and 50 enterococci (96.2%) isolates were recovered (one/sample). A high percentage of E. coli isolates exhibited resistance to streptomycin, tetracycline, trimethoprim-sulfamethoxazole or ampicillin (54-27%), and they harboured the aadA, tet(A) and/or tet(B), sul1 and blaTEM resistance genes, respectively. The E. coli isolates were ascribed to the 4 major phylogroups, D (41% of isolates), A (31.8%), B1 (18.2%) and B2 (9.1%), and carried the fimA (63.3%) or aer (13.6%) virulence genes. Among enterococcal isolates, Enterococcus faecium was the most prevalent species (50%). A high percentage of enterococcal isolates showed tetracycline resistance (88%) harbouring different combinations of tet(M) and tet(L) genes. The erm(B) or the aph(3')-IIIa gene were identified in most of our erythromycin- or kanamycin-resistant enterococci, respectively. This report suggests the role of red foxes from rural areas in the cycle of transmission and spread of antimicrobial-resistant E. coli and enterococci into the environment, representing a reservoir of these antimicrobial-resistant microorganisms. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Regional dissemination of a trimethoprim-resistance gene cassette via a successful transposable element.

    Directory of Open Access Journals (Sweden)

    Amy S Labar

    Full Text Available Antimicrobial resistance is a growing international problem. We observed a 50% increase in the prevalence of trimethoprim resistance among fecal Escherichia coli from healthy Nigerian students between 1998 and 2005, a trend to increase that continued in 2009.A PCR-based screen revealed that 131 (43.1% of isolates obtained in Nigeria in 2005 and 2009 carried integron-borne dfrA cassettes. In the case of 67 (51.1% of these isolates, the cassette was a class 1-integron-borne dfrA7 gene, which has been reported at high prevalence from E. coli isolates from other parts of Africa. Complete sequencing of a 27 Kb dfrA7-bearing plasmid from one isolate located the dfrA7 gene within a Tn21-type transposon. The transposon also contained an IS26-derived bla/sul/str element, encoding resistance to β-lactams, sulphonamides and streptomycin, and mercury resistance genes. Although the plasmid backbone was only found in 12 (5.8% of trimethoprim-resistant isolates, dfrA7 and other transposon-borne genes were detected in 14 (16.3% and 32 (26.3% of trimethoprim resistant isolates collected in Nigeria in 2005 and 2009, respectively. Additionally, 37 (19.3% of trimethoprim-resistant E. coli isolates collected between 2006 and 2008 from Ghana were positive for the dfrA7 and a transposon marker, but only 4 (2.1% harbored the plasmid backbone.Our data point to transposition as a principal mechanism for disseminating dfrA7 among E. coli from Nigeria and Ghana. On-going intensive use of the affordable broad-spectrum antibacterials is likely to promote selective success of a highly prevalent transposable element in West Africa.

  11. A set of vectors for introduction of antibiotic resistance genes by in vitro Cre-mediated recombination

    Directory of Open Access Journals (Sweden)

    Vassetzky Yegor S

    2008-12-01

    Full Text Available Abstract Background Introduction of new antibiotic resistance genes in the plasmids of interest is a frequent task in molecular cloning practice. Classical approaches involving digestion with restriction endonucleases and ligation are time-consuming. Findings We have created a set of insertion vectors (pINS carrying genes that provide resistance to various antibiotics (puromycin, blasticidin and G418 and containing a loxP site. Each vector (pINS-Puro, pINS-Blast or pINS-Neo contains either a chloramphenicol or a kanamycin resistance gene and is unable to replicate in most E. coli strains as it contains a conditional R6Kγ replication origin. Introduction of the antibiotic resistance genes into the vector of interest is achieved by Cre-mediated recombination between the replication-incompetent pINS and a replication-competent target vector. The recombination mix is then transformed into E. coli and selected by the resistance marker (kanamycin or chloramphenicol present in pINS, which allows to recover the recombinant plasmids with 100% efficiency. Conclusion Here we propose a simple strategy that allows to introduce various antibiotic-resistance genes into any plasmid containing a replication origin, an ampicillin resistance gene and a loxP site.

  12. Putative resistance genes in the CitEST database

    Directory of Open Access Journals (Sweden)

    Simone Guidetti-Gonzalez

    2007-01-01

    Full Text Available Disease resistance in plants is usually associated with the activation of a wide variety of defense responses to prevent pathogen replication and/or movement. The ability of the host plant to recognize the pathogen and to activate defense responses is regulated by direct or indirect interaction between the products of plant resistance (R and pathogen avirulence (Avr genes. Attempted infection of plants by avirulent pathogens elicits a battery of defenses often followed by the collapse of the challenged host cells. Localized host cell death may help to prevent the pathogen from spreading to uninfected tissues, known as hypersensitive response (HR. When either the plant or the pathogen lacks its cognate gene, activation of the plant’s defense responses fails to occur or is delayed and does not prevent pathogen colonization. In the CitEST database, we identified 1,300 reads related to R genes in Citrus which have been reported in other plant species. These reads were translated in silico, and alignments of their amino acid sequences revealed the presence of characteristic domains and motifs that are specific to R gene classes. The description of the reads identified suggests that they function as resistance genes in citrus.

  13. Panton-Valentine leukocidin positive sequence type 80 methicillin-resistant Staphylococcus aureus carrying a staphylococcal cassette chromosome mec type IVc is dominant in neonates and children in an Algiers hospital.

    Science.gov (United States)

    Djoudi, Ferhat; Bonura, Celestino; Benallaoua, Said; Touati, Abdelaziz; Touati, Djamila; Aleo, Aurora; Cala, Cinzia; Fasciana, Teresa; Mammina, Caterina

    2013-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a major antimicrobial drug-resistant pathogen causing serious infections. It was first detected in healthcare settings, but in recent years it has also become disseminated in the community. Children and young adults are most susceptible to infection by community-acquired (CA) MRSA strains. In this study 25 MRSA isolates implicated in infections of neonates and children admitted to an Algiers hospital during an 18 month period were characterized by molecular methods including staphylococcal cassette chromosome (SCC) mec typing, PCR amplification of pvl genes, pulsed field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Fifteen out of 25 isolates were from hospital-acquired infections. Twenty-four isolates carried SCCmec type IVc and belonged to the sequence type (ST) 80, one isolate carried SCCmec type II and was ST 39. Twenty-two out of 24 ST80-MRSA-IVc isolates carried pvl genes. Our results suggest that the Panton-Valentine leukocidin positive ST80- MRSA-IVc is the dominant MRSA clone causing disease in neonates and children in Algiers.

  14. Identification of antimicrobial resistance genes in multidrug-resistant clinical Bacteroides fragilis isolates by whole genome shotgun sequencing

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Sóki, József; Hasman, Henrik

    2015-01-01

    Bacteroides fragilis constitutes the most frequent anaerobic bacterium causing bacteremia in humans. The genetic background for antimicrobial resistance in B. fragilis is diverse with some genes requiring insertion sequence (IS) elements inserted upstream for increased expression. To evaluate whole...... genome shotgun sequencing as a method for predicting antimicrobial resistance properties, one meropenem resistant and five multidrug-resistant blood culture isolates were sequenced and antimicrobial resistance genes and IS elements identified using ResFinder 2.1 (http...

  15. Effects of ultraviolet disinfection on antibiotic-resistant Escherichia coli from wastewater: inactivation, antibiotic resistance profiles and antibiotic resistance genes.

    Science.gov (United States)

    Zhang, Chong-Miao; Xu, Li-Mei; Wang, Xiaochang C; Zhuang, Kai; Liu, Qiang-Qiang

    2017-04-29

    To evaluate the effect of ultraviolet (UV) disinfection on antibiotic-resistant Escherichia coli (E. coli). Antibiotic-resistant E. coli strains were isolated from a wastewater treatment plant and subjected to UV disinfection. The effect of UV disinfection on the antibiotic resistance profiles and the antibiotic resistance genes (ARGs) of antibiotic-resistant E. coli was evaluated by a combination of antibiotic susceptibility analysis and molecular methods. Results indicated that multiple-antibiotic-resistant (MAR) E. coli were more resistant at low UV doses and required a higher UV dose (20 mJ cm -2 ) to enter the tailing phase compared with those of antibiotic-sensitive E. coli (8 mJ cm -2 ). UV disinfection caused a selective change in the inhibition zone diameters of surviving antibiotic-resistant E. coli and a slight damage to ARGs. The inhibition zone diameters of the strains resistant to antibiotics were more difficult to alter than those susceptible to antibiotics because of the existence and persistence of corresponding ARGs. The resistance of MAR bacteria to UV disinfection at low UV doses and the changes in inhibition zone diameters could potentially contribute to the selection of ARB in wastewater treatment after UV disinfection. The risk of spread of antibiotic resistance still exists owing to the persistence of ARGs. Our study highlights the acquisition of other methods to control the spread of ARGs. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  16. Bacteria from Animals as a Pool of Antimicrobial Resistance Genes

    Science.gov (United States)

    Argudín, Maria Angeles; Deplano, Ariane; Meghraoui, Alaeddine; Dodémont, Magali; Heinrichs, Amelie; Denis, Olivier; Nonhoff, Claire; Roisin, Sandrine

    2017-01-01

    Antimicrobial agents are used in both veterinary and human medicine. The intensive use of antimicrobials in animals may promote the fixation of antimicrobial resistance genes in bacteria, which may be zoonotic or capable to transfer these genes to human-adapted pathogens or to human gut microbiota via direct contact, food or the environment. This review summarizes the current knowledge of the use of antimicrobial agents in animal health and explores the role of bacteria from animals as a pool of antimicrobial resistance genes for human bacteria. This review focused in relevant examples within the ESC(K)APE (Enterococcus faecium, Staphylococcus aureus, Clostridium difficile (Klebsiella pneumoniae), Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacteriaceae) group of bacterial pathogens that are the leading cause of nosocomial infections throughout the world. PMID:28587316

  17. Concentration of facultative pathogenic bacteria and antibiotic resistance genes during sewage treatment and in receiving rivers.

    Science.gov (United States)

    Heß, Stefanie; Lüddeke, Frauke; Gallert, Claudia

    2016-10-01

    Whereas the hygienic condition of drinking and bathing water by law must be monitored by culture-based methods, for quantification of microbes and antibiotic resistance in soil or the aquatic environment, often molecular genetic assays are used. For comparison of both methods, knowledge of their correlation is necessary. Therefore the population of total bacteria, Escherichia coli, enterococci and staphylococci during sewage treatment and in receiving river water was compared by agar plating and quantitative polymerase chain reaction (qPCR) assays. In parallel, all samples were investigated for clinically relevant antibiotic resistance genes. Whereas plating and qPCR data for total bacteria correlated well in sewage after primary treatment, qPCR data of river water indicated higher cell numbers for E. coli. It is unknown if these cells are 'only' not growing under standard conditions or if they are dead. Corresponding to the amount of non-culturable cells, the 'breakpoints' for monitoring water quality should be adapted. The abundances of clinically relevant antibiotic resistance genes in river water were in the same order of magnitude or even higher than in treated sewage. For estimation of the health risk it is important to investigate which species carry respective genes and whether these genes are disseminated via gene transfer.

  18. Introgression of stem rust resistance genes SrTA10187 and SrTA10171 from Aegilops tauschii to wheat.

    Science.gov (United States)

    Olson, Eric L; Rouse, Matthew N; Pumphrey, Michael O; Bowden, Robert L; Gill, Bikram S; Poland, Jesse A

    2013-10-01

    Aegilops tauschii, the diploid progenitor of the wheat D genome, is a readily accessible germplasm pool for wheat breeding as genes can be transferred to elite wheat cultivars through direct hybridization followed by backcrossing. Gene transfer and genetic mapping can be integrated by developing mapping populations during backcrossing. Using direct crossing, two genes for resistance to the African stem rust fungus race TTKSK (Ug99), were transferred from the Ae. tauschii accessions TA10187 and TA10171 to an elite hard winter wheat line, KS05HW14. BC2 mapping populations were created concurrently with developing advanced backcross lines carrying rust resistance. Bulked segregant analysis on the BC2 populations identified marker loci on 6DS and 7DS linked to stem rust resistance genes transferred from TA10187 and TA10171, respectively. Linkage maps were developed for both genes and closely linked markers reported in this study will be useful for selection and pyramiding with other Ug99-effective stem rust resistance genes. The Ae. tauschii-derived resistance genes were temporarily designated SrTA10187 and SrTA10171 and will serve as valuable resources for stem rust resistance breeding.

  19. Antimicrobial susceptibilities and resistance genes in Campylobacter strains isolated from poultry and pigs in Australia.

    Science.gov (United States)

    Obeng, A S; Rickard, H; Sexton, M; Pang, Y; Peng, H; Barton, M

    2012-08-01

    To evaluate the phenotypic and genotypic profiles of Campylobacter spp. from poultry faecal samples from free range or intensively raised meat chickens and free range egg layers. In addition, a case-comparison study of antibiotic resistance genes from different groups of poultry and some pig strains previously collected was carried out. Resistance to different antibiotics was assessed using the agar dilution method. In addition, all the strains were tested for ampicillin (bla(OXA-61) ), erythromycin (aph-3-1), tetracycline tet(O), streptomycin (aadE), and the energy-dependent multi-drug efflux pump (cmeB) resistance genes using multiplex polymerase chain reaction. The evaluation of phenotypic resistance revealed all of the strains from poultry were sensitive to ciprofloxacin, gentamicin, erythromycin or tylosin. But, widespread resistance to lincomycin (51-100%), extensive resistance to ampicillin (33·3-60·2%) and less resistance to tetracycline (5·6-40·7%) were observed in the different groups of chickens. Antibiotic resistance genes bla(OXA-61,) cmeB and tet(O) were found in 82·6-92·7%, 80·3-89% and 22·3-30·9% Camp. coli isolates from pigs, whilst 59-65·4% and 19·2-40·7% Camp. jejuni from chickens were found to encode bla(OXA-61) and tet(O), respectively. No significant difference between isolates from free range egg layers and meat chickens (P resistance genes. In addition, pulsed field gel electrophoresis of selected resistant isolates from the poultry and pig revealed closely related clonal groups. Our results suggest the resistant strains are persisting environmental isolates that have been acquired by the different livestock species. Furthermore, the different treatment practices in poultry and pigs have resulted in differences in resistance profiles in Campylobacter isolates. © 2012 The Authors Journal of Applied Microbiology © 2012 The Society for Applied Microbiology.

