WorldWideScience

Sample records for resistance gene mdr1

  1. Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

    Directory of Open Access Journals (Sweden)

    Buddhasukh Duang

    2004-04-01

    Full Text Available Abstract Background Multidrug resistance (MDR is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170, thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. Methods In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn, were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Results Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. Conclusion These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents.

  2. Modulation of human multidrug-resistance MDR-1 gene by natural curcuminoids

    International Nuclear Information System (INIS)

    Limtrakul, Pornngarm; Anuchapreeda, Songyot; Buddhasukh, Duang

    2004-01-01

    Multidrug resistance (MDR) is a phenomenon that is often associated with decreased intracellular drug accumulation in patient's tumor cells resulting from enhanced drug efflux. It is related to the overexpression of a membrane protein, P-glycoprotein (Pgp-170), thereby reducing drug cytotoxicity. A variety of studies have tried to find MDR modulators which increase drug accumulation in cancer cells. In this study, natural curcuminoids, pure curcumin, demethoxycurcumin and bisdemethoxycurcumin, isolated from turmeric (Curcuma longa Linn), were compared for their potential ability to modulate the human MDR-1 gene expression in multidrug resistant human cervical carcinoma cell line, KB-V1 by Western blot analysis and RT-PCR. Western blot analysis and RT-PCR showed that all the three curcuminoids inhibited MDR-1 gene expression, and bisdemethoxycurcumin produced maximum effect. In additional studies we found that commercial grade curcuminoid (approximately 77% curcumin, 17% demethoxycurcumin and 3% bisdemthoxycurcumin) decreased MDR-1 gene expression in a dose dependent manner and had about the same potent inhibitory effect on MDR-1 gene expression as our natural curcuminoid mixtures. These results indicate that bisdemethoxycurcumin is the most active of the curcuminoids present in turmeric for modulation of MDR-1 gene. Treatment of drug resistant KB-V1 cells with curcumin increased their sensitivity to vinblastine, which was consistent with a decreased MDR-1 gene product, a P-glycoprotein, on the cell plasma membrane. Although many drugs that prevent the P-glycoprotein function have been reported, this report describes the inhibition of MDR-1 expression by a phytochemical. The modulation of MDR-1 expression may be an attractive target for new chemosensitizing agents

  3. Quantitative analysis of MDR1 (multidrug resistance) gene expression in human tumors by polymerase chain reaction

    International Nuclear Information System (INIS)

    Noonan, K.E.; Beck, C.; Holzmayer, T.A.; Chin, J.E.; Roninson, I.B.; Wunder, J.S.; Andrulis, I.L.; Gazdar, A.F.; Willman, C.L.; Griffith, B.; Von Hoff, D.D.

    1990-01-01

    The resistance of tumor cells ot chemotheraprutic drugs is a major obstacle to successful cancer chemotherapy. In human cells, expression of the MDR1 gene, encoding a transmembrane efflux pump (P-glycoprotein), leads to decreased intracellular accumulation and resistance to a variety of lipophilic drugs (multidrug resistance; MDR). The levels of MDR in cell lines selected in bitro have been shown to correlate with the steady-state levels of MDR1 mRNA and P-glycoprotein. In cells with a severalfold increase in cellular drug resistance, MDR1 expression levels are close to the limits of detection by conventional assays. MDR1 expression has been frequently observed in human tumors after chemotherapy and in some but not all types of clinically refactory tumors untreated with chemotherapeutic drugs. The authors have devised a highly sensitive, specific, and quantitative protocol for measuring the levels of MDR1 mRNA in clincal samples, based on the polymerase chain reaction. They have used this assay to measure MDR1 gene expression in MDR cell lines and >300 normal tissues, tumor-derived cell lines, and clinical specimens of untreated tumors of the types in which MDR1 expression was rarely observed by standard assays. Low levels of MDR1 expression were found by polymerase chain reaction in most solid tumors and leukemias tested. The frequency of samples without detectable MDR1 expression varied among different types of tumors; MDR1-negative samples were ost common among tumor types known to be relatively responsive to chemotherapy

  4. Anaplasia and drug selection-independent overexpression of the multidrug resistance gene, MDR1, in Wilms' tumor.

    Science.gov (United States)

    Re, G G; Willingham, M C; el Bahtimi, R; Brownlee, N A; Hazen-Martin, D J; Garvin, A J

    1997-02-01

    One reason for the failure of chemotherapy is the overexpression of the multidrug resistance gene, MDR1. The product of this gene is the multidrug transporter P-glycoprotein, an ATP-dependent pump that extrudes drugs from the cytoplasm. Some tumors inherently express P-glycoprotein, whereas others acquire the ability to do so after exposure to certain chemotherapeutic agents, often by the mechanism of gene amplification. Classical Wilms' tumors (nephroblastoma) typically respond to therapy and have a good prognosis. On the contrary, anaplastic Wilms' tumors are generally refractory to chemotherapy. These anaplastic variants are rare (4.5% of all Wilms' tumors reported in the United States), aggressive, and often fatal forms of tumor, which are commonly thought to result from the progression of classical Wilms' tumors. To investigate the basis for this differential response to therapy, we examined a number of classical and anaplastic Wilms' tumors for the expression of the MDR1 gene by immunohistochemical and mRNA analysis. Classical Wilms' tumors consistently did not express P-glycoprotein except in areas of tubular differentiation, as in normal kidney. Similarly, two of three anaplastic tumors failed to show P-glycoprotein expression. In contrast, cultured cells derived from a third anaplastic tumor, W4, exhibited strong P-glycoprotein expression and were drug resistant in vitro. Southern analysis revealed that W4 cells contained a single copy of the MDR1 gene per haploid genome similar to normal cells, demonstrating that the overexpression of MDR1 was not caused by gene amplification. Transcriptional activation of the MDR1 gene would be in keeping with the concept that p53 might act as a transcriptional repressor of the MDR1 gene.

  5. Association of ACE and MDR1 Gene Polymorphisms with Steroid Resistance in Children with Idiopathic Nephrotic Syndrome.

    Science.gov (United States)

    Dhandapani, Mohanapriya Chinambedu; Venkatesan, Vettriselvi; Rengaswamy, Nammalwar Bollam; Gowrishankar, Kalpana; Nageswaran, Prahlad; Perumal, Venkatachalam

    2015-08-01

    The purpose of the study was to investigate the distribution of insertion/deletion (I/D) polymorphisms of the angiotensin-converting enzyme (ACE) gene and three exonic polymorphisms of the multidrug resistance 1 (MDR1) gene (C3435T, C1236T, and G2677T) in children diagnosed with idiopathic nephrotic syndrome (INS). The study group consisted of 100 healthy controls and 150 INS patients, of which 50 were steroid resistant. Genomic DNA from blood samples was isolated from both of these groups and genotyping of the ACE and MDR1 genes was performed by polymerase chain reaction (PCR) using specific primers. There was no significant difference observed in the genotypic distribution and D allele frequency of the ACE gene. The two single-nucleotide polymorphisms (SNPs), C1236T and C3435T, of the MDR1 gene showed no significance, whereas the SNP G2677T/A was significantly associated with the genotypes GT and GA of the MDR1 gene, indicating it may be a potential marker to detect drug resistance. Screening these polymorphisms will pave the way to better understand the molecular mechanisms of the disease, which may be useful in developing targeted therapies for INS patients.

  6. Identification of antibiotic resistance genes in the multidrug-resistant Acinetobacter baumannii strain, MDR-SHH02, using whole-genome sequencing.

    Science.gov (United States)

    Wang, Hualiang; Wang, Jinghua; Yu, Peijuan; Ge, Ping; Jiang, Yanqun; Xu, Rong; Chen, Rong; Liu, Xuejie

    2017-02-01

    This study aimed to investigate antibiotic resistance genes in the multidrug-resistant (MDR) Acinetobacter baumannii (A. baumanii) strain, MDR-SHH02, using whole‑genome sequencing (WGS). The antibiotic resistance of MDR-SHH02 isolated from a patient with breast cancer to 19 types of antibiotics was determined using the Kirby‑Bauer method. WGS of MDR-SHH02 was then performed. Following quality control and transcriptome assembly, functional annotation of genes was conducted, and the phylogenetic tree of MDR-SHH02, along with another 5 A. baumanii species and 2 Acinetobacter species, was constructed using PHYLIP 3.695 and FigTree v1.4.2. Furthermore, pathogenicity islands (PAIs) were predicted by the pathogenicity island database. Potential antibiotic resistance genes in MDR-SHH02 were predicted based on the information in the Antibiotic Resistance Genes Database (ARDB). MDR-SHH02 was found to be resistant to all of the tested antibiotics. The total draft genome length of MDR-SHH02 was 4,003,808 bp. There were 74.25% of coding sequences to be annotated into 21 of the Clusters of Orthologous Groups (COGs) of protein terms, such as 'transcription' and 'amino acid transport and metabolism'. Furthermore, there were 45 PAIs homologous to the sequence MDRSHH02000806. Additionally, a total of 12 gene sequences in MDR-SHH02 were highly similar to the sequences of antibiotic resistance genes in ARDB, including genes encoding aminoglycoside‑modifying enzymes [e.g., aac(3)-Ia, ant(2'')‑Ia, aph33ib and aph(3')-Ia], β-lactamase genes (bl2b_tem and bl2b_tem1), sulfonamide-resistant dihydropteroate synthase genes (sul1 and sul2), catb3 and tetb. These results suggest that numerous genes mediate resistance to various antibiotics in MDR-SHH02, and provide a clinical guidance for the personalized therapy of A. baumannii-infected patients.

  7. Silencage du gene MDR1 et resensibilisation des cellules MCF-7 MDR a la doxorubicine en utilisant les nanoparticules chitosane/MDR1-siARN

    Science.gov (United States)

    El-Ariss, Mohamad

    Cancer is the leading cause of death in Canada and is responsible for about 30% of all deaths in the country.[1] It is estimated that by 2015, one in four Canadians (24% women and 29% men) will die from cancer. In the world and only for 2012, 14 million new cancer cases and 8.2 million deaths from the disease were reported.[2] The worst is yet to come because, according to World Health Organization, the number of new cases is expected to increase by about 70% over the next two decades. The high mortality associated with cancer is partly explained by the acquisition of drug resistance that make patients refractory to chemotherapy. In fact, cancer cells exposed to a cytotoxic agent during chemotherapy, may develop a resistance to this agent as well as various agents sharing structural or functional similarities. These cancer cells are known for multidrug resistance ("Multiple Drug resistant cells"). The development of resistance to chimiodrogues is a major public health problem that presents an obstacle for the development of new cancer treatments. MCF-7 MDR are established cell lines of human breast cancer that have developed resistance to chimiodrogues such as doxorubicin. MCF-7 MDR have the particularity to over-express P-gp protein that is responsible for the detoxification of cells by reflux of chimiodrogues. The purpose of this study was therefore to reduce the expression of P-gp, encoded by the MDR1 gene (also called gene ABCB1) in cancer cells MCF-7, and re-sensitize MCF-7 MDR cells to anti-cancer treatments. In order to modify MDR1 gene expression, we used small RNAi called siRNA that are specific to the MDR1 gene. In total, 4 duplexes of siRNA have been used: siRNA_1, siRNA_1M, siRNA_2 and siRNA_2M. Each of the duplexes strands is consists of 21 nucleic acids and has two protruding nucleic acids (overhangs) at the 3' end. siRNA_1 and siRNA_1M are complementary to the nucleic acid sequence (577-595 nucleic acids ) of the MDR1 gene, whereas siARN_2 and si

  8. HIF-1α inhibition reverses multidrug resistance in colon cancer cells via downregulation of MDR1/P-glycoprotein.

    Directory of Open Access Journals (Sweden)

    Jianfang Chen

    Full Text Available Multidrug resistance (MDR is one of the major reasons chemotherapy-based treatments fail. Hypoxia is generally associated with tumor chemoresistance. However, the correlation between the heterodimeric hypoxia-inducible factor-1 (HIF-1 and the multidrug resistance (MDR1 gene/transporter P-glycoprotein (P-gp remains unclear. This study aims to explore the molecular mechanisms of reversing colon cancer MDR by focusing on the target gene HIF-1α.A chemotherapeutic sensitivity assay was used to observe the efficiency of MDR reversal in LoVo multicellular spheroids (MCS. The apoptotic level induced by different drugs was examined by flow cytometry (FCM. Binding of HIF-1α to the MDR1 gene promoter was evaluated by Chromatin immunoprecipitation (ChIP. The relationship between HIF-1α/P-gp expression and sensitivity to chemotherapy was analyzed.The sensitivity of LoVo MCS to all four chemotherapy drugs was decreased to varying degrees under hypoxic conditions. After silencing the HIF-1α gene, the sensitivities of LoVo MCS to all four chemotherapy drugs were restored. The apoptotic levels that all the drugs induced were all decreased to various extents in the hypoxic group. After silencing HIF-1α, the apoptosis level induced by all four chemotherapy drugs increased. The expression of HIF-1α and P-gp was significantly enhanced in LoVo MCS after treatment with hypoxia. Inhibiting HIF-1α significantly decreased the expression of MDR1/P-gp mRNA or protein in both the LoVo monolayers and LoVo MCS. The ChIP assay showed that HIF-1α was bound to the MDR1 gene promoter. Advanced colon carcinoma patients with expression of both HIF-1α and P-gp were more resistant to chemotherapy than that with non expression.HIF-1α inhibition reverses multidrug resistance in colon cancer cells via downregulation of MDR1/P-gp. The expression of HIF-1α and MDR1/P-gp can be used as a predictive marker for chemotherapy resistance in colon cancer.

  9. Multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP and lung resistance protein (LRP gene expression in childhood acute lymphoblastic leukemia

    Directory of Open Access Journals (Sweden)

    Elvis Terci Valera

    Full Text Available CONTEXT: Despite the advances in the cure rate for acute lymphoblastic leukemia, approximately 25% of affected children suffer relapses. Expression of genes for the multiple drug resistance protein (MDR-1, multidrug resistance-related protein (MRP, and lung resistance protein (LRP may confer the phenotype of resistance to the treatment of neoplasias. OBJECTIVE: To analyze the expression of the MDR-1, MRP and LRP genes in children with a diagnosis of acute lymphoblastic leukemia via the semiquantitative reverse transcription polymerase chain reaction (RT-PCR, and to determine the correlation between expression and event-free survival and clinical and laboratory variables. DESIGN: A retrospective clinical study. SETTING: Laboratory of Pediatric Oncology, Department of Pediatrics, Faculdade de Medicina de Ribeirão Preto, Universidade de São Paulo, Brazil. METHODS: Bone marrow aspirates from 30 children with a diagnosis of acute lymphoblastic leukemia were assessed for the expression of messenger RNA for the MDR-1, MRP and LRP genes by semi-quantitative RT-PCR. RESULTS: In the three groups studied, only the increased expression of LRP was related to worsened event-free survival (p = 0.005. The presence of the common acute lymphoblastic leukemia antigen (CALLA was correlated with increased LRP expression (p = 0.009 and increased risk of relapse or death (p = 0.05. The relative risk of relapse or death was six times higher among children with high LRP expression upon diagnosis (p = 0.05, as confirmed by multivariate analysis of the three genes studied (p = 0.035. DISCUSSION: Cell resistance to drugs is a determinant of the response to chemotherapy and its detection via RT-PCR may be of clinical importance. CONCLUSIONS: Evaluation of the expression of genes for resistance to antineoplastic drugs in childhood acute lymphoblastic leukemia upon diagnosis, and particularly the expression of the LRP gene, may be of clinical relevance, and should be the

  10. Association between C3435T polymorphism of MDR1 gene and the incidence of drug-resistant epilepsy in the population of Polish children.

    Science.gov (United States)

    Stasiołek, Mariusz; Romanowicz, Hanna; Połatyńska, Katarzyna; Chamielec, Maciej; Skalski, Dominik; Makowska, Marianna; Smolarz, Beata

    2016-07-08

    Epilepsy is a disease of neurological character. Approximately one third of epileptic patients demonstrate a drug-resistant phenotype, which is associated with the development of drug-resistant epilepsy. The multidrug resistance protein 1 and glycoprotein P, encoded by MDR1, play a significant role in the transmembrane transport of anti-epileptic agents. Single nucleotide polymorphism C3435T (rs1045642) within MDR1 gene may be associated with an increased expression of P-gp which affects the levels of antiepileptic drugs in plasma. The presented studies analysed the association between C3435T polymorphism of MDR1 gene and the incidence of drug-resistant epilepsy in the population of Polish children. C3435T polymorphism of MDR1 gene was analysed by the high resolution melting technique in a group of patients with drug-resistant (n = 106) and drug-responsive epilepsy (n = 67), as well as in non-epileptic children (n = 98) hospitalised at the Department of Neurology, Polish Mother's Memorial Hospital in Lodz. Genotype and allele distributions were evaluated and their compatibility with the Hardy-Weinberg distribution was assessed by means of the χ(2) test. Genotype and allele evaluation, regarding their relationship with a given feature, was supported by an analysis of odds ratio and 95 % confidence interval, calculated according to the logistic regression model. An association was observed between the incidence rate of DRE and the presence of C allele in C3435T polymorphism of MDR1 gene, which may enhance the risk of the disease. The T allele may then play a protective role. No differences were found in the studied groups, regarding either genotype or allele distribution in reference to patient's gender or concomitant diseases. Following the obtained results, C3435T polymorphism of MDR1 gene may be connected with the incidence of drug-resistant epilepsy in the population of Polish children. ISRCTN ISRCTN73824458. Registered 28th September 2014.

  11. Functional study of the novel multidrug resistance gene HA117 and its comparison to multidrug resistance gene 1

    Directory of Open Access Journals (Sweden)

    Chen Tingfu

    2010-07-01

    Full Text Available Abstract Background The novel gene HA117 is a multidrug resistance (MDR gene expressed by all-trans retinoic acid-resistant HL-60 cells. In the present study, we compared the multidrug resistance of the HA117 with that of the classical multidrug resistance gene 1 (MDR1 in breast cancer cell line 4T1. Methods Transduction of the breast cancer cell line 4T1 with adenoviral vectors encoding the HA117 gene and the green fluorescence protein gene (GFP (Ad-GFP-HA117, the MDR1 and GFP (Ad-GFP-MDR1 or GFP (Ad-GFP was respectively carried out. The transduction efficiency and the multiplicity of infection (MOI were detected by fluorescence microscope and flow cytometry. The transcription of HA117 gene and MDR1 gene were detected by reverse transcription polymerase chain reaction (RT-PCR. Western blotting analysis was used to detect the expression of P-glycoprotein (P-gp but the expression of HA117 could not be analyzed as it is a novel gene and its antibody has not yet been synthesized. The drug-excretion activity of HA117 and MDR1 were determined by daunorubicin (DNR efflux assay. The drug sensitivities of 4T1/HA117 and 4T1/MDR1 to chemotherapeutic agents were detected by Methyl-Thiazolyl-Tetrazolium (MTT assay. Results The transducted efficiency of Ad-GFP-HA117 and Ad-GFP-MDR1 were 75%-80% when MOI was equal to 50. The transduction of Ad-GFP-HA117 and Ad-GFP-MDR1 could increase the expression of HA117 and MDR1. The drug resistance index to Adriamycin (ADM, vincristine (VCR, paclitaxel (Taxol and bleomycin (BLM increased to19.8050, 9.0663, 9.7245, 3.5650 respectively for 4T1/HA117 and 24.2236, 11.0480, 11.3741, 0.9630 respectively for 4T1/MDR1 as compared to the control cells. There were no significant differences in drug sensitivity between 4T1/HA117 and 4T1/MDR1 for the P-gp substrates (ADM, VCR and Taxol (P Conclusions These results confirm that HA117 is a strong MDR gene in both HL-60 and 4T1 cells. Furthermore, our results indicate that the MDR

  12. Impact of BCRP/MXR, MRP1 and MDR1/P-Glycoprotein on thermoresistant variants of atypical and classical multidrug resistant cancer cells

    DEFF Research Database (Denmark)

    Stein, Ulrike; Lage, Hermann; Jordan, Andreas

    2002-01-01

    The impact of the ABC transporters breast cancer resistance protein/mitoxantrone resistance associated transporter (BCRP/MXR), multidrug resistance-associated protein 1 (MRP1) and multidrug resistance gene-1/P-glycoprotein (MDR1/PGP) on the multidrug resistance (MDR) phenotype in chemoresistance...... expression of BCRP/MXR and of MRP1 were clearly enhanced (vs. parental and classical MDR lines). MDR1/PGP expression was distinctly elevated in the classical MDR subline EPG85-257RDB (vs. parental and atypical MDR sublines). In all thermoresistant counterparts basal expression of BCRP/MXR, MRP1 and MDR1/PGP...... was increased relative to thermosensitive sublines. Although it could be shown that the overexpressed ABC transporters were functionally active, however, no decreased drug accumulations of doxorubicin, mitoxantrone and rhodamine 123 were observed. Thus, expression of BCRP/MXR, MRP1 and MDR1/PGP was found...

  13. Cholesterol-Containing Nuclease-Resistant siRNA Accumulates in Tumors in a Carrier-free Mode and Silences MDR1 Gene

    Directory of Open Access Journals (Sweden)

    Ivan V. Chernikov

    2017-03-01

    Full Text Available Chemical modifications are an effective way to improve the therapeutic properties of small interfering RNAs (siRNAs, making them more resistant to degradation in serum and ensuring their delivery to target cells and tissues. Here, we studied the carrier-free biodistribution and biological activity of a nuclease-resistant anti-MDR1 cholesterol-siRNA conjugate in healthy and tumor-bearing severe combined immune deficiency (SCID mice. The attachment of cholesterol to siRNA provided its efficient accumulation in the liver and in tumors, and reduced its retention in the kidneys after intravenous and intraperitoneal injection. The major part of cholesterol-siRNA after intramuscular and subcutaneous injections remained in the injection place. Confocal microscopy data demonstrated that cholesterol-siRNA spread deep in the tissue and was present in the cytoplasm of almost all the liver and tumor cells. The reduction of P-glycoprotein level in human KB-8-5 xenograft overexpressing the MDR1 gene by 60% was observed at days 5–6 after injection. Then, its initial level recovered by the eighth day. The data showed that, regardless of the mode of administration (intravenous, intraperitoneal, or peritumoral, cholesterol-siMDR efficiently reduced the P-glycoprotein level in tumors. The designed anti-MDR1 conjugate has potential as an adjuvant therapeutic for the reversal of multiple drug resistance of cancer cells.

  14. [Polymorphisms of the multiple drug resistance gene (MDR1) in Mapuche, Mestizo and Maori populations in Chile].

    Science.gov (United States)

    Wielandt, Ana María; Vollrath, Valeska; Chianale, José

    2004-09-01

    There are significant differences in drug responses among different ethnic groups. The multidrug transporter P-gp, encoded by the MDR1 gene, plays a key role in determining drug bioavailability, and an association between a polymorphism in exon 26 (C3435T) and lower P-gp expression has been found. The co-segregation of this polymorphism with the polymorphism in exon 12 (C1236T) and in exon 21 (G2677T/A) determines several MDR1 haplotypes in humans. To characterize the polymorphisms of exons 26, 21 and 12 of the MDR1 gene in different Chilean populations. Using a polymerase chain reaction and restriction fragment length polymorphism technique, we studied the allelic frequencies and the distribution of MDR1 haplotypes in 3 Chilean populations: Mestizo (n=104), Mapuche (n=96, living in the National Reservation of the Huapi Island, Ranico Lake) and Maori (n=52, living in Eastern Island). The frequency of the normal MDR1*1 haplotype, without mutations, was lower in Mapuches than in Mestizos or Maoris (p0.0.5), but lower than the frequencies reported in Caucasians or Asians (p<0.05). We found significant differences in the frequencies of genetic polymorphisms of the MDR1 gene in Chilean populations, related to the ethnic origins of our ancestors.

  15. Analysis of mdr1-1Δ mutation of MDR1 gene in the “Cimarron Uruguayo” dog

    Directory of Open Access Journals (Sweden)

    Rosa Gagliardi B.

    2013-08-01

    Full Text Available Objective. The aim of this paper is to analyze the frequency of the mdr1-1D mutation of the MDR1 gene in a dog sample of the Uruguayan Cimarron breed with the objective of increasing the knowledge of this breed’s genome. Materials and methods. Thirty-six animals of this breed were analyzed. The MDR1 gene region, which includes the location where the mutation would be present, was amplified by PCR. Results. The mutation was not detected in any of the analyzed Uruguayan Cimarron. Conclusions. The lack of described ivermectin intoxication cases in veterinary clinic in this breed is explained by the lack of the mutation object of this study. The sequence studied in Cimarron dogs is kept compared to other breeds, except Collies and related breeds (Border Collie, Bearded Collie, Old English sheepdog.

  16. Expression of multidrug resistance genes MVP, MDR1, and MRP1 determined sequentially before, during, and after hyperthermic isolated limb perfusion of soft tissue sarcoma and melanoma patients.

    Science.gov (United States)

    Stein, Ulrike; Jürchott, Karsten; Schläfke, Matthias; Hohenberger, Peter

    2002-08-01

    Isolated, hyperthermic limb perfusion (ILP) with recombinant human tumor necrosis factor alpha and melphalan is a highly effective treatment for advanced soft tissue sarcoma (STS) and locoregional metastatic malignant melanoma. Multidrug resistance (MDR)-associated genes are known to be inducible by heat and drugs; expression levels of the major vault protein (MVP), MDR1, and MDR-associated protein 1 (MRP1) were determined sequentially before, during, and after ILP of patients. Twenty-one STS or malignant melanoma patients were treated by ILP. Tumor tissue temperatures were recorded continuously and ranged from 33.4 degrees C initially to peak values of 40.4 degrees C during ILP. Serial true-cut biopsy specimens from tumor tissues were routinely microdissected. Expression analyses for MDR genes were performed by real-time reverse transcriptase polymerase chain reaction and immunohistochemistry. In 83% of the patients, MVP expression was induced during hyperthermic ILP. MVP-mRNA inductions often paralleled the increase in temperature during ILP. Increased MVP protein expressions either were observed simultaneously with the MVP-mRNA induction or were delayed until after the induction at the transcriptional level. Inductions of MDR1 and MRP1 were observed in only 13% and 27% of the specimens analyzed. Temperatures and drugs applied preferentially led to an induction of MVP and were not sufficient to induce MDR1 and MRP1 in the majority of tumors. This study is the first to analyze the expression of MDR-associated genes sequentially during ILP of patients and demonstrates that treatment might lead to increased levels of MVP, whereas enhanced levels of MDR1 and MRP1 remain rare events.

  17. JNK1/2 Activation by an Extract from the Roots of Morus alba L. Reduces the Viability of Multidrug-Resistant MCF-7/Dox Cells by Inhibiting YB-1-Dependent MDR1 Expression

    Directory of Open Access Journals (Sweden)

    Youn Kyung Choi

    2013-01-01

    Full Text Available Cancer cells acquire anticancer drug resistance during chemotherapy, which aggravates cancer disease. MDR1 encoded from multidrug resistance gene 1 mainly causes multidrug resistance phenotypes of different cancer cells. In this study, we demonstrate that JNK1/2 activation by an extract from the root of Morus alba L. (White mulberry reduces doxorubicin-resistant MCF-7/Dox cell viability by inhibiting YB-1 regulation of MDR1 gene expression. When MCF-7 or MCF-7/Dox cells, where MDR1 is highly expressed were treated with an extract from roots or leaves of Morus alba L., respectively, the root extract from the mulberry (REM but not the leaf extract (LEM reduced cell viabilities of both MCF-7 and MCF-7/Dox cells, which was enhanced by cotreatment with doxorubicin. REM but not LEM further inhibited YB-1 nuclear translocation and its regulation of MDR1 gene expression. Moreover, REM promoted phosphorylation of c-Jun NH2-terminal kinase 1/2 (JNK1/2 and JNK1/2 inhibitor, SP600125 and rescued REM inhibition of both MDR1 expression and viabilities in MCF-7/Dox cells. Consistently, overexpression of JNK1, c-Jun, or c-Fos inhibited YB-1-dependent MDR1 expression and reduced viabilities in MCF-7/Dox cells. In conclusion, our data indicate that REM-activated JNK-cJun/c-Fos pathway decreases the viability of MCF-7/Dox cells by inhibiting YB-1-dependent MDR1 gene expression. Thus, we suggest that REM may be useful for treating multidrug-resistant cancer cells.

  18. Personalized Medicine Digoxin Theraphy in Individuals with MDR Gene Polymorphism

    Directory of Open Access Journals (Sweden)

    Em Sutrisna

    2015-06-01

    Full Text Available Digoxin is one of digitalis drugs. Wider applicability to heart failure and arrhythmias (supraventricular requires fairly strict scrutiny because of its narrow therapeutic index. Digoxin is a substrate of P-glycoprotein (P-gp encoded by multi drugs resistance-1 (MDR1. MDR-1 gen located on chromosome 7q21.1. This gene contains 28 exons that encoded a protein of 1280 amino acids. This gene plays an important role in the absorption, distribution and elimination of many drugs. MDR1C3435T polymorphism occurs in exon 26. There are three types of MDR1C3435T gene namely MDR1C3435T CC, MDR1C3435T CT and MDR1C3435T TT. These polymorphisms will affect to the formation of P-gp and consequently to change the kinetic profile of digoxin. The change of kinetic profile causes changes in the digoxin blood levels. The method used in this review is data search based on pubmed, medline, and embase with keywords MDR and digoxin. There are several different studies of the influence of polymorphisms MDR1C3435T on blood digoxin levels. Increased levels of digoxin in the blood due to polymorphism of MDR1C3435T will be at risk of digitalis intoxication. Long-term digoxin treatment or large dose should consider the patient’s genetic profile. Distribution of polymorphism of MDR1C3435T in Javanese population is approximately TT (0,10, CT (0,52, and CC(0, 38.

  19. Significance of MDR1 and multiple drug resistance in refractory human epileptic brain

    Directory of Open Access Journals (Sweden)

    Dini Gabriele

    2004-10-01

    Full Text Available Abstract Background The multiple drug resistance protein (MDR1/P-glycoprotein is overexpressed in glia and blood-brain barrier (BBB endothelium in drug refractory human epileptic tissue. Since various antiepileptic drugs (AEDs can act as substrates for MDR1, the enhanced expression/function of this protein may increase their active extrusion from the brain, resulting in decreased responsiveness to AEDs. Methods Human drug resistant epileptic brain tissues were collected after surgical resection. Astrocyte cell cultures were established from these tissues, and commercially available normal human astrocytes were used as controls. Uptake of fluorescent doxorubicin and radioactive-labeled Phenytoin was measured in the two cell populations, and the effect of MDR1 blockers was evaluated. Frozen human epileptic brain tissue slices were double immunostained to locate MDR1 in neurons and glia. Other slices were exposed to toxic concentrations of Phenytoin to study cell viability in the presence or absence of a specific MDR1 blocker. Results MDR1 was overexpressed in blood vessels, astrocytes and neurons in human epileptic drug-resistant brain. In addition, MDR1-mediated cellular drug extrusion was increased in human 'epileptic' astrocytes compared to 'normal' ones. Concomitantly, cell viability in the presence of cytotoxic compounds was increased. Conclusions Overexpression of MDR1 in different cell types in drug-resistant epileptic human brain leads to functional alterations, not all of which are linked to drug pharmacokinetics. In particular, the modulation of glioneuronal MDR1 function in epileptic brain in the presence of toxic concentrations of xenobiotics may constitute a novel cytoprotective mechanism.

  20. EXSPRESSION OF MDR-GENES AND MONORESISTANCE GENES IN NON-SMALL-CELL LUNG CANCER

    Directory of Open Access Journals (Sweden)

    E. L. Yumov

    2014-01-01

    Full Text Available We studied the expression of multidrug resistance genes (MDR and monoresistance genes in normal bronchial tissue and tumor tissue of the non-small cell lung cancer (NSCLC after neoadjuvant chemotherapy (NACT (vinorelbine-carboplatine. The study included 30 patients with NSCLC (Т2–4N0–3M0. Normal bronchial tissue, normal lung tissue and tumor tissue collected during surgery following neoadjuvant chemotherapy (NACT served as a material of the study. The expression levels of MDR genes (ABCB1, ABCB2, ABCC1, ABCC2, ABCС5, ABCG1, ABCG2, GSTP and MVP, and monoresistance genes (BRCA1, ERCC1, RRM1, TOP1, TOP2A, TUBB3 and TYMS were estimated by quantitative reverse transcriptase PCR (RT-qPCR. The expression levels of some MDR genes and monoresistance genes (АВСВ1, АВСВ2, ABCG1, ERCC1, GSTP1 and MVP were significantly higher in the bronchi than in tumor tissue. The expression of ABCG1, ABCG2 and ERCC1 genes was higher in patients with T1-2 cancer than in patients with T3-4 cancer. Patients with adenocarcinoma had higher expression of BRCA1, MVP and ABCB1 genes than patients with squamous cell lung cancer. A tendency towards reduction in the expression level of MDR-genes and monoresistance genes was observed in patients with partial tumor regression compared to that observed in patients with stable disease. These findings were consistent with the previous data on reduction in the MDR-gene expression after chemotherapy with a good response in breast cancer patients.

  1. Expression of the MDR1 gene and P-glycoprotein in canine mast cell tumor cell lines

    OpenAIRE

    NAKAICHI, Munekazu; TAKESHITA, Yoko; OKUDA, Masaru; NAKAMOTO, Yuya; ITAMOTO, Kazuhito; UNE, Satoshi; SASAKI, Nobuo; KADOSAWA, Tsuyoshi; TAKAHASHI, Tomoko; TAURA, Yasuho

    2007-01-01

    Cellular drug resistance to antineoplastic drugs is often due to the presence of a drug efflux pump that reduces intracellular drug accumulation and chemosensitivity. P-glycoprotein (P-gp), which is encoded by the MDR1 gene, is considered to function as an ATP-driven membrane drug efflux pump and appears to play an important role in tumor cell resistance. In the present report, we assessed the expression of MDR1 by RT-PCR in three canine mast cell tumor cell lines, TiMC, CoMS and LuMC, origin...

  2. Normal viability and altered pharmacokinetics in mice lacking mdr1-type (drug-transporting) P-glycoproteins

    NARCIS (Netherlands)

    Schinkel, A. H.; Mayer, U.; Wagenaar, E.; Mol, C. A.; van Deemter, L.; Smit, J. J.; van der Valk, M. A.; Voordouw, A. C.; Spits, H.; van Tellingen, O.; Zijlmans, J. M.; Fibbe, W. E.; Borst, P.

    1997-01-01

    The mdr1-type P-glycoproteins (P-gps) confer multidrug resistance to cancer cells by active extrusion of a wide range of drugs from the cell. To study their physiological roles, we have generated mice genetically deficient in the mdr1b gene [mdr1b (-/-) mice] and in both the mdr1a and mdr1b genes

  3. Prognostic significance of multidrug-resistance protein (MDR-1 in renal clear cell carcinomas: A five year follow-up analysis

    Directory of Open Access Journals (Sweden)

    Strazzullo Viviana

    2006-12-01

    Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader

  4. Candida albicans Swi/Snf and Mediator Complexes Differentially Regulate Mrr1-Induced MDR1 Expression and Fluconazole Resistance.

    Science.gov (United States)

    Liu, Zhongle; Myers, Lawrence C

    2017-11-01

    Long-term azole treatment of patients with chronic Candida albicans infections can lead to drug resistance. Gain-of-function (GOF) mutations in the transcription factor Mrr1 and the consequent transcriptional activation of MDR1 , a drug efflux coding gene, is a common pathway by which this human fungal pathogen acquires fluconazole resistance. This work elucidates the previously unknown downstream transcription mechanisms utilized by hyperactive Mrr1. We identified the Swi/Snf chromatin remodeling complex as a key coactivator for Mrr1, which is required to maintain basal and induced open chromatin, and Mrr1 occupancy, at the MDR1 promoter. Deletion of snf2 , the catalytic subunit of Swi/Snf, largely abrogates the increases in MDR1 expression and fluconazole MIC observed in MRR1 GOF mutant strains. Mediator positively and negatively regulates key Mrr1 target promoters. Deletion of the Mediator tail module med3 subunit reduces, but does not eliminate, the increased MDR1 expression and fluconazole MIC conferred by MRR1 GOF mutations. Eliminating the kinase activity of the Mediator Ssn3 subunit suppresses the decreased MDR1 expression and fluconazole MIC of the snf2 null mutation in MRR1 GOF strains. Ssn3 deletion also suppresses MDR1 promoter histone displacement defects in snf2 null mutants. The combination of this work with studies on other hyperactive zinc cluster transcription factors that confer azole resistance in fungal pathogens reveals a complex picture where the induction of drug efflux pump expression requires the coordination of multiple coactivators. The observed variations in transcription factor and target promoter dependence of this process may make the search for azole sensitivity-restoring small molecules more complicated. Copyright © 2017 American Society for Microbiology.

  5. The search for the mdr1-1Δ mutation of the MDR1 gene in four canine breeds in Uruguay (preliminary study

    Directory of Open Access Journals (Sweden)

    Rosa Gagliardi B.

    2015-01-01

    Full Text Available Objective. The objective of this study is to analyze the frequency of mdr1-1Δ mutation in German Shepherd, Doberman, Border Collie and Greyhound dog breeds in Uruguay. Materials and methods. A total of 95 animals from the four breeds mentioned above were studied. DNA was isolated from blood using potassium acetate with a subsequent degradation from RNA with RNAsaH. The concentration and quality of the DNA obtained was evaluated with a Nanodrop, ND-1000 spectrophotometer. To determine the presence or absence of the mdr1-1Δ mutation, DNA samples were sent to Gene Seek, Neogen Corporation of Chicago, United States, for genotyping. Results. In all 95 animals studied, the mdr1-1Δ mutation was not present. Conclusions. Based on the preliminary results obtained, other elements that may cause adverse drug reactions must be considered: unidentified mutations in other regions of the MDR1 gene; mutations in other genes involved in the transport of drugs from the same subfamily or another; mutations in enzymes involved in drug metabolism (e.g. Cytochrome P450. Moreover, especially with Border Collies and Greyhounds, it is advisable to increase the number of animals in the study.

  6. Role of hypoxia-inducible factor-α in hepatitis-B-virus X protein-mediated MDR1 activation

    International Nuclear Information System (INIS)

    Han, Hyo-Kyung; Han, Chang Yeob; Cheon, Eun-Pa; Lee, Jaewon; Kang, Keon Wook

    2007-01-01

    The transition from chemotherapy-responsive cancer cells to chemotherapy-resistant cancer cells is mainly accompanied by the increased expression of multi-drug resistance 1 (MDR1). We found that hepatitis-B-virus X protein (HBx) increases the transcriptional activity and protein level of MDR1 in a hepatoma cell line, H4IIE. In addition, HBx overexpression made H4IIE cells more resistant to verapamil-uptake. HBx stabilized hypoxia-inducible factor-1α (HIF-1α) and induced the nuclear translocation of C/EBPβ. Reporter gene analyses showed that HBx increased the reporter activity in the cells transfected with the reporter containing MDR1 gene promoter. Moreover, the luciferase reporter gene activity was significantly inhibited by HIF-1α siRNA but not by overexpression of C/EBP dominant negative mutant. These results imply that HBx increases the MDR1 transporter activity through the transcriptional activation of the MDR1 gene with HIF-1α activation, and suggest HIF-1α for the therapeutic target of HBV-mediated chemoresistance

  7. Association between MDR1 gene polymorphisms and the risk of Crohn's disease in a cohort of Algerian pediatric patients.

    Science.gov (United States)

    Bouzidi, Amira; Mesbah-Amroun, Hamida; Boukercha, Aziza; Benhassine, Fadila; Belboueb, Réda; Berkouk, Karima; Messadi, Wassila; Touil-Boukoffa, Chafia

    2016-12-01

    The multi-drug resistance gene (MDR1) has raised increasing interest as a susceptibility gene for Crohn's disease (CD). The role of MDR1 single-nucleotide polymorphisms (SNPs) in the predisposition and behavior of CD in the pediatric population is still elusive. Here, we investigated whether SNPs in MDR1 are associated with CD in Algerian pediatric patients. A case-control study was conducted enrolling 47 pediatric CD patients and 100 controls. All subjects were genotyped for the most common MDR1 SNPs (C3434T, C1236T, and G2677A/T) using PCR-RFLP method. We also explored the association between polymorphisms and clinical sub-phenotypes. We have detected no significant association of C3435T SNP and pediatric CD. However, we observed a significantly higher frequency of the risk alleles, 1236T and 2677T/A among the CD patients compared to controls. Moreover, the risk allele 1236T was associated to a higher risk for resective surgery. Our data suggest that the C1236T and G2677A/T SNPs in the MDR1 gene are associated with CD and the C1236T risk allele with a more severe course of disease in Algerian pediatric patients. Further analysis using larger patients group and functional studies would be interesting to elucidate the role of MDR1 gene in pediatric CD.Pediatric Research (2016); doi:10.1038/pr.2016.163.

  8. MDR1 siRNA loaded hyaluronic acid-based CD44 targeted nanoparticle systems circumvent paclitaxel resistance in ovarian cancer

    Science.gov (United States)

    Yang, Xiaoqian; Lyer, Arun K.; Singh, Amit; Choy, Edwin; Hornicek, Francis J.; Amiji, Mansoor M.; Duan, Zhenfeng

    2015-02-01

    Development of multidrug resistance (MDR) is an almost universal phenomenon in patients with ovarian cancer, and this severely limits the ultimate success of chemotherapy in the clinic. Overexpression of the MDR1 gene and corresponding P-glycoprotein (Pgp) is one of the best known MDR mechanisms. MDR1 siRNA based strategies were proposed to circumvent MDR, however, systemic, safe, and effective targeted delivery is still a major challenge. Cluster of differentiation 44 (CD44) targeted hyaluronic acid (HA) based nanoparticle has been shown to successfully deliver chemotherapy agents or siRNAs into tumor cells. The goal of this study is to evaluate the ability of HA-PEI/HA-PEG to deliver MDR1 siRNA and the efficacy of the combination of HA-PEI/HA-PEG/MDR1 siRNA with paclitaxel to suppress growth of ovarian cancer. We observed that HA-PEI/HA-PEG nanoparticles can efficiently deliver MDR1 siRNA into MDR ovarian cancer cells, resulting in down-regulation of MDR1 and Pgp expression. Administration of HA-PEI/HA-PEG/MDR1 siRNA nanoparticles followed by paclitaxel treatment induced a significant inhibitory effect on the tumor growth, decreased Pgp expression and increased apoptosis in MDR ovarian cancer mice model. Our findings suggest that CD44 targeted HA-PEI/HA-PEG/MDR1 siRNA nanoparticles can serve as a therapeutic tool with great potentials to circumvent MDR in ovarian cancer.

  9. Inhibition of ABCB1 (MDR1 expression by an siRNA nanoparticulate delivery system to overcome drug resistance in osteosarcoma.

    Directory of Open Access Journals (Sweden)

    Michiro Susa

    2010-05-01

    Full Text Available The use of neo-adjuvant chemotherapy in treating osteosarcoma has improved patients' average 5 year survival rate from 20% to 70% in the past 30 years. However, for patients who progress after chemotherapy, its effectiveness diminishes due to the emergence of multi-drug resistance (MDR after prolonged therapy.In order to overcome both the dose-limiting side effects of conventional chemotherapeutic agents and the therapeutic failure resulting from MDR, we designed and evaluated a novel drug delivery system for MDR1 siRNA delivery. Novel biocompatible, lipid-modified dextran-based polymeric nanoparticles were used as the platform for MDR1 siRNA delivery; and the efficacy of combination therapy with this system was evaluated. In this study, multi-drug resistant osteosarcoma cell lines (KHOS(R2 and U-2OS(R2 were treated with the MDR1 siRNA nanocarriers and MDR1 protein (P-gp expression, drug retention, and immunofluoresence were analyzed. Combination therapy of the MDR1 siRNA loaded nanocarriers with increasing concentrations of doxorubicin was also analyzed. We observed that MDR1 siRNA loaded dextran nanoparticles efficiently suppresses P-gp expression in the drug resistant osteosarcoma cell lines. The results also demonstrated that this approach may be capable of reversing drug resistance by increasing the amount of drug accumulation in MDR cell lines.Lipid-modified dextran-based polymeric nanoparticles are a promising platform for siRNA delivery. Nanocarriers loaded with MDR1 siRNA are a potential treatment strategy for reversing MDR in osteosarcoma.

  10. Carcinogen-induced mdr overexpression is associated with xenobiotic resistance in rat preneoplastic liver nodules and hepatocellular carcinomas.

    Science.gov (United States)

    Fairchild, C R; Ivy, S P; Rushmore, T; Lee, G; Koo, P; Goldsmith, M E; Myers, C E; Farber, E; Cowan, K H

    1987-11-01

    We have previously reported the isolation of a human breast cancer cell line resistant to doxorubicin (adriamycin; AdrR MCF-7 cells) that has also developed the phenotype of multidrug resistance (MDR). MDR in this cell line is associated with increased expression of mdr (P glycoprotein) gene sequences. The development of MDR in AdrR MCF-7 cells is also associated with changes in the expression of several phase I and phase II drug-detoxifying enzymes. These changes are remarkably similar to those associated with development of xenobiotic resistance in rat hyperplastic liver nodules, a well-studied model system of chemical carcinogenesis. Using an mdr-encoded cDNA sequence isolated from AdrR MCF-7 cells, we have examined the expression of mdr sequences in rat livers under a variety of experimental conditions. The expression of mdr increased 3-fold in regenerating liver. It was also elevated (3- to 12-fold) in several different samples of rat hyperplastic nodules and in four of five hepatomas that developed in this system. This suggests that overexpression of mdr, a gene previously associated with resistance to antineoplastic agents, may also be involved in the development of resistance to xenobiotics in rat hyperplastic nodules. In addition, although the acute administration of 2-acetylaminofluorene induced an 8-fold increase in hepatic mdr-encoded RNA, performance of a partial hepatectomy either before or after administration of 2-acetylaminofluorene resulted in a greater than 80-fold increase in mdr gene expression over that in normal untreated livers. This represents an important in vivo model system in which to study the acute regulation of this drug resistance gene.

  11. SNP genetic polymorphisms of MDR-1, CYP1A2 and CYPB11 genes in four canine breeds upon toxicological evaluation.

    Science.gov (United States)

    Gagliardi, Rosa; Llambí, Silvia; Arruga, M Victoria

    2015-01-01

    The fields of pharmacogenetics and pharmacogenomics have become increasingly promising regarding the clinical application of genetic data to aid in prevention of adverse reactions. Specific screening tests can predict which animals express modified proteins or genetic sequences responsible for adverse effects associated with a drug. Among the genetic variations that have been investigated in dogs, the multidrug resistance gene (MDR) is the best studied. However, other genes such as CYP1A2 and CYP2B11 control the protein syntheses involved in the metabolism of many drugs. In the present study, the MDR-1, CYP1A2 and CYP2B11 genes were examined to identify SNP polymorphisms associated with these genes in the following four canine breeds: Uruguayan Cimarron, Border Collie, Labrador Retriever and German Shepherd. The results revealed that several SNPs of the CYP1A2 and CYP2B11 genes are potential targets for drug sensitivity investigations.

  12. Expression of multi-drug resistance-related genes MDR3 and MRP as prognostic factors in clinical liver cancer patients.

    Science.gov (United States)

    Yu, Zheng; Peng, Sun; Hong-Ming, Pan; Kai-Feng, Wang

    2012-01-01

    To investigate the expression of multi-drug resistance-related genes, MDR3 and MRP, in clinical specimens of primary liver cancer and their potential as prognostic factors in liver cancer patients. A total of 26 patients with primary liver cancer were enrolled. The expression of MDR3 and MRP genes was measured by real-time PCR and the association between gene expression and the prognosis of patients was analyzed by the Kaplan-Meier method and COX regression model. This study showed that increases in MDR3 gene expression were identified in cholangiocellular carcinoma, cirrhosis and HBsAg-positive patients, while MRP expression increased in hepatocellular carcinoma, non-cirrhosis and HBsAg-negative patients. Moreover, conjugated bilirubin and total bile acid in the serum were significantly reduced in patients with high MRP expression compared to patients with low expression. The overall survival tended to be longer in patients with high MDR3 and MRP expression compared to the control group. MRP might be an independent prognostic factor in patients with liver cancer by COX regression analysis. MDR3 and MRP may play important roles in liver cancer patients as prognostic factors and their underlying mechanisms in liver cancer are worthy of further investigation.

  13. Molecular detection of multi drug resistant tuberculosis (mdr-tb) in mdr-tb patients' attendant in north western pakistan

    International Nuclear Information System (INIS)

    Shah, T.; Hayat, A.; Shah, Z.; Hayat, A.; Khan, S.B.

    2017-01-01

    Objective: To determine the drugs susceptibility pattern of mycobacterium tuberculosis (M.TB) in multi-drug resistant tuberculosis (MDR-TB) patients' attendants in North Western, Pakistan. Study Design: Cross sectional study. Place and Duration of Study: This study was conducted at Peshawar Tuberculosis Research Laboratory (PTRL), Provincial TB Control Program Hayatabad Medical Complex Peshawar, (KP) from August 2013 to March 2014. Material and Methods: A cross sectional study in which four hundred and eighty sputum samples from MDR-TB patients' attendants were processed for the detection of M.TB through Ziehl-Neelsen staining, Lowenstein-Jensen, BACTEC MGIT-960 culture and line probe assay. Results: Out of 480 samples, 06 (2.1%) were found positive for M.TB through Ziehl-Neelsen staining while 10 (2.8%) were positive through LJ and BACTEC MGIT-960 culture. The 10 positive samples were further subjected to drugs susceptibility testing and line probes assay test to find out rifampicin, isoniazid, streptomycin and ethambutol resistant and it was found that 6 M.TB isolates were resistant while 4 were sensitive to rifampicin and isoniazid. Among the 6 resistant M.TB strains, 4 showed mutation in rpoB gene at 531, 516 and 526 codons. Conclusion: Majority of MDR-TB patients' attendants had drug-resistant tuberculosis and the rate of drug susceptible TB was low. (author)

  14. Treatment Outcomes of Patients with Multidrug-Resistant Tuberculosis (MDR- TB) Compared with Non-MDR-TB Infections in Peninsular Malaysia.

    Science.gov (United States)

    Elmi, Omar Salad; Hasan, Habsah; Abdullah, Sarimah; Mat Jeab, Mat Zuki; Ba, Zilfalil; Naing, Nyi Nyi

    2016-07-01

    Treating patients with multidrug-resistant tuberculosis (MDR-TB) strains is more complicated, complex, toxic, expensive, than treating patients with susceptible TB strains. This study aims to compare the treatment outcomes and potential factors associated between patients with MDR-TB and non MDR TB infections in peninsular Malaysia. This study was a retrospective cohort study. Data were collected from the medical records of all registered MDR-TB patients and Non-MDR-TB patients at five TB hospitals in peninsular Malaysia from January 2010 to January 2014. A total of 314 subjects were studied, including 105 MDR-TB cases and 209 non-MDR-TB. After TB treatment, 24.8% of the MDR-TB patients and 17.7% of non MDR TB relapsed; 17.1% of the MDR-TB patients and 16.3% of non MDR TB defaulted from TB treatment. A significant difference seen in treatment success rate 17.1% for MDR-TB; 63.1% for non MDR TB (P history of TB treatment, and presence of HIV infection.

  15. Expression of multidrug resistance markers ABCB1 (MDR-1/P-gp) and ABCC1 (MRP-1) in renal cell carcinoma.

    LENUS (Irish Health Repository)

    Walsh, Naomi

    2009-01-01

    BACKGROUND: Renal cell carcinoma patients respond poorly to conventional chemotherapy, this unresponsiveness may be attributable to multidrug resistance (MDR). The mechanisms of MDR in renal cancer are not fully understood and the specific contribution of ABC transporter proteins which have been implicated in the chemoresistance of various cancers has not been fully defined in this disease. METHODS: In this retrospective study the expression of two of these transporter efflux pumps, namely MDR-1 P-gp (ABCB1) and MRP-1 (ABCC1) were studied by immunohistochemistry in archival material from 95 renal cell carcinoma patients. RESULTS: In the first study investigating MDR-1 P-gp and MRP-1 protein expression patterns in renal cell carcinoma patients, high levels of expression of both efflux pumps are observed with 100% of tumours studied showing MDR-1 P-gp and MRP-1 positivity. CONCLUSION: Although these findings do not prove a causal role, the high frequency of tumours expressing these efflux pumps suggests that they may be important contributors to the chemoresistance of this tumour type.

  16. High Frequency of a Single Nucleotide Substitution (c.-6-180T>G) of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

    OpenAIRE

    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

    2013-01-01

    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type...

  17. The multidrug resistance 1 (MDR1) gene polymorphism G-rs3789243-A is not associated with disease susceptibility in Norwegian patients with colorectal adenoma and colorectal cancer; a case control study

    DEFF Research Database (Denmark)

    Andersen, V.; Agerstjerne, L.; Jensen, D.

    2009-01-01

    Background: Smoking, dietary factors, and alcohol consumption are known life style factors contributing to gastrointestinal carcinogenesis. Genetic variations in carcinogen handling may affect cancer risk. The multidrug resistance 1(MDR1/ABCB1) gene encodes the transport protein P-glycoprotein (a...... in inflammation, and may thereby affect the risk of malignity. Hence, genetic variations that modify the function of P-glycoprotein may be associated with the risk of colorectal cancer (CRC). We have previously found an association between the MDR1 intron 3 G-rs3789243-A polymorphism and the risk of CRC...... of colorectal carcinomas and adenomas in the Norwegian population was assessed in 167 carcinomas, 990 adenomas, and 400 controls. Genotypes were determined by allelic discrimination. Odds ratio (OR) and 95 confidence interval (95% CI) were estimated by binary logistic regression. Results: No association...

  18. MDR1 haplotypes conferring an increased expression of intestinal CYP3A4 rather than MDR1 in female living-donor liver transplant patients.

    Science.gov (United States)

    Hosohata, Keiko; Masuda, Satohiro; Yonezawa, Atsushi; Katsura, Toshiya; Oike, Fumitaka; Ogura, Yasuhiro; Takada, Yasutsugu; Egawa, Hiroto; Uemoto, Shinji; Inui, Ken-Ichi

    2009-07-01

    This study investigated whether haplotypes in the multidrug resistance 1 (MDR1) gene had effects on mRNA expression levels of MDR1 and cytochrome P450 (CYP) 3A4, and on the pharmacokinetics of tacrolimus in living-donor liver transplant (LDLT) patients, considering the gender difference. Haplotype analysis of MDR1 with G2677T/A and C3435T was performed in 63 de novo Japanese LDLT patients (17 to 55 years; 44.4% women). The expression levels of MDR1 and CYP3A4 mRNAs in jejunal biopsy specimens were quantified by real-time PCR. Intestinal CYP3A4 mRNA expression levels (amol/microg total RNA) showed significantly higher values in women carrying the 2677TT-3435TT haplotype (median, 10.7; range, 5.92-15.2) than those with 2677GG-3435CC (3.03; range 1.38-4.68) and 2677GT-3435CT (median, 4.31; range, 0.07-9.42) (P = 0.022), but not in men (P = 0.81). However, MDR1 haplotype did not influence mRNA expression levels of MDR1 nor the concentration/dose ratio [(ng/mL)/(mg/day)] of oral tacrolimus for the postoperative 7 days, irrespective of gender. MDR1 haplotype may have a minor association with the tacrolimus pharmacokinetics after LDLT, but could be a good predictor of the inter-individual variation of intestinal expression of CYP3A4 in women.

  19. High prevalence of the PER-1 gene among carbapenem-resistant Acinetobacter baumannii in Riyadh, Saudi Arabia.

    Science.gov (United States)

    Aly, M M; Abu Alsoud, N M; Elrobh, M S; Al Johani, S M; Balkhy, H H

    2016-11-01

    The prevalence of carbapenem-resistant Acinetobacter baumannii in Saudi Arabia and their resistance genetic mechanisms are yet to be identified. We studied the prevalence and genetic diversity of extended-spectrum beta-lactamase genes, particularly the PER-1 gene, among carbapenem-resistant A. baumannii strains from patients at a tertiary care hospital in Riyadh, Saudi Arabia between 2006 and 2014. Fresh subcultured samples were tested for antimicrobial susceptibility minimum inhibitory concentration (MIC). Total genomic DNA was extracted from each isolate and further used for polymerase chain reaction (PCR) genotyping, sequence-based typing (SBT) of PER-1 and OXA-51-like gene, and multilocus sequence typing (MLST) of positive isolates. Randomly selected clinical isolates (n = 100) were subjected to MLST. A total of 503 isolates were characterized as multidrug-resistant (MDR) using the MIC. Isolates were further PCR tested for bla -TEM and bla -PER-1 resistance genes (n = 503). The genotyping results showed that 68/503 (14 %) isolates were positive to bla TEM. The genotyping results of PER-1-like genes showed that 384/503 (76.3 %) were positive among MDR Acinetobacter isolates. Based on SBT, the majority of these isolates were clustered into three main groups including isolates harboring PER-1: AB11 (bla -PER-1 ), isolate AB16 (bla -PER-1 ), and, finally, the plasmid pAB154 (bla -PER-7 ). Remarkably, many isolates were concealing the PER-1 gene and harboring the TEM resistance genes as well. MLST results for selected isolates (n = 100) identified four main sequence types (STs: 2, 19, 20, and 25) and four novel isolates (ST 486-489). We report 76.3 % prevalence of the PER-1 resistance gene among Acinetobacter clinical isolates from Riyadh, Saudi Arabia. Further work is needed to explore the clinical risks and patient outcome with such resistance related to healthcare-associated infections and investigate the genetic and molecular mechanisms that confer the MDR

  20. Amplification of genome sections in mammalian somatic cells resistant to colchicine. VII. Localization of original and amplified copes of the mdr gene in the same segment of chromosome 4 of the Dzungarian hamster

    International Nuclear Information System (INIS)

    Sokova, O.I.; Siyanova, E.Yu.; Gudkov, A.V.; Kopnin, B.P.

    1988-01-01

    Using in situ hybridization, the mdr gene was mapped in chromosomes of Dzungarian hamster embryonic cells, amplification of which accompanies development of multidrug resistance (MDR). It was shown that the mdr gene is located in chromosome segment 4q15-21, in which, according to data obtained previously, amplified copes of open quotes MDR genes close quotes (mdr, et al.) are distributed, as a rule. Results obtained, as well as data of other investigators, attest to the fact that integration recombination of amplified copies of DNA occurs primarily at the site of disposition of homologous sequences

  1. Effect of the mutation (C3435T) at exon 26 of the MDR1 gene on expression level of MDR1 messenger ribonucleic acid in duodenal enterocytes of healthy Japanese subjects.

    Science.gov (United States)

    Nakamura, Tsutomu; Sakaeda, Toshiyuki; Horinouchi, Masanori; Tamura, Takao; Aoyama, Nobuo; Shirakawa, Toshiro; Matsuo, Masafumi; Kasuga, Masato; Okumura, Katsuhiko

    2002-04-01

    The effect of the C3435T mutation at exon 26 of the MDR1 gene on the expression levels of MDR1 messenger ribonucleic acid (mRNA) was evaluated by means of real-time polymerase chain reaction in 51 biopsy specimens of duodenum obtained from 13 healthy Japanese subjects. The mRNA levels of MDR1 were 0.38 +/- 0.15, 0.56 +/- 0.14, and 1.13 +/- 0.42 (mean value +/- SE) in the subjects with the homozygote of wild-type allele (C/C), compound heterozygote with mutant T allele (C/T), and the homozygote of the mutant allele (T/T), respectively, reasonably explaining the lower digoxin serum concentration after administration of a single oral dose to subjects harboring a mutant T allele. Good correlation (r =.797; P CYP3A4 in the individual biopsy specimens. This finding suggested a lower plasma concentration of the substrates for CYP3A4 in subjects harboring the C3435T mutation of the MDR1 gene.

  2. Reversing multidrug resistance in Caco-2 by silencing MDR1, MRP1, MRP2, and BCL-2/BCL-xL using liposomal antisense oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Yu-Li Lo

    Full Text Available Multidrug resistance (MDR is a major impediment to chemotherapy. In the present study, we designed antisense oligonucleotides (ASOs against MDR1, MDR-associated protein (MRP1, MRP2, and/or BCL-2/BCL-xL to reverse MDR transporters and induce apoptosis, respectively. The cationic liposomes (100 nm composed of N-[1-(2,3-dioleyloxypropyl]-n,n,n-trimethylammonium chloride and dioleoyl phosphotidylethanolamine core surrounded by a polyethylene glycol (PEG shell were prepared to carry ASOs and/or epirubicin, an antineoplastic agent. We aimed to simultaneously suppress efflux pumps, provoke apoptosis, and enhance the chemosensitivity of human colon adenocarcinoma Caco-2 cells to epirubicin. We evaluated encapsulation efficiency, particle size, cytotoxicity, intracellular accumulation, mRNA levels, cell cycle distribution, and caspase activity of these formulations. We found that PEGylated liposomal ASOs significantly reduced Caco-2 cell viability and thus intensified epirubicin-mediated apoptosis. These formulations also decreased the MDR1 promoter activity levels and enhanced the intracellular retention of epirubicin in Caco-2 cells. Epirubicin and ASOs in PEGylated liposomes remarkably decreased mRNA expression levels of human MDR1, MRP1, MRP2, and BCL-2. The combined treatments all significantly increased the mRNA expressions of p53 and BAX, and activity levels of caspase-3, -8, and -9. The formulation of epirubicin and ASOs targeting both pump resistance of MDR1, MRP1, and MRP2 and nonpump resistance of BCL-2/BCL-xL demonstrated more superior effect to all the other formulations used in this study. Our results provide a novel insight into the mechanisms by which PEGylated liposomal ASOs against both resistance types act as activators to epirubicin-induced apoptosis through suppressing MDR1, MRP1, and MRP2, as well as triggering intrinsic mitochondrial and extrinsic death receptor pathways. The complicated regulation of MDR highlights the necessity

  3. Multi-drug resistance (MDR1 gene and P-glycoprotein influence on pharmacokinetic and pharmacodymanic of therapeutic drugs

    Directory of Open Access Journals (Sweden)

    Linardi Renata Lehn

    2006-01-01

    Full Text Available (MDR1 gene expressed in tumor cells and also in several normal tissues, such as intestine, liver, kidney, blood-brain barrier, spinal cord, and placenta. P-gp has been identified in mice, rat, bovine, monkey, rodents, and human beings and has been receiving a particular clinical relevance because this protein expression limits brain access and intestinal absorption of many drugs. This protein plays a role as a protective barrier against a wide variety of substrates, avoiding drug entry into the central nervous system. P-glycoprotein also interferes with drug bioavailability and disposition, including absorption, distribution, metabolization, and excretion, influencing pharmacokinetic and pharmacodynamic of drugs. Modulation of P-gp may help the efficacy of treatment of several diseases and can explain some adverse central nervous system effects induced by drugs after intravenous administration and the poor response of oral administration in patients. Alteration in P-gp expression or function has been associated with several diseases susceptibility in humans and animals. Furthermore, additional studies relating MDR1 and P-gp expression has an important clinical implication also in terms of treatment efficacy.

  4. Expression of multidrug resistance gene and P-glycoprotein in nasopharyngealcarcinoma cells after irradiation

    International Nuclear Information System (INIS)

    Wang Ruoyu; Wang Hui; Fan Kai; Lv Shen

    2007-01-01

    Objective: To mimick a clinical fractionated protocol of exposure to X-radiation in vitro in order to investigate the changes in the function of MDR1 and P-gp in nasopharyngeal carcinoma (NPC) CNE cell before and after irradiation to determine the sequential order of radiotherapy and chemotherapy or the time of chemotherapy after radiotherapy in the treatment of NPC. Methods: Exponentially growing CNE cells were treated with fractionated X-radiation with total dose of 10 Gy (2 Gy per day for 5 days consecutively) in vitro. The expression of MDR1 gene was examined in CNE cells before irradiation and on days 4,8,13,17 and 21 after irradiation by RT-PCR, and its protein P-gp were detected by immunocytochemistry. The function of multidrug resistance protein P-gp was examined by MTT method. Results: Expression of MDR1 gene was below the level of detection before irradiation. Irradiation induced an overexpression of MDR1 gene on day 4, expression of MDR1 was decreased from day 8 to day 21. The overall expression of MDR1 was significantly more than that before irradiation (P<0.05) Expression of P-gp was below the level of detection before irradiation, which demonstrated that irradiation induced an overexpression of P-gp. This overexpression was increased from day 8 to day 21. The overpression of MDR1 gene was maintained dining a short period, however, the emergence of overpression of protein P-gp was later than that of MDR1 gene. Resistance index was 1 for both pre-irradiation and on day 8, and up to 8,10,11.2 on days 13, 17 and 21, respectively. The change of resistance index was accordant with the condition of overexpression of P-gp . Conclusions: Expression of P-gp in nasopharyngeal carcinoma (NPC) CNE cell was below the level of detection before irradiation. Irradiation can induce an overexpression of MDR1 gene and its protein P-gp in CNE cells. The overexpression of MDR1 gene and its protein P-gp lasted a long term. (authors)

  5. Construction of retrovirus vector taking MDR1/ACBC1 and its ...

    African Journals Online (AJOL)

    We successfully observed the expression of the reporter gene-GFP by using the green light fluorescence microscope and the p-glycoprotein (P-gp) expressed by exogenous gene MDR1 by Western Blotting. All these facts indicated that the retroviral vector PMX-flag-MDR1-GFP had successfully been transfected into ...

  6. Detekce polymorfismu v genu MDR1 u ovčáckých a honáckých psů

    OpenAIRE

    Staroveská, Marieta

    2016-01-01

    This thesis is focused on polymorphism of MDR1 gene and related drug resistance. Resistance is caused by deletion of four nucleotids, that resulting in a frame shift and synthesis of nonfunctional transport of P-glycoprotein. The text describes a polymorphism of MDR1 (ABCB1) gene, which results in reduced resistance to drugs belonging to the group of macrocyclic lactones. It also describes inheritance of this phenomenon and it deals with the detection of mutation using PCR (polymerase chain r...

  7. Genome sequencing and annotation of multidrug resistant Mycobacterium tuberculosis (MDR-TB PR10 strain

    Directory of Open Access Journals (Sweden)

    Mohd Zakihalani A. Halim

    2016-03-01

    Full Text Available Here, we report the draft genome sequence and annotation of a multidrug resistant Mycobacterium tuberculosis strain PR10 (MDR-TB PR10 isolated from a patient diagnosed with tuberculosis. The size of the draft genome MDR-TB PR10 is 4.34 Mbp with 65.6% of G + C content and consists of 4637 predicted genes. The determinants were categorized by RAST into 400 subsystems with 4286 coding sequences and 50 RNAs. The whole genome shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession number CP010968. Keywords: Mycobacterium tuberculosis, Genome, MDR, Extrapulmonary

  8. Asiatic Acid (AA) Sensitizes Multidrug-Resistant Human Lung Adenocarcinoma A549/DDP Cells to Cisplatin (DDP) via Downregulation of P-Glycoprotein (MDR1) and Its Targets.

    Science.gov (United States)

    Cheng, Qilai; Liao, Meixiang; Hu, Haibo; Li, Hongliang; Wu, Longhuo

    2018-01-01

    P-glycoprotein (P-gp, i.e., MDR1) is associated with the phenotype of multidrug resistance (MDR) and causes chemotherapy failure in the management of cancers. Searching for effective MDR modulators and combining them with anticancer drugs is a promising strategy against MDR. Asiatic acid (AA), a natural triterpene isolated from the plant Centella asiatica, may have an antitumor activity. The present study assessed the reversing effect of AA on MDR and possible molecular mechanisms of AA action in MDR1-overexpressing cisplatin (DDP)-resistant lung cancer cells, A549/DDP. Human lung adenocarcinoma A549/DDP cells were either exposed to different concentrations of AA or treated with DDP, and their viability was measured by the MTT assay. A Rhodamine 123 efflux assay, immunofluorescent staining, ATPase assay, reverse-transcription PCR (RT-PCR), and western blot analysis were conducted to elucidate the mechanisms of action of AA on MDR. Our results showed that AA significantly enhanced the cytotoxicity of DDP toward A549/DDP cells but not its parental A549 cells. Furthermore, AA strongly inhibited P-gp expression by blocking MDR1 gene transcription and increased the intracellular accumulation of the P-gp substrate Rhodamine 123 in A549/DDP cells. Nuclear factor (NF)-kB (p65) activity, IkB degradation, and NF-kB/p65 nuclear translocation were markedly inhibited by pretreatment with AA. Additionally, AA inhibited the MAPK-ERK pathway, as indicated by decreased phosphorylation of ERK1 and -2, AKT, p38, and JNK, thus resulting in reduced activity of the Y-box binding protein 1 (YB1) via blockage of its nuclear translocation. AA reversed P-gp-mediated MDR by inhibition of P-gp expression. This effect was likely related to downregulation of YB1, and this effect was mediated by the NF-kB and MAPK-ERK pathways. AA may be useful as an MDR reversal agent for combination therapy in clinical trials. © 2018 The Author(s). Published by S. Karger AG, Basel.

  9. Monoclonal antibody to an external epitope of the human mdr1 P-glycoprotein

    NARCIS (Netherlands)

    Arceci, R. J.; Stieglitz, K.; Bras, J.; Schinkel, A.; Baas, F.; Croop, J.

    1993-01-01

    A membrane glycoprotein, termed P-glycoprotein, has been shown to be responsible for cross-resistance to a broad range of structurally and functionally distinct cytotoxic agents. P-glycoprotein, encoded in humans by the mdr1 gene, functions as an energy-dependent efflux pump to exclude these

  10. The roles of CDR1, CDR2, and MDR1 in kaempferol-induced suppression with fluconazole-resistant Candida albicans.

    Science.gov (United States)

    Shao, Jing; Zhang, MengXiang; Wang, TianMing; Li, Yue; Wang, ChangZhong

    2016-01-01

    Fungal infections caused by fluconazole-resistant Candida albicans are an intractable clinical problem, calling for new efficient antifungal drugs. Kaempferol, an active flavonoid, has been considered a potential candidate against Candida species. This work investigates the resistance reversion of kaempferol in fluconazole-resistant C. albicans and the underlying mechanism. The antifungal activities of fluconazole and/or kaempferol were assessed by a series of standard procedures including broth microdilution method, checkerboard assay and time-kill (T-K) test in nine clinical strains as well as a standard reference isolate of C. albicans. Subsequently, the morphological changes, the efflux of rhodamine 6G, and the expressions of CDR 1, CDR 2, and MDR 1 were analysed by scanning electron microscope (SEM), inverted fluorescence microscope and quantitative reverse transcription polymerase chain reaction (qRT-PCR) in C. albicans z2003. For all the tested C. albicans strains, the minimum inhibitory concentrations (MICs) of fluconazole and kaempferol ranged 0.25-32 and 128-256 μg/mL with a range of fractional inhibitory concentration index of 0.257-0.531. In C. albicans z2003, the expression of both CDR 1 and CDR 2 were decreased after exposure to kaempferol alone with negligible rhodamine 6G accumulation, while the expression of CDR 1, CDR 2 and MDR 1 were all decreased when fluconazole and kaempferol were used concomitantly with notable fluorescence of rhodamine 6G observed. Kaempferol-induced reversion in fluconazole-resistant C. albicans might be likely due to the suppression of the expression of CDR1, CDR2 and MDR1.

  11. High frequency of a single nucleotide substitution (c.-6-180T>G) of the canine MDR1/ABCB1 gene associated with phenobarbital-resistant idiopathic epilepsy in Border Collie dogs.

    Science.gov (United States)

    Mizukami, Keijiro; Yabuki, Akira; Chang, Hye-Sook; Uddin, Mohammad Mejbah; Rahman, Mohammad Mahbubur; Kushida, Kazuya; Kohyama, Moeko; Yamato, Osamu

    2013-01-01

    A single nucleotide substitution (c.-6-180T>G) associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9%) in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  12. The roles of variants in human multidrug resistance (MDR1 gene and their haplotypes on antiepileptic drugs response: a meta-analysis of 57 studies.

    Directory of Open Access Journals (Sweden)

    Hui Li

    Full Text Available Previous studies reported the associations between the ATP-binding cassette sub-family B member 1 (ABCB1, also known as MDR1 polymorphisms and their haplotypes with risk of response to antiepileptic drugs in epilepsy, however, the results were inconclusive.The Pubmed, Embase, Web of Science, CNKI and Chinese Biomedicine databases were searched up to July 15, 2014. Pooled odds ratios (ORs and 95% confidence intervals (CIs were calculated using a fixed-effects or random-effects model based on heterogeneity tests. Meta-regression and Galbraith plot analysis were carried out to explore the possible heterogeneity.A total of 57 studies involving 12407 patients (6083 drug-resistant and 6324 drug-responsive patients with epilepsy were included in the pooled-analysis. For all three polymorphisms (C3435T, G2677T/A, and C1236T, we observed a wide spectrum of minor allele frequencies across different ethnicities. A significantly decreased risk of AEDs resistance was observed in Caucasian patients with T allele of C3435T variant, which was still significant after adjusted by multiple testing corrections (T vs C: OR=0.83, 95%CI=0.71-0.96, p=0.01. However, no significant association was observed between the other two variants and AEDs resistance. Of their haplotypes in ABCB1 gene (all studies were in Indians and Asians, no significant association was observed with AEDs resistance. Moreover, sensitivity and Cumulative analysis showed that the results of this meta-analysis were stable.In summary, this meta-analysis demonstrated that effect of C3435T variant on risk of AEDs resistance was ethnicity-dependent, which was significant in Caucasians. Additionally, further studies in different ethnic groups are warranted to clarify possible roles of haplotypes in ABCB1 gene in AEDs resistance, especially in Caucasians.

  13. Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1 and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

    Directory of Open Access Journals (Sweden)

    Overvad Kim

    2009-11-01

    Full Text Available Abstract Background The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1 and Breast Cancer Resistance Protein (BCRP/ABCG2 may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA and polycyclic aromatic hydrocarbons (PAH. Cyclooxygenase-2 (COX-2 derived prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC, and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. Methods The following polymorphisms were analyzed; a synonymous MDR1 C3435T (rs1045642 in exon26, G-rs3789243-A in intron3, the functional BCRP C421A (rs2231142, the two COX-2 A-1195G (rs689466 and G-765C (rs20417 in the promoter region, and the COX-2 T8473C (rs5275 polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Results Carriers of the variant allele of MDR1 intron 3 polymorphism were at 1.52-fold higher risk of CRC than homozygous wild type allele carriers (Incidence rate ratio (IRR = 1.52, 95% Confidence Interval (CI: 1.12-2.06. Carriers of the variant allele of MDR1 C3435T exon 26 had a lower risk of CRC than homozygous C-allele carriers (IRR = 0.71 (CI:0.50-1.00. There was interaction between these MDR1 polymorphisms and intake of red and processed meat in relation to CRC risk. Homozygous MDR1 C3435T C-allele carriers were at 8% increased risk pr 25 gram meat per day (CI: 1.00-1.16 whereas variant allele carriers were not at increased risk (p for interaction = 0.02. COX-2 and BCRP polymorphisms were not associated with CRC risk. There was interaction between NSAID use and MDR1 C3435T and COX-2 T

  14. Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1) and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

    International Nuclear Information System (INIS)

    Andersen, Vibeke; Østergaard, Mette; Christensen, Jane; Overvad, Kim; Tjønneland, Anne; Vogel, Ulla

    2009-01-01

    The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1) and Breast Cancer Resistance Protein (BCRP/ABCG2) may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH). Cyclooxygenase-2 (COX-2) derived prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC), and to investigate possible interactions with lifestyle factors such as smoking, meat consumption, and NSAID use. The following polymorphisms were analyzed; a synonymous MDR1 C3435T (rs1045642) in exon26, G-rs3789243-A in intron3, the functional BCRP C421A (rs2231142), the two COX-2 A-1195G (rs689466) and G-765C (rs20417) in the promoter region, and the COX-2 T8473C (rs5275) polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Carriers of the variant allele of MDR1 intron 3 polymorphism were at 1.52-fold higher risk of CRC than homozygous wild type allele carriers (Incidence rate ratio (IRR) = 1.52, 95% Confidence Interval (CI): 1.12-2.06). Carriers of the variant allele of MDR1 C3435T exon 26 had a lower risk of CRC than homozygous C-allele carriers (IRR = 0.71 (CI:0.50-1.00)). There was interaction between these MDR1 polymorphisms and intake of red and processed meat in relation to CRC risk. Homozygous MDR1 C3435T C-allele carriers were at 8% increased risk pr 25 gram meat per day (CI: 1.00-1.16) whereas variant allele carriers were not at increased risk (p for interaction = 0.02). COX-2 and BCRP polymorphisms were not associated with CRC risk. There was interaction between NSAID use and MDR1 C3435T and COX-2 T8473C (p-values for interaction 0

  15. Molecular approaches for detection of the multi-drug resistant tuberculosis (MDR-TB in Bangladesh.

    Directory of Open Access Journals (Sweden)

    Tafsina Haque Aurin

    Full Text Available The principal obstacles in the treatment of tuberculosis (TB are delayed and inaccurate diagnosis which often leads to the onset of the drug resistant TB cases. To avail the appropriate treatment of the patients and to hinder the transmission of drug-resistant TB, accurate and rapid detection of resistant isolates is critical. Present study was designed to demonstrate the efficacy of molecular techniques inclusive of line probe assay (LPA and GeneXpert MTB/RIF methods for the detection of multi-drug resistant (MDR TB. Sputum samples from 300 different categories of treated and new TB cases were tested for the detection of possible mutation in the resistance specific genes (rpoB, inhA and katG through Genotype MTBDRplus assay or LPA and GeneXpert MTB/RIF tests. Culture based conventional drug susceptibility test (DST was also carried out to measure the efficacy of the molecular methods employed. Among 300 samples, 191 (63.7% and 193 (64.3% cases were found to be resistant against rifampicin in LPA and GeneXpert methods, respectively; while 189 (63% cases of rifampicin resistance were detected by conventional DST methods. On the other hand, 196 (65.3% and 191 (63.7% isolates showed isoniazid resistance as detected by LPA and conventional drug susceptibility test (DST, respectively. Among the drug resistant isolates (collectively 198 in LPA and 193 in conventional DST, 189 (95.6% and 187 (96.9% were considered to be MDR as examined by LPA and conventional DST, respectively. Category-II and -IV patients encountered higher frequency of drug resistance compared to those from category-I and new cases. Considering the higher sensitivity, specificity and accuracy along with the required time to results significantly shorter, our study supports the adoption of LPA and GeneXpert assay as efficient tools in detecting drug resistant TB in Bangladesh.

  16. MDR-1 and MRP2 gene polymorphisms in Mexican epileptic pediatric patients with complex partial seizures.

    Directory of Open Access Journals (Sweden)

    David eEscalante-Santiago

    2014-10-01

    Full Text Available Although the Pgp efflux transport protein is overexpressed in resected tissue of patients with epilepsy, the presence of polymorphisms in MDR1 / ABCB1 and MRP2 / ABCC2 in patients with antiepileptic-drugs resistant epilepsy is controversial. The aim of this study was to perform an exploratory study to identify nucleotide changes and search new and reported mutations in patients with antiepileptic-drugs resistant epilepsy (ADR and patients with good response to anti-epileptic drugs (CTR in a rigorously selected population. We analyzed 22 samples from drug-resistant patients with epilepsy and 7 samples from patients with good response to anti-epileptic drugs. Genomic DNA was obtained from leukocytes. Eleven exons in both genes were genotyped. The concentration of drugs in saliva and plasma was determined. The concentration of valproic acid in saliva was lower in ADR than in CRT. In ABCB1, five reported SNPs and five unreported nucleotide changes were identified; rs2229109 (GA and rs2032582 (AT and AG were found only in the ADR. Of six SNPs associated with the ABCC2 that were found in the study population, rs3740066 (TT and 66744T>A (TG were found only in the ADR. The strongest risk factor in the ABCB1 gene was identified as the TA genotype of rs2032582, whereas for the ABCC2 gene the strongest risk factor was the T allele of rs3740066. The screening of SNPs in ACBC1 and ABCC2 indicates that the Mexican patients with epilepsy in this study display frequently reported ABCC1 polymorphisms; however, in the study subjects with a higher risk factor for drug resistance, new nucleotide changes were found in the ABCC2 gene. Thus, the population of Mexican patients with AED-resistant epilepsy used in this study exhibits genetic variability with respect to those reported in other study populations; however, it is necessary to explore this polymorphism in a larger population of patients with AED-resistant epilepsy.

  17. High Frequency of a Single Nucleotide Substitution (c.-6-180T>G of the Canine MDR1/ABCB1 Gene Associated with Phenobarbital-Resistant Idiopathic Epilepsy in Border Collie Dogs

    Directory of Open Access Journals (Sweden)

    Keijiro Mizukami

    2013-01-01

    Full Text Available A single nucleotide substitution (c.-6-180T>G associated with resistance to phenobarbital therapy has been found in the canine MDR1/ABCB1 gene in Border Collies with idiopathic epilepsy. In the present study, a PCR-restriction fragment length polymorphism assay was developed for genotyping this mutation, and a genotyping survey was carried out in a population of 472 Border Collies in Japan to determine the current allele frequency. The survey demonstrated the frequencies of the T/T wild type, T/G heterozygote, and G/G mutant homozygote to be 60.0%, 30.3%, and 9.8%, respectively, indicating that the frequency of the mutant G allele is extremely high (24.9% in Border Collies. The results suggest that this high mutation frequency of the mutation is likely to cause a high prevalence of phenobarbital-resistant epilepsy in Border Collies.

  18. The process behind the expression of mdr-1/P-gp and mrp/MRP in human leukemia/lymphoma.

    Science.gov (United States)

    Hirose, Masao

    2009-04-01

    There is a controversy over the link between phenotypes of multidrug resistance (MDR) and clinical outcome in leukemia/lymphoma patients. This may be because the process behind the induction and loss of expression of genotypes and phenotypes by which MDR develops and the role of MDR in fresh cells of human leukemia/lymphoma are not clearly defined. P-glycoprotein (P-gp) increased and decreased along with mdr-1 expression in three cell lines out of five vincristine (VCR)-resistant cell lines. MRP appeared with increased mrp expression in the other two cell lines. After the drug was removed from the culture system, mdr-1/P-gp changed in parallel with the level of VCR resistance, although mrp and MRP did not. It was concluded that P-gp is directly derived from mdr-1 and that mdr-1/P-gp supports the VCR-resistance but mrp/MRP is not directly linked to the VCR-resistance. These results should contribute to a better understanding of MDR phenomenon in cancer.