  20. Prevalence and characterization of methicillin-resistant Staphylococcus aureus carrying mecA or mecC and methicillin-susceptible Staphylococcus aureus in dairy sheep farms in central Italy.

    Science.gov (United States)

    Giacinti, G; Carfora, V; Caprioli, A; Sagrafoli, D; Marri, N; Giangolini, G; Amoruso, R; Iurescia, M; Stravino, F; Dottarelli, S; Feltrin, F; Franco, A; Amatiste, S; Battisti, A

    2017-10-01

    Between January and May 2012, a total of 286 bulk tank milk samples from dairy sheep farms located in central Italy were tested for the presence of Staphylococcus aureus. One hundred fifty-three samples were positive for S. aureus (53.5%), with an average count of 2.53 log cfu/mL. A total of 679 S. aureus colonies were screened for methicillin resistance by the cefoxitin disk diffusion test, and 104 selected cefoxitin-susceptible isolates were also tested for their susceptibility to other antimicrobials representative of the most relevant classes active against Staphylococcus spp. by using the Kirby-Bauer disk diffusion method. Two methicillin-resistant Staphylococcus aureus (MRSA) isolates, carrying respectively the mecA and the mecC genes, were detected in 2 samples from 2 different farms (prevalence 0.7%). The mecA-positive MRSA isolate was blaZ positive, belonged to spa type t127, sequence type (ST)1, clonal complex (CC)1, carried a staphylococcal cassette chromosome mec (SCCmec) type IVa, and was phenotypically resistant to all the β-lactams tested and to erythromycin, streptomycin, kanamycin, and tetracycline. The mecC-positive MRSA isolate was negative for the chromosomally or plasmid-associated blaZ gene but positive for the blaZ allotype associated with SCCmec XI (blaZ-SCCmecXI), belonged to spa type 843, ST(CC)130, carried a SCCmec type XI, and was resistant only to β-lactams. Both MRSA were negative for the presence of specific immune-evasion and virulence genes such as those coding for the Panton-Valentine leucocidin, the toxic shock syndrome toxin 1, and the immune evasion cluster genes. Regarding the presence of the major S. aureus enterotoxin genes, the mecC-positive MRSA tested negative, whereas the ST (CC)1 mecA-positive MRSA harbored the seh gene. Among the 104 methicillin-susceptible S. aureus isolates examined for antimicrobial susceptibility, 63 (60.58%) were susceptible to all the antimicrobials tested, and 41 (39.42%) were resistant to at

  1. Identification and molecular mapping of a wheat gene for resistance to an unadapted isolate of Colletotrichum cereale.

    Science.gov (United States)

    Inoue, Yoshihiro; Mori, Ryota; Takahashi, Yujiro; Kiguchi, So; Enomoto, Takashi; Chuma, Izumi; Tosa, Yukio

    2013-06-01

    To elucidate genetic mechanisms of host species specificity between graminicolous anthracnose fungi and gramineous plants, infection assays were performed with a Sorghum isolate (Colletotrichum sublineolum), a Digitaria isolate (C. hanaui), a Polypogon isolate (C. cereale), and an Avena isolate (C. cereale). They were specifically virulent on the plants from which they were isolated. When 72 wheat lines were inoculated with an unadapted isolate from Asia Minor bluegrass (Cgp29), however, some exceptional cultivars were recognized. Although most cultivars were resistant to Cgp29, 'Hope' was susceptible. In F2 populations derived from crosses between three resistant cultivars-'Norin 4' (N4), 'Chinese Spring' (CS), and 'Shin-chunaga' (Sch)-and the susceptible Hope, resistant and susceptible seedlings segregated in a 3:1 ratio, suggesting that a major gene is involved in the resistance of each cultivar to Cgp29. In F2 populations derived from crosses between the three resistant cultivars, all seedlings were resistant, suggesting that these three cultivars carry the same gene. This resistance gene was designated as "resistance to Colletotrichum cereale 1" (Rcc1). Analysis with the CS-Hope chromosome substitution lines and molecular mapping revealed that Rcc1 was located on the long arm of chromosome 5A. Cytologically, Rcc1 was mainly associated with hypersensitive reaction. These results suggest that major genes similar to those controlling cultivar specificity are involved in the resistance of wheat against the unadapted isolate of C. cereale.

  2. Relationship between Psidium species (Myrtaceae) by resistance gene analog markers: focus on nematode resistance.

    Science.gov (United States)

    Noia, L R; Tuler, A C; Ferreira, A; Ferreira, M F S

    2017-03-16

    Guava (Psidium guajava L.) crop is severely affected by the nematode Meloidogyne enterolobii. Native Psidium species have been reported as sources of resistance against this nematode. Knowledge on the molecular relationship between Psidium species based on plant resistance gene analogs (RGA) can be useful in the genetic breeding of guava for resistance to M. enterolobii. In this study, RGA markers from conserved domains, and structural features of plant R genes, were employed to characterize Psidium species and establish genetic proximity, with a focus on nematode resistance. SSR markers were also applied owing to their neutral nature, thus differing from RGA markers. For this, species reported as sources of resistance to M. enterolobii, such as P. cattleianum and P. friedrichsthalianum, as well as species occurring in the Atlantic Rainforest and susceptible genotypes, were investigated. In 10 evaluated Psidium species, high interspecific genetic variability was verified through RGA and SSR markers, with intraspecific variation in P. guajava higher with SSR, as was expected. Resistant species were clustered by RGA markers, and differential amplicons among genotypes resistant and susceptible to M. enterolobii were identified. Knowledge on the molecular relationships between Psidium species constitutes useful information for breeding of the guava tree, providing direction for hybridization and material for rootstocks. Additionally, the genetic relationship between native species, which have been little studied, and P. guajava were estimated by RGAs, which were confirmed as important markers for genetic diversity related to pathogen resistance.

  3. Genotypic evaluation of etravirine sensitivity of clinical human immunodeficiency virus type 1 (HIV-1) isolates carrying resistance mutations to nevirapine and efavirenz.

    Science.gov (United States)

    Oumar, A A; Jnaoui, K; Kabamba-Mukadi, B; Yombi, J C; Vandercam, B; Goubau, P; Ruelle, J

    2010-01-01

    Etravirine is a second-generation non-nucleoside reverse transcriptase inhibitor (NNRTI) with a pattern of resistance mutations quite distinct from the current NNRTIs. We collected all routine samples of HIV-1 patients followed in the AIDS reference laboratory of UCLouvain (in 2006 and 2007) carrying resistance-associated mutations to nevirapine (NVP) or efavirenz (EFV). The sensitivity to Etravirine was estimated using three different drug resistance algorithms: ANRS (July 2008), IAS (December 2008) and Stanford (November 2008). We also verified whether the mutations described as resistance mutations are not due to virus polymorphisms by the study of 58 genotypes of NNRTI-naive patients. Sixty one samples harboured resistance to NVP and EFV: 41/61 had at least one resistance mutation to Etravirine according to ANRS-IAS algorithms; 42/61 samples had at least one resistance mutation to Etravirine according to the Stanford algorithm. 48 and 53 cases were fully sensitive to Etravirine according to ANRS-IAS and Stanford algorithms, respectively. Three cases harboured more than three mutations and presented a pattern of high-degree resistance to Etravirine according to ANRS-IAS algorithm, while one case harboured more than three mutations and presented high degree resistance to Etravirine according to the Stanford algorithm. The V1061 and V179D mutations were more frequent in the ARV-naive group than in the NNRTI-experienced one. According to the currently available algorithms, Etravirine can still be used in the majority of patients with virus showing resistance to NVP and/or EFV, if a combination of other active drugs is included.

  4. Effect of route of delivery on heterologous protection against HCV induced by an adenovirus vector carrying HCV structural genes

    Directory of Open Access Journals (Sweden)

    Guan Jie

    2011-11-01

    Full Text Available Abstract Background An effective vaccine and new therapeutic methods for hepatitis C virus (HCV are needed, and a potent HCV vaccine must induce robust and sustained cellular-mediated immunity (CMI. Research has indicated that adenoviral and vaccinia vectors may have the ability to elicit strong B and T cell immune responses to target antigens. Results A recombinant replication-defective adenovirus serotype 5 (rAd5 vector, rAd5-CE1E2, and a recombinant Tian Tan vaccinia vector, rTTV-CE1E2, were constructed to express the HCV CE1E2 gene (1-746 amino acid HCV 1b subtype. Mice were prime-immunised with rAd5-CE1E2 delivered via intramuscular injection (i.m., intranasal injection (i.n., or intradermal injection (i.d. and boosted using a different combination of injection routes. CMI was evaluated via IFN-γ ELISPOT and ICS 2 weeks after immunisation, or 16 weeks after boost for long-term responses. The humoral response was analysed by ELISA. With the exception of priming by i.n. injection, a robust CMI response against multiple HCV antigens (core, E1, E2 was elicited and remained at a high level for a long period (16 weeks post-vaccination in mice. However, i.n. priming elicited the highest anti-core antibody levels. Priming with i.d. rAd5-CE1E2 and boosting with i.d. rTTV-CE1E2 carried out simultaneously enhanced CMI and the humoral immune response, compared to the homologous rAd5-CE1E2 immune groups. All regimens demonstrated equivalent cross-protective potency in a heterologous surrogate challenge assay based on a recombinant HCV (JFH1, 2a vaccinia virus. Conclusions Our data suggest that a rAd5-CE1E2-based HCV vaccine would be capable of eliciting an effective immune response and cross-protection. These findings have important implications for the development of T cell-based HCV vaccine candidates.

  5. Polymorphisms in Plasmodium falciparum chloroquine resistance transporter and multidrug resistance 1 genes

    DEFF Research Database (Denmark)

    Venkatesan, Meera; Gadalla, Nahla B; Stepniewska, Kasia

    2014-01-01

    Adequate clinical and parasitologic cure by artemisinin combination therapies relies on the artemisinin component and the partner drug. Polymorphisms in the Plasmodium falciparum chloroquine resistance transporter (pfcrt) and P. falciparum multidrug resistance 1 (pfmdr1) genes are associated...... with decreased sensitivity to amodiaquine and lumefantrine, but effects of these polymorphisms on therapeutic responses to artesunate-amodiaquine (ASAQ) and artemether-lumefantrine (AL) have not been clearly defined. Individual patient data from 31 clinical trials were harmonized and pooled by using standardized...

  6. Loss of Apc heterozygosity and abnormal tissue building in nascent intestinal polyps in mice carrying a truncated Apc gene.

    OpenAIRE

    Oshima, M; Oshima, H; Kitagawa, K; Kobayashi, M; Itakura, C; Taketo, M

    1995-01-01

    Mutations in the APC (adenomatous polyposis coli) gene appear to be responsible for not only familial adenomatous polyposis but also many sporadic cases of gastrointestinal cancers. Using homologous recombination in mouse embryonic stem cells, we constructed mice that contained a mutant gene encoding a product truncated at a 716 (Apc delta 716). Mendelian transmission of the gene caused most homozygous mice to die in utero before day 8 of gestation. The heterozygotes developed multiple polyps...

  7. Gene delivery: A single nuclear localization signal peptide is sufficient to carry DNA to the cell nucleus

    OpenAIRE

    Zanta, Maria Antonietta; Belguise-Valladier, Pascale; Behr, Jean-Paul

    1999-01-01

    Translocation of exogenous DNA through the nuclear membrane is a major concern of gene delivery technologies. To take advantage of the cellular import machinery, we have synthesized a capped 3.3-kbp CMVLuciferase-NLS gene containing a single nuclear localization signal peptide (PKKKRKVEDPYC). Transfection of cells with the tagged gene remained effective down to nanogram amounts of DNA. Transfection enhancement (10- to 1,000-fold) as a result of the signal peptide was observed irrespective of ...

  8. Fine mapping and candidate gene analysis of two loci conferring resistance to Phytophthora sojae in soybean.

    Science.gov (United States)

    Li, Linghong; Lin, Feng; Wang, Weidong; Ping, Jieqing; Fitzgerald, Joshua C; Zhao, Meixia; Li, Shuai; Sun, Lianjun; Cai, Chunmei; Ma, Jianxin

    2016-12-01

    RpsUN1 and RpsUN2 were fine mapped to two genomic regions harboring disease resistance-like genes. The haplotypes and instability of the regions and candidate genes for the two resistance loci were characterized. Phytophthora root and stem rot caused by Phytophthora sojae, is one of the most destructive diseases of soybean. Deploying soybean cultivars carrying race-specific resistance conferred by Rps genes is the most practical approach to managing this disease. Previously, two Rps genes, RpsUN1 and RpsUN2 were identified in a landrace PI 567139B and mapped to a 6.5 cM region on chromosome 3 and a 3.0 cM region on chromosome 16, corresponding to 1387 and 423 kb of the soybean reference genome sequences. By analyzing recombinants defined by genotypic and phenotypic screening of the 826 F 2:3 families derived from two reciprocal crosses between the two parental lines, RpsUN1 and RpsUN2, were further narrowed to a 151 kb region that harbors five genes including three disease resistance (R)-like genes, and a 36 kb region that contains four genes including five R-like genes, respectively, according to the reference genome. Expressional changes of these nine genes before and after inoculation with the pathogen, as revealed by RNA-seq, suggest that Glyma.03g034600 in the RpsUN1 region and Glyma.16g215200 and Glyma.16g214900 in the RpsUN2 region of PI 567139B may be associated with the resistance to P. sojae. It is also suggested that unequal recombination between/among R-like genes may have occurred, resulting in the formation of two recombinants with inconsistent genotypic and phenotypic observations. The haplotype variation of genomic regions where RpsUN1 and RpsUN2 reside in the entire soybean germplasm deposited in the US soybean germplasm collection suggests that RpsUN1 and RpsUN2 are most likely novel genes.