  19. RNAi validation of resistance genes and their interactions in the highly DDT-resistant 91-R strain of Drosophila melanogaster.

    Science.gov (United States)

    Gellatly, Kyle J; Yoon, Kyong Sup; Doherty, Jeffery J; Sun, Weilin; Pittendrigh, Barry R; Clark, J Marshall

    2015-06-01

    4,4'-dichlorodiphenyltrichloroethane (DDT) has been re-recommended by the World Health Organization for malaria mosquito control. Previous DDT use has resulted in resistance, and with continued use resistance will increase in terms of level and extent. Drosophila melanogaster is a model dipteran that has many available genetic tools, numerous studies done on insecticide resistance mechanisms, and is related to malaria mosquitoes allowing for extrapolation. The 91-R strain of D. melanogaster is highly resistant to DDT (>1500-fold), however, there is no mechanistic scheme that accounts for this level of resistance. Recently, reduced penetration, increased detoxification, and direct excretion have been identified as resistance mechanisms in the 91-R strain. Their interactions, however, remain unclear. Use of UAS-RNAi transgenic lines of D. melanogaster allowed for the targeted knockdown of genes putatively involved in DDT resistance and has validated the role of several cuticular proteins (Cyp4g1 and Lcp1), cytochrome P450 monooxygenases (Cyp6g1 and Cyp12d1), and ATP binding cassette transporters (Mdr50, Mdr65, and Mrp1) involved in DDT resistance. Further, increased sensitivity to DDT in the 91-R strain after intra-abdominal dsRNA injection for Mdr50, Mdr65, and Mrp1 was determined by a DDT contact bioassay, directly implicating these genes in DDT efflux and resistance. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Multi drug resistance to cancer chemotherapy: Genes involved and blockers

    International Nuclear Information System (INIS)

    Sayed-Ahmed, Mohamed M.

    2007-01-01

    During the last three decades, important and considerable research efforts had been performed to investigate the mechanism through which cancer cells overcome the cytotoxic effects of a variety of chemotherapeutic drugs. Most of the previously published work has been focused on the resistance of tumor cells to those anticancer drugs of natural source. Multidrug resistance (MDR) is a cellular cross-resistance to a broad spectrum of natural products used in cancer chemotherapy and is believed to be the major cause of the therapeutic failures of the drugs belonging to different naturally obtained or semisynthetic groups including vinca alkaloids, taxans, epipodophyllotoxins and certain antibiotics. This phenomenon results from overexpression of four MDR genes and their corresponding proteins that act as membrane-bound ATP consuming pumps. These proteins mediate the efflux of many structurally and functionally unrelated anticancer drugs of natural source. MDR may be intrinsic or acquired following exposure to chemotherapy. The existence of intrinsically resistant tumor cell clone before and following chemotherapeutic treatment has been associated with a worse final outcome because of increased incidence of distant metasis. In view of irreplaceability of natural product anticancer drugs as effective chemotherapeutic agents, and in view of MDR as a major obstacle to successful chemotherapy, this review is aimed to highlight the genes involved in MDR, classical MDR blockers and gene therapy approaches to overcome MDR. (author)

  1. Antimicrobial resistance and resistance genes in Salmonella strains isolated from broiler chickens along the slaughtering process in China.

    Science.gov (United States)

    Zhu, Yuanting; Lai, Haimei; Zou, Likou; Yin, Sheng; Wang, Chengtao; Han, Xinfeng; Xia, Xiaolong; Hu, Kaidi; He, Li; Zhou, Kang; Chen, Shujuan; Ao, Xiaolin; Liu, Shuliang

    2017-10-16

    A total of 189 Salmonella isolates were recovered from 627 samples which were collected from cecal contents of broilers, chicken carcasses, chicken meat after cutting step and frozen broiler chicken products along the slaughtering process at a slaughterhouse in Sichuan province of China. The Salmonella isolates were subjected to antimicrobial susceptibility testing to 10 categories of antimicrobial agents using the Kirby-Bauer disk diffusion method. Those antibiotics-resistant isolates were further investigated for the occurrence of resistance genes, the presence of class 1 integron as well as the associated gene cassettes, and the mutations within the gyrA and parC genes. Consequently, the prevalence of Salmonella was 30.14% (47.96% for cecal content, 18.78% for chicken carcasses, 31.33% for cutting meat and 14.00% for frozen meat, respectively). The predominant serotypes were S. Typhimurium (15.34%) and S. Enteritidis (69.84%). High resistance rates to the following drugs were observed: nalidixic acid (99.5%), ampicillin (87.8%), tetracycline (51.9%), ciprofloxacin (48.7%), trimethoprim/sulfamethoxazole (48.1%), and spectinomycin (34.4%). Antimicrobial resistance profiling showed that 60.8% of isolates were multidrug resistant (MDR), and MDR strains increased from 44.7% to 78.6% along the slaughtering line. 94.6% (n=157) of beta-lactam-resistant isolates harbored at least one resistance gene of bla TEM or bla CTX-M . The relatively low prevalence of aminoglycoside resistance genes (aac(3)-II, aac(3)-IV, and ant(2″)-I) was found in 49 (66.2%) of antibiotic-resistant isolates. The tetracycline resistance genes (tet(A), tet(B), tet(C), and tet(G) and sulfonamide resistance genes (sul1, sul2, and sul3) were identified in 84 (85.7%) and 89 (97.8%) antibiotic-resistant isolates respectively. floR was identified in 44 (97.8%) florfenicol-resistant isolates. Class 1 integron was detected in 37.4% (n=43) of the MDR isolates. Two different gene cassettes, bla OXA-30 -aad

  2. Mdr65 decreases toxicity of multiple insecticides in Drosophila melanogaster.

    Science.gov (United States)

    Sun, Haina; Buchon, Nicolas; Scott, Jeffrey G

    2017-10-01

    ABC transporters are ubiquitous membrane-bound proteins, present in both prokaryotes and eukaryotes. The major function of eukaryotic ABC transporters is to mediate the efflux of a variety of substrates (including xenobiotics) out of cells. ABC transporters have been widely investigated in humans, particularly for their involvement in multidrug resistance (MDR). Considerably less is known about their roles in transport and/or excretion in insects. ABC transporters are only known to function as exporters in insects. Drosophila melanogaster has 56 ABC transporter genes, including eight which are phylogenetically most similar to the human Mdr genes (ABCB1 clade). We investigated the role of ABC transporters in the ABCB1 clade in modulating the susceptibility to insecticides. We took advantage of the GAL4/UAS system in D. melanogaster to knockdown the expression levels of Mdr65, Mdr50, Mdr49 and ABCB6 using transgenic UAS-RNAi lines and conditional driver lines. The most notable effects were increased sensitivities to nine different insecticides by silencing of Mdr65. Furthermore, a null mutation of Mdr65 decreased the malathion, malaoxon and fipronil LC 50 values by a factor of 1.9, 2.1 and 3.9, respectively. Altogether, this data demonstrates the critical role of ABC transporters, particularly Mdr65, in altering the toxicity of specific, structurally diverse, insecticides in D. melanogaster. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Breed distribution of the nt230(del4) MDR1 mutation in dogs.

    Science.gov (United States)

    Gramer, Irina; Leidolf, Regina; Döring, Barbara; Klintzsch, Stefanie; Krämer, Eva-Maria; Yalcin, Ebru; Petzinger, Ernst; Geyer, Joachim

    2011-07-01

    A 4-bp deletion mutation associated with multiple drug sensitivity exists in the canine multidrug resistance (MDR1) gene. This mutation has been detected in more than 10 purebred dog breeds as well as in mixed breed dogs. To evaluate the breed distribution of this mutation in Germany, 7378 dogs were screened, including 6999 purebred and 379 mixed breed dogs. The study included dog breeds that show close genetic relationship or share breeding history with one of the predisposed breeds but in which the occurrence of the MDR1 mutation has not been reported. The breeds comprised Bearded Collies, Anatolian Shepherd Dog, Greyhound, Belgian Tervuren, Kelpie, Borzoi, Australian Cattle Dog and the Irish Wolfhound. The MDR1 mutation was not detected is any of these breeds, although it was found as expected in the Collie, Longhaired Whippet, Shetland Sheepdog, Miniature Australian Shepherd, Australian Shepherd, Wäller, White Swiss Shepherd, Old English Sheepdog and Border Collie with varying allelic frequencies for the mutant MDR1 allele of 59%, 45%, 30%, 24%, 22%, 17%, 14%, 4% and 1%, respectively. Allelic frequencies of 8% and 2% were determined in herding breed mixes and unclassified mixed breeds, respectively. Because of its widespread breed distribution and occurrence in many mixed breed dogs, it is difficult for veterinarians and dog owners to recognise whether MDR1-related drug sensitivity is relevant for an individual animal. This study provides a comprehensive overview of all affected dog breeds and many dog breeds that are probably unaffected on the basis of ∼15,000 worldwide MDR1 genotyping data. Copyright © 2010 Elsevier Ltd. All rights reserved.

  4. Genetic modification of haematopoietic cells for combined resistance to podophyllotoxins, other agents covered by MDR1-mediated efflux activity and nitrosoureas.

    Science.gov (United States)

    Baum, C; Peinert, S; Carpinteiro, A; Eckert, H G; Fairbairn, L J

    2000-05-01

    Genetic transfer and expression of drug-resistance functions into haematopoietic stem and progenitor cells is a promising means to overcome both the acute and longterm side-effects of cytotoxic drugs in bone marrow. Here, we describe a functional analysis of a retroviral vector that co-expresses human cDNAs for multidrug resistance 1/P-glycoprotein (MDR1) and a double mutant of O(6)-alkylguanine-alkyltransferase (hATPA/GA) to high levels. The hATPA/GA protein contains two amino acid substitutions that render it resistant to compounds such as O(6)-benzylguanine that inhibit the wild-type protein which is often overexpressed in resistant tumour cells. Evidence for simultaneous drug resistance of genetically modified primary murine progenitor cells to colchicine or the podophyllotoxin etoposide, both covered by MDR1-mediated efflux activity, and the nitrosourea BCNU, which is counteracted by hATPA/GA, is presented using in vitro colony assays.

  5. A Comprehensive Investigation on Common Polymorphisms in the MDR1/ABCB1 Transporter Gene and Susceptibility to Colorectal Cancer

    Czech Academy of Sciences Publication Activity Database

    Campa, D.; Sainz, J.; Pardini, Barbara; Vodičková, Ludmila; Naccarati, Alessio; Rudolph, A.; Novotný, J.; Försti, A.; Buch, S.; von Schönfels, W.; Schafmayer, C.; Völzke, H.; Hoffmeister, M.; Frank, B.; Barale, R.; Hemminki, K.; Hampe, J.; Chang-Claude, J.; Brenner, H.; Vodička, Pavel; Canzian, F.

    2012-01-01

    Roč. 7, č. 3 (2012), e32784 E-ISSN 1932-6203 R&D Projects: GA ČR GA310/07/1430; GA ČR GAP304/10/1286 Institutional research plan: CEZ:AV0Z50390703 Keywords : single-nucleotide polymorphisms * resistance 1 mdr1 * p-glycoprotein Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.730, year: 2012

  6. Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zhigang [Wayne State Univ., Detroit, MI (United States); Case Western Reserve Univ., Cleveland, OH (United States); Harbor Hospital Baltimore, MD (United States); Wang, Yong [Wayne State Univ., Detroit, MI (United States); Yedidi, Ravikiran S. [Wayne State Univ., Detroit, MI (United States); National Institutes of Health, Bethesda, MD (United States); Dewdney, Tamaria G. [Wayne State Univ., Detroit, MI (United States); Reiter, Samuel J. [Wayne State Univ., Detroit, MI (United States); Brunzelle, Joseph S. [Northwestern Univ. Feinberg School of Medicine, Chicago, IL (United States); Kovari, Iulia A. [Wayne State Univ., Detroit, MI (United States); Kovari, Ladislau C. [Wayne State Univ., Detroit, MI (United States)

    2012-12-19

    Success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. Additionally, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.

  7. Characterization of a Novel 99mTc-Carbonyl Complex as a Functional Probe of MDR1 P-Glycoprotein Transport Activity

    Directory of Open Access Journals (Sweden)

    Mary Dyszlewski

    2002-01-01

    Full Text Available Multidrug resistance (MDR mediated by overexpression of MDR1 P-glycoprotein (Pgp is one of the best characterized barriers to chemotherapy in cancer patients. Furthermore, the protective function of Pgp-mediated efflux of xenobiotics in various organs has a profound effect on the bioavailability of drugs in general. Thus, there is an expanding requirement to noninvasively interrogate Pgp transport activity in vivo. We herein report the Pgp recognition properties of a novel 99mTc(I-tricarbonyl complex, [99mTc(CO3(MIBI3] + (Tc-CO-MIBI. Tc-CO-MIBI showed 60-fold higher accumulation in drug-sensitive KB 3–1 cells compared to colchicine-selected drug-resistant KB 8-5 cells. In KB 8-5 cells, tracer enhancement was observed with the potent MDR modulator LY335979 (EC50 = 62 nM. Similar behavior was observed using drug-sensitive MCF-7 breast adenocarcinoma cells and MCF-7/MDR1 stable transfectants, confirming that Tc-CO-MIBI is specifically excluded by overexpression of MDR1 Pgp. By comparison, net accumulation in control H69 lung tumor cells was 9-fold higher than in MDR-associated protein (MRP1-expressing H69AR cells, indicating only modest transport by MRP1. Biodistribution analysis following tail vein injection of Tc-CO-MIBI showed delayed liver clearance as well as enhanced brain uptake and retention in mdr1a/1b(−/− gene deleted mice versus wild-type mice, directly demonstrating that Tc-CO-MIBI is a functional probe of Pgp transport activity in vivo.

  8. Splice form variant and amino acid changes in MDR49 confers DDT resistance in transgenic Drosophila.

    Science.gov (United States)

    Seong, Keon Mook; Sun, Weilin; Clark, John M; Pittendrigh, Barry R

    2016-03-22

    The ATP-binding cassette (ABC) transporters represent a superfamily of proteins that have important physiological roles in both prokaryotes and eukaryotes. In insects, ABC transporters have previously been implicated in insecticide resistance. The 91-R strain of Drosophila melanogaster has been intensely selected with DDT over six decades. A recent selective sweeps analysis of 91-R implicated the potential role of MDR49, an ABC transporter, in DDT resistance, however, to date the details of how MDR49 may play a role in resistance have not been elucidated. In this study, we investigated the impact of structural changes and an alternative splicing event in MDR49 on DDT-resistance in 91-R, as compared to the DDT susceptible strain 91-C. We observed three amino acid differences in MDR49 when 91-R was compared with 91-C, and only one isoform (MDR49B) was implicated in DDT resistance. A transgenic Drosophila strain containing the 91-R-MDR49B isoform had a significantly higher LD50 value as compared to the 91-C-MDR49B isoform at the early time points (6 h to 12 h) during DDT exposure. Our data support the hypothesis that the MDR49B isoform, with three amino acid mutations, plays a role in the early aspects of DDT resistance in 91-R.

  9. Comparative evaluation of GenoType MTBDRplus line probe assay with solid culture method in early diagnosis of multidrug resistant tuberculosis (MDR-TB at a tertiary care centre in India.

    Directory of Open Access Journals (Sweden)

    Raj N Yadav

    Full Text Available The objectives of the study were to compare the performance of line probe assay (GenoType MTBDRplus with solid culture method for an early diagnosis of multidrug resistant tuberculosis (MDR-TB, and to study the mutation patterns associated with rpoB, katG and inhA genes at a tertiary care centre in north India.In this cross-sectional study, 269 previously treated sputum-smear acid-fast bacilli (AFB positive MDR-TB suspects were enrolled from January to September 2012 at the All India Institute of Medical Sciences hospital, New Delhi. Line probe assay (LPA was performed directly on the sputum specimens and the results were compared with that of conventional drug susceptibility testing (DST on solid media [Lowenstein Jensen (LJ method].DST results by LPA and LJ methods were compared in 242 MDR-TB suspects. The LPA detected rifampicin (RIF resistance in 70 of 71 cases, isoniazid (INH resistance in 86 of 93 cases, and MDR-TB in 66 of 68 cases as compared to the conventional method. Overall (rifampicin, isoniazid and MDR-TB concordance of the LPA with the conventional DST was 96%. Sensitivity and specificity were 98% and 99% respectively for detection of RIF resistance; 92% and 99% respectively for detection of INH resistance; 97% and 100% respectively for detection of MDR-TB. Frequencies of katG gene, inhA gene and combined katG and inhA gene mutations conferring all INH resistance were 72/87 (83%, 10/87 (11% and 5/87 (6% respectively. The turnaround time of the LPA test was 48 hours.The LPA test provides an early diagnosis of monoresistance to isoniazid and rifampicin and is highly sensitive and specific for an early diagnosis of MDR-TB. Based on these findings, it is concluded that the LPA test can be useful in early diagnosis of drug resistant TB in high TB burden countries.

  10. Heterologously expressed bacterial and human multidrug resistance proteins confer cadmium resistance to Escherichia coli

    NARCIS (Netherlands)

    Achard-Joris, M; van Saparoea, HBV; Driessen, AJM; Bourdineaud, JP; Bourdineaud, Jean-Paul

    2005-01-01

    The human MDR1 gene is induced by cadmium exposure although no resistance to this metal is observed in human cells overexpressing hMDR1. To access the role of MDR proteins in cadmium resistance, human MDR1, Lactococcus lactis lmrA, and Oenococcus oeni omrA were expressed in an Escherichia coli tolC

  11. [Small interfering RNA-mediated COX-2 gene silencing enhances chemosensitivity of KB/VCR cells by suppressing MDR-1 gene expression and P-glycoprotein activity].

    Science.gov (United States)

    Mo, Xianchao; Li, Weizhong

    2014-05-01

    To investigate the effect of small interfering RNA (siRNA)-mediated COX-2 gene silencing in enhancing the chemosensitivity of KB/VCR cell lines. KB/VCR cells were trasnfected with COX-2 siRNA were examined for expressions of COX-2 and MDR-1 mRNAs with RT-PCR and for Rho-123 accumulation using flow cytometry. MTT assay was used to analyze the proliferation of the transfected KB/VCR cells. Compared with the negative and blank control groups, COX-2 siRNA transfection resulted in significant growth inhibition of KB/VCR cells exposed to vincristine (PKB/VCR cells. COX-2 gene silencing can enhance the chemosensitivity of KB/VCR cells to vincristine, the mechanism of which may involve down-regulated MDR-1 gene expression and inhibition of P-glycoprotein activity.

  12. P-Glycoprotein/MDR1 regulates pokemon gene transcription through p53 expression in human breast cancer cells.

    Science.gov (United States)

    He, Shengnan; Liu, Feng; Xie, Zhenhua; Zu, Xuyu; Xu, Wei; Jiang, Yuyang

    2010-08-27

    P-glycoprotein (Pgp), encoded by the multidrug resistance 1 (MDR1) gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  13. Co-ordinate loss of protein kinase C and multidrug resistance gene expression in revertant MCF-7/Adr breast carcinoma cells.

    Science.gov (United States)

    Budworth, J; Gant, T W; Gescher, A

    1997-01-01

    The aim of this study was to investigate the link between protein kinase C (PKC) and multidrug resistance (mdr) phenotype. The expression of both was studied in doxorubicin-resistant MCF-7/Adr cells as they reverted to the wild-type phenotype when cultured in the absence of drug. The following parameters were measured in cells 4, 10, 15, 20 and 24 weeks after removal of doxorubicin; (1) sensitivity of the cells towards doxorubicin; (2) levels of P-glycoprotein (P-gp) and MDR1 mRNA; (3) levels and cellular localization of PKC isoenzyme proteins alpha, theta and epsilon; and (4) gene copy number of PKC-alpha and MDR1 genes. Cells lost their resistance gradually with time, so that by week 24 they had almost completely regained the drug sensitivity seen in wild-type MCF-7 cells. P-gp levels measured by Western blot mirrored the change in doxorubicin sensitivity. By week 20, P-gp had decreased to 18% of P-gp protein levels at the outset, and P-gp was not detectable at week 24. Similarly, MDR1 mRNA levels had disappeared by week 24. MCF-7/Adr cells expressed more PKCs-alpha and -theta than wild-type cells and possessed a different cellular localization of PKC-epsilon. The expression and distribution pattern of these PKCs did not change for up to 20 weeks, but reverted back to that seen in wild-type cells by week 24. MDR1 gene amplification remained unchanged until week 20, but then was lost precipitously between weeks 20 and 24. The PKC-alpha gene was not amplified in MCF-7/Adr cells. The results suggest that MCF-7/Adr cells lose MDR1 gene expression and PKC activity in a co-ordinate fashion, consistent with the existence of a mechanistic link between MDR1 and certain PKC isoenzymes.

  14. Polymorphisms in the xenobiotic transporter Multidrug Resistance 1 (MDR1) and interaction with meat intake in relation to risk of colorectal cancer in a Danish prospective case-cohort study

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Østergaard, Mette; Christensen, Jane

    2009-01-01

    (rs5275) polymorphisms in the 3'-untranslated region. The polymorphisms were assessed together with lifestyle factors in a nested case-cohort study of 359 cases and a random cohort sample of 765 participants from the Danish prospective Diet, Cancer and Health study. Results Carriers of the variant......Background The xenobiotic transporters, Multidrug Resistance 1 (MDR1/ABCB1) and Breast Cancer Resistance Protein (BCRP/ABCG2) may restrict intestinal absorption of various carcinogens, including heterocyclic amines (HCA) and polycyclic aromatic hydrocarbons (PAH). Cyclooxygenase-2 (COX-2) derived...... prostaglandins promote gastrointestinal carcinogenesis, affecting angiogenesis, apoptosis, and invasiveness. The aim of this study was to investigate if polymorphisms in these genes were associated with risk of colorectal cancer (CRC), and to investigate possible interactions with lifestyle factors...

  15. Do polymorphisms in MDR1 and CYP3A5 genes influence the risk of cytogenetic relapse in patients with chronic myeloid leukemia on imatinib therapy?

    Science.gov (United States)

    Harivenkatesh, Natarajan; Kumar, Lalit; Bakhshi, Sameer; Sharma, Atul; Kabra, Madhulika; Velpandian, Thirumurthy; Gogia, Ajay; Shastri, Shivaram S; Gupta, Yogendra Kumar

    2017-09-01

    Influence of polymorphisms in the genes coding for imatinib transporters and metabolizing enzymes on cytogenetic relapse in patients with chronic myeloid leukemia (CML) is not known. One hundred and four patients (52 cases with cytogenetic relapse and 52 controls without relapse) with chronic-phase CML on imatinib therapy and have completed 5 years of follow-up were enrolled. The following single nucleotide polymorphisms (SNPs) were genotyped; C1236T, C3435T, G2677T/A in MDR1 gene and A6986G in CYP3A5 gene, using PCR-RFLP method and validated by direct gene sequencing. Imatinib trough levels were measured using LC-MS/MS. Patients with CC genotype for MDR1-C1236T polymorphism were at significantly higher risk for cytogenetic relapse [OR =4.382, 95% CI (1.145, 16.774), p = .022], while those with TT genotype for MDR1-C3435T polymorphism had significantly lower risk of relapse [OR =0.309, 95% CI (0.134, 0.708), p = .005]. Imatinib trough levels were lower in patients with relapse compared to those without relapse (1551.4 ± 1324.1 vs. 2154.2 ± 1358.3 ng/mL; p = .041). MDR1-C3435T genotype [adjusted-OR: 0.266; 95% CI (0.111, 0.636); p = .003] and trough levels (p = .014) were independent predictors of relapse in multivariate analysis. To conclude, C1236T and C3435T polymorphisms in MDR1 gene and trough levels significantly influence the risk of cytogenetic relapse. MDR1-C3435T genotype might emerge as a potential biomarker to predict the risk of cytogenetic relapse in patients with CML.

  16. P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Wei Xu

    2010-08-01

    Full Text Available P-glycoprotein (Pgp, encoded by the multidrug resistance 1 (MDR1 gene, is an efflux transporter and plays an important role in pharmacokinetics. In this study, we demonstrated that the pokemon promoter activity, the pokemon mRNA and protein expression can be significantly inhibited by Pgp. Chromatin immunoprecipitation assay showed that Pgp can bind the pokemon prompter to repress pokemon transcription activity. Furthermore, Pgp regulated pokemon transcription activity through expression of p53 as seen by use of p53 siRNA transfected MCF-7 cells or p53 mutated MDA-MB-231 cells. Moreover, p53 was detected to bind with Pgp in vivo using immunoprecipitation assay. Taken together, we conclude that Pgp can regulate the expression of pokemon through the presence of p53, suggesting that Pgp is a potent regulator and may offer an effective novel target for cancer therapy.

  17. In vitro detection of mdr1 mRNA in murine leukemia cells with 111In-labeled oligonucleotide

    International Nuclear Information System (INIS)

    Bai Jingming; Yokoyama, Kunihiko; Kinuya, Seigo; Michigishi, Takatoshi; Tonami, Norihisa; Shiba, Kazuhiro; Matsushita, Ryo; Nomura, Masaaki

    2004-01-01

    radioactivity and specific uptake of antisense 111 In-ODN in drug-resistant cells may facilitate future gene imaging of mdr1 mRNA. (orig.)

  18. Role of MRP-1 and GST-Pi in MDR and their inhibition by ...

    African Journals Online (AJOL)

    Samia A. Ebeed

    2016-08-16

    Aug 16, 2016 ... Various mechanisms were proposed that underlie MDR in malignant cells. ... the gene that confers MDR in lung cancer cells. MRP1 acts in order to protect ... the many physiological and pathophysiological processes influ-.

  19. IPEC-J2 MDR1, a Novel High-Resistance Cell Line with Functional Expression of Human P-glycoprotein (ABCB1) for Drug Screening Studies

    DEFF Research Database (Denmark)

    Saaby, Lasse; Helms, Hans Christian Cederberg; Brodin, Birger

    2016-01-01

    The P-glycoprotein (P-gp) efflux pump has been shown to affect drug distribution and absorption in various organs and to cause drug resistance in cancer therapy. The aim of this work was to develop a cell line to serve as a screening system for potential substrates of P-gp. This requires a cell...... line with high paracellular tightness, low expression of nonhuman ABC transporters, and high expression of functional human P-gp (ABCB1). The porcine intestinal epithelial cell line, IPEC-J2, was selected as a transfection host, due to its ability to form extremely high-resistance monolayers (>10,000 Ω......·cm(2)) and its low endogenous expression of ABC-type efflux transporters. The IPEC-J2 cells were transfected with a plasmid that contained the sequence of the human MDR1 gene, which encodes P-gp, followed by a selection of successfully transfected cells with geneticin and puromycin. The resulting cell...

  20. Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

    International Nuclear Information System (INIS)

    Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

    2008-01-01

    Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression

  1. Functional evidence of multidrug resistance transporters (MDR in rodent olfactory epithelium.

    Directory of Open Access Journals (Sweden)

    Adrien Molinas

    Full Text Available P-glycoprotein (Pgp and multidrug resistance-associated protein (MRP1 are membrane transporter proteins which function as efflux pumps at cell membranes and are considered to exert a protective function against the entry of xenobiotics. While evidence for Pgp and MRP transporter activity is reported for olfactory tissue, their possible interaction and participation in the olfactory response has not been investigated.Functional activity of putative MDR transporters was assessed by means of the fluorometric calcein acetoxymethyl ester (calcein-AM accumulation assay on acute rat and mouse olfactory tissue slices. Calcein-AM uptake was measured as fluorescence intensity changes in the presence of Pgp or MRP specific inhibitors. Epifluorescence microscopy measured time course analysis in the olfactory epithelium revealed significant inhibitor-dependent calcein uptake in the presence of each of the selected inhibitors. Furthermore, intracellular calcein accumulation in olfactory receptor neurons was also significantly increased in the presence of either one of the Pgp or MRP inhibitors. The presence of Pgp or MRP1 encoding genes in the olfactory mucosa of rat and mouse was confirmed by RT-PCR with appropriate pairs of species-specific primers. Both transporters were expressed in both newborn and adult olfactory mucosa of both species. To assess a possible involvement of MDR transporters in the olfactory response, we examined the electrophysiological response to odorants in the presence of the selected MDR inhibitors by recording electroolfactograms (EOG. In both animal species, MRPs inhibitors induced a marked reduction of the EOG magnitude, while Pgp inhibitors had only a minor or no measurable effect.The findings suggest that both Pgp and MRP transporters are functional in the olfactory mucosa and in olfactory receptor neurons. Pgp and MRPs may be cellular constituents of olfactory receptor neurons and represent potential mechanisms for modulation

  2. 8__Aisha_Detection ofMDR-TB

    African Journals Online (AJOL)

    User

    Among the MDR-TB cases rifampicin resistance was associated with rpoB WT gene and rpoB MUT gene in 100% and 62% of the ... diagnosis of TB patients, and proper treatment and management of the infected cases to minimize the spread and ..... in an amino acid change and concluded that this is one of the reasons ...

  3. ANTIBACTERIAL ACTIVITY OF DRACONTOMELON DAO EXTRACTS ON METHICILLIN-RESISTANT S. AUREUS (MRSA) AND E. COLI MULTIPLE DRUG RESISTANCE (MDR).

    Science.gov (United States)

    Yuniati, Yuniati; Hasanah, Nurul; Ismail, Sjarif; Anitasari, Silvia; Paramita, Swandari

    2018-01-01

    Staphylococcus aureus , methicillin-resistant and Escherichia coli , multidrug-resistant included in the list of antibiotic-resistant priority pathogens from WHO. As multidrug-resistant bacteria problem is increasing, it is necessary to probe new sources for identifying antimicrobial compounds. Medicinal plants represent a rich source of antimicrobial agents. One of the potential plants for further examined as antibacterial is Dracontomelon dao (Blanco) Merr. & Rolfe. The present study designed to find the antibacterial activity of D. dao stem bark extracts on Methicillin-resistant S. aureus (MRSA) and E. coli Multiple Drug Resistance (MDR), followed by determined secondary metabolites with antibacterial activity and determined the value of MIC (minimum inhibitory concentration) and MBC (minimum bactericidal concentration). D. dao stem bark extracted using 60% ethanol. Disc diffusion test methods used to find the antibacterial activity, following by microdilution methods to find the value of MIC and MBC. Secondary metabolites with antibacterial activity determined by bioautography using TLC (thin layer chromatography) methods. D. dao stem bark extracts are sensitive to MSSA, MRSA and E.coli MDR bacteria. The inhibition zone is 16.0 mm in MSSA, 11.7 mm in MRSA and 10.7 mm in E. coli MDR. The entire MBC/MIC ratios for MSSA, MRSA and E.coli MDR is lower than 4. The ratio showed bactericidal effects of D. dao stem bark extracts. In TLC results, colorless bands found to be secondary metabolites with antibacterial activity. D. dao stem bark extracts are potential to develop as antibacterial agent especially against MRSA and E. coli MDR strain.

  4. Importancia pronóstica de la expresión de MDR-1 en la leucemia mieloblástica aguda

    Directory of Open Access Journals (Sweden)

    J. Arbelbide

    2003-08-01

    Full Text Available Una proporción importante de pacientes con leucemia mieloblástica aguda (LMA presentan recaída o resistencia con el tratamiento. Uno de los mecanismos involucrados en la resistencia a drogas, es la presencia de la glicoproteína P 170 (gp-P 170 resultante de la expresión del gen MDR-1 sobre las células leucémicas. El objetivo de este trabajo es valorar el impacto pronóstico de la expresión de MDR-1 en una población de pacientes tratados por LMA. Se evaluó retrospectivamente la expresión de MDR-1 en una cohorte de 55 pacientes con LMA, mayores de 16 años, que recibieron tratamiento quimioterápico desde 1990 hasta el 2000. Se evaluó sobre biopsia de médula ósea, la expresión de MDR-1/gp-P 170 por inmunohistoquímica. Mediante una curva ROC, se estableció que una expresión de MDR-1 > 50% en células blásticas, resultó significativa para el logro de remisión completa. Esta expresión de MDR-1+ correlacionó con la presencia de leucocitosis: (p:0.002, expresion de células CD34+ (p:0.006, menor tasa de remisión completa (p:0.001, mayor tasa de recaída (p:0.02 y de estudios citogenéticos no favorables (p:0.02. La SLE fue de 21.2% ES:9.3 con un seguimiento de 22 meses para el grupo MDR-1+ versus 56.4% ES:12.5 con un seguimiento de 78 meses en los casos MDR-1- (p:0.007. Se puede concluir que la expresion de MDR-1 ha demostrado ser un factor pronóstico de resistencia a la quimioterapia. Estos pacientes presentan una menor tasa de remisión completa, una mayor tasa de recaída por persistencia de enfermedad residual post-tratamiento, lo que produce una menor sobrevida global.An important number of patients with Acute Myeloid Leukemia (AML experience relapse or resistance to chemotherapy. One of the mechanisms involved in this resistance is the presence of glycoprotein P170 (gp-P 170, which results of the MDR-1 gene in leukemic cells. The objective of this article is to assess the prognostic impact of the expression of MDR-1 in a

  5. Isolation, Identification And Screening Antibacterial Activity from Marine Sponge-Associated Fungi Against Multidrug-Resistant (MDR) Escherichia coli

    Science.gov (United States)

    Triandala Sibero, Mada; Sabdaningsih, Aninditia; Cristianawati, Olvi; Nuryadi, Handung; Karna Radjasa, Ocky; Sabdono, Agus; Trianto, Agus

    2017-02-01

    Irrational used of antibiotic in several decades ago causing resistant in bacteria and decreasing the cure rate of infectious diseases. Multidrug-resistant (MDR) Escherichia coli is known to cause various of infectious diseases such as urinary tract infection, nosocomial bloodstream infection, meningitis, bacteraemia, and gastrointestinal disease. Marine sponge-associated fungi have potential as source of new compound to combat MDR E. coli. The aims of this research were to isolate marine sponge-assosiated fungi, to screen potential fungi against MDR E. coli, to identify the potential fungi and its host sponge. There were 29 marine sponge-associated fungi successfully isolated from 9 sponges. Among 29 sponge-associated fungi screened, there were 7 isolates showed antibacterial activity against MDR E. coli. The best inhibition zone produced by MPS 14.1/MT 02 and MPS 14.3/MT 04 from sponge PP.SP.16.14. According to fungi identification result fungus MPS 14.1/MT 02 was identified as Trichoderma asperellum while MPS 14.3/MT 04 was identified as Trichoderma reesei. Sponge identification leaded the PP.SP.16.14 as Cinachyrella sp.

  6. Dioscin enhances methotrexate absorption by down-regulating MDR1 in vitro and in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Lijuan, E-mail: jlwang1979@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Wang, Changyuan, E-mail: wangcyuan@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Peng, Jinyong, E-mail: jinyongpeng2005@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Liu, Qi, E-mail: llaqii@yahoo.com.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Meng, Qiang, E-mail: mengq531@yahoo.cn [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Sun, Huijun, E-mail: sunhuijun@hotmail.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); Huo, Xiaokui, E-mail: huoxiaokui@163.com [Department of Clinical Pharmacology, College of Pharmacy, Dalian Medical University, Dalian, Liaoning (China); Provincial Key Laboratory for Pharmacokinetics and Transport, Liaoning, Dalian Medical University, Dalian, Liaoning (China); and others

    2014-06-01

    The purpose of this study was to investigate the enhancing effect of dioscin on the absorption of methotrexate (MTX) and clarify the molecular mechanism involved in vivo and in vitro. Dioscin increased MTX chemosensitivity and transepithelial flux in the absorptive direction, significantly inhibiting multidrug resistance 1 (MDR1) mRNA and protein expression and MDR1 promoter and nuclear factor κ-B (NF-κB) activities in Caco-2 cells. Moreover, inhibitor κB-α (IκB-α) degradation was inhibited by dioscin. Dioscin enhanced the intracellular concentration of MTX by down-regulating MDR1 expression through a mechanism that involves NF-κB signaling pathway inhibition in Caco-2 cells. Dioscin strengthened MTX absorption by inhibiting MDR1 expression in rat intestine. In addition, even though MTX is absorbed into the enterocytes, there was no increase in toxicity observed, and that, in fact, decreased toxicity was seen. - Highlights: • Dioscin raised MTX concentration by inhibiting MDR1 in Caco-2 cells. • Dioscin suppresses MDR1 by inhibiting NF-κB signaling pathway in Caco-2 cells. • Dioscin can enhance MTX absorption via inhibiting MDR1 in vivo and in vitro. • Dioscin did not increase MTX-induced gastrointestinal mucosal toxicity.

  7. Detection of expression and modulation of multidrug-resistance (MDR) and establishment of a new bioassay

    International Nuclear Information System (INIS)

    Berger, W.

    1993-08-01

    The present thesis deals with the resistance of human malignant cells against cellular toxicity of anticancer drugs, a phenomenon representing one of the major obstacles to successful chemotherapy. One mechanism underlying a cross-resistance to different drugs called multidrug resistance (MDR) is characterized by the expression of an active transport protein (P-glycoprotein), causing decreased intracellular drug retention and cytotoxicity. The main subjects of the present work were to establish different detection methods for MDR and its modulation (by substances blocking activity of P-glycoprotein) including immunological methods (immunocytochemistry, radioimmunoassay), molecular biology (slot-blot analysis, in-situ hybridization) and functional assays (drug-accumulation analysis, drug-cytotoxicity analysis). The methods were evaluated and compared using human and mouse MDR control cell lines and human tumor cell lines established in our laboratory. In cell lines derived from human melanoma - a malignancy insensitive to chemotherapy - expression of P-glycoprotein of relatively low transporting activity was detected by different methods in 8 of 33 cases. Furthermore a new sensitive in vitro assay for the functional detection of MDR was established using the biological features of cytochalasins, a microfilament disrupting substance group. These compounds were shown to be substrates for the P-glycoprotein efflux pump and their effects on cell division (blockade of cytokinesis resulting in multinucleate cells) correlated with MDR-activity of the tested cells. With this new assay P-glycoprotein activity can be demonstrated and analysed over a wide range of resistance against different cytotoxic drugs. Therefore it may by a suitable tool for research and diagnosis in the field of drug resistance

  8. HIV-1 integrase inhibitors are substrates for the multidrug transporter MDR1-P-glycoprotein

    Directory of Open Access Journals (Sweden)

    Cara Andrea

    2007-03-01

    Full Text Available Abstract Background The discovery of diketoacid-containing derivatives as inhibitors of HIV-1 Integrase (IN (IN inhibitors, IINs has played a major role in validating this enzyme as an important target for antiretroviral therapy. Since the in vivo efficacy depends on access of these drugs to intracellular sites where HIV-1 replicates, we determined whether the IINs are recognized by the multidrug transporter MDR1-P-glycoprotein (P-gp thereby reducing their intracellular accumulation. To address the effect of IINs on drug transport, nine quinolonyl diketo acid (DKA derivatives active on the HIV-1 IN strand transfer (ST step and with EC50 ranging from 1.83 to >50 μm in cell-based assays were tested for their in vitro interaction with P-gp in the CEM-MDR cell system. IINs were investigated for the inhibition and induction of the P-gp function and expression as well as for multidrug resistance (MDR reversing ability. Results The HIV-1 IINs act as genuine P-gp substrates by inhibiting doxorubicin efflux and inducing P-gp functional conformation changes as evaluated by the modulation of UIC2 mAb epitope. Further, IINs chemosensitize MDR cells to vinblastine and induce P-gp expression in drug sensitive revertants of CEM-MDR cells. Conclusion To our knowledge, this is the first demonstration that HIV-1 IINs are P-gp substrates. This biological property may influence the absorption, distribution and elimination of these novels anti HIV-1 compounds.

  9. Co-ordinate regulation of the cystic fibrosis and multidrug resistance genes in cystic fibrosis knockout mice.

    Science.gov (United States)

    Trezise, A E; Ratcliff, R; Hawkins, T E; Evans, M J; Freeman, T C; Romano, P R; Higgins, C F; Colledge, W H

    1997-04-01

    The cystic fibrosis (Cftr and multidrug resistance (Mdr1) genes encode structurally similar proteins which are members of the ABC transporter superfamily. These genes exhibit complementary patterns of expression in vivo, suggesting that the regulation of their expression may be co-ordinated. We have tested this hypothesis in vivo by examining Cftr and Mdr1 expression in cystic fibrosis knockout transgenic mice (Cftr(tm1CAM)). Cftr mRNA expression in Cftr(tm1CAM)/Cftr(tm1CAM) mice was 4-fold reduced in the intestine, as compared with littermate wild-type mice. All other Cftr(tm1CAM)/Cftr(tm1CAM) mouse tissues examined showed similar reductions in Cftr expression. In contrast, we observed a 4-fold increase in Mdr1 mRNA expression in the intestines of neonatal and 3- to 4-week-old Cftr(tm1CAM)/Cftr(tm1CAM) mice, as compared with age-matched +/+ mice, and an intermediate level of Mdr1 mRNA in heterozygous Cftr(tm1CAM) mice. In 10-week-old, Cftr(tm1CAM)/Cftr(tm1CAM) mice and in contrast to the younger mice, Mdr1 mRNA expression was reduced, by 3-fold. The expression of two control genes, Pgk-1 and Mdr2, was similar in all genotypes, suggesting that the changes in Mdr1 mRNA levels observed in the Cftr(tm1CAM)/Cftr(tm1CAM) mice are specific to the loss of Cftr expression and/or function. These data provide further evidence supporting the hypothesis that the regulation Cftr and Mdr1 expression is co-ordinated in vivo, and that this co-ordinate regulation is influenced by temporal factors.

  10. Increased p38-MAPK is responsible for chemotherapy resistance in human gastric cancer cells

    International Nuclear Information System (INIS)

    Guo, Xianling; Zhang, Baihe; Wu, Mengchao; Wei, Lixin; Ma, Nannan; Wang, Jin; Song, Jianrui; Bu, Xinxin; Cheng, Yue; Sun, Kai; Xiong, Haiyan; Jiang, Guocheng

    2008-01-01

    Chemoresistance is one of the main obstacles to successful cancer therapy and is frequently associated with Multidrug resistance (MDR). Many different mechanisms have been suggested to explain the development of an MDR phenotype in cancer cells. One of the most studied mechanisms is the overexpression of P-glycoprotein (P-gp), which is a product of the MDR1 gene. Tumor cells often acquire the drug-resistance phenotype due to upregulation of the MDR1 gene. Overexpression of MDR1 gene has often been reported in primary gastric adenocarcinoma. This study investigated the role of p38-MAPK signal pathway in vincristine-resistant SGC7901/VCR cells. P-gp and MDR1 RNA were detected by Western blot analysis and RT-PCR amplification. Mitgen-activated protein kinases and function of P-gp were demonstrated by Western blot and FACS Aria cytometer analysis. Ap-1 activity and cell apoptosis were detected by Dual-Luciferase Reporter Assay and annexin V-PI dual staining. The vincristine-resistant SGC7901/VCR cells with increased expression of the multidrug-resistance 1 (MDR1) gene were resistant to P-gp-related drug and P-gp-unrelated drugs. Constitutive increases of phosphorylated p38-MAPK and AP-1 activities were also found in the drug-resistant cells. Inhibition of p38-MAPK by SB202190 reduced activator protein-1 (AP-1) activity and MDR1 expression levels and increased the sensitivity of SGC7901/VCR cells to chemotherapy. Activation of the p38-MAPK pathway might be responsible for the modulation of P-glycoprotein-mediated and P-glycoprotein-unmediated multidrug resistance in the SGC7901/VCR cell line

  11. Gradient phenomenon of multidrug resistance gene expression in breast cancer during neoadjuvant chemotherapy is related to disease progression

    Directory of Open Access Journals (Sweden)

    N. V. Litviakov

    2013-01-01

    Full Text Available The paper examined 106 patients with breast cancer (BC treated with neoadjuvant chemotherapy (NАС. In the biopsy material, derived from primary tumor before NAC and surgical samples after chemotherapy the expression of 8 multidrug resistance genes (MDR ABCB1, АВСВ2, ABCC1, ABCC2, АВСС5, ABCG1, ABCG2 и MVP was evaluated using quantitative RT-PCR. During the NAC course 75 % of patients manifested gradient phenomenon for gene expression that means a unidirectional change in the expression of all five MDR genes ABCB1, ABCC1, ABCC2, ABCG1 и ABCG2 closely associated with the NAC efficacy: the reduction in MDR gene expression was related to good response to NAC while the expression increase associated with poor response to NAC. In 25% of patients there was no such change in studied gene expression that means the lack of a gradient phenomenon. The objective was to study whether gradient phenomenon for MDR gene expression during NAC is related to disease free survival in breast cancer patients. Five-year metastasis-free survival in patients having a gradient phenomenon was 73 % versus 39 % in patients who lack a gradient phenomenon (log-rank test p=0,0018. So, the presence of a gradient phenomenon in patients is appeared to be associated with a good disease prognosis. It is assumed that the gradiThe paper examined 106 patients with breast cancer (BC treated with neoadjuvant chemotherapy (NАС. In the biopsy material, derived from primary tumor before NAC and surgical samples after chemotherapy the expression of 8 multidrug resistance genes (MDR ABCB1, АВСВ2, ABCC1, ABCC2, АВСС5, ABCG1, ABCG2 и MVP was evaluated using quantitative RT-PCR. During the NAC course 75 % of patients manifested gradient phenomenon for gene expression that means a unidirectional change in the expression of all five MDR genes ABCB1, ABCC1, ABCC2, ABCG1 и ABCG2 closely associated with the NAC efficacy: the reduction in MDR gene expression was related to good

  12. Prevalence and molecular characterization of pyrazinamide resistance among multidrug-resistant Mycobacterium tuberculosis isolates from Southern China.

    Science.gov (United States)

    Pang, Yu; Zhu, Damian; Zheng, Huiwen; Shen, Jing; Hu, Yan; Liu, Jie; Zhao, Yanlin

    2017-11-06

    Pyrazinamide (PZA) plays a unique role in the treatment for multidrug-resistant tuberculosis (MDR-TB) in both first- and second-line regimens. The aim of this study was to investigate the prevalence and molecular characterization of PZA resistance among MDR-TB isolates collected in Chongqing municipality. A total of 133 MDR-TB isolates were collected from the smear-positive tuberculosis patients who were registered at local TB dispensaries of Chongqing. PZA susceptibility testing was determined with a Bactec MGIT 960 system. In addition, the genes conferring for PZA resistance were screened by DNA sequencing. Of these 133 MDR-TB isolates, 83 (62.4%) were determined as PZA-resistant by MGIT 960. In addition, streptomycin- (83.1% vs. 56.0%, P < 0.01), ofloxacin- (51.8% vs. 18.0%, P < 0.01), kanamycin- (22.9% vs. 2.0%, P < 0.01), amikacin- (18.1% vs. 2.0%, P = 0.01), capromycin-resistance (12.0% vs. 2.0%, P = 0.05), were more frequently observed among PZA-resistant isolates compared with PZA-susceptible isolates. Sequence analysis revealed that 73 out of 83 (88.0%) MDR strains harbored a mutation located in the pncA gene, including 55 (75.3%, 55/73) of single nucleotide substitutions and 18 (24.7%, 18/73) of frameshift mutation, while no genetic mutation associated with PZA resistance was found in the rpsA gene. The pncA expression of strains harboring substitution from A to G at position -11 in the promoter region of pncA was significantly lower than that of H37Rv (P < 0.01). In conclusion, our data have demonstrated that the analysis of the pncA gene rather than rpsA gene provides rapid and accurate information regarding PZA susceptibility for MDR-TB isolates in Chongqing. In addition, loss of pncA expression caused by promoter mutation confers PZA resistance in MDR-TB isolates.

  13. A gene encoding maize caffeoyl-CoA O-methyltransferase confers quantitative resistance to multiple pathogens.

    Science.gov (United States)

    Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter

    2017-09-01

    Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.

  14. The Prevalence of acrA and acrB Genes Among Multiple-Drug Resistant Uropathogenic Escherichia coli Isolated From Patients With UTI in Milad Hospital, Tehran

    Directory of Open Access Journals (Sweden)

    Maleki

    2016-09-01

    Full Text Available Background Urinary tract infection (UTI is one of the most common infectious diseases and nosocomial infections worldwide, and uropathogenic Escherichia coli is the primary cause of UTI. Due to increased antibiotic resistance and the emergence of multidrug resistant (MDR UPEC clones, the treatment of UTI is difficult. The occurrence of MDR in E. coli has been attributed to the AcrAB-TolC complex of efflux pumps. Objectives The aim of this study was to complete a frequency evaluation of acrA and acrB genes among UPEC MDR strains isolated from patients with UTI who were admitted to Milad hospital in Tehran. Methods For 123 UPEC strains that were isolated and diagnosed from the urine samples of patients using biochemical tests, antibiotic susceptibility was carried out using the disc diffusion method according to CLSI guidelines. Isolates that were resistant to at least one antimicrobial agent in three or more of the categories were considered to be MDR. The presence and frequency of acrA and acrB genes was determined using PCR. Results The rates of antibiotic resistance to ampicillin, cefalotin, tetracycline, cefazolin, ceftriaxone, ceftizoxime, ceftazidime, ciprofloxacin, and cotrimoxazole were 82.9%, 78.1%, 61.1%, 49.5%, 38.2%, 30.2%, 26.1%, 42.2%, and 60.1%, respectively. The isolates were most sensitive to nitrofurantoin (95.9%, gentamicin (77.2%, and amikacin (71.5%. A total of 78% of the isolates were MDR. The frequency of the acrA gene was 82.90%, the acrB gene was 95.90% and acrA + acrB was 95.90%. There was no significant difference between acrA and acrB frequency relating to bacterial antibiotic resistance. Conclusions Our results showed that ways to control the treatment of UTI for the prevention of MDR occurrence should be sought. For a better study of efflux pumps, a comprehensive and detailed study regarding the presence of efflux pumps gees is required.

  15. Non-p-glycoprotein-mediated multidrug resistance in detransformed rat cells selected for resistance to methylglyoxal bis(guanylhydrazone).

    Science.gov (United States)

    Weber, J M; Sircar, S; Horvath, J; Dion, P

    1989-11-01

    Three independent variants (G2, G4, G5), resistant to methylglyoxal bis(guanylhydrazone), an anticancer drug, have been isolated by single step selection from an adenovirus-transformed rat brain cell line (1). These variants display selective cross-resistance to several natural product drugs of dissimilar structure and action. Multidrug resistance has recently been shown to be caused by overexpression of the membrane-associated p-glycoprotein, most often caused by amplification of the mdr gene. Several types of experiments were conducted to determine whether the observed drug resistance in our cell lines could be due to changes at the mdr locus. The following results were obtained: (a) the mdr locus was not amplified; (b) transcription of the mdr gene and p-glycoprotein synthesis were not increased; (c) multidrug resistance cell lines, which carry an amplified mdr locus, were not cross-resistant to methylglyoxal bis(guanylhydrazone); (d) verapamil did not reverse the resistance of G cells or mdr cells to methylglyoxal bis(guanylhydrazone), nor that of G cells to vincristine; and (e) methylglyoxal bis(guanylhydrazone) resistance was recessive and depended on a block to drug uptake, as opposed to mdr cells which are dominant and express increased drug efflux. The results obtained suggest that the drug resistance in the G2, G4, and G5 cells was atypical and may be due to a mechanism distinct from that mediated by the mdr locus.

  16. Pharmacological modification of multi-drug resistance (MDR) in vitro detected by a novel fluorometric microculture cytotoxicity assay. Reversal of resistance and selective cytotoxic actions of cyclosporin A and verapamil on MDR leukemia T-cells.

    Science.gov (United States)

    Larsson, R; Nygren, P

    1990-07-15

    A novel fluorometric microculture cytotoxicity assay (FMCA), based on measurements of fluorescein diacetate (FDA) hydrolysis and DNA staining by Hoechst 33342, was used for drug sensitivity testing and detection of resistance reversal in acute lymphoblastic leukemia (ALL) cell lines. The 72-hr assay was found to be sensitive, reproducible and linearly related to the number of viable cells within a broad range of cell concentrations. At clinically achievable drug concentrations, the calcium channel blocker Verapamil (ver) and the immunosuppressant Cyclosporin A (csA) were found to partly reverse acquired Vincristine (vcr) resistance in multi-drug resistant (MDR) T-ALL L100 cells with little or no effect on the drug-sensitive parental L0 cell line. By combining the fluorometric indices, we found that low concentrations of csA were growth-inhibitory, whereas higher concentrations (greater than 10 micrograms/ml) were progressively cytotoxic for drug-sensitive L0 cells. In MDR L100 cells, on the other hand, csA produced significant cell kill even at low drug concentrations. Ver had no effects on sensitive L0 cells but showed considerable cytotoxic action towards MDR L100 cells. There was no apparent relationship between drug reversal of vcr resistance and the cytotoxic actions of the drug per se since the calcium channel blocker diltiazem (dil) significantly potentiated the actions of vcr on MDR L100 cells without being more toxic to these cells (compared to vcr-sensitive L0 cells).

  17. Distinct genotype distribution and haplotype profiles in MDR1 gene among Chinese Han, Bai, Wa and Tibetan ethnic groups.

    Science.gov (United States)

    Lai, Yong; Huang, Min; Li, Hui; Wang, Xue-Ding; Li, Jia-Li

    2012-11-01

    P-Glycoprotein (P-gp, encoded by MDR1 gene) plays an important role in determining bioavailability and pharmacologic effects of many drugs. There is increasing evidence that P-gp activity may be genetically determined. In this study, we investigated the genotype distribution and the haplotype profiles of MDR1 gene in Chinese Han, Bai, Wa and Tibetan subjects. Much lower frequencies of the 1236T allele and the 2677T allele were found in Wa subjects than those in other three ethnic groups, while the 2677A allele was found about 6-fold more frequently in Han subjects than in subjects of other three ethnic groups. The Han, Bai and Tibetan subjects share the same three predominant haplotypes (T-T-T, T-G-C and C-G-C), and T-T-T is the highest and accounts for more than one third of the number of haplotypes in the subjects from each ethnic group. However, T-T-T was less common than T-G-C, T-G-T and C-G-C and occurring at only 13.8% in Wa subjects, furthermore, higher frequencies of T-G-T, C-T-C, C-G-T and C-T-T were observed in Wa subjects compared to those in other three ethnic groups. Frequencies of C-A-C and T-A-C in Han subjects were higher than those in other three ethnic groups. The findings of this study will be of some relevance in predicting MDR1 phenotype and pharmacokinetics as well as pharmacodynamic effects of many commonly used drugs that are P-gp substrates in these four Chinese ethnic groups.

  18. vPARP Adjusts MVP Expression in Drug-resistant Cell Lines in Conjunction with MDR Proteins.

    Science.gov (United States)

    Wojtowicz, Karolina; Januchowski, Radoslaw; Nowicki, Michal; Zabel, Maciej

    2017-06-01

    The definition of vault (ribonucleoprotein particles) function remains highly complex. Vaults may cooperate with multidrug resistance (MDR) proteins, supporting their role in drug resistance. This topic is the main theme of this publication. The cell viability was determined by an MTT assay. The protein expression was detected by western blot analysis. The proteins were knocked-down using siRNA. No major vault protein (MVP) in the LoVo/Dx and W1PR cell lines after tunicamycin treatment was shown. In W1PR cells with knocked-down MVP, a statistically significant decrease in cell viability was noted. In LoVo/Dx, W1TR and A2780TR cells were vault poly-ADP-ribose polymerase (vPARP) was knockdown, a decrease in cell viability was shown. Also, MVP silencing induced an increase in glycoprotein P (Pgp) expression in LoVo/Dx cells. MVP is important for the drug resistance of cancer cells, but it probably requires the presence of vPARP for full activation. Some correlations between MDR proteins and vaults exist. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  19. The consequences of a sudden demographic change on the seroprevalence pattern, virulence genes, identification and characterisation of integron-mediated antibiotic resistance in the Salmonella enterica isolated from clinically diarrhoeic humans in Egypt.

    Science.gov (United States)

    Osman, K M; Hassan, W M M; Mohamed, R A H

    2014-08-01

    The present study was undertaken to identify and characterise integrons and integrated resistance gene cassettes among eight multidrug-resistant (MDR) Salmonella serovars isolated from humans in Egypt. Virulotyping by polymerase chain reaction (PCR) was used for the detection of the presence of virulence genes. Integron PCR was used to detect the presence of class 1 in the MDR strains. The associated individual resistance gene cassettes were identified using specific PCRs. The isolated serovars were Salmonella Grampian (C1; 2/5), Larose (C1; 1/5), Hato (B; 1/5) and Texas (B; 1/5). Among the Salmonella serovars, five Salmonella isolates showed the highest resistance to amoxicillin, ampicillin, chloramphenicol, lincomycin, gentamicin, nalidixic acid, streptomycin and trimethoprim (100%), followed by neomycin, norfloxacin and tetracycline (80%), while the lowest resistance was recorded to colistin sulphate and ciprofloxacin in percentages of 20 and 40%, respectively. The invA, avrA, ssaQ, mgtC, siiD and sopB genes were detected in all isolates (100%), while the spvC and gipA genes were totally (100%) absent from all isolates. The remaining three virulence genes were diversely distributed as follows: the bcfC gene was detected in all isolates except Salmonella Hato (80%); the sodC1 gene was detected only in Salmonella Grampian and Salmonella Texas (60%); and the sopE1 gene was detected only in Salmonella Grampian, Hato and Texas (60%). Class 1 integrons were detected in 90% of the MDR isolates, comprising serovars Muenster, Florian, Noya, Grampian, Larose, Hato and Texas. Of the class 1 integron-positive isolates, 45% harboured Salmonella genomic island 1 (SGI1) either right junction or right and left junction having an A-C-S-T phenotype. Of the class 1 integron-positive isolates, 44% harboured integron gene cassette aadA2, while 11% harboured the floR gene present in multidrug resistance flanked by two integrons of SGI1. The results of the present study indicate that

  20. Analysis of multi drug resistant tuberculosis (MDR-TB) financial protection policy: MDR-TB health insurance schemes, in Chhattisgarh state, India.

    Science.gov (United States)

    Kundu, Debashish; Sharma, Nandini; Chadha, Sarabjit; Laokri, Samia; Awungafac, George; Jiang, Lai; Asaria, Miqdad

    2018-01-27

    There are significant financial barriers to access treatment for multi drug resistant tuberculosis (MDR-TB) in India. To address these challenges, Chhattisgarh state in India has established a MDR-TB financial protection policy by creating MDR-TB benefit packages as part of the universal health insurance scheme that the state has rolled out in their effort towards attaining Universal Health Coverage for all its residents. In these schemes the state purchases health insurance against set packages of services from third party health insurance agencies on behalf of all its residents. Provider payment reform by strategic purchasing through output based payments (lump sum fee is reimbursed as per the MDR-TB benefit package rates) to the providers - both public and private health facilities empanelled under the insurance scheme was the key intervention. To understand the implementation gap between policy and practice of the benefit packages with respect to equity in utilization of package claims by the poor patients in public and private sector. Data from primary health insurance claims from January 2013 to December 2015, were analysed using an extension of 'Kingdon's multiple streams for policy implementation framework' to explain the implementation gap between policy and practice of the MDR-TB benefit packages. The total number of claims for MDR-TB benefit packages increased over the study period mainly from poor patients treated in public facilities, particularly for the pre-treatment evaluation and hospital stay packages. Variations and inequities in utilizing the packages were observed between poor and non-poor beneficiaries in public and private sector. Private providers participation in the new MDR-TB financial protection mechanism through the universal health insurance scheme was observed to be much lower than might be expected given their share of healthcare provision overall in India. Our findings suggest that there may be an implementation gap due to weak

  1. Molecular characterization of multidrug-resistant Klebsiella pneumoniae isolates

    Directory of Open Access Journals (Sweden)

    Xiang-hua Hou

    2015-09-01

    Full Text Available Klebsiella pneumoniae is an important cause of healthcare-associated infections worldwide. Selective pressure, the extensive use of antibiotics, and the conjugational transmission of antibiotic resistance genes across bacterial species and genera facilitate the emergence of multidrug-resistant (MDR K. pneumoniae. Here, we examined the occurrence, phenotypes and genetic features of MDR K. pneumoniae isolated from patients in intensive care units (ICUs at the First Affiliated Hospital of Xiamen University in Xiamen, China, from January to December 2011. Thirty-eight MDR K. pneumoniae strains were collected. These MDR K. pneumoniae isolates possessed at least seven antibiotic resistance determinants, which contribute to the high-level resistance of these bacteria to aminoglycosides, macrolides, quinolones and β-lactams. Among these isolates, 24 strains were extended-spectrum β-lactamase (ESBL producers, 2 strains were AmpC producers, and 12 strains were both ESBL and AmpC producers. The 38 MDR isolates also contained class I (28/38 and class II integrons (10/38. All 28 class I-positive isolates contained aacC1, aacC4, orfX, orfX’ and aadA1 genes. β-lactam resistance was conferred through blaSHV (22/38, blaTEM (10/38, and blaCTX-M (7/38. The highly conserved blaKPC-2 (37/38 and blaOXA-23(1/38 alleles were responsible for carbapenem resistance, and a gyrAsite mutation (27/38 and the plasmid-mediated qnrB gene (13/38 were responsible for quinolone resistance. Repetitive-sequence-based PCR (REP-PCR fingerprinting of these MDR strains revealed the presence of five groups and sixteen patterns. The MDR strains from unrelated groups showed different drug resistance patterns; however, some homologous strains also showed different drug resistance profiles. Therefore, REP-PCR-based analyses can provide information to evaluate the epidemic status of nosocomial infection caused by MDR K. pneumoniae; however, this test lacks the power to discriminate some

  2. Association of the multidrug resistance-1 gene single-nucleotide polymorphisms with the tacrolimus dose requirements in renal transplant recipients.

    Science.gov (United States)

    Anglicheau, Dany; Verstuyft, Céline; Laurent-Puig, Pierre; Becquemont, Laurent; Schlageter, Marie-Hélène; Cassinat, Bruno; Beaune, Philippe; Legendre, Christophe; Thervet, Eric

    2003-07-01

    The immunosuppressive drug tacrolimus, whose pharmacokinetic characteristics display large interindividual variations, is a substrate for P-glycoprotein (P-gp), the product of the multidrug resistance-1 (MDR1) gene. Some of the single nucleotide polymorphisms (SNP) of MDR1 reported correlated with the in vivo activity of P-gp. Because P-gp is known to control tacrolimus intestinal absorption, it was postulated that these polymorphisms are associated with tacrolimus pharmacokinetic variations in renal transplant recipients. The objective of this study was to evaluate in a retrospective study of 81 renal transplant recipients the effect on tacrolimus dosages and concentration/dose ratio of four frequent MDR1 SNP possibly associated with P-gp function (T-129C in exon 1b, 1236C>T in exon 12, 2677G>T,A in exon 21, and 3435C>T in exon 26). As in the general population, the SNP in exons 12, 21, and 26 were frequent (16, 17.3, and 22.2% for the variant homozygous genotype, respectively) and exhibited incomplete linkage disequilibrium. One month after tacrolimus introduction, exon 21 SNP correlated significantly with the daily tacrolimus dose (P < or = 0.05) and the concentration/dose ratio (P < or = 0.02). Tacrolimus dose requirements were 40% higher in homozygous than wild-type patients for this SNP. The concentration/dose ratio was 36% lower in the wild-type patients, suggesting that, for a given dose, their tacrolimus blood concentration is lower. Haplotype analysis substantiated these results and suggested that exons 26 and 21 SNP may be associated with tacrolimus dose requirements. Genotype monitoring of the MDR1 gene reliably predicts the optimal dose of tacrolimus in renal transplant recipients and may predict the initial daily dose needed by individual patients to obtain adequate immunosuppression.

  3. Efficacy of moxifloxacin & econazole against multidrug resistant (MDR Mycobacterium tuberculosis in murine model

    Directory of Open Access Journals (Sweden)

    U D Gupta

    2015-01-01

    Full Text Available Background & objectives: Studies have shown the bactericidal potential of econazole and clotrimazole against Mycobacterium tuberculosis under in vitro and ex vivo conditions along with their synergism with conventional antituberculosis drugs. These molecules were also found to be effective against different multidrug resistant (MDR M. tuberculosis isolates in vitro. Hence the present study was designed to evaluate the in vivo antimycobacterial potential of moxifloxacin and econazole alone and in combination against multidrug resistant tuberculosis (MDR-TB in a mice model. Methods: Mice were infected with 2.5×10 [7] bacilli of MDR strain of M. tuberculosis by aerosol route of infection. After four weeks of infection, chemotherapy was started orally by moxifloxacin 8.0 mg/kg body wt and econazole 3.3 mg/kg alone and in combination, as well as with four first line anti-tuberculosis drugs as a positive control. The animals were sacrificed and the lungs and spleen were excised under aspetic conditions. The tissues were homogenized with sterile normal saline, an aliquot of the homogenate was plated on Middlebrook 7H11 agar supplemented with oleate albumin dextrose catalase (OADC and incubated at 37°C for four weeks. The number of visible and individual colonies were counted. Results: The first line anti-tuberculosis drugs (RIF+INH+EMB+PZA after eight weeks of therapy had no impact as the bacillary load in lungs and spleens remained unchanged. However, econazole, moxifloxacin alone as well as in combination significantly reduced the bacillary load in lungs as well as in spleens of MDR-TB bacilli infected mice. Interpretation & conclusions: Co-administration of the two drugs (econazole and moxifloxacin to MDR-TB strain JAL-7782 infected mice exhibited additive effect, the efficacy of the drugs in combination being higher as compared with ECZ or MOX alone. These results were substantiated by histopathological studies. This study suggests the utility of

  4. Lack of Association of Multidrug Resistance Gene-1 Polymorphisms with Treatment Outcome in Chronic Myeloid Leukemia Patients Treated with Imatinib

    Directory of Open Access Journals (Sweden)

    Yaya Kassogue

    2015-10-01

    Full Text Available Background: Despite the impressive results obtained with imatinib, inadequate response or resistance are observed in certain patients. It is known that imatinib is a substrate of a multidrug resistance gene (MDR1. Thus, interindividual genetic differences linked to single nucleotide polymorphisms in MDR1 may influence the metabolism of imatinib. The present study has aimed to examine the impact of MDR1 polymorphisms on the hematologic and cytogenetic responses in 70 chronic myeloid leukemia patients who received imatinib. Methods: We used a polymerase chain reaction followed by restriction fragment length polymorphism to identify different profiles of 1236C>T, 2677G>T and 3435C>T in MDR1. Results: The distribution of the three SNPs in responders and poor responders did not show any particular trend (P>0.05. The T allele was slightly higher in responders, but not significantly regardless of the type of SNP (40.3% vs. 33.8% for 1236C>T; 25% vs. 14.7% for 2677G>T and 33.3% vs. 22% for 3435C>T. The dominant model showed a similar trend (P>0.05. Diplotypes composed by the T allele in different exons were frequent in responders. Haplotype analysis showed that 1236C-2677G-3435C was slightly higher in poor responders (60.02% compared to responders (50.42%. However, 1236T-2677T-3435T was frequent in responders (16.98% compared to poor responders (13.1%. Overall, none of the haplotypes were associated with IM response in our cohort (global haplotype association test, P=0.39. Conclusion: The identification of 1236C>T, 2677G>T and 3435C>T polymorphisms may not be advantageous to predict imatinib response for our chronic myeloid leukemia patients.

  5. Psychiatric disorders in patients with multidrug resistant tuberculosis (MDR-TB in Sardjito Hospital, Yogyakarta, Indonesia

    Directory of Open Access Journals (Sweden)

    Irwan Supriyanto

    2017-08-01

    Full Text Available Introduction: Tuberculosis has become a chronic debilitating disease in developing countries, particularly after the emergence of multidrug resistant tuberculosis (MDR-TB. Second line treatments for the disease which were subsequently developed were associated with psychiatric disorders among patients. Psychiatric disorder can either be induced by treatment regiments or psychosocial factors. Cycloserine administration is frequently reported to be associated with psychiatric disorders. In this study, we examined the prevalence and characteristics of psychiatric disorders among MDR-TB patients in Sardjito Hospital, Yogyakarta, Indonesia. Methods: In this descriptive study, we studied medical records of MDR-TB patients admitted for MDR-TB treatments to Sardjito Hospital from January 2014 to July 2016 and screened for psychiatric disorders. Results: We found that 32.8% of the patients had psychiatric disorders, some of which had multiple psychiatric diagnoses (14.1%. The diagnoses were medication induced delirium, substance/medication induced psychotic disorder, substance/medication use depressive disorder, depressive type schizoaffective disorder, bipolar I disorder current episode severe manic with psychotic features, mild depression, moderate depression, major depression without psychotic features, major depression with psychotic features, adjustment disorders with mixed anxiety and depressed mood, adjustment disorder with anxiety, acute stress disorder, and insomnia. Psychiatric disorders were significantly associated with cycloserine dose and sex. Psychotic symptoms were significantly associated with sex and level of education. Conclusion: The presence of psychiatric disorders might disturb MDR-TB treatment resulting in poor outcomes. Precaution and prompt managements are required for psychiatric disorders in patients receiving MDR-TB treatment regiments.

  6. Sequence Analysis of IncA/C and IncI1 Plasmids Isolated from Multidrug-Resistant Salmonella Newport Using Single-Molecule Real-Time Sequencing.

    Science.gov (United States)

    Cao, Guojie; Allard, Marc; Hoffmann, Maria; Muruvanda, Tim; Luo, Yan; Payne, Justin; Meng, Kevin; Zhao, Shaohua; McDermott, Patrick; Brown, Eric; Meng, Jianghong

    2018-04-05

    Multidrug-resistant (MDR) plasmids play an important role in disseminating antimicrobial resistance genes. To elucidate the antimicrobial resistance gene compositions in A/C incompatibility complex (IncA/C) plasmids carried by animal-derived MDR Salmonella Newport, and to investigate the spread mechanism of IncA/C plasmids, this study characterizes the complete nucleotide sequences of IncA/C plasmids by comparative analysis. Complete nucleotide sequencing of plasmids and chromosomes of six MDR Salmonella Newport strains was performed using PacBio RSII. Open reading frames were assigned using prokaryotic genome annotation pipeline (PGAP). To understand genomic diversity and evolutionary relationships among Salmonella Newport IncA/C plasmids, we included three complete IncA/C plasmid sequences with similar backbones from Salmonella Newport and Escherichia coli: pSN254, pAM04528, and peH4H, and additional 200 draft chromosomes. With the exception of canine isolate CVM22462, which contained an additional IncI1 plasmid, each of the six MDR Salmonella Newport strains contained only the IncA/C plasmid. These IncA/C plasmids (including references) ranged in size from 80.1 (pCVM21538) to 176.5 kb (pSN254) and carried various resistance genes. Resistance genes floR, tetA, tetR, strA, strB, sul, and mer were identified in all IncA/C plasmids. Additionally, bla CMY-2 and sugE were present in all IncA/C plasmids, excepting pCVM21538. Plasmid pCVM22462 was capable of being transferred by conjugation. The IncI1 plasmid pCVM22462b in CVM22462 carried bla CMY-2 and sugE. Our data showed that MDR Salmonella Newport strains carrying similar IncA/C plasmids clustered together in the phylogenetic tree using chromosome sequences and the IncA/C plasmids from animal-derived Salmonella Newport contained diverse resistance genes. In the current study, we analyzed genomic diversities and phylogenetic relationships among MDR Salmonella Newport using complete plasmids and chromosome

  7. FLT3-ITD and MLL-PTD influence the expression of MDR-1, MRP-1, and BCRP mRNA but not LRP mRNA assessed with RQ-PCR method in adult acute myeloid leukemia.

    Science.gov (United States)

    Nasilowska-Adamska, Barbara; Solarska, Iwona; Paluszewska, Monika; Malinowska, Iwona; Jedrzejczak, Wieslaw W; Warzocha, Krzysztof

    2014-04-01

    Fms-like tyrosine kinase 3-internal tandem duplication (FLT3-ITD) and mixed-lineage leukemia gene-partial tandem duplication (MLL-PTD) are aberrations associated with leukemia which indicate unsatisfactory prognosis. Downstream regulatory targets of FLT3-ITD and MLL-PTD are not well defined. We have analyzed the expression of MDR-1, multidrug resistant protein-1 (MRP-1), breast cancer resistance protein (BCRP), and lung resistance protein (LRP) messenger RNA (mRNA) in relation to the mutational status of FLT3-ITD and MLL-PTD in 185 acute myeloid leukemia (AML) adult patients. The real-time quantitative polymerase chain reaction method was performed to assess the expression of the MDR-1, MRP-1, BCRP, and LRP mRNA, and the results were presented as coefficients calculated using an intermediate method according to Pfaffl's rule. Significantly higher expressions of MDR-1 mRNA were found in patients who did not harbor FLT3-ITD (0.20 vs. 0.05; p = 0.0001) and MRP-1 mRNA in patients with this mutation (0.96 vs. 0.70; p = 0.002) and of BCRP mRNA in patients with MLL-PTD (0.61 vs. 0.38; p = 0.03). In univariate analysis, the high expression of MDR-1 mRNA (≥0.1317) negatively influenced the outcome of induction therapy (p = 0.05), whereas the high expression of BCRP mRNA (≥1.1487) was associated with a high relapse rate (RR) (p = 0.013). We found that the high expression of MDR-1 (≥0.1317), MRP-1 (≥0.8409), and BCRP mRNA (≥1.1487) significantly influenced disease-free survival (DFS; p = 0.059, 0.032, and 0.009, respectively) and overall survival (0.048, 0.014, and 0.059, respectively). Moreover, a high expression of BCRP mRNA (≥1.1487) proved to be an independent prognostic factor for RR (p = 0.01) and DFS (p = 0.002) in multivariate analysis. The significant correlation between the expression of MDR-1, MRP-1, and BCRP mRNA and FLT3-ITD or MLL-PTD in AML patients requires further investigation.

  8. Multimodal transfer of MDR by exosomes in human osteosarcoma.

    Science.gov (United States)

    Torreggiani, Elena; Roncuzzi, Laura; Perut, Francesca; Zini, Nicoletta; Baldini, Nicola

    2016-07-01

    Exosomes are extracellular vesicles released by both normal and tumour cells which are involved in a new intercellular communication pathway by delivering cargo (e.g., proteins, microRNAs, mRNAs) to recipient cells. Tumour-derived exosomes have been shown to play critical roles in different stages of tumour growth and progression. In this study, we investigated the potential role of exosomes to transfer the multidrug resistance (MDR) phenotype in human osteosarcoma cells. Exosomes were isolated by differential centrifugation of culture media from multidrug resistant human osteosarcoma MG-63DXR30 (Exo/DXR) and MG-63 parental cells (Exo/S). Exosome purity was examined by transmission electron microscopy and confirmed by immunoblot analysis for the expression of specific exosomal markers. Our data showed that exosomes derived from doxorubicin-resistant osteosarcoma cells could be taken up into secondary cells and induce a doxorubicin-resistant phenotype. The incubation of osteosarcoma cells with Exo/DXR decreased the sensitivity of parental cells to doxorubicin, while exposure with Exo/S was ineffective. In addition, we demonstrated that Exo/DXR expressed higher levels of MDR-1 mRNA and P-glycoprotein compared to Exo/S (p=0.03). Interestingly, both MDR-1 mRNA and P-gp increased in MG-63 cells after incubation with Exo/DXR, suggesting this as the main mechanism of exosome-mediated transfer of drug resistance. Our findings suggest that multidrug resistant osteosarcoma cells are able to spread their ability to resist the effects of doxorubicin treatment on sensitive cells by transferring exosomes carrying MDR-1 mRNA and its product P-glycoprotein.

  9. Effects of genetic polymorphisms of CYP2C19*2/*3 and MDR1 C3435T on the pharmacokinetics of lansoprazole in healthy Chinese subjects.

    Science.gov (United States)

    Zhang, Yu-Xin; Wei, Shi-Jie; Yang, Xiao-Ying; Zhang, Wen-Ping; Wang, Xin-Yu; Dang, Hong-Wan

    2014-10-01

    To evaluate the influence of CYP2C19*2/*3 and MDR1 C3435T polymorphisms on the pharmacokinetics of lansoprazole (LPZ) in healthy Chinese subjects. All 24 subjects were from a study of bioequivalence. Plasma concentrations of LPZ were determined by liquid chromatography/mass spectrometry. Cytochrome P450 (CYP) 2C19*2/*3 and multidrug resistance transporter gene 1 (MDR1) C3435T of the subjects were genotyped by polymerase chain reaction-restriction fragment length polymorphism. Significant differences were found in the area under the concentration-time curve from predose to T (AUC(0-T)), area under the concentration-time curve from predose to infinity (AUC(0-∞), t(1/2)), and apparent oral clearance (CL/F) of LPZ between CYP2C19 extensive metabolizers and intermediate metabolizers (p < 0.05). The AUC(0-T), AUC(0-∞), maximum plasma concentration, and CL/F of LPZ were significantly different between subjects with the MDR1 C3435T C/C, C/T, and T/T polymorphisms (p < 0.05). CYP2C19*2/*3 and MDR1 C3435T polymorphisms are important determinants of LPZ pharmacokinetics.

  10. Multiple Origins of Mutations in the mdr1 Gene--A Putative Marker of Chloroquine Resistance in P. vivax.

    Directory of Open Access Journals (Sweden)

    Mette L Schousboe

    2015-11-01

    Full Text Available Chloroquine combined with primaquine has been the recommended antimalarial treatment of Plasmodium vivax malaria infections for six decades but the efficacy of this treatment regimen is threatened by chloroquine resistance (CQR. Single nucleotide polymorphisms (SNPs in the multidrug resistance gene, Pvmdr1 are putative determinants of CQR but the extent of their emergence at population level remains to be explored.In this study we describe the prevalence of SNPs in the Pvmdr1 among samples collected in seven P. vivax endemic countries and we looked for molecular evidence of drug selection by characterising polymorphism at microsatellite (MS loci flanking the Pvmdr1 gene.We examined the prevalence of SNPs in the Pvmdr1 gene among 267 samples collected from Pakistan, Afghanistan, Sri Lanka, Nepal, Sudan, São Tomé and Ecuador. We measured and diversity in four microsatellite (MS markers flanking the Pvmdr1 gene to look evidence of selection on mutant alleles.SNP polymorphism in the Pvmdr1 gene was largely confined to codons T958M, Y976F and F1076L. Only 2.4% of samples were wildtype at all three codons (TYF, n = 5, 13.3% (n = 28 of the samples were single mutant MYF, 63.0% of samples (n = 133 were double mutant MYL, and 21.3% (n = 45 were triple mutant MFL. Clear geographic differences in the prevalence of these Pvmdr mutation combinations were observed. Significant linkage disequilibrium (LD between Pvmdr1 and MS alleles was found in populations sampled in Ecuador, Nepal and Sri Lanka, while significant LD between Pvmdr1 and the combined 4 MS locus haplotype was only seen in Ecuador and Sri Lanka. When combining the 5 loci, high level diversity, measured as expected heterozygosity (He, was seen in the complete sample set (He = 0.99, while He estimates for individual loci ranged from 0.00-0.93. Although Pvmdr1 haplotypes were not consistently associated with specific flanking MS alleles, there was significant differentiation between geographic

  11. Development of PET and SPECT radiopharmaceuticals to study multi-drug resistance (MDR)

    International Nuclear Information System (INIS)

    Katsififs, A.; Dikic, B.; Greguric, I.; Knott, R.; Mattner, F.

    2002-01-01

    Full text: Cellular resistance or Multidrug Resistance (MDR) to cytotoxic agents is the major cause of treatment failure in many human cancers. P-glycoprotein (Pgp), a Mr 17,0000 transmembrane protein and Multi Resistance Protein (MRP) are two proteins that are over expressed and confer resistance to a large number of chemotherapeutic agents by enhancing their extracellular transport. P-glycoprotein is expressed at a relative high level in treated and untreated human malignant tumours, including renal, colonic, adrenal, hepatocellular carcinoma and a considerable percentage of breast carcinomas. 99m Tc-Sestamibi, a lipophilic cationic complex is a transport substrate for Pgp. In clinical studies of human neoplasms it was found that tumour uptake and clearance of this tracer correlate with Pgp expression and may be used for the phenotypic assessment of MDR. However, new tracers with better substrate specificity for Pgp and other drug transporters would greatly assist in optimising chemotherapeutic treatment and improving patient management by predicting tumour response to therapy and to assist in the development of antagonists, which may reverse or halt MDR. The aim of this project is therefore to develop PET and SPECT radiopharmaceuticals with improved affinity and selectivity for Pgp and MRP for the clinical evaluation of MDR in cancer patients. To optimise cellular transport characteristics, a number of chemical families that have been found to be substrates of Pgp and other drug efflux pumps, will be investigated. In the first instance, a series of drugs based on the flavonol natural product, Quercetin will be developed, screened for MDR and radiolabelled with PET and SPECT isotopes. Quercetin and related flavonol derivatives have been selected for this project because of their moderate to good affinity for Pgp. With the assistance of molecular modeling and in vitro studies, structural modification will be undertaken to improve the specificity and affinity for

  12. The Salmonella genomic island 1 is specifically mobilized in trans by the IncA/C multidrug resistance plasmid family.

    Science.gov (United States)

    Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Doublet, Benoît

    2010-12-20

    The Salmonella genomic island 1 (SGI1) is a Salmonella enterica-derived integrative mobilizable element (IME) containing various complex multiple resistance integrons identified in several S. enterica serovars and in Proteus mirabilis. Previous studies have shown that SGI1 transfers horizontally by in trans mobilization in the presence of the IncA/C conjugative helper plasmid pR55. Here, we report the ability of different prevalent multidrug resistance (MDR) plasmids including extended-spectrum β-lactamase (ESBL) gene-carrying plasmids to mobilize the multidrug resistance genomic island SGI1. Through conjugation experiments, none of the 24 conjugative plasmids tested of the IncFI, FII, HI2, I1, L/M, N, P incompatibility groups were able to mobilize SGI1 at a detectable level (transfer frequency IncA/C incompatibility group. Several conjugative IncA/C MDR plasmids as well as the sequenced IncA/C reference plasmid pRA1 of 143,963 bp were shown to mobilize in trans SGI1 from a S. enterica donor to the Escherichia coli recipient strain. Depending on the IncA/C plasmid used, the conjugative transfer of SGI1 occurred at frequencies ranging from 10(-3) to 10(-6) transconjugants per donor. Of particular concern, some large IncA/C MDR plasmids carrying the extended-spectrum cephalosporinase bla(CMY-2) gene were shown to mobilize in trans SGI1. The ability of the IncA/C MDR plasmid family to mobilize SGI1 could contribute to its spread by horizontal transfer among enteric pathogens. Moreover, the increasing prevalence of IncA/C plasmids in MDR S. enterica isolates worldwide has potential implications for the epidemic success of the antibiotic resistance genomic island SGI1 and its close derivatives.

  13. MDR1 P-glycoprotein transports endogenous opioid peptides

    NARCIS (Netherlands)

    Oude Elferink, R. P.; Zadina, J.

    2001-01-01

    MDR1 P-glycoprotein is generally regarded as an efflux pump for amphipathic toxic compounds. The question remains, however, whether certain endogenous compounds are also substrates for this transporter. Certain peptides have been shown to interact with MDR1 Pgp as well and we have therefore

  14. Molecular characterization of mutations associated with resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients from high prevalence tuberculosis city in Morocco.

    Science.gov (United States)

    Oudghiri, Amal; Karimi, Hind; Chetioui, Fouad; Zakham, Fathiah; Bourkadi, Jamal Eddine; Elmessaoudi, My Driss; Laglaoui, Amin; Chaoui, Imane; El Mzibri, Mohammed

    2018-02-27

    The emergence of extensively drug-resistant tuberculosis (XDR-TB) has raised public health concern for global TB control. Although multi drug-resistant tuberculosis (MDR- TB) prevalence and associated genetic mutations in Morocco are well documented, scarce information on XDR TB is available. Hence, the evaluation of pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drugs, is of great value for better management of M/XDR TB in Morocco. To evaluate pre-XDR and XDR prevalence, as well as the mutation status of gyrA, gyrB, rrs, tlyA genes and eis promoter region, associated with resistance to second line drug resistance, in 703 clinical isolates from TB patients recruited in Casablanca, and to assess the usefulness of molecular tools in clinical laboratories for better management of M/XDR TB in Morocco. Drug susceptibility testing (DST) was performed by the proportional method for first line drugs, and then the selected MDR isolates were tested for second line drugs (Ofloxacin, Kanamycin, Amikacin and Capreomycin). Along with DST, all samples were subjected to rpoB, katG and p-inhA mutation analysis by PCR and DNA sequencing. MDR isolates as well as 30 pan-susceptible strains were subjected to PCR and DNA sequencing of gyrA, gyrB, rrs, tlyA genes and eis promoter, associated with resistance to fluoroquinolones and injectable drugs. Among the 703 analysed strains, 12.8% were MDR; Ser531Leu and Ser315Thr being the most common recorded mutations within rpoB and katG genes associated with RIF and INH resistance respectively. Drug susceptibility testing for second line drugs showed that among the 90 MDR strains, 22.2% (20/90) were resistant to OFX, 2.22% (2/90) to KAN, 3.33% (3/90) to AMK and 1.11% (1/90) to CAP. Genotypic analysis revealed that 19 MDR strains harbored mutations in the gyrA gene; the most recorded mutation being Asp91Ala accounting for 47.6% (10

  15. Characteristics of plasmids in multi-drug-resistant Enterobacteriaceae isolated during prospective surveillance of a newly opened hospital in Iraq.

    Directory of Open Access Journals (Sweden)

    Xiao-Zhe Huang

    Full Text Available BACKGROUND: Gram-negative multidrug-resistant (MDR bacteria are major causes of nosocomial infections, and antibiotic resistance in these organisms is often plasmid mediated. Data are scarce pertaining to molecular mechanisms of antibiotic resistance in resource constrained areas such as Iraq. METHODOLOGY/PRINCIPAL FINDINGS: In this study, all MDR Enterobacteriaceae (n = 38 and randomly selected non-MDR counterparts (n = 41 isolated from patients, healthcare workers and environmental surfaces in a newly opened hospital in Iraq were investigated to characterize plasmids found in these isolates and determine their contribution to antibiotic resistance. Our results demonstrated that MDR E. coli and K. pneumoniae isolates harbored significantly more (≥ 3 plasmids compared to their non-MDR counterparts, which carried ≤ 2 plasmids (p<0.01. Various large plasmids (~52 to 100 kb from representative isolates were confirmed to contain multiple resistance genes by DNA microarray analysis. Aminoglycoside (acc, aadA, aph, strA/B, and ksgA, β-lactam (bla(TEM1, bla(AMPC, bla(CTX-M-15, bla(OXA-1, bla(VIM-2 and bla(SHV, sulfamethoxazole/trimethoprim (sul/dfr, tetracycline (tet and chloramphenicol (cat resistance genes were detected on these plasmids. Additionally, multiple plasmids carrying multiple antibiotic resistance genes were found in the same host strain. Genetic transfer-associated genes were identified on the plasmids from both MDR and non-MDR isolates. Seven plasmid replicon types (FII, FIA, FIB, B/O, K, I1 and N were detected in the isolates, while globally disseminated IncA/C and IncHI1 plasmids were not detected in these isolates. CONCLUSIONS/SIGNIFICANCE: This is the first report of the characteristics of the plasmids found in Enterobacteriaceae isolated following the opening of a new hospital in Iraq. The information provided here furthers our understanding of the mechanisms of drug resistance in this specific region and their evolutionary

  16. Different phenotypic and molecular mechanisms associated with multidrug resistance in Gram-negative clinical isolates from Egypt

    Directory of Open Access Journals (Sweden)

    Helmy OM

    2017-12-01

    Full Text Available Omneya M Helmy, Mona T Kashef Department of Microbiology and Immunology, Faculty of Pharmacy, Cairo University, Cairo, Egypt Objectives: We set out to investigate the prevalence, different mechanisms, and clonal relatedness of multidrug resistance (MDR among third-generation cephalosporin-resistant Gram-negative clinical isolates from Egypt.Materials and methods: A total of 118 third-generation cephalosporin-resistant Gram-negative clinical isolates were included in this study. Their antimicrobial susceptibility pattern was determined using Kirby–Bauer disk diffusion method. Efflux pump-mediated resistance was tested by the efflux-pump inhibitor-based microplate assay using chlorpromazine. Detection of different aminoglycoside-, β-lactam-, and quinolone-resistance genes was done using polymerase chain reaction. The genetic diversity of MDR isolates was investigated using random amplification of polymorphic DNA.Results: Most of the tested isolates exhibited MDR phenotypes (84.75%. The occurrence of efflux pump-mediated resistance in the different MDR species tested was 40%–66%. Acinetobacter baumannii isolates showed resistance to most of the tested antibiotics, including imipenem. The blaOXA-23-like gene was detected in 69% of the MDR A. baumannii isolates. The MDR phenotype was detected in 65% of Pseudomonas aeruginosa isolates, of which only 23% exhibited efflux pump-mediated resistance. On the contrary, efflux-mediated resistance to piperacillin and gentamicin was recorded in 47.5% of piperacillin-resistant and 25% of gentamicin-resistant MDR Enterobacteriaceae. Moreover, the plasmid-mediated quinolone-resistance genes (aac(6’-Ib-cr, qnrB, and qnrS were detected in 57.6% and 83.33% of quinolone-resistant MDR Escherichia coli and Klebsiella pneumoniae isolates, respectively. The β-lactamase-resistance gene blaSHV-31 was detected for the first time in one MDR K. pneumoniae isolate from an endotracheal tube specimen in Egypt

  17. Molecular Characterization of Multidrug Resistant Uropathogenic E. Coli Isolates from Jordanian Patients.

    Science.gov (United States)

    Nairoukh, Yacoub R; Mahafzah, Azmi M; Irshaid, Amal; Shehabi, Asem A

    2018-01-01

    Emergence of multi-drug resistant uropathogenic E. coli strains is an increasing problem to empirical treatment of urinary tract infections in many countries. This study investigated the magnitude of this problem in Jordan. A total of 262 E. coli isolates were recovered from urine samples of Jordanian patients which were suspected to have urinary tract infections (UTIs). All isolates were primarily identified by routine biochemical tests and tested for antimicrobial susceptibility by disc diffusion method. Fifty representative Multidrug Resistance (MDR) E. coli isolates to 3 or more antibiotic classes were tested for the presence of resistance genes of blaCTX-M- 1, 9 and 15, carbapenemase ( blaIMP, blaVIM, blaNDM-1, blaOXA-48 ), fluoroquinolones mutated genes ( parC and gyrA ) and clone of ST131 type using PCR methods. A total of 150/262 (57.3%) of E. coli isolates were MDR. Urine samples of hospitalized patients showed significantly more MDR isolates than outpatients. Fifty representative MDR E. coli isolates indicated the following molecular characteristics: All were positive for mutated parC gene and gyrA and for ST131 clone, and 78% were positive for genes of CTX-M-15 , 76% for CTX-M-I and for 8% CTX-M-9 , respectively. Additionally, all 50 MDR E. coli isolates were negative for carbapenemase genes ( blaIMP, blaVIM, blaNDM-1, blaOXA-48 ), except of one isolate was positive for blaKPC-2 . This study indicates alarming high rates recovery of MDR uropathogenic E. coli from Jordanian patients associated with high rates of positive ST131 clone, fluoroquinolone resistant and important types of blaCTX-M.

  18. Consolidating and Exploring Antibiotic Resistance Gene Data Resources

    DEFF Research Database (Denmark)

    Xavier, Basil Britto; Das, Anupam J.; Cochrane, Guy

    2016-01-01

    The unrestricted use of antibiotics has resulted in rapid acquisition of antibiotic resistance (AR) and spread of multidrug-resistant (MDR) bacterial pathogens. With the advent of next-generation sequencing technologies and their application in understanding MDR pathogen dynamics, it has become i...

  19. Inhibitory effect of the reversal agents V-104, GF120918 and Pluronic L61 on MDR1 Pgp-, MRP1- and MRP2-mediated transport

    NARCIS (Netherlands)

    Evers, R.; Kool, M.; Smith, A. J.; van Deemter, L.; de Haas, M.; Borst, P.

    2000-01-01

    The human multidrug transporter MDR1 P-glycoprotein and the multidrug resistance proteins MRP1 and MRP2 transport a range of cytotoxic drugs, resulting in multidrug resistance in tumour cells. To overcome this form of drug resistance in patients, several inhibitors (reversal agents) of these

  20. Correlation between ability of biofilm formation with their responsible genes and MDR patterns in clinical and environmental Acinetobacter baumannii isolates.

    Science.gov (United States)

    Bardbari, Ali Mohammadi; Arabestani, Mohammad Reza; Karami, Manoochehr; Keramat, Fariba; Alikhani, Mohammad Yousef; Bagheri, Kamran Pooshang

    2017-07-01

    Acinetobacter baumannii potential to form biofilm and exhibit multiple antibiotic resistances may be responsible in its survival in hospital environment. Accordingly, our study was aimed to determine the correlation between ability of biofilm formation and the frequency of biofilm related genes with antibiotic resistance phenotypes, and also the categorization of their patterns in clinical and environmental isolates. A total of 75 clinical and 32 environmental strains of the A. baumannii were collected and identified via API 20NE. Antibiotic susceptibility was evaluated by disk diffusion and microdilution broth methods. Biofilm formation assay was performed by microtiter plate method. OXA types and biofilm related genes including Bla OXA-51 , Bla OXA-23 , Bla OXA-24 , Bla OXA-58 , bap, bla PER-1 , and ompA were amplified by PCR. The rate of MDR A. baumannii in clinical isolates (100%) was higher than environmental (81.2%) isolates (p baumannii isolates was associated with biofilm formation. There was a significant correlation between multiple drug resistance and biofilm formation. The clinical isolates had a higher ability to form strong biofilms compared to the environmental samples. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Novel understanding of ABC transporters ABCB1/MDR/P-glycoprotein, ABCC2/MRP2, and ABCG2/BCRP in colorectal pathophysiology

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Svenningsen, Katrine; Knudsen, Lina Almind

    2015-01-01

    transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1....../Mdr1a, abcc2/Mrp2, abcg2/Bcrp, knock-out mice, tight junction, membrane lipid function. RESULTS: Recently, human studies reported that changes in the levels of ABC transporters were early events in the adenoma-carcinoma sequence leading to CRC. A link between ABCB1, high fat diet and gut microbes...

  2. Cyclooxygenase-2, multidrug resistance 1, and breast cancer resistance protein gene polymorphisms and inflammatory bowel disease in the Danish population

    DEFF Research Database (Denmark)

    Østergaard, Mette; Ernst, Anja; Labouriau, Rodrigo S.

    2009-01-01

    =0.006) and 1.39 ((0.99-1.92) p=0.054), respectively, and for UC of 2.63 ((1.33-5.26) p=0.005) and 1.28 ((0.96-1.51) p=0.093), respectively, assuming complete dominance. No association was found for BCRP or other MDR1 SNPs, or for selected MDR1 haplotypes. No effect-modification of smoking habit......OBJECTIVE: Crohn's disease (CD) and ulcerative colitis (UC) are characterized by an impaired mucosal defence to normal constituents of the intestinal flora and a dysregulated inflammatory response. The purpose of the study was to investigate whether single nucleotide polymorphisms (SNPs) in genes....../A, C3435T and G-rs3789243-A (intron 3) were assessed in a Danish case-control study comprising 373 CD and 541 UC patients and 796 healthy controls. RESULTS: Carriers of the homozygous COX-2 and MDR1 intron 3 variant had a relatively high risk of CD, odds ratio (95% CI) (OR (95% CI))=2.86 ((1.34-5.88) p...

  3. Imaging and Targeted Therapy of Multidrug Resistance. Final Report

    International Nuclear Information System (INIS)

    Piwnica-Worms, David

    2009-01-01

    One focus area of DOE Office of Science was the Imaging of Gene Expression in Health and Disease in real time in tissue culture, whole animals and ultimately patients. Investigators of the Molecular Imaging Group, Washington University Medical School, ascribed to this objective and a major focus of this group directly tied into the DOE program through their efforts targeting the multidrug resistance gene (MDR1). Our plans for continuation of the program were to extend and build on this line of investigation, incorporating new molecular tools into our methodology to selectively inhibit MDR1 gene expression with novel modulation strategies. Two approaches were to be pursued: (1) high throughput screening of compounds that disrupted mutant p53 transactivation of the MDR1 promoter, and (2) knockdown of MDR1 messenger RNA with retroviral-mediated delivery of small interfering RNA constructs. These would be combined with our continuing effort to synthesize ligands and examine structure-activity relationships of bis-salicylaldehydes labeled with gallium-68 to generate PET agents for imaging MDR1 P-glycoprotein function. We would be uniquely positioned to correlate therapeutic modulation of MDR1 gene expression and protein function in the same systems in vivo using PET and bioluminescence reporters. Use of animal models such as the mdr1a/1b(-/-) gene deleted mice would also have enabled refined analysis of modulation and tracer pharmacokinetics in vivo. Overall, this DOE program and resultant tools would enable direct monitoring of novel therapeutic strategies and the MDR phenotype in relation to gene expression and protein function in vivo.

  4. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Science.gov (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  5. Rapid Screening of MDR-TB in Cases of Extra Pulmonary Tuberculosis Using Geno Type MTBDRplus.

    Directory of Open Access Journals (Sweden)

    Richa Kumari

    Full Text Available Drug resistance in tuberculosis is a major public health challenge in developing countries. The limited data available on drug resistance in extra pulmonary tuberculosis stimulated us to design our study on anti-tuberculosis drug resistance pattern in cases of extra pulmonary tuberculosis in a tertiary referral hospital of North India. We performed Geno Type MTBDRplus assay in comparison with conventional drug susceptibility testing by proportion method to study the mutation patterns in rpoB, katG and inhA genes.A total of 510 extra pulmonary samples were included in this study. After the smear microscopy, all the specimens were subjected for culture on Lowenstein Jensen (LJ media. Phenotypic drug susceptibility testing (DST was performed on LJ media for all the MTB isolates and compared with the results of Geno Type MTBDRplus assay which was performed with the DNA isolated from the culture by conventional method.Of 510 specimens cultured, the total culture positivity obtained was 11.8% (60 encompassing 54 (10.6% Mycobacterium tuberculosis and 6 (1.2% non-tubercular mycobacteria (NTM. DST results by Geno Type MTBDRplus assay and solid culture methods were compared in 51 MTB isolates excluding the two Rif indeterminate and one invalid test. Geno Type MTBDRplus accurately identified 13 of 14 rifampicin-resistant strains, 14 of 15 isoniazid-resistant strains and 13 of 14 as multi drug resistant tuberculosis (MDR-TB in comparison with conventional method. Sensitivity and specificity were 92.86% and 97.30% respectively for detection of RIF resistance, 93.33% and 94.44% respectively for detection of INH resistance, 92.86% and 97.30% respectively for detection of MDR-TB, while the overall concordance of Geno Type MTBDRplus assay with conventional DST was 94.11%. The turn-around time for performing Geno Type MTBDRplus assay test was 48 hours.The problem of MDR in extra pulmonary tuberculosis (EPTB cannot be overlooked and due attention on patients

  6. Specificity of drug transport mediated by CaMDR1: a major facilitator ...

    Indian Academy of Sciences (India)

    Unknown

    CaMDR1 encodes a major facilitator superfamily (MFS) protein in Candida albicans whose expression has been linked to .... by plaque assay and the integration of CaMDR1 at the ... with recombinant virus, vAcCaMDR1 and cells infected.

  7. Proteus genomic island 1 (PGI1), a new resistance genomic island from two Proteus mirabilis French clinical isolates.

    Science.gov (United States)

    Siebor, Eliane; Neuwirth, Catherine

    2014-12-01

    To analyse the genetic environment of the antibiotic resistance genes in two clinical Proteus mirabilis isolates resistant to multiple antibiotics. PCR, gene walking and whole-genome sequencing were used to determine the sequence of the resistance regions, the surrounding genetic structure and the flanking chromosomal regions. A genomic island of 81.1 kb named Proteus genomic island 1 (PGI1) located at the 3'-end of trmE (formerly known as thdF) was characterized. The large MDR region of PGI1 (55.4 kb) included a class 1 integron (aadB and aadA2) and regions deriving from several transposons: Tn2 (blaTEM-135), Tn21, Tn6020-like transposon (aphA1b), a hybrid Tn502/Tn5053 transposon, Tn501, a hybrid Tn1696/Tn1721 transposon [tetA(A)] carrying a class 1 integron (aadA1) and Tn5393 (strA and strB). Several ISs were also present (IS4321, IS1R and IS26). The PGI1 backbone (25.7 kb) was identical to that identified in Salmonella Heidelberg SL476 and shared some identity with the Salmonella genomic island 1 (SGI1) backbone. An IS26-mediated recombination event caused the division of the MDR region into two parts separated by a large chromosomal DNA fragment of 197 kb, the right end of PGI1 and this chromosomal sequence being in inverse orientation. PGI1 is a new resistance genomic island from P. mirabilis belonging to the same island family as SGI1. The role of PGI1 in the spread of antimicrobial resistance genes among Enterobacteriaceae of medical importance needs to be evaluated. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  8. Evaluating the Role of Multidrug Resistance Protein 3 (MDR3) Inhibition in Predicting Drug-Induced Liver Injury Using 125 Pharmaceuticals.

    Science.gov (United States)

    Aleo, Michael D; Shah, Falgun; He, Kan; Bonin, Paul D; Rodrigues, A David

    2017-05-15

    The role of bile salt export protein (BSEP) inhibition in drug-induced liver injury (DILI) has been investigated widely, while inhibition of the canalicular multidrug resistant protein 3 (MDR3) has received less attention. This transporter plays a pivotal role in secretion of phospholipids into bile and functions coordinately with BSEP to mediate the formation of bile acid-containing biliary micelles. Therefore, inhibition of MDR3 in human hepatocytes was examined across 125 drugs (70 of Most-DILI-concern and 55 of No-DILI-concern). Of these tested, 41% of Most-DILI-concern and 47% of No-DILI-concern drugs had MDR3 IC 50 values of <50 μM. A better distinction across DILI classifications occurred when systemic exposure was considered where safety margins of 50-fold had low sensitivity (0.29), but high specificity (0.96). Analysis of physical chemical property space showed that basic compounds were twice as likely to be MDR3 inhibitors as acids, neutrals, and zwitterions and that inhibitors were more likely to have polar surface area (PSA) values of <100 Å 2 and cPFLogD values between 1.5 and 5. These descriptors, with different cutoffs, also highlighted a group of compounds that shared dual potency as MDR3 and BSEP inhibitors. Nine drugs classified as Most-DILI-concern compounds (four withdrawn, four boxed warning, and one liver injury warning in their approved label) had intrinsic potency features of <20 μM in both assays, thereby reinforcing the notion that multiple inhibitory mechanisms governing bile formation (bile acid and phospholipid efflux) may confer additional risk factors that play into more severe forms of DILI as shown by others for BSEP inhibitors combined with multidrug resistance-associated protein (MRP2, MRP3, MRP4) inhibitory properties. Avoiding physical property descriptors that highlight dual BSEP and MDR3 inhibition or testing drug candidates for inhibition of multiple efflux transporters (e.g., BSEP, MDR3, and MRPs) may be an effective

  9. Rapid genotyping assays for the 4-base pair deletion of canine MDR1/ABCB1 gene and low frequency of the mutant allele in Border Collie dogs.

    Science.gov (United States)

    Mizukami, Keijiro; Chang, Hye-Sook; Yabuki, Akira; Kawamichi, Takuji; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Yamato, Osamu

    2012-01-01

    P-glycoprotein, encoded by the MDR1 or ABCB1 gene, is an integral component of the blood-brain barrier as an efflux pump for xenobiotics crucial in limiting drug uptake into the central nervous system. Dogs homozygous for a 4-base pair deletion of the canine MDR1 gene show altered expression or function of P-glycoprotein, resulting in neurotoxicosis after administration of the substrate drugs. In the present study, the usefulness of microchip electrophoresis for genotyping assays detecting this deletion mutation was evaluated. Mutagenically separated polymerase chain reaction (MS-PCR) and real-time PCR assays were newly developed and evaluated. Furthermore, a genotyping survey was carried out in a population of Border Collies dogs in Japan to determine the allele frequency in this breed. Microchip electrophoresis showed advantages in detection sensitivity and time saving over other modes of electrophoresis. The MS-PCR assay clearly discriminated all genotypes. Real-time PCR assay was most suitable for a large-scale survey due to its high throughput and rapidity. The genotyping survey demonstrated that the carrier and mutant allele frequencies were 0.49% and 0.25%, respectively, suggesting that the mutant allele frequency in Border Collies is markedly low compared to that in the susceptible dog breeds such as rough and smooth Collies.

  10. Mice heterozygous for the Mdr2 gene demonstrate decreased PEMT activity and diminished steatohepatitis on the MCD diet.

    Science.gov (United States)

    Igolnikov, Alexander C; Green, Richard M

    2006-03-01

    The administration of a methionine and choline deficient (MCD) diet to mice serves as an animal model of NASH. The multidrug resistant 2 (Mdr2) P-glycoprotein encodes for the canalicular phospholipid transporter, and Mdr2 (+/-) mice secrete 40% less phosphatidylcholine than wild-type mice. We have hypothesized that phosphatidylethanolamine-N-methyl transferase (PEMT) up-regulation is a consequence of MCD diet administration, and is important for the pathogenesis of steatohepatitis in this model. However, the effect of decreased phosphatidylcholine secretion and modulation of PEMT on the development of diet-induced steatohepatitis in Mdr2 (+/-) mice has not been explored. Thus, the purpose of the study is to examine the effects of the MCD diet on Mdr2 (+/-) mice. Mdr2 (+/-) and Mdr2 (+/+) mice were treated with an MCD or control diet for up to 30 days, and the severity of steatohepatitis, PEMT activity and hepatic S-adenosylmethionine (SAM), and S-adenosylhomocysteine (SAH) levels were measured. Serum ALT levels, hepatic inflammation, and PEMT activity were significantly lower, and hepatic SAM:SAH ratios were significantly higher in Mdr2 (+/-) mice at 7 and 30 days on the MCD diet. Mdr2 (+/-) mice have diminished susceptibility to MCD diet-induced NASH, which is associated with a relative decrease in PEMT activity and increased SAM:SAH ratios.

  11. Mutations inside rifampicin-resistance determining region of rpoB gene associated with rifampicin-resistance in Mycobacterium tuberculosis.

    Science.gov (United States)

    Zaw, Myo T; Emran, Nor A; Lin, Zaw

    2018-04-26

    Rifampicin (RIF) plays a pivotal role in the treatment of tuberculosis due to its bactericidal effects. Because the action of RIF is on rpoB gene encoding RNA polymerase β subunit, 95% of RIF resistant mutations are present in rpoB gene. The majority of the mutations in rpoB gene are found within an 81bp RIF-resistance determining region (RRDR). Literatures on RIF resistant mutations published between 2010 and 2016 were thoroughly reviewed. The most commonly mutated codons in RRDR of rpoB gene are 531, 526 and 516. The possibilities of absence of mutation in RRDR of rpoB gene in MDR-TB isolates in few studies was due to existence of other rare rpoB mutations outside RRDR or different mechanism of rifampicin resistance. Molecular methods which can identify extensive mutations associated with multiple anti-tuberculous drugs are in urgent need so that the research on drug resistant mutations should be extended. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  12. Fungicide-driven evolution and molecular basis of multidrug resistance in field populations of the grey mould fungus Botrytis cinerea.

    Directory of Open Access Journals (Sweden)

    Matthias Kretschmer

    2009-12-01

    Full Text Available The grey mould fungus Botrytis cinerea causes losses of commercially important fruits, vegetables and ornamentals worldwide. Fungicide treatments are effective for disease control, but bear the risk of resistance development. The major resistance mechanism in fungi is target protein modification resulting in reduced drug binding. Multiple drug resistance (MDR caused by increased efflux activity is common in human pathogenic microbes, but rarely described for plant pathogens. Annual monitoring for fungicide resistance in field isolates from fungicide-treated vineyards in France and Germany revealed a rapidly increasing appearance of B. cinerea field populations with three distinct MDR phenotypes. All MDR strains showed increased fungicide efflux activity and overexpression of efflux transporter genes. Similar to clinical MDR isolates of Candida yeasts that are due to transcription factor mutations, all MDR1 strains were shown to harbor activating mutations in a transcription factor (Mrr1 that controls the gene encoding ABC transporter AtrB. MDR2 strains had undergone a unique rearrangement in the promoter region of the major facilitator superfamily transporter gene mfsM2, induced by insertion of a retrotransposon-derived sequence. MDR2 strains carrying the same rearranged mfsM2 allele have probably migrated from French to German wine-growing regions. The roles of atrB, mrr1 and mfsM2 were proven by the phenotypes of knock-out and overexpression mutants. As confirmed by sexual crosses, combinations of mrr1 and mfsM2 mutations lead to MDR3 strains with higher broad-spectrum resistance. An MDR3 strain was shown in field experiments to be selected against sensitive strains by fungicide treatments. Our data document for the first time the rising prevalence, spread and molecular basis of MDR populations in a major plant pathogen in agricultural environments. These populations will increase the risk of grey mould rot and hamper the effectiveness of

  13. Expression of LRP and MDR1 in locally advanced breast cancer predicts axillary node invasion at the time of rescue mastectomy after induction chemotherapy

    International Nuclear Information System (INIS)

    Schneider, José; Gonzalez-Roces, Severino; Pollán, Marina; Lucas, Raul; Tejerina, Armando; Martin, Miguel; Alba, Alfonso

    2001-01-01

    Axillary node status after induction chemotherapy for locally advanced breast cancer has been shown on multivariate analysis to be an independent predictor of relapse. However, it has been postulated that responders to induction chemotherapy with a clinically negative axilla could be spared the burden of lymphadenectomy, because most of them will not show histological nodal invasion. P-glycoprotein expression in the rescue mastectomy specimen has finally been identified as a significant predictor of patient survival. We studied the expression of the genes encoding multidrug resistance associated protein (MDR1) and lung cancer associated resistance protein (LRP) in formalin-fixed, paraffin-embedded tumor samples from 52 patients treated for locally advanced breast cancer by means of induction chemotherapy followed by rescue mastectomy. P-glycoprotein expression was assessed by means of immunohistochemistry before treatment in 23 cases, and by means of reverse-transcriptase-mediated polymerase chain reaction (RT-PCR) after treatment in 46 (6 failed). LRP expression was detected by means of immunohistochemistry, with the LRP-56 monoclonal antibody, in 31 cases before treatment. Immunohistochemistry for detecting the expression of c-erb-B2, p53, Ki67, estrogen receptor and progesterone receptor are routinely performed in our laboratory in every case, and the results obtained were included in the study. All patients had received between two and six cycles of standard 5-fluorouracil, doxorubicin and cyclophosphamide (FAC) chemotherapy, with two exceptions [one patient received four cycles of a docetaxel-adriamycin combination, and the other four cycles of standard cyclophosphamide-methotrexate-5-fluorouracil (CMF) polychemotherapy]. Response was assessed in accordance with the Response Evaluation Criteria In Solid Tumors (RECIST). By these, 2 patients achieved a complete clinical response, 37 a partial response, and the remaining 13 showed stable disease. This makes a

  14. Antimicrobial resistance in equine faecal Escherichia coli isolates from North West England

    Directory of Open Access Journals (Sweden)

    Williams Nicola J

    2010-04-01

    Full Text Available Abstract Background Escherichia coli isolates of equine faecal origin were investigated for antibiotic resistance, resistance genes and their ability to perform horizontal transfer. Methods In total, 264 faecal samples were collected from 138 horses in hospital and community livery premises in northwest England, yielding 296 resistant E. coli isolates. Isolates were tested for susceptibility to antimicrobial drugs by disc diffusion and agar dilution methods in order to determine minimum inhibitory concentrations (MIC. PCR amplification was used to detect genes conferring resistance to: ampicillin (TEM and SHV beta-lactamase, chloramphenicol (catI, catII, catIII and cml, tetracycline (tetA, tetB, tetC, tetD, tet E and tetG, and trimethoprim (dfrA1, dfrA9, dfrA12, dfrA13, dfr7, and dfr17. Results The proportion of antibiotic resistant isolates, and multidrug resistant isolates (MDR was significantly higher in hospital samples compared to livery samples (MDR: 48% of hospital isolates; 12% of livery isolates, p dfr, TEM beta-lactamase, tet and cat, conferring resistance to trimethoprim, ampicillin, tetracycline and chloramphenicol, respectively. Within each antimicrobial resistance group, these genes occurred at frequencies of 93% (260/279, 91%, 86.8% and 73.5%, respectively; with 115/296 (38.8% found to be MDR isolates. Conjugation experiments were performed on selected isolates and MDR phenotypes were readily transferred. Conclusions Our findings demonstrate that E. coli of equine faecal origin are commonly resistant to antibiotics used in human and veterinary medicine. Furthermore, our results suggest that most antibiotic resistance observed in equine E. coli is encoded by well-known and well-characterized resistant genes common to E. coli from man and domestic animals. These data support the ongoing concern about antimicrobial resistance, MDR, antimicrobial use in veterinary medicine and the zoonotic risk that horses could potentially pose to

  15. Frequency of the MDR1 mutant allele associated with multidrug sensitivity in dogs from Brazil

    Directory of Open Access Journals (Sweden)

    Monobe MM

    2015-04-01

    Full Text Available Marina M Monobe,1 João P Araujo Junior,2 Kari V Lunsford,3 Rodrigo C Silva,4 Camilo Bulla41Department of Veterinary Clinics, School of Veterinary Medicine and Animal Science, 2Department of Microbiology and Immunology, Biosciences Institute, Sao Paulo State University (UNESP, Botucatu, Brazil; 3Department of Clinical Sciences and Animal Health Center, 4Department of Pathobiology and Population Medicine, College of Veterinary Medicine, Mississippi State University, Mississippi, MS, USAAbstract: To date, a 4-bp deletion in the MDR1 gene has been detected in more than ten dog breeds, as well as in mixed breed dogs, in several countries, however information regarding this mutation in dogs from Brazil is lacking. For this reason, 103 Collies, 77 Border Collies, 76 Shetland Sheepdogs, 20 Old English Sheepdogs, 55 German Shepherds, 16 Australian Shepherds, and 53 Whippets from Brazil were screened for the presence of the mutation. The heterozygous mutated genotype, MDR1 (+/−, frequency found for Collies, Australian Shepherd, and Shetland Sheepdog was 50.5% (95% CI =41.1%–59.9%, 31.3% (95% CI =8.6%–53.2%, and 15.8% (95% CI =7.7%–23.9%, respectively. Homozygous mutated genotype, MDR1 (−/−, was detected only in Collies 35.9%. The MDR1 allele mutant frequency found for Collies, Australian Shepherd, and Shetland Sheepdog was 61.2% (95% CI =54.8%–67.5%, 15.6% (95% CI =3.1%–28.2%, and 7.9% (95% CI =3.7%–12.1%, respectively. Additionally, even free of the mutant allele, the maximum mutant prevalence (MMP in that population, with 95% CI, was 3.8%, 5.2%, 5.4%, and 13.8% for Border Collies, German Shepherds, Whippets, and Old English Sheepdogs, respectively. In this way, this information is important, not only for MDR1 genotype-based breeding programs and international exchange of breeding animals of predisposed breeds, but also for modification of drug therapy for breeds at risk.Keywords: P-glycoprotein, MDR1 mutation, ivermectin, dog, drug

  16. Rapid diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis using a molecular-based diagnostic algorithm.

    Science.gov (United States)

    Simons, S O; van der Laan, T; Mulder, A; van Ingen, J; Rigouts, L; Dekhuijzen, P N R; Boeree, M J; van Soolingen, D

    2014-10-01

    There is an urgent need for rapid and accurate diagnosis of pyrazinamide-resistant multidrug-resistant tuberculosis (MDR-TB). No diagnostic algorithm has been validated in this population. We hypothesized that pncA sequencing added to rpoB mutation analysis can accurately identify patients with pyrazinamide-resistant MDR-TB. We identified from the Dutch national database (2007-11) patients with a positive Mycobacterium tuberculosis culture containing a mutation in the rpoB gene. In these cases, we prospectively sequenced the pncA gene. Results from the rpoB and pncA mutation analysis (pncA added to rpoB) were compared with phenotypic susceptibility testing results to rifampicin, isoniazid and pyrazinamide (reference standard) using the Mycobacterial Growth Indicator Tube 960 system. We included 83 clinical M. tuberculosis isolates containing rpoB mutations in the primary analysis. Rifampicin resistance was seen in 72 isolates (87%), isoniazid resistance in 73 isolates (88%) and MDR-TB in 65 isolates (78%). Phenotypic reference testing identified pyrazinamide-resistant MDR-TB in 31 isolates (48%). Sensitivity of pncA sequencing added to rpoB mutation analysis for detecting pyrazinamide-resistant MDR-TB was 96.8%, the specificity was 94.2%, the positive predictive value was 90.9%, the negative predictive value was 98.0%, the positive likelihood was 16.8 and the negative likelihood was 0.03. In conclusion, pyrazinamide-resistant MDR-TB can be accurately detected using pncA sequencing added to rpoB mutation analysis. We propose to include pncA sequencing in every isolate with an rpoB mutation, allowing for stratification of MDR-TB treatment according to pyrazinamide susceptibility. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.

  17. Use of GenoType® MTBDRplus assay to assess drug resistance and mutation patterns of multidrug-resistant tuberculosis isolates in northern India

    Directory of Open Access Journals (Sweden)

    A K Maurya

    2013-01-01

    Full Text Available Purpose: The emergence and spread of multidrug-resistant tuberculosis (MDR-TB is a major public health problem. The diagnosis of MDR-TB is of paramount importance in establishing appropriate clinical management and infection control measures. The aim of this study was to evaluate drug resistance and mutational patterns in clinical isolates MDR-TB by GenoType® MTBDRplus assay. Material and Methods: A total of 350 non-repeated sputum specimens were collected from highly suspected drug-resistant pulmonary tuberculosis (PTB cases; which were processed by microscopy, culture, differentiation and first line drug susceptibility testing (DST using BacT/ALERT 3D system. Results: Among a total of 125 mycobacterium tuberculosis complex (MTBC strains, readable results were obtained from 120 (96% strains by GenoType® MTBDRplus assay. Only 45 MDR-TB isolates were analysed for the performance, frequency and mutational patterns by GenoType® MTBDRplus assay. The sensitivity of the GenoType® MDRTBplus assay for detecting individual resistance to rifampicin (RIF, isoniazid (INH and multidrug resistance was found to be 95.8%, 96.3% and 97.7%, respectively. Mutation in codon S531L of the rpoB gene and codon S315T1 of katG genes were dominated in MDR-TB strains, respectively (P < 0.05. Conclusions: The GenoType® MTBDRplus assay is highly sensitive with short turnaround times and a rapid test for the detection of the most common mutations conferring resistance in MDR-TB strains that can readily be included in a routine laboratory workflow.

  18. [Expression and significance of P-gp/mdr1 mRNA, MRP and LRP in non-Hodgkin's lymphoma].

    Science.gov (United States)

    Li, Le; Su, Li-ping; Ma, Li; Zhao, Jin; Zhu, Lei; Zhou, Yong-an

    2009-03-01

    To explore the expression and clinical significance of P-glycoprotein (P-gp)/mdr1mRNA, multidrug resistance-associated protein (MRP) and lung resistance protein (LRP) in newly diagnosed non-Hodgkin's lymphoma. mdr1 mRNA of in 41 patients with non-Hodgkin's lymphoma was assayed by semi-quantitative RT-PCR. The expressions of P-gp, MRP and LRP proteins in lymph node viable blasts were identified by flow cytometry. The results were compared with those obtained from control cases, and the correlation of the changes with clinical outcomes was analyzed. (1) Among the 41 cases, the positive expression of P-gp protein was detected in 8 cases, MRP in 7 cases, LRP in 15 cases, and mdr 1 mRNA in 11 cases. (2) The P-gp and LRP levels in NHL were significantly higher than those in control group, but MRP wasn't. The P-gp over-expression was significantly associated with mdr1mRNA (r = 0.396, P = 0.01). No correlation was showed among the expressions of P-gp, MRP and LRP. (3) Patients with P-gp expression had a poorer outcome of chemotherapy than those with P-gp-negative (P = 0.005). P-gp expression was significantly associated with higher clinical stage (P = 0.046) and elevated serum lactate dehydrogenase level (P = 0.032), but not associated with malignant degree (P = 0.298). MRP had no impact on the outcome of chemotherapy (P = 0.212), and wasn't significantly associated with higher clinical stage (P = 0.369), elevated LDH (P = 0.762) and higher malignant degree (P = 0.451). Patients with LRP expression had a poorer outcome of chemotherapy than those LRP-negative (P = 0.012). LRP expression was significantly associated with higher clinical stage (P = 0.0019), elevated LDH (P = 0.02) and higher malignant degree (P = 0.01). The data of this study indicate that P-gp and LRP expressions but not MRP expression are important in the mechanism of drug resistance associated with a poor clinical outcome in previously untreated NHL.

  19. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  20. Molecular screening of antibiotic-resistant determinants among multidrug-resistant clinical isolates of Proteus mirabilis from SouthWest Nigeria.

    Science.gov (United States)

    Alabi, Olumuyiwa Samuel; Mendonça, Nuno; Adeleke, Olufemi Ezekiel; da Silva, Gabriela Jorge

    2017-06-01

    Globally, and particularly in developing countries, the menace of anti-microbial resistance is an accelerating problem. In Nigeria, increase in bacterial resistance has been phenotypically established but due to high cost, few molecular studies have been reported. This study screened for presence of transferable resistance genes and mobile genetic elements (MGEs) such as integron among multi-drug resistant (MDR) P. mirabilis . A total of 108 P. mirabilis strains collected from five tertiary hospitals in SouthWest Nigeria were subjected to antibiotic susceptibility study using disc-diffusion method. Transferable resistance genes and MGEs were amplified using Polymerase chain reaction (PCR) analysis and amplicons sequenced. Varied resistance was observed against all the antibiotics tested. About 56% of the isolates were MDR including those from 0-12 years old children. PCR analysis revealed the presence of aac(6')-Ib (33.3%), plasmid mediated quinolone resistance (PMQR) genes [qnrA (36.7%), acc(6')-Ib-cr (5%)], TEM (48.3%), CTX-M (6.7%) and integrons class 1 (58.3%) and class 2 (26.7%). Sequencing analysis revealed bla TEM-1 , bla CTX-M-15 associated with IS Ecp1 and eight different arrays of gene cassettes: aadA1, aadA1-qacH, aadB-aadA2, aadA5, dfrA7, dfrA15, dfrA17, dfrA17-aadA5 . Transferable resistance genes in association with MGEs are present in Nigerian P. mirabilis thus their potential in disseminating resistance.

  1. Transmissible Plasmids and Integrons Shift Escherichia coli Population Toward Larger Multiple Drug Resistance Numbers.

    Science.gov (United States)

    Suhartono, Suhartono; Savin, Mary C; Gbur, Edward E

    2018-04-01

    Transmissible plasmids and integrons may play important roles in the persistence and spread of antibiotic-resistant bacteria throughout aquatic environment by accumulating antibiotic resistance genes (ARG). Class 1 and class 2 integron (intI), mobilization (mob), sulfamethoxazole resistance (sul), and trimethoprim resistance (dfr) genes were PCR-amplified and confirmed through DNA sequencing following plasmid extraction from 139 antibiotic-resistant Escherichia coli. E. coli had previously been recovered from wastewater treatment plant effluent and receiving stream water in Northwest Arkansas and isolates had expressed resistance to one to six antibiotics. Almost half of the total isolates (47%) carried putatively transmissible plasmids with mob F12 gene as the most frequently detected mobilization gene. When two or three mob genes were detected per isolate, there was a significant shift in the population toward larger multiple drug resistance (MDR) number. Class 1 and/or 2 integrons were prevalent (46%), and the presence of integron significantly shifted the isolate population toward larger MDR number. More isolates carried single or coexistence of two or three sul genes (99.3%), and single or a combination up to five dfr genes (89.3%) than had exhibited in vitro resistance to the respective antibiotics. These findings indicate not only the role of the wastewater treatment effluent and the stream environment in coaccumulation of ARG with transmissible plasmids and integrons in multiple antibiotic-resistant E. coli populations but also suggest that density of sul and dfr resistance genes within an isolate may serve as a biomarker for mobile MDR in general.

  2. Transmission of MDR and XDR tuberculosis in Shanghai, China.

    Directory of Open Access Journals (Sweden)

    Ming Zhao

    Full Text Available Multidrug-resistant (MDR and extensively drug-resistant (XDR tuberculosis (TB are global health problems. We sought to determine the characteristics, prevalence, and relative frequency of transmission of MDR and XDR TB in Shanghai, one of the largest cities in Asia.TB is diagnosed in district TB hospitals in Shanghai, China. Drug susceptibility testing for first-line drugs was performed for all culture positive TB cases, and tests for second-line drugs were performed for MDR cases. VNTR-7 and VNTR-16 were used to genotype the strains, and prior treatment history and treatment outcomes were determined for each patient.There were 4,379 culture positive TB cases diagnosed with drug susceptibility test results available during March 2004 through November 2007. 247 (5.6% were infected with a MDR strain of M. tuberculosis and 11 (6.3% of the 175 MDR patients whose isolate was tested for susceptibility to second-line drugs, were XDR. More than half of the patients with MDR and XDR were newly diagnosed and had no prior history of TB treatment. Nearly 57% of the patients with MDR were successfully treated.Transmission of MDR and XDR strains is a serious problem in Shanghai. While a history of prior anti-TB treatment indicates which individuals may have acquired MDR or XDR TB, it does not accurately predict which TB patients have disease caused by transmission of MDR and XDR strains. Therefore, universal drug susceptibility testing is recommended for new and retreatment TB cases.

  3. Risk factors associated with multidrug-resistant tuberculosis (MDR-TB) in a tertiary armed force referral and teaching hospital, Ethiopia.

    Science.gov (United States)

    Demile, Biresaw; Zenebu, Amare; Shewaye, Haile; Xia, Siqing; Guadie, Awoke

    2018-05-31

    Ethiopia is one of the world health organization defined higher tuberculosis (TB) burden countries where the disease remains a massive public health threat. This study aimed to identify the prevalence and associated factors of multidrug-resistant tuberculosis (MDR-TB) using all armed force and civilian TB attendants in a tertiary level armed force hospital, where data for MDR-TB are previously unpublished. Cross-sectional study was conducted from September 2014 to August 2015 in a tertiary level Armed Force Referral and Teaching Hospital (AFRTH), Ethiopia. Armed force members (n = 251) and civilians (n = 130) which has been undergone TB diagnosis at AFRTH were included. All the specimens collected were subjected to microscopic smear observation, culture growth and drug susceptibility testing. Data were analyzed using statistical package for social sciences following binary logistic regression and Chi-square. P-values < 0.05 were considered statistically significant. Among 381 TB patients, 355 (93.2%) new and 26 (6.8%) retreatment cases were identified. Culture and smear positive TB cases were identified in 297 (77.9%) and 252 (66.1%) patients, respectively. The overall prevalence of MDR-TB in AFRTH was found 1.8% (1.3% for armed force members and 0.5% for civilian patients) all of which were previously TB treated cases. The entire treatment success rates were 92.6% achieved highest in the armed force (active and pension) than the civilian patients. The failure and dead cases were also found 2.5 and 4.6%, respectively. Using bivariate analysis, category of attendants and TB contact history were strong predictors of MDR-TB in armed force and civilian patients. Moreover, human immunodeficiency virus (HIV) infection also identified a significant (OR = 14.6; 95% CI = 2.3-92.1; p = 0.004) predicting factor for MDR-TB in armed force members. However, sex, age and body mass index were not associated factor for MDR-TB. In AFRTH, lower prevalence of

  4. Ecdysteroids Sensitize MDR and Non-MDR Cancer Cell Lines to Doxorubicin, Paclitaxel, and Vincristine but Tend to Protect Them from Cisplatin

    Directory of Open Access Journals (Sweden)

    Ana Martins

    2015-01-01

    Full Text Available Ecdysteroids, analogs of the insect molting hormone, are known for their various mild, nonhormonal bioactivities in mammals. Previously, we reported that less-polar ecdysteroids can modulate the doxorubicin resistance of a multidrug resistant (MDR mouse lymphoma cell line expressing the human ABCB1 transporter. Here, we describe the ability of 20-hydroxyecdysone (1 and its mono- (2 and diacetonide (3 derivatives to sensitize various MDR and non-MDR cancer cell lines towards doxorubicin, paclitaxel, vincristine, or cisplatin. Drug IC50 values with or without ecdysteroid were determined by MTT assay. Compound 3 significantly sensitized all cell lines to each chemotherapeutic except for cisplatin, whose activity was decreased. In order to overcome solubility and stability issues for the future in vivo administration of compound 3, liposomal formulations were developed. By means of their combination index values obtained via checkerboard microplate method, a formulation showed superior activity to that of compound 3 alone. Because ecdysteroids act also on non-ABCB1 expressing (sensitive cell lines, our results demonstrate that they do not or not exclusively exert their adjuvant anticancer activity as ABCB1 inhibitors, but other mechanisms must be involved, and they opened the way towards their in vivo bioactivity testing against various cancer xenografts.

  5. Localization and activity of multidrug resistance protein 1 in the secretory pathway of Leishmania parasites.

    Science.gov (United States)

    Dodge, Matthew A; Waller, Ross F; Chow, Larry M C; Zaman, Muhammad M; Cotton, Leanne M; McConville, Malcolm J; Wirth, Dyann F

    2004-03-01

    Upregulation of the multidrug resistance protein 1 (LeMDR1) in the protozoan parasite, Leishmania enriettii, confers resistance to hydrophobic drugs such as vinblastine, but increases the sensitivity of these parasites to the mitochondrial drug, rhodamine 123. In order to investigate the mechanism of action of LeMDR1, the subcellular localization of green fluorescent protein (GFP)-tagged versions of LeMDR1 and the fate of the traceable-fluorescent LeMDR1 substrate calcein AM were examined in both Leishmania mexicana and L. enriettii LeMDR1 -/- and overexpressing cell lines. The LeMDR1-GFP chimera was localized by fluorescence microscopy to a number of secretory and endocytic compartments, including the Golgi apparatus, endoplasmic reticulum (ER) and a multivesicular tubule (MVT)-lysosome. Pulse-chase labelling experiments with calcein AM suggested that the Golgi and ER pools, but not the MVT-lysosome pool, of LeMDR1 were active in pumping calcein AM out of the cell. Cells labelled with calcein AM under conditions that slow vesicular transport (low temperature and stationary growth) inhibited export and resulted in the accumulation of fluorescent calcein in both the Golgi and the mitochondria. We propose that LeMDR1 substrates are pumped into secretory compartments and exported from the parasite by exocytosis. Accumulation of MDR substrates in the ER can result in alternative transport to the mitochondrion, explaining the reciprocal sensitivity of drug-resistant Leishmania to vinblastine and rhodamine 123.

  6. Efficacy and safety profile of linezolid in the treatment of multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis: a systematic review and meta-analysis.

    Science.gov (United States)

    Agyeman, Akosua Adom; Ofori-Asenso, Richard

    2016-06-22

    Treatment options for drug-resistant tuberculosis are still limited. Linezolid has been recommended for treatment of patients with multidrug-resistant (MDR) or extensively-drug-resistant (XDR) tuberculosis, although uncertainties remain regarding its safety and tolerability in these circumstances. To systematically evaluate the existing evidence regarding the efficacy and tolerability of linezolid in the treatment of MDR or XDR tuberculosis. We conducted a systematic review and meta-analysis in accordance with the PRISMA guidelines. Searches were conducted in PubMed, Web of Science and EMBASE followed by direct search of abstracts in the International Journal of Tuberculosis and Lung Disease to retrieve primary studies published between January 2000 and January 2016 assessing linezolid efficacy and safety in the treatment of drug-resistant TB. We evaluated the occurrence of outcomes including culture conversion, treatment success and incidence of adverse events such as myelosuppression and neuropathy. Twenty-three (23) studies conducted in fourteen (14) countries and involving 507 patients were retrieved. Only 1 randomized controlled trial was identified and none of the identified studies involved participants from Africa. The pooled proportion for treatment success was 77.36 % (95 % CI = 71.38-82.83 %, I(2) = 37.6 %) with culture conversion rate determined as 88.45 % (95 % CI = 83.82-92.38 %, I(2) = 45.4 %). There was no strong evidence for both culture conversion (p = 0.0948) and treatment success (p = 0.0695) between linezolid daily doses ≤ 600 and > 600 mg. Only myelosuppression showed a strong statistical significance (p linezolid also showed no significance upon dose comparisons (p = 0.3213, p = 0.9050 respectively). Available evidence presents Linezolid as a viable option in the treatment of MDR/XDR TB although patients ought to be monitored closely for the incidence of major adverse events such as myelosuppression and

  7. Molecular epidemiology of multidrug-resistant Acinetobacter baumannii isolates in a university hospital in Nepal reveals the emergence of a novel epidemic clonal lineage.

    Science.gov (United States)

    Shrestha, Shovita; Tada, Tatsuya; Miyoshi-Akiyama, Tohru; Ohara, Hiroshi; Shimada, Kayo; Satou, Kazuhito; Teruya, Kuniko; Nakano, Kazuma; Shiroma, Akino; Sherchand, Jeevan Bdr; Rijal, Basista Psd; Hirano, Takashi; Kirikae, Teruo; Pokhrel, Bharat Mani

    2015-11-01

    The emergence of multidrug-resistant (MDR) Acinetobacter baumannii has become a serious medical problem worldwide. To clarify the genetic and epidemiological properties of MDR A. baumannii strains isolated from a medical setting in Nepal, 246 Acinetobacter spp. isolates obtained from different patients were screened for MDR A. baumannii by antimicrobial disk susceptibility testing. Whole genomes of the MDR A. baumannii isolates were sequenced by MiSeq™ (Illumina), and the complete genome of one isolate (IOMTU433) was sequenced by PacBio RS II. Phylogenetic trees were constructed from single nucleotide polymorphism concatemers. Multilocus sequence types were deduced and drug resistance genes were identified. Of the 246 Acinetobacter spp. isolates, 122 (49.6%) were MDR A. baumannii, with the majority being resistant to aminoglycosides, carbapenems and fluoroquinolones but not to colistin and tigecycline. These isolates harboured the 16S rRNA methylase gene armA as well as bla(NDM-1), bla(OXA-23) or bla(OXA-58). MDR A. baumannii isolates belonging to clonal complex 1 (CC1) and CC2 as well as a novel clonal complex (CC149) have spread throughout a medical setting in Nepal. The MDR isolates harboured genes encoding carbapenemases (OXA and NDM-1) and a 16S rRNA methylase (ArmA). Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  8. From MDR to MXR

    DEFF Research Database (Denmark)

    Litman, Thomas; Druley, T E; Stein, W D

    2001-01-01

    The ATP binding cassette (ABC) superfamily of membrane transporters is one of the largest protein classes known, and counts numerous proteins involved in the trafficking of biological molecules across cell membranes. The first known human ABC transporter was P-glycoprotein (P-gp), which confers...... multidrug resistance (MDR) to anticancer drugs. In recent years, we have obtained an increased understanding of the mechanism of action of P-gp as its ATPase activity, substrate specificity and pharmacokinetic interactions have been investigated. This review focuses on the functional characterization of P...... for reversal of MDR in cancer and for drug delivery, are discussed....

  9. Molecular identification of marine symbiont bacteria of gastropods from the waters of the Krakal coast Yogyakarta and its potential as a Multi-Drug Resistant (MDR) antibacterial agent

    Science.gov (United States)

    Bahry, Muhammad Syaifudien; Pringgenies, Delianis; Trianto, Agus

    2017-01-01

    The resistance of pathogenic bacteria may occur to many types of antibiotics, especially in cases of non-compliance use of antibiotics, which likely to allow the evolution of Multi-Drug Resistant (MDR) bacteria. Gastropods seas are marine invertebrates informed capable of production of secondary metabolites as antibacterial MDR. The purpose of the study was the isolation and identification of gastropod symbiont bacteria found in the waters of Krakal, Gunung Kidul, Yogyakarta, which has the ability to produce antibacterial compounds against MDR(Escherichia coli, Enterobacter cloacae, Klebsiella pneumoniae, MRSA (methicillin-Resistant Staphylococcus aureus), Staphylococcus aureus, and Staphylococcus homunis) molecular. Stages of this research began with the isolation of bacteria, bacteria screening for anti-MDR compound, mass culture, and extraction, antibacterial activity test, DNA extraction, amplification by PCR 16S rDNA and sequencing. The results of the study showed that 19 isolates of bacteria were isolated from three species of gastropods namely Littorina scabra, Cypraea moneta and Conus ebraeus. Among them, 4 isolates showed activity against MDR test bacteria (E. coli, E. cloacae, K. pneumoniae, S. aureus and S. homunis). The highest activity was displayed by code LS.G1.8 isolate with the largest inhibition zone 15.47±0.45mm on S. humonis at 250 µg/disk concentration. Isolate CM.G2.1 showed largest inhibition zone, with 21.5±0.07mm on MRSA at 1000 µg/disk concentration and isolate the largest inhibition zone CM.G2.5 14.37±0.81mm on MRSA 14.37±0.81mm at concentrations 1000 µg/disk. The molecular identification of isolates LS.G1.8 has 99% homology with Bacillus subtilis and isolates CM.G2.1 has 99% homology with Bacillus pumillus.

  10. Polymorphisms in the HIV-1 gp41 env gene, natural resistance to enfuvirtide (T-20) and pol resistance among pregnant Brazilian women.

    Science.gov (United States)

    Reis, Mônica Nogueira da Guarda; de Alcântara, Keila Correa; Cardoso, Ludimila Paula Vaz; Stefani, Mariane Martins Araújo

    2014-01-01

    The selective pressure of antiretroviral drugs (ARVs) targeting HIV-1 pol can promote drug resistance mutations in other genomic regions, such as env. Drug resistance among women should be monitored to avoid horizontal and mother-to-child transmission. To describe natural resistance to T-20 (enfuvirtide), gp41 env polymorphisms, mutations in pol and HIV-1 subtypes, 124 pregnant women were recruited. For 98 patients, the gp41 env, protease (PR) and reverse transcriptase (RT) fragments were sequenced. The patients were ARV naïve (n = 30), taking mother-to-child transmission prophylaxis (n = 50), or being treated with highly active ARV therapy/HAART (n = 18). The Stanford and IAS/USA databases and other sources were used to analyze PR/RT, gp41 env resistance mutations. The HIV-1 genetic diversity was analyzed by REGA/phylogenetic analyses. The patients' median age was 25 years (range, 16-42), 18.4% had AIDS. The frequency of natural resistance to T-20 (N42D, L44M, and R46M-low-impact mutations) was 6.1% (6/98); 20.4% (20/98) had compensatory mutations in HR2. The prevalence of transmitted drug resistance in the pol was 13.3% (4/30), and the prevalence of secondary drug resistance was 33.3% (6/18). Two patients were infected with multidrug resistant/MDR viruses. The analysis of HIV-1 subtypes (PR/RT/gp41) revealed that 61.2% (60/98) were subtype B, 12.2% (12/98) were subtype C, 4.1% (4/98) were subtype F1, and 22.4% (22/98) were possible recombinants (BF1 = 20.4%; BC = 2%). Natural resistance to T-20 was not associated with pol resistance or previous ARV use. The high rate of secondary resistance, including MDR, indicates that the number of women that may need T-20 salvage therapy may be higher than anticipated. © 2013 Wiley Periodicals, Inc.

  11. Integration of the blaNDM-1 carbapenemase gene into Proteus genomic island 1 (PGI1-PmPEL) in a Proteus mirabilis clinical isolate.

    Science.gov (United States)

    Girlich, Delphine; Dortet, Laurent; Poirel, Laurent; Nordmann, Patrice

    2015-01-01

    To decipher the mechanisms and their associated genetic determinants responsible for β-lactam resistance in a Proteus mirabilis clinical isolate. The entire genetic structure surrounding the β-lactam resistance genes was characterized by PCR, gene walking and DNA sequencing. Genes encoding the carbapenemase NDM-1 and the ESBL VEB-6 were located in a 38.5 kb MDR structure, which itself was inserted into a new variant of the Proteus genomic island 1 (PGI1). This new PGI1-PmPEL variant of 64.4 kb was chromosomally located, as an external circular form in the P. mirabilis isolate, suggesting potential mobility. This is the first known description of the bla(NDM-1) gene in a genomic island structure, which might further enhance the spread of the bla(NDM-1) carbapenemase gene among enteric pathogens. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  12. Several Virulence Factors of Multidrug-Resistant Staphylococcus aureus Isolates From Hospitalized Patients in Tehran

    Directory of Open Access Journals (Sweden)

    Abdolmajid Ghasemian

    2015-05-01

    Full Text Available Background: Biofilm formation plays an important role in resistance of Staphylococcus aureus isolates; especially multidrug-resistant isolates are a threat to healthcare settings. Objectives: The aims of this study were to detect biofilm formation and presence of several related genes among multidrug-resistant (MDR isolates of Staphylococcus aureus. Patients and Methods: A total Of 209 S. aureus strains were isolated from patients and identified by conventional diagnostic tests. The multidrug-resistant MRSA isolates were detected by antibiotic susceptibility test. The phenotypic biofilm formation was detected by micro-titre tissue plate assay. The polymerase chain reaction (PCR was performed to detect the mecA, Staphylococcal Cassette Chromosome mec (SCCmec types, accessory gene regulatory (agr genes, the icaADBC and several genes encoding staphylococcal surface proteins including clfAB, fnbAB, fib, eno, can, ebps and bbp genes with specific primers. Results: Sixty-four (30.6% isolates were methicillin-resistant, among which thirty-six (56.2% were MDR. These isolates were resistant to amoxicillin, tetracycline, ciprofloxacin, gentamicin, erythromycin and trimethoprim-sulfamethoxazole (except to 6 isolates. All the isolates were susceptible to vancomycin and linezolid. All the MDR-MRSA harbored SCCmec type III. All the MDR- MRSA isolates were strong biofilm producers in the phenotypic test. The majority of MDR- MRSA was belonged to agrI (67%, n = 24, followed by agr II (17%, n = 6, agrIV (11%, n = 4 and agrIII (5.5%, n = 2. The frequency of icaADBC genes were 75% (n = 27, 61% (n = 22, 72% (n = 26 and 72% (n = 26, respectively. Furthermore, the prevalence of clfA, clfB, fnbA, fnbB, fib, can, eno, ebps and bbp genes was 100%, 100%, 67%, 56%, 80%, 63%, 78%, 7% and 0%, respectively. Furthermore, approximately all the MRSA was strong biofilm producers. Conclusions: Multidrug-resistant isolates produced biofilm strongly and the majority harbored most

  13. TM4SF1 Promotes Gemcitabine Resistance of Pancreatic Cancer In Vitro and In Vivo.

    Directory of Open Access Journals (Sweden)

    Jia Cao

    Full Text Available TM4SF1 is overexpressed in pancreatic ductal adenocarcinoma (PDAC and affects the development of this cancer. Also, multidrug resistance (MDR is generally associated with tumor chemoresistance in pancreatic cancer. However, the correlation between TM4SF1 and MDR remains unknown. This research aims to investigate the effect of TM4SF1 on gemcitabine resistance in PDAC and explore the possible molecular mechanism between TM4SF1 and MDR.The expression of TM4SF1 was evaluated in pancreatic cancer cell lines and human pancreatic duct epithelial (HPDE cell lines by quantitative RT-PCR. TM4SF1 siRNA transfection was carried out using Hiperfect transfection reagent to knock down TM4SF1. The transcripts were analyzed by quantitative RT-PCR, RT-PCR and western blotting for further study. The cell proliferation and apoptosis were obtained to investigate the sensitivity to gemcitabine of pancreatic cancer cells after silencing TM4SF1 in vitro. We demonstrated that cell signaling of TM4SF1 mediated chemoresistance in cancer cells by assessing the expression of multidrug resistance (MDR genes using quantitative RT-PCR. In vivo, we used orthotopic pancreatic tumor models to investigate the effect of proliferation after silencing TM4SF1 by a lentivirus-mediated shRNA in MIA PaCa-2 cell lines.The mRNA expression of TM4SF1 was higher in seven pancreatic cancer cell lines than in HPDE cell lines. In three gemcitabine-sensitive cell lines (L3.6pl, BxPC-3, SU86.86, the expression of TM4SF1 was lower than that in four gemcitabine-resistant cell lines (MIA PaCa-2, PANC-1, Hs766T, AsPC-1. We evaluated that TM4SF1 was a putative target for gemcitabine resistance in pancreatic cancer cells. Using AsPC-1, MIA PaCa-2 and PANC-1, we investigated that TM4SF1 silencing affected cell proliferation and increased the percentages of cell apoptosis mediated by treatment with gemcitabine compared with cells which were treated with negative control. This resistance was associated

  14. Active Sputum Monitoring Detects Substantial Rate of Multi-Drug Resistant Tuberculosis (MDR-TB) in an HIV-Infected Population in South Africa

    Science.gov (United States)

    Hassim, Shaheen; Shaw, Pamela A.; Sangweni, Phumelele; Malan, Lizette; Ntshani, Ella; Mathibedi, Monkwe Jethro; Stubbs, Nomso; Metcalf, Julia A; Eckes, Risa; Masur, Henry; Komati, Stephanus

    2010-01-01

    Background Tuberculosis (TB) co-infection with HIV is a substantial problem in South Africa. There has been a presumption that drug resistant strains of TB are common in South Africa, but few studies have documented this impression. Methods In Phidisa, a joint observational and randomized HIV treatment study for South African National Defence Force members and dependents, an initiative obtained microbiologic TB testing in subjects who appeared to be at high risk. We report results for HIV-infected subjects. Results TB was identified by culture in 116/584 (19.9%) of patients selected for sputum examination on the basis of suggestive symptoms. Smear was an insensitive technique for confirming the diagnosis: only 33% of culture-positive patients were identified by smear, with a 0.2% false positive rate. Of the 107 culture-positive individuals with susceptibility testing, 22 (20.6%) were identified to be MDR and 4 (3.7%) became extremely drug resistant tuberculosis (XDR) while under observation. Culture-positive cases with a history of TB treatment had more than twice the rate of MDR than those without, 27.1% vs. 11.9% (p=0.05). Conclusions TB is common in this cohort of HIV-infected patients. Smear was not a sensitive technique for identifying culture-positive cases in this health system. Drug susceptibility testing is essential to proper patient management because MDR was present in 20.6% of culture-positive patients. Better management strategies are needed to reduce the development of MDR-TB since so many such patients had received prior antituberculous therapy that was presumably not curative. PMID:20196651

  15. Bakteri Simbion Gastropoda Pleuroploca trapesium Dari Perairan Ternate, Sebagai Alternatif Antibakteri MDR (Bacterial Symbiont Gastropoda Pleuroploca trapezium from Ternate, as Alternative Antibacterial MDR

    Directory of Open Access Journals (Sweden)

    Delianis Pringgenies

    2014-03-01

    The bacteria resistant to some antibiotics are known as multi drug resistant (MDR. To overcome the problem, it is needed to search for a new antibiotic compounds more effectively and efficiently. This study aims to identify potential from symbionts of Pleuroploca trapezium as a source of antibacteria MDR and identifying the bacteria that were active against the MDR. Samples were collected from Ternate, Maluku. Isolation of symbiotic bacteria, screening for bacteria which producing secondary metabolites as anti-MDR bacteria, antibacterial test, isolation of clinical pathogenic bacteria of MDR. Conducting anti-bacterial sensitivity test,  sensitivity test for antibacterial,  DNA exctraction, DNA amplification based on PCR method, DNA sequencing.  Result of 16S r-DNA sequence was then analyzed and edited using GENETYX program and followed by 16S rDNA sequence analysis. Screening of bacteria associated with P. trapezium resulted in 19 isolates with 5 active bacteria. Based on the size of the zone forming and the consistency of zone, so the best isolate is TPT 4.7. The identification shows that TPT 4.7 has a close relationship with the Paracoccus sp. MBIC4019 with homologi of 95%, which shows the relationship at the genus level. Its suggest that these results are very promising as a new antibacterial material. Keywords: antibacterial, symbiotic bacteria, Pleuroploca trapezium, multi drugs resistant

  16. Multidrug resistance gene expression is controlled by steroid hormones in the secretory epithelium of the uterus

    NARCIS (Netherlands)

    Arceci, R. J.; Baas, F.; Raponi, R.; Horwitz, S. B.; Housman, D.; Croop, J. M.

    1990-01-01

    The multidrug resistance (mdr) gene family has been shown to encode a membrane glycoprotein, termed the P-glycoprotein, which functions as a drug efflux pump with broad substrate specificity. This multigene family is expressed in a tissue-specific fashion in a wide variety of normal and neoplastic

  17. Factors influencing [F-18]2-fluoro-2-deoxy-D-glucose (F-18 FDG) accumulation in melanoma cells. Is FDG a substrate of multidrug resistance (MDR)?

    International Nuclear Information System (INIS)

    Yamada, Kiyoshi; Brink, I.; Engelhardt, R.

    2005-01-01

    In order to specify the influence of multidrug-resistance (MDR) on the accumulation of the PET tracer, F-18 FDG ([Fluorine-18]2-fluoro-2-deoxy-D-glucose, in melanoma cells, both the MDR function and expression of two human melanoma cell lines SK-MEL 23 and 24, were evaluated. The effects of MDR modulators on FDG accumulation and efflux were also investigated. A functional analysis using representative MDR fluorescent substrates and inhibitors clarified the following characteristics: SK-MEL 23 possesses a highly active function of multidrug resistance-associated protein (MRP), but not P-gp. SK-MEL 24 possesses weak functions of both MRP and P-gp. Western blot analysis using monoclonal antibodies for MDR expression demonstrated an exceedingly high MRP expression of SK-MEL 23 and only slight P-gp and MRP expression of SK-MEL 24, corresponding to the functional data. The efflux inhibition assay using F-18 FDG revealed a considerable retention of FDG in SK-MEL 23 in the presence of the MRP inhibitor probenecid. It was also found that the P-gp inhibitor verapamil depressed the FDG efflux of SK-MEL 24. Our present in vitro study suggests that FDG may be a substrate of MDR in some melanoma cells and further MDR may be one of the important factors affecting FDG-PET melanoma imaging. (author)

  18. YB-1 facilitates basal and 5-fluorouracil-inducible expression of the human major vault protein (MVP) gene.

    Science.gov (United States)

    Stein, Ulrike; Bergmann, Stephan; Scheffer, George L; Scheper, Rik J; Royer, Hans-Dieter; Schlag, Peter M; Walther, Wolfgang

    2005-05-19

    Vaults have been suggested to play a direct role in multidrug resistance (MDR) to anticancer drugs. The human major vault protein (MVP) also known as lung resistance-related protein (LRP) represents the predominant component of vaults that may be involved in the defense against xenobiotics. Here, we demonstrate that besides MDR-related cytostatics, also the non-MDR-related drug 5-fluorouracil (5-FU) was able to induce MVP mRNA and protein expression. Treatment with 5-FU amplified the binding activity and interaction of the transcription factor Y-box binding protein-1 (YB-1) with the Y-box of the human MVP gene promoter in a time-dependent manner. 5-FU also induced reporter expressions driven by a panel of newly generated MVP promoter deletion mutants. Interestingly, stably YB-1 overexpressing cell clones showed enhanced binding of YB-1 to the Y-box motif, associated with enhanced basal as well as 5-FU-inducible MVP promoter-driven reporter expressions. Moreover, transduction of YB-1 cDNA led to increased expression of endogenous MVP protein. Under physiological conditions, we observed a strong coexpression of MVP and YB-1 in human colon carcinoma specimen. In summary, our data demonstrate a direct involvement of YB-1 in controlling basal and 5-FU-induced MVP promoter activity. Therefore, YB-1 is directly linked to MVP-mediated drug resistance.

  19. Multidrug-resistant pathogens in the food supply.

    Science.gov (United States)

    Doyle, Marjorie E

    2015-04-01

    Antimicrobial resistance, including multidrug resistance (MDR), is an increasing problem globally. MDR bacteria are frequently detected in humans and animals from both more- and less-developed countries and pose a serious concern for human health. Infections caused by MDR microbes may increase morbidity and mortality and require use of expensive drugs and prolonged hospitalization. Humans may be exposed to MDR pathogens through exposure to environments at health-care facilities and farms, livestock and companion animals, human food, and exposure to other individuals carrying MDR microbes. The Centers for Disease Control and Prevention classifies drug-resistant foodborne bacteria, including Campylobacter, Salmonella Typhi, nontyphoidal salmonellae, and Shigella, as serious threats. MDR bacteria have been detected in both meat and fresh produce. Salmonellae carrying genes coding for resistance to multiple antibiotics have caused numerous foodborne MDR outbreaks. While there is some level of resistance to antimicrobials in environmental bacteria, the widespread use of antibiotics in medicine and agriculture has driven the selection of a great variety of microbes with resistance to multiple antimicrobials. MDR bacteria on meat may have originated in veterinary health-care settings or on farms where animals are given antibiotics in feed or to treat infections. Fresh produce may be contaminated by irrigation or wash water containing MDR bacteria. Livestock, fruits, and vegetables may also be contaminated by food handlers, farmers, and animal caretakers who carry MDR bacteria. All potential sources of MDR bacteria should be considered and strategies devised to reduce their presence in foods. Surveillance studies have documented increasing trends in MDR in many pathogens, although there are a few reports of the decline of certain multidrug pathogens. Better coordination of surveillance programs and strategies for controlling use of antimicrobials need to be implemented in

  20. Genetic polymorphisms in MDR1 and CYP3A4 genes in Asians and the influence of MDR1 haplotypes on cyclosporin disposition in heart transplant recipients.

    Science.gov (United States)

    Chowbay, Balram; Cumaraswamy, Sivathasan; Cheung, Yin Bun; Zhou, Qingyu; Lee, Edmund J D

    2003-02-01

    Intestinal cytochrome P450 3A4 (CYP3A4) and P-glycoprotein (P-gp) both play a vital role in the metabolism of oral cyclosporine (CsA). We investigated the genetic polymorphisms in CYP3A4(promoter region and exons 5, 7 and 9) and MDR1 (exons 12, 21 and 26) genes and the impact of these polymorphisms on the pharmacokinetics of oral CsA in stable heart transplant patients (n = 14). CYP3A4 polymorphisms were rare in the Asian population and transplant patients. Haplotype analysis revealed 12 haplotypes in the Chinese, eight in the Malays and 10 in the Indians. T-T-T was the most common haplotype in all ethnic groups. The frequency of the homozygous mutant genotype at all three loci (TT-TT-TT) was highest in the Indians (31%) compared to 19% and 15% in the Chinese and Malays, respectively. In heart transplant patients, CsA exposure (AUC(0-4 h), AUC(0-12 h) and C(max)) was high in patients with the T-T-T haplotypes compared to those with C-G-C haplotypes. These findings suggest that haplotypes rather than genotypes influence CsA disposition in transplant patients.

  1. Isolation, Characterization and Anti-Multiple Drug Resistant (MDR ...

    African Journals Online (AJOL)

    (MDR) Bacterial Activity of Endophytic Fungi Isolated from ... Institute of Protection & Development of Beibu Wan Ocean Resources, Qinzhou University, Qinzhou, Guangxi Province, ..... isolated from secondary metabolites of the mangrove.

  2. Multidrug resistance in tumour cells: characterisation of the multidrug resistant cell line K562-Lucena 1

    Directory of Open Access Journals (Sweden)

    VIVIAN M. RUMJANEK

    2001-03-01

    Full Text Available Multidrug resistance to chemotherapy is a major obstacle in the treatment of cancer patients. The best characterised mechanism responsible for multidrug resistance involves the expression of the MDR-1 gene product, P-glycoprotein. However, the resistance process is multifactorial. Studies of multidrug resistance mechanisms have relied on the analysis of cancer cell lines that have been selected and present cross-reactivity to a broad range of anticancer agents. This work characterises a multidrug resistant cell line, originally selected for resistance to the Vinca alkaloid vincristine and derived from the human erythroleukaemia cell K562. This cell line, named Lucena 1, overexpresses P-glycoprotein and have its resistance reversed by the chemosensitisers verapamil, trifluoperazine and cyclosporins A, D and G. Furthermore, we demonstrated that methylene blue was capable of partially reversing the resistance in this cell line. On the contrary, the use of 5-fluorouracil increased the resistance of Lucena 1. In addition to chemotherapics, Lucena 1 cells were resistant to ultraviolet A radiation and hydrogen peroxide and failed to mobilise intracellular calcium when thapsigargin was used. Changes in the cytoskeleton of this cell line were also observed.A resistência a múltiplos fármacos é o principal obstáculo no tratamento de pacientes com câncer. O mecanismo responsável pela resistência múltipla mais bem caracterizado envolve a expressão do produto do gene MDR-1, a glicoproteína P. Entretanto, o processo de resistência tem fatores múltiplos. Estudos de mecanismos de resistência m��ltipla a fármacos têm dependido da análise de linhagens celulares tumorais que foram selecionadas e apresentam reatividade cruzada a uma ampla faixa de agentes anti-tumorais. Este trabalho caracteriza uma linhagem celular com múltipla resistência a fármacos, selecionada originalmente pela resistência ao alcalóide de Vinca vincristina e derivado

  3. Enterotoxigenicity and Antimicrobial Resistance of Staphylococcus aureus Isolated from Retail Food in China

    Science.gov (United States)

    Wang, Wei; Baloch, Zulqarnain; Jiang, Tao; Zhang, Cunshan; Peng, Zixin; Li, Fengqin; Fanning, Séamus; Ma, Aiguo; Xu, Jin

    2017-01-01

    Staphylococcus aureus is one of the most common causes of zoonotic agent in the world, which are attributable to the contamination of food with enterotoxins. In this study, a total of 1,150 S. aureus isolates were cultured from 27,000 retail foods items from 203 cities of 24 provinces in China in 2015 and were test for antimicrobial susceptibility. Additionally, the role of the genes responsible for the staphylococcal enterotoxins (SEA to SEE), methicillin resistance (mecA) and the toxigenic capabilities were also assessed. The results showed that 4.3% retail foods were contaminated with S. aureus, and 7.9% retail foods isolates were mecA positive. Some 97.6% of S. aureus isolates were resistant to at least one antimicrobial compound, and 57.5% of these were multi drug resistant (MDR). Resistance to penicillin (83.7%, 963/1,150), was common, followed by linezolid (67.7%, 778/1,150) and erythromycin (52.1%, 599/1,150). The isolates cultured from raw meats showed high levels of resistant to tetracycline (42.8%), ciprofloxacin (17.4%), and chloramphenicol (12.0%) and expressed a MDR phenotype (62.4%). A total of 29.7% S. aureus isolates harbored the classical SEs genes (sea, seb, sec, and sed). The sea and seb genes were the most frequent SEs genes detected. Of note, 22% of the SEs genes positive S. aureus harbored two or three SEs genes, and 16 isolates were confirmed with the capacity to simultaneously produce two or three enterotoxin types. Moreover, nearly 50% of the MRSA isolates were positive for at least one SE gene in this study. Therefore, it is important to monitor the antimicrobial susceptibility and enterotoxigenicity of MDR S. aureus and MRSA in the food chain and to use these data to develop food safety measures, designed to reduce the contamination and transmission of this bacterium. PMID:29209290

  4. Molecular detection of multidrug-resistant Mycobacterium leprae from Indian leprosy patients.

    Science.gov (United States)

    Lavania, Mallika; Singh, Itu; Turankar, Ravindra P; Ahuja, Madhvi; Pathak, Vinay; Sengupta, Utpal; Das, Loretta; Kumar, Archana; Darlong, Joydeepa; Nathan, Rajeev; Maseey, Asha

    2018-03-01

    The emergence of multidrug-resistant (MDR) organisms for any infectious disease is a public health concern. Global efforts to control leprosy by intensive chemotherapy have led to a significant decrease in the number of registered patients. Currently recommended control measures for treating leprosy with multidrug therapy (MDT) were designed to prevent the spread of dapsone-resistant Mycobacterium leprae strains. Here we report the identification of MDR M. leprae from relapse leprosy patients from endemic regions in India. Resistance profiles to rifampicin, dapsone and ofloxacin of the isolated strains were confirmed by identification of mutations in genes previously shown to be associated with resistance to each drug. Between 2009-2016, slit-skin smear samples were collected from 239 relapse and 11 new leprosy cases from hospitals of The Leprosy Mission across India. DNA was extracted from the samples and was analysed by PCR targeting the rpoB, folP and gyrA genes associated with resistance to rifampicin, dapsone and ofloxacin, respectively, in M. leprae. M. leprae Thai-53 (wild-type) and Zensho-4 (MDR) were used as reference strains. Fifteen strains showed representative mutations in at least two resistance genes. Two strains showed mutations in all three genes responsible for drug resistance. Seven, seven and one strain, respectively, showed mutations in genes responsible for rifampicin and dapsone resistance, for dapsone and ofloxacin resistance and for rifampicin and ofloxacin resistance. This study showed the emergence of MDR M. leprae in MDT-treated leprosy patients from endemic regions of India. Copyright © 2017 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

  5. Genomic Analysis of Multidrug-Resistant Escherichia coli from North Carolina Community Hospitals: Ongoing Circulation of CTX-M-Producing ST131-H30Rx and ST131-H30R1 Strains.

    Science.gov (United States)

    Kanamori, Hajime; Parobek, Christian M; Juliano, Jonathan J; Johnson, James R; Johnston, Brian D; Johnson, Timothy J; Weber, David J; Rutala, William A; Anderson, Deverick J

    2017-08-01

    Escherichia coli sequence type 131 (ST131) predominates globally among multidrug-resistant (MDR) E. coli strains. We used whole-genome sequencing (WGS) to investigate 63 MDR E. coli isolates from 7 North Carolina community hospitals (2010 to 2015). Of these, 39 (62%) represented ST131, including 37 (95%) from the ST131- H 30R subclone: 10 (27%) from its H 30R1 subset and 27 (69%) from its H 30Rx subset. ST131 core genomes differed by a median of 15 (range, 0 to 490) single-nucleotide variants (SNVs) overall versus only 7 within H 30R1 (range, 3 to 12 SNVs) and 11 within H 30Rx (range, 0 to 21). The four isolates with identical core genomes were all H 30Rx. Epidemiological and clinical characteristics did not vary significantly by strain type, but many patients with MDR E. coli or H 30Rx infection were critically ill and had poor outcomes. H 30Rx isolates characteristically exhibited fluoroquinolone resistance and CTX-M-15 production, had a high prevalence of trimethoprim-sulfamethoxazole resistance (89%), sul1 (89%), and dfrA17 (85%), and were enriched for specific virulence traits, and all qualified as extraintestinal pathogenic E. coli The high overall prevalence of CTX-M-15 appeared to be possibly attributable to its association with the ST131- H 30Rx subclone and IncF[F2:A1:B-] plasmids. Some phylogenetically clustered non-ST131 MDR E. coli isolates also had distinctive serotypes/ fimH types, fluoroquinolone mutations, CTX-M variants, and IncF types. Thus, WGS analysis of our community hospital source MDR E. coli isolates suggested ongoing circulation and differentiation of E. coli ST131 subclones, with clonal segregation of CTX-M variants, other resistance genes, Inc-type plasmids, and virulence genes. Copyright © 2017 American Society for Microbiology.

  6. Development of a Patient-Centred, Psychosocial Support Intervention for Multi-Drug-Resistant Tuberculosis (MDR-TB Care in Nepal.

    Directory of Open Access Journals (Sweden)

    Sudeepa Khanal

    Full Text Available Multi-drug-resistant tuberculosis (MDR-TB poses a major threat to public health worldwide, particularly in low-income countries. The current long (20 month and arduous treatment regime uses powerful drugs with side-effects that include mental ill-health. It has a high loss-to-follow-up (25% and higher case fatality and lower cure-rates than those with drug sensitive tuberculosis (TB. While some national TB programmes provide small financial allowances to patients, other aspects of psychosocial ill-health, including iatrogenic ones, are not routinely assessed or addressed. We aimed to develop an intervention to improve psycho-social well-being for MDR-TB patients in Nepal. To do this we conducted qualitative work with MDR-TB patients, health professionals and the National TB programme (NTP in Nepal. We conducted semi-structured interviews (SSIs with 15 patients (10 men and 5 women, aged 21 to 68, four family members and three frontline health workers. In addition, three focus groups were held with MDR-TB patients and three with their family members. We conducted a series of meetings and workshops with key stakeholders to design the intervention, working closely with the NTP to enable government ownership. Our findings highlight the negative impacts of MDR-TB treatment on mental health, with greater impacts felt among those with limited social and financial support, predominantly married women. Michie et al's (2011 framework for behaviour change proved helpful in identifying corresponding practice- and policy-level changes. The findings from this study emphasise the need for tailored psycho-social support. Recent work on simple psychological support packages for the general population can usefully be adapted for use with people with MDR-TB.