  9. Recombination Rate Heterogeneity within Arabidopsis Disease Resistance Genes.

    Science.gov (United States)

    Choi, Kyuha; Reinhard, Carsten; Serra, Heïdi; Ziolkowski, Piotr A; Underwood, Charles J; Zhao, Xiaohui; Hardcastle, Thomas J; Yelina, Nataliya E; Griffin, Catherine; Jackson, Matthew; Mézard, Christine; McVean, Gil; Copenhaver, Gregory P; Henderson, Ian R

    2016-07-01

    Meiotic crossover frequency varies extensively along chromosomes and is typically concentrated in hotspots. As recombination increases genetic diversity, hotspots are predicted to occur at immunity genes, where variation may be beneficial. A major component of plant immunity is recognition of pathogen Avirulence (Avr) effectors by resistance (R) genes that encode NBS-LRR domain proteins. Therefore, we sought to test whether NBS-LRR genes would overlap with meiotic crossover hotspots using experimental genetics in Arabidopsis thaliana. NBS-LRR genes tend to physically cluster in plant genomes; for example, in Arabidopsis most are located in large clusters on the south arms of chromosomes 1 and 5. We experimentally mapped 1,439 crossovers within these clusters and observed NBS-LRR gene associated hotspots, which were also detected as historical hotspots via analysis of linkage disequilibrium. However, we also observed NBS-LRR gene coldspots, which in some cases correlate with structural heterozygosity. To study recombination at the fine-scale we used high-throughput sequencing to analyze ~1,000 crossovers within the RESISTANCE TO ALBUGO CANDIDA1 (RAC1) R gene hotspot. This revealed elevated intragenic crossovers, overlapping nucleosome-occupied exons that encode the TIR, NBS and LRR domains. The highest RAC1 recombination frequency was promoter-proximal and overlapped CTT-repeat DNA sequence motifs, which have previously been associated with plant crossover hotspots. Additionally, we show a significant influence of natural genetic variation on NBS-LRR cluster recombination rates, using crosses between Arabidopsis ecotypes. In conclusion, we show that a subset of NBS-LRR genes are strong hotspots, whereas others are coldspots. This reveals a complex recombination landscape in Arabidopsis NBS-LRR genes, which we propose results from varying coevolutionary pressures exerted by host-pathogen relationships, and is influenced by structural heterozygosity.

  10. Gene pyramiding enhances durable blast disease resistance in rice.

    Science.gov (United States)

    Fukuoka, Shuichi; Saka, Norikuni; Mizukami, Yuko; Koga, Hironori; Yamanouchi, Utako; Yoshioka, Yosuke; Hayashi, Nagao; Ebana, Kaworu; Mizobuchi, Ritsuko; Yano, Masahiro

    2015-01-14

    Effective control of blast, a devastating fungal disease of rice, would increase and stabilize worldwide food production. Resistance mediated by quantitative trait loci (QTLs), which usually have smaller individual effects than R-genes but confer broad-spectrum or non-race-specific resistance, is a promising alternative to less durable race-specific resistance for crop improvement, yet evidence that validates the impact of QTL combinations (pyramids) on the durability of plant disease resistance has been lacking. Here, we developed near-isogenic experimental lines representing all possible combinations of four QTL alleles from a durably resistant cultivar. These lines enabled us to evaluate the QTLs singly and in combination in a homogeneous genetic background. We present evidence that pyramiding QTL alleles, each controlling a different response to M. oryzae, confers strong, non-race-specific, environmentally stable resistance to blast disease. Our results suggest that this robust defence system provides durable resistance, thus avoiding an evolutionary "arms race" between a crop and its pathogen.

  11. Persistence of antimicrobial resistance genes from sows to finisher pigs

    DEFF Research Database (Denmark)

    Birkegård, Anna Camilla; Halasa, Tariq; Folkesson, Anders

    2018-01-01

    Antimicrobial resistance in pigs has been under scrutiny for many years. However, many questions remain unanswered, including whether the initial antimicrobial resistance level of a pig will influence the antimicrobial resistance found at slaughter. Faecal samples from finishers pigs from 681 farms...... and from sows from 82 farms were collected, and levels of seven antimicrobial resistance genes, ermB, ermF, sulI, sulII, tet(M), tet(O), and tet(W), were quantified by high-capacity qPCR. There were 40 pairs of observations where the finishers were born in the farms of the sows. The objective of this study...... was to evaluate whether the levels of AMR genes found in finisher pigs at slaughter were associated with the levels in the farm where the finishers were born, and whether the levels of the AMR genes were equal in the sow and finisher pig populations. We found a significant positive correlation between the levels...

  12. Mapping fusiform rust resistance genes within a complex mating design of loblolly pine

    Science.gov (United States)

    Tania Quesada; Marcio F.R. Resende Jr.; Patricio Munoz; Jill L. Wegrzyn; David B. Neale; Matias Kirst; Gary F. Peter; Salvador A. Gezan; C.Dana Nelson; John M. Davis

    2014-01-01

    Fusiform rust resistance can involve gene-for-gene interactions where resistance (Fr) genes in the host interact with corresponding avirulence genes in the pathogen, Cronartium quercuum f.sp. fusiforme (Cqf). Here, we identify trees with Fr genes in a loblolly pine population derived from a complex mating design challenged with two Cqf inocula (one gall and 10 gall...

  13. Resistance-Gene Cassettes Associated With Salmonella enterica Genotypes.

    Science.gov (United States)

    Bakhshi, Bita; Ghafari, Mohsen; Pourshafie, Mohammad R; Zarbakhsh, Behnaz; Katouli, Mohammad; Rahbar, Mohammad; Hajia, Masoud; Hosseini-Aliabad, Neda; Boustanshenas, Mina

    2015-01-01

    The epidemiology of salmonellosis is complex because of the diversity and different serotypes of Salmonella enterica (S. enterica) that occur in different reservoirs and geographic incidences. To determine the genotype distribution and resistance-gene content of 2 classes of integron among S. enterica isolates. Thirty-six S. enterica species were isolated and tested for their serological distribution and the resistance-gene contents of 2 classes of integron, as well as for their genetic diversity, using the pulsed-field gel electrophoresis (PFGE) genotyping method. Serogroups E (36.1%) and D (30.5%) were dominant among the isolates. All of the isolates in serogroup D belonged to the serovar enteritidis. The aadA1 gene was found within all resistance-gene cassettes. We observed 4 common and 26 single pulsotypes among the isolates, which indicated a high degree of genetic diversity among the isolates. Using the PulseNet International standard protocol, it was found that these isolates were different from those reported previously in Iran. The presence of a few common and new pulsotypes among the isolates suggests the emergence and spread of new clones of S. enterica in Iran. Copyright© by the American Society for Clinical Pathology (ASCP).

  14. Continental-scale pollution of estuaries with antibiotic resistance genes.

    Science.gov (United States)

    Zhu, Yong-Guan; Zhao, Yi; Li, Bing; Huang, Chu-Long; Zhang, Si-Yu; Yu, Shen; Chen, Yong-Shan; Zhang, Tong; Gillings, Michael R; Su, Jian-Qiang

    2017-01-30

    Antibiotic resistance genes (ARGs) have moved from the environmental resistome into human commensals and pathogens, driven by human selection with antimicrobial agents. These genes have increased in abundance in humans and domestic animals, to become common components of waste streams. Estuarine habitats lie between terrestrial/freshwater and marine ecosystems, acting as natural filtering points for pollutants. Here, we have profiled ARGs in sediments from 18 estuaries over 4,000 km of coastal China using high-throughput quantitative polymerase chain reaction, and investigated their relationship with bacterial communities, antibiotic residues and socio-economic factors. ARGs in estuarine sediments were diverse and abundant, with over 200 different resistance genes being detected, 18 of which were found in all 90 sediment samples. The strong correlations of identified resistance genes with known mobile elements, network analyses and partial redundancy analysis all led to the conclusion that human activity is responsible for the abundance and dissemination of these ARGs. Such widespread pollution with xenogenetic elements has environmental, agricultural and medical consequences.

  15. Detection of linezolid resistance due to the optrA gene in Enterococcus faecalis from poultry meat from the American continent (Colombia)

    DEFF Research Database (Denmark)

    Cavaco, Lina; Bernal, J F; Zankari, Ea

    2017-01-01

    Three Enterococcus isolates obtained from retail chicken collected in 2010-11 as part of the Colombian Integrated Program for Antimicrobial Resistance Surveillance (COIPARS) showed reduced susceptibility towards linezolid (MIC 8 mg/L). This study aimed at characterizing the isolates resistant...... to linezolid and detecting the resistance mechanism. Strains were analysed in 2011-12 without successful detection of the resistance mechanism. All isolates were found negative for the cfr gene and no 23S rRNA mutations were detected. In 2016, with the novel resistance gene optrA being described, the WGS data......A gene encoding resistance to linezolid and phenicols. Additional screening of 37 enterococci strains from the same study did not detect any further positives. Typing showed that two of the isolates belong to ST59, while the last belongs to ST489. All isolates carry genes encoding resistance to macrolide...

  16. Resistance gene transfer during treatments for experimental avian colibacillosis.

    Science.gov (United States)

    Dheilly, Alexandra; Le Devendec, Laëtitia; Mourand, Gwenaëlle; Bouder, Axelle; Jouy, Eric; Kempf, Isabelle

    2012-01-01

    An experiment was conducted in animal facilities to compare the impacts of four avian colibacillosis treatments-oxytetracycline (OTC), trimethoprim-sulfadimethoxine (SXT), amoxicillin (AMX), or enrofloxacin (ENR)-on the susceptibility of Escherichia coli in broiler intestinal tracts. Birds were first orally inoculated with rifampin-resistant E. coli strains bearing plasmid genes conferring resistance to fluoroquinolones (qnr), cephalosporins (bla(CTX-M) or bla(FOX)), trimethoprim-sulfonamides, aminoglycosides, or tetracyclines. Feces samples were collected before, during, and after antimicrobial treatments. The susceptibilities of E. coli strains were studied, and resistance gene transfer was analyzed. An increase in the tetracycline-resistant E. coli population was observed only in OTC-treated birds, whereas multiresistant E. coli was detected in the dominant E. coli populations of SXT-, AMX-, or ENR-treated birds. Most multiresistant E. coli strains were susceptible to rifampin and exhibited various pulsed-field gel electrophoresis profiles, suggesting the transfer of one of the multiresistance plasmids from the inoculated strains to other E. coli strains in the intestinal tract. In conclusion, this study clearly illustrates how, in E. coli, "old" antimicrobials may coselect antimicrobial resistance to recent and critical molecules.

  17. Prednisolone-induced differential gene expression in mouse liver carrying wild type or a dimerization-defective glucocorticoid receptor

    Directory of Open Access Journals (Sweden)

    Dokter Wim

    2010-06-01

    Full Text Available Abstract Background Glucocorticoids (GCs control expression of a large number of genes via binding to the GC receptor (GR. Transcription may be regulated either by binding of the GR dimer to DNA regulatory elements or by protein-protein interactions of GR monomers with other transcription factors. Although the type of regulation for a number of individual target genes is known, the relative contribution of both mechanisms to the regulation of the entire transcriptional program remains elusive. To study the importance of GR dimerization in the regulation of gene expression, we performed gene expression profiling of livers of prednisolone-treated wild type (WT and mice that have lost the ability to form GR dimers (GRdim. Results The GR target genes identified in WT mice were predominantly related to glucose metabolism, the cell cycle, apoptosis and inflammation. In GRdim mice, the level of prednisolone-induced gene expression was significantly reduced compared to WT, but not completely absent. Interestingly, for a set of genes, involved in cell cycle and apoptosis processes and strongly related to Foxo3a and p53, induction by prednisolone was completely abolished in GRdim mice. In contrast, glucose metabolism-related genes were still modestly upregulated in GRdim mice upon prednisolone treatment. Finally, we identified several novel GC-inducible genes from which Fam107a, a putative histone acetyltransferase complex interacting protein, was most strongly dependent on GR dimerization. Conclusions This study on prednisolone-induced effects in livers of WT and GRdim mice identified a number of interesting candidate genes and pathways regulated by GR dimers and sheds new light onto the complex transcriptional regulation of liver function by GCs.

  18. Functional Analysis of Genes Comprising the Locus of Heat Resistance in Escherichia coli.

    Science.gov (United States)

    Mercer, Ryan; Nguyen, Oanh; Ou, Qixing; McMullen, Lynn; Gänzle, Michael G

    2017-10-15

    The locus of heat resistance (LHR) is a 15- to 19-kb genomic island conferring exceptional heat resistance to organisms in the family Enterobacteriaceae , including pathogenic strains of Salmonella enterica and Escherichia coli The complement of LHR-comprising genes that is necessary for heat resistance and the stress-induced or growth-phase-induced expression of LHR-comprising genes are unknown. This study determined the contribution of the seven LHR-comprising genes yfdX1 GI , yfdX2 , hdeD GI , orf11 , trx GI , kefB , and psiE GI by comparing the heat resistances of E. coli strains harboring plasmid-encoded derivatives of the different LHRs in these genes. (Genes carry a subscript "GI" [genomic island] if an ortholog of the same gene is present in genomes of E. coli ) LHR-encoded heat shock proteins sHSP20, ClpK GI , and sHSP GI are not sufficient for the heat resistance phenotype; YfdX1, YfdX2, and HdeD are necessary to complement the LHR heat shock proteins and to impart a high level of resistance. Deletion of trx GI , kefB , and psiE GI from plasmid-encoded copies of the LHR did not significantly affect heat resistance. The effect of the growth phase and the NaCl concentration on expression from the putative LHR promoter p2 was determined by quantitative reverse transcription-PCR and by a plasmid-encoded p2:GFP promoter fusion. The expression levels of exponential- and stationary-phase E. coli cells were not significantly different, but the addition of 1% NaCl significantly increased LHR expression. Remarkably, LHR expression in E. coli was dependent on a chromosomal copy of evgA In conclusion, this study improved our understanding of the genes required for exceptional heat resistance in E. coli and factors that increase their expression in food. IMPORTANCE The locus of heat resistance (LHR) is a genomic island conferring exceptional heat resistance to several foodborne pathogens. The exceptional level of heat resistance provided by the LHR questions the

  19. Gateway binary vectors with the bialaphos resistance gene, bar, as a selection marker for plant transformation.

    Science.gov (United States)

    Nakamura, Shinya; Mano, Shoji; Tanaka, Yuji; Ohnishi, Masato; Nakamori, Chihiro; Araki, Masami; Niwa, Tomoko; Nishimura, Mikio; Kaminaka, Hironori; Nakagawa, Tsuyoshi; Sato, Yutaka; Ishiguro, Sumie

    2010-01-01

    We constructed two series of Gateway binary vectors, pGWBs and R4pGWBs, possessing the bialaphos resistance gene (bar) as a selection marker for plant transformation. The reporters and tags employed in this system are sGFP, GUS, LUC, EYFP, ECFP, G3GFP, mRFP, TagRFP, 6xHis, FLAG, 3xHA, 4xMyc, 10xMyc, GST, T7 and TAP. Selection of Arabidopsis transformants with BASTA was successfully carried out using both plate-grown and soil-grown seedlings. Transformed rice calli and suspension-cultured tobacco cells were selected on plates containing BASTA or glufosinate-ammonium. These vectors are compatible with existing pGWB and R4pGWB vectors carrying kanamycin and hygromycin B resistance.