  7. Epigenetic mechanisms involved in differential MDR1 mRNA expression between gastric and colon cancer cell lines and rationales for clinical chemotherapy

    Directory of Open Access Journals (Sweden)

    Kim Kyung-Jong

    2008-08-01

    Full Text Available Abstract Background The membrane transporters such as P-glycoprotein (Pgp, the MDR1 gene product, are one of causes of treatment failure in cancer patients. In this study, the epigenetic mechanisms involved in differential MDR1 mRNA expression were compared between 10 gastric and 9 colon cancer cell lines. Methods The MDR1 mRNA levels were determined using PCR and real-time PCR assays after reverse transcription. Cytotoxicity was performed using the MTT assay. Methylation status was explored by quantification PCR-based methylation and bisulfite DNA sequencing analyses. Results The MDR1 mRNA levels obtained by 35 cycles of RT-PCR in gastric cancer cells were just comparable to those obtained by 22 cycles of RT-PCR in colon cancer cells. Real-time RT-PCR analysis revealed that MDR1 mRNA was not detected in the 10 gastric cancer cell lines but variable MDR1 mRNA levels in 7 of 9 colon cancer cell lines except the SNU-C5 and HT-29 cells. MTT assay showed that Pgp inhibitors such as cyclosporine A, verapamil and PSC833 sensitized Colo320HSR (colon, highest MDR1 expression but not SNU-668 (gastric, highest and SNU-C5 (gastric, no expression to paclitaxel. Quantification PCR-based methylation analysis revealed that 90% of gastric cancer cells, and 33% of colon cancer cells were methylated, which were completely matched with the results obtained by bisulfite DNA sequencing analysis. 5-aza-2'-deoxcytidine (5AC, a DNA methyltransferase inhibitor increased the MDR1 mRNA levels in 60% of gastric cells, and in 11% of colon cancer cells. Trichostatin A (TSA, histone deacetylase inhibitor increased the MDR1 mRNA levels in 70% of gastric cancer cells and 55% of colon cancer cells. The combined treatment of 5AC with TSA increased the MDR1 mRNA levels additively in 20% of gastric cancer cells, but synergistically in 40% of gastric and 11% of colon cancer cells. Conclusion These results indicate that the MDR1 mRNA levels in gastric cancer cells are significantly

  8. Exploration of Fungal Association From Hard Coral Against Pathogen MDR Staphylococcus haemolyticus

    Science.gov (United States)

    Cristianawati, O.; Radjasa, O. K.; Sabdono, A.; Trianto, A.; Sabdaningsih, A.; Sibero, M. T.; Nuryadi, H.

    2017-02-01

    Staphylococcus haemolyticus are opportunistic bacteria and as the second leading cause of nosocomial infections. It is a disease causing septicemia, peritonitis, otitis, and urinary tract infections and infections of the eye. It also a phenotype resistant to multiple antibiotics commercial. There is now an urgency to find an alternative antibiotics to combat this bacteria. It has been widely reported that many bioactive marine natural products from marine invertebrate have striking similarities to metabolites of their associated microorganisms including fungi. Hard coral associated microorganisms are among of the most interesting and promising marine natural product sources, which produce with various biological activities. The proposed work focused on the discovery of bioactive compounds and also estimated the phylogenetic diversity from fungal association of hard coral against pathogen MDR Staphylococcus haemolyticus. A total of 32 fungal association, FHP 7 which were isolated from Favia sp. capable of inhibiting the growth MDR. Molecular identification based on 18S rRNA gene sequences revealed that the active fungal association belonged 100% to the members from one of the genera Trichoderma longibrachiatum. Accession Number LC185084.1.

  9. The multidrug resistance 1 gene Abcb1 in brain and placenta: comparative analysis in human and guinea pig.

    Science.gov (United States)

    Pappas, Jane J; Petropoulos, Sophie; Suderman, Matthew; Iqbal, Majid; Moisiadis, Vasilis; Turecki, Gustavo; Matthews, Stephen G; Szyf, Moshe

    2014-01-01

    The Multidrug Resistance 1 (MDR1; alternatively ABCB1) gene product P-glycoprotein (P-gp), an ATP binding cassette transporter, extrudes multiple endogenous and exogenous substrates from the cell, playing an important role in normal physiology and xenobiotic distribution and bioavailability. To date, the predominant animal models used to investigate the role of P-gp have been the mouse and rat, which have two distinct genes, Abcb1a and Abcb1b. In contrast, the human has a single gene, ABCB1, for which only a single isoform has been validated. We and others have previously shown important differences between Abcb1a and Abcb1b, limiting the extrapolation from rodent findings to the human. Since the guinea pig has a relatively long gestation, hemomonochorial placentation and neuroanatomically mature offspring, it is more similar to the human, and may provide a more comparable model for investigating the regulation of P-gp in the brain and placenta, however, to date, the Abcb1 gene in the guinea pig remains to be characterized. The placenta and fetal brain are barrier sites that express P-gp and that play a critical role of protection of the fetus and the fetal brain from maternally administered drugs and other xenobiotics. Using RNA sequencing (RNA-seq), reverse transcription-polymerase chain reaction (RT-PCR) and quantitative PCR (QPCR) to sequence the expressed isoforms of guinea pig Abcb1, we demonstrate that like the human, the guinea pig genome contains one gene for Abcb1 but that it is expressed as at least three different isoforms via alternative splicing and alternate exon usage. Further, we demonstrate that these isoforms are more closely related to human than to rat or mouse isoforms. This striking, overall similarity and evolutionary relatedness between guinea pig Abcb1 and human ABCB1 indicate that the guinea pig represents a relevant animal model for investigating the function and regulation of P-gp in the placenta and brain.

  10. Three distinct clones of carbapenem-resistant Acinetobacter baumannii with high diversity of carbapenemases isolated from patients in two hospitals in Kuwait

    Directory of Open Access Journals (Sweden)

    N.A. Al-Sweih

    2012-02-01

    Full Text Available Summary: Objectives: This study was undertaken to investigate the clonal relatedness of multidrug-resistant (MDR Acinetobacter baumannii isolates collected from patients in two teaching hospitals in Kuwait. Materials and methods: Clinically significant consecutive isolates of A. baumannii obtained from patients in the Mubarak (36 and Adan (58 hospitals over a period of 6 months were studied. These isolates were identified using molecular methods, and their antimicrobial susceptibility was determined by the Etest method. The mechanism of resistance to carbapenem was investigated by PCR, and pulsed-field gel electrophoresis (PFGE was used to determine the clonal relatedness of MDR isolates. Results: Of the 94 isolates investigated, 80 (85.1% were multidrug resistant (MDR. The A. baumannii PFGE clone A and subclone A1 were the most prevalent in patients infected with MDR isolates. Fifty-five (94.8% and 15 (41.7% of the MDR isolates from the Adan and Mubarak hospitals, respectively, belonged to PFGE clone A; isolates in this group showed higher resistance rates to antibiotics than isolates form other groups. Of the 94 isolates, 40 (42.6% were resistant to either imipenem or meropenem or to both (CRAB. Most CRAB isolates (29/40 or 72.5% carried bla genes, which code for MBL (VIM-2 and IMP-1 enzymes. Two isolates harbored blaOXA-23. Conclusion: Three distinct clones of CRAB were isolated, providing evidence of a high diversity of carbapenemases among our geographically related isolates. Keywords: MDR A. baumannii, Genotypes, bla genes, Kuwait hospitals

  11. The demise of multidrug-resistant HIV-1: the national time trend in Portugal.

    Science.gov (United States)

    Vercauteren, Jurgen; Theys, Kristof; Carvalho, Ana Patricia; Valadas, Emília; Duque, Luis Miguel; Teófilo, Eugénio; Faria, Telo; Faria, Domitília; Vera, José; Aguas, Maria João; Peres, Susana; Mansinho, Kamal; Vandamme, Anne-Mieke; Camacho, Ricardo Jorge

    2013-04-01

    Despite a decreasing mortality and morbidity in treated HIV-1 patients, highly active antiretroviral treatment (HAART) can still fail due to the development of drug resistance. Especially, multidrug-resistant viruses pose a threat to efficient therapy. We studied the changing prevalence of multidrug resistance (MDR) over time in a cohort of HIV-1-infected patients in Portugal. We used data of 8065 HIV-1-infected patients followed from July 2001 up to April 2012 in 22 hospitals located in Portugal. MDR at a specific date of sampling was defined as no more than one fully active drug (excluding integrase and entry inhibitors) at that time authorized by the Portuguese National Authority of Medicines and Health Products (INFARMED), as interpreted with the Rega algorithm version 8.0.2. A generalized linear mixed model was used to study the time trend of the prevalence of MDR. We observed a statistically significant decrease in the prevalence of MDR over the last decade, from 6.9% (95% CI: 5.7-8.4) in 2001-03, 6.0% (95% CI: 4.9-7.2) in 2003-05, 3.7% (95% CI: 2.8-4.8) in 2005-07 and 1.6% (95% CI: 1.1-2.2) in 2007-09 down to 0.6% (95% CI: 0.3-0.9) in 2009-12 [OR=0.80 (95% CI: 0.75-0.86); P<0.001]. In July 2011 the last new case of MDR was seen. The prevalence of multidrug-resistant HIV-1 is decreasing over time in Portugal, reflecting the increasing efficiency of HAART and the availability of new drugs. Therefore, in designing a new drug, safety and practical aspects, e.g. less toxicity and ease of use, may need more attention than focusing mainly on efficacy against resistant strains.

  12. The Xenobiotic Transporter Mdr1 Enforces T Cell Homeostasis in the Presence of Intestinal Bile Acids.

    Science.gov (United States)

    Cao, Wei; Kayama, Hisako; Chen, Mei Lan; Delmas, Amber; Sun, Amy; Kim, Sang Yong; Rangarajan, Erumbi S; McKevitt, Kelly; Beck, Amanda P; Jackson, Cody B; Crynen, Gogce; Oikonomopoulos, Angelos; Lacey, Precious N; Martinez, Gustavo J; Izard, Tina; Lorenz, Robin G; Rodriguez-Palacios, Alex; Cominelli, Fabio; Abreu, Maria T; Hommes, Daniel W; Koralov, Sergei B; Takeda, Kiyoshi; Sundrud, Mark S

    2017-12-19

    CD4 + T cells are tightly regulated by microbiota in the intestine, but whether intestinal T cells interface with host-derived metabolites is less clear. Here, we show that CD4 + T effector (Teff) cells upregulated the xenobiotic transporter, Mdr1, in the ileum to maintain homeostasis in the presence of bile acids. Whereas wild-type Teff cells upregulated Mdr1 in the ileum, those lacking Mdr1 displayed mucosal dysfunction and induced Crohn's disease-like ileitis following transfer into Rag1 -/- hosts. Mdr1 mitigated oxidative stress and enforced homeostasis in Teff cells exposed to conjugated bile acids (CBAs), a class of liver-derived emulsifying agents that actively circulate through the ileal mucosa. Blocking ileal CBA reabsorption in transferred Rag1 -/- mice restored Mdr1-deficient Teff cell homeostasis and attenuated ileitis. Further, a subset of ileal Crohn's disease patients displayed MDR1 loss of function. Together, these results suggest that coordinated interaction between mucosal Teff cells and CBAs in the ileum regulate intestinal immune homeostasis. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Sensitization of multidrug-resistant human cancer cells to Hsp90 inhibitors by down-regulation of SIRT1

    Science.gov (United States)

    Kim, Hak-Bong; Lee, Su-Hoon; Um, Jee-Hyun; Oh, Won Keun; Kim, Dong-Wan; Kang, Chi-Dug; Kim, Sun-Hee

    2015-01-01

    The effectiveness of Hsp90 inhibitors as anticancer agents was limited in multidrug-resistant (MDR) human cancer cells due to induction of heat shock proteins (Hsps) such as Hsp70/Hsp27 and P-glycoprotein (P-gp)-mediated efflux. In the present study, we showed that resistance to Hsp90 inhibitors of MDR human cancer cells could be overcome with SIRT1 inhibition. SIRT1 knock-down or SIRT1 inhibitors (amurensin G and EX527) effectively suppressed the resistance to Hsp90 inhibitors (17-AAG and AUY922) in several MDR variants of human lymphoblastic leukemia and human breast cancer cell lines. SIRT1 inhibition down-regulated the expression of heat shock factor 1 (HSF1) and subsequently Hsps and facilitated Hsp90 multichaperone complex disruption via hyperacetylation of Hsp90/Hsp70. These findings were followed by acceleration of ubiquitin ligase CHIP-mediated mutant p53 (mut p53) degradation and subsequent down-regulation of P-gp in 17-AAG-treated MDR cancer cells expressing P-gp and mut p53 after inhibition of SIRT1. Therefore, combined treatment with Hsp90 inhibitor and SIRT1 inhibitor could be a more effective therapeutic approach for Hsp90 inhibitor-resistant MDR cells via down-regulation of HSF1/Hsps, mut p53 and P-gp. PMID:26416354

  14. Resistance patterns and trends of extensively drug-resistant tuberculosis: 5-year experience

    Directory of Open Access Journals (Sweden)

    Amresh Kumar Singh

    2013-12-01

    Full Text Available Objective:Extensively drug-resistant tuberculosis (XDR-TB strains were emerged when multidrug-resistant TB (MDR- TB was inadequately treated. Inadequate treatment of MDR-TB cases may result in additional resistance especially non-XDR-TB and then XDR-TB. The aim of this study was to know the prevalence, resistance patterns and trends of the XDR-TB strains among the MDR-TB at a tertiary care hospital in Lucknow, India Methods: A total of 430 Mycobacterium isolates were underwent NAP test and TB MPT64 Ag test for the identification of Mycobacterium tuberculosis complex (MTBC. Drug-susceptibility test (DST was performed over MTBC for the first line drugs by 1% proportion method (Bactec and for the second-line drugs by 1% proportion method (Lowenstein- Jensen media. The XDR-TB status was further confirmed by line probe assay (GenoType® MTBDRsl assay. Results: Among the 430 isolates of mycobacterium, 365 (84.9% were MTBC and 139 (38.1% were MDR-TB respectively. Further 97 MDR-TB from “highly suspected drug resistant-TB (DR-TB” cases among MDR-TB were tested with second line drugs in which 15 (15.5% XDR-TB and 82 (84.5% were non-XDR-TB. Regarding XDR-TB status, using the 1% proportion method a 100% agreement was seen with the GenoType® MTBDRsl assay. Resistance patterns of XDR-TB were as; 10/15 (66.7% as isoniazid + rifampicin + ciprofloxacin + amikacin resistance and 5/15 (33.3% as isoniazid + rifampicin + ciprofloxacin + amikacin + kanamycin resistance. Conclusion:The prevalence of XDR-TB was 15.5% among MDR-TB. Hence laboratory testing of “highly suspected drug resistant-TB” isolates should be done for both first and second line drugs simultaneously especially in developing countries.J Microbiol Infect Dis 2013;3(4: 169-175

  15. Treatment outcomes of MDR-tuberculosis patients in Brazil: a retrospective cohort analysis

    Directory of Open Access Journals (Sweden)

    Mayara Lisboa Bastos

    2017-11-01

    Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDR-TB is a threat for the global TB epidemic control. Despite existing evidence that individualized treatment of MDR-TB is superior to standardized regimens, the latter are recommended in Brazil, mainly because drug-susceptibility tests (DST are often restricted to first-line drugs in public laboratories. We compared treatment outcomes of MDR-TB patients using standardized versus individualized regimens in Brazil, a high TB-burden, low resistance setting. Methods The 2007–2013 cohort of the national electronic database (SITE-TB, which records all special treatments including drug-resistance, was analysed. Patients classified as MDR-TB in SITE-TB were eligible. Treatment outcomes were classified as successful (cure/treatment completed or unsuccessful (failure/relapse/death/loss to follow-up. The odds for successful treatment according to type of regimen were controlled for demographic and clinical variables. Results Out of 4029 registered patients, we included 1972 recorded from 2010 to 2012, who had more complete outcome data. The overall success proportion was 60%. Success was more likely in non-HIV patients, sputum-negative at baseline, with unilateral disease and without prior DR-TB. Adjusted for these variables, those receiving standardized regimens had 2.7-fold odds of success compared to those receiving individualized treatments when failure/relapse were considered, and 1.4-fold odds of success when death was included as an unsuccessful outcome. When loss to follow-up was added, no difference between types of treatment was observed. Patients who used levofloxacin instead of ofloxacin had 1.5-fold odds of success. Conclusion In this large cohort of MDR-TB patients with a low proportion of successful outcomes, standardized regimens had superior efficacy than individualized regimens, when adjusted for relevant variables. In addition to the limitations of any retrospective observational

  16. Global transcriptional profiling of longitudinal clinical isolates of Mycobacterium tuberculosis exhibiting rapid accumulation of drug resistance.

    Directory of Open Access Journals (Sweden)

    Anirvan Chatterjee

    Full Text Available The identification of multidrug resistant (MDR, extensively and totally drug resistant Mycobacterium tuberculosis (Mtb, in vulnerable sites such as Mumbai, is a grave threat to the control of tuberculosis. The current study aimed at explaining the rapid expression of MDR in Directly Observed Treatment Short Course (DOTS compliant patients, represents the first study comparing global transcriptional profiles of 3 pairs of clinical Mtb isolates, collected longitudinally at initiation and completion of DOTS. While the isolates were drug susceptible (DS at onset and MDR at completion of DOTS, they exhibited identical DNA fingerprints at both points of collection. The whole genome transcriptional analysis was performed using total RNA from H37Rv and 3 locally predominant spoligotypes viz. MANU1, CAS and Beijing, hybridized on MTBv3 (BuG@S microarray, and yielded 36, 98 and 45 differentially expressed genes respectively. Genes encoding transcription factors (sig, rpoB, cell wall biosynthesis (emb genes, protein synthesis (rpl and additional central metabolic pathways (ppdK, pknH, pfkB were found to be down regulated in the MDR isolates as compared to the DS isolate of the same genotype. Up regulation of drug efflux pumps, ABC transporters, trans-membrane proteins and stress response transcriptional factors (whiB in the MDR isolates was observed. The data indicated that Mtb, without specific mutations in drug target genes may persist in the host due to additional mechanisms like drug efflux pumps and lowered rate of metabolism. Furthermore this population of Mtb, which also showed reduced DNA repair activity, would result in selection and stabilization of spontaneous mutations in drug target genes, causing selection of a MDR strain in the presence of drug pressures. Efflux pump such as drrA may play a significant role in increasing fitness of low level drug resistant cells and assist in survival of Mtb till acquisition of drug resistant mutations with

  17. The emergence of a novel sequence type of MDR Acinetobacter baumannii from the intensive care unit of an Egyptian tertiary care hospital.

    Science.gov (United States)

    Ghaith, Doaa Mohammad; Zafer, Mai Mahmoud; Al-Agamy, Mohamed Hamed; Alyamani, Essam J; Booq, Rayan Y; Almoazzamy, Omar

    2017-05-10

    Acinetobacter baumannii is known for nosocomial outbreaks worldwide. In this study, we aimed to investigate the antibiotic susceptibility patterns and the clonal relationship of A. baumannii isolates from the intensive care unit (ICU) of an Egyptian hospital. In the present study, 50 clinical isolates of multidrug resistant (MDR)-A. baumannii were obtained from patients admitted into the ICU from June to December 2015. All isolates were analyzed for antimicrobial susceptibilities. Multiplex PCR was performed to detect genes encoding oxacillinase genes (bla OXA-51 -like, bla OXA-23 -like, bla OXA-24 -like, and bla OXA-58 -like). Multilocus sequence typing (MLST) based on the seven-gene scheme (gltA, gyrB, gdhB, recA, cpn60, gpi, rpoD) was used to examine these isolates. All A. baumannii clinical isolates showed the same resistance pattern, characterized by resistance to most common antibiotics including imipenem (MIC ≥ 8μ/mL), with the only exception being colistin. Most isolates were positive for bla OXA-51 -like and bla OXA-23 -like (100 and 96%, respectively); however, bla OXA-24 -like and bla OXA-58 -like were not detected. MLST analysis identified different sequence types (ST195, ST208, ST231, ST441, ST499, and ST723) and a new sequence type (ST13929) with other sporadic strains. MDR A. baumannii strains harboring bla OXA-23 -like genes were widely circulating in this ICU. MLST was a powerful tool for identifying and epidemiologically typing our strains. Strict infection control measures must be implemented to contain the worldwide spread of MDR A. baumannii in ICUs.

  18. Connection between Proliferation Rate and Temozolomide Sensitivity of Primary Glioblastoma Cell Culture and Expression of YB-1 and LRP/MVP.

    Science.gov (United States)

    Moiseeva, N I; Susova, O Yu; Mitrofanov, A A; Panteleev, D Yu; Pavlova, G V; Pustogarov, N A; Stavrovskaya, A A; Rybalkina, E Yu

    2016-06-01

    Glioblastomas (GBL) are the most common and aggressive brain tumors. They are distinguished by high resistance to radiation and chemotherapy. To find novel approaches for GBL classification, we obtained 16 primary GBL cell cultures and tested them with real-time PCR for mRNA expression of several genes (YB-1, MGMT, MELK, MVP, MDR1, BCRP) involved in controlling cell proliferation and drug resistance. The primary GBL cultures differed in terms of proliferation rate, wherein a group of GBL cell cultures with low proliferation rate demonstrated higher resistance to temozolomide. We found that GBL primary cell cultures characterized by high proliferation rate and lower resistance to temozolomide expressed higher mRNA level of the YB-1 and MDR1 genes, whereas upregulated expression of MVP/LRP mRNA was a marker in the group of GBL with low proliferation rate and high resistance. A moderate correlation between expression of YB-1 and MELK as well as YB-1 and MDR1 was found. In the case of YB-1 and MGMT expression, no correlation was found. A significant negative correlation was revealed between mRNA expression of MVP/LRP and MELK, MDR1, and BCRP. No correlation in expression of YB-1 and MVP/LRP genes was observed. It seems that mRNA expression of YB-1 and MVP/LRP may serve as a marker for GBL cell cultures belonging to distinct groups, each of which is characterized by a unique pattern of gene activity.

  19. Expression of Drug-Resistant Factor Genes in Hepatocellular Carcinoma Patients Undergoing Chemotherapy with Platinum Complex by Arterial Infusion

    Directory of Open Access Journals (Sweden)

    Shiro Ueda

    2010-09-01

    Full Text Available This study investigated gene expression of drug resistance factors in biopsy tissue samples from hepatocellular carcinoma (HCC patients undergoing chemotherapy by platinum complex. Liver biopsy was performed to collect tissue from the tumor site (T and the non-tumor site (NT prior to the start of treatment. For drug-resistant factors, drug excretion transporters cMOAT and MDR-1, intracellular metal binding protein MT2, DNA repair enzyme ERCC-l and inter-nucleic cell transport protein MVP, were investigated. The comparison of the expression between T and NT indicated a significant decrease of MT2 and MDR-1 in T while a significant increase in ERCC-1 was noted in T. Further, expression was compared between the response cases and non-response cases using the ratios of expression in T to those in NT. The response rate was significantly low in the high expression group when the cutoff value of cMOAT and MT2 was set at 1.5 and 1.0, respectively. Furthermore, when the patients were classified into A group (cMOAT ≧ 1.5 or MT2 ≧ 1.0 and B group (cMOAT < 1.5 and MT2 < 1.0, the response rate of A group was significantly lower than B group when we combined the cutoff values of cMOAT and MT2. It is considered possible to estimate the therapeutic effect of platinum complex at a high probability by combining the expression condition of these two genes.

  20. The expression and significance of multi-drug resistance genes in breast cancer stem cells%乳腺癌干细胞多药耐药基因的表达及意义

    Institute of Scientific and Technical Information of China (English)

    Zhi Li; Chunping Liu; Yanli He; Jinghui Zhang; Tao Huang

    2008-01-01

    Objective:To approach the expressions of MDR1 and BCRP in breast cancer stem cells and differentiated cells.Methods:The breast cancer stem calls were separated from human breast cancer primary tissues and MCF-7 by flow cytometry.Then we measured the expressions of MDR1 and BCRP with different subset cells by Realtime-PCR.Results:Contrasted with breast cancer differentiated cells,the expressions of MDR1 and BCRP in breast cancer stem calls were higher (P<0.01),and the proportion of stem cells rose after chemotherapy (P<0.01).Conclusion:Contrasted with breast cancer differentiated cells,breast cancer stem cells have stronger ability of clrug-resistanca with higher level of multi-drug resistance genes,and it is one of key points for chemotherapy failure of breast cancer.

  1. Global DNA hypermethylation-associated cancer chemotherapy resistance and its reversion with the demethylating agent hydralazine

    Directory of Open Access Journals (Sweden)

    Benitez-Bribiesca Luis

    2006-08-01

    Full Text Available Abstract Background The development of resistance to cytotoxic chemotherapy continues to be a major obstacle for successful anticancer therapy. It has been shown that cells exposed to toxic concentrations of commonly used cancer chemotherapy agents develop DNA hypermetylation. Hence, demethylating agents could play a role in overcoming drug resistance. Methods MCF-7 cells were rendered adriamycin-resistant by weekly treatment with adriamycin. Wild-type and the resulting MCF-7/Adr cells were analyzed for global DNA methylation. DNA methyltransferase activity and DNA methyltransferase (dnmt gene expression were also determined. MCF-7/Adr cells were then subjected to antisense targeting of dnmt1, -3a, and -b genes and to treatment with the DNA methylation inhibitor hydralazine to investigate whether DNA demethylation restores sensitivity to adriamycin. Results MCF-7/Adr cells exhibited the multi-drug resistant phenotype as demonstrated by adriamycin resistance, mdr1 gene over-expression, decreased intracellular accumulation of adriamycin, and cross-resistance to paclitaxel. The mdr phenotype was accompanied by global DNA hypermetylation, over-expression of dnmt genes, and increased DNA methyltransferase activity as compared with wild-type MCF-7 cells. DNA demethylation through antisense targeting of dnmts or hydralazine restored adriamycin sensitivity of MCF-7/Adr cells to a greater extent than verapamil, a known inhibitor of mdr protein, suggesting that DNA demethylation interferes with the epigenetic reprogramming that participates in the drug-resistant phenotype. Conclusion We provide evidence that DNA hypermethylation is at least partly responsible for development of the multidrug-resistant phenotype in the MCF-7/Adr model and that hydralazine, a known DNA demethylating agent, can revert the resistant phenotype.

  2. TaEDS1 genes positively regulate resistance to powdery mildew in wheat.

    Science.gov (United States)

    Chen, Guiping; Wei, Bo; Li, Guoliang; Gong, Caiyan; Fan, Renchun; Zhang, Xiangqi

    2018-04-01

    Three EDS1 genes were cloned from common wheat and were demonstrated to positively regulate resistance to powdery mildew in wheat. The EDS1 proteins play important roles in plant basal resistance and TIR-NB-LRR protein-triggered resistance in dicots. Until now, there have been very few studies on EDS1 in monocots, and none in wheat. Here, we report on three common wheat orthologous genes of EDS1 family (TaEDS1-5A, 5B and 5D) and their function in powdery mildew resistance. Comparisons of these genes with their orthologs in diploid ancestors revealed that EDS1 is a conserved gene family in Triticeae. The cDNA sequence similarity among the three TaEDS1 genes was greater than 96.5%, and they shared sequence similarities of more than 99.6% with the respective orthologs from diploid ancestors. The phylogenetic analysis revealed that the EDS1 family originated prior to the differentiation of monocots and dicots, and EDS1 members have since undergone clear structural differentiation. The transcriptional levels of TaEDS1 genes in the leaves were obviously higher than those of the other organs, and they were induced by Blumeria graminis f. sp. tritici (Bgt) infection and salicylic acid (SA) treatment. The BSMV-VIGS experiments indicated that knock-down the transcriptional levels of the TaEDS1 genes in a powdery mildew-resistant variety of common wheat compromised resistance. Contrarily, transient overexpression of TaEDS1 genes in a susceptible common wheat variety significantly reduced the haustorium index and attenuated the growth of Bgt. Furthermore, the expression of TaEDS1 genes in the Arabidopsis mutant eds1-1 complemented its susceptible phenotype to powdery mildew. The above evidences strongly suggest that TaEDS1 acts as a positive regulator and confers resistance against powdery mildew in common wheat.

  3. Multidrug resistance and retroviral transduction potential in human small cell lung cancer cell lines

    DEFF Research Database (Denmark)

    Theilade, M D; Gram, G J; Jensen, P B

    1999-01-01

    Multidrug resistance (MDR) remains a major problem in the successful treatment of small cell lung cancer (SCLC). New treatment strategies are needed, such as gene therapy specifically targeting the MDR cells in the tumor. Retroviral LacZ gene-containing vectors that were either pseudotyped...... for the gibbon ape leukemia virus (GALV-1) receptor or had specificity for the amphotropic murine leukemia virus (MLV-A) receptor were used for transduction of five SCLC cell lines differing by a range of MDR mechanisms. Transduction efficiencies in these cell lines were compared by calculating the percentage...... of blue colonies after X-Gal staining of the cells grown in soft agar. All examined SCLC cell lines were transducible with either vector. Transduction efficiencies varied from 5.7% to 33.5% independent of the presence of MDR. These results indicate that MDR does not severely impair transduction of SCLC...

  4. First report on class 1 integrons and Trimethoprim-resistance genes from dfrA group in uropathogenic E. coli (UPEC) from the Aleppo area in Syria

    Science.gov (United States)

    Al-Assil, Bodour; Mahfoud, Maysa; Hamzeh, Abdul Rezzak

    2013-01-01

    Horizontal gene transfer (HGT) introduces advantageous genetic elements into pathogenic bacteria using tools such as class1 integrons. This study aimed at investigating the distribution of these integrons among uropathogenic E. coli (UPEC) isolated from patients in Aleppo, Syria. It also set to uncover the frequencies of the clinically relevant DfrA1 and DfrA17,7, as well as various associations leading to reduced susceptibility. This study involved 75 Trimethoprim-resistant E. coli isolates from in- and outpatients with urinary tract infections (UTIs) from 3 major hospitals in Aleppo. Bacterial identification, resistance and extended-spectrum-β-lactamase (ESBL) production testing were performed according to Clinical Laboratory Standards Institute guidelines. Detection of integrons and DfrA genes was done using PCR and statistical significance was inferred through χ2 (Fisher’s) test. Class1 integrons were detected in 54.6% of isolates while DfrA1 and DfrA17,7 were found in 16% and 70.6% of tested samples respectively. Furthermore, only DfrA17,7 were strongly associated with class1 integrons, as were reduced susceptibility to the majority of individual antibiotics, multidrug resistance and ESBL production. This study demonstrated the high prevalence of class1 integrons among UPEC strains in Aleppo, Syria, as well as their significant associations with MDR. This data give information for local healthcare provision using antibiotic chemotherapy. PMID:23956949

  5. Molecular characterization of Ambler class A to D β-lactamases, ISAba1, and integrons reveals multidrug-resistant Acinetobacter spp. isolates in northeastern China.

    Science.gov (United States)

    Sun, Xiaoyu; Liu, Bin; Chen, Yan; Huang, Honglan; Wang, Guoqing; Li, Fan; Ni, Zhaohui

    2016-12-01

    The prevalence of various Ambler class A to D β-lactamases, ISAba1, and class 1 and 2 integrons as well as the clonal relatedness in 105 Acinetobacter spp. isolates found in northeastern China was investigated. All 105 Acinetobacter spp. isolates were determined to be multidrug resistant (MDR), and the resistance rates to carbapenem agents were approximately 50%. PER, IMP, AmpC, and OXA-23 were found to be dominant β-lactamases belonging to different classes, respectively. This is the first report of the coexistence of bla PER , bla IMP , bla AmpC , and bla OXA-23-like genes in Acinetobacter spp. isolates from northeastern China. ISAba1 was found upstream of the bla OXA-23-like gene in 87.8% (36/41) strains and upstream of the bla OXA-51-like gene in 26.5% (13/49) strains. ISAba3-like element was found upstream of the bla OXA-58-like gene in one bla OXA-58-like -positive strain. The presence of IntI1 was detected in 63.8% (67/105) of the isolates and the most prevalent gene cassettes were aacA4, aadA1, and catB8. The highly prevalent isolates belong to international clonal lineage (ICL)-II. These results indicate that the wide horizontal and clonal spread of MDR Acinetobacter spp. isolates harbouring multiple β-lactamase genes has become a serious problem in northeastern China.

  6. The demise of multidrug-resistant HIV-1: the national time trend in Portugal

    Science.gov (United States)

    Vercauteren, Jurgen; Theys, Kristof; Carvalho, Ana Patricia; Valadas, Emília; Duque, Luis Miguel; Teófilo, Eugénio; Faria, Telo; Faria, Domitília; Vera, José; Águas, Maria João; Peres, Susana; Mansinho, Kamal; Vandamme, Anne-Mieke; Camacho, Ricardo Jorge; Mansinho, Kamal; Cláudia Miranda, Ana; Aldir, Isabel; Ventura, Fernando; Nina, Jaime; Borges, Fernando; Valadas, Emília; Doroana, Manuela; Antunes, Francisco; João Aleixo, Maria; João Águas, Maria; Botas, Júlio; Branco, Teresa; Vera, José; Vaz Pinto, Inês; Poças, José; Sá, Joana; Duque, Luis; Diniz, António; Mineiro, Ana; Gomes, Flora; Santos, Carlos; Faria, Domitília; Fonseca, Paula; Proença, Paula; Tavares, Luís; Guerreiro, Cristina; Narciso, Jorge; Faria, Telo; Teófilo, Eugénio; Pinheiro, Sofia; Germano, Isabel; Caixas, Umbelina; Faria, Nancy; Paula Reis, Ana; Bentes Jesus, Margarida; Amaro, Graça; Roxo, Fausto; Abreu, Ricardo; Neves, Isabel

    2013-01-01

    Objectives Despite a decreasing mortality and morbidity in treated HIV-1 patients, highly active antiretroviral treatment (HAART) can still fail due to the development of drug resistance. Especially, multidrug-resistant viruses pose a threat to efficient therapy. We studied the changing prevalence of multidrug resistance (MDR) over time in a cohort of HIV-1-infected patients in Portugal. Patients and methods We used data of 8065 HIV-1-infected patients followed from July 2001 up to April 2012 in 22 hospitals located in Portugal. MDR at a specific date of sampling was defined as no more than one fully active drug (excluding integrase and entry inhibitors) at that time authorized by the Portuguese National Authority of Medicines and Health Products (INFARMED), as interpreted with the Rega algorithm version 8.0.2. A generalized linear mixed model was used to study the time trend of the prevalence of MDR. Results We observed a statistically significant decrease in the prevalence of MDR over the last decade, from 6.9% (95% CI: 5.7–8.4) in 2001–03, 6.0% (95% CI: 4.9–7.2) in 2003–05, 3.7% (95% CI: 2.8–4.8) in 2005–07 and 1.6% (95% CI: 1.1–2.2) in 2007–09 down to 0.6% (95% CI: 0.3–0.9) in 2009–12 [OR = 0.80 (95% CI: 0.75–0.86); P < 0.001]. In July 2011 the last new case of MDR was seen. Conclusions The prevalence of multidrug-resistant HIV-1 is decreasing over time in Portugal, reflecting the increasing efficiency of HAART and the availability of new drugs. Therefore, in designing a new drug, safety and practical aspects, e.g. less toxicity and ease of use, may need more attention than focusing mainly on efficacy against resistant strains. PMID:23228933

  7. Mortality among MDR-TB cases: comparison with drug-susceptible tuberculosis and associated factors.

    Directory of Open Access Journals (Sweden)

    Kocfa Chung-Delgado

    Full Text Available An increase in multidrug-resistant tuberculosis (MDR-TB cases is evident worldwide. Its management implies a complex treatment, high costs, more toxic anti-tuberculosis drug use, longer treatment time and increased treatment failure and mortality. The aims of this study were to compare mortality between MDR and drug-susceptible cases of tuberculosis, and to determine risk factors associated with mortality among MDR-TB cases.A retrospective cohort study was performed using data from clinical records of the National Strategy for Prevention and Control of Tuberculosis in Lima, Peru. In the first objective, MDR-TB, compared to drug-susceptible cases, was the main exposure variable and time to death, censored at 180 days, the outcome of interest. For the second objective, different variables obtained from clinical records were assessed as potential risk factors for death among MDR-TB cases. Cox regression analysis was used to determine hazard ratios (HR and 95% confidence intervals (95%CI. A total of 1,232 patients were analyzed: mean age 30.9 ±14.0 years, 60.0% were males. 61 patients (5.0% died during treatment, whereas the MDR-TB prevalence was 19.2%. MDR-TB increased the risk of death during treatment (HR = 7.5; IC95%: 4.1-13.4 when compared to presumed drug-susceptible cases after controlling for potential confounders. Education level (p = 0.01, previous TB episodes (p<0.001, diabetes history (p<0.001 and HIV infection (p = 0.04 were factors associated with mortality among MDR-TB cases.MDR-TB is associated with an increased risk of death during treatment. Lower education, greater number of previous TB episodes, diabetes history, and HIV infection were independently associated with mortality among MDR-TB cases. New strategies for appropriate MDR-TB detection and management should be implemented, including drug sensitivity tests, diabetes and HIV screening, as well as guarantee for a complete adherence to therapy.

  8. Characterization of Multidrug Resistant ESBL-Producing Escherichia coli Isolates from Hospitals in Malaysia

    Directory of Open Access Journals (Sweden)

    King-Ting Lim

    2009-01-01

    Full Text Available The emergence of Escherichia coli that produce extended spectrum β-lactamases (ESBLs and are multidrug resistant (MDR poses antibiotic management problems. Forty-seven E. coli isolates from various public hospitals in Malaysia were studied. All isolates were sensitive to imipenem whereas 36 were MDR (resistant to 2 or more classes of antibiotics. PCR detection using gene-specific primers showed that 87.5% of the ESBL-producing E. coli harbored the blaTEM gene. Other ESBL-encoding genes detected were blaOXA, blaSHV, and blaCTX-M. Integron-encoded integrases were detected in 55.3% of isolates, with class 1 integron-encoded intI1 integrase being the majority. Amplification and sequence analysis of the 5′CS region of the integrons showed known antibiotic resistance-encoding gene cassettes of various sizes that were inserted within the respective integrons. Conjugation and transformation experiments indicated that some of the antibiotic resistance genes were likely plasmid-encoded and transmissible. All 47 isolates were subtyped by PFGE and PCR-based fingerprinting using random amplified polymorphic DNA (RAPD, repetitive extragenic palindromes (REPs, and enterobacterial repetitive intergenic consensus (ERIC. These isolates were very diverse and heterogeneous. PFGE, ERIC, and REP-PCR methods were more discriminative than RAPD in subtyping the E. coli isolates.

  9. TTFields alone and in combination with chemotherapeutic agents effectively reduce the viability of MDR cell sub-lines that over-express ABC transporters

    International Nuclear Information System (INIS)

    Schneiderman, Rosa S; Shmueli, Esther; Kirson, Eilon D; Palti, Yoram

    2010-01-01

    Exposure of cancer cells to chemotherapeutic agents may result in reduced sensitivity to structurally unrelated agents, a phenomenon known as multidrug resistance, MDR. The purpose of this study is to investigate cell growth inhibition of wild type and the corresponding MDR cells by Tumor Treating Fields - TTFields, a new cancer treatment modality that is free of systemic toxicity. The TTFields were applied alone and in combination with paclitaxel and doxorubicin. Three pairs of wild type/MDR cell lines, having resistivity resulting from over-expression of ABC transporters, were studied: a clonal derivative (C11) of parental Chinese hamster ovary AA8 cells and their emetine-resistant sub-line Emt R1 ; human breast cancer cells MCF-7 and their mitoxantrone-resistant sub lines MCF-7/Mx and human breast cancer cells MDA-MB-231 and their doxorubicin resistant MDA-MB-231/Dox cells. TTFields were applied for 72 hours with and without the chemotherapeutic agents. The numbers of viable cells in the treated cultures and the untreated control groups were determined using the XTT assay. Student t-test was applied to asses the significance of the differences between results obtained for each of the three cell pairs. TTFields caused a similar reduction in the number of viable cells of wild type and MDR cells. Treatments by TTFields/drug combinations resulted in a similar increased reduction in cell survival of wild type and MDR cells. TTFields had no effect on intracellular doxorubicin accumulation in both wild type and MDR cells. The results indicate that TTFields alone and in combination with paclitaxel and doxorubicin effectively reduce the viability of both wild type and MDR cell sub-lines and thus can potentially be used as an effective treatment of drug resistant tumors

  10. Virulence-associated genes, antimicrobial resistance and molecular typing of Salmonella Typhimurium strains isolated from swine from 2000 to 2012 in Brazil.

    Science.gov (United States)

    Almeida, F; Medeiros, M I C; Kich, J D; Falcão, J P

    2016-06-01

    The aims of this study were to assess the pathogenic potential, antimicrobial resistance and genotypic diversity of Salmonella Typhimurium strains isolated in Brazil from swine (22) and the surrounding swine environment (5) from 2000 to 2012 and compare them to the profiles of 43 human strains isolated from 1983 to 2010, which had been previously studied. The presence of 12 SPI-1, SPI-2 and plasmid genes was assessed by PCR, the antimicrobial susceptibility to 13 antimicrobials was determined by the disc diffusion assay and genotyping was performed using pulsed-field gel electrophoresis (PFGE), multiple-locus variable-number of tandem repeats analysis (MLVA) and ERIC-PCR. More than 77·8% of the swine strains carried 10 or more of the virulence markers. Ten (37%) strains isolated from swine were multi-drug resistant (MDR). All the molecular typing techniques grouped the strains in two main clusters. Some strains isolated from swine and humans were allocated together in the PFGE-B2, MLVA-A1, MLVA-B and ERIC-A1 clusters. The genotyping results suggest that some strains isolated from swine and humans may descend from a common subtype and may indicate a possible risk of MDR S. Typhimurium with high frequency of virulence genes isolated from swine to contaminate humans in Brazil. This study provided new information about the pathogenic potential, antimicrobial resistance and genotypic diversity of S. Typhimurium isolates from swine origin in Brazil, the fourth largest producer of pigs worldwide. © 2016 The Society for Applied Microbiology.

  11. Multidrug-Resistant CTX-M-(15, 9, 2)- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance).

    Science.gov (United States)

    Andrade, Leonardo N; Siqueira, Thiago E S; Martinez, Roberto; Darini, Ana Lucia C

    2018-01-01

    Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes ( sil operon: silE, silS, silR, silC, silF, silB, silA , and silP ) and acquired extended-spectrum cephalosporin and carbapenem resistance genes ( bla CTX-M and bla KPC ) in Enterobacter cloacae Complex (EcC) ( n = 27) and Enterobacter aerogenes ( n = 8) isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump) and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump), arsB (arsenite-efflux pump), terF (tellurite resistance protein), and merA (mercuric reductase) were also investigated. Outstandingly, 21/27 (78%) EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA -positive EcC isolates. Interestingly, 8/20 (40%) E. hormaechei and 5/6 (83%) E. asburiae co-harbored silA/pcoD genes and bla CTX-M-(15,2,or9) and/or bla KPC-2 genes. Frequent occurrences of arsB, terF , and merA genes were detected, especially in silA/pcoD -positive, multidrug-resistant (MDR) and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.

  12. Multidrug-Resistant CTX-M-(15, 9, 2- and KPC-2-Producing Enterobacter hormaechei and Enterobacter asburiae Isolates Possessed a Set of Acquired Heavy Metal Tolerance Genes Including a Chromosomal sil Operon (for Acquired Silver Resistance

    Directory of Open Access Journals (Sweden)

    Leonardo N. Andrade

    2018-03-01

    Full Text Available Bacterial resistance to antibiotics is concern in healthcare-associated infections. On the other hand, bacterial tolerance to other antimicrobials, like heavy metals, has been neglected and underestimated in hospital pathogens. Silver has long been used as an antimicrobial agent and it seems to be an important indicator of heavy metal tolerance. To explore this perspective, we searched for the presence of acquired silver resistance genes (sil operon: silE, silS, silR, silC, silF, silB, silA, and silP and acquired extended-spectrum cephalosporin and carbapenem resistance genes (blaCTX−M and blaKPC in Enterobacter cloacae Complex (EcC (n = 27 and Enterobacter aerogenes (n = 8 isolated from inpatients at a general hospital. Moreover, the genetic background of the silA (silver-efflux pump and the presence of other acquired heavy metal tolerance genes, pcoD (copper-efflux pump, arsB (arsenite-efflux pump, terF (tellurite resistance protein, and merA (mercuric reductase were also investigated. Outstandingly, 21/27 (78% EcC isolates harbored silA gene located in the chromosome. Complete sil operon was found in 19/21 silA-positive EcC isolates. Interestingly, 8/20 (40% E. hormaechei and 5/6 (83% E. asburiae co-harbored silA/pcoD genes and blaCTX−M−(15,2,or9 and/or blaKPC−2 genes. Frequent occurrences of arsB, terF, and merA genes were detected, especially in silA/pcoD-positive, multidrug-resistant (MDR and/or CTX-M-producing isolates. Our study showed co-presence of antibiotic and heavy metal tolerance genes in MDR EcC isolates. In our viewpoint, there are few studies regarding to bacterial heavy metal tolerance and we call attention for more investigations and discussion about this issue in different hospital pathogens.

  13. Mdr1a plays a crucial role in regulating the analgesic effect and toxicity of aconitine by altering its pharmacokinetic characteristics

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Lijun; Wu, Jinjun; Zhao, Min; Song, Wenjie; Qi, Xiaoxiao; Wang, Ying [International Institute for Translational Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510006 (China); Lu, Linlin [International Institute for Translational Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510006 (China); State Key Laboratory of Quality Research in Chinese Medicine, Macau University of Science and Technology, Macau (SAR) 999078 (China); Liu, Zhongqiu, E-mail: liuzq@gzucm.edu.cn [International Institute for Translational Chinese Medicine, Guangzhou University of Chinese Medicine, Guangzhou, Guangdong 510006 (China); State Key Laboratory of Quality Research in Chinese Medicine, Macau University of Science and Technology, Macau (SAR) 999078 (China)

    2017-04-01

    Aconitine (AC) is the primary bioactive/toxic alkaloid in plants of the Aconitum species. Our previous study demonstrated that Mdr1 was involved in efflux of AC. However, the mechanism by which Mdr1 regulates the efficacy/toxicity of AC in vivo remains unclear. The present study aimed to determine the effects of Mdr1a on the efficacy/toxicity and pharmacokinetics of AC in wild-type and Mdr1a{sup −/−} FVB mice. After oral administration of AC, significantly higher analgesic effect was observed in Mdr1a{sup −/−} mice (49% to 105%) compared to wild-type mice (P < 0.05). The levels of s100-β protein and creatine kinase, which indicate cerebral and myocardial damage, respectively, were also significantly increased (P < 0.05) in Mdr1a{sup −/−} mice. Histopathological examination revealed that the Mdr1a{sup −/−} mice suffered from evident cerebral and myocardial damages, but the wild-type mice did not. These findings suggested that Mdr1a deficiency significantly promoted the analgesic effect of AC and exacerbated its toxicity. Pharmacokinetic experiments showed that T{sub 1/2} of AC in the Mdr1a{sup −/−} mice was significantly higher (from 87% to 300%) than that in wild-type mice (P < 0.05). The distribution of AC in the brain of Mdr1a{sup −/−} mice was 2- to 32-fold higher than that in the brains of wild-type mice (P < 0.05). Toxic reactions were more severe in Mdr1a{sup −/−} mice compared to wild-type mice. In conclusion, Mdr1a deficiency significantly enhanced the analgesic effect of AC and exacerbated its toxicity by upregulating its distribution to the brain and decreasing its plasma elimination rate. Thus, Mdr1a dysfunction may cause severe AC poisoning. - Highlights: • The efficacy and toxicity of aconitine were significantly enhanced in Mdr1a{sup −/−} mice. • The distribution of aconitine to the brain was remarkably increased in Mdr1a{sup −/−} mice. • The elimination rate of aconitine was significantly decreased in Mdr1a

  14. Antibacterial Activity Test of Nudibranches Polka - Dot (Jorunna funebris (Gastropods : Molusc Extract Against Multi(Aktivitas Antibakteri Ekstrak Nudibranch Polka-Dot (Jorunna funebris (Gastropoda : Moluska Terhadap Bakteri Multidrug Resistant (MDR

    Directory of Open Access Journals (Sweden)

    Delianis Pringgenies

    2015-12-01

    Full Text Available Terjadinya resistensi antibiotik menjadi permasalahan dalam dunia kesehatan. Peningkatan kemampuan patogen dalam menahan efek obat menyebabkan timbulnya resistensi. Beberapa bakteri patogen pada manusia dilaporkan telah mengalami resistensi terhadap lebih dari satu kelas antibiotik. Untuk mengatasi permasalahan tersebut, maka perlu dilakukan pencarian senyawa antibiotik baru yang lebih efektif dalam mengatasi permasalahan bakteri Multi-drug Resistant (MDR. Metabolit sekunder yang diproduksi oleh invertebrata laut  mempunyai prospek sebagai bahan obat dari laut. Nudibranch diduga mampu menghasilkan metabolit sekunder sebagai mekanisme pertahanan diri. Tujuan dari penelitian ini adalah untuk mengetahui fraksi dari ekstrak nudibranch Jorunna funebris yang menunjukkan bioaktivitas terhadap bakteri Multi-drug Resistant (MDR. Proses ekstraksi dilakukan dengan metode maserasi. Fraksinasi dengan Kromatografi Kolom Terbuka (KKT. Uji aktivitas antibakteri menggunakan metode difusi agar. Analisis komponen senyawa dengan GC-MS. Hasil penelitian menunjukkan bahwa 8 fraksi ekstrak nudibranch J. funebris menunjukkan aktivitas antibakteri. Hasil uji aktivitas menunjukkan fraksi I paling aktif terhadap 5 bakteri uji yaitu Klebsiella, Pseudomonas, Escherichia coli, Enterobacter 5 dan Enterobacter 10 dengan rata-rata zona hambatan secara berurutan sebesar 12,78 mm; 12,51 mm; 15,47 mm; 14,09 mm dan 12,46 mm. Fraksi II paling aktif terhadap bakteri Coagulase Negative Staphylococcus dengan rata-rata zona hambatan sebesar 12,70 mm. Analisis GC-MS menunjukkan bahwa dalam fraksi II terdapat senyawa 1-oktadekanol yang berpotensi sebagai antibakteri. Kata kunci : nudibranch, Jorunna funebris, antibakteri, multi-drug resistant, 1-oktadekanol Emergence of antibiotic resistance become a problems on medical world. Increasing pathogen ability to hold the antibiotic effect caused resistance. Several human-patogen bacteria were resistance to one or more classes of antibiotics

  15. Integron types, gene cassettes and antimicrobial resistance profile of Acinetobacter baumannii isolated from BAL samples in Babol, north of Iran.

    Science.gov (United States)

    Akrami, Fariba; Shahandashti, Elaheh Ferdosi; Yahyapour, Yousef; Sadeghi, Mohsen; Khafri, Soraya; Pournajaf, Abazar; Rajabnia, Ramazan

    2017-08-01

    Multi-drug resistant isolates of Acinetobacter baumannii have created therapeutic problems worldwide. This current study was intended to determine the Integron types, gene cassettes and antimicrobial resistance profile of A. baumannii isolated from BAL samples in Babol, north of Iran. During a 15-month period, 35 A. baumannii isolates were studied. Different classes of antimicrobial agents were used to determine the resistance ratios. Multiplex-PCR was used to detect different types of integrons and associated gene cassettes. The resistance rates to GM, FEP, AK, TOB, CP, PIP, SAM, IPM, SXT, CTX, CAZ, CL, TIM, MEM, and TZP were 85.7%, 100%, 91.4%, 68.5%, 94.3%, 88.5%, 97.1%, 94.3%, 100%, 100%, 100%, 0.0%, 91.4%, 94.3% and 91.4%, respectively. The distribution analysis of int genes showed that 25.7%, 88.6% and 28.6% of isolates carried the intI, intII and intIII genes, respectively. The prevalence of aadB, dfrA1, bla-OXA 30 and aadA1 genes were 94.3%, 77.1%, 40% and 5.7%, respectively. The current study showed that a high level of A. baumannii isolates harbor integrons in our therapeutic center, which may lead to distribution of multiple antimicrobial resistance. The different types of gene cassette arrays in the present study highlight the important role of geographical features in MDR isolates dissemination which could be credited to different profiles of drug consumption in different areas. The findings emphasized that the need for continuous surveillance to prevent distribution of multidrug resistance among A. baumannii strains in Iran. Copyright © 2017. Published by Elsevier Ltd.

  16. In vivo detection of multidrug-resistant (MDR1) phenotype by technetium-99m sestamibi scan in untreated breast cancer patients

    International Nuclear Information System (INIS)

    Del Vecchio, S.; Ciarmiello, A.; Potena, M.I.; Carriero, M.V.; Mainolfi, C.; Botti, G.; Thomas, R.; Cerra, M.; D'Aiuto, G.; Tsuruo, T.; Salvatore, M.

    1997-01-01

    Technetium-99m sestamibi is a transport substrate recognised by the multidrug-resistant P-glycoprotein (Pgp). To test whether 99m Tc-sestamibi efflux is enhanced in breast carcinomas overexpressing Pgp, we determined the efflux rates of 99m Tc-sestamibi and Pgp levels in tumours from 30 patients with untreated breast carcinoma. Patients were intravenously injected with 740 MBq of 99m Tc-sestamibi and underwent a 15-min dynamic study followed by the acquisition of static planar images at 0.5, 1, 2 and 4 h. Tumour specimens were obtained from each patient 24 h after 99m Tc-sestamibi scan and Pgp levels were determined using 125 I-MRK16 monoclonal antibody and in vitro quantitative autoradiography. All breast carcinomas showed high uptake of 99m Tc-sestamibi and data from region of interest analysis on sequential images were fitted with a monoexponential function. The efflux rates of 99m Tc-sestamibi, calculated from decay-corrected time-activity curves, ranged between 0.00121 and 0.01690 min -1 and were directly correlated with Pgp levels measured in the same tumours (r=0.62; P 99m Tc-sestamibi efflux from tumours of group A was 2.7 times higher than that observed in tumours of group B (0.00686 ±0.00390 min -1 vs 0.00250 ±0.00090 min -1 , P 99m Tc-sestamibi showed a sensitivity and a specificity of 80% and 95%, respectively. In conclusion, the efflux rate of 99m Tc-sestamibi may be used for the in vivo identification of the multidrug resistant (MDR1) phenotype in untreated breast cancer patients. (orig.). With 7 figs., 3 tabs

  17. Multidrug-resistance and presence of class 1 integrons in clinical isolates of Salmonella enterica serotype Enteritidis, circulating in Armenia

    DEFF Research Database (Denmark)

    Sedrakyan, Anahit M.; Arakelova, K. A.; Zakaryan, Magdalina K.

    2014-01-01

    a rapid and large-scale penetration of antibiotic resistance genes into populations of S. Enteritidis, which complicates infection control. More rigorous regulations should be imposed on antibiotic use, together with a vigilant epidemiological surveillance, to prevent the emergence and spread of MDR S...

  18. Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolated in Nepal.

    Science.gov (United States)

    Poudel, Ajay; Nakajima, Chie; Fukushima, Yukari; Suzuki, Haruka; Pandey, Basu Dev; Maharjan, Bhagwan; Suzuki, Yasuhiko

    2012-06-01

    Despite the fact that Nepal is one of the first countries globally to introduce multidrug-resistant tuberculosis (MDR-TB) case management, the number of MDR-TB cases is continuing to rise in Nepal. Rapid molecular tests applicable in this setting to identify resistant organisms would be an effective tool in reversing this trend. To develop such tools, information about the frequency and distribution of mutations that are associated with phenotypic drug resistance in Mycobacterium tuberculosis is required. In the present study, we investigated the prevalence of mutations in rpoB and katG genes and the inhA promoter region in 158 M. tuberculosis isolates (109 phenotypically MDR and 49 non-MDR isolates collected in Nepal) by DNA sequencing. Mutations affecting the 81-bp rifampin (RIF) resistance-determining region (RRDR) of rpoB were identified in 106 of 109 (97.3%) RIF-resistant isolates. Codons 531, 526, and 516 were the most commonly affected, at percentages of 58.7, 15.6, and 15.6%, respectively. Of 113 isoniazid (INH)-resistant isolates, 99 (87.6%) had mutations in the katG gene, with Ser315Thr being the most prevalent (81.4%) substitution. Mutations in the inhA promoter region were detected in 14 (12.4%) INH-resistant isolates. The results from this study provide an overview of the current situation of RIF and INH resistance in M. tuberculosis in Nepal and can serve as a basis for developing or improving rapid molecular tests to monitor drug-resistant strains in this country.

  19. Study of tea polyphenol as a reversal agent for carcinoma cell lines' multidrug resistance (study of TP as a MDR reversal agent)

    International Nuclear Information System (INIS)

    Zhu Aizhi; Wang Xiangyun; Guo Zhenquan

    2001-01-01

    The aim of this study was to examine MDR1 expression product P-glycoprotein (Pgp) and study the effect and mechanism of tea polyphenol (TP) in reversion of multidrug resistance (MDR) in carcinoma cell lines. Immunocytochemical method was used for qualitative detection of Pgp. A comparative study of cytotoxicity and multidrug resistance reversion effect was made by MTT assay for tea polyphenol and quinidine in MCF-7 and MCF-7/Adr cell lines. The multidrug resistance reversion effect and mechanism were studied by measuring the uptake of 99m Tc-tetrofosmin in the carcinoma cell lines. (1) The Pgp overexpression in MCF-7/Adr cells was found to be strong positive, while the Pgp expression of MCF-7 was negative. (2) Although both tea polyphenol and quinidine could not remarkably change the toxicity of adriamycin to MCF-7, they could improve the sensitivity of MCF-7/Adr to adriamycin. The reversion index of tea polyphenol and quinidine was 3 and 10 respectively. (3) The cellular uptake of 99m Tc-tetrofosmin was remarkably lower in MCF-7/Adr than in MCF-7. The uptake of 99m Tc-tetrofosmin in MCF-7/Adr exhibited a 4, 13, 16 fold increase in the presence of 200, 400 and 500 μg/ml of tea polyphenol respectively. The uptake of 99m Tc-tetrofosmin in MCF-7/Adr exhibited only a 4-fold increase in the presence of 200 μM of quinidine. Immunocytochemistry can detect P-glycoprotein expression level qualitatively. Tea polyphenol is not only an anti-tumor agent, but also a multidrug resistant modulator similar to quinidine. The multidrug resistance reversion mechanism of tea polyphenol seems to be its inhibition of the activity of P-glycoprotein. Tea polyphenol has the advantage of very low toxicity in tumor treatment

  20. Genotypic analysis of multidrug-resistant tuberculosis isolates from extra pulmonary tuberculosis cases in tertiary care centers in Northern India

    Directory of Open Access Journals (Sweden)

    Anand K Maurya

    2016-01-01

    Conclusion: The prevalence (13.4% of MDR-TB among EPTB was high, and the most prominent mutations in rpoB, katG, and inhA genes were S531L (67.3%, S315T1 (94.5%, and C15T (20%, respectively. Beijing stains are significantly associated with MDR-TB among EPTB in this region. We found that the transmission of prominent mutations contributes to an unexpected increase in primary resistance, including MDR-TB cases in Northern India.

  1. Overexpression of the ATP-binding cassette half-transporter, ABCG2 (Mxr/BCrp/ABCP1), in flavopiridol-resistant human breast cancer cells

    DEFF Research Database (Denmark)

    Robey, R W; Medina-Pérez, W Y; Nishiyama, K

    2001-01-01

    We sought to characterize the interactions of flavopiridol with members of the ATP-binding cassette (ABC) transporter family. Cells overexpressing multidrug resistance-1 (MDR-1) and multidrug resistance-associated protein (MRP) did not exhibit appreciable flavopiridol resistance, whereas cell lines...... overexpressing the ABC half-transporter, ABCG2 (MXR/BCRP/ABCP1), were found to be resistant to flavopiridol. Flavopiridol at a concentration of 10 microM was able to prevent MRP-mediated calcein efflux, whereas Pgp-mediated transport of rhodamine 123 was unaffected at flavopiridol concentrations of up to 100...... analysis revealed overexpression of the ABCG2 gene. Western blot confirmed overexpression of ABCG2; neither P-glycoprotein nor MRP overexpression was detected. These results suggest that ABCG2 plays a role in resistance to flavopiridol....

  2. JNK signaling maintains the mesenchymal properties of multi-drug resistant human epidermoid carcinoma KB cells through snail and twist1

    International Nuclear Information System (INIS)

    Zhan, Xia; Feng, Xiaobing; Kong, Ying; Chen, Yi; Tan, Wenfu

    2013-01-01

    In addition to possess cross drug resistance characteristic, emerging evidences have shown that multiple-drug resistance (MDR) cancer cells exhibit aberrant metastatic capacity when compared to parental cells. In this study, we explored the contribution of c-Jun N-terminal kinases (JNK) signaling to the mesenchymal phenotypes and the aberrant motile capacity of MDR cells utilizing a well characterized MDR cell line KB/VCR, which is established from KB human epidermoid carcinoma cells by vincristine (VCR), and its parental cell line KB. Taking advantage of experimental strategies including pharmacological tool and gene knockdown, we showed here that interference with JNK signaling pathway by targeting JNK1/2 or c-Jun reversed the mesenchymal properties of KB/VCR cells to epithelial phenotypes and suppressed the motile capacity of KB/VCR cells, such as migration and invasion. These observations support a critical role of JNK signaling in maintaining the mesenchymal properties of KB/VCR cells. Furthermore, we observed that JNK signaling may control the expression of both snail and twist1 in KB/VCR cells, indicating that both snail and twist1 are involved in controlling the mesenchymal characteristics of KB/VCR cells by JNK signaling. JNK signaling is required for maintaining the mesenchymal phenotype of KB/VCR cells; and JNK signaling may maintain the mesenchymal characteristics of KB/VCR cells potentially through snail and twist1

  3. JNK signaling maintains the mesenchymal properties of multi-drug resistant human epidermoid carcinoma KB cells through snail and twist1.

    Science.gov (United States)

    Zhan, Xia; Feng, Xiaobing; Kong, Ying; Chen, Yi; Tan, Wenfu

    2013-04-04

    In addition to possess cross drug resistance characteristic, emerging evidences have shown that multiple-drug resistance (MDR) cancer cells exhibit aberrant metastatic capacity when compared to parental cells. In this study, we explored the contribution of c-Jun N-terminal kinases (JNK) signaling to the mesenchymal phenotypes and the aberrant motile capacity of MDR cells utilizing a well characterized MDR cell line KB/VCR, which is established from KB human epidermoid carcinoma cells by vincristine (VCR), and its parental cell line KB. Taking advantage of experimental strategies including pharmacological tool and gene knockdown, we showed here that interference with JNK signaling pathway by targeting JNK1/2 or c-Jun reversed the mesenchymal properties of KB/VCR cells to epithelial phenotypes and suppressed the motile capacity of KB/VCR cells, such as migration and invasion. These observations support a critical role of JNK signaling in maintaining the mesenchymal properties of KB/VCR cells. Furthermore, we observed that JNK signaling may control the expression of both snail and twist1 in KB/VCR cells, indicating that both snail and twist1 are involved in controlling the mesenchymal characteristics of KB/VCR cells by JNK signaling. JNK signaling is required for maintaining the mesenchymal phenotype of KB/VCR cells; and JNK signaling may maintain the mesenchymal characteristics of KB/VCR cells potentially through snail and twist1.

  4. Occurrence of the mcr-1 Colistin Resistance Gene and other Clinically Relevant Antibiotic Resistance Genes in Microbial Populations at Different Municipal Wastewater Treatment Plants in Germany

    Directory of Open Access Journals (Sweden)

    Norman Hembach

    2017-07-01

    Full Text Available Seven wastewater treatment plants (WWTPs with different population equivalents and catchment areas were screened for the prevalence of the colistin resistance gene mcr-1 mediating resistance against last resort antibiotic polymyxin E. The abundance of the plasmid-associated mcr-1 gene in total microbial populations during water treatment processes was quantitatively analyzed by qPCR analyses. The presence of the colistin resistance gene was documented for all of the influent wastewater samples of the seven WWTPs. In some cases the mcr-1 resistance gene was also detected in effluent samples of the WWTPs after conventional treatment reaching the aquatic environment. In addition to the occurrence of mcr-1 gene, CTX-M-32, blaTEM, CTX-M, tetM, CMY-2, and ermB genes coding for clinically relevant antibiotic resistances were quantified in higher abundances in all WWTPs effluents. In parallel, the abundances of Acinetobacter baumannii, Klebsiella pneumoniae, and Escherichia coli were quantified via qPCR using specific taxonomic gene markers which were detected in all influent and effluent wastewaters in significant densities. Hence, opportunistic pathogens and clinically relevant antibiotic resistance genes in wastewaters of the analyzed WWTPs bear a risk of dissemination to the aquatic environment. Since many of the antibiotic resistance gene are associated with mobile genetic elements horizontal gene transfer during wastewater treatment can't be excluded.

  5. IncA/C plasmids harboured in serious multidrug-resistant Vibrio cholerae serogroup O139 strains in China.

    Science.gov (United States)

    Wang, Ruibai; Yu, Dong; Zhu, Lianhui; Li, Jie; Yue, Junjie; Kan, Biao

    2015-03-01

    Vibrio cholerae serogroup O139 emerged in 1992 and is one of two major serogroups to have caused cholera epidemics. After 1998, serious multidrug-resistant (MDR) O139 strains quickly became common in China, showing a multidrug resistance profile to eight antibiotics. It is a great threat to public health, and elucidation of its mechanisms of resistance will provide a helpful guide for the clinical treatment and prevention of cholera. In this study, mega-plasmids from MDR V. cholerae O139 strains were identified by pulsed-field gel electrophoresis (PFGE) without enzyme digestion. One plasmid was isolated and sequenced, belonging to the IncA/C family. Ten antibiotic resistance genes were found in the MDR regions, including a blaTEM-20 gene, and these genes endowed the host with resistance to seven antibiotics. This kind of plasmid was positive in 71.2% (198/278) of toxigenic O139 strains, and the rate of plasmid positivity was consistent with the yearly change in MDR rates of these strains. This study reveals an important role of the IncA/C family plasmid in the spread of multiple antibiotic resistance of epidemic V. cholerae serogroup O139 strains, which has recombined with plasmids from different bacterial species and transferred among V. cholerae strains. Copyright © 2014 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  6. Regulation of multidrug resistance by microRNAs in anti-cancer therapy

    Directory of Open Access Journals (Sweden)

    Xin An

    2017-01-01

    Full Text Available Multidrug resistance (MDR remains a major clinical obstacle to successful cancer treatment. Although diverse mechanisms of MDR have been well elucidated, such as dysregulation of drugs transporters, defects of apoptosis and autophagy machinery, alterations of drug metabolism and drug targets, disrupti on of redox homeostasis, the exact mechanisms of MDR in a specific cancer patient and the cross-talk among these different mechanisms and how they are regulated are poorly understood. MicroRNAs (miRNAs are a new class of small noncoding RNAs that could control the global activity of the cell by post-transcriptionally regulating a large variety of target genes and proteins expression. Accumulating evidence shows that miRNAs play a key regulatory role in MDR through modulating various drug resistant mechanisms mentioned above, thereby holding much promise for developing novel and more effective individualized therapies for cancer treatment. This review summarizes the various MDR mechanisms and mainly focuses on the role of miRNAs in regulating MDR in cancer treatment.

  7. Amurensin G, a potent natural SIRT1 inhibitor, rescues doxorubicin responsiveness via down-regulation of multidrug resistance 1

    DEFF Research Database (Denmark)

    Oh, Won Keun; Cho, Kyoung Bin; Hien, Tran Thi

    2010-01-01

    The transition from a chemotherapy-responsive cancer to a chemotherapy-resistant one is accompanied by increased expression of multidrug resistance 1 (MDR1, p-glycoprotein), which plays an important role in the efflux from the target cell of many anticancer agents. We recently showed that a Forkh...

  8. The Prevalence and Molecular Epidemiology of Multidrug-Resistant Enterobacteriaceae Colonization in a Pediatric Intensive Care Unit.

    Science.gov (United States)

    Suwantarat, Nuntra; Logan, Latania K; Carroll, Karen C; Bonomo, Robert A; Simner, Patricia J; Rudin, Susan D; Milstone, Aaron M; Tekle, Tsigereda; Ross, Tracy; Tamma, Pranita D

    2016-05-01

    To determine the prevalence and acquisition of extended-spectrum β-lactamases (ESBLs), plasmid-mediated AmpCs (pAmpCs), and carbapenemases ("MDR Enterobacteriaceae") colonizing children admitted to a pediatric intensive care unit (PICU). Prospective study. 40-bed PICU. Admission and weekly thereafter rectal surveillance swabs were collected on all pediatric patients during a 6-month study period. Routine phenotypic identification and antibiotic susceptibility testing were performed. Enterobacteriaceae displaying characteristic resistance profiles underwent further molecular characterization to identify genetic determinants of resistance likely to be transmitted on mobile genetic elements and to evaluate relatedness of strains including DNA microarray, multilocus sequence typing, repetitive sequence-based PCR, and hsp60 sequencing typing. Evaluating 854 swabs from unique children, the overall prevalence of colonization with an MDR Enterobacteriaceae upon admission to the PICU based on β-lactamase gene identification was 4.3% (n=37), including 2.8% ESBLs (n=24), 1.3% pAmpCs (n=11), and 0.2% carbapenemases (n=2). Among 157 pediatric patients contributing 603 subsequent weekly swabs, 6 children (3.8%) acquired an incident MDR Enterobacteriaceae during their PICU stay. One child acquired a pAmpC (E. coli containing bla DHA) related to an isolate from another patient. Approximately 4% of children admitted to a PICU were colonized with MDR Enterobacteriaceae (based on β-lactamase gene identification) and an additional 4% of children who remained in the PICU for at least 1 week acquired 1 of these organisms during their PICU stay. The acquired MDR Enterobacteriaceae were relatively heterogeneous, suggesting that a single source was not responsible for the introduction of these resistance mechanisms into the PICU setting.

  9. Beyond cellular detoxification: a plethora of physiological roles for MDR transporter homologs in plants

    Science.gov (United States)

    Remy, Estelle; Duque, Paula

    2014-01-01

    Higher plants possess a multitude of Multiple Drug Resistance (MDR) transporter homologs that group into three distinct and ubiquitous families—the ATP-Binding Cassette (ABC) superfamily, the Major Facilitator Superfamily (MFS), and the Multidrug And Toxic compound Extrusion (MATE) family. As in other organisms, such as fungi, mammals, and bacteria, MDR transporters make a primary contribution to cellular detoxification processes in plants, mainly through the extrusion of toxic compounds from the cell or their sequestration in the central vacuole. This review aims at summarizing the currently available information on the in vivo roles of MDR transporters in plant systems. Taken together, these data clearly indicate that the biological functions of ABC, MFS, and MATE carriers are not restricted to xenobiotic and metal detoxification. Importantly, the activity of plant MDR transporters also mediates biotic stress resistance and is instrumental in numerous physiological processes essential for optimal plant growth and development, including the regulation of ion homeostasis and polar transport of the phytohormone auxin. PMID:24910617

  10. The culturable soil antibiotic resistome: a community of multi-drug resistant bacteria.

    Science.gov (United States)

    Walsh, Fiona; Duffy, Brion

    2013-01-01

    Understanding the soil bacterial resistome is essential to understanding the evolution and development of antibiotic resistance, and its spread between species and biomes. We have identified and characterized multi-drug resistance (MDR) mechanisms in the culturable soil antibiotic resistome and linked the resistance profiles to bacterial species. We isolated 412 antibiotic resistant bacteria from agricultural, urban and pristine soils. All isolates were multi-drug resistant, of which greater than 80% were resistant to 16-23 antibiotics, comprising almost all classes of antibiotic. The mobile resistance genes investigated, (ESBL, bla NDM-1, and plasmid mediated quinolone resistance (PMQR) resistance genes) were not responsible for the respective resistance phenotypes nor were they present in the extracted soil DNA. Efflux was demonstrated to play an important role in MDR and many resistance phenotypes. Clinically relevant Burkholderia species are intrinsically resistant to ciprofloxacin but the soil Burkholderia species were not intrinsically resistant to ciprofloxacin. Using a phenotypic enzyme assay we identified the antibiotic specific inactivation of trimethoprim in 21 bacteria from different soils. The results of this study identified the importance of the efflux mechanism in the soil resistome and variations between the intrinsic resistance profiles of clinical and soil bacteria of the same family.

  11. The culturable soil antibiotic resistome: a community of multi-drug resistant bacteria.

    Directory of Open Access Journals (Sweden)

    Fiona Walsh

    Full Text Available Understanding the soil bacterial resistome is essential to understanding the evolution and development of antibiotic resistance, and its spread between species and biomes. We have identified and characterized multi-drug resistance (MDR mechanisms in the culturable soil antibiotic resistome and linked the resistance profiles to bacterial species. We isolated 412 antibiotic resistant bacteria from agricultural, urban and pristine soils. All isolates were multi-drug resistant, of which greater than 80% were resistant to 16-23 antibiotics, comprising almost all classes of antibiotic. The mobile resistance genes investigated, (ESBL, bla NDM-1, and plasmid mediated quinolone resistance (PMQR resistance genes were not responsible for the respective resistance phenotypes nor were they present in the extracted soil DNA. Efflux was demonstrated to play an important role in MDR and many resistance phenotypes. Clinically relevant Burkholderia species are intrinsically resistant to ciprofloxacin but the soil Burkholderia species were not intrinsically resistant to ciprofloxacin. Using a phenotypic enzyme assay we identified the antibiotic specific inactivation of trimethoprim in 21 bacteria from different soils. The results of this study identified the importance of the efflux mechanism in the soil resistome and variations between the intrinsic resistance profiles of clinical and soil bacteria of the same family.

  12. Selection of Plasmodium falciparum Multidrug Resistance Gene 1 Alleles in Asexual Stages and Gametocytes by Artemether-Lumefantrine in Nigerian Children with Uncomplicated Falciparum Malaria ▿

    OpenAIRE

    Happi, C. T.; Gbotosho, G. O.; Folarin, O. A.; Sowunmi, A.; Hudson, T.; O'Neil, M.; Milhous, W.; Wirth, D. F.; Oduola, A. M. J.

    2008-01-01

    We assessed Plasmodium falciparum mdr1 (Pfmdr1) gene polymorphisms and copy numbers as well as P. falciparum Ca2+ ATPase (PfATPase6) gene polymorphisms in 90 Nigerian children presenting with uncomplicated falciparum malaria and enrolled in a study of the efficacy of artemether-lumefantrine (AL). The nested PCR-restriction fragment length polymorphism and the quantitative real-time PCR methodologies were used to determine the alleles of the Pfmdr1 and PfATPase6 genes and the Pfmdr1 copy numbe...

  13. Candida albicans AGE3, the ortholog of the S. cerevisiae ARF-GAP-encoding gene GCS1, is required for hyphal growth and drug resistance.

    Directory of Open Access Journals (Sweden)

    Thomas Lettner

    Full Text Available BACKGROUND: Hyphal growth and multidrug resistance of C. albicans are important features for virulence and antifungal therapy of this pathogenic fungus. METHODOLOGY/PRINCIPAL FINDINGS: Here we show by phenotypic complementation analysis that the C. albicans gene AGE3 is the functional ortholog of the yeast ARF-GAP-encoding gene GCS1. The finding that the gene is required for efficient endocytosis points to an important functional role of Age3p in endosomal compartments. Most C. albicans age3Delta mutant cells which grew as cell clusters under yeast growth conditions showed defects in filamentation under different hyphal growth conditions and were almost completely disabled for invasive filamentous growth. Under hyphal growth conditions only a fraction of age3Delta cells shows a wild-type-like polarization pattern of the actin cytoskeleton and lipid rafts. Moreover, age3Delta cells were highly susceptible to several unrelated toxic compounds including antifungal azole drugs. Irrespective of the AGE3 genotype, C-terminal fusions of GFP to the drug efflux pumps Cdr1p and Mdr1p were predominantly localized in the plasma membrane. Moreover, the plasma membranes of wild-type and age3Delta mutant cells contained similar amounts of Cdr1p, Cdr2p and Mdr1p. CONCLUSIONS/SIGNIFICANCE: The results indicate that the defect in sustaining filament elongation is probably caused by the failure of age3Delta cells to polarize the actin cytoskeleton and possibly of inefficient endocytosis. The high susceptibility of age3Delta cells to azoles is not caused by inefficient transport of efflux pumps to the cell membrane. A possible role of a vacuolar defect of age3Delta cells in drug susceptibility is proposed and discussed. In conclusion, our study shows that the ARF-GAP Age3p is required for hyphal growth which is an important virulence factor of C. albicans and essential for detoxification of azole drugs which are routinely used for antifungal therapy. Thus, it

  14. Metabolic Reprogramming During Multidrug Resistance in Leukemias

    Directory of Open Access Journals (Sweden)

    Raphael Silveira Vidal

    2018-04-01

    Full Text Available Cancer outcome has improved since introduction of target therapy. However, treatment success is still impaired by the same drug resistance mechanism of classical chemotherapy, known as multidrug resistance (MDR phenotype. This phenotype promotes resistance to drugs with different structures and mechanism of action. Recent reports have shown that resistance acquisition is coupled to metabolic reprogramming. High-gene expression, increase of active transport, and conservation of redox status are one of the few examples that increase energy and substrate demands. It is not clear if the role of this metabolic shift in the MDR phenotype is related to its maintenance or to its induction. Apart from the nature of this relation, the metabolism may represent a new target to avoid or to block the mechanism that has been impairing treatment success. In this mini-review, we discuss the relation between metabolism and MDR resistance focusing on the multiple non-metabolic functions that enzymes of the glycolytic pathway are known to display, with emphasis with the diverse activities of glyceraldehyde-3-phosphate dehydrogenase.

  15. Microarray-based analysis of IncA/C plasmid-associated genes from multidrug-resistant Salmonella enterica.

    Science.gov (United States)

    Lindsey, Rebecca L; Frye, Jonathan G; Fedorka-Cray, Paula J; Meinersmann, Richard J

    2011-10-01

    In the family Enterobacteriaceae, plasmids have been classified according to 27 incompatibility (Inc) or replicon types that are based on the inability of different plasmids with the same replication mechanism to coexist in the same cell. Certain replicon types such as IncA/C are associated with multidrug resistance (MDR). We developed a microarray that contains 286 unique 70-mer oligonucleotide probes based on sequences from five IncA/C plasmids: pYR1 (Yersinia ruckeri), pPIP1202 (Yersinia pestis), pP99-018 (Photobacterium damselae), pSN254 (Salmonella enterica serovar Newport), and pP91278 (Photobacterium damselae). DNA from 59 Salmonella enterica isolates was hybridized to the microarray and analyzed for the presence or absence of genes. These isolates represented 17 serovars from 14 different animal hosts and from different geographical regions in the United States. Qualitative cluster analysis was performed using CLUSTER 3.0 to group microarray hybridization results. We found that IncA/C plasmids occurred in two lineages distinguished by a major insertion-deletion (indel) region that contains genes encoding mostly hypothetical proteins. The most variable genes were represented by transposon-associated genes as well as four antimicrobial resistance genes (aphA, merP, merA, and aadA). Sixteen mercury resistance genes were identified and highly conserved, suggesting that mercury ion-related exposure is a stronger pressure than anticipated. We used these data to construct a core IncA/C genome and an accessory genome. The results of our studies suggest that the transfer of antimicrobial resistance determinants by transfer of IncA/C plasmids is somewhat less common than exchange within the plasmids orchestrated by transposable elements, such as transposons, integrating and conjugative elements (ICEs), and insertion sequence common regions (ISCRs), and thus pose less opportunity for exchange of antimicrobial resistance.

  16. FAM-MDR: a flexible family-based multifactor dimensionality reduction technique to detect epistasis using related individuals.

    Directory of Open Access Journals (Sweden)

    Tom Cattaert

    Full Text Available We propose a novel multifactor dimensionality reduction method for epistasis detection in small or extended pedigrees, FAM-MDR. It combines features of the Genome-wide Rapid Association using Mixed Model And Regression approach (GRAMMAR with Model-Based MDR (MB-MDR. We focus on continuous traits, although the method is general and can be used for outcomes of any type, including binary and censored traits. When comparing FAM-MDR with Pedigree-based Generalized MDR (PGMDR, which is a generalization of Multifactor Dimensionality Reduction (MDR to continuous traits and related individuals, FAM-MDR was found to outperform PGMDR in terms of power, in most of the considered simulated scenarios. Additional simulations revealed that PGMDR does not appropriately deal with multiple testing and consequently gives rise to overly optimistic results. FAM-MDR adequately deals with multiple testing in epistasis screens and is in contrast rather conservative, by construction. Furthermore, simulations show that correcting for lower order (main effects is of utmost importance when claiming epistasis. As Type 2 Diabetes Mellitus (T2DM is a complex phenotype likely influenced by gene-gene interactions, we applied FAM-MDR to examine data on glucose area-under-the-curve (GAUC, an endophenotype of T2DM for which multiple independent genetic associations have been observed, in the Amish Family Diabetes Study (AFDS. This application reveals that FAM-MDR makes more efficient use of the available data than PGMDR and can deal with multi-generational pedigrees more easily. In conclusion, we have validated FAM-MDR and compared it to PGMDR, the current state-of-the-art MDR method for family data, using both simulations and a practical dataset. FAM-MDR is found to outperform PGMDR in that it handles the multiple testing issue more correctly, has increased power, and efficiently uses all available information.

  17. Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number.

    Science.gov (United States)

    Price, Ric N; Uhlemann, Anne-Catrin; Brockman, Alan; McGready, Rose; Ashley, Elizabeth; Phaipun, Lucy; Patel, Rina; Laing, Kenneth; Looareesuwan, Sornchai; White, Nicholas J; Nosten, François; Krishna, Sanjeev

    The borders of Thailand harbour the world's most multidrug resistant Plasmodium falciparum parasites. In 1984 mefloquine was introduced as treatment for uncomplicated falciparum malaria, but substantial resistance developed within 6 years. A combination of artesunate with mefloquine now cures more than 95% of acute infections. For both treatment regimens, the underlying mechanisms of resistance are not known. The relation between polymorphisms in the P falciparum multidrug resistant gene 1 (pfmdr1) and the in-vitro and in-vivo responses to mefloquine were assessed in 618 samples from patients with falciparum malaria studied prospectively over 12 years. pfmdr1 copy number was assessed by a robust real-time PCR assay. Single nucleotide polymorphisms of pfmdr1, P falciparum chloroquine resistance transporter gene (pfcrt) and P falciparum Ca2+ ATPase gene (pfATP6) were assessed by PCR-restriction fragment length polymorphism. Increased copy number of pfmdr1 was the most important determinant of in-vitro and in-vivo resistance to mefloquine, and also to reduced artesunate sensitivity in vitro. In a Cox regression model with control for known confounders, increased pfmdr1 copy number was associated with an attributable hazard ratio (AHR) for treatment failure of 6.3 (95% CI 2.9-13.8, p<0.001) after mefloquine monotherapy and 5.4 (2.0-14.6, p=0.001) after artesunate-mefloquine therapy. Single nucleotide polymorphisms in pfmdr1 were associated with increased mefloquine susceptibility in vitro, but not in vivo. Amplification in pfmdr1 is the main cause of resistance to mefloquine in falciparum malaria. Multidrug resistant P falciparum malaria is common in southeast Asia, but difficult to identify and treat. Genes that encode parasite transport proteins maybe involved in export of drugs and so cause resistance. In this study we show that increase in copy number of pfmdr1, a gene encoding a parasite transport protein, is the best overall predictor of treatment failure with

  18. Antimicrobial Resistance and Cytotoxicity of Citrobacter spp. in Maanshan Anhui Province, China

    Directory of Open Access Journals (Sweden)

    Liyun Liu

    2017-07-01

    Full Text Available Objectives:Citrobacter spp. especially Citrobacter freundii, is frequently causing nosocomial infections, and increasingly becoming multi-drug resistant (MDR. In this study, we aimed to determine the genetic diversity and relationships of Citrobacter spp. from diarrheal patients and food sources, their antimicrobial resistance profiles and in vitro virulence properties.Methods: Sixty two Citrobacter isolates, including 13 C. freundii, 41 C. youngae and eight C. braakii isolates, were obtained from human diarrheal patients and food sources. Multilocus Sequence Typing (MLST of seven housekeeping genes and antimicrobial susceptibility testing using the broth microdilution method according to CLSI recommendations were carried out. Adhesion and cytotoxicity to HEp-2 cells were performed. PCR and sequencing were used to identify blaCTX−M, blaSHV, blaTEM and qnr genes.Results: The 62 isolates were divided into 53 sequence types (STs with all STs being novel, displaying high genetic diversity. ST39 was a predominant ST shared by 5 C. youngae strains isolated from four foods and a diarrheal patient. All isolates were resistant to cefoxitin, and sensitive to imipenem, meropenem and amikacin. The majority of Citrobacter isolates (61.3% were MDR of three or more antibiotics out of the 22 antibiotics tested. Two C. freundii isolates each carried the blaTEM−1 gene and a variant of qnrB77. Three Citrobacter isolates each carried qnrS1 and aac(6'-Ib-cr genes. Seven isolates that showed strong cytotoxicity to HEp-2 cells were MDR.Conclusions:Citrobacter spp. from human and food sources are diverse with variation in virulence properties and antibiotic resistance profiles. Food may be an important source of Citrobacter species in transmission to humans. C. freundii and C. youngae are potential foodborne pathogens.

  19. Gene-gene interactions of IRF5, STAT4, IKZF1 and ETS1 in systemic lupus erythematosus.

    Science.gov (United States)

    Dang, J; Shan, S; Li, J; Zhao, H; Xin, Q; Liu, Y; Bian, X; Liu, Q

    2014-06-01

    Interferon (IFN) activation signaling and T helper 17 (Th17)-cell/B-cell regulation play a critical role in the pathogenesis of systemic lupus erythematosus (SLE). Several studies have provided convincing evidence that polymorphisms in IRF5, STAT4, IKZF1 and ETS1 from these pathways may be involved in SLE by affecting gene expression or epistasis. We analyzed the genetic interaction in known SLE susceptibility loci from the four genes in northern Han Chinese. A total of 946 northern Han Chinese participated in this study (370 unrelated SLE patients and 576 healthy controls). Subjects underwent genotyping for the single-nucleotide polymorphisms (SNPs) rs2004640 in IRF5, rs7574865 in STAT4, rs4917014 in IKZF1 and rs1128334 in ETS1 by use of a TaqMan SNP genotyping assay and direct sequencing. Gene-gene interaction analysis involved direct counting, multifactor dimensionality reduction (MDR) and linear regression analysis. SLE patients and controls differed in allele frequencies of rs7574865, rs1128334 (P < 0.001) and rs4917014 (P < 0.01). Direct counting revealed that the frequency of risk homozygote combinations was higher for SLE patients than controls (P < 0.01). Furthermore, 2-, 3- and 4-way gene-gene epistasis in SLE was confirmed by parametric methods and MDR analysis. Gene expression analysis partially supported the findings. Our study confirmed the association of the IFN pathway or Th17/B-cells and the pathogenesis of SLE, and gene-gene interaction in this pathway may increase the risk of SLE. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Drug-resistance patterns of Mycobacterium tuberculosis strains and associated risk factors among multi drug-resistant tuberculosis suspected patients from Ethiopia.

    Science.gov (United States)

    Mesfin, Eyob Abera; Beyene, Dereje; Tesfaye, Abreham; Admasu, Addisu; Addise, Desalegn; Amare, Miskir; Dagne, Biniyam; Yaregal, Zelalem; Tesfaye, Ephrem; Tessema, Belay

    2018-01-01

    Multidrug drug-resistant tuberculosis (MDR-TB) is a major health problem and seriously threatens TB control and prevention efforts globally. Ethiopia is among the 30th highest TB burden countries for MDR-TB with 14% prevalence among previously treated cases. The focus of this study was on determining drug resistance patterns of Mycobacterium tuberculosis among MDR-TB suspected cases and associated risk factors. A cross-sectional study was conducted in Addis Ababa from June 2015 to December 2016. Sputum samples and socio-demographic data were collected from 358 MDR-TB suspected cases. Samples were analyzed using Ziehl-Neelsen technique, GeneXpert MTB/RIF assay, and culture using Lowenstein-Jensen and Mycobacterial growth indicator tube. Data were analyzed using SPSS version 23. A total of 226 the study participants were culture positive for Mycobacterium tuberculosis, among them, 133 (58.8%) participants were males. Moreover, 162 (71.7%) had been previously treated for tuberculosis, while 128 (56.6%) were TB/HIV co-infected. A majority [122 (54%)] of the isolates were resistant to any first-line anti-TB drugs. Among the resistant isolates, 110 (48.7%) were determined to be resistant to isoniazid, 94 (41.6%) to streptomycin, 89 (39.4%) to rifampicin, 72 (31.9%) to ethambutol, and 70 (30.9%) to pyrazinamide. The prevalence of MDR-TB was 89 (39.4%), of which 52/89 (58.4%) isolates were resistance to all five first-line drugs. Risk factors such as TB/HIV co-infection (AOR = 5.59, p = 0.00), cigarette smoking (AOR = 3.52, p = 0.045), alcohol drinking (AOR = 5.14, p = 0.001) hospital admission (AOR = 3.49, p = 0.005) and visiting (AOR = 3.34, p = 0.044) were significantly associated with MDR-TB. The prevalence of MDR-TB in the study population was of a significantly high level among previously treated patients and age group of 25-34. TB/HIV coinfection, smoking of cigarette, alcohol drinking, hospital admission and health facility visiting were identified as risk factors

  1. Polymorphisms in Plasmodium falciparum chloroquine resistance transporter and multidrug resistance 1 genes

    DEFF Research Database (Denmark)

    Venkatesan, Meera; Gadalla, Nahla B; Stepniewska, Kasia

    2014-01-01

    Adequate clinical and parasitologic cure by artemisinin combination therapies relies on the artemisinin component and the partner drug. Polymorphisms in the Plasmodium falciparum chloroquine resistance transporter (pfcrt) and P. falciparum multidrug resistance 1 (pfmdr1) genes are associated...... with decreased sensitivity to amodiaquine and lumefantrine, but effects of these polymorphisms on therapeutic responses to artesunate-amodiaquine (ASAQ) and artemether-lumefantrine (AL) have not been clearly defined. Individual patient data from 31 clinical trials were harmonized and pooled by using standardized...

  2. Dissemination of Multidrug-Resistant, Class I and II Integrons and Molecular Typing of CTX-M-producing Klebsiella pneumoniae.

    Science.gov (United States)

    Akya, Alisha; Elahi, Azam; Chegenelorestani, Roya; Rezaee, Mahya

    2018-01-01

    Klebsiella pneumoniae ( K. pneumoniae ) is an important opportunistic pathogen causes serious community and hospital-acquired infections, which is highly resistant to antibiotics. We aimed to determine the frequency of multidrug resistant (MDR) and molecular typing of clinical isolates of K. pneumoniae . One hundred isolates of K. pneumoniae were collected from clinical samples in three general hospitals in Kermanshah. The antimicrobial susceptibility and extended-spectrum beta-lactamases (ESBL) production of isolates were determined using disk diffusion and combined disk methods, respectively. The bla CTX-M gene, class I and II integrons were detected using polymerase chain reaction. The bla CTX-M positive isolates were selected for genotyping using pulsed-field gel electrophoresis (PFGE). MDR phenotype was observed in 56% of isolates. The 40% of isolates were ESBL positive and 35 isolates contained bla CTX-M . Class I and II of integrons were detected in 50 (89.2%) and 39 (69.6%) of MDR isolates, respectively. PFGE patterns of K. pneumoniae bla CTX-M positive isolates indicated 19 clusters (X 1-19 ) with different genotype patterns. The study findings highlight the concern of circulating MDR strains of K. pneumoniae with bla CTX-M and class I and II integrons in Kermanshah hospitals. The presence of integrons among isolates may facilitate the spread of new resistance genes in this bacterium. Therefore, surveillance for the spread of MDR strains of this bacterium is recommended in hospitals.

  3. Regorafenib overcomes chemotherapeutic multidrug resistance mediated by ABCB1 transporter in colorectal cancer: In vitro and in vivo study.

    Science.gov (United States)

    Wang, Yi-Jun; Zhang, Yun-Kai; Zhang, Guan-Nan; Al Rihani, Sweilem B; Wei, Meng-Ning; Gupta, Pranav; Zhang, Xiao-Yu; Shukla, Suneet; Ambudkar, Suresh V; Kaddoumi, Amal; Shi, Zhi; Chen, Zhe-Sheng

    2017-06-28

    Chemotherapeutic multidrug resistance (MDR) is a significant challenge to overcome in clinic practice. Several mechanisms contribute to MDR, one of which is the augmented drug efflux induced by the upregulation of ABCB1 in cancer cells. Regorafenib, a multikinase inhibitor targeting the RAS/RAF/MEK/ERK pathway, was approved by the FDA to treat metastatic colorectal cancer and gastrointestinal stromal tumors. We investigated whether and how regorafenib overcame MDR mediated by ABCB1. The results showed that regorafenib reversed the ABCB1-mediated MDR and increased the accumulation of [ 3 H]-paclitaxel in ABCB1-overexpressing cells by suppressing efflux activity of ABCB1, but not altering expression level and localization of ABCB1. Regorafenib inhibited ATPase activity of ABCB1. In mice bearing resistant colorectal tumors, regorafenib raised the intratumoral concentration of paclitaxel and suppressed the growth of resistant colorectal tumors. But regorafenib did not induce cardiotoxicity/myelosuppression of paclitaxel in mice. Strategy to reposition one FDA-approved anticancer drug regorafenib to overcome the resistance of another FDA-approved, widely used chemotherapeutic paclitaxel, may be a promising direction for the field of adjuvant chemotherapy. This study provides clinical rationale for combination of conventional chemotherapy and targeted anticancer agents. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Management and treatment outcomes of patients enrolled in MDR-TB treatment in Viet Nam.

    Science.gov (United States)

    Phuong, N T M; Nhung, N V; Hoa, N B; Thuy, H T; Takarinda, K C; Tayler-Smith, K; Harries, A D

    2016-03-21

    The programmatic management of drug-resistant tuberculosis (TB) in Viet Nam has been rapidly scaled up since 2009. To document the annual numbers of patients enrolled for multidrug-resistant tuberculosis (MDR-TB) treatment during 2010-2014 and to determine characteristics and treatment outcomes of patients initiating treatment during 2010-2012. A retrospective cohort study using national reports and data from the national electronic data system for drug-resistant TB. The number of patients enrolled annually for MDR-TB treatment increased from 97 in 2010 to 1522 in 2014. The majority of patients were middle-aged men who had pulmonary disease and had failed a retreatment regimen; 77% had received ⩾2 courses of TB treatment. Favourable outcomes (cured and treatment completed) were attained in 73% of patients. Unfavourable outcomes included loss to follow-up (12.5%), death (8%) and failure (6.3%). Having had ⩾2 previous treatment courses and being human immunodeficiency virus-positive were associated with unfavourable outcomes. Increasing numbers of patients are being treated for MDR-TB each year with good treatment outcomes under national programme management in Viet Nam. However, there is a need to increase case detection-currently at 30% of the estimated 5100 MDR-TB cases per year, reduce adverse outcomes and improve monitoring and evaluation.

  5. Evaluation of GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing of multi-drug resistance tuberculosis in Northern India

    Directory of Open Access Journals (Sweden)

    Anand Kumar Maurya

    2013-01-01

    Full Text Available Background: The problem of multi-drug resistance tuberculosis (MDR-TB is growing in several hotspots throughout the world. Rapid and accurate diagnosis of MDR-TB is crucial to facilitate early treatment and to reduce its spread in the community. The aim of the present study was to evaluate the new, novel GenoType® MTBDRplus assay for rapid detection of drug susceptibility testing (DST of MDR-TB cases in Northern India. Materials and Methods: A total of 550 specimens were collected from highly suspected drug resistant from pulmonary and extra-pulmonary TB cases. All the specimens were processed by Ziehl- Neelsen staining, culture, differentiation by the GenoType® CM assay, first line DST using BacT/ALERT 3D system and GenoType® MTBDRplus assay. The concordance of the GenoType® MTBDRplus assay was calculated in comparison with conventional DST results. Results: Overall the sensitivity for detection of rifampicin, isoniazid and MDR-TB resistance by GenoType® MTBDRplus assay was 98.0%, 98.4% and 98.2% respectively. Out of 55 MDR-TB strains, 45 (81.8%, 52 (94.5% and 17 (30.9% strains showed mutation in rpoB, katG and inhA genes respectively (P < 0.05. The most prominent mutations in rpoB, katG and inhA genes were; 37 (67.3% in S531L, 52 (94.5% in S315T1 and 11 (20% in C15T regions respectively (P < 0.05. Conclusions: Our study demonstrated a high concordance between the GenoType® MTBDRplus assay resistance patterns and those were observed by conventional DST with good sensitivity, specificity with short turnaround times and to control new cases of MDR-TB in countries with a high prevalence of MDR-TB.

  6. Metallo- β-lactamases among Multidrug Resistant (MDR Gram Negative Bacteria Isolated from Clinical Specimens during 2009 in Sanandaj, Kurdistan Province

    Directory of Open Access Journals (Sweden)

    Himen Salimizand

    2012-08-01

    Full Text Available Background: Today, there are numerous reports about emerging multi drug resistant gram negative bacteria all around the world, especially in ICUs. Rarely, Metallo-β-lactamase (MBL enzymes are responsible for these cases. Study of MBLs for diagnosing and preventing distribution of the origin of infection are critical issues. In addition, we would like to compare the efficacy of Iranian and foreign- made antibiotic disks. Materials and Methods: During 2009 all entered clinical specimens to the laboratory tested for detecting gram negative bacteria. Isolated bacteria were tested by Kirby-Bauer method to antibiotic susceptibility test by Iranian and foreign (MAST disks. For gram negative carbapenem resistant isolates, PCR technique used to detect VIM, GIM, and SIM variants of MBLs.Results: During one year, 17890 clinical specimens referred Besat laboratory. The most specimen was Urine (8172 followed by blood culture (5190 that in which 1110 gram negative and positives isolated. Out of which, 778 (70% of isolates were gram negatives. MDR gram negatives were 157 (20.2%. Imipenem and meropenem were the most efficient antibiotics (all susceptible and ceftriaxone was the least (19 % susceptible. E. coli was the most prevalent isolate. 79 Gram negative isolates (10.1% were resistant to Iranian-made discs but all susceptible for foreign ones. All 79 isolates were tested by PCR for MBL genes, that, all were negative. Besides, Iranian imipenem and cefepime disks have had distinguishable difference in susceptibility of isolates.Conclusion: Fortunately, none of gram negative isolates were MBL producer, which revealed no colonization of MBL producing bacteria. Iranian-made disks appear efficient except for imipenem and cefepime.

  7. Whole Genome Sequencing and Plasmid Genomics of Antimicrobial Resistance – Salmonella’s mobile genetic elements and the antimicrobial resistance genes they carry

    Science.gov (United States)

    With the emergence of antibiotic resistance (AR), multidrug resistance (MDR), and carbapenem resistant Enterobacteriaceae (CRE), the specter of widespread untreatable bacterial infections threatens human and animal health. The ability of these emerging resistances to transfer between bacteria on mob...

  8. The Prevalence and Molecular Epidemiology of Multidrug-Resistant Enterobacteriaceae Colonization in a Pediatric Intensive Care Unit

    Science.gov (United States)

    Suwantarat, Nuntra; Logan, Latania K.; Carroll, Karen C.; Bonomo, Robert A.; Simner, Patricia J.; Rudin, Susan D.; Milstone, Aaron M.; Tekle, Tsigereda; Ross, Tracy; Tamma, Pranita D.

    2016-01-01

    OBJECTIVE To determine the prevalence and acquisition of extended-spectrum β-lactamases (ESBLs), plasmid-mediated AmpCs (pAmpCs), and carbapenemases (“MDR Enterobacteriaceae”) colonizing children admitted to a pediatric intensive care unit (PICU). DESIGN Prospective study. SETTING 40-bed PICU. METHODS Admission and weekly thereafter rectal surveillance swabs were collected on all pediatric patients during a 6-month study period. Routine phenotypic identification and antibiotic susceptibility testing were performed. Enterobacteriaceae displaying characteristic resistance profiles underwent further molecular characterization to identify genetic determinants of resistance likely to be transmitted on mobile genetic elements and to evaluate relatedness of strains including DNA microarray, multilocus sequence typing, repetitive sequence-based PCR, and hsp60 sequencing typing. Results Evaluating 854 swabs from unique children, the overall prevalence of colonization with an MDR Enterobacteriaceae upon admission to the PICU based on β-lactamase gene identification was 4.3% (n = 37), including 2.8% ESBLs (n =24), 1.3% pAmpCs (n =11), and 0.2% carbapenemases (n =2). Among 157 pediatric patients contributing 603 subsequent weekly swabs, 6 children (3.8%) acquired an incident MDR Enterobacteriaceae during their PICU stay. One child acquired a pAmpC (E. coli containing blaDHA) related to an isolate from another patient. Conclusions Approximately 4% of children admitted to a PICU were colonized with MDR Enterobacteriaceae (based on β-lactamase gene identification) and an additional 4% of children who remained in the PICU for at least 1 week acquired 1 of these organisms during their PICU stay. The acquired MDR Enterobacteriaceae were relatively heterogeneous, suggesting that a single source was not responsible for the introduction of these resistance mechanisms into the PICU setting. PMID:26856439

  9. ABCB1 (MDR1) polymorphisms and ovarian cancer progression and survival

    DEFF Research Database (Denmark)

    Johnatty, Sharon E; Beesley, Jonathan; Gao, Bo

    2013-01-01

    ABCB1 encodes the multi-drug efflux pump P-glycoprotein (P-gp) and has been implicated in multi-drug resistance. We comprehensively evaluated this gene and flanking regions for an association with clinical outcome in epithelial ovarian cancer (EOC)....

  10. Association of ABCB1, β tubulin I, and III with multidrug resistance of MCF7/DOC subline from breast cancer cell line MCF7.

    Science.gov (United States)

    Li, Wentao; Zhai, Baoping; Zhi, Hui; Li, Yuhong; Jia, Linjiao; Ding, Chao; Zhang, Bin; You, Wei

    2014-09-01

    Docetaxel is a first-line chemotherapeutic agent for treating advanced breast cancer. The development of chemoresistance or multidrug resistance (MDR), however, results in breast cancer chemotherapy failure. This study aims to explore the molecular mechanisms underlying docetaxel-resistance in treatment of breast cancer. The docetaxel-resistant subline MCF7/DOC, derived from the parental sensitive breast cancer cell line MCF7, was established by intermittent exposure to moderate concentrations of docetaxel, followed by examination of its phenotypes. The MCF7/DOC subline showed cross resistance against paclitaxel, doxorubicin, methotrexate, and 5-Fu. Compared to the parental MCF7, MCF7/DOC cells were enlarged with heterogeneous sizes and a cobblestone and polygonal appearance. They were arrested at G2/M phase and proliferated slowly. The colony formation potential of MCF7/DOC in soft agar was significantly increased. MCF7/DOC cells showed reduced intracellular accumulation and increased efflux of rhodamine 123. The mRNA expression level of adenosine triphosphate binding cassette (ABC) transporter family, i.e., ABCB1, ABCC1, ABCC2, ABCG2, and β tubulin isotypes were characterized by quantitative PCR. High-level expression of ABCB1, βI, and βIII tubulin mRNA in MCF7/DOC was detected. Downregulation of ABCB1, βI, and βIII tubulin mediated by three combined siRNAs resulted in stronger growth inhibition of MCF7/DOC than inhibition of the expression of individual genes. ABCB1, βI, and βIII tubulin might contribute to the MDR of MCF7/DOC and be potential therapeutic targets for overcoming MDR of breast cancer.

  11. Inhibitory Effects of Neochamaejasmin B on P-Glycoprotein in MDCK-hMDR1 Cells and Molecular Docking of NCB Binding in P-Glycoprotein

    Directory of Open Access Journals (Sweden)

    Lanying Pan

    2015-02-01

    Full Text Available Stellera chamaejasme L. (Thymelaeaceae is widely distributed in Mongolia, Tibet and the northern parts of China. Its roots are commonly used as “Langdu”, which is embodied in the Pharmacopoeia of the P.R. China (2010 as a toxic Traditional Chinese Medicine. It is claimed to have antivirus, antitumor and antibacterial properties in China and other Asian countries. Studies were carried out to characterize the inhibition of neochamaejasmin B (NCB on P-glycoprotein (P-gp, ABCB1, MDR1. Rhodamine-123 (R-123 transport and accumulation studies were performed in MDCK-hMDR1 cells. ABCB1 (MDR1 mRNA gene expression and P-gp protein expression were analyzed. Binding selectivity studies based on molecular docking were explored. R-123 transport and accumulation studies in MDCK-hMDR1 cells indicated that NCB inhibited the P-gp-mediated efflux in a concentration-dependent manner. RT-PCR and Western blot demonstrated that the P-gp expression was suppressed by NCB. To investigate the inhibition type of NCB on P-gp, Ki and Ki’ values were determined by double-reciprocal plots in R-123 accumulation studies. Since Ki was greater than Ki’, the inhibition of NCB on P-gp was likely a mixed type of competitive and non-competitive inhibition. The results were confirmed by molecular docking in our current work. The docking data indicated that NCB had higher affinity to P-gp than to Lig1 ((S-5,7-dihydroxy-2-(4-hydroxyphenylchroman-4-one.

  12. Class 1 Integrons and the Antiseptic Resistance Gene (qacEΔ1) in Municipal and Swine Slaughterhouse Wastewater Treatment Plants and Wastewater-Associated Methicillin-Resistant Staphylococcus aureus.

    Science.gov (United States)

    Wan, Min Tao; Chou, Chin Cheng

    2015-06-02

    Class 1 integrons are mobile gene elements (MGEs) containing qacEΔ1 that are resistant to quaternary ammonium compound (QAC) disinfectants. This study compared the abundances of class 1 integrons and antiseptic resistance genes in municipal (M) and swine slaughterhouse (S) wastewater treatment plants (WWTPs) and investigated the presence of class 1 integrons and antiseptic resistance genes in methicillin-resistant Staphylococcus aureus (MRSA) isolated from wastewater samples. The abundances of intI1 and qacEΔ1 genes in 96 wastewater samples were quantified using real-time quantitative polymerase chain reaction (real-time qPCR), and 113 MRSA isolates recovered from the wastewater samples were detected class 1 integrons and linked antiseptic resistance genes (qacEΔ1), and minimum inhibitory concentrations (MICs) for QAC antiseptics. The intI1 and qacEΔ1 genes were detected in all the wastewater samples, and they were more abundant in S-WWTP samples than in M-WWTP samples. A higher percentage of MRSA isolates carried qacEΔ1 in MRSA from swine wastewater samples (62.8%) than in municipal MRSA (3.7%). All the MRSA isolates showed high MICs for antiseptic agents. This study provides important evidence regarding the abundances of intI1 and qacEΔ1 genes in municipal and swine slaughterhouse wastewater, and antiseptic-resistant MRSA strains were detected in swine slaughterhouse wastewater.

  13. Class 1 Integrons and the Antiseptic Resistance Gene (qacEΔ1) in Municipal and Swine Slaughterhouse Wastewater Treatment Plants and Wastewater—Associated Methicillin-Resistant Staphylococcus aureus

    Science.gov (United States)

    Wan, Min Tao; Chou, Chin Cheng

    2015-01-01

    Class 1 integrons are mobile gene elements (MGEs) containing qacEΔ1 that are resistant to quaternary ammonium compound (QAC) disinfectants. This study compared the abundances of class 1 integrons and antiseptic resistance genes in municipal (M) and swine slaughterhouse (S) wastewater treatment plants (WWTPs) and investigated the presence of class 1 integrons and antiseptic resistance genes in methicillin-resistant Staphylococcus aureus (MRSA) isolated from wastewater samples. The abundances of intI1 and qacEΔ1 genes in 96 wastewater samples were quantified using real-time quantitative polymerase chain reaction (real-time qPCR), and 113 MRSA isolates recovered from the wastewater samples were detected class 1 integrons and linked antiseptic resistance genes (qacEΔ1), and minimum inhibitory concentrations (MICs) for QAC antiseptics. The intI1 and qacEΔ1 genes were detected in all the wastewater samples, and they were more abundant in S-WWTP samples than in M-WWTP samples. A higher percentage of MRSA isolates carried qacEΔ1 in MRSA from swine wastewater samples (62.8%) than in municipal MRSA (3.7%). All the MRSA isolates showed high MICs for antiseptic agents. This study provides important evidence regarding the abundances of intI1 and qacEΔ1 genes in municipal and swine slaughterhouse wastewater, and antiseptic-resistant MRSA strains were detected in swine slaughterhouse wastewater. PMID:26042365

  14. Genetic diversity and natural selection of Plasmodium vivax multi-drug resistant gene (pvmdr1) in Mesoamerica.

    Science.gov (United States)

    González-Cerón, Lilia; Montoya, Alberto; Corzo-Gómez, Josselin C; Cerritos, Rene; Santillán, Frida; Sandoval, Marco A

    2017-07-01

    The Plasmodium vivax multidrug resistant 1 gene (pvmdr1) codes for a transmembrane protein of the parasite's digestive vacuole. It is likely that the pvmdr1 gene mutations occur at different sites by convergent evolution. In here, the genetic variation of pvmdr1 at three sites of the Mesoamerican region was studied. Since 1950s, malarious patients of those areas have been treated only with chloroquine and primaquine. Blood samples from patients infected with P. vivax were obtained in southern Mexico (SMX), in the Northwest (NIC-NW) and in the northeast (NIC-NE) of Nicaragua. Genomic DNA was obtained and fragments of pvmdr1 were amplified and sequenced. The nucleotide and amino acid changes as well as the haplotype frequency in pvmdr1 were determined per strain and per geographic site. The sequences of pvmdr1 obtained from the studied regions were compared with homologous sequences from the GenBank database to explore the P. vivax genetic structure. In 141 parasites, eight nucleotide changes (two changes were synonymous and other six were nonsynonymous) were detected in 1536 bp. The PvMDR1 amino acid changes Y976F, F1076FL were predominant in endemic parasites from NIC-NE and outbreak parasites in NIC-NW but absent in SMX. Thirteen haplotypes were resolved, and found to be closely related, but their frequency at each geographic site was different (P = 0.0001). The pvmdr1 codons 925-1083 gene fragment showed higher genetic and haplotype diversity in parasites from NIC-NE than the other areas outside Latin America. The haplotype networks suggested local diversification of pvmdr1 and no significant departure from neutrality. The F ST values were low to moderate regionally, but high between NIC-NE or NIC-NW and other regions inside and outside Latin America. The pvmdr1 gene might have diversified recently at regional level. In the absence of significant natural, genetic drift might have caused differential pvmdr1 haplotype frequencies at different geographic sites

  15. Resistance patterns among multidrug-resistant tuberculosis patients in greater metropolitan Mumbai: trends over time.

    Science.gov (United States)

    Dalal, Alpa; Pawaskar, Akshay; Das, Mrinalini; Desai, Ranjan; Prabhudesai, Pralhad; Chhajed, Prashant; Rajan, Sujeet; Reddy, Deepesh; Babu, Sajit; Jayalakshmi, T K; Saranchuk, Peter; Rodrigues, Camilla; Isaakidis, Petros

    2015-01-01

    While the high burden of multidrug-resistant tuberculosis (MDR-TB) itself is a matter of great concern, the emergence and rise of advanced forms of drug-resistance such as extensively drug-resistant TB (XDR-TB) and extremely drug-resistant TB (XXDR-TB) is more troubling. The aim of this study was to investigate the trends over time of patterns of drug resistance in a sample of MDR-TB patients in greater metropolitan Mumbai, India. This was a retrospective, observational study of drug susceptibility testing (DST) results among MDR-TB patients from eight health care facilities in greater Mumbai between 2005 and 2013. We classified resistance patterns into four categories: MDR-TB, pre-XDR-TB, XDR-TB and XXDR-TB. A total of 340 MDR-TB patients were included in the study. Pre-XDR-TB was the most common form of drug-resistant TB observed overall in this Mumbai population at 56.8% compared to 29.4% for MDR-TB. The proportion of patients with MDR-TB was 39.4% in the period 2005-2007 and 27.8% in 2011-2013, while the proportion of those with XDR-TB and XXDR-TB was changed from 6.1% and 0% respectively to 10.6% and 5.6% during the same time period. During the same periods, the proportions of patients with ofloxacin, moxifloxacin and ethionamide resistance significantly increased from 57.6% to 75.3%, from 60.0% to 69.5% and from 24.2% to 52.5% respectively (pMumbai highlight the need for individualized drug regimens, designed on the basis of DST results involving first- and second-line anti-TB drugs and treatment history of the patient. A drug-resistant TB case-finding strategy based on molecular techniques that identify only rifampicin resistance will lead to initiation of suboptimal treatment regimens for a significant number of patients, which may in turn contribute to amplification of resistance and transmission of strains with increasingly advanced resistance within the community.

  16. The role of Cercospora zeae-maydis homologs of Rhodobacter sphaeroides 1O2-resistance genes in resistance to the photoactivated toxin cercosporin.

    Science.gov (United States)

    Beseli, Aydin; Goulart da Silva, Marilia; Daub, Margaret E

    2015-01-01

    The photosynthetic bacterium Rhodobacter sphaeroides and plant pathogenic fungus Cercospora nicotianae have been used as models for understanding resistance to singlet oxygen ((1)O(2)), a highly toxic reactive oxygen species. In Rhodobacter and Cercospora, (1)O(2) is derived, respectively, from photosynthesis and from the (1)O(2)-generating toxin cercosporin which the fungus produces to parasitize plants. We identified common genes recovered in transcriptome studies of putative (1)O(2)-resistance genes in these two systems, suggesting common (1)O(2)-resistance mechanisms. To determine if the Cercospora homologs of R. sphaeroides (1)O(2)-resistance genes are involved in resistance to cercosporin, we expressed the genes in the cercosporin-sensitive fungus Neurospora crassa and assayed for increases in cercosporin resistance. Neurospora crassa transformants expressing genes encoding aldo/keto reductase, succinyl-CoA ligase, O-acetylhomoserine (thiol) lyase, peptide methionine sulphoxide reductase and glutathione S-transferase did not have elevated levels of cercosporin resistance. Several transformants expressing aldehyde dehydrogenase were significantly more resistant to cercosporin. Expression of the transgene and enzyme activity did not correlate with resistance, however. We conclude that although the genes tested in this study are important in (1)O(2) resistance in R. sphaeroides, their Cercospora homologs are not involved in resistance to (1)O(2) generated from cercosporin. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Class 1 and 2 integrons, sul resistance genes and antibiotic resistance in Escherichia coli isolated from Dongjiang River, South China

    International Nuclear Information System (INIS)

    Su Haochang; Ying Guangguo; Tao Ran; Zhang Ruiquan; Zhao Jianliang; Liu Yousheng

    2012-01-01

    Antibiotic susceptibility, detection of sul gene types and presence of class 1, 2 and 3 integrons and gene cassettes using PCR assays were investigated in 3456 Escherichia coli isolates obtained from 38 sampling sites of the Dongjiang River catchment in the dry and wet seasons. 89.1% of the isolates were resistant and 87.5% showed resistance to at least three antibiotics. sul2 was detected most frequently in 89.2% of 1403 SXT-resistant isolates. The presence of integrons (class 1 and 2) was frequently observed (82.3%) while no class 3 integron was found. In these integrons, 21 resistance genes of 14 gene cassette arrays and 10 different families of resistance genes were identified. Three gene cassette arrays, aac(6')-Ib-cr-aar-3-dfrA27-aadA16, aacA4-catB3-dfrA1 and aadA2-lnuF, were detected for the first time in surface water. The results showed that bacterial resistance in the catchment was seriously influenced by human activities, especially discharge of wastewater. Highlights: ► Antibiotic resistance was investigated for a river catchment of southern China. ► 87.5% of E coli isolates showed resistance to at least three antibiotics. ► The presence of integrons (class 1 and 2) was frequently observed (82.3%). ► Bacterial resistance in the catchment was seriously influenced by human activities. - Bacterial resistance to antibiotics in a catchment is related to the discharge of wastewater into the aquatic environment.

  18. Targeting glucosylceramide synthase induction of cell surface globotriaosylceramide (Gb3) in acquired cisplatin-resistance of lung cancer and malignant pleural mesothelioma cells

    Energy Technology Data Exchange (ETDEWEB)

    Tyler, Andreas, E-mail: andreas.tyler@medbio.umu.se [Department of Medical Biosciences, Umeå University, S-901 85 Umea (Sweden); Johansson, Anders [Department of Odontology, Umeå University, S-901 85 Umea (Sweden); Karlsson, Terese [Department of Radiation Sciences, Oncology, S-901 85 Umea (Sweden); Gudey, Shyam Kumar; Brännström, Thomas; Grankvist, Kjell; Behnam-Motlagh, Parviz [Department of Medical Biosciences, Umeå University, S-901 85 Umea (Sweden)

    2015-08-01

    Background: Acquired resistance to cisplatin treatment is a caveat when treating patients with non-small cell lung cancer (NSCLC) and malignant pleural mesothelioma (MPM). Ceramide increases in response to chemotherapy, leading to proliferation arrest and apoptosis. However, a tumour stress activation of glucosylceramide synthase (GCS) follows to eliminate ceramide by formation of glycosphingolipids (GSLs) such as globotriaosylceramide (Gb3), the functional receptor of verotoxin-1. Ceramide elimination enhances cell proliferation and apoptosis blockade, thus stimulating tumor progression. GSLs transactivate multidrug resistance 1/P-glycoprotein (MDR1) and multidrug resistance-associated protein 1 (MRP1) expression which further prevents ceramide accumulation and stimulates drug efflux. We investigated the expression of Gb3, MDR1 and MRP1 in NSCLC and MPM cells with acquired cisplatin resistance, and if GCS activity or MDR1 pump inhibitors would reduce their expression and reverse cisplatin-resistance. Methods: Cell surface expression of Gb3, MDR1 and MRP1 and intracellular expression of MDR1 and MRP1 was analyzed by flow cytometry and confocal microscopy on P31 MPM and H1299 NSCLC cells and subline cells with acquired cisplatin resistance. The effect of GCS inhibitor PPMP and MDR1 pump inhibitor cyclosporin A for 72 h on expression and cisplatin cytotoxicity was tested. Results: The cisplatin-resistant cells expressed increased cell surface Gb3. Cell surface Gb3 expression of resistant cells was annihilated by PPMP whereas cyclosporin A decreased Gb3 and MDR1 expression in H1299 cells. No decrease of MDR1 by PPMP was noted in using flow cytometry, whereas a decrease of MDR1 in H1299 and H1299res was indicated with confocal microscopy. No certain co-localization of Gb3 and MDR1 was noted. PPMP, but not cyclosporin A, potentiated cisplatin cytotoxicity in all cells. Conclusions: Cell surface Gb3 expression is a likely tumour biomarker for acquired cisplatin

  19. HIF-1 activation induces doxorubicin resistance in MCF7 3-D spheroids via P-glycoprotein expression: a potential model of the chemo-resistance of invasive micropapillary carcinoma of the breast

    Directory of Open Access Journals (Sweden)

    Doublier Sophie

    2012-01-01

    Full Text Available Abstract Background Invasive micropapillary carcinoma (IMPC of the breast is a distinct and aggressive variant of luminal type B breast cancer that does not respond to neoadjuvant chemotherapy. It is characterized by small pseudopapillary clusters of cancer cells with inverted cell polarity. To investigate whether hypoxia-inducible factor-1 (HIF-1 activation may be related to the drug resistance described in this tumor, we used MCF7 cancer cells cultured as 3-D spheroids, which morphologically simulate IMPC cell clusters. Methods HIF-1 activation was measured by EMSA and ELISA in MCF7 3-D spheroids and MCF7 monolayers. Binding of HIF-1α to MDR-1 gene promoter and modulation of P-glycoprotein (Pgp expression was evaluated by ChIP assay and FACS analysis, respectively. Intracellular doxorubicin retention was measured by spectrofluorimetric assay and drug cytotoxicity by annexin V-FITC measurement and caspase activity assay. Results In MCF7 3-D spheroids HIF-1 was activated and recruited to participate to the transcriptional activity of MDR-1 gene, coding for Pgp. In addition, Pgp expression on the surface of cells obtained from 3-D spheroids was increased. MCF7 3-D spheroids accumulate less doxorubicin and are less sensitive to its cytotoxic effects than MCF7 cells cultured as monolayer. Finally, HIF-1α inhibition either by incubating cells with 3-(5'-hydroxymethyl-2'-furyl-1-benzylindazole (a widely used HIF-1α inhibitor or by transfecting cells with specific siRNA for HIF-1α significantly decreased the expression of Pgp on the surface of cells and increased the intracellular doxorubicin accumulation in MCF7 3-D spheroids. Conclusions MCF7 breast cancer cells cultured as 3-D spheroids are resistant to doxorubicin and this resistance is associated with an increased Pgp expression in the plasma membrane via activation of HIF-1. The same mechanism may be suggested for IMPC drug resistance.

  20. First report in Africa of two clinical isolates of Proteus mirabilis carrying Salmonella genomic island (SGI1) variants, SGI1-PmABB and SGI1-W.

    Science.gov (United States)

    Soliman, Ahmed M; Ahmed, Ashraf M; Shimamoto, Toshi; El-Domany, Ramadan A; Nariya, Hirofumi; Shimamoto, Tadashi

    2017-07-01

    Two Proteus mirabilis strains, designated PmTAN59 and PmKAF126, were isolated from two different Egyptian cities in 2014 and 2015, respectively. PmTAN59 was isolated from a sputum swab from a pneumonia patient in Tanta University Teaching Hospital. PmKAF126 was isolated from a patient with a diabetic foot infection in a hospital in the city of Kafr El-Sheikh. The two isolates were identified with bacterial small ribosomal RNA (16S rRNA) gene amplification and sequencing and tested for antimicrobial sensitivity with a Kirby-Bauer disk diffusion assay. The two strains were resistant to amoxicillin/clavulante, ampicillin, cefotaxime, cefoxitin, ceftriaxone, chloramphenicol, ciprofloxacin, colistin, gentamicin, kanamycin, nalidixic acid, spectinomycin, streptomycin, sulfamethoxazole/trimethoprime, and tetracycline, but sensitive to aztreonam, imipenem, and meropenem. Molecular characterization was used to map the entire backbone, including the multiple antibiotic resistance (MDR) region, of Salmonella genomic island 1 (SGI1). Both isolates carried a structure similar to SGI1, with two different MDR regions corresponding to SGI1-PmABB in PmTAN59 and SGI1-W in PmKAF126. SGI1-PmABB carried an integron of ~1.5kb with a two-gene cassette, aacCA5-aadA7, which confers resistance to gentamicin, streptomycin, and spectinomycin, whereas SGI1-W carried an integron of ~1.9kb containing aadA2-lnuF, which confers resistance to spectinomycin, streptomycin, and lincosamides. PmKAF126 carried the entire SGI1 sequence, however PmTAN59 carried a SGI1 structure with a deletion in the region from ORF S005 to ORF S009 and accompanied by insertion of IS1359 (1258bp). Furthermore, PmTAN59 carried class 2 integron of ~2.2kb containing dfrA1-sat2-aadA1. An ERIC-PCR analysis detected no clonal relationship between the two strains. Molecular screening for other antimicrobial resistance genes and a plasmid analysis indicated that PmTAN59 carried an IncFIB plasmid type. This strain also carried bla

  1. Emergence of fluoroquinolone resistance among drug resistant tuberculosis patients at a tertiary care facility in Karachi, Pakistan.

    Science.gov (United States)

    Zaidi, Syed Mohammad Asad; Haseeb, Abdul; Habib, Shifa Salman; Malik, Amyn; Khowaja, Saira; SaifUllah, Nausheen; Rizvi, Nadeem

    2017-07-25

    Pakistan is classified as one of the high multi-drug resistant tuberculosis (MDR-TB) burden countries. A poorly regulated private sector, over-prescription of antibiotics and self-medication has led to augmented rates of drug-resistance in the country. Pakistan's first national anti-tuberculosis drug resistance survey identified high prevalence of fluoroquinolone resistance among MDR-TB patients. Further institutional evidence of fluoroquinolone drug-resistance can support re-evaluation of treatment regimens as well as invigorate efforts to control antibiotic resistance in the country. In this study, data for drug-susceptibility testing (DST) was retrospectively analyzed for a total of 133 patients receiving MDR-TB treatment at the Chest Department of Jinnah Postgraduate Medical Center, Karachi, Pakistan. Frequency analyses for resistance patterns was carried out and association of fluoroquinolone (ofloxacin) resistance with demographics and past TB treatment category were assessed. Within first-line drugs, resistance to isoniazid was detected in 97.7% of cases, followed by rifampicin (96.9%), pyrazinamide (86.4%), ethambutol (69.2%) and streptomycin (64.6%). Within second-line drugs, ofloxacin resistance was detected in 34.6% of cases. Resistance to ethionamide and amikacin was 2.3% and 1.6%, respectively. Combined resistance of oflaxacin and isoniazid was detected in 33.9% of cases. Age, gender and past TB treatment category were not significantly associated with resistance to ofloxacin. Fluoroquinolone resistance was observed in an alarmingly high proportion of MDR-TB cases. Our results suggest caution in their use for empirical management of MDR-TB cases and recommended treatment regimens for MDR-TB may require re-evaluation. Greater engagement of private providers and stringent pharmacy regulations are urgently required.

  2. MDR-TB Outbreak among HIV-Negative Tunisian Patients followed during 11 Years.

    Directory of Open Access Journals (Sweden)

    Naira Dekhil

    Full Text Available Multidrug-resistant tuberculosis (MDR-TB outbreaks that evolve, from the outset, in a context strictly negative for HIV infection deserve special consideration since they reflect the true intrinsic epidemic potential of the causative strain. To our knowledge, the long-term evolution of such exceptional outbreaks and the treatment outcomes for the involved patients has never been reported hitherto. Here we provide a thorough description, over an 11-year period, of an MDR-TB outbreak that emerged and expanded in an HIV-negative context, Northern Tunisia.From October 2001 to June 2011, the MDR-TB outbreak involved 48 HIV-negative individuals that are mainly young (mean age 31.09 yrs; 89.6% male and noninstitutionalized. Drug susceptibility testing coupled to mutational analysis revealed that initial transmission involved an isolate that was simultaneously resistant to isoniazid, rifampicin, ethambutol, and streptomycin. The causative Haarlem3-ST50 outbreak strain expanded mainly as an 11-banded IS6110 RFLP profile (77.1%, from which a 12-banded subclone evolved. After undergoing a 2-year treatment with second-line drugs, 22 (45.8% patients were cured and 3 (6.2% completed treatment, thus yielding an overall treatment success rate of 52.1%. Among the patients that experienced unfavorable treatment outcomes, 10 (20.8% failed treatment, 3 (6.2% were lost to follow-up, 5 (10.4% died, and 5 (10.4% could not be evaluated. Poor adherence to treatment was found to be the main independent predictor of unfavorable outcomes (HR: 9.15; 95% CI 1.72-48.73; P = 0.014. Intriguingly, the evolved 12-banded subclone proved significantly associated with unfavorable outcomes (HR: 4.90; 95% CI 1.04-23.04, P = 0.044. High rate of fatality and relapse was further demonstrated at the long-term, since 70% of those whose treatment failed have died, and 24% among those deemed successfully treated have relapsed.Taken together, the data obtained in this study indicate that MDR

  3. Mechanisms of antibiotic resistance in Mycobacterium tuberculosis, validation of methods BACTECTM MGIT 960 and AnyplexM TII MTB / MDR / XDR Detection for detection of antibiotic resistance to first and second line in Mycobacterium tuberculosis strains

    International Nuclear Information System (INIS)

    Centeno Urena, Yadel

    2014-01-01

    A literature review is developed of drug-resistant TB in the world and in Costa Rica. The mechanisms of resistance to antibiotics are studied of the bacterium that causes tuberculosis; drug resistance to first-line and second-line, treatment regimen according to the World Health Organization and edge detection methods available in the market. The agreement between the results is studied by the phenotypic detection system of resistance of M. tuberculosis BACTEC MGIT960 and PCR, in real-time of commercial kit Anyplex II MTB/MDR/XDR, for genotypic identification of M. tuberculosis and related mutations to resistance with the referring results to thirty strains provided by the Pan American Health Organization, allowing a significant shortening in the time of obtaining reliable results. The results obtained have allowed to suggest a possible implementation at the Centro Nacional de Referencia en Micobacteriologia (CNRM), to perform antibiotic susceptibility testing and genotypic testing of multidrug cases respectively. The study results have allowed the implementation of the technology of genotypic detection of M. tuberculosis in the CNRM, obtaining for the first time in Costa Rica, information about genes of M. tuberculosis related to the generation of resistance to the major drugs of Primary treatment scheme as well as testing of resistance to second-line drug for resistant strains referred to the Centro Nacional de Referencia en Micobacteriologia in 2013. (author) [es

  4. Mechanisms of azole resistance in a clinical isolate of Candida tropicalis.

    Science.gov (United States)

    Vandeputte, Patrick; Larcher, Gérald; Bergès, Thierry; Renier, Gilles; Chabasse, Dominique; Bouchara, Jean-Philippe

    2005-11-01

    Azole resistance has been insufficiently investigated in the yeast Candida tropicalis. Here we determined the molecular mechanisms responsible for azole resistance in a clinical isolate of this pathogenic yeast. Antifungal susceptibility testing performed by a disk diffusion method showed resistance or markedly decreased susceptibility to azoles, which was confirmed by determination of MICs. Considering the relationship between azole susceptibility and the respiration reported for other yeast species, the respiratory activity of this isolate was investigated. Flow cytometry using rhodamine 123 and oxygraphy demonstrated an increased respiratory activity, which was not linked to an overexpression or increased number of copies of the mitochondrial genome. Among previously described resistance mechanisms, an increased activity of efflux pumps was investigated by flow cytometry using rhodamine 6G. However, the efflux of rhodamine 6G was lower in the resistant isolate than in susceptible ones. Likewise, real-time reverse transcription-PCR quantification of the expression of C. tropicalis MDR1 (CtMDR1), which encodes an efflux protein belonging to the major facilitator superfamily, did not show overexpression of this gene. In contrast, the resistant isolate overexpressed the CtERG11 gene coding for lanosterol 14alpha-demethylase. This was in agreement with the larger amount of ergosterol found in this isolate. Moreover, sequencing of CtERG11 showed a point mutation leading to a tyrosine substitution in the protein sequence, which might lead to decreased binding affinity for azoles. In conclusion, overexpression of CtERG11 associated with a missense mutation in this gene seemed to be responsible for the acquired azole resistance of this clinical isolate.

  5. Mechanisms of first-line antimicrobial resistance in multi-drug and extensively drug resistant strains of Mycobacterium tuberculosis in KwaZulu-Natal, South Africa

    Directory of Open Access Journals (Sweden)

    Navisha Dookie

    2016-10-01

    Full Text Available Abstract Background In South Africa, drug resistant tuberculosis is a major public health crisis in the face of the colossal HIV pandemic. Methods In an attempt to understand the distribution of drug resistance in our setting, we analysed the rpoB, katG, inhA, pncA and embB genes associated with resistance to key drugs used in the treatment of tuberculosis in clinical isolates of Mycobacterium tuberculosis in the KwaZulu-Natal province. Results Classical mutations were detected in the katG, inhA and embB genes associated with resistance to isoniazid and ethambutol. Diverse mutations were recorded in the multidrug resistant (MDR and extensively drug resistant (XDR isolates for the rpoB and pncA gene associated with resistance to rifampicin and pyrazinamide. Conclusions M.tuberculosis strains circulating in our setting display a combination of previously observed mutations, each mediating resistance to a different drug. The MDR and XDR TB isolates analysed in this study displayed classical mutations linked to INH and EMB resistance, whilst diverse mutations were linked to RIF and PZA resistance. The similarity of the XDR strains confirms reports of the clonality of the XDR epidemic. The successful dissemination of the drug resistant strains in the province underscores the need for rapid diagnostics to effectively diagnose drug resistance and guide treatment.

  6. Comparison of bacteriological conversion and treatment outcomes among MDR-TB patients with and without diabetes in Mexico: Preliminary data

    Directory of Open Access Journals (Sweden)

    M. Muñoz-Torrico

    2017-01-01

    Full Text Available Diabetes mellitus (DM is a well-known risk factor for tuberculosis (TB. However, it is not known to what extent DM affects the outcome in patients with multidrug-resistant (MDR-TB and extensively drug-resistant TB (XDR-TB treated with second-line anti-TB drugs.The objective of this study was to compare the microbiological evolution (sputum smear and culture conversion and final outcomes of MDR/XDR-TB patients with and without DM, managed at the national TB reference centre in Mexico City. Results: Ninety patients were enrolled between 2010 and 2015: 73 with MDR-TB (81.1%, 11 with pre-XDR-TB (e.g. MDR-TB with additional resistance to one injectable drug or a fluoroquinolone, 12.2% and 6 (6.7% with XDR-TB. Out of these, 49 (54.4% had DM and 42 (86% were undergoing insulin treatment.No statistically significant differences were found in treatment outcomes comparing DM vs. non-DM MDR-TB cases: 18/32 (56.3% of DM cases and 19/24 (79.2% non DM patients achieved treatment success (p = 0.07. The time to sputum smear and culture conversion was longer (although not statistically in patients without DM, as follows: the mean (±SD time to sputum smear conversion was 53.9 (±31.4 days in DM patients and 65.2 (±34.8 days in non-DM ones (p = 0.15, while the time to culture conversion was 66.2 (±27.6 days for DM and 81.4 (±37.7 days for non-DM MDR-TB cases (p = 0.06. Conclusions: The study results support the Mexican National TB programme to strengthen its collaboration with the DM programme, as an entry point for TB (and latent TB infection screening and management. Keywords: Diabetes mellitus, Delay, Sputum and culture conversion, MDR-TB, High treatment adherence

  7. Molecular characterization of two high-level ceftriaxone-resistant Neisseria gonorrhoeae isolates detected in Catalonia, Spain.

    Science.gov (United States)

    Cámara, Jordi; Serra, Judit; Ayats, Josefina; Bastida, Teresa; Carnicer-Pont, Dolors; Andreu, Antònia; Ardanuy, Carmen

    2012-08-01

    The aim of this study was to characterize the first two extended-spectrum cephalosporin-resistant and multidrug-resistant (MDR) Neisseria gonorrhoeae isolates collected from two sexually related patients (men who have sex with men) in Spain. Antimicrobial susceptibility was studied by Etest. Genes involved in quinolone, ceftriaxone and multidrug resistance were amplified by PCR and sequenced in both directions. The isolates were typed by N. gonorrhoeae multi-antigen sequence typing (NG-MAST). The two isolates had the same MDR profile, showing resistance to penicillin (MIC 0.094 mg/L; β-lactamase negative), ceftriaxone (MIC 1.5 mg/L), cefixime (MIC 1.5 mg/L), cefotaxime (MIC 1 mg/L), ciprofloxacin (MIC >32 mg/L) and tetracycline (MIC 1.5 mg/L). NG-MAST showed that both isolates belonged to sequence type (ST) 1407 (porB-908 and tbpB-110). Ciprofloxacin resistance was due to amino acid substitutions in GyrA (S91F and D95G) and ParC (S87R). An A deletion in the promoter of the MtrCDE efflux pump (mtrR) was detected. No changes were detected in the pilQ gene. The outer membrane protein PorB showed two substitutions at G120K and A121N. An L421P substitution was observed in the PBP1A (ponA) sequence. The sequence of PBP2 (penA) showed a mosaic structure related to genotype XXXIV with a single additional amino acid substitution (A501P). This genotype was identical to a recently described French isolate (F89). This is the first reported case of high-level extended-spectrum cephalosporin-resistant N. gonorrhoeae transmission. The molecular typing and MDR genotype suggest possible European spread of this strain, highlighting the need for surveillance and the importance of testing the susceptibility of N. gonorrhoeae to extended-spectrum cephalosporins.

  8. Survey of multidrug resistance integrative mobilizable elements SGI1 and PGI1 in Proteus mirabilis in humans and dogs in France, 2010-13.

    Science.gov (United States)

    Schultz, Eliette; Haenni, Marisa; Mereghetti, Laurent; Siebor, Eliane; Neuwirth, Catherine; Madec, Jean-Yves; Cloeckaert, Axel; Doublet, Benoît

    2015-09-01

    To characterize MDR genomic islands related to Salmonella genomic island 1 (SGI1) and Proteus genomic island 1 (PGI1) in Proteus mirabilis from human and animal sources in France in light of the previously reported cases. A total of 52 and 46 P. mirabilis clinical strains from human and animal sources, respectively, were studied for the period 2010-13. MDR was assessed by antimicrobial susceptibility testing, PCR detection of SGI1 and PGI1 and PCR mapping of the MDR regions. The diversity of the SGI1/PGI1-positive P. mirabilis strains was assessed by PFGE. Twelve P. mirabilis strains (5 humans and 7 dogs) were found to harbour an MDR island related to SGI1 or PGI1. Among them, several SGI1 variants were identified in diverse P. mirabilis genetic backgrounds. The variant SGI1-V, which harbours the ESBL bla VEB-6 gene, was found in closely genetically related human and dog P. mirabilis strains. The recently described PGI1 element was also identified in human and dog strains. Finally, one strain harboured a novel SGI genomic island closely related to SGI1 and SGI2 without an insertion of the MDR region. This study reports for the first time, to our knowledge, SGI1-positive and PGI1-positive P. mirabilis strains from dogs in France. The genetic diversity of the strains suggests several independent horizontal acquisitions of these MDR elements. The potential transmission of SGI1/PGI1-positive P. mirabilis strains between animals and humans is of public health concern, notably with regard to the spread of ESBL and carbapenemase genes, i.e. bla VEB-6 and bla NDM-1. © The Author 2015. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  9. Characterization of the psoRPM1 gene for resistance to root-knot ...

    African Journals Online (AJOL)

    Several root-knot nematode (Meloidogyne spp.) resistance genes have been discovered in different stone fruit crops. However, none of them has yet been cloned and they were only located on the chromosomes. In this study, a candidate root-knot nematode resistance gene (designated as psoRPM1) was isolated from the ...

  10. Prevalence, Virulence Genes and Antimicrobial Resistance Profiles of Salmonella Serovars from Retail Beef in Selangor, Malaysia.

    Science.gov (United States)

    Thung, Tze Y; Radu, Son; Mahyudin, Nor A; Rukayadi, Yaya; Zakaria, Zunita; Mazlan, Nurzafirah; Tan, Boon H; Lee, Epeng; Yeoh, Soo L; Chin, Yih Z; Tan, Chia W; Kuan, Chee H; Basri, Dayang F; Wan Mohamed Radzi, Che W J

    2017-01-01

    The aim of the present study was to investigate the prevalence of Salmonella spp., Salmonella Enteritidis and Salmonella Typhimurium in retail beef from different retail markets of Selangor area, as well as, to assess their pathogenic potential and antimicrobial resistance. A total of 240 retail beef meat samples (chuck = 60; rib = 60; round = 60; sirloin = 60) were randomly collected. The multiplex polymerase chain reaction (mPCR) in combination with the most probable number (MPN) method was employed to detect Salmonella spp., S . Enteritidis and S . Typhimurium in the meat samples. The prevalence of Salmonella spp., S . Enteritidis and S . Typhimurium in 240 beef meat samples were 7.50, 1.25, and 0.83%, respectively. The microbial loads of total Salmonella was found in the range of retail beef products tested were widely contaminated with multi-drug resistant (MDR) Salmonella and various virulence genes are present among the isolated Salmonella serovars.

  11. Substantial excretion of digoxin via the intestinal mucosa and prevention of long-term digoxin accumulation in the brain by the mdr1a P-glycoprotein

    NARCIS (Netherlands)

    Mayer, U; Wagenaar, E; Beijnen, J.H; Smit, J.W; Meijer, D.K F; van Asperen, J.; Borst, P; Schinkel, A.H

    1 We have used mice with a disrupted mdrla P-glycoprotein gene (mdrIa (-/-) mice) to study the role of P-glycoprotein in the pharmacokinetics of digoxin, a model P-glycoprotein substrate. 2 [K-3]-digoxin at a dose of 0.2 mg kg(-1) was administered as a single i.v. or oral bolus injection. We

  12. Vital and dispensable roles of Plasmodium multidrug resistance transporters during blood- and mosquito-stage development.

    Science.gov (United States)

    Rijpma, Sanna R; van der Velden, Maarten; Annoura, Takeshi; Matz, Joachim M; Kenthirapalan, Sanketha; Kooij, Taco W A; Matuschewski, Kai; van Gemert, Geert-Jan; van de Vegte-Bolmer, Marga; Siebelink-Stoter, Rianne; Graumans, Wouter; Ramesar, Jai; Klop, Onny; Russel, Frans G M; Sauerwein, Robert W; Janse, Chris J; Franke-Fayard, Blandine M; Koenderink, Jan B

    2016-07-01

    Multidrug resistance (MDR) proteins belong to the B subfamily of the ATP Binding Cassette (ABC) transporters, which export a wide range of compounds including pharmaceuticals. In this study, we used reverse genetics to study the role of all seven Plasmodium MDR proteins during the life cycle of malaria parasites. Four P. berghei genes (encoding MDR1, 4, 6 and 7) were refractory to deletion, indicating a vital role during blood stage multiplication and validating them as potential targets for antimalarial drugs. Mutants lacking expression of MDR2, MDR3 and MDR5 were generated in both P. berghei and P. falciparum, indicating a dispensable role for blood stage development. Whereas P. berghei mutants lacking MDR3 and MDR5 had a reduced blood stage multiplication in vivo, blood stage growth of P. falciparum mutants in vitro was not significantly different. Oocyst maturation and sporozoite formation in Plasmodium mutants lacking MDR2 or MDR5 was reduced. Sporozoites of these P. berghei mutants were capable of infecting mice and life cycle completion, indicating the absence of vital roles during liver stage development. Our results demonstrate vital and dispensable roles of MDR proteins during blood stages and an important function in sporogony for MDR2 and MDR5 in both Plasmodium species. © 2016 John Wiley & Sons Ltd.

  13. Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco

    Directory of Open Access Journals (Sweden)

    Zakham F

    2013-11-01

    Full Text Available Fathiah Zakham,1,4 Imane Chaoui,1 Amina Hadbae Echchaoui,2 Fouad Chetioui,3 My Driss Elmessaoudi,3 My Mustapha Ennaji,4 Mohammed Abid,2 Mohammed El Mzibri11Unité de Biologie et Recherché Médicale, Centre National de l'Energie, des Sciences et des Techniques Nucléaires (CNESTEN, Rabat, 2Laboratoire de Génétique Mycobacterienne, Institut Pasteur, Tangier, 3Laboratoire de Tuberculose Institut Pasteur, Casablanca, 4Laboratoire de Microbiologie, Hygiène et Virologie, Faculté des Sciences et Techniques, Mohammedia, MoroccoBackground: Tuberculosis (TB is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR and extensively drug resistant (XDR TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid.Methods: For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing.Results: Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%. Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a

  14. Chlortetracycline and florfenicol induce expression of genes associated with pathogenicity in multidrug-resistant Salmonella enterica serovar Typhimurium

    Science.gov (United States)

    Background Multidrug-resistant (MDR) Salmonella enterica serovar Typhimurium (S. Typhimurium) is a serious public health threat as infections caused by these strains are more difficult and expensive to treat. Livestock serve as a reservoir for MDR Salmonella, and the antibiotics chlortetracycline an...

  15. Effects of Copper Addition on Copper Resistance, Antibiotic Resistance Genes, and intl1 during Swine Manure Composting

    Science.gov (United States)

    Yin, Yanan; Gu, Jie; Wang, Xiaojuan; Song, Wen; Zhang, Kaiyu; Sun, Wei; Zhang, Xin; Zhang, Yajun; Li, Haichao

    2017-01-01

    Copper is one of the most abundant heavy metals present in swine manure. In this study, a laboratory-scale aerobic composting system was amended with Cu at three levels (0, 200, and 2000 mg kg-1, i.e., control, Cu200, and Cu2000 treatments, respectively) to determine its effect on the fate of copper resistance genes [copper resistance genes (CRGs): pcoA, cusA, copA, and tcrB], antibiotic resistance genes [antibiotic resistance genes (ARGs): erm(A) and erm(B)], and intl1. The results showed that the absolute abundances of pcoA, tcrB, erm(A), erm(B), and intl1 were reduced, whereas those of copA and cusA increased after swine manure composting. Redundancy analysis showed that temperature significantly affected the variations in CRGs, ARGs, and intl1. The decreases in CRGs, ARGs, and intI1 were positively correlated with the exchangeable Cu levels. The bacterial community could be grouped according to the composting time under different treatments, where the high concentration of copper had a more persistent effect on the bacterial community. Network analysis determined that the co-occurrence of CRGs, ARGs, and intI1, and the bacterial community were the main contributors to the changes in CRGs, ARG, and intl1. Thus, temperature, copper, and changes in the bacterial community composition had important effects on the variations in CRGs, ARGs, and intl1 during manure composting in the presence of added copper. PMID:28316595

  16. Prevalence, Virulence Genes and Antimicrobial Resistance Profiles of Salmonella Serovars from Retail Beef in Selangor, Malaysia

    Directory of Open Access Journals (Sweden)

    Tze Y. Thung

    2018-01-01

    Full Text Available The aim of the present study was to investigate the prevalence of Salmonella spp., Salmonella Enteritidis and Salmonella Typhimurium in retail beef from different retail markets of Selangor area, as well as, to assess their pathogenic potential and antimicrobial resistance. A total of 240 retail beef meat samples (chuck = 60; rib = 60; round = 60; sirloin = 60 were randomly collected. The multiplex polymerase chain reaction (mPCR in combination with the most probable number (MPN method was employed to detect Salmonella spp., S. Enteritidis and S. Typhimurium in the meat samples. The prevalence of Salmonella spp., S. Enteritidis and S. Typhimurium in 240 beef meat samples were 7.50, 1.25, and 0.83%, respectively. The microbial loads of total Salmonella was found in the range of <3 to 15 MPN/g. Eight different serovars of Salmonella were identified among the 23 isolates, and S. Agona was the predominant serovar (26.09%. Interestingly, all the Salmonella isolates were resistant to penicillin, erythromycin and vancomycin, but the sensitivity was observed for tetracycline, gentamicin and amoxicillin/clavulanic acid. All 23 isolates were resistant to at least three antibiotics. Two S. Typhimurium isolates (8.70% exhibited the highest multiple antibiotic resistance (MAR index value of 0.56 which shown resistance to nine antibiotics. PCR analysis of virulence genes showed that all Salmonella isolates (100% were positive for the invA gene. Meanwhile, pefA was only identified in S. Enteritidis and S. Typhimurium. The findings in this study indicate that retail beef products tested were widely contaminated with multi-drug resistant (MDR Salmonella and various virulence genes are present among the isolated Salmonella serovars.

  17. Virulence factors and mechanisms of antimicrobial resistance in Shigella strains from periurban areas of Lima (Peru).

    Science.gov (United States)

    Lluque, Angela; Mosquito, Susan; Gomes, Cláudia; Riveros, Maribel; Durand, David; Tilley, Drake H; Bernal, María; Prada, Ana; Ochoa, Theresa J; Ruiz, Joaquim

    2015-01-01

    The study was aimed to describe the serotype, mechanisms of antimicrobial resistance, and virulence determinants in Shigella spp. isolated from Peruvian children. Eighty three Shigella spp. were serogrouped and serotyped being established the antibiotic susceptibility. The presence of 12 virulence factors (VF) and integrase 1 and 2, along with commonly found antibiotic resistance genes was established by PCR. S. flexneri was the most relevant serogroup (55 isolates, 66%), with serotype 2a most frequently detected (27 of 55, 49%), followed by S. boydii and S. sonnei at 12 isolates each (14%) and S. dysenteriae (four isolates, 5%). Fifty isolates (60%) were multi-drug resistant (MDR) including 100% of S. sonnei and 64% of S. flexneri. Resistance levels were high to trimethoprim-sulfamethoxazole (86%), tetracycline (74%), ampicillin (67%), and chloramphenicol (65%). Six isolates showed decreased azithromycin susceptibility. No isolate was resistant to nalidixic acid, ciprofloxacin, nitrofurantoin, or ceftriaxone. The most frequent resistance genes were sul2 (95%), tet(B) (92%), cat (80%), dfrA1 (47%), blaOXA-1like (40%), with intl1 and intl2 detected in 51 and 52% of the isolates, respectively. Thirty-one different VF profiles were observed, being the ipaH (100%), sen (77%), virA and icsA (75%) genes the most frequently found. Differences in the prevalence of VF were observed between species with S. flexneri isolates, particularly serotype 2a, possessing high numbers of VF. In conclusion, this study highlights the high heterogeneity of Shigella VF and resistance genes, and prevalence of MDR organisms within this geographic region. Copyright © 2015 Elsevier GmbH. All rights reserved.

  18. Emergence of multidrug-resistant Acinetobacter baumannii producing OXA-23 Carbapenemase in Qatar

    Directory of Open Access Journals (Sweden)

    J.-M. Rolain

    2016-05-01

    Full Text Available The objective of our study was to describe the molecular support of carbapenem resistance from randomly selected clinical isolates of multidrug-resistant (MDR Acinetobacter baumannii as a pilot study from the Hamad Medical Corporation (HMC, Qatar. Results of our report will be used to study carbapenemases using molecular techniques in all isolated MDR A. baumannii. Forty-eight MDR A. baumannii were randomly selected from isolates preserved at HMC. Identification of all isolates was confirmed by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Antibiotic resistance was tested phenotypically by Phoenix and confirmed by Etest. The molecular support of carbapenemases (blaOXA-23, blaOXA-24, blaOXA-58, blaNDM was investigated by real-time PCR. The epidemiologic relatedness of the isolates was verified by phylogenetic analysis based on partial sequences of CsuE and blaOXA-51 genes. All 48 isolates were identified as A. baumannii and were confirmed to be resistant to most antibiotics, especially meropenem, imipenems, ciprofloxacin, levofloxacin, amikacin, gentamicin and most of the β-lactams; they were sensitive to colistin. All the isolates were positive for blaOXA-23 and negative for the other tested carbapenemase genes. Clonality analysis demonstrated that different lineages were actually circulating in Qatar; and we suggest that an outbreak occurred in the medical intensive care unit of HMC between 2011 and 2012. Here we report the emergence of MDR A. baumannii producing the carbapenemase OXA-23 in Qatar.

  19. Comparative Sequence Analysis of Multidrug-Resistant IncA/C Plasmids from Salmonella enterica.

    Science.gov (United States)

    Hoffmann, Maria; Pettengill, James B; Gonzalez-Escalona, Narjol; Miller, John; Ayers, Sherry L; Zhao, Shaohua; Allard, Marc W; McDermott, Patrick F; Brown, Eric W; Monday, Steven R

    2017-01-01

    Determinants of multidrug resistance (MDR) are often encoded on mobile elements, such as plasmids, transposons, and integrons, which have the potential to transfer among foodborne pathogens, as well as to other virulent pathogens, increasing the threats these traits pose to human and veterinary health. Our understanding of MDR among Salmonella has been limited by the lack of closed plasmid genomes for comparisons across resistance phenotypes, due to difficulties in effectively separating the DNA of these high-molecular weight, low-copy-number plasmids from chromosomal DNA. To resolve this problem, we demonstrate an efficient protocol for isolating, sequencing and closing IncA/C plasmids from Salmonella sp. using single molecule real-time sequencing on a Pacific Biosciences (Pacbio) RS II Sequencer. We obtained six Salmonella enterica isolates from poultry, representing six different serovars, each exhibiting the MDR-Ampc resistance profile. Salmonella plasmids were obtained using a modified mini preparation and transformed with Escherichia coli DH10Br. A Qiagen Large-Construct kit™ was used to recover highly concentrated and purified plasmid DNA that was sequenced using PacBio technology. These six closed IncA/C plasmids ranged in size from 104 to 191 kb and shared a stable, conserved backbone containing 98 core genes, with only six differences among those core genes. The plasmids encoded a number of antimicrobial resistance genes, including those for quaternary ammonium compounds and mercury. We then compared our six IncA/C plasmid sequences: first with 14 IncA/C plasmids derived from S. enterica available at the National Center for Biotechnology Information (NCBI), and then with an additional 38 IncA/C plasmids derived from different taxa. These comparisons allowed us to build an evolutionary picture of how antimicrobial resistance may be mediated by this common plasmid backbone. Our project provides detailed genetic information about resistance genes in

  20. Comparative Sequence Analysis of Multidrug-Resistant IncA/C Plasmids from Salmonella enterica

    Directory of Open Access Journals (Sweden)

    Maria Hoffmann

    2017-08-01

    Full Text Available Determinants of multidrug resistance (MDR are often encoded on mobile elements, such as plasmids, transposons, and integrons, which have the potential to transfer among foodborne pathogens, as well as to other virulent pathogens, increasing the threats these traits pose to human and veterinary health. Our understanding of MDR among Salmonella has been limited by the lack of closed plasmid genomes for comparisons across resistance phenotypes, due to difficulties in effectively separating the DNA of these high-molecular weight, low-copy-number plasmids from chromosomal DNA. To resolve this problem, we demonstrate an efficient protocol for isolating, sequencing and closing IncA/C plasmids from Salmonella sp. using single molecule real-time sequencing on a Pacific Biosciences (Pacbio RS II Sequencer. We obtained six Salmonella enterica isolates from poultry, representing six different serovars, each exhibiting the MDR-Ampc resistance profile. Salmonella plasmids were obtained using a modified mini preparation and transformed with Escherichia coli DH10Br. A Qiagen Large-Construct kit™ was used to recover highly concentrated and purified plasmid DNA that was sequenced using PacBio technology. These six closed IncA/C plasmids ranged in size from 104 to 191 kb and shared a stable, conserved backbone containing 98 core genes, with only six differences among those core genes. The plasmids encoded a number of antimicrobial resistance genes, including those for quaternary ammonium compounds and mercury. We then compared our six IncA/C plasmid sequences: first with 14 IncA/C plasmids derived from S. enterica available at the National Center for Biotechnology Information (NCBI, and then with an additional 38 IncA/C plasmids derived from different taxa. These comparisons allowed us to build an evolutionary picture of how antimicrobial resistance may be mediated by this common plasmid backbone. Our project provides detailed genetic information about

  1. Emergence of a Clonal Lineage of Multidrug-Resistant ESBL-Producing Salmonella Infantis Transmitted from Broilers and Broiler Meat to Humans in Italy between 2011 and 2014

    DEFF Research Database (Denmark)

    Franco, Alessia; Leekitcharoenphon, Pimlapas; Feltrin, Fabiola

    2015-01-01

    We report the spread of a clone of multidrug-resistant (MDR), ESBL-producing (blaCTX-M-1) Salmonella enterica subsp. enterica serovar Infantis, in the Italian broiler chicken industry and along the food-chain. This was first detected in Italy in 2011 and led to human infection in Italy in 2013....... This megaplasmid carried the ESBL gene blaCTX-M-1, and additional genes [tet(A), sul1, dfrA1 and dfrA14] mediating cefotaxime, tetracycline, sulfonamide, and trimethoprim resistance. It also contained genes conferring enhanced colonization capability, virulence (fimbriae, yersiniabactin), resistance and fitness...

  2. Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco.

    Science.gov (United States)

    Zakham, Fathiah; Chaoui, Imane; Echchaoui, Amina Hadbae; Chetioui, Fouad; Elmessaoudi, My Driss; Ennaji, My Mustapha; Abid, Mohammed; Mzibri, Mohammed El

    2013-01-01

    Tuberculosis (TB) is a major public health problem with high mortality and morbidity rates, especially in low-income countries. Disturbingly, the emergence of multidrug resistant (MDR) and extensively drug resistant (XDR) TB cases has worsened the situation, raising concerns of a future epidemic of virtually untreatable TB. Indeed, the rapid diagnosis of MDR TB is a critical issue for TB management. This study is an attempt to establish a rapid diagnosis of MDR TB by sequencing the target fragments of the rpoB gene which linked to resistance against rifampicin and the katG gene and inhA promoter region, which are associated with resistance to isoniazid. For this purpose, 133 sputum samples of TB patients from Morocco were enrolled in this study. One hundred samples were collected from new cases, and the remaining 33 were from previously treated patients (drug relapse or failure, chronic cases) and did not respond to anti-TB drugs after a sufficient duration of treatment. All samples were subjected to rpoB, katG and pinhA mutation analysis by polymerase chain reaction and DNA sequencing. Molecular analysis showed that seven strains were isoniazid-monoresistant and 17 were rifampicin-monoresistant. MDR TB strains were identified in nine cases (6.8%). Among them, eight were traditionally diagnosed as critical cases, comprising four chronic and four drug-relapse cases. The last strain was isolated from a new case. The most recorded mutation in the rpoB gene was the substitution TCG > TTG at codon 531 (Ser531 Leu), accounting for 46.15%. Significantly, the only mutation found in the katG gene was at codon 315 (AGC to ACC) with a Ser315Thr amino acid change. Only one sample harbored mutation in the inhA promoter region and was a point mutation at the -15p position (C > T). The polymerase chain reaction sequencing approach is an accurate and rapid method for detection of drug-resistant TB in clinical specimens, and could be of great interest in the management of TB in

  3. Estimating the future burden of multidrug-resistant and extensively drug-resistant tuberculosis in India, the Philippines, Russia, and South Africa: a mathematical modelling study.

    Science.gov (United States)

    Sharma, Aditya; Hill, Andrew; Kurbatova, Ekaterina; van der Walt, Martie; Kvasnovsky, Charlotte; Tupasi, Thelma E; Caoili, Janice C; Gler, Maria Tarcela; Volchenkov, Grigory V; Kazennyy, Boris Y; Demikhova, Olga V; Bayona, Jaime; Contreras, Carmen; Yagui, Martin; Leimane, Vaira; Cho, Sang Nae; Kim, Hee Jin; Kliiman, Kai; Akksilp, Somsak; Jou, Ruwen; Ershova, Julia; Dalton, Tracy; Cegielski, Peter

    2017-07-01

    Multidrug-resistant (MDR) and extensively drug-resistant (XDR) tuberculosis are emerging worldwide. The Green Light Committee initiative supported programmatic management of drug-resistant tuberculosis in 90 countries. We used estimates from the Preserving Effective TB Treatment Study to predict MDR and XDR tuberculosis trends in four countries with a high burden of MDR tuberculosis: India, the Philippines, Russia, and South Africa. We calibrated a compartmental model to data from drug resistance surveys and WHO tuberculosis reports to forecast estimates of incident MDR and XDR tuberculosis and the percentage of incident MDR and XDR tuberculosis caused by acquired drug resistance, assuming no fitness cost of resistance from 2000 to 2040 in India, the Philippines, Russia, and South Africa. The model forecasted the percentage of MDR tuberculosis among incident cases of tuberculosis to increase, reaching 12·4% (95% prediction interval 9·4-16·2) in India, 8·9% (4·5-11·7) in the Philippines, 32·5% (27·0-35·8) in Russia, and 5·7% (3·0-7·6) in South Africa in 2040. It also predicted the percentage of XDR tuberculosis among incident MDR tuberculosis to increase, reaching 8·9% (95% prediction interval 5·1-12·9) in India, 9·0% (4·0-14·7) in the Philippines, 9·0% (4·8-14·2) in Russia, and 8·5% (2·5-14·7) in South Africa in 2040. Acquired drug resistance would cause less than 30% of incident MDR tuberculosis during 2000-40. Acquired drug resistance caused 80% of incident XDR tuberculosis in 2000, but this estimate would decrease to less than 50% by 2040. MDR and XDR tuberculosis were forecast to increase in all four countries despite improvements in acquired drug resistance shown by the Green Light Committee-supported programmatic management of drug-resistant tuberculosis. Additional control efforts beyond improving acquired drug resistance rates are needed to stop the spread of MDR and XDR tuberculosis in countries with a high burden of MDR

  4. Effect of pO2 on antitumor drug cytotoxicity on MDR and non-MDR variants selected from the LoVo metastatic colon carcinoma cell line.

    Science.gov (United States)

    Lelong-Rebel, Isabelle; Brisson, Christine; Fabre, Michel; Bergerat, Jean-Pierre; Rebel, Gérard

    2008-01-01

    Two chemosensitive cell lines, LoVo-fusoid (LoVo-f) and LoVo-small cells (LoVo-sc) were derived from the original LoVo cell line. These two variants and the multidrug-resistant (MDR) cell line LoVo-Dox were screened for various properties. In non-permeabilized cells, only LoVo-sc showed mucin-2 staining whereas labelling was positive in all permeabilized cell lines. As shown by electron microscopy screening and by relative resistance to trypsin detachment, only LoVo-sc cells showed strong mucus secretion. All three cell lines displayed strong staining for P-glycoprotein (P-gp), multidrug resistance-associated protein (MRP) and lung-resistance-related protein (LRP) in different locations according to the drug resistance state. The three cell lines showed intracellular labelling of LRP and MRP. The sensitive cells showed P-gp in a large perinuclear ring and in the cytoplasm, but little (LoVo-sc cells) or no staining (LoVo-f cells) was shown at the plasma membrane level. For the Lovo-Dox cells, P-gp was located in the plasma membrane, in cellular anchorages and in the cytoplasm as well. Cell resistance against antineoplastic agents often results from mobilization of various factors, the modulation of which is linked to the culture conditions. As most of the protocols utilize cells growing in (air + 5-10% CO2) atmosphere e.g. 20% O2, balance of the respective participants in the MDR multi-modal mechanism may not be representative of the in vivo situation and may lead to erratic pharmacological response. Indeed, cells within solid tumours were exposed to low pO2, most of them being under hypoxic condition (0.1-5% O2). In the absence of anticancer drugs, all LoVo cell lines grew notably faster at 20% O2 than at 5% O2. Moreover, respective sensitivities of both non-MDR variants to doxorubicin were altered according the pO2. Whatever the pO2 was, virtually none of the antioxidants tested affected the cytotoxic activity of doxorubicin for the three cell lines. By contrast

  5. Frequency, Antimicrobial Resistance and Genetic Diversity of Klebsiella pneumoniae in Food Samples.

    Directory of Open Access Journals (Sweden)

    Yumei Guo

    Full Text Available This study aimed to assess the frequency of Klebsiella pneumoniae in food samples and to detect antibiotic resistance phenotypes, antimicrobial resistance genes and the molecular subtypes of the recovered isolates. A total of 998 food samples were collected, and 99 (9.9% K. pneumoniae strains were isolated; the frequencies were 8.2% (4/49 in fresh raw seafood, 13.8% (26/188 in fresh raw chicken, 11.4% (34/297 in frozen raw food and 7.5% (35/464 in cooked food samples. Antimicrobial resistance was observed against 16 antimicrobials. The highest resistance rate was observed for ampicillin (92.3%, followed by tetracycline (31.3%, trimethoprim-sulfamethoxazole (18.2%, and chloramphenicol (10.1%. Two K. pneumoniae strains were identified as extended-spectrum β-lactamase (ESBL-one strain had three beta-lactamases genes (blaSHV, blaCTX-M-1, and blaCTX-M-10 and one had only the blaSHV gene. Nineteen multidrug-resistant (MDR strains were detected; the percentage of MDR strains in fresh raw chicken samples was significantly higher than in other sample types (P<0.05. Six of the 18 trimethoprim-sulfamethoxazole-resistant strains carried the folate pathway inhibitor gene (dhfr. Four isolates were screened by PCR for quinolone resistance genes; aac(6'-Ib-cr, qnrB, qnrA and qnrS were detected. In addition, gyrA gene mutations such as T247A (Ser83Ile, C248T (Ser83Phe, and A260C (Asp87Ala and a parC C240T (Ser80Ile mutation were identified. Five isolates were screened for aminoglycosides resistance genes; aacA4, aacC2, and aadA1 were detected. Pulsed-field gel electrophoresis-based subtyping identified 91 different patterns. Our results indicate that food, especially fresh raw chicken, is a reservoir of antimicrobial-resistant K. pneumoniae, and the potential health risks posed by such strains should not be underestimated. Our results demonstrated high prevalence, antibiotic resistance rate and genetic diversity of K. pneumoniae in food in China. Improved

  6. Analysis of β-Lactamase Resistance Determinants in Enterobacteriaceae from Chicago Children: a Multicenter Survey

    Science.gov (United States)

    Hujer, Andrea M.; Marshall, Steven H.; Domitrovic, T. Nicholas; Rudin, Susan D.; Zheng, Xiaotian; Qureshi, Nadia K.; Hayden, Mary K.; Scaggs, Felicia A.; Karadkhele, Anand; Bonomo, Robert A.