  20. Gene Prioritization of Resistant Rice Gene against Xanthomas oryzae pv. oryzae by Using Text Mining Technologies

    Directory of Open Access Journals (Sweden)

    Jingbo Xia

    2013-01-01

    Full Text Available To effectively assess the possibility of the unknown rice protein resistant to Xanthomonas oryzae pv. oryzae, a hybrid strategy is proposed to enhance gene prioritization by combining text mining technologies with a sequence-based approach. The text mining technique of term frequency inverse document frequency is used to measure the importance of distinguished terms which reflect biomedical activity in rice before candidate genes are screened and vital terms are produced. Afterwards, a built-in classifier under the chaos games representation algorithm is used to sieve the best possible candidate gene. Our experiment results show that the combination of these two methods achieves enhanced gene prioritization.

  1. Quantification and characterization of β-lactam resistance genes in 15 sewage treatment plants from East Asia and North America.

    Science.gov (United States)

    Yang, Ying; Zhang, Tong; Zhang, Xu-Xiang; Liang, Da-Wei; Zhang, Ming; Gao, Da-Wen; Zhu, He-Guang; Huang, Qing-Guo; Fang, Herbert H P

    2012-09-01

    The emerging antibiotic resistance genes in the aquatic environment have aroused public concern. As β-lactam is the most widely used group of antibiotics, β-lactam resistance genes were selected to investigate their distribution and diversity in the activated sludge from 15 geographically different sewage treatment plants (STPs) of China, Singapore, USA, and Canada. Specific PCR and quantitative real-time PCR (q-PCR) were used to investigate the occurrence and abundance of nine β-lactam resistance genes. Five genes (OXA-1, OXA-2, OXA-10, ampC, and TEM-1) were detected in most of the sludge collected, while three genes (mecA, CTX-M-1, and SME) were not found in any sludge sample. The total abundances of the six detected β-lactam resistance genes in the 15 STPs varied from 5.34 × 10(1) copies/ng DNA (ampC) to 5.49 × 10(4) copies/ng DNA (OXA-1). Overall, OXA-1 had the highest total concentration, followed by IMP and OXA-10. Noticeably, the abundances of TEM-1 in Chinese STPs were generally higher than those in the STPs of other countries, while the abundances of OXA-2 and IMP in the STPs of North America were much greater than those of East Asia. A total of 78 clones carrying β-lactam resistance genes were randomly selected from six clone libraries for phylogenetic diversity analysis; the similarity of these cloned genes to known β-lactam resistance genes with sequence identities ranged from 96% to 100%. Furthermore, OXA-1, ampC, and IMP were found to be more diverse than the other β-lactam resistance genes.

  2. Spread of tetracycline resistance genes at a conventional dairy farm

    Czech Academy of Sciences Publication Activity Database

    Kyselková, Martina; Jirout, Jiří; Vrchotová, Naděžda; Schmitt, H.; Elhottová, Dana

    2015-01-01

    Roč. 6, may (2015), s. 536 ISSN 1664-302X R&D Projects: GA ČR GAP504/10/2077; GA MŠk(CZ) EE2.3.30.0032; GA MŠk(CZ) LO1415 Institutional support: RVO:67179843 ; RVO:60077344 Keywords : antibiotic resistance spread * animal manure * cattle intestinal microflora * chlortetracycline * dairy cattle * dairy farm * heavy metals * tetracycline resistance genes Subject RIV: EI - Biotechnology ; Bionics; EE - Microbiology, Virology (BC-A) Impact factor: 4.165, year: 2015

  3. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  4. Using SNP genetic markers to elucidate the linkage of the Co-34/Phg-3 anthracnose and angular leaf spot resistance gene cluster with the Ur-14 resistance gene

    Science.gov (United States)

    The Ouro Negro common bean cultivar contains the Co-34/Phg-3 gene cluster that confers resistance to the anthracnose (ANT) and angular leaf spot (ALS) pathogens. These genes are tightly linked on chromosome 4. Ouro Negro also has the Ur-14 rust resistance gene, reportedly in the vicinity of Co- 34; ...

  5. Carrying Capacity

    DEFF Research Database (Denmark)

    Schroll, Henning; Andersen, Jan; Kjærgård, Bente

    2012-01-01

    A spatial planning act was introduced inIndonesia 1992 and renewed in 2008. It emphasised the planning role of decentralised authorities. The spatial planning act covers both spatial and environmental issues. It defines the concept of carrying capacity and includes definitions of supportive....../cities. Four different sectors (water, food production, waste, and forests) were selected as core areas for decentralised spatial planning. Indicators for SCC and ACC were identified and assessed with regard to relevance and quantifiability. For each of the indicators selected, a legal threshold or guiding...... was introduced inIndonesia 1992 and renewed in 2008. It emphasised the planning role of decentralised authorities. The spatial planning act covers both spatial and environmental issues. It defines the concept of carrying capacity and includes definitions of supportive carrying capacity (SCC) and assimilative...

  6. Detection and Genetic Environment of Pleuromutilin-Lincosamide-Streptogramin A Resistance Genes in Staphylococci Isolated from Pets.

    Science.gov (United States)

    Deng, Fengru; Wang, Huiwen; Liao, Yifei; Li, Jun; Feßler, Andrea T; Michael, Geovana B; Schwarz, Stefan; Wang, Yang

    2017-01-01

    Increasing emergence of staphylococci resistant to pleuromutilins, lincosamides, and streptogramin A (PLS A ) and isolated from humans and pets is a growing public health concern worldwide. Currently, there was only one published study regarding one of the PLS A genes, vga (A) detected in staphylococci isolated from cat. In this study, eleven pleuromutilin-resistant staphylococci from pets and two from their owners were isolated and further characterized for their antimicrobial susceptibilities, plasmid profiles, genotypes, and genetic context of the PLS A resistance genes. The gene sal (A) identified in 11 staphylococcal isolates was found for the first time in Staphylococcus haemolyticus, Staphylococcus epidermidis , and Staphylococcus xylosus . Moreover, these 11 isolates shared the identical regions flanking the sal (A) gene located in the chromosomal DNA. Two S. haemolyticus isolates from a cat and its owner carried similar vga (A) LC plasmids and displayed indistinguishable PFGE patterns. A novel chromosomal multidrug resistance genomic island (MDRGI) containing 13 resistance genes, including lsa (E), was firstly identified in S. epidermidis . In addition, vga (A) LC , sal (A), and lsa (E) were for the first time identified in staphylococcal isolates originating from pet animals. The plasmids, chromosomal DNA region, and MDRGI associated with the PLS A resistance genes vga (A), vga (A) LC , sal (A), and lsa (E) are present in staphylococci isolated from pets and humans and present significant challenges for the clinical management of infections by limiting therapeutic options.

  7. Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

    Directory of Open Access Journals (Sweden)

    Riley Laura M

    2012-03-01

    Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

  8. Environmental and Public Health Implications of Water Reuse: Antibiotics, Antibiotic Resistant Bacteria, and Antibiotic Resistance Genes

    KAUST Repository

    Hong, Pei-Ying

    2013-07-31

    Water scarcity is a global problem, and is particularly acute in certain regions like Africa, the Middle East, as well as the western states of America. A breakdown on water usage revealed that 70% of freshwater supplies are used for agricultural irrigation. The use of reclaimed water as an alternative water source for agricultural irrigation would greatly alleviate the demand on freshwater sources. This paradigm shift is gaining momentum in several water scarce countries like Saudi Arabia. However, microbial problems associated with reclaimed water may hinder the use of reclaimed water for agricultural irrigation. Of particular concern is that the occurrence of antibiotic residues in the reclaimed water can select for antibiotic resistance genes among the microbial community. Antibiotic resistance genes can be associated with mobile genetic elements, which in turn allow a promiscuous transfer of resistance traits from one bacterium to another. Together with the pathogens that are present in the reclaimed water, antibiotic resistant bacteria can potentially exchange mobile genetic elements to create the “perfect microbial storm”. Given the significance of this issue, a deeper understanding of the occurrence of antibiotics in reclaimed water, and their potential influence on the selection of resistant microorganisms would be essential. In this review paper, we collated literature over the past two decades to determine the occurrence of antibiotics in municipal wastewater and livestock manure. We then discuss how these antibiotic resistant bacteria may impose a potential microbial risk to the environment and public health, and the knowledge gaps that would have to be addressed in future studies. Overall, the collation of the literature in wastewater treatment and agriculture serves to frame and identify potential concerns with respect to antibiotics, antibiotic resistant bacteria, and antibiotic resistance genes in reclaimed water.

  9. Validation of candidate genes putatively associated with resistance to SCMV and MDMV in maize (Zea mays L. by expression profiling

    Directory of Open Access Journals (Sweden)

    Wenzel Gerhard

    2009-02-01

    Full Text Available Abstract Background The potyviruses sugarcane mosaic virus (SCMV and maize dwarf mosaic virus (MDMV are major pathogens of maize worldwide. Two loci, Scmv1 and Scmv2, have ealier been shown to confer complete resistance to SCMV. Custom-made microarrays containing previously identified SCMV resistance candidate genes and resistance gene analogs were utilised to investigate and validate gene expression and expression patterns of isogenic lines under pathogen infection in order to obtain information about the molecular mechanisms involved in maize-potyvirus interactions. Results By employing time course microarray experiments we identified 68 significantly differentially expressed sequences within the different time points. The majority of differentially expressed genes differed between the near-isogenic line carrying Scmv1 resistance locus at chromosome 6 and the other isogenic lines. Most differentially expressed genes in the SCMV experiment (75% were identified one hour after virus inoculation, and about one quarter at multiple time points. Furthermore, most of the identified mapped genes were localised outside the Scmv QTL regions. Annotation revealed differential expression of promising pathogenesis-related candidate genes, validated by qRT-PCR, coding for metallothionein-like protein, S-adenosylmethionine synthetase, germin-like protein or 26S ribosomal RNA. Conclusion Our study identified putative candidate genes and gene expression patterns related to resistance to SCMV. Moreover, our findings support the effectiveness and reliability of the combination of different expression profiling approaches for the identification and validation of candidate genes. Genes identified in this study represent possible future targets for manipulation of SCMV resistance in maize.

  10. Multiple antibiotic resistance genes distribution in ten large-scale membrane bioreactors for municipal wastewater treatment.

    Science.gov (United States)

    Sun, Yanmei; Shen, Yue-Xiao; Liang, Peng; Zhou, Jizhong; Yang, Yunfeng; Huang, Xia

    2016-12-01

    Wastewater treatment plants are thought to be potential reservoirs of antibiotic resistance genes. In this study, GeoChip was used for analyzing multiple antibiotic resistance genes, including four multidrug efflux system gene groups and three β-lactamase genes in ten large-scale membrane bioreactors (MBRs) for municipal wastewater treatment. Results revealed that the diversity of antibiotic genes varied a lot among MBRs, but about 40% common antibiotic resistance genes were existent. The average signal intensity of each antibiotic resistance group was similar among MBRs, nevertheless the total abundance of each group varied remarkably and the dominant resistance gene groups were different in individual MBR. The antibiotic resistance genes majorly derived from Proteobacteria and Actinobacteria. Further study indicated that TN, TP and COD of influent, temperature and conductivity of mixed liquor were significant (Pantibiotic resistance genes distribution in MBRs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Abundant rifampin resistance genes and significant correlations of antibiotic resistance genes and plasmids in various environments revealed by metagenomic analysis.

    Science.gov (United States)

    Ma, Liping; Li, Bing; Zhang, Tong

    2014-06-01

    In the present study, a newly developed metagenomic analysis approach was applied to investigate the abundance and diversity of antibiotic resistance genes (ARGs) and mobile genetic elements (MGEs) in aquaculture farm sediments, activated sludge, biofilm, anaerobic digestion sludge, and river water. BLASTX analysis against the Comprehensive Antibiotic Resistance Database was conducted for the metagenomic sequence data of each sample and then the ARG-like sequences were sorted based on structured sub-database using customized scripts. The results showed that freshwater fishpond sediment had the highest abundance (196 ppm), and anaerobic digestion sludge possessed the highest diversity (133 subtypes) of ARGs among the samples in this study. Significantly, rifampin resistance genes were universal in all the diverse samples and consistently accounted for 26.9~38.6 % of the total annotated ARG sequences. Furthermore, a significant linear correlation (R (2) = 0.924) was found between diversities (number of subtypes) of ARGs and diversities of plasmids in diverse samples. This work provided a wide spectrum scan of ARGs and MGEs in different environments and revealed the prevalence of rifampin resistance genes and the strong correlation between ARG diversity and plasmid diversity for the first time.

  12. Genes of Microorganisms: Paving Way to Tailor Next Generation Fungal Disease Resistant Crop Plants

    Directory of Open Access Journals (Sweden)

    Prem L. KASHYAP

    2011-11-01

    Full Text Available The automation of sequencing technologies, flooding in the knowledge of plant-pathogen interactions and advancements in bioinformatics provide tools leading to better knowledge not only of the genome of plant pathogens or microorganism beneficial to plants but also of ways of incorporating genes from microbes into plants as microbial-derived resistance. The identification of various microorganism genes playing key role during pathogensis and the dissection of the signal transduction components of the hypersensitive response and systemic acquired resistance pathways have greatly increased the diversity of options available for tailoring fungus resistant crops. The genetically engineered plants carrying these genes showed spontaneous activation of different defense mechanisms, leading the plant in an elevated state of defense. This defense mode greatly enhances the plants ability to quickly react to a pathogen invasion and more successfully overcome the infection. The aim of this review is to highlight the dynamic use of genes of microorganisms in enhancing crop tolernace towards fungal intruders by examining the most relevant research in this field.

  13. An accurate DNA marker assay for stem rust resistance gene Sr2 in wheat.

    Science.gov (United States)

    Mago, R; Simkova, H; Brown-Guedira, G; Dreisigacker, S; Breen, J; Jin, Y; Singh, R; Appels, R; Lagudah, E S; Ellis, J; Dolezel, J; Spielmeyer, W

    2011-03-01

    The stem rust resistance gene Sr2 has provided broad-spectrum protection against stem rust (Puccinia graminis Pers. f. sp. tritici) since its wide spread deployment in wheat from the 1940s. Because Sr2 confers partial resistance which is difficult to select under field conditions, a DNA marker is desirable that accurately predicts Sr2 in diverse wheat germplasm. Using DNA sequence derived from the vicinity of the Sr2 locus, we developed a cleaved amplified polymorphic sequence (CAPS) marker that is associated with the presence or absence of the gene in 115 of 122 (95%) diverse wheat lines. The marker genotype predicted the absence of the gene in 100% of lines which were considered to lack Sr2. Discrepancies were observed in lines that were predicted to carry Sr2 but failed to show the CAPS marker. Given the high level of accuracy observed, the marker provides breeders with a selection tool for one of the most important disease resistance genes of wheat.

  14. Expression Analysis of Hairpin RNA Carrying Sugarcane mosaic virus (SCMV Derived Sequences and Transgenic Resistance Development in a Model Rice Plant

    Directory of Open Access Journals (Sweden)

    Sehrish Akbar

    2017-01-01

    Full Text Available Developing transgenic resistance in monocotyledonous crops against pathogens remains a challenging area of research. Sugarcane mosaic virus (SCMV is a serious pathogen of many monocotyledonous crops including sugarcane. The objective of present study was to analyze transgenic expression of hairpin RNA (hpRNA, targeting simultaneously CP (Coat Protein and Hc-Pro (helper component-proteinase genes of SCMV, in a model rice plant. Conserved nucleotide sequences, exclusive for DAG (Aspartic acid-Alanine-Glycine and KITC (Lycine-Isoleucine-Threonine-Cysteine motifs, derived from SCMV CP and Hc-Pro genes, respectively, were fused together and assembled into the hpRNA cassette under maize ubiquitin promoter to form Ubi-hpCP:Hc-Pro construct. The same CP:Hc-Pro sequence was fused with the β-glucuronidase gene (GUS at the 3′ end under CaMV 35S promoter to develop 35S-GUS:CP:Hc-Pro served as a target reporter gene construct. When delivered into rice callus tissues by particle bombardment, the Ubi-hpCP:Hc-Pro construct induced strong silencing of 35S-GUS:CP:Hc-Pro. Transgenic rice plants, containing Ubi-hpCP:Hc-Pro construct, expressed high level of 21–24 nt small interfering RNAs, which induced specific suppression against GUS:CP:Hc-Pro delivered by particle bombardment and conferred strong resistance to mechanically inoculated SCMV. It is concluded that fusion hpRNA approach is an affordable method for developing resistance against SCMV in model rice plant and it could confer SCMV resistance when transformed into sugarcane.

  15. Virulence Genes Profile of Multidrug Resistant Pseudomonas aeruginosa Isolated from Iranian Children with UTIs

    Directory of Open Access Journals (Sweden)

    Zohreh Heidary

    2016-04-01

    Full Text Available Virulent and resistant strains Pseudomonas aeruginosa (P. aeruginosa is one of the most important cause of UTIs in pediatrics. The present study was carried to investigate the frequency of virulence factors in the multi-drug resistant strains of P. aeruginosa isolated from pediatrics hospitalized due to the UTIs. One - hundred and forty three urine samples were collected from pediatric patients suffered from UTIs. Samples were cultured and those that were P. aeruginosa positive were analyzed for the presence of putative virulence genes. Seventy one out of 143 samples (49.65% were positive for P. aeruginosa. Monthly, sex and age-dependent prevalence were seen for P. aeruginosa. Bacterial strains had the highest levels of resistance against ampicillin (95.77%, gentamicin (92.95% and ciprofloxacin (81.69%. Of 71 P. aeruginosa isolates, 12 strains were resistant to more than 9 antibiotics (16.90%. The most commonly detected virulence factors in the cases of urethral infections were exoU and plcH while those of pyelonephritis and cystitis were were exoS and lasB. Our findings should raise awareness about antibiotic resistance in hospitalized pediatrics with UTIs in Iran. Clinicians should exercise caution in prescribing antibiotics, especially in cases of UTIs. Such information can help in identifying these virulence genes as useful diagnostic markers for clinical P. aeruginosa strains isolated from UTIs.

  16. Transcriptome analyses and virus induced gene silencing identify genes in the Rpp4-mediated Asian soybean rust resistance pathway

    Science.gov (United States)

    Rpp4 (Resistance to Phakopsora pachyrhizi 4) confers resistance to P. pachyrhizi, the causal agent of Asian soybean rust (ASR). By combining expression profiling and virus induced gene silencing (VIGS), we are developing a genetic framework for Rpp4-mediated resistance. We measured gene expression i...

  17. Fate and transport of antibiotic resistant bacteria and resistance genes in artificially drained agricultural fields receiving swine manure application

    Science.gov (United States)

    While previous studies have examined the occurrence of antibiotic resistant bacteria and antibiotic resistant genes around confined swine feeding operations, little information is known about their release and transport from artificially drained fields receiving swine manure application. Much of the...

  18. Spectrum of Resistance Conferred by ml-o Powdery Mildew Resistance Genes in Barley

    DEFF Research Database (Denmark)

    Jørgensen, Jørgen Helms

    1977-01-01

    /(4) in all tests. They were also resistant to field populations of the pathogen when scored in disease nurseries at more than 78 locations in 29 countries in Europe, the Near East, North and South America. New Zealand, and Japan. This indicates that the 11 genes confer the same, world-wide spectrum...

  19. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters

    Science.gov (United States)

    Miller, Jennifer H.; Novak, John T.; Knocke, William R.; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1—a Pseudomonas sp.) and thermophilic (Iso T10—a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457–0.829, P digested sludge or thermophilic digested sludge (Spearman rho = 0.130–0.486, P = 0.075–0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene transfer between raw sludge bacteria and the digester microbial community. PMID:27014196

  20. Antibiotic resistance genes and residual antimicrobials in cattle feedlot surface soil

    Science.gov (United States)

    Antibiotic residues and resistant bacteria in cattle feedlot manure may impact antibiotic resistance in the environment. This study investigated common antimicrobials (tetracyclines and monensin) and associated resistance genes in cattle feedlot soils over time. Animal diets and other feedlot soil...

  1. Novel streptomycin and spectinomycin resistance gene as a gene cassette within a class 1 integron isolated from Escherichia coli

    DEFF Research Database (Denmark)

    Sandvang, D.

    1999-01-01

    The aadA genes, encoding resistance to streptomycin and spectinomycin, have been found as gene cassettes in different gram-negative and gram-positive bacterial species. The present study has revealed the sequence of a new gene, aadA5, integrated as a gene cassette together with the trimethoprim...... resistance gene dfr7 in a class 1 integron. The integron was located on a plasmid and was identified in a pathogenic porcine Escherichia coli isolate....

  2. Novel Streptomycin and Spectinomycin Resistance Gene as a Gene Cassette within a Class 1 Integron Isolated from Escherichia coli

    Science.gov (United States)

    Sandvang, Dorthe

    1999-01-01

    The aadA genes, encoding resistance to streptomycin and spectinomycin, have been found as gene cassettes in different gram-negative and gram-positive bacterial species. The present study has revealed the sequence of a new gene, aadA5, integrated as a gene cassette together with the trimethoprim resistance gene dfr7 in a class 1 integron. The integron was located on a plasmid and was identified in a pathogenic porcine Escherichia coli isolate. PMID:10582907

  3. Transport of tylosin and tylosin-resistance genes in subsurface drainage water from manured fields

    Science.gov (United States)

    Animal agriculture appears to contribute to the spread of antibiotic resistance genes, but few studies have quantified gene transport in agricultural fields. The transport of tylosin, tylosin-resistance genes (erm B, F, A) and tylosin-resistant Enterococcus were measured in tile drainage water from ...

  4. Antimicrobial susceptibility and occurrence of resistance genes among Salmonella enterica serovar Weltevreden from different countries

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Lertworapreecha, M.; Evans, M.C.

    2003-01-01

    and gentamicin. All nine ampicillin-resistant isolates contained a sequence similar to the bla(TEM-1b) gene, one of the eight chloramphenicol-resistant isolates a sequence similar to the catA1 gene, all three neomycin-resistant isolates a sequence similar to the aphA-2 gene, 16 (73%) of the 22 streptomycin...

  5. Altered viral fitness and drug susceptibility in HIV-1 carrying mutations that confer resistance to nonnucleoside reverse transcriptase and integrase strand transfer inhibitors.

    Science.gov (United States)

    Hu, Zixin; Kuritzkes, Daniel R

    2014-08-01

    Nonnucleoside reverse transcriptase (RT) inhibitors (NNRTI) and integrase (IN) strand transfer inhibitors (INSTI) are key components of antiretroviral regimens. To explore potential interactions between NNRTI and INSTI resistance mutations, we investigated the combined effects of these mutations on drug susceptibility and fitness of human immunodeficiency virus type 1 (HIV-1). In the absence of drug, single-mutant viruses were less fit than the wild type; viruses carrying multiple mutations were less fit than single-mutant viruses. These findings were explained in part by the observation that mutant viruses carrying NNRTI plus INSTI resistance mutations had reduced amounts of virion-associated RT and/or IN protein. In the presence of efavirenz (EFV), a virus carrying RT-K103N together with IN-G140S and IN-Q148H (here termed IN-G140S/Q148H) mutations was fitter than a virus with a RT-K103N mutation alone. Similarly, in the presence of EFV, the RT-E138K plus IN-G140S/Q148H mutant virus was fitter than one with the RT-E138K mutation alone. No effect of INSTI resistance mutations on the fitness of RT-Y181C mutant viruses was observed. Conversely, RT-E138K and -Y181C mutations improved the fitness of the IN-G140S/Q148H mutant virus in the presence of raltegravir (RAL); the RT-K103N mutation had no effect. The NNRTI resistance mutations had no effect on RAL susceptibility. Likewise, the IN-G140S/Q148H mutations had no effect on EFV or RPV susceptibility. However, both the RT-K103N plus IN-G140S/Q148H and the RT-E138K plus IN-G140S/Q148H mutant viruses had significantly greater fold increases in 50% inhibitory concentration (IC50) of EFV than viruses carrying a single NNRTI mutation. Likewise, the RT-E138K plus IN-G140S/Q148H mutant virus had significantly greater fold increases in RAL IC50 than that of the IN-G140S/Q148H mutant virus. These results suggest that interactions between RT and IN mutations are important for NNRTI and INSTI resistance and viral fitness

  6. Shotgun label-free proteomic analysis of clubroot (Plasmodiophora brassicae resistance conferred by the gene Rcr1 in Brassica rapa

    Directory of Open Access Journals (Sweden)

    Tao Song

    2016-07-01

    Full Text Available Clubroot, caused by the plasmodiophorid pathogen Plasmodiophora brassicae, is one of the most serious diseases on Brassica crops worldwide and a major threat to canola production in western Canada. Host resistance is the key strategy for clubroot management on canola. Several clubroot resistance (CR genes have been identified, but the mechanisms associated with these CR genes are poorly understood. In the current study, a label-free shotgun proteomic approach was used to profile and compare the proteomes of B. rapa carrying and not carrying the CR gene Rcr1 upon P. brassicae infection. A total of 527 differentially accumulated proteins (DAPs were identified between the resistant and susceptible samples, and functional annotation of these DAPs indicates that the perception of P. brassicae and activation of defense responses is triggered via an unique signaling pathway distinct from common modes of recognition receptors reported with many other plant-pathogen interactions; this pathway appears to act in a calcium-independent manner through a not-well defined cascade of mitogen-activated protein kinases and may require the ubiquitin-26S proteasome related to abiotic stresses, especially the cold-stress tolerance. Both up-regulation of defense-related and down-regulation of pathogenicity-related metabolism were observed in plants carrying Rcr1, and these functions may all contribute to the clubroot resistance mediated by this CR gene. These results, combined with those of transcriptomic analysis reported earlier, improved our understanding of molecular mechanisms associated with Rcr1 and clubroot resistance at large, and identified candidate metabolites or pathways for further confirmation of specific resistance mechanisms. Deploying CR genes with different modes of action may help improve the durability of clubroot resistance.

  7. Resistance of Antimicrobial Peptide Gene Transgenic Rice to Bacterial Blight

    Directory of Open Access Journals (Sweden)

    Wei WANG

    2011-03-01

    Full Text Available Antimicrobial peptide is a polypeptide with antimicrobial activity. Antimicrobial peptide genes Np3 and Np5 from Chinese shrimp (Fenneropenaeus Chinensis were integrated into Oryza sativa L. subsp. japonica cv. Aichi ashahi by Agrobacterium mediated transformation system. PCR analysis showed that the positive ratios of Np3 and Np5 were 36% and 45% in T0 generation, respectively. RT-PCR analysis showed that the antimicrobial peptide genes were expressed in T1 generation, and there was no obvious difference in agronomic traits between transgenic plants and non-transgenic plants. Four Np3 and Np5 transgenic lines in T1 generation were inoculated with Xanthomonas oryzae pv. oryzae strain CR4, and all the four transgenic lines had significantly enhanced resistance to bacterial blight caused by the strain CR4. The Np5 transgenic lines also showed higher resistance to bacterial blight caused by strains JS97-2, Zhe 173 and OS-225. It is suggested that transgenic lines with Np5 gene might possess broad spectrum resistance to rice bacterial blight.