    2016-01-01

    Multidrug-resistant (MDR) Enterobacteriaceae infections are increasing in U.S. children; however, there is a paucity of multicentered analyses of antibiotic resistance genes responsible for MDR phenotypes among pediatric Enterobacteriaceae isolates. In this study, 225 isolates phenotypically identified as extended-spectrum β-lactamase (ESBL) or carbapenemase producers, recovered from children ages 0 to 18 years hospitalized between January 2011 and April 2015 at three Chicago area hospitals, were analyzed. We used DNA microarray platforms to detect ESBL, plasmid-mediated AmpC (pAmpC), and carbapenemase type β-lactamase (bla) genes. Repetitive-sequence-based PCR and multilocus sequence typing (MLST) were performed to assess isolate similarity. Plasmid replicon typing was conducted to classify plasmids. The median patient age was 4.2 years, 56% were female, and 44% presented in the outpatient setting. The majority (60.9%) of isolates were Escherichia coli and from urinary sources (69.8%). Of 225 isolates exhibiting ESBL- or carbapenemase-producing phenotypes, 90.7% contained a bla gene. The most common genotype was the blaCTX-M-1 group (49.8%); 1.8% were carbapenem-resistant Enterobacteriaceae (three blaKPC and one blaIMP). Overall, pAmpC (blaACT/MIR and blaCMY) were present in 14.2%. The predominant E. coli phylogenetic group was the virulent B2 group (67.6%) associated with ST43/ST131 (Pasteur/Achtman MLST scheme) containing the blaCTX-M-1 group (84%), and plasmid replicon types FIA, FII, and FIB. K. pneumoniae harboring blaKPC were non-ST258 with replicon types I1 and A/C. Enterobacter spp. carrying blaACT/MIR contained plasmid replicon FIIA. We found that β-lactam resistance in children is diverse and that certain resistance mechanisms differ from known circulating genotypes in adults in an endemic area. The potential impact of complex molecular types and the silent dissemination of MDR Enterobacteriaceae in a vulnerable population needs to be studied further

  7. Social, economic, and psychological impacts of MDR-TB treatment in Tijuana, Mexico: a patient's perspective.

    Science.gov (United States)

    Morris, M D; Quezada, L; Bhat, P; Moser, K; Smith, J; Perez, H; Laniado-Laborin, R; Estrada-Guzman, J; Rodwell, T C

    2013-07-01

    The State of Baja California, Mexico, had the highest prevalence of multidrug-resistant tuberculosis (MDR-TB) in Mexico in 2009. To understand the socio-economic burden of MDR-TB disease and its treatment on patients in Tijuana and Mexicali, Mexico. From July to November 2009, qualitative interviews were conducted with 12 patients enrolled in a US-Mexico binational MDR-TB treatment program, Puentes de Esperanza (Bridges of Hope), which was designed to support MDR-TB patients. In-depth interviews were coded to identify major themes in patient experiences of MDR-TB diagnosis and care. While some patients were able to maintain their pre-MDR-TB lives to a limited extent, most patients reported losing their sense of identity due to their inability to work, social isolation, and stigmatization from family and friends. The majority of participants expressed appreciation for Puentes' role in 'saving their lives'. Being diagnosed with MDR-TB and undergoing treatment imposes significant psychological, social and economic stress on patients. Strong social support elements within Puentes helped alleviate these burdens. Improvements to the program might include peer-support groups for patients undergoing treatment and transitioning back into the community after treatment.

  8. Transmission of MDR MRSA between primates, their environment and personnel at a United States primate centre.

    Science.gov (United States)

    Soge, Olusegun O; No, David; Michael, Karen E; Dankoff, Jennifer; Lane, Jennifer; Vogel, Keith; Smedley, Jeremy; Roberts, Marilyn C

    2016-10-01

    MDR MRSA isolates cultured from primates, their facility and primate personnel from the Washington National Primate Research Center were characterized to determine whether they were epidemiologically related to each other and if they represented common local human-associated MRSA strains. Human and primate nasal and composite environmental samples were collected, enriched and selected on medium supplemented with oxacillin and polymyxin B. Isolates were biochemically verified as Staphylococcus aureus and screened for the mecA gene. Selected isolates were characterized using SCCmec typing, MLST and WGS. Nasal cultures were performed on 596 primates and 105 (17.6%) were MRSA positive. Two of 79 (2.5%) personnel and two of 56 (3.6%) composite primate environmental facility samples were MRSA positive. Three MRSA isolates from primates, one MRSA from personnel, two environmental MRSA and one primate MSSA were ST188 and were the same strain type by conventional typing methods. ST188 isolates were related to a 2007 ST188 human isolate from Hong Kong. Both MRSA isolates from out-of-state primates had a novel MLST type, ST3268, and an unrelated group. All isolates carried ≥1 other antibiotic resistance gene(s), including tet(38), the only tet gene identified. ST188 is very rare in North America and has almost exclusively been identified in people from Pan-Asia, while ST3268 is a newly reported MRSA type. The data suggest that the primate MDR MRSA was unlikely to come from primate centre employees. Captive primates are likely to be an unappreciated source of MRSA. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  9. Multidrug-resistant Enterobacteriaceae from indoor air of an urban wastewater treatment plant.

    Science.gov (United States)

    Teixeira, Juliana V; Cecílio, Pedro; Gonçalves, Daniela; Vilar, Vítor J P; Pinto, Eugénia; Ferreira, Helena N

    2016-07-01

    Wastewater treatment plants (WWTPs) have been recognized as sources of bioaerosols that may act as vehicles for dissemination of pathogens and multidrug-resistant (MDR) bacteria. The occurrence of MDR Enterobacteriaceae in indoor air of an urban WWTP was investigated. A possible airborne contamination with extended-spectrum beta-lactamase (ESBL) and carbapenemase-producing Enterobacteriaceae was also explored. Fourteen of 39 Enterobacteriaceae isolates were MDR. These isolates were found at all sampling sites, mainly at the secondary sedimentation settings. The highest levels of resistance were detected in three different species: Enterobacter cloacae, Escherichia coli, and Citrobacter freundii. Furthermore, one of the airborne E. coli isolates was phenotypically characterized as an ESBL producer. Additionally, five isolates showed non-susceptibility to at least one carbapenem tested. The presence of genes encoding relevant beta-lactamase types in these ESBL-producing and carbapenem-resistant Enterobacteriaceae isolates was investigated by PCR. Results showed amplification for bla CTX-M and bla OXA. These findings are relevant both in terms of occupational/public health and of environmental dissemination of MDR bacteria.

  10. Antimicrobial Resistance Mechanisms and Genetic Diversity of Multidrug-Resistant Acinetobacter baumannii Isolated from a Teaching Hospital in Malaysia.

    Science.gov (United States)

    Biglari, Shirin; Hanafiah, Alfizah; Mohd Puzi, Shaliawani; Ramli, Ramliza; Rahman, Mostafizur; Lopes, Bruno Silvester

    2017-07-01

    Multidrug-resistant (MDR) Acinetobacter baumannii has increasingly emerged as an important nosocomial pathogen. The aim of this study was to determine the resistance profiles and genetic diversity in A. baumannii clinical isolates in a tertiary medical center in Malaysia. The minimum inhibitory concentrations of carbapenems (imipenem and meropenem), cephalosporins (ceftazidime and cefepime), and ciprofloxacin were determined by E-test. PCR and sequencing were carried out for the detection of antibiotic resistance genes and mutations. Clonal relatedness among A. baumannii isolates was determined by REP-PCR. Sequence-based typing of OXA-51 and multilocus sequence typing were performed. One hundred twenty-five of 162 (77.2%) A. baumannii isolates had MDR phenotype. From the 162 A. baumannii isolates, 20 strain types were identified and majority of A. baumannii isolates (66%, n = 107) were classified as strain type 1 and were positive for ISAba1-bla OXA-23 and ISAba1-bla ADC and had mutations in both gyrA and parC genes at positions, 83 and 80, resulting in serine-to-leucine conversion. REP-PCR analysis showed 129 REP types that generated 31 clones with a 90% similarity cutoff value. OXA-66 variant of the bla OXA-51-like genes was predominantly detected among our A. baumannii clinical isolates belonging to ST195 (found in six clones: 1, 8, 9, 19, 27, and 30) and ST208 (found in clone 21). The study helps us in understanding the genetic diversity of A. baumannii isolates in our setting and confirms that international clone II is the most widely distributed clone in Universiti Kebangsaan Malaysia Medical Centre, Malaysia.

  11. Functionalized graphene oxide mediated adriamycin delivery and miR-21 gene silencing to overcome tumor multidrug resistance in vitro.

    Directory of Open Access Journals (Sweden)

    Feng Zhi

    Full Text Available Multidrug resistance (MDR is a major impediment to successful cancer chemotherapy. Co-delivery of novel MDR-reversing agents and anticancer drugs to cancer cells holds great promise for cancer treatment. MicroRNA-21 (miR-21 overexpression is associated with the development and progression of MDR in breast cancer, and it is emerging as a novel and promising MDR-reversing target. In this study, a multifunctional nanocomplex, composed of polyethylenimine (PEI/poly(sodium 4-styrenesulfonates (PSS/graphene oxide (GO and termed PPG, was prepared using the layer-by-layer assembly method to evaluate the reversal effects of PPG as a carrier for adriamycin (ADR along with miR-21 targeted siRNA (anti-miR-21 in cancer drug resistance. ADR was firstly loaded onto the PPG surface (PPGADR by physical mixing and anti-miR-21 was sequentially loaded onto PPGADR through electric absorption to form (anti-miR-21PPGADR. Cell experiments showed that PPG significantly enhanced the accumulation of ADR in MCF-7/ADR cells (an ADR resistant breast cancer cell line and exhibited much higher cytotoxicity than free ADR, suggesting that PPG could effectively reverse ADR resistance of MCF-7/ADR. Furthermore, the enhanced therapeutic efficacy of PPG could be correlated with effective silencing of miR-21 and with increased accumulation of ADR in drug-resistant tumor cells. The endocytosis study confirmed that PPG could effectively carry drug molecules into cells via the caveolae and clathrin-mediated endocytosis pathways. These results suggest that this PPG could be a potential and efficient non-viral vector for reversing MDR, and the strategy of combining anticancer drugs with miRNA therapy to overcome MDR could be an attractive approach in cancer treatment.

  12. Novel understanding of ABC transporters ABCB1/MDR/P-glycoprotein, ABCC2/MRP2, and ABCG2/BCRP in colorectal pathophysiology

    DEFF Research Database (Denmark)

    Andersen, Vibeke; Svenningsen, Katrine; Almind Knudsen, Lina

    2015-01-01

    AIM: To evaluate ATP-binding cassette (ABC) transporters in colonic pathophysiology as they had recently been related to colorectal cancer (CRC) development. METHODS: Literature search was conducted on PubMed using combinations of the following terms: ABC transporters, ATP binding cassette...... with glucocorticoids. The evidence for the involvement of ABCC2 and ABCG2 in colonic pathophysiology was weak. CONCLUSION: ABCB1, diet, and gut microbes mutually interact in colonic inflammation, a well-known risk factor for CRC. Further insight may be translated into preventive and treatment strategies....... transporter proteins, inflammatory bowel disease, ulcerative, colitis, Crohns disease, colorectal cancer, colitis, intestinal inflammation, intestinal carcinogenesis, ABCB1/P-glycoprotein (P-gp/CD243/MDR1), ABCC2/multidrug resistance protein 2 (MRP2) and ABCG2/breast cancer resistance protein (BCRP), Abcb1...

  13. [The effect and mechanism of vinorelbine on cisplatin resistance of human lung cancer cell line A549/DDP].

    Science.gov (United States)

    Qi, Chunsheng; Gao, Sen; Li, Huiqiang; Gao, Weizhen

    2014-02-01

    Drug resistance is a major obstacle on lung cancer treatment and Vinorelbine is an effective drug to inhibition of tumor proliferation and metastasis. In this study, we investigated the effect and mechanism of Vinorelbine on reversing the cisplatin resistance of human lung cancer A549/DDP cell line. With 1 μmol/L and 5 μmol/L Vinorelbine treatment, MTS assay was employed to determine the effect of the cisplatin sensitivity of tumor cells, flow cytometry to determine the apoptosis rate and change of Rh-123 content; Western blot to determine the expression of MDR1, Bcl-2, surviving, PTEN, caspase-3/8 and phosphorylation level of Akt (p-Akt); Real-time PCR was to determine the mRNA expression of MDR1, Bcl-2, survivin and PTEN. Finally the transcriptional activities of NF-κB, Twist and Snail were determined by reporter gene system. With 1 μmol/L and 5 μmol/L Vinorelbine treatment, the sensitivity of cancer cells to cisplatin was increased by 1.91- and 2.54- folds respectively, flow cytometry showed that the content of Rh-123 was elevated 1.93- and 2.95- folds and apoptosis rate was increased 2.25- and 3.82- folds, Western blot showed that the expression of multidrug resistance related proteins MDR, Bcl-2 and survivin were downregulated, caspase-3/8 and PTEN was upregulated, phosphorylation of Akt was downregulated as well, real-time assay showed that the mRNA expression of MDR1 was downregulated 43.5% and 25.8%, Bcl-2 was downregulated 57.3% and 34.1%, survivin was downregulated 37.6% and 12.4%, PTEN was upregulated 183.4% and 154.2%, the transcriptional activities of NF-κB was downregulated 53.2% and 34.5%, Twist was downregulated 61.4% and 33.5%, and Snail was downregulated 57.8% and 18.7%. Vinorelbine treatment led to increase of cisplatin sensitivity of A549/DDP cells and the mechanisms included the regulation of PTEN/AKT/NF-κB signal pathway to decreased drug resistance gene expression and increased pro-apoptosis gene expression.

  14. Isolation and in vitro evaluation of bacteriophages against MDR-bacterial isolates from septic wound infections.

    Directory of Open Access Journals (Sweden)

    Roja Rani Pallavali

    Full Text Available Multi-drug resistance has become a major problem for the treatment of pathogenic bacterial infections. The use of bacteriophages is an attractive approach to overcome the problem of drug resistance in several pathogens that cause fatal diseases. Our study aimed to isolate multi drug resistant bacteria from patients with septic wounds and then isolate and apply bacteriophages in vitro as alternative therapeutic agents. Pus samples were aseptically collected from Rajiv Gandhi Institute of Medical Science (RIMS, Kadapa, A.P., and samples were analyzed by gram staining, evaluating morphological characteristics, and biochemical methods. MDR-bacterial strains were collected using the Kirby-Bauer disk diffusion method against a variety of antibiotics. Bacteriophages were collected and tested in vitro for lytic activity against MDR-bacterial isolates. Analysis of the pus swab samples revealed that the most of the isolates detected had Pseudomonas aeruginosa as the predominant bacterium, followed by Staphylococcus aureus, Klebsiella pneumoniae and Escherichia coli. Our results suggested that gram-negative bacteria were more predominant than gram-positive bacteria in septic wounds; most of these isolates were resistant to ampicillin, amoxicillin, penicillin, vancomycin and tetracycline. All the gram-positive isolates (100% were multi-drug resistant, whereas 86% of the gram-negative isolates had a drug resistant nature. Further bacteriophages isolated from sewage demonstrated perfect lytic activity against the multi-drug resistant bacteria causing septic wounds. In vitro analysis of the isolated bacteriophages demonstrated perfect lysis against the corresponding MDR-bacteria, and these isolated phages may be promising as a first choice for prophylaxis against wound sepsis, Moreover, phage therapy does not enhance multi-drug resistance in bacteria and could work simultaneously on a wide variety of MDR-bacteria when used in a bacteriophage cocktail. Hence

  15. The Occurrence of the Colistin Resistance Gene mcr-1 in the Haihe River (China

    Directory of Open Access Journals (Sweden)

    Dong Yang

    2017-05-01

    Full Text Available Antibiotic failure is occurring worldwide. In a routine surveillance study on antibioticresistance genes (ARGs in natural water bodies, we noted the detection of colistin-resistance gene mcr-1, previously identified in Escherichia coli and Klebsiella pneumoniae isolates from human beings and animals in several countries. The mcr-1 gene might be present in water environments, because aquatic ecosystems are recognized as reservoirs for antibiotic resistant bacteria (ARB and ARGs. In this study, a qPCR assay was developed to monitor and quantify the mcr-1 gene in the Haihe River, China. The results showed that all 18 samples collected from different locations over 6 months along the Haihe River were positive for the mcr-1 gene, and the highest level of mcr-1 reached 3.81 × 105 gene copies (GC per liter of water. This is the first study to quantify mcr-1 in a natural water system by qPCR. Our findings highlight the potential for this antibiotic resistance determinant to spread extensively, suggesting a significant health and ecological impact.

  16. Multidrug-resistant tuberculosis in Europe, 2010-2011

    DEFF Research Database (Denmark)

    Günther, Gunar; van Leth, Frank; Alexandru, Sofia

    2015-01-01

    Drug-resistant Mycobacterium tuberculosis is challenging elimination of tuberculosis (TB). We evaluated risk factors for TB and levels of second-line drug resistance in M. tuberculosis in patients in Europe with multidrug-resistant (MDR) TB. A total of 380 patients with MDR TB and 376 patients...... with non-MDR TB were enrolled at 23 centers in 16 countries in Europe during 2010-2011. A total of 52.4% of MDR TB patients had never been treated for TB, which suggests primary transmission of MDR M. tuberculosis. At initiation of treatment for MDR TB, 59.7% of M. tuberculosis strains tested were...

  17. Bafetinib (INNO-406) reverses multidrug resistance by inhibiting the efflux function of ABCB1 and ABCG2 transporters

    Science.gov (United States)

    Zhang, Yun-Kai; Zhang, Guan-Nan; Wang, Yi-Jun; Patel, Bhargav A.; Talele, Tanaji T.; Yang, Dong-Hua; Chen, Zhe-Sheng

    2016-05-01

    ATP-Binding Cassette transporters are involved in the efflux of xenobiotic compounds and are responsible for decreasing drug accumulation in multidrug resistant (MDR) cells. Discovered by structure-based virtual screening algorithms, bafetinib, a Bcr-Abl/Lyn tyrosine kinase inhibitor, was found to have inhibitory effects on both ABCB1- and ABCG2-mediated MDR in this in-vitro investigation. Bafetinib significantly sensitized ABCB1 and ABCG2 overexpressing MDR cells to their anticancer substrates and increased the intracellular accumulation of anticancer drugs, particularly doxorubicin and [3H]-paclitaxel in ABCB1 overexpressing cells; mitoxantrone and [3H]-mitoxantrone in ABCG2 overexpressing cells, respectively. Bafetinib stimulated ABCB1 ATPase activities while inhibited ABCG2 ATPase activities. There were no significant changes in the expression level or the subcellular distribution of ABCB1 and ABCG2 in the cells exposed to 3 μM of bafetinib. Overall, our study indicated that bafetinib reversed ABCB1- and ABCG2-mediated MDR by blocking the drug efflux function of these transporters. These findings might be useful in developing combination therapy for MDR cancer treatment.

  18. Artemether resistance in vitro is linked to mutations in PfATP6 that also interact with mutations in PfMDR1 in travellers returning with Plasmodium falciparum infections.

    KAUST Repository

    Pillai, Dylan R; Lau, Rachel; Khairnar, Krishna; Lepore, Rosalba; Via, Allegra; Staines, Henry M; Krishna, Sanjeev

    2012-01-01

    BACKGROUND: Monitoring resistance phenotypes for Plasmodium falciparum, using in vitro growth assays, and relating findings to parasite genotype has proved particularly challenging for the study of resistance to artemisinins. METHODS: Plasmodium falciparum isolates cultured from 28 returning travellers diagnosed with malaria were assessed for sensitivity to artemisinin, artemether, dihydroartemisinin and artesunate and findings related to mutations in pfatp6 and pfmdr1. RESULTS: Resistance to artemether in vitro was significantly associated with a pfatp6 haplotype encoding two amino acid substitutions (pfatp6 A623E and S769N; (mean IC50 (95% CI) values of 8.2 (5.7 - 10.7) for A623/S769 versus 623E/769 N 13.5 (9.8 - 17.3) nM with a mean increase of 65%; p = 0.012). Increased copy number of pfmdr1 was not itself associated with increased IC50 values for artemether, but when interactions between the pfatp6 haplotype and increased copy number of pfmdr1 were examined together, a highly significant association was noted with IC50 values for artemether (mean IC50 (95% CI) values of 8.7 (5.9 - 11.6) versus 16.3 (10.7 - 21.8) nM with a mean increase of 87%; p = 0.0068). Previously described SNPs in pfmdr1 are also associated with differences in sensitivity to some artemisinins. CONCLUSIONS: These findings were further explored in molecular modelling experiments that suggest mutations in pfatp6 are unlikely to affect differential binding of artemisinins at their proposed site, whereas there may be differences in such binding associated with mutations in pfmdr1. Implications for a hypothesis that artemisinin resistance may be exacerbated by interactions between PfATP6 and PfMDR1 and for epidemiological studies to monitor emerging resistance are discussed.

  19. Artemether resistance in vitro is linked to mutations in PfATP6 that also interact with mutations in PfMDR1 in travellers returning with Plasmodium falciparum infections.

    KAUST Repository

    Pillai, Dylan R

    2012-04-27

    BACKGROUND: Monitoring resistance phenotypes for Plasmodium falciparum, using in vitro growth assays, and relating findings to parasite genotype has proved particularly challenging for the study of resistance to artemisinins. METHODS: Plasmodium falciparum isolates cultured from 28 returning travellers diagnosed with malaria were assessed for sensitivity to artemisinin, artemether, dihydroartemisinin and artesunate and findings related to mutations in pfatp6 and pfmdr1. RESULTS: Resistance to artemether in vitro was significantly associated with a pfatp6 haplotype encoding two amino acid substitutions (pfatp6 A623E and S769N; (mean IC50 (95% CI) values of 8.2 (5.7 - 10.7) for A623/S769 versus 623E/769 N 13.5 (9.8 - 17.3) nM with a mean increase of 65%; p = 0.012). Increased copy number of pfmdr1 was not itself associated with increased IC50 values for artemether, but when interactions between the pfatp6 haplotype and increased copy number of pfmdr1 were examined together, a highly significant association was noted with IC50 values for artemether (mean IC50 (95% CI) values of 8.7 (5.9 - 11.6) versus 16.3 (10.7 - 21.8) nM with a mean increase of 87%; p = 0.0068). Previously described SNPs in pfmdr1 are also associated with differences in sensitivity to some artemisinins. CONCLUSIONS: These findings were further explored in molecular modelling experiments that suggest mutations in pfatp6 are unlikely to affect differential binding of artemisinins at their proposed site, whereas there may be differences in such binding associated with mutations in pfmdr1. Implications for a hypothesis that artemisinin resistance may be exacerbated by interactions between PfATP6 and PfMDR1 and for epidemiological studies to monitor emerging resistance are discussed.

  20. Transcriptional profiles of pulmonary innate immune responses to isogenic antibiotic-susceptible and multidrug-resistant Pseudomonas aeruginosa.

    Science.gov (United States)

    Tam, Vincent H; Pérez, Cynthia; Ledesma, Kimberly R; Lewis, Russell E

    2018-04-01

    The virulence of an isogenic pair of Pseudomonas aeruginosa strains was studied under similar experimental conditions in two animal infection models. The time to death was significantly longer for the multidrug resistant (MDR) than the wild-type strain. The transcriptional profiles of 84 innate immune response genes in the lungs of immune competent Balb/C mice were further compared. Significantly weaker expression of genes involved in production of soluble pattern recognition receptor and complement were observed in animals infected with the MDR strain. Altered patterns of innate immune system activation may explain the attenuated virulence in MDR bacteria. © 2018 The Societies and John Wiley & Sons Australia, Ltd.

  1. Molecular cloning of the potato Gro1-4 gene conferring resistance to pathotype Ro1 of the root cyst nematode Globodera rostochiensis, based on a candidate gene approach.

    Science.gov (United States)

    Paal, Jürgen; Henselewski, Heike; Muth, Jost; Meksem, Khalid; Menéndez, Cristina M; Salamini, Francesco; Ballvora, Agim; Gebhardt, Christiane

    2004-04-01

    The endoparasitic root cyst nematode Globodera rostochiensis causes considerable damage in potato cultivation. In the past, major genes for nematode resistance have been introgressed from related potato species into cultivars. Elucidating the molecular basis of resistance will contribute to the understanding of nematode-plant interactions and assist in breeding nematode-resistant cultivars. The Gro1 resistance locus to G. rostochiensis on potato chromosome VII co-localized with a resistance-gene-like (RGL) DNA marker. This marker was used to isolate from genomic libraries 15 members of a closely related candidate gene family. Analysis of inheritance, linkage mapping, and sequencing reduced the number of candidate genes to three. Complementation analysis by stable potato transformation showed that the gene Gro1-4 conferred resistance to G. rostochiensis pathotype Ro1. Gro1-4 encodes a protein of 1136 amino acids that contains Toll-interleukin 1 receptor (TIR), nucleotide-binding (NB), leucine-rich repeat (LRR) homology domains and a C-terminal domain with unknown function. The deduced Gro1-4 protein differed by 29 amino acid changes from susceptible members of the Gro1 gene family. Sequence characterization of 13 members of the Gro1 gene family revealed putative regulatory elements and a variable microsatellite in the promoter region, insertion of a retrotransposon-like element in the first intron, and a stop codon in the NB coding region of some genes. Sequence analysis of RT-PCR products showed that Gro1-4 is expressed, among other members of the family including putative pseudogenes, in non-infected roots of nematode-resistant plants. RT-PCR also demonstrated that members of the Gro1 gene family are expressed in most potato tissues.

  2. Biofilm Formation Potential of Heat-Resistant Escherichia coli Dairy Isolates and the Complete Genome of Multidrug-Resistant, Heat-Resistant Strain FAM21845.

    Science.gov (United States)

    Marti, Roger; Schmid, Michael; Kulli, Sandra; Schneeberger, Kerstin; Naskova, Javorka; Knøchel, Susanne; Ahrens, Christian H; Hummerjohann, Jörg

    2017-08-01

    We tested the biofilm formation potential of 30 heat-resistant and 6 heat-sensitive Escherichia coli dairy isolates. Production of curli and cellulose, static biofilm formation on polystyrene (PS) and stainless steel surfaces, biofilm formation under dynamic conditions (Bioflux), and initial adhesion rates (IAR) were evaluated. Biofilm formation varied greatly between strains, media, and assays. Our results highlight the importance of the experimental setup in determining biofilm formation under conditions of interest, as correlation between different assays was often not a given. The heat-resistant, multidrug-resistant (MDR) strain FAM21845 showed the strongest biofilm formation on PS and the highest IAR and was the only strain that formed significant biofilms on stainless steel under conditions relevant to the dairy industry, and it was therefore fully sequenced. Its chromosome is 4.9 Mb long, and it harbors a total of five plasmids (147.2, 54.2, 5.8, 2.5, and 1.9 kb). The strain carries a broad range of genes relevant to antimicrobial resistance and biofilm formation, including some on its two large conjugative plasmids, as demonstrated in plate mating assays. IMPORTANCE In biofilms, cells are embedded in an extracellular matrix that protects them from stresses, such as UV radiation, osmotic shock, desiccation, antibiotics, and predation. Biofilm formation is a major bacterial persistence factor of great concern in the clinic and the food industry. Many tested strains formed strong biofilms, and especially strains such as the heat-resistant, MDR strain FAM21845 may pose a serious issue for food production. Strong biofilm formation combined with diverse resistances (some encoded on conjugative plasmids) may allow for increased persistence, coselection, and possible transfer of these resistance factors. Horizontal gene transfer may conceivably occur in the food production setting or the gastrointestinal tract after consumption. Copyright © 2017 Marti et al.

  3. Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.

    Science.gov (United States)

    Jain, Parul; Tar'an, Bunyamin

    2014-11-01

    Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

  4. ECG-triggered MDR-CT for the detection of pulmonary metastases

    International Nuclear Information System (INIS)

    Pauls, S.; Wahl, J.; Aschoff, A.J.; Brambs, H.J.; Fleiter, T.R.

    2003-01-01

    Purpose: Comparison of multidetector-row CT (MDR-CT) of the chest with and without ECG triggering for the detection of pulmonary metastases. Materials and Methods: Fifty patients with malignant tumors underwent CT of the chest. The unenhanced phase was performed with ECG-triggered MDR-CT and the contrast-enhanced phase with helical MDR-CT. The ECG-triggered and standard helical scans were interpreted in separate sessions, with the analysis determining the number and demarcation of the intrapulmonary nodules and the delineation of the mediastinal structure (rated 1 = excellent to 5 = poor). Results: ECG-MDR-CT images detected 38% more pulmonary nodules than MDR-CT. The detection rate for tumors [de

  5. Multidrug resistance 1 gene polymorphisms may determine Crohn's disease behavior in patients from Rio de Janeiro

    Directory of Open Access Journals (Sweden)

    Ana Teresa P. Carvalho

    2014-01-01

    Full Text Available OBJECTIVES: Conflicting data from studies on the potential role of multidrug resistance 1 gene polymorphisms in inflammatory bowel disease may result from the analysis of genetically and geographically distinct populations. Here, we investigated whether multidrug resistance 1 gene polymorphisms are associated with inflammatory bowel diseases in patients from Rio de Janeiro. METHODS: We analyzed 123 Crohn's disease patients and 83 ulcerative colitis patients to determine the presence of the multidrug resistance 1 gene polymorphisms C1236T, G2677T and C3435T. In particular, the genotype frequencies of Crohn's disease and ulcerative colitis patients were analyzed. Genotype-phenotype associations with major clinical characteristics were established, and estimated risks were calculated for the mutations. RESULTS: No significant difference was observed in the genotype frequencies of the multidrug resistance 1 G2677T/A and C3435T polymorphisms between Crohn's disease and ulcerative colitis patients. In contrast, the C1236T polymorphism was significantly more common in Crohn's disease than in ulcerative colitis (p = 0.047. A significant association was also found between the multidrug resistance 1 C3435T polymorphism and the stricturing form of Crohn's disease (OR: 4.13; p = 0.009, whereas no association was found with penetrating behavior (OR: 0.33; p = 0.094. In Crohn's disease, a positive association was also found between the C3435T polymorphism and corticosteroid resistance/refractoriness (OR: 4.14; p = 0.010. However, no significant association was found between multidrug resistance 1 gene polymorphisms and UC subphenotypic categories. CONCLUSION: The multidrug resistance 1 gene polymorphism C3435T is associated with the stricturing phenotype and an inappropriate response to therapy in Crohn's disease. This association with Crohn's disease may support additional pathogenic roles for the multidrug resistance 1 gene in regulating gut

  6. Multidrug resistant commensal Escherichia coli in animals and its impact for public health

    Directory of Open Access Journals (Sweden)

    Ama eSzmolka

    2013-09-01

    Full Text Available After the era of plentiful antibiotics we are alarmed by the increasing number of antibiotic resistant strains. The genetic flexibility and adaptability of E. coli to constantly changing environments allows to acquire a great number of antimicrobial resistance mechanisms. Commensal strains of E. coli as versatile residents of the lower intestine are also repeatedly challenged by antimicrobial pressures during the lifetime of their host. As a consequence, commensal strains acquire the respective resistance genes, and/or develop resistant mutants in order to survive and maintain microbial homeostasis in the lower intestinal tract. Thus, commensal E. coli strains are regarded as indicators of antimicrobial load on their hosts. This chapter provides a short historic background of the appearance and presumed origin and transfer of antimicrobial resistance genes in commensal intestinal E. coli of animals with comparative information on their pathogenic counterparts. The dynamics, development and ways of evolution of resistance in the E. coli populations differ according to hosts, resistance mechanisms and antimicrobial classes used. The most frequent tools of E. coli against a variety of antimicrobials are the efflux pumps and mobile resistance mechanisms carried by plasmids and/or other transferable elements. The emergence of hybrid plasmids (both resistance and virulence among E. coli is of further concern. Co-existence and co-transfer of these bad genes in this huge and most versatile in vivo compartment may represent an increased public health risk in the future. Significance of multidrug resistant (MDR commensal E. coli seem to be highest in the food animal industry, acting as reservoir for intra- and interspecific exchange and a source for spread of MDR determinants through contaminated food to humans. Thus, public health potential of MDR commensal E. coli of food animals can be a concern and needs monitoring and more molecular analysis in the

  7. Differential contributions of five ABC transporters to mutidrug resistance, antioxidion and virulence of Beauveria bassiana, an entomopathogenic fungus.

    Directory of Open Access Journals (Sweden)

    Ting-Ting Song

    Full Text Available Multidrug resistance (MDR confers agrochemical compatibility to fungal cells-based mycoinsecticdes but mechanisms involved in MDR remain poorly understood for entomopathogenic fungi, which have been widely applied as biocontrol agents against arthropod pests. Here we characterized the functions of five ATP-binding cassette (ABC transporters, which were classified to the subfamilies ABC-B (Mdr1, ABC-C (Mrp1 and ABC-G (Pdr1, Pdr2 and Pdr5 and selected from 54 full-size ABC proteins of Beauveria bassiana based on their main domain architecture, membrane topology and transcriptional responses to three antifungal inducers. Disruption of each transporter gene resulted in significant reduction in resistance to four to six of eight fungicides or antifungal drugs tested due to their differences in structure and function. Compared with wild-type and complemented (control strains, disruption mutants of all the five transporter genes became significantly less tolerant to the oxidants menadione and H₂O₂ based on 22-41% and 10-31% reductions of their effective concentrations required for the suppression of 50% colony growth at 25°C. Under a standardized spray, the killing actions of ΔPdr5 and ΔMrp1 mutants against Spodoptera litura second-instar larvae were delayed by 59% and 33% respectively. However, no significant virulence change was observed in three other delta mutants. Taken together, the examined five ABC transporters contribute differentially to not only the fungal MDR but antioxidant capability, a phenotype rarely associated with ABC efflux pumps in previous reports; at least some of them are required for the full virulence of B. bassiana, thereby affecting the fungal biocontrol potential. Our results indicate that ABC pump-dependent MDR mechanisms exist in entomopathogenic fungi as do in yeasts and human and plant pathogenic fungi.

  8. Frequency Of C3435 Mdr1 And A6896g Cyp3a5 Single Nucleotide Polymorphism in an Iranian Population and Comparison with Other Ethnic Groups

    Directory of Open Access Journals (Sweden)

    N. AZARPIRA

    2006-11-01

    Full Text Available Background:It is well recognized that different patients respond in different ways to medications. The inter-individual variations are greater than the intera- individual variations,a finding consistent with the notion that inheritance is a determinant of drug responses. The recent identification of genetic polymorphisms in drug-metabolizing enzymes and drug transporters led to the hypothesis that genetic factors may be implicated in this interindividual variation. Single nucleotide polymorphism in common metabolic pathway,cytochrome P450 and common transporter,multidrug resistance-1 gene are two important sites that might involve clinically significant genetic variations. Ethnicity greatly influences these genetic polymorphism distributions. Methods: We studied the inheritance patterns of polymorphisms for MDR1 and CYP3A5 genes in the Iranian population and compared its genotype and allele frequencies with 3 different ethnic groups: Caucasian (United Kingdom, Chinese and Japanese. Results: We found striking differences in the distribution of MDR allelic variants between Iranian,Japanese and Chinese (p<0.02 and similar between the Iranian and Caucasian population.(p=0.06.Almost 50% of Iranian and Caucasian individuals were homozygous carriers of the variant T allele compared with 32% of the Japanese and 43% of the Chinese (p<0.02.More than half of Iranian subjects have at least one T allele,with lower P-gp level in small intestine.We also noted dramatic differences in the CYP3A5 alleles and genotypes distribution between Iranian subjects with other compared populations.99% of Iranian individuals were homozygous carriers of the variant G allele compared with about 70% of the Chinese and Japanese and 19% of the Caucasian population. The G/G genotype has a very low level of active cytochrome P450 enzyme.Conclusion:Our results emphasize the role of ethnicity in interindividual variability of the pharmacokinetic and pharmacodynamic characteristics

  9. Phenotypic low-level isoniazid resistance as a marker to predict ethionamide resistance in Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Salima Qamar

    2017-01-01

    Full Text Available Background: Tuberculosis is one of the most prevalent diseases in Pakistan. Pakistan has the highest burden of MDR-TB in the Eastern Mediterranean region. Ethionamide is an anti-tuberculous drug frequently used to treat MDR-TB. Its drug susceptibility testing is not easily available in resource limited settings. Since it acts on the same target protein as isoniazid (inhA protein encoded by inhA gene, we sought to find out if phenotypic isoniazid resistance can be a marker of ethionamide resistance. Materials and Methods: This was a retrospective observational study conducted at the Aga Khan University hospital section of microbiology. Data was retrieved between 2011 to 2014 for all culture positive MTB strains. All culture positive MTB isolates with susceptibilities to isoniazid and ethionamide recorded were included in the study. Isoniazid and ethionamide susceptibilities were performed using agar proportion method on Middlebrook 7H10 agar. Rate of Ethionamide resistance between low-level isoniazid resistant, high level isoniazid resistant and isoniazid sensitive MTB was compared. Results: A total of 11,274 isolates were included in the study. A statistically significant association (P < 0.001 was found between Ethionamide resistance and low-level isoniazid resistance (26.6% as compared to high-level isoniazid resistance (8.85% and isoniazid sensitivity (0.71% in MTB strains. However this association was not seen in XDR-TB strains. Conclusion: Low level isoniazid resistance may be used as marker for phenotypic ethionamide resistance and hence guide clinicians' choice of antituberculous agent for MDR-TB in Pakistan. Further studies involving detection of genotypic association of isoniazid and ethionamide susceptibilities are needed before a final conclusion can be derived.

  10. Generation of Newly Discovered Resistance Gene mcr-1 Knockout in Escherichia coli Using the CRISPR/Cas9 System.

    Science.gov (United States)

    Sun, Lichang; He, Tao; Zhang, Lili; Pang, Maoda; Zhang, Qiaoyan; Zhou, Yan; Bao, Hongduo; Wang, Ran

    2017-07-28

    The mcr-1 gene is a new "superbug" gene discoverd in China in 2016 that makes bacteria highly resistant to the last-resort class of antibiotics. The mcr-1 gene raised serious concern about its possible global dissemination and spread. Here, we report a potential anti-resistant strategy using the CRISPR/Cas9-mediated approach that can efficiently induce mcr-1 gene knockout in Escherichia coli . Our findings suggested that using the CRISPR/Cas9 system to knock out the resistance gene mcr-1 might be a potential anti-resistant strategy. Bovine myeloid antimicrobial peptide-27 could help deliver plasmid pCas::mcr targeting specific DNA sequences of the mcr-1 gene into microbial populations.

  11. Use of generalized ordered logistic regression for the analysis of multidrug resistance data.

    Science.gov (United States)

    Agga, Getahun E; Scott, H Morgan

    2015-10-01

    Statistical analysis of antimicrobial resistance data largely focuses on individual antimicrobial's binary outcome (susceptible or resistant). However, bacteria are becoming increasingly multidrug resistant (MDR). Statistical analysis of MDR data is mostly descriptive often with tabular or graphical presentations. Here we report the applicability of generalized ordinal logistic regression model for the analysis of MDR data. A total of 1,152 Escherichia coli, isolated from the feces of weaned pigs experimentally supplemented with chlortetracycline (CTC) and copper, were tested for susceptibilities against 15 antimicrobials and were binary classified into resistant or susceptible. The 15 antimicrobial agents tested were grouped into eight different antimicrobial classes. We defined MDR as the number of antimicrobial classes to which E. coli isolates were resistant ranging from 0 to 8. Proportionality of the odds assumption of the ordinal logistic regression model was violated only for the effect of treatment period (pre-treatment, during-treatment and post-treatment); but not for the effect of CTC or copper supplementation. Subsequently, a partially constrained generalized ordinal logistic model was built that allows for the effect of treatment period to vary while constraining the effects of treatment (CTC and copper supplementation) to be constant across the levels of MDR classes. Copper (Proportional Odds Ratio [Prop OR]=1.03; 95% CI=0.73-1.47) and CTC (Prop OR=1.1; 95% CI=0.78-1.56) supplementation were not significantly associated with the level of MDR adjusted for the effect of treatment period. MDR generally declined over the trial period. In conclusion, generalized ordered logistic regression can be used for the analysis of ordinal data such as MDR data when the proportionality assumptions for ordered logistic regression are violated. Published by Elsevier B.V.

  12. Occurrence of integrons and resistance genes among sulphonamide-resistant Shigella spp. from Brazil

    DEFF Research Database (Denmark)

    Peirano, G.; Agersø, Yvonne; Aarestrup, Frank Møller

    2005-01-01

    Objectives: To determine the occurrence of class 1 and 2 integrons and antimicrobial resistance genes among sulphonamide-resistant Shigella strains isolated in Brazil during 1999-2003. Methods: Sixty-two Shigella (Shigella flexneri, n = 47 and Shigella sonnei, n = 15) were tested against 21...... antimicrobial agents. The presence of integrons classes 1 and 2 and antimicrobial resistance genes was investigated by PCR using specific primers. Results: A total of eight antimicrobial resistance profiles were identified, with the profile of resistance to sulfamethoxazole, trimethoprim, spectinomycin...... of 2214 bp harbouring a gene cassette array conferring resistance to trimethoprim, streptothricin and spectinomycin/streptomycin. The genes coding for resistance to chloramphenicol (catA1), tetracycline [tet(A) and tet(B)] and ampicillin (bla(OXA) and bla(TEM)), were detected in resistant strains...

  13. MicroRNA Expression Profiles Associated with Development of Drug Resistance in Ehrlich Ascites Tumor Cells

    DEFF Research Database (Denmark)

    Husted, Susanne; Søkilde, Rolf; Rask, Lene

    2011-01-01

    Multidrug resistance (MDR) poses a major obstacle to successful chemotherapeutic treatment of cancer, and often involves multiple genes, which may be regulated post-transcriptionally by microRNAs (miRNAs). The purpose of the present study was therefore to identify any resistance-associated change...

  14. Genetic and physical mapping of homologues of the virus resistance gene Rx1 and the cyst nematode resistance gene Gpa2 in potato.

    Science.gov (United States)

    Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A

    2003-05-01

    Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.

  15. Multiple drug resistant carbapenemases producing Acinetobacter baumannii isolates harbours multiple R-plasmids

    Directory of Open Access Journals (Sweden)

    Rajagopalan Saranathan

    2014-01-01

    Full Text Available Background & objectives: The nosocomial human pathogen Acinetobacter baumannii has high propensity to develop resistance to antimicrobials and to become multidrug resistant (MDR, consequently complicating the treatment. This study was carried out to investigate the presence of resistant plasmids (R-plasmids among the clinical isolates of A. baumannii. In addition, the study was performed to check the presence of common β-lactamases encoding genes on these plasmids. Methods: A total of 55 clinical isolates of A. baumannii were included in the study and all were subjected to plasmid DNA isolation, followed by PCR to check the presence of resistance gene determinants such as blaOXA-23 , blaOXA-51, blaOXA-58 and blaIMP-1 on these plasmids that encode for oxacillinase (OXA and metallo-β-lactamase (MBL type of carbapenemases. Plasmid curing experiments were carried out on selected isolates using ethidium bromide and acridine orange as curing agents and the antibiotic resistance profiles were evaluated before and after curing. Results: All the isolates were identified as A. baumannii by 16SrDNA amplification and sequencing. Plasmid DNA isolated from these isolates showed the occurrence of multiple plasmids with size ranging from 500bp to ≥ 25 kb. The percentage of blaOXA-51 and blaOXA-23 on plasmids were found to be 78 and 42 per cent, respectively and 20 isolates (36% carried blaIMP-1 gene on plasmids. Significant difference was observed in the antibiograms of plasmid cured isolates when compared to their parental ones. The clinical isolates became susceptible to more than two antibiotic classes after curing of plasmids indicating plasmid borne resistance. Interpretation & conclusions: Our study determined the plasmid mediated resistance mechanisms and occurrence of different resistance genes on various plasmids isolated from MDR A. baumannii. The present findings showed the evidence for antibiotic resistance mediated through multiple plasmids in

  16. Frequency of canine nt230(del4) MDR1 mutation in prone pure breeds, their crosses and mongrels in Israel - insights from a worldwide comparative perspective.

    Science.gov (United States)

    Dekel, Yaron; Machluf, Yossy; Stoler, Aviad; Aderet, Arava; Baumel, Daniel; Kellerman, Efrat; Plotsky, Yoram; Noked Partouche, Oshrat; Elhalal, Gal; Ben-Shlomo, Izhar; Bercovich, Dani

    2017-11-13

    Sensitivity to macrocyclic lactones, which are commonly used in veterinary clinics, was first found in Rough Collies, and was attributed in 2001 to a 4 bp deletion in the MDR1 gene. The list of affected breeds currently includes 13 breeds. Researchers from different countries and continents examined the allelic frequencies of the nt230(del4) MDR1 mutation, emphasizing the clinical importance of this test not only to mutation-prone dogs, but also to their crosses and mongrels, since treatment of a deletion carrier with these compounds may lead to its death. In this study, the allelic frequencies of nt230(del4) MDR1 mutation in affected breeds, their crosses, unrelated pure breeds and mongrels are reported for the state of Israel (n = 1416 dogs). The Israeli data were compared with reports from the US, Europe, UK, Australia and Japan. The allelic frequencies of nt230(del4) MDR1 mutation in Israel for Australian, Swiss and German Shepherds (31%, 17% and 2.4%, respectively) are similar to the corresponding frequencies worldwide, much higher for Border Collies (4.8%), twice lower for Rough Collies (28%, compared to 55% or more elsewhere), and ~1% for mongrels. The frequencies for crosses of Australian Shepherd and Border Collies in Israel are 4 and 1.6 times lower, respectively, compared to the frequencies for the respective pure breeds. This work, that for the first time presents the frequency of nt230(del4) MDR1 mutation in Israel, along with a worldwide survey, has implications for clinicians, owners and breeders of sheepdogs and their crosses and supports the need for extra care in treatment and in future breeding. Of note, the relative proportion of affected breeds, in the overall tested dogs, might be higher than their actual proportion in Israel due to directed samples collection by veterinarians for clinical purposes, as these are mainly limited to certain affected breeds or dogs that resemble them.

  17. Investigating of four main carbapenem-resistance mechanisms in high-level carbapenem resistant Pseudomonas aeruginosa isolated from burn patients

    Directory of Open Access Journals (Sweden)

    Soodabeh Rostami

    2018-02-01

    Conclusion: Emerging antimicrobial resistance in burn wound bacterial pathogens is a serious therapeutic challenge for clinicians. In the present study, most of the isolates were MDR. This finding indicated an alarming spread of resistant isolates and suggested that infection control strategies should be considered. Resistance to carbapenems is influenced by several factors, not all of which were evaluated in our study; however, the results showed that production of MBLs and overexpression of the mexB gene were the most frequent mechanisms in carbapenem-resistant isolates.

  18. Role of MexAB-OprM and MexXY-OprM efflux pumps and class 1 integrons in resistance to antibiotics in burn and Intensive Care Unit isolates of Pseudomonas aeruginosa.

    Science.gov (United States)

    Goli, Hamid Reza; Nahaei, Mohammad Reza; Ahangarzadeh Rezaee, Mohammad; Hasani, Alka; Samadi Kafil, Hossein; Aghazadeh, Mohammad; Nikbakht, Mojtaba; Khalili, Younes

    2017-10-06

    The overexpression of efflux pumps and existence of class 1 integrons are the most important mechanisms that contribute to antimicrobial resistance in Pseudomonas aeruginosa especially in burn and Intensive Care Units (ICUs). The present study evaluated the role of MexAB-OprM and MexXY-OprM efflux pumps and class 1 integrons in resistance to antibiotics in burn and ICU isolates of P. aeruginosa. Fifteen burn and forty-two ICU isolates were obtained from four hospitals in Northwest Iran. The isolates were identified and evaluated by the disk diffusion and agar dilution methods for determining antibiotic resistances. The presence of class 1 integrons and associated resistance gene cassettes were detected by PCR and sequencing of the products. The expression levels of efflux pumps were evaluated by phenotypic and genotypic (Quantitative Real-time PCR) methods. The isolates were genotyped by Random Amplified Polymorphic DNA Typing (RAPD-PCR). All burn isolates were integron positive and Multi-drug resistant (MDR), while 78.5% and 69% of ICU isolates were found as MDR and integron positive, respectively. The aadB gene was the most prevalent gene cassette (63.6%) followed by aacA4 (47.7%). Thirty-nine (68.4%) and 43 (75.4%) isolates exhibited an overexpression of MexAB-OprM and MexXY-OprM. Among burn isolates, 80% and 86.6% of them were mexB and mexY overexpressed, while 64.2% and 71.4% of ICU isolates exhibited mexB and mexY overexpression, correspondingly. The isolates were genotyped as 24 different RAPD profiles and were grouped into 15 clusters. The data suggested that class 1 integron had a more significant role than efflux pumps in resistance to beta-lactams and aminoglycosides in burn and ICUs except for gentamicin in burn isolates. Based on our data, it is possible that efflux pumps were not the main cause of high-level resistance to antibiotics. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. Risk factors for MDR and XDR-TB in a tertiary referral hospital in India.

    Directory of Open Access Journals (Sweden)

    V Balaji

    Full Text Available BACKGROUND: India has a high burden of drug resistant TB, although there are few data on XDR-TB. Although XDR-TB has existed previously in India, the definition has not been widely applied, and surveillance using second line drug susceptibility testing has not been performed. Our objective was to analyze clinical and demographic risk factors associated with isolation of MDR and XDR TB as compared to susceptible controls, at a tertiary center. METHODOLOGY/FINDINGS: Retrospective chart review based on positive cultures isolated in a high volume mycobacteriology laboratory between 2002 and 2007. 47 XDR, 30 MDR and 117 susceptible controls were examined. Drug resistant cases were less likely to be extrapulmonary, and had received more previous treatment regimens. Significant risk factors for XDR-TB included residence outside the local state (OR 7.43, 3.07-18.0 and care costs subsidized (OR 0.23, 0.097-0.54 in bivariate analysis and previous use of a fluoroquinolone and injectable agent (other than streptomycin (OR 7.00, 95% C.I. 1.14-43.03 and an initial treatment regimen which did not follow national guidelines (OR 5.68, 1.24-25.96 in multivariate analysis. Cavitation and HIV did not influence drug resistance. CONCLUSIONS/SIGNIFICANCE: There is significant selection bias in the sample available. Selection pressure from previous treatment and an inadequate initial regimen increases risk of drug resistance. Local patients and those requiring financial subsidies may be at lower risk of XDR-TB.

  20. Enzyme-mediated formulation of stable elliptical silver nanoparticles tested against clinical pathogens and MDR bacteria and development of antimicrobial surgical thread.

    Science.gov (United States)

    Thapa, Rupak; Bhagat, Chintan; Shrestha, Pragya; Awal, Suvash; Dudhagara, Pravin

    2017-05-16

    Silver nanoparticles (AgNPs) are believed to be emerging tool against various infectious diseases including multi-drug resistant (MDR) bacteria. In the present study, in vitro synthesis of AgNPs was optimized using 1:50 ratio of macerozyme (25 μg/μl) and 1 mM AgNO 3 incubated at 80 °C for 8 h. AgNPs were characterized by UV-Visible spectroscopy, dynamic light scattering (DLS), scanning electron microscopy, energy-dispersive X-ray spectroscopy, transmission electron microscopy (TEM) and X-ray diffraction (XRD). Characterization studies suggest the synthesis of elliptical, stable and crystalline AgNPs with an average size of 38.26 ± 0.4 nm calculated using TEM. The XRD pattern revealed the face-centered-cubic (fcc) form of metallic silver. Good shape integrity and dispersion of AgNPs after 1 year of incubation confirmed their stability. AgNPs were exibited the antimicrobial property against ten pathogenic bacteria, three molds and one yeast. The AgNPs also revealed remarkable antimicrobial activity against three MDR strains i.e. Extended spectrum beta-lactamase positive Escherichia coli, Staphylococcus aureus (MRSA) and Teicoplanin resistant Streptococcus Pneumoniae. The AgNPs coated surgical threads (suture) were revealed the remarkble antibacterial activity against three MDR strains. This is the first report to synthesize antimicrobial elliptical AgNPs using enzymes. The results suggest the possibilities to develop the nanoparticles coated antimicrobial medical fabric to combat against MDR infection.

  1. The impact of R1and R3a genes on tuber resistance to late blight of the potato breeding clones

    Directory of Open Access Journals (Sweden)

    Zoteyeva Nadezhda

    2016-04-01

    Full Text Available Potato breeding clones were evaluated for resistance to late blight (agent Phytophthora infestans using tuber inoculation tests and for presence of the resistance alleles of R1 and R3a genes in polymerase chain reaction tests. Among clones tested those expressing high, moderate and low resistance were identified. The data were analysed for the impact of R1 and R3a genes on tuber resistance to late blight in tested plant material. In previous evaluations performed on smaller amount of clones the tuber resistance levels significantly depended on presence/absence of the resistance allele of R3a gene and did not depend on presence of R1 gene allele. In the current study the statistical analyses did not prove the significant difference in resistance levels depending on presence of the resistance alleles, neither of R1 gene, nor of R3a gene. Tuber resistant clones bearing R3a gene resistance alleles still noticeably prevailed over the clones bearing the alleles of R1 gene as well as over the clones bearing the no resistance alleles of both genes. In several cases the resistance of clones with detected resistance allele of R1 gene was higher compared to those derived from the same crosses and showing amplification of the allele of R3a gene or those with no resistance alleles. Clones accumulating the resistance alleles of both (R1 and R3a genes expressed high tuber resistance accompanied by necrotic reaction.

  2. Modification of barley powdery mildew resistance controlled by the gene M1-a212

    International Nuclear Information System (INIS)

    Torp, J.; Joergensen, J.H.

    1989-01-01

    Full text: The barley line Sultan 5 carries resistance gene M1-a12. Seeds were treated with EMS or NaN 3 . Among 10381 M 1 -spike progenies inoculated with M1-a12 a-virulent isolates of Erysiphe graminis, 25 segregated for less resistant infection type. Among 10 mutants analyzed, 9 had mutant allels of M1-a12 and one had a recessive mutant gene in a different locus acting as a ''suppressor'' of M1-a12. (author)

  3. Piperine activates human pregnane X receptor to induce the expression of cytochrome P450 3A4 and multidrug resistance protein 1

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yue-Ming; Lin, Wenwei; Chai, Sergio C.; Wu, Jing; Ong, Su Sien [Department of Chemical Biology and Therapeutics, St. Jude Children' s Research Hospital, 262 Danny Thomas Place, Memphis, TN 38105 (United States); Schuetz, Erin G. [Department of Pharmaceutical Sciences, St. Jude Children' s Research Hospital, 262 Danny Thomas Place, Memphis, TN 38105 (United States); Chen, Taosheng, E-mail: taosheng.chen@stjude.org [Department of Chemical Biology and Therapeutics, St. Jude Children' s Research Hospital, 262 Danny Thomas Place, Memphis, TN 38105 (United States)

    2013-10-01

    Activation of the pregnane X receptor (PXR) and subsequently its target genes, including those encoding drug transporters and metabolizing enzymes, while playing substantial roles in xenobiotic detoxification, might cause undesired drug-drug interactions. Recently, an increased awareness has been given to dietary components for potential induction of diet–drug interactions through activation of PXR. Here, we studied, whether piperine (PIP), a major component extracted from the widely-used daily spice black pepper, could induce PXR-mediated expression of cytochrome P450 3A4 (CYP3A4) and multidrug resistance protein 1 (MDR1). Our results showed that PIP activated human PXR (hPXR)-mediated CYP3A4 and MDR1 expression in human hepatocytes, intestine cells, and a mouse model; PIP activated hPXR by recruiting its coactivator SRC-1 in both cellular and cell-free systems; PIP bound to the hPXR ligand binding domain in a competitive ligand binding assay in vitro. The dichotomous effects of PIP on induction of CYP3A4 and MDR1 expression observed here and inhibition of their activity reported elsewhere challenges the potential use of PIP as a bioavailability enhancer and suggests that caution should be taken in PIP consumption during drug treatment in patients, particularly those who favor daily pepper spice or rely on certain pepper remedies. - Highlights: • Piperine induces PXR-mediated CYP3A4 and MDR1 expression. • Piperine activates PXR by binding to PXR and recruiting coactivator SRC-1. • Piperine induces PXR activation in vivo. • Caution should be taken in piperine consumption during drug treatment.

  4. Breast cancer resistance protein is localized at the plasma membrane in mitoxantrone- and topotecan-resistant cell lines

    NARCIS (Netherlands)

    Scheffer, GL; Maliepaard, M; Pijnenborg, ACLM; van Gastelen, MA; Schroeijers, AB; Allen, JD; Ross, DD; van der Valk, P; Dalton, WS; Schellens, JHM; Scheper, RJ; de Jong, MC

    2000-01-01

    Tumor cells may display a multidrug resistant phenotype by overexpression of ATP-binding cassette transporters such as multidrug resistance (,MDR1) P-glycoprotein, multidrug resistance protein 1 (MRP1), and breast cancer resistance protein (BCRP). The presence of BCRP has thus far been reported

  5. Should all suspected tuberculosis cases in high income countries be tested with GeneXpert?

    Science.gov (United States)

    Vella, Venanzio; Broda, Agnieszka; Drobniewski, Francis

    2018-05-01

    In countries with a low incidence of multidrug-resistant tuberculosis (MDR-TB), universal testing with GeneXpert might not be always cost-effective. This study provides hospital managers in low MDR-TB incidence countries with criteria on when decentralised universal GeneXpert testing would make sense. The alternatives taken into consideration include: universal microbiological culture and drug susceptibility testing (DST) only (comparator); as above but with concurrent centralized GeneXpert in a referral laboratory vs a decentralized GeneXpert system in every hospital to test smear-positive cases only; as above but testing all samples with GeneXpert regardless of smear status. The parameters were from the national TB statistics for England and from a systematic review. Decentralised GeneXpert to test any suspected TB case was the most cost-effective option when 6% or more TB patients belonged to the high-risk group, defined as previous TB diagnosis and or being born in countries with a high MDR-TB incidence. Hospital managers in England and other low MDR-TB incidence countries could use these findings to decide when to invest in GeneXpert or other molecular diagnostics with similar performance criteria for TB diagnostics. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. In vitro activity of rifampicin alone and in combination with imipenem against multidrug-resistant Acinetobacter baumannii harboring the blaOXA-72 resistance gene.

    Science.gov (United States)

    Majewski, Piotr; Wieczorek, Piotr; Ojdana, Dominika; Sacha, Paweł Tomasz; Wieczorek, Anna; Tryniszewska, Elżbieta Anna

    2014-04-01

    The growing incidence of multidrug resistance (MDR) in bacteria is an emerging challenge in the treatment of infections. Acinetobacter baumannii is an opportunistic pathogen prone to exhibit MDR that contributes significantly to nosocomial infections, particularly in severely ill patients. Thus, we performed research on rifampicin activity against selected MDR OXA-72 carbapenemase-producing A. baumannii strains. Since it is widely accepted that rifampicin should not be used as monotherapy in order to avoid the rapid development of rifampicin resistance, we evaluated the efficacy of combination therapy with imipenem. Minimal inhibitory concentrations (MICs) of both rifampicin and imipenem were determined by use of the broth microdilution method. Evaluations of the interactions between rifampicin and imipenem were performed by analysis of the fractional inhibitory concentration index (∑FIC), determined using the checkerboard titration method. All tested isolates showed full susceptibility to rifampicin. The checkerboard method revealed synergism in 5 isolates (29%) and an additive effect in another 5 isolates (29%); no difference was reported in the remaining 7 isolates (41%). Strains moderately resistant to imipenem (MIC ≤ 64 mg/l) tended to show synergy or additive interaction. We conclude that in vitro synergism or an additive interaction between rifampicin and imipenem most likely occurs in A. baumannii strains showing moderate resistance to imipenem (MIC ≤ 64 mg/l). Moreover, utilizing this combination in the therapy of infections caused by strains exhibiting higher levels of resistance (MIC > 64 mg/l) is not recommended since in this setting imipenem could not prevent the development of rifampicin resistance.

  7. Frequent Multidrug-Resistant Acinetobacter baumannii Contamination of Gloves, Gowns, and Hands of Healthcare Workers

    Science.gov (United States)

    Morgan, Daniel J.; Liang, Stephen Y.; Smith, Catherine L.; Johnson, J. Kristie; Harris, Anthony D.; Furuno, Jon P.; Thom, Kerri A.; Snyder, Graham M.; Day, Hannah R.; Perencevich, Eli N.

    2010-01-01

    BACKGROUND Multidrug-resistant (MDR) gram-negative bacilli are important nosocomial pathogens. OBJECTIVE To determine the incidence of transmission of MDR Acinetobacter baumannii and Pseudomonas aeruginosa from patients to healthcare workers (HCWs) during routine patient care. DESIGN Prospective cohort study. SETTING Medical and surgical intensive care units. METHODS We observed HCWs who entered the rooms of patients colonized with MDR A. baumannii or colonized with both MDR A. baumannii and MDR P. aeruginosa. We examined their hands before room entry, their disposable gloves and/or gowns upon completion of patient care, and their hands after removal of gloves and/or gowns and before hand hygiene. RESULTS Sixty-five interactions occurred with patients colonized with MDR A. baumannii and 134 with patients colonized with both MDR A. baumannii and MDR P. aeruginosa. Of 199 interactions between HCWs and patients colonized with MDR A. baumannii, 77 (38.7% [95% confidence interval {CI}, 31.9%–45.5%]) resulted in HCW contamination of gloves and/or gowns, and 9 (4.5% [95% CI, 1.6%–7.4%]) resulted in contamination of HCW hands after glove removal before hand hygiene. Of 134 interactions with patients colonized with MDR P. aeruginosa, 11 (8.2% [95% CI, 3.6%–12.9%]) resulted in HCW contamination of gloves and/or gowns, and 1 resulted in HCW contamination of hands. Independent risk factors for contamination with MDR A. baumannii were manipulation of wound dressing (adjusted odds ratio [aOR], 25.9 [95% CI, 3.1–208.8]), manipulation of artificial airway (aOR, 2.1 [95% CI, 1.1–4.0]), time in room longer than 5 minutes (aOR, 4.3 [95% CI, 2.0–9.1]), being a physician or nurse practitioner (aOR, 7.4 [95% CI, 1.6–35.2]), and being a nurse (aOR, 2.3 [95% CI, 1.1–4.8]). CONCLUSIONS Gowns, gloves, and unwashed hands of HCWs were frequently contaminated with MDR A. baumannii. MDR A. baumannii appears to be more easily transmitted than MDR P. aeruginosa and perhaps more

  8. 40 CFR 174.513 - Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene); exemption from the...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Potato Leaf Roll Virus Resistance Gene... REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS Tolerances and Tolerance Exemptions § 174.513 Potato Leaf Roll... protectant Potato Leaf Roll Virus Resistance Gene (also known as orf1/orf2 gene) in or on all food...

  9. Assessment of trends of ofloxacin resistance in Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    J S Verma

    2011-01-01

    Full Text Available Purpose: Ofloxacin (OFX is one of the potent fluoroquinolone (FQ recommended to treat MDR-TB. Over a decade, the preexposure of this drug for the treatment of other bacterial infections has resulted in acquisition of FQ resistance among Mycobacterium tuberculosis strains. Considering this possibility, a study was undertaken in a tertiary care center in the capital city (India to assess the drug resistance trends of OFX among susceptible and multidrug resistant (MDR strains of M. tuberculosis. Materials and Methods: A total of 102 M. tuberculosis isolates (47 susceptible to first-line drugs and 55 MDR isolates were screened for susceptibility testing of OFX with a critical concentration of 2 μg/ml by Lowenstein Jensen (LJ proportion method. Results: The results showed 40 (85.1% isolates among 47 susceptible isolates and 34 (61.8% isolates among 55 MDR isolates, were found to be susceptible to OFX. Fisher′s exact test showed significant P-value (0.0136 demonstrating 1.377 fold (95% confidence interval increased risk to become resistant to OFX than susceptible isolates. These finding shows decreased OFX susceptibility is not only limited to MDR isolates but also increasingly seen in susceptible strains as a result of drug abuse. Conclusions: Our finding were not alarming, but highlights the general risk of acquiring resistance to OFX, jeopardizing the potential for these drugs to be used as second-line anti-TB agents in the management of drug-resistant TB and creating incurable TB strains .

  10. Prediction of Phenotypic Antimicrobial Resistance Profiles From Whole Genome Sequences of Non-typhoidal Salmonella enterica.

    Science.gov (United States)

    Neuert, Saskia; Nair, Satheesh; Day, Martin R; Doumith, Michel; Ashton, Philip M; Mellor, Kate C; Jenkins, Claire; Hopkins, Katie L; Woodford, Neil; de Pinna, Elizabeth; Godbole, Gauri; Dallman, Timothy J

    2018-01-01

    Surveillance of antimicrobial resistance (AMR) in non-typhoidal Salmonella enterica (NTS), is essential for monitoring transmission of resistance from the food chain to humans, and for establishing effective treatment protocols. We evaluated the prediction of phenotypic resistance in NTS from genotypic profiles derived from whole genome sequencing (WGS). Genes and chromosomal mutations responsible for phenotypic resistance were sought in WGS data from 3,491 NTS isolates received by Public Health England's Gastrointestinal Bacteria Reference Unit between April 2014 and March 2015. Inferred genotypic AMR profiles were compared with phenotypic susceptibilities determined for fifteen antimicrobials using EUCAST guidelines. Discrepancies between phenotypic and genotypic profiles for one or more antimicrobials were detected for 76 isolates (2.18%) although only 88/52,365 (0.17%) isolate/antimicrobial combinations were discordant. Of the discrepant results, the largest number were associated with streptomycin (67.05%, n = 59). Pan-susceptibility was observed in 2,190 isolates (62.73%). Overall, resistance to tetracyclines was most common (26.27% of isolates, n = 917) followed by sulphonamides (23.72%, n = 828) and ampicillin (21.43%, n = 748). Multidrug resistance (MDR), i.e., resistance to three or more antimicrobial classes, was detected in 848 isolates (24.29%) with resistance to ampicillin, streptomycin, sulphonamides and tetracyclines being the most common MDR profile ( n = 231; 27.24%). For isolates with this profile, all but one were S . Typhimurium and 94.81% ( n = 219) had the resistance determinants bla TEM-1, strA-strB, sul2 and tet (A). Extended-spectrum β-lactamase genes were identified in 41 isolates (1.17%) and multiple mutations in chromosomal genes associated with ciprofloxacin resistance in 82 isolates (2.35%). This study showed that WGS is suitable as a rapid means of determining AMR patterns of NTS for public health surveillance.

  11. Experience with LDR and MDR brachytherapy for cervical cancer

    International Nuclear Information System (INIS)

    Okawa, Tomohiko; Okawa, Midori-Kita; Kaneyasu, Yuko; Karasawa, Kumiko; Fukuhara, Noboru

    1996-01-01

    As the brachytherapy dose-rate increases, it is necessary to reduce the total dose or to increase the fraction number with reducing the fraction dose in order not to increase the incidence of the late effect. With the introduction to the Tokyo Women's Medical College, Hospital of a remote afterloading system of Selectron - MDR, delivering dose-rate to point A became approximately twice of that with our classical cesium LDR manual afterloading technique. Material and Methods: Between 1987 to 1993 a total of, previously untreated 74 patients with cervical cancer received MDR brachytherapy using a Selection - MDR. This analysis is therefore of those patients series who underwent radical radioradiotherapy with MDR, 1987-1993, in comparison with the 347 cases who were treated with classical manual LDR afterloading machine, 1969-1986. The treatment was a brachytherapy during external radiotherapy and dos-rate at point A was 160-180 cGy/hour with MDR and 80-90 cGy/hour with LDR. The mean fraction dose was 800-1000 cGy by MDR and 1000-1200 cGy by LDR and fraction number was increased 1-2times in the MDR group with no change of a total dose at point A. Results: The mean age was 63.3 years in the MDR group and 60.2 in the LDR group. In the MDR group, 4 patients were at stage I, 16 stage II, 32 stage III, and 22 stage IV. In the LDR group, 32 were at stage I, 83 stage II, 183 stage III, and 49 stage IV. The medical rate was not significantly different between two groups. The tumor response by manual examination one month after radiotherapy showed no significant difference. The 5-year survival rate for the MDR and LDR groups were 100% : 78% at stage I, 61% : 71% at stage II and 52% : 53% at stage III, with no significant differences. Late complications by severity with grade II-III according to Kottureire's classification were not significantly different in the rectum or bladder. These results suggested that MDR brachytherapy was useful for the patients' QOL as it reduced the

  12. Persistence of Multidrug-Resistant Acinetobacter baumannii Isolates Harboring blaOXA-23 and bap for 5 Years.

    Science.gov (United States)

    Sung, Ji Youn; Koo, Sun Hoe; Kim, Semi; Kwon, Gye Cheol

    2016-08-28

    The emergence and dissemination of carbapenemase-producing Acinetobacter baumannii isolates have been reported worldwide, and A. baumannii isolates harboring blaOXA-23 are often resistant to various antimicrobial agents. Antimicrobial resistance can be particularly strong for biofilm-forming A. baumannii isolates. We investigated the genetic basis for carbapenem resistance and biofilm-forming ability of multidrug-resistant (MDR) clinical isolates. Ninety-two MDR A. baumannii isolates were collected from one university hospital located in the Chungcheong area of Korea over a 5-year period. Multiplex PCR and DNA sequencing were performed to characterize carbapenemase and bap genes. Clonal characteristics were analyzed using REP-PCR. In addition, imaging and quantification of biofilms were performed using a crystal violet assay. All 92 MDR A. baumannii isolates involved in our study contained the blaOXA-23 and bap genes. The average absorbance of biomass in Bap-producing strains was much greater than that in non-Bap-producing strains. In our study, only three REP-PCR types were found, and the isolates showing type A or type B were found more than 60 times among unique patients during the 5 years of surveillance. These results suggest that the isolates have persisted and colonized for 5 years, and biofilm formation ability has been responsible for their persistence and colonization.

  13. Cisplatin Resistant Spheroids Model Clinically Relevant Survival Mechanisms in Ovarian Tumors.

    Directory of Open Access Journals (Sweden)

    Winyoo Chowanadisai

    Full Text Available The majority of ovarian tumors eventually recur in a drug resistant form. Using cisplatin sensitive and resistant cell lines assembled into 3D spheroids we profiled gene expression and identified candidate mechanisms and biological pathways associated with cisplatin resistance. OVCAR-8 human ovarian carcinoma cells were exposed to sub-lethal concentrations of cisplatin to create a matched cisplatin-resistant cell line, OVCAR-8R. Genome-wide gene expression profiling of sensitive and resistant ovarian cancer spheroids identified 3,331 significantly differentially expressed probesets coding for 3,139 distinct protein-coding genes (Fc >2, FDR < 0.05 (S2 Table. Despite significant expression changes in some transporters including MDR1, cisplatin resistance was not associated with differences in intracellular cisplatin concentration. Cisplatin resistant cells were significantly enriched for a mesenchymal gene expression signature. OVCAR-8R resistance derived gene sets were significantly more biased to patients with shorter survival. From the most differentially expressed genes, we derived a 17-gene expression signature that identifies ovarian cancer patients with shorter overall survival in three independent datasets. We propose that the use of cisplatin resistant cell lines in 3D spheroid models is a viable approach to gain insight into resistance mechanisms relevant to ovarian tumors in patients. Our data support the emerging concept that ovarian cancers can acquire drug resistance through an epithelial-to-mesenchymal transition.

  14. Selection of Plasmodium falciparum multidrug resistance gene 1 alleles in asexual stages and gametocytes by artemether-lumefantrine in Nigerian children with uncomplicated falciparum malaria.

    Science.gov (United States)

    Happi, C T; Gbotosho, G O; Folarin, O A; Sowunmi, A; Hudson, T; O'Neil, M; Milhous, W; Wirth, D F; Oduola, A M J

    2009-03-01

    We assessed Plasmodium falciparum mdr1 (Pfmdr1) gene polymorphisms and copy numbers as well as P. falciparum Ca(2+) ATPase (PfATPase6) gene polymorphisms in 90 Nigerian children presenting with uncomplicated falciparum malaria and enrolled in a study of the efficacy of artemether-lumefantrine (AL). The nested PCR-restriction fragment length polymorphism and the quantitative real-time PCR methodologies were used to determine the alleles of the Pfmdr1 and PfATPase6 genes and the Pfmdr1 copy number variation, respectively, in patients samples collected prior to treatment and at the reoccurrence of parasites during a 42-day follow-up. The Pfmdr1 haplotype 86N-184F-1246D was significantly associated (P copy of the Pfmdr1 gene and the wild-type allele (L89) at codon 89 of the PfATPase6 gene. These findings suggest that polymorphisms in the Pfmdr1 gene are under AL selection pressure. Pfmdr1 polymorphisms may result in reduction in the therapeutic efficacy of this newly adopted combination treatment for uncomplicated falciparum malaria in Saharan countries of Africa.

  15. Presence of the resistance genes vanC1 and pbp5 in phenotypically vancomycin and ampicillin susceptible Enterococcus faecalis.

    Science.gov (United States)

    Schwaiger, Karin; Bauer, Johann; Hörmansdorfer, Stefan; Mölle, Gabriele; Preikschat, Petra; Kämpf, Peter; Bauer-Unkauf, Ilse; Bischoff, Meike; Hölzel, Christina

    2012-08-01

    Ampicillin and vancomycin are important antibiotics for the therapy of Enterococcus faecalis infections. The ampicillin resistance gene pbp5 is intrinsic in Enterococcus faecium. The vanC1 gene confers resistance to vancomycin and serves as a species marker for Enterococcus gallinarum. Both genes are chromosomally located. Resistance to ampicillin and vancomycin was determined in 484 E. faecalis of human and porcine origin by microdilution. Since E. faecalis are highly skilled to acquire resistance genes, all strains were investigated for the presence of pbp5 (and, in positive strains, for the penicillin-binding protein synthesis repressor gene psr) and vanC1 (and, in positive strains, for vanXYc and vanT) by using polymerase chain reaction (PCR). One porcine and one human isolate were phenotypically resistant to ampicillin; no strain was vancomycin resistant. Four E. faecalis (3/1 of porcine/human origin) carried pbp5 (MIC=1 mg/L), and four porcine strains were vanC1 positive (minimum inhibitory concentration [MIC]=1 mg/L). Real-time reverse transcriptase (RT)-PCR revealed that the genes were not expressed. The psr gene was absent in the four pbp5-positive strains; the vanXYc gene was absent in the four vanC1-positive strains. However, vanT of the vanC gene cluster was detected in two vanC1-positive strains. To our knowledge, this is the first report on the presence of pbp5, identical with the "E. faecium pbp5 gene," and of vanC1/vanT in E. faecalis. Even if resistance is not expressed in these strains, this study shows that E. faecalis have a strong ability to acquire resistance genes-and potentially to spread them to other bacteria. Therefore, close monitoring of this species should be continued.

  16. Expression profiling of the VKORC1 and Calumenin gene in a Danish strain of bromadiolone-resistant Norway rats

    DEFF Research Database (Denmark)

    Markussen, Mette Drude; Heiberg, Ann-Charlotte; Fredholm, Merete

    2008-01-01

    in European strains of Norway rats while high hepatic levels of calumenin has been suggested responsible for resistance in an US strain of rats. To characterize the resistance mechanism in a Danish strain of bromadiolone-resistant Norway rats (with an Y139C-VKORC1 mutation), we compared VKORC1 and Calumenin......Anticoagulant resistance in Norway rats (Rattus norvegicus) has been associated with two genes, VKORC1 and Calumenin, which encodes proteins essential to the vitamin K-dependent gamma-carboxylation system. Mutations in the VKORC1 gene are considered the genetic basis for anticoagulant resistance...... liver gene expression between resistant and anticoagulant-susceptible rats upon saline and bromadiolone-administration. The resistant male and female rats had significantly lower constitutive VKORC1 expression (57 % and 63 %) compared to the susceptible rats (100 %) while the constitutive Calumenin...

  17. Small-molecule synthetic compound norcantharidin reverses multi-drug resistance by regulating Sonic hedgehog signaling in human breast cancer cells.

    Directory of Open Access Journals (Sweden)

    Yu-Jen Chen

    Full Text Available Multi-drug resistance (MDR, an unfavorable factor compromising treatment efficacy of anticancer drugs, involves upregulated ATP binding cassette (ABC transporters and activated Sonic hedgehog (Shh signaling. By preparing human breast cancer MCF-7 cells resistant to doxorubicin (DOX, we examined the effect and mechanism of norcantharidin (NCTD, a small-molecule synthetic compound, on reversing multidrug resistance. The DOX-prepared MCF-7R cells also possessed resistance to vinorelbine, characteristic of MDR. At suboptimal concentration, NCTD significantly inhibited the viability of DOX-sensitive (MCF-7S and DOX-resistant (MCF-7R cells and reversed the resistance to DOX and vinorelbine. NCTD increased the intracellular accumulation of DOX in MCF-7R cells and suppressed the upregulated the mdr-1 mRNA, P-gp and BCRP protein expression, but not the MRP-1. The role of P-gp was strengthened by partial reversal of the DOX and vinorelbine resistance by cyclosporine A. NCTD treatment suppressed the upregulation of Shh expression and nuclear translocation of Gli-1, a hallmark of Shh signaling activation in the resistant clone. Furthermore, the Shh ligand upregulated the expression of P-gp and attenuated the growth inhibitory effect of NCTD. The knockdown of mdr-1 mRNA had not altered the expression of Shh and Smoothened in both MCF-7S and MCF-7R cells. This indicates that the role of Shh signaling in MDR might be upstream to mdr-1/P-gp, and similar effect was shown in breast cancer MDA-MB-231 and BT-474 cells. This study demonstrated that NCTD may overcome multidrug resistance through inhibiting Shh signaling and expression of its downstream mdr-1/P-gp expression in human breast cancer cells.

  18. Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

    Science.gov (United States)

    Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

    2016-05-01

    For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

  19. Spread of ISCR1 Elements Containing blaDHA-1 and Multiple Antimicrobial Resistance Genes Leading to Increase of Flomoxef Resistance in Extended-Spectrum-β-Lactamase-Producing Klebsiella pneumoniae▿

    Science.gov (United States)

    Lee, Chen-Hsiang; Liu, Jien-Wei; Li, Chia-Chin; Chien, Chun-Chih; Tang, Ya-Fen; Su, Lin-Hui

    2011-01-01

    Increasing resistance to quinolones, aminoglycosides, and/or cephamycins in extended-spectrum-β-lactamase (ESBL)-producing Enterobacteriaceae exacerbates the already limited antibiotic treatment options for infections due to these microbes. In this study, the presence of resistance determinants for these antimicrobial agents was examined by PCR among ESBL-producing Klebsiella pneumoniae (ESBL-KP) isolates that caused bacteremia. Pulsed-field gel electrophoresis was used to differentiate the clonal relationship among the isolates studied. Transferability and the location of the resistance genes were analyzed by conjugation experiments, followed by DNA-DNA hybridization. Among the 94 ESBL-KP isolates studied, 20 isolates of flomoxef-resistant ESBL-KP were identified. They all carried a DHA-1 gene and were genetically diverse. CTX-M genes were found in 18 of the isolates. Among these DHA-1/CTX-M-producing K. pneumoniae isolates, ISCR1 was detected in 13 (72%) isolates, qnr genes (1 qnrA and 17 qnrB genes) were detected in 18 (100%), aac(6′)-Ib-cr was detected in 11 (61%), and 16S rRNA methylase (all armA genes) was detected in 14 (78%). Four transconjugants were available for further analysis, and qnrB4, aac(6′)-Ib-cr, armA, and blaDHA-1 were all identified on these self-transferable blaCTX-M-carrying plasmids. The genetic environments of ISCR1 associated with armA, blaDHA-1, and qnrB4 genes in the four transconjugants were identical. Replicon-type analysis revealed a FIIA plasmid among the four self-transferable plasmids, although the other three were nontypeable. The cotransfer of multiple resistance genes with the ISCR1 element-carrying plasmids has a clinical impact and warrants close monitoring and further study. PMID:21746945

  20. Synergistic activity of synthetic N-terminal peptide of human lactoferrin in combination with various antibiotics against carbapenem-resistant Klebsiella pneumoniae strains.

    Science.gov (United States)

    Morici, P; Florio, W; Rizzato, C; Ghelardi, E; Tavanti, A; Rossolini, G M; Lupetti, A

    2017-10-01

    The spread of multi-drug resistant (MDR) Klebsiella pneumoniae strains producing carbapenemases points to a pressing need for new antibacterial agents. To this end, the in-vitro antibacterial activity of a synthetic N-terminal peptide of human lactoferrin, further referred to as hLF1-11, was evaluated against K. pneumoniae strains harboring different carbapenemase genes (i.e. OXA-48, KPC-2, KPC-3, VIM-1), with different susceptibility to colistin and other antibiotics, alone or in combination with conventional antibiotics (gentamicin, tigecycline, rifampicin, clindamycin, and clarithromycin). An antimicrobial peptide susceptibility assay was used to assess the bactericidal activity of hLF1-11 against the different K. pneumoniae strains tested. The synergistic activity was evaluated by a checkerboard titration method, and the fractional inhibitory concentration (FIC) index was calculated for the various combinations. hLF1-11 was more efficient in killing a K. pneumoniae strain susceptible to most antimicrobials (including colistin) than a colistin-susceptible strain and a colistin-resistant MDR K. pneumoniae strain. In addition, hLF1-11 exhibited a synergistic effect with the tested antibiotics against MDR K. pneumoniae strains. The results of this study indicate that resistance to hLF1-11 and colistin are not strictly associated, and suggest an hLF1-11-induced sensitizing effect of K. pneumoniae to antibiotics, especially to hydrophobic antibiotics, which are normally not effective on Gram-negative bacteria. Altogether, these data indicate that hLF1-11 in combination with antibiotics is a promising candidate to treat infections caused by MDR-K. pneumoniae strains.