  8. Sequence of pNL194, a 79.3-Kilobase IncN Plasmid Carrying the blaVIM-1 Metallo-β-Lactamase Gene in Klebsiella pneumoniae▿

    Science.gov (United States)

    Miriagou, V.; Papagiannitsis, C. C.; Kotsakis, S. D.; Loli, A.; Tzelepi, E.; Legakis, N. J.; Tzouvelekis, L. S.

    2010-01-01

    The nucleotide sequence of pNL194, a VIM-1-encoding plasmid, is described in this study. pNL194 (79,307 bp) comprised an IncN-characteristic segment (38,940 bp) and a mosaic structure (40,367 bp) including blaVIM-1, aacA7, aadA1, aadA2, dfrA1, dfrA12, aphA1, strA, strB, and sul1. Tn1000 or Tn5501 insertion within fipA probably facilitated recruitment of additional mobile elements carrying resistance genes. PMID:20660690

  9. Sequence of pNL194, a 79.3-kilobase IncN plasmid carrying the blaVIM-1 metallo-beta-lactamase gene in Klebsiella pneumoniae.

    Science.gov (United States)

    Miriagou, V; Papagiannitsis, C C; Kotsakis, S D; Loli, A; Tzelepi, E; Legakis, N J; Tzouvelekis, L S

    2010-10-01

    The nucleotide sequence of pNL194, a VIM-1-encoding plasmid, is described in this study. pNL194 (79,307 bp) comprised an IncN-characteristic segment (38,940 bp) and a mosaic structure (40,367 bp) including bla(VIM-1), aacA7, aadA1, aadA2, dfrA1, dfrA12, aphA1, strA, strB, and sul1. Tn1000 or Tn5501 insertion within fipA probably facilitated recruitment of additional mobile elements carrying resistance genes.

  10. Expression levels of resistant genes affect cervical cancer prognosis.

    Science.gov (United States)

    Yang, Fengmei; Gao, Bo; Li, Rui; Li, Wencui; Chen, Wei; Yu, Zongtao; Zhang, Jicai

    2017-05-01

    Tumor cells may develop multidrug resistance (MDR) to various chemotherapy regimens. Such resistance reduces the sensitivity of cells to chemotherapy drugs, leading to the failure of cervical cancer (CC) treatment and disease progression. The present study aimed to investigate the role of MDR1, lung resistance protein (LRP) and placental glutathione S‑transferase π 1 (GSTP1) in CC and MDR, and the prognostic value of these genes. The mRNA expression levels of these resistance‑associated genes were determined in 47 CC and 20 healthy cervical tissue samples. Subsequently, the data was analyzed alongside clinicopathological parameters. The mRNA expression levels of MDR1, LRP and GSTP1 in CC were 0.57±0.32, 0.58±0.29 and 0.44±0.24, respectively, whereas those in healthy cervical tissues were 0.19±0.10, 0.17±0.14 and 0.18±0.10, respectively. Therefore, the expression levels of these genes were significantly greater in CC compared with healthy cervical tissue (PMRD1 were increased in the well differentiated group (0.68±0.27) compared with the poorly differentiated group (0.38±0.33; P0.05). Multivariate logistic regression indicated that the degree of differentiation and the MDR1 gene expression levels were predictors of CC prognosis (P<0.05). The survival rate of patients in the MDR1‑negative group was significantly greater compared with the MDR1‑positive group (P<0.05). The results of the present study therefore suggested that MDR1 gene expression is a predictor of poor survival in CC.

  11. Direct ethanol production from cellulosic materials by Zymobacter palmae carrying Cellulomonas endoglucanase and Ruminococcus β-glucosidase genes.

    Science.gov (United States)

    Kojima, Motoki; Okamoto, Kenji; Yanase, Hideshi

    2013-06-01

    In order to reduce the cost of bioethanol production from lignocellulosic biomass, we conferred the ability to ferment cellulosic materials directly on Zymobacter palmae by co-expressing foreign endoglucanase and β-glucosidase genes. Z. palmae is a novel ethanol-fermenting bacterium capable of utilizing a broad range of sugar substrates, but not cellulose. Therefore, the six genes encoding the cellulolytic enzymes (CenA, CenB, CenD, CbhA, CbhB, and Cex) from Cellulomonas fimi were introduced and expressed in Z. palmae. Of these cellulolytic enzyme genes cloned, CenA degraded carboxymethylcellulose and phosphoric acid-swollen cellulose (PASC) efficiently. The extracellular CenA catalyzed the hydrolysis of barley β-glucan and PASC to liberate soluble cello-oligosaccharides, indicating that CenA is the most suitable enzyme for cellulose degradation among those cellulolytic enzymes expressed in Z. palmae. Furthermore, the cenA gene and β-glucosidase gene (bgl) from Ruminococcus albus were co-expressed in Z. palmae. Of the total endoglucanase and β-glucosidase activities, 57.1 and 18.1 % were localized in the culture medium of the strain. The genetically engineered strain completely saccharified and fermented 20 g/l barley β-glucan to ethanol within 84 h, producing 79.5 % of the theoretical yield. Thus, the production and secretion of CenA and BGL enabled Z. palmae to efficiently ferment a water-soluble cellulosic polysaccharide to ethanol.

  12. Identification of Gene Resistance to Avian InfluenzaVirus (Mx Gene among Wild Waterbirds

    Directory of Open Access Journals (Sweden)

    Dewi Elfidasari

    2013-04-01

    Full Text Available The Mx gene is an antiviral gene used to determine the resistance or the susceptibility to different types of viruses, including the Avian Influenza (AI virus subtype H5N1. The AI virus subtype H5N1 infection in chickens causes Mx gene polymorphism. The Mx+ gene shows resistant to the AIvirus subtype H5N1, whereas the Mx-gene shows signs of susceptible. The objective of thisresearch was to detect the Mxgene in wild aquatic birds using the Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP method with the primer pairs F2 and NE-R2/R and the RsaI restriction enzyme. DNA samples were obtained from eight species of wild waterbirds with positive and negative exposure to the AI virus subtype H5N1. DNA amplification results showed that the Mxgene in wild aquatic birds is found in a 100 bp fragment, which is the same as the Mx gene found in chickens. However, unlike chickens, the Mxgene in wild aquatic birds did not show any polymorphism. This study proves that Mx- based resistance to AI virus subtype H5N1 in different in wild birds than in chickens.

  13. Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus

    Directory of Open Access Journals (Sweden)

    Ting Xiang Neik

    2017-11-01

    Full Text Available Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae, Blackleg (Leptosphaeria maculans and L. biglobosa, Sclerotinia Stem Rot (Sclerotinia sclerotiorum, and Downy Mildew (Hyaloperonospora parasitica. We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus.

  14. Current Status and Challenges in Identifying Disease Resistance Genes in Brassica napus

    Science.gov (United States)

    Neik, Ting Xiang; Barbetti, Martin J.; Batley, Jacqueline

    2017-01-01

    Brassica napus is an economically important crop across different continents including temperate and subtropical regions in Europe, Canada, South Asia, China and Australia. Its widespread cultivation also brings setbacks as it plays host to fungal, oomycete and chytrid pathogens that can lead to serious yield loss. For sustainable crop production, identification of resistance (R) genes in B. napus has become of critical importance. In this review, we discuss four key pathogens affecting Brassica crops: Clubroot (Plasmodiophora brassicae), Blackleg (Leptosphaeria maculans and L. biglobosa), Sclerotinia Stem Rot (Sclerotinia sclerotiorum), and Downy Mildew (Hyaloperonospora parasitica). We first review current studies covering prevalence of these pathogens on Brassica crops and highlight the R genes and QTL that have been identified from Brassica species against these pathogens. Insights into the relationships between the pathogen and its Brassica host, the unique host resistance mechanisms and how these affect resistance outcomes is also presented. We discuss challenges in identification and deployment of R genes in B. napus in relation to highly specific genetic interactions between host subpopulations and pathogen pathotypes and emphasize the need for common or shared techniques and research materials or tighter collaboration between researchers to reconcile the inconsistencies in the research outcomes. Using current genomics tools, we provide examples of how characterization and cloning of R genes in B. napus can be carried out more effectively. Lastly, we put forward strategies to breed resistant cultivars through introgressions supported by genomic approaches and suggest prospects that can be implemented in the future for a better, pathogen-resistant B. napus. PMID:29163558

  15. Magnitude of gene mutations conferring drug resistance in mycobacterium tuberculosis isolates from lymph node aspirates in ethiopia.

    Science.gov (United States)

    Biadglegne, Fantahun; Tessema, Belay; Rodloff, Arne C; Sack, Ulrich

    2013-01-01

    Resistance to drugs is due to particular genomic mutations in the specific genes of Mycobacterium tuberculosis. Timely genetic characterization will allow identification of resistance mutations that will optimize an effective antibiotic treatment regimen. We determine the magnitude of gene mutations conferring resistance to isoniazid (INH), rifampicin (RMP) and ethambutol (EMB) among tuberculosis (TB) lymphadenitis patients. A cross sectional prospective study was conducted among 226 M.tuberculosis isolates from culture positive lymph node aspirates collected from TB lymphadenitis patients between April 2012 and May 2012. Detection of mutations conferring resistance to drugs was carried out using GenoType(®) MTBDRplus and GenoType® MTBDRsl assay. Out of the 226 strains, mutations conferring resistance to INH, RMP, multidrug resistance tuberculosis (MDR-TB) and EMB were 8, 3, 2 and 2 isolates, respectively. There was no isolated strain that showed mutation in the inhA promoter region gene. All INH resistant strains had mutations in the katG gene at codon 315 with amino acid change of S315T1. Among rifampicin resistant strains, two isolates displayed mutations at codon 531 in the rpoB gene with amino acid change of S531L and one isolate was by omission of wild type probes at Q513L. According to mutations associated with ethambutol resistance, all of the isolates had mutations in the embB gene with aminoacid change of M306I. All isolates resistant to INH, RMP and MDR using BacT/AlerT 3D system were correctly identified by GenoType® MTBDRplus assay. We observed mutations conferring resistance to INH at S315T1 of the katG gene, RMP at S531L and Q513L in the rpoB genes and EMB at M306I of the embB gene. In the absence of conventional drug susceptibility testing, the effort to develop easy, rapid and cost effective molecular assays for drug resistance TB monitoring is definitely desirable and the GenoType® MTBDRplus assay was found to be a useful method for diagnosis

  16. Establishment of induced pluripotent stem cell line (ZZUi010-A from an Alzheimer's disease patient carrying an APP gene mutation

    Directory of Open Access Journals (Sweden)

    Zhilei Wang

    2017-12-01

    Full Text Available Alzheimer's disease (AD is one of the most common neurodegenerative disorders. Previous studies have identified mutations in several genes, such as amyloid precursor protein (APP, presenilin-1 (PSEN1, and presenilin-2 (PSEN2, in patients with early-onset (<65 years familial AD. Recently, a patient with an APP gene mutation was identified; the dermal fibroblasts of the patient were obtained and a line of induced pluripotent stem cells (iPSCs was successfully generated using the Sendai-virus (SeV delivery system. The iPSC line will be useful for further study of the pathomechanism and drug screening for AD.

  17. Interleukin 28B Gene Variation at rs12979860 Determines Early Viral Kinetics During Treatment in Patients Carrying Genotypes 2 or 3 of Hepatitis C Virus

    DEFF Research Database (Denmark)

    Lindh, Magnus; Lagging, Martin; Färkkilä, Martti

    2011-01-01

    Single-nucleotide polymorphisms upstream of the interleukin 28B (interferon λ3) gene (IL28B) strongly influence treatment efficacy in patients carrying hepatitis C virus (HCV) of genotype 1. In patients receiving 12 or 24 weeks of interferon-ribavirin therapy for infection with genotype 2 or 3 (n...

  18. Molecular evaluation of colistin-resistant gene expression changes in Acinetobacter baumannii with real-time polymerase chain reaction

    Directory of Open Access Journals (Sweden)

    Sepahvand S

    2017-11-01

    Full Text Available Shahriar Sepahvand,1 Mohammad Ali Davarpanah,2 Amir Roudgari,3 Abbas Bahador,4 Vajihe Karbasizade,5 Zahra Kargar Jahromi6 1Department of Microbiology, Falavarjan Branch, Islamic Azad University, Isfahan, Iran; 2Shiraz HIV/AIDS Research Center, Institute of Health, Shiraz University of Medical Sciences, Shiraz, Iran; 3Shiraz Trauma Center, Shiraz University of Medical Sciences, Shiraz, Iran; 4Department of Microbiology, Faculty of Medicine, Tehran University of Medical Sciences, Tehran, Iran; 5Department of Microbiology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran; 6Zoonoses Research Center, Jahrom University of Medical Sciences, Jahrom, Iran Background: Acinetobacter baumannii is an important human pathogen which has recently gained increased attention due to the occurrence of drug-resistant nosocomial infections in patients suffering from immune system disorders, and those in hospital intensive care units. The aim of this research was to identify and isolate A. baumannii strains resistant to colistin, determine antibiotic resistance pattern of this bacteria, investigate the presence of colistin-resistant genes, and finally assess the effect of expression changes in pmrA and pmrB genes resistant to A. baumannii against colistin via real-time polymerase chain reaction.Methods: The samples were initially purified and isolated using biochemical tests and Microgen kit. Later, the resistance pattern evaluation of validated samples to different antibiotics and colistin was carried out using two methods viz., disc diffusion and E-test. This was followed by the assessment of genes resistant to colistin via polymerase chain reaction besides gene expression changes via real-time polymerase chain reaction. Results: The results of this study indicated that eleven strains of A. baumannii isolated from Shahid Rajaee Trauma Hospital were resistant to colistin. However, in the resistance pattern evaluation of A. baumannii isolated

  19. Role of NADPH-insensitive nitroreductase gene to metronidazole resistance of Helicobacter pylori strains

    Directory of Open Access Journals (Sweden)

    M Kargar

    2010-06-01

    Full Text Available Background and the purpose of the study: Current anti-H. pylori therapies are based on the use of two antibiotics with a proton pump inhibitor and/or a bismuth component. Metronidazole is a key component of such combination therapies in Iran. The aim of this study was to determine the role of rdxA gene in resistant strains of H. pylori isolated from Shahrekord Hajar hospital to metronidazole. Methods: This study was a cross-sectional method, which was carried out on 263 patients who referred to endoscopy department of Hajar hospital, in 2007. Biopsy samples were cultured on selective Brucella agar containing 10% blood and incubated under microerophilic condition at 370C for 3 - 7 days. Suspected colonies were tested by Gram staining, urease, oxidase and catalase activities. Organisms were confirmed to be H. pylori on the basis of the presence of ureC(glmM gene by PCR .Specific primers were used for detection of rdxA gene mutation . Results: Eighty and four strains of H. pylori determined by PCR method. Of the isolated strains, 49 (58.33% were resistant, 7 (8.33% were semi-sensitive to metronidazole and 200bp deletion in rdxA gene was observed in 2 strains. Conclusion: Because of the high metronidazole resistance in patients under study it was necessary to replace it by other antibiotics in therapeutic regimens. On the basis of low frequency of resistance mutation in rdxA gene, sequence analysis for identification of other mechanisms is suggested.

  20. SnTox3 acts in effector triggered susceptibility to induce disease on wheat carrying the Snn3 gene.

    Directory of Open Access Journals (Sweden)

    Zhaohui Liu

    2009-09-01

    Full Text Available The necrotrophic fungus Stagonospora nodorum produces multiple proteinaceous host-selective toxins (HSTs which act in effector triggered susceptibility. Here, we report the molecular cloning and functional characterization of the SnTox3-encoding gene, designated SnTox3, as well as the initial characterization of the SnTox3 protein. SnTox3 is a 693 bp intron-free gene with little obvious homology to other known genes. The predicted immature SnTox3 protein is 25.8 kDa in size. A 20 amino acid signal sequence as well as a possible pro sequence are predicted. Six cysteine residues are predicted to form disulfide bonds and are shown to be important for SnTox3 activity. Using heterologous expression in Pichia pastoris and transformation into an avirulent S. nodorum isolate, we show that SnTox3 encodes the SnTox3 protein and that SnTox3 interacts with the wheat susceptibility gene Snn3. In addition, the avirulent S. nodorum isolate transformed with SnTox3 was virulent on host lines expressing the Snn3 gene. SnTox3-disrupted mutants were deficient in the production of SnTox3 and avirulent on the Snn3 differential wheat line BG220. An analysis of genetic diversity revealed that SnTox3 is present in 60.1% of a worldwide collection of 923 isolates and occurs as eleven nucleotide haplotypes resulting in four amino acid haplotypes. The cloning of SnTox3 provides a fundamental tool for the investigation of the S. nodorum-wheat interaction, as well as vital information for the general characterization of necrotroph-plant interactions.

  1. Detection of Genes that Determine Maize Grain Quality Characteristics and Resistance to Stress Factors

    Directory of Open Access Journals (Sweden)

    Markovskyi, O.V.

    2014-01-01

    Full Text Available 200 experimental maize samples (Maize Company were examined for the presence of genes that determine the quality characteristics of grain (wx and fl-2 genes, herbicide (bar (pat, epsps genes and insect (cry-genes resistance. The total DNA was extracted from maize living plant tissue. Primers to detect wx, fl-2, bar (pat, mepsps, CP4 epsps, cry1A(b, cry1F, cry1A.105, mcry3A, cry2Ab2, cry3Bb1, cry34Ab1, cry35Ab1 genes were designed and selected. Multiplex and Touchdown PCR were worked out. PCR amplification of certain sequences was carried out. No transgenes (bar (pat, mepsps, CP4 epsps, cry1A(b, cry1F, cry1A.105, mcry3A, cry2Ab2, cry3Bb1, cry34Ab1, cry35Ab1 were found among 200 analyzed experimental maize samples. At the same time, fl-2 gene was found in 41 samples, wx gene was found in 192 analyzed samples.

  2. Enhanced resistance to early blight in transgenic tomato lines expressing heterologous plant defense genes.

    Science.gov (United States)

    Schaefer, Scott C; Gasic, Ksenija; Cammue, Bruno; Broekaert, Willem; van Damme, Els J M; Peumans, Willy J; Korban, Schuyler S

    2005-11-01

    Genes coding for an iris ribosomal-inactivating protein (I-RIP), a maize beta-glucanase (M-GLU), and a Mirabilis jalapa antimicrobial peptide (Mj-AMP1) were separately introduced into tomato (Lycopersicon esculentum cv. Sweet Chelsea) cotyledons via Agrobacterium tumefaciens-mediated transformation. Transgenic lines carrying each of the transgenes were confirmed for integration into the tomato genome using Southern blot hybridization. Transcription of I-RIP, M-GLU, and Mj-AMP1 genes in various transgenic lines was determined using Northern blot analysis. Plants of selected transgenic lines were inoculated with a 2-3x10(4) conidial spores/ml suspension of the fungal pathogen Alternaria solani, the causal agent of tomato early blight. Compared to control (non-transformed) plants, two transgenic lines carrying either a M-GLU or Mj-AMP1 showed enhanced resistance to early blight disease. None of the four lines carrying the I-RIP transgene showed increased resistance to early blight.

  3. A double EPSPS gene mutation endowing glyphosate resistance shows a remarkably high resistance cost.

    Science.gov (United States)

    Han, Heping; Vila-Aiub, Martin M; Jalaludin, Adam; Yu, Qin; Powles, Stephen B

    2017-12-01

    A novel glyphosate resistance double point mutation (T102I/P106S, TIPS) in the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene has been recently identified for the first time only in the weed species Eleusine indica. Quantification of plant resistance cost associated with the TIPS and the often reported glyphosate resistance single P106S mutation was performed. A significant resistance cost (50% in seed number currency) associated with the homozygous TIPS but not the homozygous P106S EPSPS variant was identified in E. indica plants. The resistance cost associated with the TIPS mutation escalated to 85% in plants under resource competition with rice crops. The resistance cost was not detected in nonhomozygous TIPS plants denoting the recessive nature of the cost associated with the TIPS allele. An excess of 11-fold more shikimate and sixfold more quinate in the shikimate pathway was detected in TIPS plants in the absence of glyphosate treatment compared to wild type, whereas no changes in these compounds were observed in P106S plants when compared to wild type. TIPS plants show altered metabolite levels in several other metabolic pathways that may account for the expression of the observed resistance cost. © 2017 John Wiley & Sons Ltd.

  4. Resistance gene homologues in melon are linked to genetic loci conferring disease and pest resistance.

    Science.gov (United States)

    Brotman, Y.; Silberstein, L.; Kovalski, I.; Perin, C.; Dogimont, C.; Pitrat, M.; Klingler, J.; Thompson, A.; Perl-Treves, R.

    2002-05-01

    Genomic and cDNA fragments with homology to known disease resistance genes (RGH fragments) were cloned from Cucumis melo using degenerate-primer PCR. Fifteen homologues of the NBS-LRR gene family have been isolated. The NBS-LRR homologues show high divergence and, based on the partial NBS-fragment sequences, appear to include members of the two major subfamilies that have been described in dicot plants, one that possesses a TIR-protein element and one that lacks such a domain. Genomic organization of these sequences was explored by DNA gel-blot analysis, and conservation among other Cucurbitaceae was assessed. Two mapping populations that segregate for several disease and pest resistance loci were used to map the RGH probes onto the melon genetic map. Several NBS-LRR related sequences mapped to the vicinity of genetic loci that control resistance to papaya ringspot virus, Fusarium oxysporum race 1, F. oxysporum race 2 and to the insect pest Aphis gossypii. The utility of such markers for breeding resistant melon cultivars and for cloning the respective R-genes is discussed.

  5. Detection of selected antibiotic resistance genes using multiplex PCR assay in mastitis pathogens in the Czech Republic

    Directory of Open Access Journals (Sweden)

    Vladimir Pyatov

    2017-01-01

    Full Text Available The aim of this research was to develop multiplex polymerase chain reaction assays for the detection of aminoglycoside (strA, strB, sulphonamide (sulI, sulII, tetracycline (tetA, tetB, tetK, tetM, tetO, macrolide and lincosamide (msrA, ermA, ermB, ermC, mefA/E genes of resistance in mastitis pathogens (Escherichia coli, Staphylococcus aureus, Streptococcus uberis, Streptococcus agalactiae and Streptococcus dysgalactiae. Applying the established assays, we investigated the distribution of antibiotic resistance genes in the above mentioned species isolated from milk samples in the Czech Republic. Each assay consisted of seven pairs of primers. Six of them amplified fragments of antibiotic resistance genes and one pair a fragment of a species specific gene. Polymerase chain reaction conditions were optimized to amplify seven gene fragments simultaneously in one reaction. In total, 249 isolates were used, among which 111 were positive for E. coli, 52 for S. aureus and 86 for Streptococcus spp. The majority (60.2% of bacteria carried at least one antibiotic resistance gene and 44.6% were multidrug-resistant. The designed multiplex polymerase chain reaction assays may be applied as diagnostic method to replace or complement standard techniques of antibiotic susceptibility testing in the mentioned pathogens.

  6. New eight genes identified at the clinical multidrug-resistant Acinetobacter baumannii DMS06669 strain in a Vietnam hospital

    Directory of Open Access Journals (Sweden)

    Nguyen Si-Tuan

    2017-11-01

    Full Text Available Abstract Background Acinetobacter baumannii is an important nosocomial pathogen that can develop multidrug resistance. In this study, we characterized the genome of the A. baumannii strain DMS06669 (isolated from the sputum of a male patient with hospital-acquired pneumonia and focused on identification of genes relevant to antibiotic resistance. Methods Whole genome analysis of A. baumannii DMS06669 from hospital-acquired pneumonia patients included de novo assembly; gene prediction; functional annotation to public databases; phylogenetics tree construction and antibiotics genes identification. Results After sequencing the A. baumannii DMS06669 genome and performing quality control, de novo genome assembly was carried out, producing 24 scaffolds. Public databases were used for gene prediction and functional annotation to construct a phylogenetic tree of the DMS06669 strain with 21 other A. baumannii strains. A total of 18 possible antibiotic resistance genes, conferring resistance to eight distinct classes of antibiotics, were identified. Eight of these genes have not previously been reported to occur in A. baumannii. Conclusions Our results provide important information regarding mechanisms that may contribute to antibiotic resistance in the DMS06669 strain, and have implications for treatment of patients infected with A. baumannii.

  7. [State-of-the-art status on airborne antibiotic resistant bacteria and antibiotic resistance genes].

    Science.gov (United States)

    Li, J; Yao, M S

    2018-04-06

    The world is facing more deaths due to increasing antibiotic-resistant bacterial infections and the shortage of new highly effective antibiotics, however the air media as its important transmission route has not been adequately studied. Based on the latest literature acquired in this work, we have discussed the state-of-the-art research progress of the concentration, distribution and spread of antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARGs) in different environmental air media, and also analyzed some future prevention and control measures. The large use of antibiotics in the medical settings and animal husbandry places has resulted in higher abundances of ARB and ARGs in the relevant and surrounding atmosphere than in urban and general indoor air environments. ARGs can be spread by adhering to airborne particles, and researchers have also found that air media contain more abundant ARGs than other environmental media such as soil, water and sediment. It was suggested in this review that strengthening the monitoring, study on spreading factors and biological toxicity, and also research and development on pathogen accurate diagnosis and new green antibiotic are expected to help effectively monitor, prevent and control of the impacts of airborne resistant bacteria and resistance genes on both human and ecologies.

  8. Investigation on prevalence of Escherichia coli strains carrying virulence genes ipaH, estA, eaeA and bfpA isolated from different water sources

    Directory of Open Access Journals (Sweden)

    Reza Ranjbar

    2016-04-01

    Full Text Available Objective: To investigate prevalence of Escherichia coli (E. coli strains carrying virulence genes ipaH, estA, eaeA and bfpA, isolated from different water sources in Alborz Province. Methods: This study was carried out in 2014. The research included all E. coli strains isolated from different surface water sources in Alborz Province of Iran. E. coli isolates were detected and identified by standard microbiological and biochemical tests. The strains were evaluated for the presence of virulence genes ipaH, estA, eaeA and bfpA by PCR using specific primers. The PCR amplicons were visualized via electrophoresis and stained with ethidium bromide. Results: One hundred E. coli strains were isolated and included in the study. The PCR results showed that 97% of the strains harbored ipaH gene. Moreover, estA, eaeA and bfpA genes were found in 37%, 31% and 3% of the isolates. Conclusions: Our finding showed that the prevalence rates of virulence genes ipaH and estA were very high among E. coli strains isolated from different surface water sources in Alborz Province. Considering their plasmid-borne nature, the risk of transmission of these genes between other bacterial species could pose a high threat to public health.

  9. Two pathways act in an additive rather than obligatorily synergistic fashion to induce systemic acquired resistance and PR gene expression

    Directory of Open Access Journals (Sweden)

    Shapiro Allan D

    2002-10-01

    Full Text Available Abstract Background Local infection with necrotizing pathogens induces whole plant immunity to secondary challenge. Pathogenesis-related genes are induced in parallel with this systemic acquired resistance response and thought to be co-regulated. The hypothesis of co-regulation has been challenged by induction of Arabidopsis PR-1 but not systemic acquired resistance in npr1 mutant plants responding to Pseudomonas syringae carrying the avirulence gene avrRpt2. However, experiments with ndr1 mutant plants have revealed major differences between avirulence genes. The ndr1-1 mutation prevents hypersensitive cell death, systemic acquired resistance and PR-1 induction elicited by bacteria carrying avrRpt2. This mutation does not prevent these responses to bacteria carrying avrB. Results Systemic acquired resistance, PR-1 induction and PR-5 induction were assessed in comparisons of npr1-2 and ndr1-1 mutant plants, double mutant plants, and wild-type plants. Systemic acquired resistance was displayed by all four plant lines in response to Pseudomonas syringae bacteria carrying avrB. PR-1 induction was partially impaired by either single mutation in response to either bacterial strain, but only fully impaired in the double mutant in response to avrRpt2. PR-5 induction was not fully impaired in any of the mutants in response to either avirulence gene. Conclusion Two pathways act additively, rather than in an obligatorily synergistic fashion, to induce systemic acquired resistance, PR-1 and PR-5. One of these pathways is NPR1-independent and depends on signals associated with hypersensitive cell death. The other pathway is dependent on salicylic acid accumulation and acts through NPR1. At least two other pathways also contribute additively to PR-5 induction.