  1. Phenotypic and genotypic profile of clinical and animal multidrug-resistant Salmonella enterica isolates from Mexico.

    Science.gov (United States)

    Aguilar-Montes de Oca, S; Talavera-Rojas, M; Soriano-Vargas, E; Barba-León, J; Vázquez-Navarrete, J; Acosta-Dibarrat, J; Salgado-Miranda, C

    2018-01-01

    The objective of this study was to obtain a phenotypic and genotypic profile of Salmonella enterica including multidrug-resistant (MDR) isolates from food-producing animals and clinical isolates, as well as their genetic relatedness in two different States of Mexico (Jalisco and State of Mexico). A total of 243 isolates were evaluated in terms of antimicrobial resistance (AMR) and related genes through a disk diffusion method and PCR respectively; we found 16 MDR isolates, all of them harbouring the bla CMY gene but not qnr genes, these isolates represent less than 10% of the collection. The pulsed-field gel electrophoresis revealed a higher genotypic similitude within isolates of State of Mexico than Jalisco. A low percentage of Salmonella isolates were resistant to relevant antibiotics in human health, nevertheless, the AMR and involved genes were similar despite the different serovars and origin of the isolates. This investigation provided an insight of the current status of AMR of Salmonella isolates in two States of Mexico and pinpoint the genes involved in AMR and their epidemiological relationship, the information could help to determine an adequate therapy in human and veterinary medicine. © 2017 The Society for Applied Microbiology.

  2. PD173074, a selective FGFR inhibitor, reverses MRP7 (ABCC10-mediated MDR

    Directory of Open Access Journals (Sweden)

    Nagaraju Anreddy

    2014-06-01

    Full Text Available Multidrug resistance protein 7 (MRP7, ABCC10 is a recently identified member of the ATP-binding cassette (ABC transporter family, which adequately confers resistance to a diverse group of antineoplastic agents, including taxanes, vinca alkaloids and nucleoside analogs among others. Clinical studies indicate an increased MRP7 expression in non-small cell lung carcinomas (NSCLC compared to a normal healthy lung tissue. Recent studies revealed increased paclitaxel sensitivity in the Mrp7−/− mouse model compared to their wild-type counterparts. This demonstrates that MRP7 is a key contributor in developing drug resistance. Recently our group reported that PD173074, a specific fibroblast growth factor receptor (FGFR inhibitor, could significantly reverse P-glycoprotein-mediated MDR. However, whether PD173074 can interact with and inhibit other MRP members is unknown. In the present study, we investigated the ability of PD173074 to reverse MRP7-mediated MDR. We found that PD173074, at non-toxic concentration, could significantly increase the cellular sensitivity to MRP7 substrates. Mechanistic studies indicated that PD173074 (1 μmol/L significantly increased the intracellular accumulation and in-turn decreased the efflux of paclitaxel by inhibiting the transport activity without altering expression levels of the MRP7 protein, thereby representing a promising therapeutic agent in the clinical treatment of chemoresistant cancer patients.

  3. APC loss in breast cancer leads to doxorubicin resistance via STAT3 activation.

    Science.gov (United States)

    VanKlompenberg, Monica K; Leyden, Emily; Arnason, Anne H; Zhang, Jian-Ting; Stefanski, Casey D; Prosperi, Jenifer R

    2017-11-28

    Resistance to chemotherapy is one of the leading causes of death from breast cancer. We recently established that loss of Adenomatous Polyposis Coli (APC) in the Mouse Mammary Tumor Virus - Polyoma middle T (MMTV-PyMT) transgenic mouse model results in resistance to cisplatin or doxorubicin-induced apoptosis. Herein, we aim to establish the mechanism that is responsible for APC-mediated chemotherapeutic resistance. Our data demonstrate that MMTV-PyMT; Apc Min/+ cells have increased signal transducer and activator of transcription 3 (STAT3) activation. STAT3 can be constitutively activated in breast cancer, maintains the tumor initiating cell (TIC) population, and upregulates multidrug resistance protein 1 (MDR1). The activation of STAT3 in the MMTV-PyMT; Apc Min/+ model is independent of interleukin 6 (IL-6); however, enhanced EGFR expression in the MMTV-PyMT; Apc Min/+ cells may be responsible for the increased STAT3 activation. Inhibiting STAT3 with a small molecule inhibitor A69 in combination with doxorubicin, but not cisplatin, restores drug sensitivity. A69 also decreases doxorubicin enhanced MDR1 gene expression and the TIC population enhanced by loss of APC. In summary, these results have revealed the molecular mechanisms of APC loss in breast cancer that can guide future treatment plans to counteract chemotherapeutic resistance.

  4. Trends of 9,416 multidrug-resistant Gram-negative bacteria

    Directory of Open Access Journals (Sweden)

    Viviane Decicera Colombo Oliveira

    2015-06-01

    Full Text Available Summary Objective: a resistance of hospital-acquired bacteria to multiple antibiotics is a major concern worldwide. The objective of this study was to investigate multidrugresistant (MDR bacteria, clinical specimens, origin of specimen and trends, and correlate these with bacterial sensitivity and consumption of antimicrobials. Methods: 9,416 bacteria of nosocomial origin were evaluated in a tertiary hospital, from 1999 to 2008. MDR was defined for Gram-negative bacteria (GNB as resistance to two or more classes/groups of antibiotics. Results: GNB MDR increased by 3.7 times over the study period (p<0.001. Acinetobacter baumannii was the most prevalent (36.2%. Over the study period, there were significant 4.8-fold and 14.6-fold increases for A. baumannii and K. pneumoniae (p<0.001, respectively. Sixty-seven percent of isolates of MDR GNB were isolated in intensive care units. The resistance of A. baumannii to carbapenems increased from 7.4 to 57.5% during the study period and concomitant with an increased consumption. Conclusion: that decade showed prevalence of GNB and a gradual increase in MDR GNB. There was an increase in carbapenem resistance of 50.1% during the study.

  5. The draft genome sequence of multidrug-resistant Pseudomonas aeruginosa strain CCBH4851, a nosocomial isolate belonging to clone SP (ST277 that is prevalent in Brazil

    Directory of Open Access Journals (Sweden)

    Melise Silveira

    2014-12-01

    Full Text Available The high occurrence of nosocomial multidrug-resistant (MDR microorganisms is considered a global health problem. Here, we report the draft genome sequence of a MDR Pseudomonas aeruginosa strain isolated in Brazil that belongs to the endemic clone ST277. The genome encodes important resistance determinant genes and consists of 6.7 Mb with a G+C content of 66.86% and 6,347 predicted coding regions including 60 RNAs.

  6. Inhibition of bacterial multidrug resistance by celecoxib, a cyclooxygenase-2 inhibitor.

    Science.gov (United States)

    Kalle, Arunasree M; Rizvi, Arshad

    2011-01-01

    Multidrug resistance (MDR) is a major problem in the treatment of infectious diseases and cancer. Accumulating evidence suggests that the cyclooxygenase-2 (COX-2)-specific inhibitor celecoxib would not only inhibit COX-2 but also help in the reversal of drug resistance in cancers by inhibiting the MDR1 efflux pump. Here, we demonstrate that celecoxib increases the sensitivity of bacteria to the antibiotics ampicillin, kanamycin, chloramphenicol, and ciprofloxacin by accumulating the drugs inside the cell, thus reversing MDR in bacteria.

  7. Transgenic Citrus Expressing an Arabidopsis NPR1 Gene Exhibit Enhanced Resistance against Huanglongbing (HLB; Citrus Greening).

    Science.gov (United States)

    Dutt, Manjul; Barthe, Gary; Irey, Michael; Grosser, Jude

    2015-01-01

    Commercial sweet orange cultivars lack resistance to Huanglongbing (HLB), a serious phloem limited bacterial disease that is usually fatal. In order to develop sustained disease resistance to HLB, transgenic sweet orange cultivars 'Hamlin' and 'Valencia' expressing an Arabidopsis thaliana NPR1 gene under the control of a constitutive CaMV 35S promoter or a phloem specific Arabidopsis SUC2 (AtSUC2) promoter were produced. Overexpression of AtNPR1 resulted in trees with normal phenotypes that exhibited enhanced resistance to HLB. Phloem specific expression of NPR1 was equally effective for enhancing disease resistance. Transgenic trees exhibited reduced diseased severity and a few lines remained disease-free even after 36 months of planting in a high-disease pressure field site. Expression of the NPR1 gene induced expression of several native genes involved in the plant defense signaling pathways. The AtNPR1 gene being plant derived can serve as a component for the development of an all plant T-DNA derived consumer friendly GM tree.

  8. Transgenic Citrus Expressing an Arabidopsis NPR1 Gene Exhibit Enhanced Resistance against Huanglongbing (HLB; Citrus Greening.

    Directory of Open Access Journals (Sweden)

    Manjul Dutt

    Full Text Available Commercial sweet orange cultivars lack resistance to Huanglongbing (HLB, a serious phloem limited bacterial disease that is usually fatal. In order to develop sustained disease resistance to HLB, transgenic sweet orange cultivars 'Hamlin' and 'Valencia' expressing an Arabidopsis thaliana NPR1 gene under the control of a constitutive CaMV 35S promoter or a phloem specific Arabidopsis SUC2 (AtSUC2 promoter were produced. Overexpression of AtNPR1 resulted in trees with normal phenotypes that exhibited enhanced resistance to HLB. Phloem specific expression of NPR1 was equally effective for enhancing disease resistance. Transgenic trees exhibited reduced diseased severity and a few lines remained disease-free even after 36 months of planting in a high-disease pressure field site. Expression of the NPR1 gene induced expression of several native genes involved in the plant defense signaling pathways. The AtNPR1 gene being plant derived can serve as a component for the development of an all plant T-DNA derived consumer friendly GM tree.

  9. Anti-cancer effect of oncolytic adenovirus-armed shRNA targeting MYCN gene on doxorubicin-resistant neuroblastoma cells.

    Science.gov (United States)

    Li, Yuan; Zhuo, Baobiao; Yin, Yiyu; Han, Tao; Li, Shixian; Li, Zhengwei; Wang, Jian

    2017-09-09

    Chemotherapy is one of the few effective choices for patients with neuroblastoma. However, the development of muti-drug resistance (MDR) to chemotherapy is a major obstacle to the effective treatment of advanced or recurrent neuroblastoma. The muti-drug resistance-associated protein (MRP), which encodes a transmembrane glycoprotein, is a key regulator of MDR. The expression of MRP is a close correlation with MYCN oncogene in neuroblastoma. We have recently shown ZD55-shMYCN (oncolytic virus armed with shRNA against MYCN) can down-regulate MYCN to inhibit tumor cells proliferation and induce apoptosis in neuroblastoma. Here we further report ZD55-shMYCN re-sensitized doxorubicin-resistant cells to doxorubicin (as shown by reduced proliferation, increased apoptosis, and inhibited cell migration), and reduced the in vivo growth rate of neuroblastoma xenografts by down-regulation of MRP expression. Sequential therapy with doxorubicin did not affect the replication of ZD55-shMYCN in doxorubicin-resistant neuroblastoma cells, but decreased the expression of Bcl-2, Bcl-X L , MMP-1. Thus, this synergistic effect of ZD55-shMYCN in combination with doxorubicin provides a novel therapy strategy for doxorubicin-resistant neuroblastoma, and is a promising approach for further clinical development. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Incidence of multidrug-resistant, extensively drug-resistant and pan-drug-resistant bacteria in children hospitalized at Dr. Hasan Sadikin general hospital Bandung Indonesia

    Science.gov (United States)

    Adrizain, R.; Suryaningrat, F.; Alam, A.; Setiabudi, D.

    2018-03-01

    Antibiotic resistance has become a global issue, with 700,000 deaths attributable to multidrug-resistance (MDR) occurring each year. Centers for Disease Control and Prevention (CDC) show rapidly increasing rates of infection due to antibiotic-resistant bacteria. The aim of the study isto describe the incidence of MDR, extensively drug-resistant (XDR) and pan drug-resistant (PDR) in Enterococcus spp., Staphylococcus aureus, K. pneumonia, Acinetobacter baumanii, P. aeruginosin, and Enterobacter spp. (ESKAPE) pathogens in children admitted to Dr. Hasan Sadikin Hospital. All pediatric patients having blood culture drawn from January 2015 to December 2016 were retrospectively studied. Data include the number of drawn blood culture, number of positive results, type of bacteria, sensitivity pattern. International standard definitions for acquired resistance by ECDC and CDC was used as definitions for MDR, XDR and PDR bacteria. From January 2015 to December 2016, 299 from 2.542 (11.7%) blood culture was positive, with Staphylococcus aureus, Enterococcus spp., Enterobacteriaceae, Pseudomonas aeruginosa, Acinetobacter spp., respectively 5, 6, 24, 5, 20 with total 60 (20%). The MDR and XDR pathogen found were 47 and 13 patients, respectively.

  11. Overview of drug-resistant tuberculosis worldwide

    Directory of Open Access Journals (Sweden)

    Ali A Velayati

    2016-01-01

    Full Text Available Even in the 21st century, we are losing the battle against eradication of tuberculosis (TB. In 2015, 9.6 million people were estimated to have fallen ill with TB, of which 1.5 million people died. This is the real situation despite the well-structured treatment programs and availability of effective treatment options since the 1950s. The high mortality rate has been associated with other risk factors, such as the HIV epidemic, underlying diseases, and decline of socioeconomic standards. Furthermore, the problem of drug resistance that was recognized in the early days of the chemotherapeutic era raises serious concerns. Although resistance to a single agent is the most common type, resistance to multiple agents is less frequent but of greater concern. The World Health Organization estimated approximately 5% of all new TB cases involved multidrug-resistant (MDR-TB. The estimation for MDR-TB is 3.3% for new cases, and 20.5% for previously treated cases. Failure to identify and appropriately treat MDR-TB patients has led to more dangerous forms of resistant TB. Based on World Health Organization reports, 5% of global TB cases are now considered to be extensively drug resistant (XDR, defined as MDR with additional resistance to both fluoroquinolones and at least one second-line injectable drug. XDR-TB had been reported by 105 countries by 2015. An estimated 9.7% of people with MDR-TB have XDR-TB. More recently, another dangerous form of TB bacillus was identified, which was named totally drug resistant (TDR-TB or extremely drug resistant TB. These strains were resistant to all first- and second-line anti-TB drugs. Collectively, it is accepted that 2% of MDR-TB strains turn to be TDR-TB. This number, however, may not reflect the real situation, as many laboratories in endemic TB countries do not have proper facilities and updated protocols to detect the XDR or TDR-TB strains. Nevertheless, existing data emphasize the need for additional control

  12. Laboratory-Based Surveillance of Extensively Drug-Resistant Tuberculosis in Eastern China.

    Science.gov (United States)

    Huang, Yu; Wu, Qingqing; Xu, Shuiyang; Zhong, Jieming; Chen, Songhua; Xu, Jinghang; Zhu, Liping; He, Haibo; Wang, Xiaomeng

    2017-03-01

    With 25% of the global burden, China has the highest incidence of drug-resistant tuberculosis (TB) in the world. However, surveillance data on extensively drug-resistant TB (XDR-TB) from China are scant. To estimate the prevalence of XDR-TB in Zhejiang, Eastern China, 30 of 90 TB treatment centers in Zhejiang were recruited. Patients with suspected TB who reported to the clinics for diagnosis were requested to undergo a smear sputum test. Positive sputum samples were tested for drug susceptibility. Data on anti-TB drug resistance from 1999 to 2008 were also collected to assess drug resistance trends. A total of 931 cases were recruited for drug susceptibility testing (DST). Among these, 23.6% (95% confidence interval [CI], 18.8-24.4) were resistant to any of the following drugs: isoniazid, rifampin, streptomycin, and ethambutol. Multidrug resistant (MDR) strains were identified in 5.1% of all cases (95% CI, 3.61-6.49). Among MDR-TB cases, 6.4% were XDR (95% CI, 1.7-18.6) and 8.9% (95% CI, 7.0-10.8) of all cases were resistant to either isoniazid or rifampin (but not both). Among MDR-TB cases, 23.4% (95% CI, 12.8-38.4) were resistant to either fluoroquinolones or a second-line anti-TB injectable drug, but not both. From 1999 to 2014, the percentage of MDR cases decreased significantly, from 8.6% to 5.1% (p = 0.00). The Global Fund to Fight TB program showed signs of success in Eastern China. However, drug-resistant TB, MDR-TB, and XDR-TB still pose a challenge for TB control in Eastern China. High-quality directly observed treatment, short-course, and universal DST for TB cases to determine appropriate treatment regimens are urgently needed to prevent acquired drug resistance.

  13. Selection of Plasmodium falciparum Multidrug Resistance Gene 1 Alleles in Asexual Stages and Gametocytes by Artemether-Lumefantrine in Nigerian Children with Uncomplicated Falciparum Malaria ▿

    Science.gov (United States)

    Happi, C. T.; Gbotosho, G. O.; Folarin, O. A.; Sowunmi, A.; Hudson, T.; O'Neil, M.; Milhous, W.; Wirth, D. F.; Oduola, A. M. J.

    2009-01-01

    We assessed Plasmodium falciparum mdr1 (Pfmdr1) gene polymorphisms and copy numbers as well as P. falciparum Ca2+ ATPase (PfATPase6) gene polymorphisms in 90 Nigerian children presenting with uncomplicated falciparum malaria and enrolled in a study of the efficacy of artemether-lumefantrine (AL). The nested PCR-restriction fragment length polymorphism and the quantitative real-time PCR methodologies were used to determine the alleles of the Pfmdr1 and PfATPase6 genes and the Pfmdr1 copy number variation, respectively, in patients samples collected prior to treatment and at the reoccurrence of parasites during a 42-day follow-up. The Pfmdr1 haplotype 86N-184F-1246D was significantly associated (P copy of the Pfmdr1 gene and the wild-type allele (L89) at codon 89 of the PfATPase6 gene. These findings suggest that polymorphisms in the Pfmdr1 gene are under AL selection pressure. Pfmdr1 polymorphisms may result in reduction in the therapeutic efficacy of this newly adopted combination treatment for uncomplicated falciparum malaria in Saharan countries of Africa. PMID:19075074

  14. Comparative mapping of powdery mildew resistance gene Pm21 and functional characterization of resistance-related genes in wheat.

    Science.gov (United States)

    He, Huagang; Zhu, Shanying; Jiang, Zhengning; Ji, Yaoyong; Wang, Feng; Zhao, Renhui; Bie, Tongde

    2016-04-01

    The powdery mildew resistance gene Pm21 was physically and comparatively mapped by newly developed markers. Seven candidate genes were verified to be required for Pm21 -mediated resistance to wheat powdery mildew. Pm21, a gene derived from wheat wild relative Dasypyrum villosum, has been transferred into common wheat and widely utilized in wheat resistance breeding for powdery mildew. Previously, Pm21 has been located to the bin FL0.45-0.58 of 6VS by using deletion stocks. However, its fine mapping is still a hard work. In the present study, 30 gene-derived 6VS-specific markers were obtained based on the collinearity among genomes of Brachypodium distachyon, Oryza and Triticeae, and then physically and comparatively mapped in the bin FL0.45-0.58 and its nearby chromosome region. According to the maps, the bin FL0.45-0.58 carrying Pm21 was closely flanked by the markers 6VS-03 and 6VS-23, which further narrowed the orthologous regions to 1.06 Mb in Brachypodium and 1.38 Mb in rice, respectively. Among the conserved genes shared by Brachypodium and rice, four serine/threonine protein kinase genes (DvMPK1, DvMLPK, DvUPK and DvPSYR1), one protein phosphatase gene (DvPP2C) and two transcription factor genes (DvGATA and DvWHY) were confirmed to be required for Pm21-mediated resistance to wheat powdery mildew by barley stripe mosaic virus-induced gene silencing (BSMV-VIGS) and transcriptional pattern analyses. In summary, this study gives new insights into the genetic basis of the Pm21 locus and the disease resistance pathways mediated by Pm21.

  15. Management of MDR-TB in HIV co-infected patients in Eastern Europe

    DEFF Research Database (Denmark)

    Efsen, A M W; Schultze, A; Miller, R F

    2018-01-01

    below the target of 90%, reflecting the challenging patient population and the environment in which health care is provided. Urgent improvement of management of patients with TB/HIV in EE, in particular for those with MDR-TB, is needed and includes widespread access to rapid TB diagnostics, better......OBJECTIVES: Mortality among HIV patients with tuberculosis (TB) remains high in Eastern Europe (EE), but details of TB and HIV management remain scarce. METHODS: In this prospective study, we describe the TB treatment regimens of patients with multi-drug resistant (MDR) TB and use of antiretroviral...... access to and use of second-line TB drugs, timely ART initiation with viral load monitoring, and integration of TB/HIV care....

  16. Management of multidrug-resistant tuberculosis in human immunodeficiency virus patients

    Science.gov (United States)

    Jamil, K. F.

    2018-03-01

    Tuberculosis (TB) is a chronic infectious disease mainly caused by Mycobacterium tuberculosis(MTB). 10.4 million new TB cases will appear in 2015 worldwide. There were an estimated 1.4 million TB deaths in 2015, and an additional 0.4 million deaths resulting from TB disease among people living with human immunodeficiency virus (HIV). Multidrug- resistant and extensively drug-resistant tuberculosis (MDR and XDR-TB) are major public health concerns worldwide. 480.000 new cases of MDR-TB will appear in 2015 and an additional 100,000 people with rifampicin-resistant TB (RR-TB) who were also newly eligible for MDR-TB treatment. Their association with HIV infection has contributed to the slowing down of TB incidence decline over the last two decades, therefore representing one important barrier to reach TB elimination. Patients infected with MDR-TB require more expensive treatment regimens than drug-susceptible TB, with poor treatment.Patients with multidrug- resistant tuberculosis do not receive rifampin; drug interactions risk is markedly reduced. However, overlapping toxicities may limit options for co-treatment of HIV and multidrug- resistant tuberculosis.

  17. Folate decorated dual drug loaded nanoparticle: role of curcumin in enhancing therapeutic potential of nutlin-3a by reversing multidrug resistance.

    Directory of Open Access Journals (Sweden)

    Manasi Das

    Full Text Available Retinoblastoma is the most common intraocular tumor in children. Malfunctioning of many signaling pathways regulating cell survival or apoptosis, make the disease more vulnerable. Notably, resistance to chemotherapy mediated by MRP-1, lung-resistance protein (LRP is the most challenging aspect to treat this disease. Presently, much attention has been given to the recently developed anticancer drug nutlin-3a because of its non-genotoxic nature and potency to activate tumor suppressor protein p53. However, being a substrate of multidrug resistance protein MRP1 and Pgp its application has become limited. Currently, research has step towards reversing Multi drug resistance (MDR by using curcumin, however its clinical relevance is restricted by plasma instability and poor bioavailability. In the present investigation we tried to encapsulate nutlin-3a and curcumin in PLGA nanoparticle (NPs surface functionalized with folate to enhance therapeutic potential of nutlin-3a by modulating MDR. We document that curcumin can inhibit the expression of MRP-1 and LRP gene/protein in a concentration dependent manner in Y79 cells. In vitro cellular cytotoxicity, cell cycle analysis and apoptosis studies were done to compare the effectiveness of native drugs (single or combined and single or dual drug loaded nanoparticles (unconjugated/folate conjugated. The result demonstrated an augmented therapeutic efficacy of targeted dual drug loaded NPs (Fol-Nut-Cur-NPs over other formulation. Enhanced expression or down regulation of proapoptotic/antiapoptotic proteins respectively and down-regulation of bcl2 and NFκB gene/protein by Fol-Nut-Cur-NPs substantiate the above findings. This is the first investigation exploring the role of curcumin as MDR modulator to enhance the therapeutic potentiality of nutlin-3a, which may opens new direction for targeting cancer with multidrug resistance phenotype.

  18. Amino acid substitutions in the thymidine kinase gene of induced acyclovir-resistant herpes simplex virus type 1

    Science.gov (United States)

    Hussin, Ainulkhir; Nor, Norefrina Shafinaz Md; Ibrahim, Nazlina

    2013-11-01

    Acyclovir (ACV) is an antiviral drug of choice in healthcare setting to treat infections caused by herpes viruses, including, but not limited to genital herpes, cold sores, shingles and chicken pox. Acyclovir resistance has emerged significantly due to extensive use and misuse of this antiviral in human, especially in immunocompromised patients. However, it remains unclear about the amino acid substitutions in thymidine (TK) gene, which specifically confer the resistance-associated mutation in herpes simplex virus. Hence, acyclovir-resistant HSV-1 was selected at high concentration (2.0 - 4.5 μg/mL), and the TK-gene was subjected to sequencing and genotypic characterization. Genotypic sequences comparison was done using HSV-1 17 (GenBank Accesion no. X14112) for resistance-associated mutation determination whereas HSV-1 KOS, HSV-1 473/08 and HSV clinical isolates sequences were used for polymorphism-associated mutation. The result showed that amino acid substitutions at the non-conserved region (UKM-1: Gln34Lys, UKM-2: Arg32Ser & UKM-5: Arg32Cys) and ATP-binding site (UKM-3: Tyr53End & UKM-4: Ile54Leu) of the TK-gene. These discoveries play an important role to extend another dimension to the evolution of acyclovir-resistant HSV-1 and suggest that selection at high ACV concentration induced ACV-resistant HSV-1 evolution. These findings also expand the knowledge on the type of mutations among acyclovir-resistant HSV-1. In conclusion, HSV-1 showed multiple strategies to exhibit acyclovir resistance, including amino acid substitutions in the TK gene.

  19. Design, synthesis and evaluation of a potent substrate analog inhibitor identified by scanning Ala/Phe mutagenesis, mimicking substrate co-evolution, against multidrug-resistant HIV-1 protease

    Energy Technology Data Exchange (ETDEWEB)

    Yedidi, Ravikiran S. [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States); Muhuhi, Joseck M. [Department of Chemistry, Wayne State University, Detroit, MI 48202 (United States); Liu, Zhigang [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States); Bencze, Krisztina Z. [Department of Chemistry, Fort Hays State University, Hays, KS 67601 (United States); Koupparis, Kyriacos [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States); Department of Chemistry, Wayne State University, Detroit, MI 48202 (United States); O’Connor, Carrie E.; Kovari, Iulia A. [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States); Spaller, Mark R. [Department of Chemistry, Wayne State University, Detroit, MI 48202 (United States); Kovari, Ladislau C., E-mail: kovari@med.wayne.edu [Department of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, Detroit, MI 48201 (United States)

    2013-09-06

    Highlights: •Inhibitors against MDR HIV-1 protease were designed, synthesized and evaluated. •Lead peptide (6a) showed potent inhibition (IC{sub 50}: 4.4 nM) of MDR HIV-1 protease. •(6a) Showed favorable binding isotherms against NL4-3 and MDR proteases. •(6a) Induced perturbations in the {sup 15}N-HSQC spectrum of MDR HIV-1 protease. •Molecular modeling suggested that (6a) may induce total flap closure inMDR protease. -- Abstract: Multidrug-resistant (MDR) clinical isolate-769, human immunodeficiency virus type-1 (HIV-1) protease (PDB ID: (1TW7)), was shown to exhibit wide-open flaps and an expanded active site cavity, causing loss of contacts with protease inhibitors. In the current study, the expanded active site cavity of MDR769 HIV-1 protease was screened with a series of peptide-inhibitors that were designed to mimic the natural substrate cleavage site, capsid/p2. Scanning Ala/Phe chemical mutagenesis approach was incorporated into the design of the peptide series to mimic the substrate co-evolution. Among the peptides synthesized and evaluated, a lead peptide (6a) with potent activity (IC{sub 50}: 4.4 nM) was identified against the MDR769 HIV-1 protease. Isothermal titration calorimetry data showed favorable binding profile for 6aagainst both wild type and MDR769 HIV-1 protease variants. Nuclear magnetic resonance spectrum of {sup 15}N-labeled MDR769 HIV-1 protease in complex with 6a showed some major perturbations in chemical shift, supporting the peptide induced conformational changes in protease. Modeling analysis revealed multiple contacts between 6a and MDR769 HIV-1 protease. The lead peptide-inhibitor, 6a, with high potency and good binding profile can be used as the basis for developing potent small molecule inhibitors against MDR variants of HIV.

  20. Design, synthesis and evaluation of a potent substrate analog inhibitor identified by scanning Ala/Phe mutagenesis, mimicking substrate co-evolution, against multidrug-resistant HIV-1 protease

    International Nuclear Information System (INIS)

    Yedidi, Ravikiran S.; Muhuhi, Joseck M.; Liu, Zhigang; Bencze, Krisztina Z.; Koupparis, Kyriacos; O’Connor, Carrie E.; Kovari, Iulia A.; Spaller, Mark R.; Kovari, Ladislau C.

    2013-01-01

    Highlights: •Inhibitors against MDR HIV-1 protease were designed, synthesized and evaluated. •Lead peptide (6a) showed potent inhibition (IC 50 : 4.4 nM) of MDR HIV-1 protease. •(6a) Showed favorable binding isotherms against NL4-3 and MDR proteases. •(6a) Induced perturbations in the 15 N-HSQC spectrum of MDR HIV-1 protease. •Molecular modeling suggested that (6a) may induce total flap closure inMDR protease. -- Abstract: Multidrug-resistant (MDR) clinical isolate-769, human immunodeficiency virus type-1 (HIV-1) protease (PDB ID: (1TW7)), was shown to exhibit wide-open flaps and an expanded active site cavity, causing loss of contacts with protease inhibitors. In the current study, the expanded active site cavity of MDR769 HIV-1 protease was screened with a series of peptide-inhibitors that were designed to mimic the natural substrate cleavage site, capsid/p2. Scanning Ala/Phe chemical mutagenesis approach was incorporated into the design of the peptide series to mimic the substrate co-evolution. Among the peptides synthesized and evaluated, a lead peptide (6a) with potent activity (IC 50 : 4.4 nM) was identified against the MDR769 HIV-1 protease. Isothermal titration calorimetry data showed favorable binding profile for 6aagainst both wild type and MDR769 HIV-1 protease variants. Nuclear magnetic resonance spectrum of 15 N-labeled MDR769 HIV-1 protease in complex with 6a showed some major perturbations in chemical shift, supporting the peptide induced conformational changes in protease. Modeling analysis revealed multiple contacts between 6a and MDR769 HIV-1 protease. The lead peptide-inhibitor, 6a, with high potency and good binding profile can be used as the basis for developing potent small molecule inhibitors against MDR variants of HIV

  1. Comparative genomics of the IncA/C multidrug resistance plasmid family.

    Science.gov (United States)

    Fricke, W Florian; Welch, Timothy J; McDermott, Patrick F; Mammel, Mark K; LeClerc, J Eugene; White, David G; Cebula, Thomas A; Ravel, Jacques

    2009-08-01

    Multidrug resistance (MDR) plasmids belonging to the IncA/C plasmid family are widely distributed among Salmonella and other enterobacterial isolates from agricultural sources and have, at least once, also been identified in a drug-resistant Yersinia pestis isolate (IP275) from Madagascar. Here, we present the complete plasmid sequences of the IncA/C reference plasmid pRA1 (143,963 bp), isolated in 1971 from the fish pathogen Aeromonas hydrophila, and of the cryptic IncA/C plasmid pRAx (49,763 bp), isolated from Escherichia coli transconjugant D7-3, which was obtained through pRA1 transfer in 1980. Using comparative sequence analysis of pRA1 and pRAx with recent members of the IncA/C plasmid family, we show that both plasmids provide novel insights into the evolution of the IncA/C MDR plasmid family and the minimal machinery necessary for stable IncA/C plasmid maintenance. Our results indicate that recent members of the IncA/C plasmid family evolved from a common ancestor, similar in composition to pRA1, through stepwise integration of horizontally acquired resistance gene arrays into a conserved plasmid backbone. Phylogenetic comparisons predict type IV secretion-like conjugative transfer operons encoded on the shared plasmid backbones to be closely related to a group of integrating conjugative elements, which use conjugative transfer for horizontal propagation but stably integrate into the host chromosome during vegetative growth. A hipAB toxin-antitoxin gene cluster found on pRA1, which in Escherichia coli is involved in the formation of persister cell subpopulations, suggests persistence as an early broad-spectrum antimicrobial resistance mechanism in the evolution of IncA/C resistance plasmids.

  2. Coumpounds affecting cell membrane functions and integrity: MDR pumps and theit exploration

    Czech Academy of Sciences Publication Activity Database

    Sigler, Karel; Gášková, D.

    2002-01-01

    Roč. 51, č. 24 (2002), s. 19-22 ISSN 0137-1398. [Uroczyste Seminarium z okazji urodzin Profesora Stanislawa Witka /70./. Wroclaw, 21.07.2002] R&D Projects: GA AV ČR IBS5020202; GA MŠk ME 577 Keywords : xenobioticexporting * multidrug resistance * mdr pumps Subject RIV: EE - Microbiology, Virology

  3. Betulinic Acid Exerts Cytotoxic Activity Against Multidrug-Resistant Tumor Cells via Targeting Autocrine Motility Factor Receptor (AMFR

    Directory of Open Access Journals (Sweden)

    Mohamed E. M. Saeed

    2018-05-01

    Full Text Available Betulinic acid (BetA is a naturally occurring pentacyclic triterpene isolated from the outer bark of white-barked birch trees and many other medicinal plants. Here, we studied betulinic acid's cytotoxic activity against drug-resistant tumor cell lines. P-glycoprotein (MDR1/ABCB1 and BCRP (ABCG2 are known ATP-binding cassette (ABC drug transporters that mediating MDR. ABCB5 is a close relative to ABCB1, which also mediates MDR. Constitutive activation of the EGF receptor is tightly linked to the development of chemotherapeutic resistance. BetA inhibited P-gp, BCRP, ABCB5 and mutation activated EGFR overexpressing cells with similar efficacy as their drug-sensitive parental counterparts. Furthermore, the mRNA expressions of ABCB1, BCRP, ABCB5 and EGFR were not related to the 50% inhibition concentrations (IC50 for BetA in a panel of 60 cell lines of the National Cancer Institute (NCI, USA. In addition to well-established MDR mechanisms, we attempted to identify other molecular mechanisms that play a role in mediating BetA's cytotoxic activity. For this reason, we performed COMPARE and hierarchical cluster analyses of the transcriptome-wide microarray-based mRNA expression of the NCI cell lines panel. Various genes significantly correlating to BetA's activity were involved in different biological processes, e.g., cell cycle regulation, microtubule formation, signal transduction, transcriptional regulation, chromatin remodeling, cell adhesion, tumor suppression, ubiquitination and proteasome degradation. Immunoblotting and in silico analyses revealed that the inhibition of AMFR activity might be one of the mechanisms for BetA to overcome MDR phenotypes. In conclusion, BetA may have therapeutic potential for the treatment of refractory tumors.

  4. High chlorpyrifos resistance in Culex pipiens mosquitoes: strong synergy between resistance genes

    Science.gov (United States)

    Alout, H; Labbé, P; Berthomieu, A; Makoundou, P; Fort, P; Pasteur, N; Weill, M

    2016-01-01

    We investigated the genetic determinism of high chlorpyrifos resistance (HCR), a phenotype first described in 1999 in Culex pipiens mosquitoes surviving chlorpyrifos doses ⩾1 mg l−1 and more recently found in field samples from Tunisia, Israel or Indian Ocean islands. Through chlorpyrifos selection, we selected several HCR strains that displayed over 10 000-fold resistance. All strains were homozygous for resistant alleles at two main loci: the ace-1 gene, with the resistant ace-1R allele expressing the insensitive G119S acetylcholinesterase, and a resistant allele of an unknown gene (named T) linked to the sex and ace-2 genes. We constructed a strain carrying only the T-resistant allele and studied its resistance characteristics. By crossing this strain with strains harboring different alleles at the ace-1 locus, we showed that the resistant ace-1R and the T alleles act in strong synergy, as they elicited a resistance 100 times higher than expected from a simple multiplicative effect. This effect was specific to chlorpyrifos and parathion and was not affected by synergists. We also examined how HCR was expressed in strains carrying other ace-1-resistant alleles, such as ace-1V or the duplicated ace-1D allele, currently spreading worldwide. We identified two major parameters that influenced the level of resistance: the number and the nature of the ace-1-resistant alleles and the number of T alleles. Our data fit a model that predicts that the T allele acts by decreasing chlorpyrifos concentration in the compartment targeted in insects. PMID:26463842

  5. Prevalence of resistance to second-line tuberculosis drug among multidrug-resistant tuberculosis patients in Viet Nam, 2011.

    Science.gov (United States)

    Nguyen, Hoa Binh; Nguyen, Nhung Viet; Tran, Huong Thi Giang; Nguyen, Hai Viet; Bui, Quyen Thi Tu

    2016-01-01

    Extensively drug-resistant tuberculosis (XDR-TB) represents an emerging public health problem worldwide. According to the World Health Organization, an estimated 9.7% of multidrug-resistant TB (MDR-TB) cases are defined as XDR-TB globally. The objective of this study was to determine the prevalence of drug resistance to second-line TB drugs among MDR-TB cases detected in the Fourth National Anti-Tuberculosis Drug Resistance Survey in Viet Nam. Eighty clusters of TB cases were selected using a probability-proportion-to-size approach. To identify MDR-TB cases, drug susceptibility testing (DST) was performed for the four major first-line TB drugs. DST of second-line drugs (ofloxacin, amikacin, kanamycin, capreomycin) was performed on isolates from MDR-TB cases to identify pre-XDR and XDR cases. A total of 1629 smear-positive TB cases were eligible for culture and DST. Of those, DST results for first-line drugs were available for 1312 cases, and 91 (6.9%) had MDR-TB. Second-line DST results were available for 84 of these cases. Of those, 15 cases (17.9%) had ofloxacin resistance and 6.0% were resistant to kanamycin and capreomycin. Five MDR-TB cases (6.0%) met the criteria of XDR-TB. This survey provides the first estimates of the proportion of XDR-TB among MDR-TB cases in Viet Nam and provides important information for local policies regarding second-line DST. Local policies and programmes that are geared towards TB prevention, early diagnosis and treatment with effective regimens are of high importance.

  6. Multidrug resistance in Lactococcus lactis

    NARCIS (Netherlands)

    Bolhuis, Hendrik

    1996-01-01

    Multidrug resistance (MDR) was initially recongnized as the major cause of the failure of the drug-based treatment of human cancers. It has become increasingly clear that MDR occurs in mammalian cells but also in lower eukaryotes and bacteria. The appearance of multiple antibiotic resistant

  7. Rapid selection of Plasmodium falciparum chloroquine resistance transporter gene and multidrug resistance gene-1 haplotypes associated with past chloroquine and present artemether-lumefantrine use in Inhambane District, southern Mozambique

    DEFF Research Database (Denmark)

    Thomsen, Thomas T; Madsen, Laura B; Hansson, Helle H

    2013-01-01

    Chloroquine (CQ) use in Mozambique was stopped in 2002 and artemether-lumefantrine (AL) was implemented in 2008. In light of no use of CQ and extensive use of AL, we determined the frequency of molecular markers of Plasmodium falciparum drug resistance/tolerance to CQ and AL in persons living...... in Linga-Linga, an isolated peninsula and in Furvela village, which is located 8 km inland. The P. falciparum chloroquine resistance transporter gene CVMNK wild type increased in frequency from 43.9% in 2009 to 66.4% in 2010 (P = 0.001), and combined P. falciparum multidrug resistance gene 1 N86-184F-D1246...... haplotype increased significantly between years (P = 0.039). The combination of P. falciparum chloroquine resistance transporter gene CVMNK and P. falciparum multidrug resistance gene NFD increased from 24.3% (2009) to 45.3% in (2010, P = 0.017). The rapid changes observed may largely be caused by decreased...

  8. Position on mouse chromosome 1 of a gene that controls resistance to Salmonella typhimurium.

    Science.gov (United States)

    Taylor, B A; O'Brien, A D

    1982-06-01

    Ity is a gene which regulates the magnitude of Salmonella typhimurium growth in murine tissues and, hence, the innate salmonella resistance of mice. The results of a five-point backcross clearly showed that the correct gene order on chromosome 1 is fz-Idh-1-Ity-ln-Pep-3.

  9. [A novel chemo-resistant gene MSX2 discovered by establishment of two pancreatic cancer drug resistant cell lines JF305/CDDP and PANC-1/GEM].

    Science.gov (United States)

    Yuan, W; Sui, C G; Ma, X; Ma, J

    2018-05-23

    Objective: To explore new multidrug resistant genes of pancreatic cancer by establishment and characterization of chemo-resistant cell lines. Methods: The cisplatin-resistant cell line JF305/CDDP and the gemcitabine-resistant cell line PANC-1/GEM were induced by high-dose intermittent treatment. CCK-8 assay was used to detect the 50% inhibiting concentration (IC(50)), drug resistance index (R), cross-resistance, and growth difference of different cells. The changes of cell cycle and migration ability of drug-resistant cells were determined by flow cytometry and transwell assay, respectively. And then real-time fluorescence quantitative PCR was used to detect the expression of multidrug resistance-related genes. Results: The drug resistance indexes of JF305/CDDP and PANC-1/GEM were 15.3 and 27.31, respectively, and there was cross-resistance. Compared with the parental cells, the proliferation rate of JF305/CDDP was decreased by 40% on the fourth day ( P PANC-1 cells upregulated MRP2 level ( P PANC-1/GEM, were successfully established. MSX2 might be a new drug resistance related gene in pancreatic cancer cells by up-regulation of MRP2 expression.

  10. Bloodstream infections caused by multi-drug resistant Proteus mirabilis: Epidemiology, risk factors and impact of multi-drug resistance.

    Science.gov (United States)

    Korytny, Alexander; Riesenberg, Klaris; Saidel-Odes, Lisa; Schlaeffer, Fransisc; Borer, Abraham

    2016-01-01

    The prevalence of antimicrobial co-resistance among ESBL-producing Enterobactereaceae is extremely high in Israel. Multidrug-resistant Proteus mirabilis strains (MDR-PM), resistant to almost all antibiotic classes have been described. The aim was to determine the risk factors for bloodstream infections caused by MDR-PM and clinical outcomes. A retrospective case-control study. Adult patients with PM bacteremia during 7 years were identified retrospectively and their files reviewed for demographics, underlying diseases, Charlson Comorbidity Index, treatment and outcome. One hundred and eighty patients with PM-bloodstream infection (BSI) were included; 90 cases with MDR-PM and 90 controls with sensitive PM (S-PM). Compared to controls, cases more frequently were from nursing homes, had recurrent hospital admissions in the past year and received antibiotic therapy in the previous 3 months, were bedridden and suffered from peripheral vascular disease and peptic ulcer disease (p < 0.001). Two-thirds of the MDR-PM isolates were ESBL-producers vs 4.4% of S-PM isolates (p < 0.001, OR = 47.6, 95% CI = 15.9-142.6). In-hospital crude mortality rate of patients with MDR-PM BSI was 37.7% vs 23.3% in those with S-PM BSI (p = 0.0359, OR = 2, 95% CI = 1.4-3.81). PM bacteremia in elderly and functionally-dependent patients is likely to be caused by nearly pan-resistant PM strains in the institution; 51.8% of the patients received inappropriate empiric antibiotic treatment. The crude mortality rate of patients with MDR-PM BSI was significantly higher than that of patients with S-PM BSI.

  11. Identification of a rice gene (Bph 1) conferring resistance to brown planthopper (Nilaparvata lugens Stal) using STS markers.

    Science.gov (United States)

    Kim, Suk-Man; Sohn, Jae-Keun

    2005-08-31

    This study was carried out to identify a high-resolution marker for a gene conferring resistance to brown planthopper (BPH) biotype 1, using japonica type resistant lines. Bulked segregant analyses were conducted using 520 RAPD primers to identify RAPD fragments linked to the BPH resistance gene. Eleven RAPDs were shown to be polymorphic amplicons between resistant and susceptible progeny. One of these primers, OPE 18, which amplified a 923 bp band tightly linked to resistance, was converted into a sequence-tagged-site (STS) marker. The STS marker, BpE18-3, was easily detectable as a dominant band with tight linkage (3.9cM) to Bph1. It promises to be useful as a marker for assisted selection of resistant progeny in backcross breeding programs to introgress the resistance gene into elite japonica cultivars.

  12. Intrachromosomal amplification, locus deletion and point mutation in the aquaglyceroporin AQP1 gene in antimony resistant Leishmania (Viannia guyanensis.

    Directory of Open Access Journals (Sweden)

    Rubens Monte-Neto

    2015-02-01

    Full Text Available Antimony resistance complicates the treatment of infections caused by the parasite Leishmania.Using next generation sequencing, we sequenced the genome of four independent Leishmania guyanensis antimony-resistant (SbR mutants and found different chromosomal alterations including aneuploidy, intrachromosomal gene amplification and gene deletion. A segment covering 30 genes on chromosome 19 was amplified intrachromosomally in three of the four mutants. The gene coding for the multidrug resistance associated protein A involved in antimony resistance was also amplified in the four mutants, most likely through chromosomal translocation. All mutants also displayed a reduced accumulation of antimony mainly due to genomic alterations at the level of the subtelomeric region of chromosome 31 harboring the gene coding for the aquaglyceroporin 1 (LgAQP1. Resistance involved the loss of LgAQP1 through subtelomeric deletions in three mutants. Interestingly, the fourth mutant harbored a single G133D point mutation in LgAQP1 whose role in resistance was functionality confirmed through drug sensitivity and antimony accumulation assays. In contrast to the Leishmania subspecies that resort to extrachromosomal amplification, the Viannia strains studied here used intrachromosomal amplification and locus deletion.This is the first report of a naturally occurred point mutation in AQP1 in antimony resistant parasites.

  13. Multidrug-resistant and extensively drug-resistant tuberculosis: implications for the HIV epidemic and antiretroviral therapy rollout in South Africa.

    Science.gov (United States)

    Andrews, Jason R; Shah, N Sarita; Gandhi, Neel; Moll, Tony; Friedland, Gerald

    2007-12-01

    Drug-resistant tuberculosis (TB) is emerging as a major clinical and public health challenge in areas of sub-Saharan Africa where there is a high prevalence of human immunodeficiency virus (HIV) infection. TB drug-resistance surveillance in this region has been limited by laboratory capacity and the public health infrastructure; however, with the maturation of the HIV epidemic, the burden of drug-resistant TB is increasing rapidly. The recent discovery of large numbers of cases of multidrug-resistant (MDR) TB and extensively drug-resistant (XDR) TB in South Africa likely represents an unrecognized and evolving epidemic rather than sporadic, localized outbreaks. The combination of a large population of HIV-infected susceptible hosts with poor TB treatment success rates, a lack of airborne infection control, limited drug-resistance testing, and an overburdened MDR-TB treatment program provides ideal conditions for an MDR-TB and XDR-TB epidemic of unparalleled magnitude. In the present article, we review the history of drug-resistant TB in South Africa, describe its interaction with the HIV epidemic and the resultant consequences, and suggest measures necessary for controlling MDR-TB and XDR-TB in this context. A successful response to the emergence of MDR-TB and XDR-TB will necessitate increased resources for and collaboration between TB and HIV programs.

  14. miR-297 modulates multidrug resistance in human colorectal carcinoma by down-regulating MRP-2.

    Science.gov (United States)

    Xu, Ke; Liang, Xin; Shen, Ke; Cui, Daling; Zheng, Yuanhong; Xu, Jianhua; Fan, Zhongze; Qiu, Yanyan; Li, Qi; Ni, Lei; Liu, Jianwen

    2012-09-01

    Colorectal carcinoma is a frequent cause of cancer-related death in men and women. miRNAs (microRNAs) are endogenous small non-coding RNAs that regulate gene expression negatively at the post-transcriptional level. In the present study we investigated the possible role of microRNAs in the development of MDR (multidrug resistance) in colorectal carcinoma cells. We analysed miRNA expression levels between MDR colorectal carcinoma cell line HCT116/L-OHP cells and their parent cell line HCT116 using a miRNA microarray. miR-297 showed lower expression in HCT116/L-OHP cells compared with its parental cells. MRP-2 (MDR-associated protein 2) is an important MDR protein in platinum-drug-resistance cells and is a predicted target of miR-297. Additionally miR-297 was down-regulated in a panel of human colorectal carcinoma tissues and negatively correlated with expression levels of MRP-2. Furthermore, we found that ectopic expression of miR-297 in MDR colorectal carcinoma cells reduced MRP-2 protein level and sensitized these cells to anti-cancer drugs in vitro and in vivo. Taken together, our findings suggest that miR-297 could play a role in the development of MDR in colorectal carcinoma cells, at least in part by modulation of MRP-2.

  15. Drug resistance in Mexico: results from the National Survey on Drug-Resistant Tuberculosis.

    Science.gov (United States)

    Bojorquez-Chapela, I; Bäcker, C E; Orejel, I; López, A; Díaz-Quiñonez, A; Hernández-Serrato, M I; Balandrano, S; Romero, M; Téllez-Rojo Solís, M M; Castellanos, M; Alpuche, C; Hernández-Ávila, M; López-Gatell, H

    2013-04-01

    To present estimations obtained from a population-level survey conducted in Mexico of prevalence rates of mono-, poly- and multidrug-resistant strains among newly diagnosed cases of pulmonary tuberculosis (TB), as well as the main factors associated with multidrug resistance (combined resistance to isoniazid and rifampicin). Study data came from the National Survey on TB Drug Resistance (ENTB-2008), a nationally representative survey conducted during 2008-2009 in nine states with a stratified cluster sampling design. Samples were obtained for all newly diagnosed cases of pulmonary TB in selected sites. Drug susceptibility testing (DST) was performed for anti-tuberculosis drugs. DST results were obtained for 75% of the cases. Of these, 82.2% (95%CI 79.5-84.7) were susceptible to all drugs. The prevalence of multidrug-resistant TB (MDR-TB) was estimated at 2.8% (95%CI 1.9-4.0). MDR-TB was associated with previous treatment (OR 3.3, 95%CI 1.1-9.4). The prevalence of drug resistance is relatively low in Mexico. ENTB-2008 can be used as a baseline for future follow-up of drug resistance.

  16. Additional risk factors for infection by multidrug-resistant pathogens in healthcare-associated infection: a large cohort study

    Directory of Open Access Journals (Sweden)

    Cardoso Teresa

    2012-12-01

    Full Text Available Abstract Background There is a lack of consensus regarding the definition of risk factors for healthcare-associated infection (HCAI. The purpose of this study was to identify additional risk factors for HCAI, which are not included in the current definition of HCAI, associated with infection by multidrug-resistant (MDR pathogens, in all hospitalized infected patients from the community. Methods This 1-year prospective cohort study included all patients with infection admitted to a large, tertiary care, university hospital. Risk factors not included in the HCAI definition, and independently associated with MDR pathogen infection, namely MDR Gram-negative (MDR-GN and ESKAPE microorganisms (vancomycin-resistant Enterococcus faecium, methicillin-resistant Staphylococcus aureus, extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella species, carbapenem-hydrolyzing Klebsiella pneumonia and MDR Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter species, were identified by logistic regression among patients admitted from the community (either with community-acquired or HCAI. Results There were 1035 patients with infection, 718 from the community. Of these, 439 (61% had microbiologic documentation; 123 were MDR (28%. Among MDR: 104 (85% had MDR-GN and 41 (33% had an ESKAPE infection. Independent risk factors associated with MDR and MDR-GN infection were: age (adjusted odds ratio (OR = 1.7 and 1.5, p = 0.001 and p = 0.009, respectively, and hospitalization in the previous year (between 4 and 12 months previously (adjusted OR = 2.0 and 1,7, p = 0.008 and p = 0.048, respectively. Infection by pathogens from the ESKAPE group was independently associated with previous antibiotic therapy (adjusted OR = 7.2, p p = 0.003. Patients with infection by MDR, MDR-GN and pathogens from the ESKAPE group had significantly higher rates of inadequate antibiotic therapy than those without (46% vs 7%, 44% vs 10%, 61% vs 15%, respectively, p

  17. A population-based study of first and second-line drug-resistant tuberculosis in a high-burden area of the Mexico/United States border

    Directory of Open Access Journals (Sweden)

    Pola Becerril-Montes

    2013-04-01

    Full Text Available The resistance of 139 Mycobacterium tuberculosis (MTB isolates from the city of Monterrey, Northeast Mexico, to first and second-line anti-TB drugs was analysed. A total of 73 isolates were susceptible and 66 were resistant to anti-TB drugs. Monoresistance to streptomycin, isoniazid (INH and ethambutol was observed in 29 cases. Resistance to INH was found in 52 cases and in 29 cases INH resistance was combined with resistance to two or three drugs. A total of 24 isolates were multidrug-resistant (MDR resistant to at least INH and rifampicin and 11 MDR cases were resistant to five drugs. The proportion of MDR-TB among new TB cases in our target population was 0.72% (1/139 cases. The proportion of MDR-TB among previously treated cases was 25.18% (35/139 cases. The 13 polyresistant and 24 MDR isolates were assayed against the following seven second-line drugs: amikacin (AMK, kanamycin (KAN, capreomycin (CAP, clofazimine (CLF, ethionamide (ETH, ofloxacin (OFL and cycloserine (CLS. Resistance to CLF, OFL or CLS was not observed. Resistance was detected to ETH (10.80% and to AMK (2.70%, KAN (2.70% and CAP (2.70%. One isolate of MDR with primary resistance was also resistant to three second-line drugs. Monterrey has a high prevalence of MDR-TB among previously treated cases and extensively drug-resistant-MTB strains may soon appear.

  18. National Survey of Practices to Prevent Methicillin-Resistant Staphylococcus aureus and Multidrug-Resistant Acinetobacter baumannii in Thailand.

    Science.gov (United States)

    Apisarnthanarak, Anucha; Ratz, David; Khawcharoenporn, Thana; Patel, Payal K; Weber, David J; Saint, Sanjay; Greene, M Todd

    2017-05-15

    We evaluated the extent to which hospital characteristics, infection control practices, and compliance with prevention bundles impacted multidrug-resistant organism (MDRO) infections in Thai hospitals. From 1 January 2014 to 30 November 2014, we surveyed all Thai hospitals with an intensive care unit and ≥250 beds. Infection control practices for methicillin-resistant Staphylococcus aureus (MRSA) and multidrug-resistant Acinetobacter baumannii (MDR-AB) were assessed. Linear regression was used to examine associations between hospital characteristics and prevention bundle compliance and changes in MDRO infection rates. A total of 212 of 245 (86.5%) eligible hospitals responded. Most hospitals regularly used several fundamental infection control practices for MRSA and MDR-AB (ie, contact precautions, private room/cohorting, hand hygiene, environmental cleaning, and antibiotic stewardship); advanced infection control practices (ie, active surveillance, chlorhexidine bathing, decolonization for MRSA, and hydrogen peroxide vaporizer for MDR-AB) were used less commonly. Facilities with ≥75% compliance with the MRSA prevention bundle experienced a 17.4% reduction in MRSA rates (P = .03). Although the presence of environmental cleaning services (41.3% reduction, P = .01) and a microbiology laboratory (82.8% reduction, P = .02) were among characteristics associated with decreases in MDR-AB rates, greater compliance with the MDR-AB prevention bundle did not lead to reductions in MDR-AB rates. Although fundamental MRSA and MDR-AB control practices are used regularly in most Thai hospitals, compliance with more comprehensive bundled prevention approaches is suboptimal. Improving compliance with bundled infection prevention approaches and promoting the integration of certain hospital factors into infection control efforts may help reduce MDRO infections in Thai hospitals. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America

  19. Screening for Resistance to Brown Rust of Sugarcane: Use of Bru1 resistance gene prospects and challenges

    Science.gov (United States)

    Brown rust of sugarcane caused by, Puccinia melanocephala, is a serious problem in the US sugarcane industry. A major resistance gene, Bru1 was identified and methodology for detecting it was developed by French scientists at CIRAD. The majority of the research resulting in the discovery of Bru1 res...

  20. 20(S)-Protopanaxadiol (PPD) analogues chemosensitize multidrug-resistant cancer cells to clinical anticancer drugs.

    Science.gov (United States)

    Liu, Junhua; Wang, Xu; Liu, Peng; Deng, Rongxin; Lei, Min; Chen, Wantao; Hu, Lihong

    2013-07-15

    Novel 20(S)-protopanoxadiol (PPD) analogues were designed, synthesized, and evaluated for the chemosensitizing activity against a multidrug resistant (MDR) cell line (KBvcr) overexpressing P-glycoprotein (P-gp). Structure-activity relationship analysis showed that aromatic substituted aliphatic amine at the 24-positions (groups V) effectively and significantly sensitized P-gp overexpressing multidrug resistant (MDR) cells to anticancer drugs, such as docetaxel (DOC), vincristine (VCR), and adriamycin (ADM). PPD derivatives 12 and 18 showed 1.3-2.6 times more effective reversal ability than verapamil (VER) for DOC and VCR. Importantly, no cytotoxicity was observed by the active PPD analogues (5μM) against both non-MDR and MDR cells, suggesting that PPD analogues serve as novel lead compounds toward a potent and safe resistance modulator. Moreover, a preliminary mechanism study demonstrated that the chemosensitizing activity of PPD analogues results from inhibition of P-glycoprotein (P-gp) overexpressed in MDR cancer cells. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. Preferential cytotoxicity of bortezomib toward highly malignant human liposarcoma cells via suppression of MDR1 expression and function

    International Nuclear Information System (INIS)

    Hu, Yamei; Wang, Lingxian; Wang, Lu; Wu, Xuefeng; Wu, Xudong; Gu, Yanhong; Shu, Yongqian; Sun, Yang; Shen, Yan; Xu, Qiang

    2015-01-01

    Liposarcoma is the most common soft tissue sarcoma with a high risk of relapse. Few therapeutic options are available for the aggressive local or metastatic disease. Here, we report that the clinically used proteasome inhibitor bortezomib exhibits significantly stronger cytotoxicity toward highly malignant human liposarcoma SW872-S cells compared with its parental SW872 cells, which is accompanied by enhanced activation of apoptotic signaling both in vitro and in vivo. Treatment of cells with Jun-N-terminal kinase (JNK) inhibitor SP60015 or the translation inhibitor cycloheximide ameliorated this enhanced apoptosis. Bortezomib inhibited MDR1 expression and function more effectively in SW872-S cells than in SW872 cells, indicating that the increased cytotoxicity relies on the degree of proteasome inhibition. Furthermore, the pharmacological or genetic inhibition of sarco/endoplasmic reticulum calcium-ATPase (SERCA) 2, which is highly expressed in SW872-S cells, resulted in partial reversal of cell growth inhibition and increase of MDR1 expression in bortezomib-treated SW872-S cells. These results show that bortezomib exhibits preferential cytotoxicity toward SW872-S cells possibly via highly expressed SERCA2-associated MDR1 suppression and suggest that bortezomib may serve as a potent agent for treating advanced liposarcoma. - Highlights: • We compare the cytotoxicity of different drugs between SW872-S and SW872 cells. • Highly malignant liposarcoma cells SW872-S show hypersensitivity to bortezomib. • Apoptotic signaling is robustly enhanced in bortezomib-treated SW872-S cells. • Bortezomib has strong suppression on MDR1 expression and function in SW872-S cells. • Inhibition of SERCA2 protects SW872-S cells from bortezomib

  2. Preferential cytotoxicity of bortezomib toward highly malignant human liposarcoma cells via suppression of MDR1 expression and function

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Yamei; Wang, Lingxian; Wang, Lu; Wu, Xuefeng; Wu, Xudong [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Gu, Yanhong; Shu, Yongqian [Department of Clinical Oncology, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210029 (China); Sun, Yang [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Shen, Yan, E-mail: shenyan@nju.edu.cn [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China); Xu, Qiang, E-mail: molpharm@163.com [State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093 (China)

    2015-02-15

    Liposarcoma is the most common soft tissue sarcoma with a high risk of relapse. Few therapeutic options are available for the aggressive local or metastatic disease. Here, we report that the clinically used proteasome inhibitor bortezomib exhibits significantly stronger cytotoxicity toward highly malignant human liposarcoma SW872-S cells compared with its parental SW872 cells, which is accompanied by enhanced activation of apoptotic signaling both in vitro and in vivo. Treatment of cells with Jun-N-terminal kinase (JNK) inhibitor SP60015 or the translation inhibitor cycloheximide ameliorated this enhanced apoptosis. Bortezomib inhibited MDR1 expression and function more effectively in SW872-S cells than in SW872 cells, indicating that the increased cytotoxicity relies on the degree of proteasome inhibition. Furthermore, the pharmacological or genetic inhibition of sarco/endoplasmic reticulum calcium-ATPase (SERCA) 2, which is highly expressed in SW872-S cells, resulted in partial reversal of cell growth inhibition and increase of MDR1 expression in bortezomib-treated SW872-S cells. These results show that bortezomib exhibits preferential cytotoxicity toward SW872-S cells possibly via highly expressed SERCA2-associated MDR1 suppression and suggest that bortezomib may serve as a potent agent for treating advanced liposarcoma. - Highlights: • We compare the cytotoxicity of different drugs between SW872-S and SW872 cells. • Highly malignant liposarcoma cells SW872-S show hypersensitivity to bortezomib. • Apoptotic signaling is robustly enhanced in bortezomib-treated SW872-S cells. • Bortezomib has strong suppression on MDR1 expression and function in SW872-S cells. • Inhibition of SERCA2 protects SW872-S cells from bortezomib.

  3. CYP3A5*3 and MDR1 C3435T are influencing factors of inter-subject variability in rupatadine pharmacokinetics in healthy Chinese volunteers.

    Science.gov (United States)

    Xiong, Yuqing; Yuan, Zhao; Yang, Jingzhi; Xia, Chunhua; Li, Xinhua; Huang, Shibo; Zhang, Hong; Liu, Mingyi

    2016-04-01

    Rupatadine (RUP) is an oral antihistamine and platelet-activating factor antagonist and is shown as the substrate of CYP3A5 and P-gp. The significant interindividual differences of CYP3A5 and P-gp often cause bioavailability differences of some clinical drugs. The present study is aimed to evaluate the effect of genetic polymorphisms of CYP3A5 and MDR1 on RUP pharmacokinetics in healthy male Chinese volunteer subjects. Blood samples were collected from 36 subjects before and after a single, oral RUP 10 mg dose. A PCR-RFLP assay was used to genotype CYP3A5*3 and assess MDR1 C3435T variation. A validated LC-MS/MS method quantified plasma RUP concentration. The relationship between RUP plasma concentration, pharmacokinetic parameters, and polymorphic alleles (CYP3A5 and MDR1) were assessed. Plasma RUP concentrations were lower for CYP3A5*1/*1 carriers than for CYP3A5*3/*3 and CYP3A5*1/*3 carriers. Mean C(max), AUC(0-t) and AUC(0-∞) were significantly lower, and the CLz and Vd were significantly higher in the CYP3A5 wild-type group, than in the CYP3A5 mutated group. MDR1 CT and MDR1 TT carriers had lower plasma RUP concentrations than MDR1 CC carriers. The mean C(max), AUC(0-t), AUC(0-∞) and T max were significantly lower in the TT group than in the CC and CT groups. The mean CLz was higher in the TT group than in the CC and CT groups, but not significantly. These results suggest that CYP3A5 and MDR1 may play a key role in the variability of RUP metabolism and transport, respectively. CYP3A5 and MDR1 polymorphisms may be the main explanation for the differences observed in RUP pharmacokinetics, and therefore may provide a rationale for safe and effective clinical use of RUP. Our research lays down a solid theory foundation to guide the safe and effective clinical use of RUP and a route to achieve individualized therapy.

  4. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    Science.gov (United States)

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  5. Identifying resistance gene analogs associated with resistances to different pathogens in common bean.

    Science.gov (United States)

    López, Camilo E; Acosta, Iván F; Jara, Carlos; Pedraza, Fabio; Gaitán-Solís, Eliana; Gallego, Gerardo; Beebe, Steve; Tohme, Joe

    2003-01-01

    ABSTRACT A polymerase chain reaction approach using degenerate primers that targeted the conserved domains of cloned plant disease resistance genes (R genes) was used to isolate a set of 15 resistance gene analogs (RGAs) from common bean (Phaseolus vulgaris). Eight different classes of RGAs were obtained from nucleotide binding site (NBS)-based primers and seven from not previously described Toll/Interleukin-1 receptor-like (TIR)-based primers. Putative amino acid sequences of RGAs were significantly similar to R genes and contained additional conserved motifs. The NBS-type RGAs were classified in two subgroups according to the expected final residue in the kinase-2 motif. Eleven RGAs were mapped at 19 loci on eight linkage groups of the common bean genetic map constructed at Centro Internacional de Agricultura Tropical. Genetic linkage was shown for eight RGAs with partial resistance to anthracnose, angular leaf spot (ALS) and Bean golden yellow mosaic virus (BGYMV). RGA1 and RGA2 were associated with resistance loci to anthracnose and BGYMV and were part of two clusters of R genes previously described. A new major cluster was detected by RGA7 and explained up to 63.9% of resistance to ALS and has a putative contribution to anthracnose resistance. These results show the usefulness of RGAs as candidate genes to detect and eventually isolate numerous R genes in common bean.

  6. SUSCEPTIBILITY OF RIFAMPICIN-ISONIAZID RESISTANT MYCOBACTERIUM TUBERCULOSIS ISOLATES AGAINST LEVOFLOXACIN

    Directory of Open Access Journals (Sweden)

    A. H. Kurniawan

    2016-01-01

    Full Text Available Background: Tuberculosis (TB is a high burden disease in Indonesia with multidrug-resistant (MDR TB incidence started to increase. Treatment success of MDR-TB globally was low in number than it was targeted which was especially caused by fluoroquinolone resistance. One of the fluoroquinolone is levofloxacin, an antibiotic that has been widely used irrationally as antimicrobial treatment. Therefore, this study investigated the sensitivity and MBC of MDR Mycobacterium tuberculosis isolates against Levofloxacin. Method: The susceptibility test for MDR-Mycobacterium tuberculosis on levofloxacin by standard method with levofloxacin were on concentrations 0,5 μg/ml, 1 μg/ml, and 2 μg/ml. Sample of 8 strains MDR-Mycobacterium tuberculosis were cultured with each concentrations on Middlebrook 7H9 for 1 week incubation. Next, each of the incubated concentration was subcultured on solid media Middlebrook 7H10 for 3 weeks incubation. Colonized agar plates after 3 weeks incubation were confirmed with acid-fast stain. Results: On MB 7H10 with levofloxacin concentration 2 μg/ml showed bactericidal effect 100% by no MDR Mycobacterium tuberculosis colony grew (0/8 while the MB 7H10 with levofloxacin concentration 1 μg/ml and 0,5 μg/ml showed the bactericidal effect 37,5% and 25% respectively. The colonized agar plate implied that the MDR Mycobacterium tuberculosis with levofloxacin concentration 1 μg/ml (5/8 and 0,5 μg/ml (6/8 grew well. Conclusion: Levofloxacin concentration 2 μg/ml was susceptible on MDR Mycobacterium tuberculosis. The concentration 2 μg/ml of levofloxacin could be considered as MBC.

  7. Anethole inhibits growth of recently emerged multidrug resistant toxigenic Vibrio cholerae O1 El Tor variant strains in vitro.

    Science.gov (United States)

    Zahid, M Shamim Hasan; Awasthi, Sharda Prasad; Hinenoya, Atsushi; Yamasaki, Shinji

    2015-05-01

    To search natural compounds having inhibitory effect on bacterial growth is important, particularly in view of growing multidrug resistant (MDR) strains of bacterial pathogens. Like other bacterial pathogens, MDR Vibrio cholerae, the causative agent of diarrheal disease cholera, is becoming a great concern. As an approach of searching new antimicrobial agents, here, we show that anethole, a well-studied natural component of sweet fennel and star anise seeds, could potentially inhibit the growth of MDR O1 El Tor biotype, the ongoing 7th cholera pandemic variant strains of toxigenic V. cholerae. The minimum inhibitory concentration (MIC) of anethole against diverse O1 El Tor biotype strains is evaluated as 200 µg/ml. Moreover, the effect of anethole is bactericidal and exerts rapid-killing action on V. cholerae cells. This study is the first report which demonstrates that anethole, purified from natural compound, is a potent inhibitor of growth of toxigenic V. cholerae. Our data suggest that anethole could be a potential antimicrobial drug candidate, particularly against MDR V. cholerae mediated infections.

  8. Molecular study on some antibiotic resistant genes in Salmonella spp. isolates

    Science.gov (United States)

    Nabi, Ari Q.

    2017-09-01

    Studying the genes related with antimicrobial resistance in Salmonella spp. is a crucial step toward a correct and faster treatment of infections caused by the pathogen. In this work Integron mediated antibiotic resistant gene IntI1 (Class I Integrase IntI1) and some plasmid mediated antibiotic resistance genes (Qnr) were scanned among the isolated non-Typhoid Salmonellae strains with known resistance to some important antimicrobial drugs using Sybr Green real time PCR. The aim of the study was to correlate the multiple antibiotics and antimicrobial resistance of Salmonella spp. with the presence of integrase (IntI1) gene and plasmid mediated quinolone resistant genes. Results revealed the presence of Class I Integrase gene in 76% of the isolates with confirmed multiple antibiotic resistances. Moreover, about 32% of the multiple antibiotic resistant serotypes showed a positive R-PCR for plasmid mediated qnrA gene encoding for nalidixic acid and ciprofloxacin resistance. No positive results could be revealed form R-PCRs targeting qnrB or qnrS. In light of these results we can conclude that the presence of at least one of the qnr genes and/or the presence of Integrase Class I gene were responsible for the multiple antibiotic resistance to for nalidixic acid and ciprofloxacin from the studied Salmonella spp. and further studies required to identify the genes related with multiple antibiotic resistance of the pathogen.

  9. Comparative study on reversal efficacy of SDZ PSC 833, cyclosporin a and verapamil on multidrug resistance in vitro and in vivo

    International Nuclear Information System (INIS)

    Watanabe, Toru; Tsuge, Harumi; Oh-Hara, Tomoko; Naito, Mikihiko; Tsuruo, Takashi

    1995-01-01

    A non-immunosuppressive cyclosporin, SDZ PSC 833 (PSC833), shows a reversal effect on multidrug resistance (MDR) by functional modulation of MDR1 gene product, P-glycoprotein. The objective of the present study was to compare the reversal efficacy of three multidrug resistance modulators, PSC833, cyclosporin A (CsA) and verapamil (Vp). PSC833 has approximately 3-10-fold greater potency than CsA and Vp with respect to the restoring effect on reduced accumulation of doxorubicin (ADM) and vincristine (VCR) in ADM-resistant K562 myelogenous leukemia cells (K562/ADM) in vitro and also on the sensitivity of K562/ADM to ADM and VCR in in vitro growth inhibition. The in vivo efficacy of a combination of modifiers (PSC833 and CsA: 50 mg/kg, Vp 100 mg/kg administered p.o. 4 h before the administration of anticancer drugs) with anticancer drugs (ADM 2.5 mg/kg i.p., Q4D days 1, 5 and 9, VCR 0.05 mg/kg i.p., QD days 1-5) was tested in ADM-resistant P388-bearing mice. PSC833 significantly enhanced the increase in life span by more than 80%, whereas CsA and Vp enhanced by less than 50%. This reversal potency, which exceeded that of CsA and Vp, was confirmed by therapeutic experiments using colon adenocarcinoma 26-bearing mice. These results demonstrated that PSC833 has significant potency to reverse MDR in vitro and in vivo, suggesting that PSC833 is a good candidate for reversing multidrug resistance in clinical situations. (orig.)

  10. Molecular biological studies on the human radioresistance and drug resistance

    International Nuclear Information System (INIS)

    Kim, Chang Min; Hong, Weon Seon

    1992-04-01

    We irradiated the MKN45 and PC14 cell lines with 500 rads and also established the adriamycin-resistant and cis-platinum resistant cell line. The genomic DNA and total RNA were extracted and subjected to the Southern and Northern analysis using various probes including heat shock protein 70, MDR1, fos, TGFb etc. The mRNA transcript was increased 1 hour after the irradiation and sustained during the 48 hours and returned to the level of pre-irradiation. No significant change was observed with the drug resistant cell lines at the level of gene dosage. We suggest that the marked increase of the hsp70 transcript is very important finding and is believed to be a good candidate for the modulation of the cellular response to irradiation and the radioresistance. (Author)

  11. Differences in virulence genes and genome patterns of mastitis-associated Staphylococcus aureus among goat, cow, and human isolates in Taiwan.

    Science.gov (United States)

    Chu, Chishih; Wei, Yajiun; Chuang, Shih-Te; Yu, Changyou; Changchien, Chih-Hsuan; Su, Yaochi

    2013-03-01

    A total of 117 mastitis-associated Staphylococcus aureus isolates from cow, goat, and human patients were analyzed for differences in antibiotic susceptibility, virulence genes, and genotypes using accessory gene regulator (agr) typing, pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Multidrug-resistant (MDR) S. aureus were commonly found in all sources, though they were predominantly found in human and goat isolates. Almost 70% of the isolates were resistant to ampicillin and penicillin. Host-associated virulence genes were identified as follows: tst, a gene encoding toxic shock syndrome toxin, was found in goat isolates; lukED and lukM, genes encoding leukocidin, found in cow isolates; lukPV, a gene encoding leukocidin, found in human isolates; and eta, a gene encoding for exfoliative toxin, found in both human and cow isolates. All four types of hemolysin, α, β, γ, and δ, were identified in human isolates, three types (α, γ, and δ), were identified in cow isolates, and two types (α and δ) were identified in goat isolates. Agr-typing determined agr1 to be the main subtype in human and cow isolates. PFGE and MLST analysis revealed the presence of diverse genotypes among the three sources. In conclusion, mastitis-associated, genetically diverse strains of MDR S. aureus differed in virulence genes among human, cow, and goat isolates.

  12. Changing patterns and trends of multidrug-resistant tuberculosis at referral centre in Northern India: A 4-year experience

    Directory of Open Access Journals (Sweden)

    A K Maurya

    2013-01-01

    Full Text Available Purpose: India has a high burden of drug-resistant tuberculosis (TB, although there is little data on multidrug-resistant tuberculosis (MDR-TB. Although MDR-TB has existed for long time in India, very few diagnostic laboratories are well-equipped to test drug sensitivity. The objectives of this study were to determine the prevalence of MDR-TB, first-line drug resistance patterns and its changing trends in northern India in the 4 years. Materials and Methods: This was a prospective study from July 2007 to December 2010. Microscopy, culture by Bactec460 and p-nitro-α-acetylamino-β-hydroxypropiophenone (NAP test was performed to isolate and identify Mycobacterium tuberculosis (M. tb complex (MTBC. Drug sensitivity testing (DST was performed by 1% proportional method (Bactec460 for four drugs: Rifampicin, isoniazid, ethambutol and streptomycin. Various clinical and demographical profiles were evaluated to analyse risk factors for development of drug resistance. Results: We found the overall prevalence rate of MDR-TB to be 38.8%, increasing from 36.4% in 2007 to 40.8% in 2010. we found that the prevalence of MDR-TB in new and previously treated cases was 29.1% and 43.3% ( P < 0.05; CI 95%. The increasing trend of MDR-TB was more likely in pulmonary TB when compared with extra-pulmonary TB ( P < 0.05; CI 95%. Conclusions: we found a high prevalence (38.8% of MDR-TB both in new cases (29.1% and previously treated cases (43.3%.This study strongly highlights the need to make strategies for testing, surveillance, monitoring and management of such drug-resistant cases.

  13. The midgut cadherin-like gene is not associated with resistance to Bacillus thuringiensis toxin Cry1Ac in Plutella xylostella (L.).

    Science.gov (United States)

    Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun

    2015-03-01

    The Gram-positive bacterium Bacillus thuringiensis (Bt) produces Cry toxins that have been used to control important agricultural pests. Evolution of resistance in target pests threatens the effectiveness of these toxins when used either in sprayed biopesticides or in Bt transgenic crops. Although alterations of the midgut cadherin-like receptor can lead to Bt Cry toxin resistance in many insects, whether the cadherin gene is involved in Cry1Ac resistance of Plutella xylostella (L.) remains unclear. Here, we present experimental evidence that resistance to Cry1Ac or Bt var. kurstaki (Btk) in P. xylostella is not due to alterations of the cadherin gene. The bona fide P. xylostella cadherin cDNA sequence was cloned and analyzed, and comparisons of the cadherin cDNA sequence among susceptible and resistant P. xylostella strains confirmed that Cry1Ac resistance was independent of mutations in this gene. In addition, real-time quantitative PCR (qPCR) indicated that cadherin transcript levels did not significantly differ among susceptible and resistant P. xylostella strains. RNA interference (RNAi)-mediated suppression of cadherin gene expression did not affect larval susceptibility to Cry1Ac toxin. Furthermore, genetic linkage assays using four cadherin gDNA allelic biomarkers confirmed that the cadherin gene is not linked to resistance against Cry1Ac in P. xylostella. Taken together, our findings demonstrate that Cry1Ac resistance of P. xylostella is independent of the cadherin gene. Copyright © 2015 Elsevier Inc. All rights reserved.

  14. Direct detection of Mycobacterium tuberculosis and drug resistance in respiratory specimen using Abbott Realtime MTB detection and RIF/INH resistance assay.

    Science.gov (United States)

    Tam, Kingsley King-Gee; Leung, Kenneth Siu-Sing; To, Sabrina Wai-Chi; Siu, Gilman Kit-Hang; Lau, Terrence Chi-Kong; Shek, Victor Chi-Man; Tse, Cindy Wing-Sze; Wong, Samson Sai-Yin; Ho, Pak-Leung; Yam, Wing-Cheong

    2017-10-01

    Abbott RealTime MTB (Abbott-RT) in conjunction with Abbott RealTime MTB RIF/INH Resistance (Abbott-RIF/INH) is a new, high-throughput automated nucleic acid amplification platform (Abbott-MDR) for detection of Mycobacterium tuberculosis complex (MTBC) and the genotypic markers for rifampicin (RIF) and isoniazid (INH) resistance directly from respiratory specimens. This prospective study evaluated the diagnostic performance of this new platform for MTBC and multidrug-resistant tuberculosis (MDR-TB) using 610 sputum specimens in a tuberculosis high-burden setting. Using conventional culture results and clinical background as reference standards, Abbott-RT exhibited an overall sensitivity and specificity of 95.2% and 99.8%, respectively. Genotypic RIF/INH resistance of 178 "MTB detected" specimens was subsequently analyzed by Abbott-RIF/INH. Compared to phenotypic drug susceptibility test results, Abbott-RIF/INH detected resistance genotypic markers in 84.6% MDR-TB, 80% mono-RIF-resistant and 66.7% mono-INH-resistant specimens. Two of the RIF-resistant specimens carried a novel single, nonsense mutation at rpoB Q513 and in silico simulation demonstrated that the truncated RpoB protein failed to bind with other subunits for transcription. Overall, Abbott-MDR platform provided high throughput and reliable diagnosis of MDR-TB within a TB high-burden region. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. A study of multidrug-resistant tuberculosis in risk groups in the city of Santos, São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Andréa Gobetti Vieira Coelho

    2012-09-01

    Full Text Available Monitoring the extent of and trends in multidrug-resistant tuberculosis (MDR-TB is a priority of the Brazilian National Tuberculosis Control Programme. The current study aimed to estimate the incidence of MDR-TB, describe the profile of TB drug resistance in risk groups and examine whether screening for MDR-TB adhered to the recommended guidelines. A descriptive study that examined diagnosed cases of pulmonary TB was conducted in the city of Santos, Brazil, between 2000-2004. Of the 2,176 pulmonary TB cases studied, 671 (30.8% met the criteria for drug sensitivity testing and, of these cases, 31.7% (213/671 were tested. Among the tested cases, 9.4% were resistant to one anti-TB drug and 15% were MDR. MDR was observed in 11.6% of 86 new TB cases and 17.3% of 127 previously treated cases. The average annual incidence of MDR-TB was 1.9 per 100,000 inhabitants-years. The extent of known MDR-TB in the city of Santos is high, though likely to be underestimated. Our study therefore indicates an inadequate adherence to the guidelines for MDR-TB screening and suggests the necessity of alternative strategies of MDR-TB surveillance.

  16. Use of Lot Quality Assurance Sampling to Ascertain Levels of Drug Resistant Tuberculosis in Western Kenya.

    Directory of Open Access Journals (Sweden)

    Julia Jezmir

    Full Text Available To classify the prevalence of multi-drug resistant tuberculosis (MDR-TB in two different geographic settings in western Kenya using the Lot Quality Assurance Sampling (LQAS methodology.The prevalence of drug resistance was classified among treatment-naïve smear positive TB patients in two settings, one rural and one urban. These regions were classified as having high or low prevalence of MDR-TB according to a static, two-way LQAS sampling plan selected to classify high resistance regions at greater than 5% resistance and low resistance regions at less than 1% resistance.This study classified both the urban and rural settings as having low levels of TB drug resistance. Out of the 105 patients screened in each setting, two patients were diagnosed with MDR-TB in the urban setting and one patient was diagnosed with MDR-TB in the rural setting. An additional 27 patients were diagnosed with a variety of mono- and poly- resistant strains.Further drug resistance surveillance using LQAS may help identify the levels and geographical distribution of drug resistance in Kenya and may have applications in other countries in the African Region facing similar resource constraints.

  17. Use of Lot Quality Assurance Sampling to Ascertain Levels of Drug Resistant Tuberculosis in Western Kenya.

    Science.gov (United States)

    Jezmir, Julia; Cohen, Ted; Zignol, Matteo; Nyakan, Edwin; Hedt-Gauthier, Bethany L; Gardner, Adrian; Kamle, Lydia; Injera, Wilfred; Carter, E Jane

    2016-01-01

    To classify the prevalence of multi-drug resistant tuberculosis (MDR-TB) in two different geographic settings in western Kenya using the Lot Quality Assurance Sampling (LQAS) methodology. The prevalence of drug resistance was classified among treatment-naïve smear positive TB patients in two settings, one rural and one urban. These regions were classified as having high or low prevalence of MDR-TB according to a static, two-way LQAS sampling plan selected to classify high resistance regions at greater than 5% resistance and low resistance regions at less than 1% resistance. This study classified both the urban and rural settings as having low levels of TB drug resistance. Out of the 105 patients screened in each setting, two patients were diagnosed with MDR-TB in the urban setting and one patient was diagnosed with MDR-TB in the rural setting. An additional 27 patients were diagnosed with a variety of mono- and poly- resistant strains. Further drug resistance surveillance using LQAS may help identify the levels and geographical distribution of drug resistance in Kenya and may have applications in other countries in the African Region facing similar resource constraints.

  18. Characterization of the duodenase-1 gene and its associations with resistance to Streptococuus agalactiae in hybrid tilapia (Oreochromis spp.).