  10. Multidrug-Resistant Escherichia albertii: Co-occurrence of β-Lactamase and MCR-1 Encoding Genes

    Directory of Open Access Journals (Sweden)

    Qun Li

    2018-02-01

    Full Text Available Escherichia albertii is an emerging member of the Enterobacteriaceae causing human and animal enteric infections. Antimicrobial resistance among enteropathogens has been reported to be increasing in the past years. The purpose of this study was to investigate antibiotic resistance and resistance genes in E. albertii isolated from Zigong city, Sichuan province, China. The susceptibility to 21 antimicrobial agents was determined by Kirby–Bauer disk diffusion method. The highest prevalence was tetracycline resistance with a rate of 62.7%, followed by resistance to nalidixic acid and streptomycin with a rate of 56.9 and 51.0%, respectively. All isolates were sensitive or intermediate susceptible to imipenem, meropenem, amoxicillin–clavulanic acid, and levofloxacin. Among 51 E. albertii isolates, 15 were extended-spectrum β-lactamase-producing as confirmed by the double disk test. The main β-lactamase gene groups, i.e., blaTEM, blaSHV, and blaCTX-M, were detected in17, 20, and 22 isolates, respectively. Furthermore, four colistin-resistant isolates with minimum inhibitory concentrations of 8 mg/L were identified. The colistin-resistant isolates all harbored mcr-1 and blaCTX-M-55. Genome sequencing showed that E. albertii strain SP140150 carried mcr-1 and blaCTX-M-55 in two different plasmids. This study provided significant information regarding antibiotic resistance profiles and identified the co-occurrence of β-lactamase and MCR-1 encoding genes in E. albertii isolates.

  11. Study on drug resistance of mycobacterium tuberculosis in patients with pulmonary tuberculosis by drug resistance gene detecting

    International Nuclear Information System (INIS)

    Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing

    2004-01-01

    To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)

  12. Evolution by Pervasive Gene Fusion in Antibiotic Resistance and Antibiotic Synthesizing Genes

    Directory of Open Access Journals (Sweden)

    Orla Coleman

    2015-03-01

    Full Text Available Phylogenetic (tree-based approaches to understanding evolutionary history are unable to incorporate convergent evolutionary events where two genes merge into one. In this study, as exemplars of what can be achieved when a tree is not assumed a priori, we have analysed the evolutionary histories of polyketide synthase genes and antibiotic resistance genes and have shown that their history is replete with convergent events as well as divergent events. We demonstrate that the overall histories of these genes more closely resembles the remodelling that might be seen with the children’s toy Lego, than the standard model of the phylogenetic tree. This work demonstrates further that genes can act as public goods, available for re-use and incorporation into other genetic goods.

  13. DNA tagging of blast resistant gene(s in three Brazilian rice cultivars

    Directory of Open Access Journals (Sweden)

    S.S. Sandhu

    2003-12-01

    Full Text Available Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.. Seven randomly amplified polymorphic DNA (RAPD markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000, OPA5(1200, OPG17(700, OPG18(850, OPG19(500, OPG19(600, OPF9(600, OPF17(1200 and OPF19(600 were identified as dominant markers for the blast resistant gene in resistant cultivar lines. These loci facilitate the indirect scoring of blast resistant and blast susceptible genotypes. The codomine RAPDs markers will facilitate marker-assisted selection of the blast resistant gene in two blast resistant genotypes of rice (Labelle and Line 11 and will be useful in rice breeding programs.

  14. Loss of Apc heterozygosity and abnormal tissue building in nascent intestinal polyps in mice carrying a truncated Apc gene.

    Science.gov (United States)

    Oshima, M; Oshima, H; Kitagawa, K; Kobayashi, M; Itakura, C; Taketo, M

    1995-05-09

    Mutations in the APC (adenomatous polyposis coli) gene appear to be responsible for not only familial adenomatous polyposis but also many sporadic cases of gastrointestinal cancers. Using homologous recombination in mouse embryonic stem cells, we constructed mice that contained a mutant gene encoding a product truncated at a 716 (Apc delta 716). Mendelian transmission of the gene caused most homozygous mice to die in utero before day 8 of gestation. The heterozygotes developed multiple polyps throughout the intestinal tract, mostly in the small intestine. The earliest polyps arose multifocally during the third week after birth, and new polyps continued to appear thereafter. Surprisingly, every nascent polyp consisted of a microadenoma covered with a layer of the normal villous epithelium. These microadenomas originated from single crypts by forming abnormal outpockets into the inner (lacteal) side of the neighboring villi. We carefully dissected such microadenomas from nascent polyps by peeling off the normal epithelium and determined their genotype by PCR: all microadenomas had already lost the wild-type Apc allele, whereas the mutant allele remained unchanged. These results indicate that loss of heterozygosity followed by formation of intravillous microadenomas is responsible for polyposis in Apc delta 716 intestinal mucosa. It is therefore unlikely that the truncated product interacts directly with the wild-type protein and causes the microadenomas by a dominant negative mechanism.

  15. Reduction of Skeletal Muscle Power in Adolescent Males Carrying H63D Mutation in the HFE Gene

    Directory of Open Access Journals (Sweden)

    Marcin Luszczyk

    2017-01-01

    Full Text Available Iron overload resulting from the mutation of genes involved in iron metabolism or excess dietary intake has been reported to negatively influence human physical performance. The aim of this study was to test the hypothesis that adolescents bearing a hemochromatosis gene (HFE mutation in contrast to adults with the same mutation will not experience iron accumulation and their aerobic capacity will be similar to that of age-matched controls. Thirteen boys participated in the study. Seven of them are carriers of H63D mutation in the HFE gene and six were wild type. Fitness levels were assessed using the cardiopulmonary exercise test. In addition, iron status and inflammatory markers were determined. We observed that cardiovascular fitness was significantly lower in the group bearing the HFE mutation compared to the control group. Moreover, the HFE mutation group achieved lower maximal power output compared to the control group. There were no differences in blood ferritin concentrations between the two groups which indicates similar amounts of stored iron. Obtained data do not confirm our hypothesis. On the contrary, it was demonstrated that HFE mutation is associated with a lower level of aerobic capacity, even in the absence of iron accumulation.

  16. [Phenotypic and genotypic analysis of a fetus carrying an intermediate 22q11.2 deletion encompassing the CRKL gene].

    Science.gov (United States)

    Lin, Shaobin; Zheng, Xiaohe; Gu, Heng; Li, Mingzhen

    2017-06-10

    To delineate the phenotypic characteristics of 22q11.2 deletion syndrome and the role of CRKL gene in the pathogenesis of cardiac abnormalities. G-banded karyotyping, single nucleotide polymorphism (SNP) array and fluorescence in situ hybridization (FISH) were performed on a fetus with tetralogy of Fallot detected by ultrasound. Correlation between the genotype and phenotype was explored after precise mapping of the breakpoints on chromosome 22q11.2. SNP array was also performed on peripheral blood samples from both parents to clarify its origin. The fetus showed a normal karyotype of 46,XY. SNP array performed on fetal blood sample revealed a 749 kb deletion (chr22: 20 716 876-21 465 659) at 22q11.21, which encompassed the CRKL gene but not TBX1, HIRA, COMT and MAPK1. Precise mapping of the breakpoints suggested that the deleted region has overlapped with that of central 22q11.2 deletion syndrome. SNP array analysis of the parental blood samples suggested that the 22q11.21 deletion has a de novo origin. The presence of 22q11.21 deletion in the fetus was also confirmed by FISH analysis. Central 22q11.21 deletion probably accounts for the cardiac abnormalities in the fetus, for which the CRKL gene should be considered as an important candidate.

  17. Occurrence of the mcr-1 Colistin Resistance Gene and other Clinically Relevant Antibiotic Resistance Genes in Microbial Populations at Different Municipal Wastewater Treatment Plants in Germany

    Directory of Open Access Journals (Sweden)

    Norman Hembach

    2017-07-01

    Full Text Available Seven wastewater treatment plants (WWTPs with different population equivalents and catchment areas were screened for the prevalence of the colistin resistance gene mcr-1 mediating resistance against last resort antibiotic polymyxin E. The abundance of the plasmid-associated mcr-1 gene in total microbial populations during water treatment processes was quantitatively analyzed by qPCR analyses. The presence of the colistin resistance gene was documented for all of the influent wastewater samples of the seven WWTPs. In some cases the mcr-1 resistance gene was also detected in effluent samples of the WWTPs after conventional treatment reaching the aquatic environment. In addition to the occurrence of mcr-1 gene, CTX-M-32, blaTEM, CTX-M, tetM, CMY-2, and ermB genes coding for clinically relevant antibiotic resistances were quantified in higher abundances in all WWTPs effluents. In parallel, the abundances of Acinetobacter baumannii, Klebsiella pneumoniae, and Escherichia coli were quantified via qPCR using specific taxonomic gene markers which were detected in all influent and effluent wastewaters in significant densities. Hence, opportunistic pathogens and clinically relevant antibiotic resistance genes in wastewaters of the analyzed WWTPs bear a risk of dissemination to the aquatic environment. Since many of the antibiotic resistance gene are associated with mobile genetic elements horizontal gene transfer during wastewater treatment can't be excluded.

  18. Aspergillus fumigatus carrying TR34/L98H resistance allele causing complicated suppurative otitis media in Tanzania: Call for improved diagnosis of fungi in sub-Saharan Africa.

    Science.gov (United States)

    Mushi, Martha F; Buname, Gustave; Bader, Oliver; Groß, Uwe; Mshana, Stephen E

    2016-09-02

    Suppurative otitis media (SOM) is a major public health concern worldwide and is associated with increased morbidity. Cases of fungal suppurative otitis media were studied to establish the effect of fungi in otitis media. Ear swabs from 410 patients were collected aseptically using sterile cotton swabs from discharging ear through perforated tympanic membrane. Swabs were subjected to microscopic and culture investigations. The species of fungal growing on Sabouraud's agar were identified using MALDI-TOF MS. For moulds broth micro dilution method following EUCAST guidelines was employed to determine susceptibility patterns against itraconazole, voriconazole and posaconazole. A total of 44 (10.74 %) cases with positive fungal culture growth were studied. The median age of patients with fungal infection was 29.5 (IQR 16-43) years. Of 44 patients; 35 (79.6 %) had pure growth of one type of fungal. Candida albicans was the most common fungus isolated (n = 13; 29.6 %) followed by Aspergillus versicolor (n = 8; 18.2 %). A total of 7 (15.9 %) patients had disease complication at time of enrollment; of them 6 (13.6 %) had hearing loss. On follow up 7 (15.9 %) had poor treatment outcome. All five Aspergillus fumigatus strains resistant itraconazole with reduced susceptibility to voriconazole and posaconazole carried carrying TR34/L98H resistance allele. In addition, all Penicillium citrinum isolates were resistant to voriconazole while all Penicillium sumatrense were resistant to both itraconazole and voriconazole. There were non-significant association of poor treatment outcome and female gender, being HIV positive and being infected with moulds. Fungal infections play a significant role in SOM pathology in our setting. Diagnosis of fungal infections in developing countries should be improved so that appropriate management can be initiated on time to prevent associated complications.

  19. Bacterial plasmid-mediated quinolone resistance genes in aquatic environments in China

    OpenAIRE

    Yan, Lei; Liu, Dan; Wang, Xin-Hua; Wang, Yunkun; Zhang, Bo; Wang, Mingyu; Xu, Hai

    2017-01-01

    Emerging antimicrobial resistance is a major threat to human?s health in the 21st century. Understanding and combating this issue requires a full and unbiased assessment of the current status on the prevalence of antimicrobial resistance genes and their correlation with each other and bacterial groups. In aquatic environments that are known reservoirs for antimicrobial resistance genes, we were able to reach this goal on plasmid-mediated quinolone resistance (PMQR) genes that lead to resistan...

  20. Distribution of tetracycline resistance genes and AmpC β-lactamase genes in representative non-urban sewage plants and correlations with treatment processes and heavy metals.

    Science.gov (United States)

    Xu, Yan-Bin; Hou, Mao-Yu; Li, Ya-Fei; Huang, Lu; Ruan, Jing-Jing; Zheng, Li; Qiao, Qing-Xia; Du, Qing-Ping

    2017-03-01

    The mixed development of livestock breeding and industry in non-urban zones is a very general phenomenon in China. Distribution of antibiotic resistance genes (ARGs) in non-urban sewage treatment systems has not been paid enough attentions. In this study, eleven tetracycline resistance genes (tetA, tetB, tetC, tetE, tetG, tetL, tetM, tetO, tetQ, tetS and tetX), four AmpC β-lactamase genes (EBC, MOX, FOX and CIT) and four heavy metals (Cu, Zn, Cd and Pb) were detected and analyzed in four non-urban sewage plants with different sewage sources and different treatment processes in Guangzhou. The results showed that tetA and tetC were the most prevalent tetracycline resistance genes with the same detection frequency of 85% and EBC was the most prevalent AmpC β-lactamase gene with a detection frequency of 75%. The relative abundance of tetracycline resistance genes was approximately 1.6 orders of magnitudes higher than that of AmpC β-lactamase genes in all samples. A/O was the most effective process for the non-urban sewage plant receiving industrial or agricultural wastewater. Sedimentation was the most key process to eliminate ARGs from liquid phase. Most ARGs were carried in excess sludge rather than effluent. Significant correlation was found between the tet gene and Zn (r = 0.881, p gene and Cu (r = 0.847, p gene and Cu (r = 0.714, p < 0.05). Therefore, the pollution of ARGs in the sewage treatment systems of non-urban zones co-polluted by heavy metals should be paid more attentions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter.

    Science.gov (United States)

    Li, Lili; Heidemann Olsen, Rikke; Ye, Lei; Yan, He; Nie, Qing; Meng, Hecheng; Shi, Lei

    2016-04-01

    The aim of this study was to investigate the phe