    Science.gov (United States)

    Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

    2015-08-01

    Tilapia is a group of cultured teleost fishes whose production is threatened by some diseases. Identification of DNA markers associated with disease resistance in candidate genes may facilitate to accelerate the selection of disease resistance. The gene encoding a duodenase, which can trigger immune response, has not been studied in fish. We characterized the cDNA of duodenase-1 gene of hybrid tilapia. Its ORF is 759 bp, encoding a serine protease of 252 amino acids. This gene consisted of five exons and four introns. Its expression was detected in all 10 tissues examined, and it was highly expressed in the intestine and kidney. After a challenge with the bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the intestine, liver and spleen. We identified seven SNPs in the gene and found that four of them were significantly associated with the resistance to S. agalactiae (P tilapia. The SNP markers in the duodenase-1 gene associated with resistance to the bacterial pathogen, may facilitate the selection of tilapia resistant to the bacterial disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. [The differences of the effects of Vrd1 and Ppd-D1 gene alleles on winterhardiness, frost resistance, and yield in winter wheat].

    Science.gov (United States)

    Mokanu, N V; Faĭt, V I

    2008-01-01

    The influence of allelic differences of Vrd1 and Ppd-D1 genes on winterhardiness, frost resistance, yield and its components was studied in recombinant-inbred F5 lines of Odesskaya 16/Bezostaya 1. From 9 to 15% differences in the resistance of recombinant-inbred lines were determined by alternative alleles of Vrd1 gene and 10-16% of Ppd-D1 gene. Interaction of vrd1 and Ppd-D1a alleles led to the higher winterhardiness and frost resistance of tillered plants during the winter. At the same time the significant increase of the period to heading, plant height and the tendency of yield reduction were revealed for vrd1 vrd1 Ppd-D1a Ppd-D1a lines when compared to the lines of Vrd1 Vrd1 Ppd-D1a Ppd-D1a genotype.

  20. The Role of Adjunctive Therapies in Septic Shock by Gram Negative MDR/XDR Infections.

    Science.gov (United States)

    Busani, Stefano; Roat, Erika; Serafini, Giulia; Mantovani, Elena; Biagioni, Emanuela; Girardis, Massimo

    2017-01-01

    Patients with septic shock by multidrug resistant microorganisms (MDR) are a specific sepsis population with a high mortality risk. The exposure to an initial inappropriate empiric antibiotic therapy has been considered responsible for the increased mortality, although other factors such as immune-paralysis seem to play a pivotal role. Therefore, beyond conventional early antibiotic therapy and fluid resuscitation, this population may benefit from the use of alternative strategies aimed at supporting the immune system. In this review we present an overview of the relationship between MDR infections and immune response and focus on the rationale and the clinical data available on the possible adjunctive immunotherapies, including blood purification techniques and different pharmacological approaches.

  1. The Role of Adjunctive Therapies in Septic Shock by Gram Negative MDR/XDR Infections

    Directory of Open Access Journals (Sweden)

    Stefano Busani

    2017-01-01

    Full Text Available Patients with septic shock by multidrug resistant microorganisms (MDR are a specific sepsis population with a high mortality risk. The exposure to an initial inappropriate empiric antibiotic therapy has been considered responsible for the increased mortality, although other factors such as immune-paralysis seem to play a pivotal role. Therefore, beyond conventional early antibiotic therapy and fluid resuscitation, this population may benefit from the use of alternative strategies aimed at supporting the immune system. In this review we present an overview of the relationship between MDR infections and immune response and focus on the rationale and the clinical data available on the possible adjunctive immunotherapies, including blood purification techniques and different pharmacological approaches.

  2. Malnutrition associated with unfavorable outcome and death among South African MDR-TB and HIV co-infected children.

    Science.gov (United States)

    Hicks, R M; Padayatchi, N; Shah, N S; Wolf, A; Werner, L; Sunkari, V B; O'Donnell, M R

    2014-09-01

    Pediatric multidrug-resistant tuberculosis (MDR-TB) is complicated by difficult diagnosis, complex treatment, and high mortality. In South Africa, these challenges are amplified by human immunodeficiency virus (HIV) co-infection; however, evidence on treatment outcomes among co-infected children is limited. Using conventional and new pediatric definitions, to describe treatment outcomes and identify risk factors for unfavorable outcome and mortality in children aged children (median age 8 years, IQR 4-12) with MDR-TB (n = 78) or XDR-TB (n = 6) initiated treatment. Sixty-four (77%) were HIV-positive and 62 (97%) received antiretroviral therapy. Sixty-six (79%) achieved favorable treatment outcomes. Overall mortality was 11% (n = 9) at 18 months after initiation of treatment. Malnutrition (aOR 27.4, 95%CI 2.7-278.7) and severe radiographic findings (aOR 4.68, 95%CI 1.01-21.9) were associated with unfavorable outcome. New pediatric outcome definitions increased the proportion classified as cured. It is possible to successfully treat pediatric MDR-TB-HIV even in resource-poor settings. Malnutrition is a marker for severe TB-HIV disease, and is a potential target for future interventions in these patients.

  3. The Burden of Drug-Resistant Tuberculosis in Papua New Guinea: Results of a Large Population-Based Survey.

    Directory of Open Access Journals (Sweden)

    Paul Aia

    Full Text Available Reliable estimates of the burden of multidrug-resistant tuberculosis (MDR-TB are crucial for effective control and prevention of tuberculosis (TB. Papua New Guinea (PNG is a high TB burden country with limited information on the magnitude of the MDR-TB problem.A cross-sectional study was conducted in four PNG provinces: Madang, Morobe, National Capital District and Western Province. Patient sputum samples were tested for rifampicin resistance by the Xpert MTB/RIF assay and those showing the presence of resistance underwent phenotypic susceptibility testing to first- and second-line anti-TB drugs including streptomycin, isoniazid, rifampicin, ethambutol, pyrazinamide, ofloxacin, amikacin, kanamycin and capreomycin.Among 1,182 TB patients enrolled in the study, MDR-TB was detected in 20 new (2.7%; 95% confidence intervals [CI] 1.1-4.3% and 24 previously treated (19.1%; 95%CI: 8.5-29.8% TB cases. No case of extensively drug-resistant TB (XDR-TB was detected. Thirty percent (6/20 of new and 33.3% (8/24 of previously treated cases with MDR-TB were detected in a single cluster in Western Province.In PNG the proportion of MDR-TB in new cases is slightly lower than the regional average of 4.4% (95%CI: 2.6-6.3%. A large proportion of MDR-TB cases were identified from a single hospital in Western Province, suggesting that the prevalence of MDR-TB across the country is heterogeneous. Future surveys should further explore this finding. The survey also helped strengthening the use of smear microscopy and Xpert MTB/RIF testing as diagnostic tools for TB in the country.

  4. Impact of drug resistance on the tuberculosis treatment outcome

    Directory of Open Access Journals (Sweden)

    E. Lesnic

    2017-03-01

    Full Text Available Background. The standard treatment of a new case of multidrug-resistant tuberculosis (MDR-TB according to WHO recommendations in the Republic of Moldova is performed since 2005 showing a low treatment succes. Actually the treatment success rate increased due to excluding of MDR-TB patients from the general cohort. The major rate of patients with low outcome is represented by the failed and lost to follow-up cases. The purpose of the study was to assess the impact of multidrug-resiatnce and MDR-TB on the tuberculosis treatment outcome. Materials and methods. A retrospective selective, descriptive study targeting social, demographic, economic and epidemiological peculiarities, case-management, diagnostic radiological aspects and microbiological characteristics of 187 patients with pulmonary tuberculosis registered during 2013–2015 distributed in two groups: 1st group (61 patients with established multidrug-resistant strains using conventional cultural methods and the 2nd group (126 patients with MDR-TB. Results. Multidrug-resistance was established more frequently in new cases and MDR-TB in two thirds of retreated patients. No difference was identified in gender and age distribution, social, economical, educational characteristics; case-management assessment identified a similar proportion of patients revealed by general practitioners and specialists, with low rate of screened high risk groups. All patients from the multidrug-resistant group began the standard treatment for drug-responsiveness tuberculosis before drug susceptibility testing and one third of MDR-TB group was treated from the onset with the DOTS-Plus regimen. Highest success rate was identified in the new-case subgroups of both groups and higher rate of died patients was determined in the retreated subgroups. Such a low rate of patients aggrevates the resistance. Conclusions. Early diagnosis, drug responsiveness testing and raising awareness among about treatment compliance will

  5. Resistance to antibiotics in Lacid acid bacteria - strain Lactococcus

    Directory of Open Access Journals (Sweden)

    Filipić Brankica

    2015-01-01

    Full Text Available Lactic acid bacteria (LAB are widely used in the food industry, especially in the production of fermented dairy products and meat. The most studied species among Lis Lactococcus lactis. L. lactis strains are of great importance in the production of fermented dairy products such as yogurt, butter, fresh cheese and some kind of semi-hard cheese. Although L. lactis acquired the „Generally Regarded As Safe“ (GRAS status, many investigations indicated that lactococci may act as reservoirs of antibiotic resistance genes, which could be transferred to other bacterial species in human gastrointestinal tract includ­ing pathogens. The genome analysis of L. lactis indicated the presence of at least 40 putative drug transporter genes, and only four multidrug resistance (MDR transporters are functionally characterized: LmrA, LmrP, LmrCD i CmbT. LmrA is the first described MDR transporter in prokaryotes. LmrCD is responsible for resistance to cholate, which is an integral part of human bile and LmrCD is important for intestinal survival of lactococci that are used as probiotics. Secondary multidrug transporter LmrP confers resistance to lincosamides, macrolides, streptogramins and tetracyclines. CmbT protein has an effect on the host cell resistance to lincomycin, sulfadiazine, streptomycin, rifampicin, puromycin and sulfametox­azole. Since the food chain is an important way of transmitting resistance genes in human and animal population, it is of great importance to study the mechanisms of resistance in lactococci and other LAB, intended for the food industry. [Projekat Ministarstva nauke Republike Srbije, br. 173019: Izučavanje gena i molekularnih mehanizama u osnovi probiotičke aktivnosti bakterija mlečne kiseline izolovanih sa područja Zapadnog Balkana

  6. Characterization of quinolone-resistant Enterobacteriaceae strains isolated from poultry in Western Algeria: First report of qnrS in an Enterobacter cloacae

    Directory of Open Access Journals (Sweden)

    Qada Benameur

    2018-04-01

    Full Text Available Aim: Multidrug-resistant (MDR Enterobacteriaceae have frequently been reported, in both human and veterinary medicine, from different parts of the world as a consequence of antibiotic usage. However, there is a lack of published data regarding antimicrobial resistance in non-Escherichia coli (E. coli Enterobacteriaceae from animals in Algeria. This study aimed to evaluate the frequency of resistance to antibiotics with a focus on quinolones and to investigate the presence of qnr genes in Enterobacteriaceae of poultry origin. Materials and Methods: A total of 310 samples of poultry origin were collected from 2010 to 2014 from broiler and layer farms and hatcheries located in different geographic areas of Western Algeria (including Mostaganem, Oran, Mascara, Relizane, Chlef, Tiaret, and Tissemsilt. Antimicrobial susceptibility testing was performed using disc diffusion assay. Polymerase chain reaction and sequencing accomplished the characterization of qnr genes (qnrA, qnrB, and qnrS. Results: A total of 253 Enterobacteriaceae strains were isolated in this study. These isolates exhibited high levels of resistance to quinolones and other families of antibiotics. All the strains isolated in this study were resistant to at least one antibiotic. Among them, 233 (92.09% were considered MDR. Among the 18 randomly selected nalidixic acid (NA- resistant Enterobacteriaceae isolates, one E. coli and one Enterobacter cloacae were carrying qnrS1. By contrast, qnrA and qnrB were not detected in this study. Conclusion: This is the first report on the identification of the qnrS gene in E. cloacae isolated from animal source in Algeria. Further studies have to be conducted to determine the real prevalence of qnr genes.

  7. Genomic analysis of globally diverse Mycobacterium tuberculosis strains provides insights into emergence and spread of multidrug resistance

    Science.gov (United States)

    Manson, Abigail L.; Cohen, Keira A.; Abeel, Thomas; Desjardins, Christopher A.; Armstrong, Derek T.; Barry, Clifton E.; Brand, Jeannette; Chapman, Sinéad B.; Cho, Sang-Nae; Gabrielian, Andrei; Gomez, James; Jodals, Andreea M.; Joloba, Moses; Jureen, Pontus; Lee, Jong Seok; Malinga, Lesibana; Maiga, Mamoudou; Nordenberg, Dale; Noroc, Ecaterina; Romancenco, Elena; Salazar, Alex; Ssengooba, Willy; Velayati, A. A.; Winglee, Kathryn; Zalutskaya, Aksana; Via, Laura E.; Cassell, Gail H.; Dorman, Susan E.; Ellner, Jerrold; Farnia, Parissa; Galagan, James E.; Rosenthal, Alex; Crudu, Valeriu; Homorodean, Daniela; Hsueh, Po-Ren; Narayanan, Sujatha; Pym, Alexander S.; Skrahina, Alena; Swaminathan, Soumya; Van der Walt, Martie; Alland, David; Bishai, William R.; Cohen, Ted; Hoffner, Sven; Birren, Bruce W.; Earl, Ashlee M.

    2017-01-01

    Multidrug-resistant tuberculosis (MDR-TB), caused by drug resistant strains of Mycobacterium tuberculosis, is an increasingly serious problem worldwide. In this study, we examined a dataset of 5,310 M. tuberculosis whole genome sequences from five continents. Despite great diversity with respect to geographic point of isolation, genetic background and drug resistance, patterns of drug resistance emergence were conserved globally. We have identified harbinger mutations that often precede MDR. In particular, the katG S315T mutation, conferring resistance to isoniazid, overwhelmingly arose before rifampicin resistance across all lineages, geographic regions, and time periods. Molecular diagnostics that include markers for rifampicin resistance alone will be insufficient to identify pre-MDR strains. Incorporating knowledge of pre-MDR polymorphisms, particularly katG S315, into molecular diagnostics will enable targeted treatment of patients with pre-MDR-TB to prevent further development of MDR-TB. PMID:28092681

  8. Co-occurrence of colistin-resistance genes mcr-1 and mcr-3 among multidrug-resistant Escherichia coli isolated from cattle, Spain, September 2015.

    Science.gov (United States)

    Hernández, Marta; Iglesias, M Rocío; Rodríguez-Lázaro, David; Gallardo, Alejandro; Quijada, Narciso; Miguela-Villoldo, Pedro; Campos, Maria Jorge; Píriz, Segundo; López-Orozco, Gema; de Frutos, Cristina; Sáez, José Luis; Ugarte-Ruiz, María; Domínguez, Lucas; Quesada, Alberto

    2017-08-03

    Colistin resistance genes mcr-3 and mcr-1 have been detected in an Escherichia coli isolate from cattle faeces in a Spanish slaughterhouse in 2015. The sequences of both genes hybridised to same plasmid band of ca 250 kb, although colistin resistance was non-mobilisable. The isolate was producing extended-spectrum beta-lactamases and belonged to serotype O9:H10 and sequence type ST533. Here we report an mcr-3 gene detected in Europe following earlier reports from Asia and the United States. This article is copyright of The Authors, 2017.

  9. Evolution of Regions Containing Antibiotic Resistance Genes in FII-2-FIB-1 ColV-Colla Virulence Plasmids.

    Science.gov (United States)

    Moran, Robert A; Hall, Ruth M

    2018-05-01

    Three ColV virulence plasmids carrying antibiotic resistance genes were assembled from draft genome sequences of commensal ST95, ST131, and ST2705 Escherichia coli isolates from healthy Australians. Plasmids pCERC4, pCERC5, and pCERC9 include almost identical backbones containing FII-2 and FIB-1 replicons and the conserved ColV virulence region with an additional ColIa determinant. Only pCERC5 includes a complete, uninterrupted F-like transfer region and was able to conjugate. pCERC5 and pCERC9 contain Tn1721, carrying the tet(A) tetracycline resistance determinant in the same location, with Tn2 (bla TEM ; ampicillin resistance) interrupting the Tn1721 in pCERC5. pCERC4 has a Tn1721/Tn21 hybrid transposon carrying dfrA5 (trimethoprim resistance) and sul1 (sulfamethoxazole resistance) in a class 1 integron. Four FII-2:FIB-1 ColV-ColIa plasmids in the GenBank nucleotide database have a related transposon in the same position, but an IS26 has reshaped the resistance gene region, deleting 2,069 bp of the integron 3'-CS, including sul1, and serving as a target for IS26 translocatable units containing bla TEM , sul2 and strAB (streptomycin resistance), or aphA1 (kanamycin/neomycin resistance). Another ColV-ColIa plasmid containing a related resistance gene region has lost the FII replicon and acquired a unique transfer region via recombination within the resistance region and at oriT. Eighteen further complete ColV plasmid sequences in GenBank contained FIB-1, but the FII replicons were of three types, FII-24, FII-18, and a variant of FII-36.

  10. P-glycoprotein binds to ezrin at amino acid residues 149-242 in the FERM domain and plays a key role in the multidrug resistance of human osteosarcoma.

    Science.gov (United States)

    Brambilla, Daria; Zamboni, Silvia; Federici, Cristina; Lugini, Luana; Lozupone, Francesco; De Milito, Angelo; Cecchetti, Serena; Cianfriglia, Maurizio; Fais, Stefano

    2012-06-15

    Overexpression of the mdr1 gene encoding P-glycoprotein (Pgp) exerts a major role in reducing the effectiveness of cytotoxic therapy in osteosarcoma. The interaction between actin and Pgp has been shown to be instrumental in the establishment of multidrug resistance (MDR) in human tumor cells. The cytoskeleton linker ezrin exerts a pivotal role in maintaining the functional connection between actin and Pgp. We investigated the role of ezrin in a human multidrug-resistant osteosarcoma cell line overexpressing Pgp and compared it to its counterpart that overexpresses an ezrin deletion mutant. The results showed that Pgp binds at amino acid residues 149-242 of the N-terminal domain of ezrin. The interaction between ezrin and Pgp occurs in the plasma membrane of MDR cells, where they also co-localize with the ganglioside G(M1) located in lipid rafts. The overexpression of the ezrin deletion mutant entirely restored drug susceptibility of osteosarcoma cells, consistent with Pgp dislocation to cytoplasmic compartments and abrogation of G(M1) /Pgp co-localization at the plasma membrane. Our study provides evidence that ezrin exerts a key role in MDR of human osteosarcoma cells through a Pgp-ezrin-actin connection that is instrumental for the permanence of Pgp into plasma membrane lipid rafts. We also show for the first time that Pgp-binding site is localized to amino acid residues 149-242 of the ezrin Band 4.1, Ezrin/Radixin/Moesin (FERM) domain, thus proposing a specific target for future molecular therapy aimed at counteracting MDR in osteosarcoma patients. Copyright © 2011 UICC.

  11. Outbreak of resistant Acinetobacter baumannii- measures and proposal for prevention and control.

    Science.gov (United States)

    Romanelli, Roberta Maia de Castro; Jesus, Lenize Adriana de; Clemente, Wanessa Trindade; Lima, Stella Sala Soares; Rezende, Edna Maria; Coutinho, Rosane Luiza; Moreira, Ricardo Luiz Fontes; Neves, Francelli Aparecida Cordeiro; Brás, Nelma de Jesus

    2009-10-01

    Acinetobacter baumannii colonization and infection, frequent in Intensive Care Unit (ICU) patients, is commonly associated with high morbimortality. Several outbreaks due to multidrug-resistant (MDR) A. baumanii have been reported but few of them in Brazil. This study aimed to identify risk factors associated with colonization and infection by MDR and carbapenem-resistant A. baumannii strains isolated from patients admitted to the adult ICU at HC/UFMG. A case-control study was performed from January 2007 to June 2008. Cases were defined as patients colonized or infected by MDR/carbapenem-resistant A. baumannii, and controls were patients without MDR/carbapenem-resistant A. baumannii isolation, in a 1:2 proportion. For statistical analysis, due to changes in infection control guidelines, infection criteria and the notification process, this study was divided into two periods. During the first period analyzed, from January to December 2007, colonization or infection by MDR/carbapenem-resistant A. baumannii was associated with prior infection, invasive device utilization, prior carbapenem use and clinical severity. In the multivariate analysis, prior infection and mechanical ventilation proved to be statistically significant risk factors. Carbapenem use showed a tendency towards a statistical association. During the second study period, from January to June 2008, variables with a significant association with MDR/carbapenem-resistant A. baumannii colonization/infection were catheter utilization, carbapenem and third-generation cephalosporin use, hepatic transplantation, and clinical severity. In the multivariate analysis, only CVC use showed a statistical difference. Carbapenem and third-generation cephalosporin use displayed a tendency to be risk factors. Risk factors must be focused on infection control and prevention measures considering A. baumanni dissemination.

  12. Outbreak of resistant Acinetobacter baumannii: measures and proposal for prevention and control

    Directory of Open Access Journals (Sweden)

    Roberta Maia de Castro Romanelli

    Full Text Available Acinetobacter baumannii colonization and infection, frequent in Intensive Care Unit (ICU patients, is commonly associated with high morbimortality. Several outbreaks due to multidrug-resistant (MDR A. baumanii have been reported but few of them in Brazil. This study aimed to identify risk factors associated with colonization and infection by MDR and carbapenem-resistant A. baumannii strains isolated from patients admitted to the adult ICU at HC/UFMG. A case-control study was performed from January 2007 to June 2008. Cases were defined as patients colonized or infected by MDR/carbapenem-resistant A. baumannii, and controls were patients without MDR/carbapenem-resistant A. baumannii isolation, in a 1:2 proportion. For statistical analysis, due to changes in infection control guidelines, infection criteria and the notification process, this study was divided into two periods. During the first period analyzed, from January to December 2007, colonization or infection by MDR/carbapenem-resistant A. baumannii was associated with prior infection, invasive device utilization, prior carbapenem use and clinical severity. In the multivariate analysis, prior infection and mechanical ventilation proved to be statistically significant risk factors. Carbapenem use showed a tendency towards a statistical association. During the second study period, from January to June 2008, variables with a significant association with MDR/carbapenem-resistant A. baumannii colonization/infection were catheter utilization, carbapenem and third-generation cephalosporin use, hepatic transplantation, and clinical severity. In the multivariate analysis, only CVC use showed a statistical difference. Carbapenem and third-generation cephalosporin use displayed a tendency to be risk factors. Risk factors must be focused on infection control and prevention measures considering A. baumanni dissemination.

  13. Heterologous Expression of the Cotton NBS-LRR Gene GbaNA1 Enhances Verticillium Wilt Resistance in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Nan-Yang Li

    2018-02-01

    Full Text Available Verticillium wilt caused by Verticillium dahliae results in severe losses in cotton, and is economically the most destructive disease of this crop. Improving genetic resistance is the cleanest and least expensive option to manage Verticillium wilt. Previously, we identified the island cotton NBS-LRR-encoding gene GbaNA1 that confers resistance to the highly virulent V. dahliae isolate Vd991. In this study, we expressed cotton GbaNA1 in the heterologous system of Arabidopsis thaliana and investigated the defense response mediated by GbaNA1 following inoculations with V. dahliae. Heterologous expression of GbaNA1 conferred Verticillium wilt resistance in A. thaliana. Moreover, overexpression of GbaNA1 enabled recovery of the resistance phenotype of A. thaliana mutants that had lost the function of GbaNA1 ortholog gene. Investigations of the defense response in A. thaliana showed that the reactive oxygen species (ROS production and the expression of genes associated with the ethylene signaling pathway were enhanced significantly following overexpression of GbaNA1. Intriguingly, overexpression of the GbaNA1 ortholog from Gossypium hirsutum (GhNA1 in A. thaliana did not induce the defense response of ROS production due to the premature termination of GhNA1, which lacks the encoded NB-ARC and LRR motifs. GbaNA1 therefore confers Verticillium wilt resistance in A. thaliana by the activation of ROS production and ethylene signaling. These results demonstrate the functional conservation of the NBS-LRR-encoding GbaNA1 in a heterologous system, and the mechanism of this resistance, both of which may prove valuable in incorporating GbaNA1-mediated resistance into other plant species.

  14. Community-based MDR-TB care project improves treatment initiation in patients diagnosed with MDR-TB in Myanmar.

    Science.gov (United States)

    Wai, Pyae Phyo; Shewade, Hemant Deepak; Kyaw, Nang Thu Thu; Thein, Saw; Si Thu, Aung; Kyaw, Khine Wut Yee; Aye, Nyein Nyein; Phyo, Aye Mon; Maung, Htet Myet Win; Soe, Kyaw Thu; Aung, Si Thu

    2018-01-01

    The Union in collaboration with national TB programme (NTP) started the community-based MDR-TB care (CBMDR-TBC) project in 33 townships of upper Myanmar to improve treatment initiation and treatment adherence. Patients with MDR-TB diagnosed/registered under NTP received support through the project staff, in addition to the routine domiciliary care provided by NTP staff. Each township had a project nurse exclusively for MDR-TB and 30 USD per month (max. for 4 months) were provided to the patient as a pre-treatment support. To assess whether CBMDR-TBC project's support improved treatment initiation. In this cohort study (involving record review) of all diagnosed MDR-TB between January 2015 and June 2016 in project townships, CBMDR-TBC status was categorized as "receiving support" if date of project initiation in patient's township was before the date of diagnosis and "not receiving support", if otherwise. Cox proportional hazards regression (censored on 31 Dec 2016) was done to identify predictors of treatment initiation. Of 456 patients, 57% initiated treatment: 64% and 56% among patients "receiving support (n = 208)" and "not receiving support (n = 228)" respectively (CBMDR-TBC status was not known in 20 (4%) patients due to missing diagnosis dates). Among those initiated on treatment (n = 261), median (IQR) time to initiate treatment was 38 (20, 76) days: 31 (18, 50) among patients "receiving support" and 50 (26,101) among patients "not receiving support". After adjusting other potential confounders (age, sex, region, HIV, past history of TB treatment), patients "receiving support" had 80% higher chance of initiating treatment [aHR (0.95 CI): 1.8 (1.3, 2.3)] when compared to patients "not receiving support". In addition, age 15-54 years, previous history of TB and being HIV negative were independent predictors of treatment initiation. Receiving support under CBMDR-TBC project improved treatment initiation: it not only improved the proportion initiated but also

  15. Distinct effects of struvite and biochar amendment on the class 1 integron antibiotic resistance gene cassettes in phyllosphere and rhizosphere.

    Science.gov (United States)

    An, Xin-Li; Chen, Qing-Lin; Zhu, Dong; Su, Jian-Qiang

    2018-08-01

    Struvite recovered from wastewater is promising for recycling phosphorus into soil as fertilizers. However, struvite application may prompt the proliferation of antibiotic resistance in soil and plant. This study examined the impacts of struvite application and biochar amendment on integrons abundance and gene cassette contexts in rhizosphere soil and phyllosphere using quantitative PCR and clone library analysis. Microcosm experiments revealed that class 1 integron was the most prevalent in all samples, with higher concentration and higher relative abundance in rhizosphere than those in phyllosphere. The majority of resistance gene cassettes were associated with genes encoding resistance to aminoglycosides, beta-lactams and chloramphenicols. Struvite application significantly increased the genetic diversity of antibiotic resistance gene cassettes in both rhizosphere and phyllosphere. However, biochar amendment attenuated the increasing effect of struvite application exerting on the class 1 integron antibiotic resistance gene cassette pool in phyllosphere. These findings highlighted human activities to be the source of integron gene cassette pool and raised the possibility of using biochar amendment as an alternative mean for mitigating antibiotic resistance in environments. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Development of pVCR94ΔX from Vibrio cholerae, a prototype for studying multidrug resistant IncA/C conjugative plasmids.

    Science.gov (United States)

    Carraro, Nicolas; Sauvé, Maxime; Matteau, Dominick; Lauzon, Guillaume; Rodrigue, Sébastien; Burrus, Vincent

    2014-01-01

    Antibiotic resistance has grown steadily in Vibrio cholerae over the last few decades to become a major threat in countries affected by cholera. Multi-drug resistance (MDR) spreads among clinical and environmental V. cholerae strains by lateral gene transfer often mediated by integrative and conjugative elements (ICEs) of the SXT/R391 family. However, in a few reported but seemingly isolated cases, MDR in V. cholerae was shown to be associated with other self-transmissible genetic elements such as conjugative plasmids. IncA/C conjugative plasmids are often found associated with MDR in isolates of Enterobacteriaceae. To date, IncA/C plasmids have not been commonly found in V. cholerae or other species of Vibrio. Here we present a detailed analysis of pVCR94ΔX derived from pVCR94, a novel IncA/C conjugative plasmid identified in a V. cholerae clinical strain isolated during the 1994 Rwandan cholera outbreak. pVCR94 was found to confer resistance to sulfamethoxazole, trimethoprim, ampicillin, streptomycin, tetracycline, and chloramphenicol and to transfer at very high frequency. Sequence analysis revealed its mosaic nature as well as high similarity of the core genes responsible for transfer and maintenance with other IncA/C plasmids and ICEs of the SXT/R391 family. Although IncA/C plasmids are considered a major threat in antibiotics resistance, their basic biology has received little attention, mostly because of the difficulty to genetically manipulate these MDR conferring elements. Therefore, we developed a convenient derivative from pVCR94, pVCR94Δ X, a 120.5-kb conjugative plasmid which only codes for sulfamethoxazole resistance. Using pVCR94Δ X, we identified the origin of transfer (oriT) and discovered an essential gene for transfer, both located within the shared backbone, allowing for an annotation update of all IncA/C plasmids. pVCR94Δ X may be a useful model that will provide new insights on the basic biology of IncA/C conjugative plasmids.

  17. Quadruple-first line drug resistance in Mycobacterium tuberculosis in Vietnam: What can we learn from genes?

    Science.gov (United States)

    Nguyen, Huy Quang; Nguyen, Nhung Viet; Contamin, Lucie; Tran, Thanh Hoa Thi; Vu, Thuong Thi; Nguyen, Hung Van; Nguyen, Ngoc Lan Thi; Nguyen, Son Thai; Dang, Anh Duc; Bañuls, Anne-Laure; Nguyen, Van Anh Thi

    2017-06-01

    In Vietnam, a country with high tuberculosis (137/100.000 population) and multidrug-resistant (MDR)-TB burdens (7.8/100.000 population), little is known about the molecular signatures of drug resistance in general and more particularly of second line drug (SLD) resistance. This study is specifically focused on Mycobacterium tuberculosis isolates resistant to four first-line drugs (FLDs) that make TB much more difficult to treat. The aim is to determine the proportion of SLD resistance in these quadruple drug resistant isolates and the genetic determinants linked to drug resistance to better understand the genetic processes leading to quadruple and extremely drug resistance (XDR). 91 quadruple (rifampicin, isoniazid, ethambutol and streptomycin) FLD resistant and 55 susceptible isolates were included. Spoligotyping and 24-locus MIRU-VNTR techniques were performed and 9 genes and promoters linked to FLD and SLD resistance were sequenced. SLD susceptibility testing was carried out on a subsample of isolates. High proportion of quadruple-FLD resistant isolates was resistant to fluoroquinolones (27%) and second-line injectable drugs (30.2%) by drug susceptibility testing. The sequencing revealed high mutation diversity with prevailing mutations at positions katG315, inhA-15, rpoB531, embB306, rrs1401, rpsL43 and gyrA94. The sensitivity and specificity were high for most drug resistances (>86%), but the sensitivity was lower for injectable drug resistances (resistance. Nevertheless, particular mutation patterns linked to high-level resistance and low fitness costs seem to be favored. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Antibiotic resistance and resistance genes in Escherichia coli from poultry farms, southwest Nigeria.

    Science.gov (United States)

    Adelowo, Olawale O; Fagade, Obasola E; Agersø, Yvonne

    2014-09-12

    This study investigated the mechanisms of resistance in 36 E. coli isolated from waste, litter, soil and water samples collected from poultry farms in Southwestern Nigeria. Minimum inhibitory concentration (MIC) distributions of the isolates were determined using the methods of the Clinical and Laboratory Standard Institute and resistance genes detected by PCR. A total of 30 isolates (94%) showed resistance to more than one antimicrobial. Percentage resistance was: tetracycline 81%, sulphamethoxazole 67%, streptomycin 56%, trimethoprim 47 %, ciprofloxacin 42%, ampicillin 36%, spectinomycin 28%, nalidixic acid 25%, chloramphenicol 22%, neomycin 14%, gentamicin 8%, amoxicillin-clavulanate, ceftiofur, cefotaxime, colistin, florfenicol and apramycin 0%. Resistance genes found among the isolates include bla-TEM (85%), sul2 (67%), sul3 (17%), aadA (65%), strA (70%), strB (61%), catA1 (25%), cmlA1 (13%), tetA (21%) and tetB (17%). Class 1 and 2 integrons were found in five (14%) and six (17%) isolates, respectively, while one isolate was positive for both classes of integrons. Seven out of eight isolates with resistance to ciprofloxacin and MIC ≤ 32 mg/L to nalidixic acid contained qnrS genes. Our findings provided additional evidence that the poultry production environment in Nigeria represents an important reservoir of antibiotic resistance genes such as qnrS that may spread from livestock production farms to human populations via manure and water.

  19. Prevalence of drug-resistant tuberculosis and imputed burden in South Africa: a national and sub-national cross-sectional survey.

    Science.gov (United States)

    Ismail, Nazir Ahmed; Mvusi, Lindiwe; Nanoo, Ananta; Dreyer, Andries; Omar, Shaheed V; Babatunde, Sanni; Molebatsi, Thabo; van der Walt, Martie; Adelekan, Adeboye; Deyde, Varough; Ihekweazu, Chikwe; Madhi, Shabir A

    2018-04-20

    Globally, per-capita, South Africa reports a disproportionately high number of cases of multidrug-resistant (MDR) tuberculosis and extensively drug-resistant (XDR) tuberculosis. We sought to estimate the prevalence of resistance to tuberculosis drugs in newly diagnosed and retreated patients with tuberculosis provincially and nationally, and compared these with the 2001-02 estimates. A cross-sectional survey was done between June 15, 2012-June 14, 2014, using population proportionate randomised cluster sampling in the nine provinces in South Africa. 343 clusters were included, ranging between 31 and 48 per province. A patient was eligible for inclusion in the survey if he or she presented as a presumptive case during the intake period at a drug resistance survey enrolling facility. Consenting participants (≥18 years old) completed a questionnaire and had a sputum sample tested for resistance to first-line and second-line drugs. Analysis was by logistic regression with robust SEs, inverse probability weighted against routine data, and estimates were derived using a random effects model. 101 422 participants were tested in 2012-14. Nationally, the prevalence of MDR tuberculosis was 2·1% (95% CI 1·5-2·7) among new tuberculosis cases and 4·6% (3·2-6·0) among retreatment cases. The provincial point prevalence of MDR tuberculosis ranged between 1·6% (95% CI 0·9-2·9) and 5·1% (3·7-7·0). Overall, the prevalence of rifampicin-resistant tuberculosis (4·6%, 95% CI 3·5-5·7) was higher than the prevalence of MDR tuberculosis (2·8%, 2·0-3·6; p=0·01). Comparing the current survey with the previous (2001-02) survey, the overall MDR tuberculosis prevalence was 2·8% versus 2·9% and prevalance of rifampicin-resistant tuberculosis was 3·4% versus 1·8%, respectively. The prevalence of isoniazid mono-resistant tuberculosis was above 5% in all provinces. The prevalence of ethionamide and pyrazinamide resistance among MDR tuberculosis cases was 44·7% (95% CI 25

  20. An AFLP marker linked to the Pm-1 gene that confers resistance to Podosphaera xanthii race 1 in Cucumis melo

    Directory of Open Access Journals (Sweden)

    Ana Paula Matoso Teixeira

    2008-01-01

    Full Text Available Brazil produced 330,000 metric tons of melons in 2005, principally in the Northeast region where one of the most important melon pathogens is the powdery mildew fungus Podosphaera xanthii. The disease is controlled mainly by incorporating single dominant resistance genes into commercial hybrids. We report on linkage analysis of the Pm-1 resistance gene, introgressed from the AF125Pm-1 Cantalupensis Charentais-type breeding line into the yellow-fleshed melon (Group Inodorus breeding line AF426-S by backcrossing to produce the resistant line AF426-R, and the amplified fragment length polymorphism (AFLP marker M75/H35_155 reported to be polymorphic between AF426-S and AF426-R. Segregation analysis of M75/H35_155 using a backcross population of 143 plants derived from [AF426-R x AF426-S] x AF426-S and screened for resistance to P. xanthii race 1 produced a recombination frequency of 4.9%, indicating close linkage between M75/H35_155 and Pm-1. Using the same segregating population, the M75/H35_155 marker had previously been reported to be distantly linked to Prv¹, a gene conferring resistance to papaya ringspot virus-type W. Since M75/H35_155 is linked to Prv¹ at a distance of 40.9 cM it is possible that Pm-1 and Prv¹ are also linked.

  1. Evaluation of 11C-Acetate and 18 F-FDG PET/CT in mouse multidrug resistance gene-2 deficient mouse model of hepatocellular carcinoma

    International Nuclear Information System (INIS)

    Territo, Paul R.; Maluccio, Mary; Riley, Amanda A.; McCarthy, Brian P.; Fletcher, James; Tann, Mark; Saxena, Romil; Skill, Nicholas J.

    2015-01-01

    Hepatocellular carcinoma (HCC) remains a global health problem with unique diagnostic and therapeutic challenges, including difficulties in identifying the highest risk patients. Previous work from our lab has established the murine multidrug resistance-2 mouse (MDR2) model of HCC as a reasonable preclinical model that parallels the changes seen in human inflammatory associated HCC. The purpose of this study is to evaluate modalities of PET/CT in MDR2 −/− mice in order to facilitate therapeutic translational studies from bench to bedside. 18 F-FDG and 11 C-acetate PET/CT was performed on 12 m MDR2 −/− mice (n = 3/tracer) with HCC and 12 m MDR2 −/+ control mice (n = 3/tracer) without HCC. To compare PET/CT to biological markers of HCC and cellular function, serum alpha-fetoprotein (AFP), lysophosphatidic acid (LPA), cAMP and hepatic tumor necrosis factor α (TNFα) were quantified in 3-12 m MDR2 −/− (n = 10) mice using commercially available ELISA analysis. To translate results in mice to patients 11 C-acetate PET/CT was also performed in 8 patents suspected of HCC recurrence following treatment and currently on the liver transplant wait list. Hepatic 18 F-FDG metabolism was not significantly increased in MDR2 −/− mice. In contrast, hepatic 11 C-acetate metabolism was significantly elevated in MDR2 −/− mice when compared to MDR2 −/+ controls. Serum AFP and LPA levels increased in MDR2 −/− mice contemporaneous with the emergence of HCC. This was accompanied by a significant decrease in serum cAMP levels and an increase in hepatic TNFα. In patients suspected of HCC recurrence there were 5 true positives, 2 true negatives and 1 suspected false 11 C-acetate negative. Hepatic 11 C-acetate PET/CT tracks well with HCC in MDR2 −/− mice and patients with underlying liver disease. Consequently 11 C-acetate PET/CT is well suited to study 1) HCC emergence/progression in patients and 2) reduce animal numbers required to study new

  2. Comparison of effectiveness and safety of imipenem/clavulanate- versus meropenem/clavulanate-containing regimens in the treatment of MDR- and XDR-TB.

    Science.gov (United States)

    Tiberi, Simon; Sotgiu, Giovanni; D'Ambrosio, Lia; Centis, Rosella; Abdo Arbex, Marcos; Alarcon Arrascue, Edith; Alffenaar, Jan Willem; Caminero, Jose A; Gaga, Mina; Gualano, Gina; Skrahina, Alena; Solovic, Ivan; Sulis, Giorgia; Tadolini, Marina; Alarcon Guizado, Valentina; De Lorenzo, Saverio; Roby Arias, Aurora Jazmín; Scardigli, Anna; Akkerman, Onno W; Aleksa, Alena; Artsukevich, Janina; Auchynka, Vera; Bonini, Eduardo Henrique; Chong Marín, Félix Antonio; Collahuazo López, Lorena; de Vries, Gerard; Dore, Simone; Kunst, Heinke; Matteelli, Alberto; Moschos, Charalampos; Palmieri, Fabrizio; Papavasileiou, Apostolos; Payen, Marie-Christine; Piana, Andrea; Spanevello, Antonio; Vargas Vasquez, Dante; Viggiani, Pietro; White, Veronica; Zumla, Alimuddin; Migliori, Giovanni Battista

    2016-06-01

    No large study to date has ever evaluated the effectiveness, safety and tolerability of imipenem/clavulanate versus meropenem/clavulanate to treat multidrug- and extensively drug-resistant tuberculosis (MDR- and XDR-TB). The aim of this observational study was to compare the therapeutic contribution of imipenem/clavulanate versus meropenem/clavulanate added to background regimens to treat MDR- and XDR-TB cases.84 patients treated with imipenem/clavulanate-containing regimens showed a similar median number of antibiotic resistances (8 versus 8) but more fluoroquinolone resistance (79.0% versus 48.9%, pimipenem/clavulanate- and meropenem/clavulanate-containing regimens for a median (interquartile range) of 187 (60-428) versus 85 (49-156) days, respectively.Statistically significant differences were observed on sputum smear and culture conversion rates (79.7% versus 94.8%, p=0.02 and 71.9% versus 94.8%, pimipenem/clavulanate and meropenem/clavulanate were reported in 5.4% and 6.5% of cases only.Our study suggests that meropenem/clavulanate is more effective than imipenem/clavulanate in treating MDR/XDR-TB patients. Copyright ©ERS 2016.

  3. MRJP1-containing glycoproteins isolated from honey, a novel antibacterial drug candidate with broad spectrum activity against multi-drug resistant clinical isolates

    Directory of Open Access Journals (Sweden)

    Katrina eBrudzynski

    2015-07-01

    Full Text Available The emergence of extended- spectrum β-lactamase (ESBL is the underlying cause of growing antibiotic resistance among Gram-negative bacteria to β-lactam antibiotics. We recently reported the discovery of honey glycoproteins (glps that exhibited a rapid, concentration-dependent antibacterial activity against both Gram-positive Bacillus subtilis and Gram-negative Escherichia coli that resembled action of cell wall-active β-lactam drugs. Glps showed sequence identity with the Major Royal Jelly Protein 1 (MRJP1 precursor that harbors three antimicrobial peptides: Jelleins 1, 2 and 4. Here, we used semi-quantitative radial diffusion assay and broth microdilution assay to evaluate susceptibility of a number of multi-drug resistant (MDR clinical isolates to the MRJP1-contaning honey glycoproteins. The MDR bacterial strains comprised 3 MRSA, 4 Pseudomonas aeruginosa, 2 Klebsiella pneumoniae, 2 VRE and 5 Extended-spectrum beta-lactamase (ESBL identified as 1 Proteus mirabilis, 3 Escherichia coli and 1 Escherichia coli NDM. Their resistance to different classes of antibiotics was confirmed using automated system Vitek 2. MDR isolates differred in their susceptibility to glps with MIC90 values ranging from 4.8μg/ml against B. subtilis to 14.4μg/ml against ESBL K. pneumoniae, Klebsiella spp ESBL and E. coli and up to 33μg/ml against highly resistant strains of P. aeruginosa. Glps isolated from different honeys showed a similar ability to overcome bacterial resistance to β-lactams suggesting that (a their mode of action is distinct from other classes of β-lactams and that (b the common glps structure was the lead structure responsible for the activity. The results of the current study together with our previous evidence of a rapid bactericidal activity of glps demonstrate that glps possess suitable characteristics to be considered a novel antibacterial drug candidate.

  4. Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

    Science.gov (United States)

    Wang, Na; Yang, Xiaohong; Jiao, Shaojun; Zhang, Jun; Ye, Boping; Gao, Shixiang

    2014-01-01

    Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs) increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (psulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

  5. Candidate genes for cross-resistance against DNA-damaging drugs

    DEFF Research Database (Denmark)

    Wittig, Rainer; Nessling, Michelle; Will, Rainer D

    2002-01-01

    Drug resistance of tumor cells leads to major drawbacks in the treatment of cancer. To identify candidate genes for drug resistance, we compared the expression patterns of the drug-sensitive human malignant melanoma cell line MeWo and three derived sublines with acquired resistance to the DNA...... as several apoptosis-related genes, in particular STK17A and CRYAB. As MPP1 and CRYAB are also among the 14 genes differentially expressed in all three of the drug-resistant sublines, they represent the strongest candidates for resistance against DNA-damaging drugs....

  6. Current trends of human infections and antibiotic resistance of the genus Shewanella.

    Science.gov (United States)

    Yousfi, K; Bekal, S; Usongo, V; Touati, A

    2017-08-01

    Shewanella spp. are commonly known as environmental bacteria and are most frequently isolated from aquatic areas. Currently, diseases syndromes and multidrug resistance have increasingly been reported in the genus Shewanella. Some species are associated with various infections, such as skin and soft tissue infections, as well as bacteremia. Generally, these bacteria are opportunistic and mostly affect people with an impaired immune system. This genus is also a probable vehicle and progenitor of antibiotic resistance genes. In fact, several resistance genes and mobile genetic elements have been identified in some resistant species isolated from environmental or clinical settings. These genes confer resistance to different antibiotic classes, including those used in therapies such as β-lactams and quinolones, and are generally located on the chromosome. Recently, a multidrug-resistant (MDR) plasmid harboring several drug resistance genes associated with transposons and integrons has been identified in Shewanella xiamenensis. These antibiotic resistance genes can circulate in the environment and contribute to the emergence of antibiotic resistance. This review describes different aspects of Shewanella, focusing on the infections caused by this genus, as well as their role in the propagation of antibiotic resistance via mobile genetic elements.

  7. Mouse ATP-Binding Cassette (ABC) Transporters Conferring Multi-Drug Resistance

    Science.gov (United States)

    Shuaizhang, L I; Zhang, Wen; Yin, Xuejiao; Xing, Shilai; Xie, Qunhui; Cao, Zhengyu; Zhao, Bin

    2015-04-28

    The ABC (ATP-binding cassette) transporter is one of the largest and most ancient protein families with members functioning from protozoa to human. The resistance of cancer and tumor cells to anticancer drugs is due to the over-expression of some ABC transporters, which may finally lead to chemotherapy failure. The mouse ABC transporters are classified into seven subfamilies by phylogenetic analysis. The mouse ABC transporter gene, alias, chromosomal location and function have been determined. Within the ABC super-family, the MDR transporters (Abcb1, Abcc1, Abcg2) in mouse models have been proved to be valuable to investigate the biochemistry and physiological functions. This review concentrates on the multidrug resistance of mouse ABC transporters in cancer and tumor cells.

  8. A mutation within the extended X loop abolished substrate-induced ATPase activity of the human liver ATP-binding cassette (ABC) transporter MDR3.

    Science.gov (United States)

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-02-20

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. An aureobasidin A resistance gene isolated from Aspergillus is a homolog of yeast AUR1, a gene responsible for inositol phosphorylceramide (IPC) synthase activity.

    Science.gov (United States)

    Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K

    1999-03-01

    The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.

  10. Photochemical internalisation of chemotherapy potentiates killing of multidrug-resistant breast and bladder cancer cells.

    Science.gov (United States)

    Adigbli, D K; Wilson, D G G; Farooqui, N; Sousi, E; Risley, P; Taylor, I; Macrobert, A J; Loizidou, M

    2007-08-20

    Multidrug resistance (MDR) is the major confounding factor in adjuvant solid tumour chemotherapy. Increasing intracellular amounts of chemotherapeutics to circumvent MDR may be achieved by a novel delivery method, photochemical internalisation (PCI). PCI consists of the co-administration of drug and photosensitiser; upon light activation the latter induces intracellular release of organelle-bound drug. We investigated whether co-administration of hypericin (photosensitiser) with mitoxantrone (MTZ, chemotherapeutic) plus illumination potentiates cytotoxicity in MDR cancer cells. We mapped the extent of intracellular co-localisation of drug/photosensitiser. We determined whether PCI altered drug-excreting efflux pump P-glycoprotein (Pgp) expression or function in MDR cells. Bladder and breast cancer cells and their Pgp-overexpressing MDR subclones (MGHU1, MGHU1/R, MCF-7, MCF-7/R) were given hypericin/MTZ combinations, with/without blue-light illumination. Pilot experiments determined appropriate sublethal doses for each. Viability was determined by the 3-[4,5-dimethylthiazolyl]-2,5-diphenyltetrazolium bromide assay. Intracellular localisation was mapped by confocal microscopy. Pgp expression was detected by immunofluorescence and Pgp function investigated by Rhodamine123 efflux on confocal microscopy. MTZ alone (0.1-0.2 microg ml(-1)) killed up to 89% of drug-sensitive cells; MDR cells exhibited less cytotoxicity (6-28%). Hypericin (0.1-0.2 microM) effects were similar for all cells; light illumination caused none or minimal toxicity. In combination, MTZ /hypericin plus illumination, potentiated MDR cell killing, vs hypericin or MTZ alone. (MGHU1/R: 38.65 and 36.63% increase, Phypericin increased killing by 28.15% (Phypericin was evident before illumination and at serial times post-illumination. MTZ was always found in sensitive cell nuclei, but not in dark resistant cell nuclei. In illuminated resistant cells there was some mobilisation of MTZ into the nucleus. Pgp

  11. Modulation of P-glycoprotein-mediated multidrug resistance in K562 leukemic cells by indole-3-carbinol

    International Nuclear Information System (INIS)

    Arora, Annu; Seth, Kavita; Kalra, Neetu; Shukla, Yogeshwer

    2005-01-01

    Resistance to chemotherapeutic drugs is one of the major problems in the treatment of cancer. P-glycoprotein (P-gp) encoded by the mdr gene is a highly conserved protein, acts as a multidrug transporter, and has a major role in multiple drug resistance (MDR). Targeting of P-gp by naturally occurring compounds is an effective strategy to overcome MDR. Indole-3-carbinol (I3C), a glucosinolates present in cruciferous vegetables, is a promising chemopreventive agent as it is reported to possess antimutagenic, antitumorigenic, and antiestrogenic properties in experimental studies. In the present investigation, the potential of I3C to modulate P-gp expression was evaluated in vinblastine (VBL)-resistant K562 human leukemic cells. The resistant K562 cells (K562/R10) were found to be cross-resistant to vincristine (VCR), doxorubicin (DXR), and other antineoplastic agents. I3C at a nontoxic dose (10 x 10 -3 M) enhanced the cytotoxic effects of VBL time dependently in VBL-resistant human leukemia (K562/R10) cells but had no effect on parent-sensitive cells (K562/S). The Western blot analysis of K 562/R 10 cells showed that I3C downregulates the induced levels of P-gp in resistant cells near to normal levels. The quantitation of immunocytochemically stained K562/R10 cells showed 24%, 48%, and 80% decrease in the levels of P-gp by I3C for 24, 48, and 72 h of incubation. The above features thus indicate that I3C could be used as a novel modulator of P-gp-mediated multidrug resistance in vitro and may be effective as a dietary adjuvant in the treatment of MDR cancers

  12. Primary drug-resistant tuberculosis in Hanoi, Viet Nam: present status and risk factors.

    Directory of Open Access Journals (Sweden)

    Nguyen Thi Le Hang

    Full Text Available INTRODUCTION: Resistance of Mycobacterium tuberculosis (MTB to anti-tuberculosis (TB drugs presents a serious challenge to TB control worldwide. We investigated the status of drug resistance, including multidrug-resistant (MDR TB, and possible risk factors among newly diagnosed TB patients in Hanoi, the capital of Viet Nam. METHODS: Clinical and epidemiological information was collected from 506 newly diagnosed patients with sputum smear- and culture-positive TB, and 489 (96.6% MTB isolates were subjected to conventional drug susceptibility testing, spoligotyping, and 15-locus variable numbers of tandem repeats typing. Adjusted odds ratios (aORs were calculated to analyze the risk factors for primary drug resistance. RESULTS: Of 489 isolates, 298 (60.9% were sensitive to all drugs tested. Resistance to isoniazid, rifampicin, streptomycin, ethambutol, and MDR accounted for 28.2%, 4.9%, 28.2%, 2.9%, and 4.5%, respectively. Of 24 isolates with rifampicin resistance, 22 (91.7% were MDR and also resistant to streptomycin, except one case. Factors associated with isoniazid resistance included living in old urban areas, presence of the Beijing genotype, and clustered strains [aOR = 2.23, 95% confidence interval (CI 1.15-4.35; 1.91, 1.18-3.10; and 1.69, 1.06-2.69, respectively. The Beijing genotype was also associated with streptomycin resistance (aOR = 2.10, 95% CI 1.29-3.40. Human immunodeficiency virus (HIV coinfection was associated with rifampicin resistance and MDR (aOR = 5.42, 95% CI 2.07-14.14; 6.23, 2.34-16.58, respectively. CONCLUSION: Isoniazid and streptomycin resistance was observed in more than a quarter of TB patients without treatment history in Hanoi. Transmission of isoniazid-resistant TB among younger people should be carefully monitored in urban areas, where Beijing strains and HIV coinfection are prevalent. Choosing an optimal treatment regimen on the basis of the results of drug susceptibility tests and monitoring of treatment

  13. Expression profiles of vault components MVP, TEP1 and vPARP and their correlation to other multidrug resistance proteins in ovarian cancer.

    Science.gov (United States)

    Szaflarski, Witold; Sujka-Kordowska, Patrycja; Pula, Bartosz; Jaszczyńska-Nowinka, Karolina; Andrzejewska, Małgorzata; Zawierucha, Piotr; Dziegiel, Piotr; Nowicki, Michał; Ivanov, Pavel; Zabel, Maciej

    2013-08-01

    Vaults are cytoplasmic ribonucleoprotein particles composed of three proteins (MVP, TEP1, vPARP) and vault‑associated RNAs (vRNAs). Although the cellular functions of vaults remain unclear, vaults are strongly linked to the development of multidrug resistance (MDR), the major obstacle to the efficient treatment of cancers. Available published data suggest that vaults and their components are frequently upregulated in broad variety of multidrug-resistant cancer cell lines and tumors of different histological origin. Here, we provide detailed analysis of vault protein expression in post-surgery ovarian cancer samples from patients that were not exposed to chemotherapy. Our analysis suggests that vault proteins are expressed in the ovaries of healthy individuals but their expression in cancer patients is changed. Specifically, MVP, TEP1 and vPARP mRNA levels are significantly decreased in cancer samples with tendency of lower expression in higher-grade tumors. The pattern of vault protein mRNA expression is strongly correlated with the expression of other MDR-associated proteins such as MDR1, MRP1 and BCRP. Surprisingly, the protein levels of MVP, TEP1 and vPARP are actually increased in the higher‑grade tumors suggesting existence of post-transcriptional regulation of vault component production.

  14. MicroRNA signatures from multidrug-resistant Mycobacterium tuberculosis

    Science.gov (United States)

    REN, NA; GAO, GUIJU; SUN, YUE; ZHANG, LING; WANG, HUIZHU; HUA, WENHAO; WAN, KANGLIN; LI, XINGWANG

    2015-01-01

    Tuberculosis (TB) infections, caused by multi-drug-resistant Mycobacterium tuberculosis (MDR MTB), remain a significant public health concern worldwide. The regulatory mechanisms underlying the emergence of MDR MTB strains remain to be fully elucidated, and further investigation is required in order to develop better strategies for TB control. The present study investigated the expression profile of microRNA (miRNA) in MTB strains, and examined the differences between sensitive MTB and MDR MTB using next generation sequencing (NGS) with Illumina Deep Sequencing technology to better understand the mechanisms of resistance in MDR MTB, A total of 5, 785 and 195, and 6, 290 and 595 qualified Illumina reads were obtained from two MDR MTB strains, and 6, 673 and 665, and 7, 210 and 217 qualified Illumina reads were obtained from two sensitive MTB strains. The overall de novo assembly of miRNA sequence data generated 62 and 62, and 95 and 112 miRNAs between the 18 and 30 bp long from sensitive MTB strains and MDR MTB strains, respectively. Comparative miRNA analysis revealed that 142 miRNAs were differentially expressed in the MDR MTB strain, compared with the sensitive MTB strain, of which 48 were upregulated and 94 were downregulated. There were six similarly expressed miRNAs between the MDR and sensitive MTB strains, and 108 miRNAs were expressed only in the MDR MTB strain. The present study acquired miRNA data from sensitive MTB and MDR MTB strains using NGS techniques, and this identification miRNAs may serve as an invaluable resource for revealing the molecular basis of the regulation of expression associated with the mechanism of drug-resistance in MTB. PMID:26324150

  15. MicroRNA signatures from multidrug‑resistant Mycobacterium tuberculosis.

    Science.gov (United States)

    Ren, Na; Gao, Guiju; Sun, Yue; Zhang, Ling; Wang, Huizhu; Hua, Wenhao; Wan, Kanglin; Li, Xingwang

    2015-11-01

    Tuberculosis (TB) infections, caused by multidrug‑resistant Mycobacterium tuberculosis (MDR MTB), remain a significant public health concern worldwide. The regulatory mechanisms underlying the emergence of MDR MTB strains remain to be fully elucidated, and further investigation is required in order to develop better strategies for TB control. The present study investigated the expression profile of microRNA (miRNA) in MTB strains, and examined the differences between sensitive MTB and MDR MTB using next generation sequencing (NGS) with Illumina Deep Sequencing technology to better understand the mechanisms of resistance in MDR MTB, A total of 5, 785 and 195, and 6, 290 and 595 qualified Illumina reads were obtained from two MDR MTB strains, and 6, 673 and 665, and 7, 210 and 217 qualified Illumina reads were obtained from two sensitive MTB strains. The overall de novo assembly of miRNA sequence data generated 62 and 62, and 95 and 112 miRNAs between the 18 and 30 bp long from sensitive MTB strains and MDR MTB strains, respectively. Comparative miRNA analysis revealed that 142 miRNAs were differentially expressed in the MDR MTB strain, compared with the sensitive MTB strain, of which 48 were upregulated and 94 were downregulated. There were six similarly expressed miRNAs between the MDR and sensitive MTB strains, and 108 miRNAs were expressed only in the MDR MTB strain. The present study acquired miRNA data from sensitive MTB and MDR MTB strains using NGS techniques, and this identification miRNAs may serve as an invaluable resource for revealing the molecular basis of the regulation of expression associated with the mechanism of drug‑resistance in MTB.

  16. Effect of moxifloxacin on oxidative stress, paraoxonase-1 (PON1 ...

    African Journals Online (AJOL)

    Purpose: To investigate the effect of moxifloxacin on paraoxonase-1 (PON1) activity, and serum oxidative stress in patients with multiple drug-resistant tuberculosis (MDR-TB). Methods: A total ofof 130 MDR-TB patients who were treated with moxifloxacin from October 2014 to October 2010 in Eastern Medical District of Linyi ...

  17. Association between HIV/AIDS and multi-drug resistance tuberculosis: a systematic review and meta-analysis.

    Directory of Open Access Journals (Sweden)

    Yonatan Moges Mesfin

    Full Text Available BACKGROUND: Human immunodeficiency virus (HIV, multi-drug resistant tuberculosis (MDR is emerging as major challenge facing tuberculosis control programs worldwide particularly in Asia and Africa. Findings from different studies on associations of HIV co-infection and drug resistance among patients with TB have been contradictory (discordant. Some institution based studies found strongly increased risks for multi-drug resistant TB (MDR TB among patients co-infected with TB and HIV, whereas other studies found no increased risk (it remains less clear in community based studies. The aim was to conduct a systematic review and meta-analysis of the association between multi-drug resistant tuberculosis and HIV infection. METHODS AND FINDINGS: Systematic review of the published literature of observational studies was conducted. Original studies were identified using databases of Medline/Pubmed, Google Scholar and HINARI. The descriptions of original studies were made using frequency and forest plot. Publication bias was assessed using Funnel plot graphically and Egger weighted and Begg rank regression tests statistically. Heterogeneity across studies was checked using Cochrane Q test statistic and I(2. Pool risk estimates of MDR-TB and sub-grouping analysis were computed to analyze associations with HIV. Random effects of the meta-analysis of all 24 observational studies showed that HIV is associated with a marginal increased risk of multi-drug resistant tuberculosis (estimated Pooled OR 1.24; 95%, 1.04-1.43. Subgroup analyses showed that effect estimates were higher (Pooled OR 2.28; 95%, 1.52-3.04 for primary multi-drug resistance tuberculosis and moderate association between HIV/AIDS and MDR-TB among population based studies and no significant association in institution settings. CONCLUSIONS: This study demonstrated that there is association between MDR-TB and HIV. Capacity for diagnosis of MDR-TB and initiating and scale up of antiretroviral

  18. Structure and function of ABCG2-rich extracellular vesicles mediating multidrug resistance.

    Directory of Open Access Journals (Sweden)

    Vicky Goler-Baron

    2011-01-01

    Full Text Available Multidrug resistance (MDR is a major impediment to curative cancer chemotherapy. The ATP-Binding Cassette transporters ABCG2, ABCB1 and ABCC2 form a unique defense network against multiple structurally and functionally distinct chemotherapeutics, thereby resulting in MDR. Thus, deciphering novel mechanisms of MDR and their overcoming is a major goal of cancer research. Recently we have shown that overexpression of ABCG2 in the membrane of novel extracellular vesicles (EVs in breast cancer cells results in mitoxantrone resistance due to its dramatic sequestration in EVs. However, nothing is known about EVs structure, biogenesis and their ability to concentrate multiple antitumor agents. To this end, we here found that EVs are structural and functional homologues of bile canaliculi, are apically localized, sealed structures reinforced by an actin-based cytoskeleton and secluded from the extracellular milieu by the tight junction proteins occludin and ZO-1. Apart from ABCG2, ABCB1 and ABCC2 were also selectively targeted to the membrane of EVs. Moreover, Ezrin-Radixin-Moesin protein complex selectively localized to the border of the EVs membrane, suggesting a key role for the tethering of MDR pumps to the actin cytoskeleton. The ability of EVs to concentrate and sequester different antitumor drugs was also explored. Taking advantage of the endogenous fluorescence of anticancer drugs, we found that EVs-forming breast cancer cells display high level resistance to topotecan, imidazoacridinones and methotrexate via efficient intravesicular drug concentration hence sequestering them away from their cellular targets. Thus, we identified a new modality of anticancer drug compartmentalization and resistance in which multiple chemotherapeutics are actively pumped from the cytoplasm and highly concentrated within the lumen of EVs via a network of MDR transporters differentially targeted to the EVs membrane. We propose a composite model for the structure and

  19. Activity of Topical Antimicrobial Agents Against Multidrug-Resistant Bacteria Recovered from Burn Patients

    Science.gov (United States)

    2010-01-01

    Spectrum of activity Pros Cons Resistance/ other Prior studies Bacitracin Polypeptide produced by Bacillus subtilis that inhibits cell wall synthesis and...concentrations (MICs) and zones of inhibition (ZI). Isolates had systemic antibiotic resistance and clonality determined. MDR included resistance to... antibiotics in three or more classes. Results: We assessed 22 ESBL-producing K. pneumoniae, 20 ABC (75% MDR), 20 P. aeruginosa (45% MDR), and 20 MRSA

  20. Primary and secondary anti-tuberculosis drug resistance in Hitossa District of Arsi Zone, Oromia Regional State, Central Ethiopia

    Directory of Open Access Journals (Sweden)

    Shallo Daba Hamusse

    2016-07-01

    Full Text Available Abstract Background Multidrug-resistant tuberculosis (MDR-TB drugs which is resistant to the major first-line anti-TB drugs, Isoniazid and Rifampicin, has become a major global challenge in tuberculosis (TB control programme. However, its burden at community level is not well known. Thus, the aim of study was to assess the prevalence of primary and secondary resistance to any first line anti-TB drugs and MDR TB in Hitossa District of Oromia Regional State, Central Ethiopia. Methods Population based cross- sectional study was conducted on individuals aged ≥15 years. Those with symptoms suggestive of TB were interviewed and two sputum specimens were collected from each and examined using Lowenstein-Jensen (LJ culture medium. Further, the isolates were confirmed by the Ziehl-Neelsen microscopic examination method. Drug susceptibility test (DST was also conducted on LJ medium using a simplified indirect proportion method. The resistance strains were then determined by percentage of colonies that grew on the critical concentration of Isoniazid, Streptomycin, Rifampicin and Ethambutol. Results The overall resistance of all forms of TB to any first-line anti-TB drug was 21.7 %. Of the total new and previously treated culture positive TB cases, 15.3 and 48.8 % respectively were found to be a resistant to any of the first-line anti-TB drugs. Further, of all forms of TB, the overall resistance of MDR-TB was 4.7 %. However, of the total new TB cases, 2.4 % had primary while 14.3 % had secondary MDR-TB. Resistance to any of the first-line anti-TB drugs (adjusted odd ratio (AOR, 8.1; 95 % CI: 2.26–29.30 and MDR-TB (AOR, 7.1; 95 % CI: 2.6–43.8 was found to be linked with previous history of anti-TB treatment. Conclusions The study has identified a high rate of primary and secondary resistance to any of the first-line anti-TB drugs and MDR-TB in the study area. The resistance may have resulted from sub-optimal performance of directly observed

  1. Multiplex TaqMan® detection of pathogenic and multi-drug resistant Salmonella.

    Science.gov (United States)

    Singh, Prashant; Mustapha, Azlin

    2013-09-02

    Overuse of antibiotics in the medical and animal industries is one of the major causes for the development of multi-drug-resistant (MDR) food pathogens that are often difficult to treat. In the past few years, higher incidences of outbreaks caused by MDR Salmonella have been increasingly documented. The objective of this study was to develop a rapid multiplex real-time polymerase chain reaction (PCR) assay for simultaneous detection of pathogenic and MDR Salmonella spp. A multiplex TaqMan®real-time PCR was designed by targeting the invasin virulence gene (invA), and four commonly found antibiotic resistance genes, viz. ampicillin, chloramphenicol, streptomycin and tetracycline. To avoid false negative results and to increase the reliability of the assay, an internal amplification control (IAC) was added which was detected using a locked nucleic acid (LNA) probe. In serially diluted (5 ng-50 fg) DNA samples, the assay was able to detect 100 genomic equivalents of Salmonella, while in a multiplex format, the sensitivity was 1000 genomic equivalents. The assay performed equally well on artificially contaminated samples of beef trim, ground beef of different fat contents (73:27, 80:20, 85:15 and 93:7), chicken rinse, ground chicken, ground turkey, egg, spinach and tomato. While the detection limit for un-enriched inoculated food samples was 10(4) CFU/g, this was improved to 10 CFU/g after a 12-h enrichment in buffered peptone water, with 100% reproducibility. The multiplex real-time assay developed in this study can be used as a valuable tool to detect MDR virulent Salmonella, thus enhancing the safety of food. © 2013.

  2. NSC23925, identified in a high-throughput cell-based screen, reverses multidrug resistance.

    Directory of Open Access Journals (Sweden)

    Zhenfeng Duan

    2009-10-01

    Full Text Available Multidrug resistance (MDR is a major factor which contributes to the failure of cancer chemotherapy, and numerous efforts have been attempted to overcome MDR. To date, none of these attempts have yielded a tolerable and effective therapy to reverse MDR; thus, identification of new agents would be useful both clinically and scientifically.To identify small molecule compounds that can reverse chemoresistance, we developed a 96-well plate high-throughput cell-based screening assay in a paclitaxel resistant ovarian cancer cell line. Coincubating cells with a sublethal concentration of paclitaxel in combination with each of 2,000 small molecule compounds from the National Cancer Institute Diversity Set Library, we identified a previously uncharacterized molecule, NSC23925, that inhibits Pgp1 and reverses MDR1 (Pgp1 but does not inhibit MRP or BCRP-mediated MDR. The cytotoxic activity of NSC23925 was further evaluated using a panel of cancer cell lines expressing Pgp1, MRP, and BCRP. We found that at a concentration of >10 microM NSC23925 moderately inhibits the proliferation of both sensitive and resistant cell lines with almost equal activity, but its inhibitory effect was not altered by co-incubation with the Pgp1 inhibitor, verapamil, suggesting that NSC23925 itself is not a substrate of Pgp1. Additionally, NSC23925 increases the intracellular accumulation of Pgp1 substrates: calcein AM, Rhodamine-123, paclitaxel, mitoxantrone, and doxorubicin. Interestingly, we further observed that, although NSC23925 directly inhibits the function of Pgp1 in a dose-dependent manner without altering the total expression level of Pgp1, NSC23925 actually stimulates ATPase activity of Pgp, a phenomenon seen in other Pgp inhibitors.The ability of NSC23925 to restore sensitivity to the cytotoxic effects of chemotherapy or to prevent resistance could significantly benefit cancer patients.

  3. Reversal of cisplatin resistance in non-small cell lung cancer stem cells by Taxus chinensis var.

    Science.gov (United States)

    Jiang, Y Q; Xu, X P; Guo, Q M; Xu, X C; Liu, Q Y; An, S H; Xu, J L; Su, F; Tai, J B

    2016-09-02

    Drug resistance in cells is a major impedance to successful treatment of lung cancer. Taxus chinensis var. inhibits the growth of tumor cells and promotes the synthesis of interleukins 1 and 2 and tumor necrosis factor, enhancing immune function. In this study, T. chinensis var.-induced cell death was analyzed in lung cancer cells (H460) enriched for stem cell growth in a defined serum-free medium. Taxus-treated stem cells were also analyzed for Rhodamine 123 (Rh-123) expression by flow cytometry, and used as a standard functional indicator of MDR. The molecular basis of T. chinensis var.-mediated drug resistance was established by real-time PCR analysis of ABCC1, ABCB1, and lung resistance-related protein (LRP) mRNA, and western blot analysis of MRP1, MDR1, and LRP. Our results revealed that stem cells treated with higher doses of T. chinensis var. showed significantly lower growth inhibition rates than did H460 cells (P var. and cisplatin was also significantly inhibited (P var. (P var.-treated stem cells showed significant downregulation of the ABCC1, ABCB1, and LRP mRNA and MRP1, MDR1, and LRP (P var.-mediated downregulation of MRP1, MDR1, and LRP might contribute to the reversal of drug resistance in non-small cell lung cancer stem cells.

  4. Characterization of CTX-M enzymes, quinolone resistance determinants, and antimicrobial residues from hospital sewage, wastewater treatment plant, and river water.

    Science.gov (United States)

    Conte, Danieli; Palmeiro, Jussara Kasuko; da Silva Nogueira, Keite; de Lima, Thiago Marenda Rosa; Cardoso, Marco André; Pontarolo, Roberto; Degaut Pontes, Flávia Lada; Dalla-Costa, Libera Maria

    2017-02-01

    Multidrug-resistant (MDR) bacteria are widespread in hospitals and have been increasingly isolated from aquatic environments. The aim of the present study was to characterize extended-spectrum β-lactamase (ESBL) and quinolone-resistant Enterobacteriaceae from a hospital effluent, sanitary effluent, inflow sewage, aeration tank, and outflow sewage within a wastewater treatment plant (WWTP), as well as river water upstream and downstream (URW and DRW, respectively), of the point where the WWTP treated effluent was discharged. β-lactamase (bla) genes, plasmid-mediated quinolone resistance (PMQR), and quinolone resistance-determining regions (QRDRs) were assessed by amplification and sequencing in 55 ESBL-positive and/or quinolone-resistant isolates. Ciprofloxacin residue was evaluated by high performance liquid chromatography. ESBL-producing isolates were identified in both raw (n=29) and treated (n=26) water; they included Escherichia coli (32), Klebsiella pneumoniae (22) and Klebsiella oxytoca (1). Resistance to both cephalosporins and quinolone was observed in 34.4% of E. coli and 27.3% of K. pneumoniae. Resistance to carbapenems was found in 5.4% of K. pneumoniae and in K. oxytoca. Results indicate the presence of bla CTX-M (51/55, 92.7%) and bla SHV (8/55, 14.5%) ESBLs, and bla GES (2/55, 3.6%) carbapenemase-encoding resistance determinants. Genes conferring quinolone resistance were detected at all sites, except in the inflow sewage and aeration tanks. Quinolone resistance was primarily attributed to amino acid substitutions in the QRDR of GyrA (47%) or to the presence of PMQR (aac-(6')-Ib-cr, oqxAB, qnrS, and/or qnrB; 52.9%) determinants. Ciprofloxacin residue was absent only from URW. Our results have shown strains carrying ESBL genes, PMQR determinants, and mutations in the gyrA QRDR genes mainly in hospital effluent, URW, and DRW samples. Antimicrobial use, and the inefficient removal of MDR bacteria and antibiotic residue during sewage treatment, may

  5. Changing patterns of drug-resistant Shigella isolates in egypt.

    Science.gov (United States)

    Abd-Elmeged, Ghada M; Khairy, Rasha M; Abo-Eloyoon, Sahar M; Abdelwahab, Sayed F

    2015-06-01

    The emergence of multidrug resistance (MDR) is a serious problem in treating shigellosis. There are limited existing data examining the change in the antimicrobial resistance profile of Shigella in Egypt. We previously reported that 58% of the Shigella isolates in Egypt were resistant to at least one member of the three different antimicrobial groups. This study was performed to determine the antimicrobial resistance profile of Shigella, determine their possible mechanisms of resistance, and compare their resistance profile to those reported 20 years ago. Stool samples were collected from 500 subjects and processed for the isolation and identification of Shigella. The susceptibility of the isolates to 11 different antimicrobials was determined using the disc diffusion method. Of 500 stool cultures, 24 (4.8%) samples were positive for Shigella. There was a high percentage of resistance to ampicillin (88%), tetracycline (83%), and sulfamethoxazole-trimethoprim (75%). Also, there was a moderate percentage of resistance to chloramphenicol (46%), streptomycin (42%), ceftazidime (33%), and cefotaxime (25%). A lower percentage of resistance was recorded for amikacin, nalidixic acid (17% each), and ofloxacin (7%), while no resistance was found to ciprofloxacin (0%). Twenty-one of the isolates (88%) were resistant to at least three different antimicrobial groups (indicating MDR). The average number of antimicrobial agents to which the Shigella isolates were resistant was 4.3±1.4, while it was 3.4±1.5 in the same locality in 1994. These data demonstrate that there is a marked increase in MDR and change in the resistance patterns of Shigella over the past 20 years.

  6. Detection of Methicillin-Resistant Staphylococci Isolated from Food Producing Animals: A Public Health Implication

    Directory of Open Access Journals (Sweden)

    Etinosa O. Igbinosa

    2016-07-01

    Full Text Available The emergence of antibiotic-resistant bacteria in food animals is a potential public health concern. Staphylococci are a significant opportunistic pathogen both in humans and dairy cattle. In the present study, the genotypic characterization of methicillin-resistant staphylococcal strains recovered from dairy cattle in a rural community (Okada, Edo State, Nigeria was investigated. A total of 283 samples from cattle (137 milk samples and 146 nasal swabs were assessed between February and April 2015. Antimicrobial susceptibility was performed by Kirby-Bauer disc diffusion method. Polymerase chain reaction (PCR assay was employed for the detection of 16S rRNA, mecA and Panton-Valentine Leucocidinis (PVL genes. The staphylococcal strains were identified through partial 16S ribosomal ribonucleic acids (rRNA nucleotide sequencing, and Basic Local Alignment Search Tool (BLAST analysis of the gene sequence showed that the staphylococcal strains have 96%–100% similarity to Staphylococcus aureus (30, S. epidermidis (17, S. haemolyticus (15, S. saprophyticus (13, S. chromogenes (8, S. simulans (7, S. pseudintermedius (6 and S. xylosus (4. Resistance of 100% was observed in all Staphylococcus spp. against MET, PEN, CLN, CHL and SXT. Multi-drug resistant (MDR bacteria from nasal cavities and raw milk reveals 13 isolates were MDR against METR, PENR, AMXR, CLNR, CHLR, SXTR CLXR, KANR, ERYR, and VANR. Of all isolates, 100% harboured the mecA gene, while 30% of the isolates possess the PVL gene. All S. aureus harboured the PVL gene while other Staphylococcus spp. were negative for the PVL gene. The presence of methicillin-resistant Staphylococcus spp. isolates in dairy cattle is a potential public health risk and thus findings in this study can be used as a baseline for further surveillance.

  7. A maize resistance gene functions against bacterial streak disease in rice.

    Science.gov (United States)

    Zhao, Bingyu; Lin, Xinghua; Poland, Jesse; Trick, Harold; Leach, Jan; Hulbert, Scot

    2005-10-25

    Although cereal crops all belong to the grass family (Poacea), most of their diseases are specific to a particular species. Thus, a given cereal species is typically resistant to diseases of other grasses, and this nonhost resistance is generally stable. To determine the feasibility of transferring nonhost resistance genes (R genes) between distantly related grasses to control specific diseases, we identified a maize R gene that recognizes a rice pathogen, Xanthomonas oryzae pv. oryzicola, which causes bacterial streak disease. Bacterial streak is an important disease of rice in Asia, and no simply inherited sources of resistance have been identified in rice. Although X. o. pv. oryzicola does not cause disease on maize, we identified a maize gene, Rxo1, that conditions a resistance reaction to a diverse collection of pathogen strains. Surprisingly, Rxo1 also controls resistance to the unrelated pathogen Burkholderia andropogonis, which causes bacterial stripe of sorghum and maize. The same gene thus controls resistance reactions to both pathogens and nonpathogens of maize. Rxo1 has a nucleotide-binding site-leucine-rich repeat structure, similar to many previously identified R genes. Most importantly, Rxo1 functions after transfer as a transgene to rice, demonstrating the feasibility of nonhost R gene transfer between cereals and providing a valuable tool for controlling bacterial streak disease.

  8. Antimicrobial Resistance and Resistance Genes in Aerobic Bacteria Isolated from Pork at Slaughter.

    Science.gov (United States)

    Li, Lili; Heidemann Olsen, Rikke; Ye, Lei; Yan, He; Nie, Qing; Meng, Hecheng; Shi, Lei

    2016-04-01

    The aim of this study was to investigate the phenotypic and genotypic antimicrobial resistance, integrons, and transferability of resistance markers in 243 aerobic bacteria recovered from pork at slaughter in the People's Republic of China. The organisms belonged to 22 genera of gram-negative bacteria (92.2%) and gram-positive bacteria (7.8%). High levels of resistance were detected to tetracycline, trimethoprim-sulfamethoxazole, and ampicillin (36.2 to 54.3%), and lower levels were detected to nitrofurantoin, cefotaxime, gentamicin, ciprofloxacin, and chloramphenicol (7.8 to 29.2%). Across species, genes conferring antimicrobial resistance were observed with the following frequencies: blaTEM, 40.7%; blaCMY-2, 15.2%; blaCTX-M, 11.5%; sul2, 27.2%; sul1, 14.4%; tet(A), 5.4%; tet(L), 5.4%; tet(M), 5.0%; tet(E), 3.7%; tet(C), 3.3%; tet(S), 2.5%; and tet(K), 0.8%. Various antimicrobial resistance genes were found in new carriers: blaTEM in Lactococcus garvieae, Myroides odoratimimus, Aeromonas hydrophila, Staphylococcus sciuri, Raoultella terrigena, Macrococcus caseolyticus, Acinetobacter ursingii, Sphingobacterium sp., and Oceanobacillus sp.; blaCMY-2 in Lactococcus lactis, Klebsiella oxytoca, Serratia marcescens, Acinetobacter baumannii, and Myroides phaeus; tet(L) in M. caseolyticus; sul1 in Vibrio cincinnatiensis; sul2 in Acinetobacter bereziniae, Acinetobacter johnsonii, and V. cincinnatiensis; and the class 1 integron and gene cassette aadA2 in V. cincinnatiensis. Approximately 6.6% of isolates contained class 1 integrons, and one isolate harbored class 2 integrons. Plasmid associated intI1 and androgen receptor- encoding genes were transferred into Escherichia coli J53 and E. coli DH5α by conjugation and transformation experiments, respectively. Our study highlights the importance of aerobic bacteria from pork as reservoirs for antimicrobial resistance genes and mobile genetic elements that can readily be transferred intra- and interspecies.

  9. Sulfonamide-resistant bacteria and their resistance genes in soils fertilized with manures from Jiangsu Province, Southeastern China.

    Directory of Open Access Journals (Sweden)

    Na Wang

    Full Text Available Antibiotic-resistant bacteria and genes are recognized as new environmental pollutants that warrant special concern. There were few reports on veterinary antibiotic-resistant bacteria and genes in China. This work systematically analyzed the prevalence and distribution of sulfonamide resistance genes in soils from the environments around poultry and livestock farms in Jiangsu Province, Southeastern China. The results showed that the animal manure application made the spread and abundance of antibiotic resistance genes (ARGs increasingly in the soil. The frequency of sulfonamide resistance genes was sul1 > sul2 > sul3 in pig-manured soil DNA and sul2 > sul1 > sul3 in chicken-manured soil DNA. Further analysis suggested that the frequency distribution of the sul genes in the genomic DNA and plasmids of the SR isolates from manured soil was sul2 > sul1 > sul3 overall (p<0.05. The combination of sul1 and sul2 was the most frequent, and the co-existence of sul1 and sul3 was not found either in the genomic DNA or plasmids. The sample type, animal type and sampling time can influence the prevalence and distribution pattern of sulfonamide resistance genes. The present study also indicated that Bacillus, Pseudomonas and Shigella were the most prevalent sul-positive genera in the soil, suggesting a potential human health risk. The above results could be important in the evaluation of antibiotic-resistant bacteria and genes from manure as sources of agricultural soil pollution; the results also demonstrate the necessity and urgency of the regulation and supervision of veterinary antibiotics in China.

  10. Diversity of multi-drug resistant Acinetobacter baumannii population in a major hospital in Kuwait

    Directory of Open Access Journals (Sweden)

    Leila eVali

    2015-07-01

    Full Text Available Acinetobacter baumannii is one of the most important opportunistic pathogens that causes serious health care associated complications in critically ill patients. In the current study we report on the diversity of the clinical multi-drug resistant A. baumannii in Kuwait by molecular characterization. One hundred A. baumannii were isolated from one of the largest governmental hospitals in Kuwait. Following the identification of the isolates by molecular methods, the amplified blaOXA-51-like gene product of one isolate (KO-12 recovered from blood showed the insertion of the ISAba19 at position 379 in blaOXA-78. Of the 33 multi-drug resistant isolates, 28 (85% contained blaOXA-23, 2 (6% blaOXA-24 and 6 (18% blaPER-1 gene. We did not detect blaOXA-58, blaVIM, blaIMP, blaGES, blaVEB and blaNDM genes in any of the tested isolates. In 3 blaPER-1 positive isolates the genetic environment of blaPER-1 consisted of two copies of ISPa12 (tnpiA1 surrounding the blaPER-1 gene on a highly stable plasmid of ca. 140-kb. MLST analysis of the 33 A. baumannii isolates identified 20 different STs, of which 6 (ST-607, ST-608, ST-609, ST-610, ST-611 and ST-612 were novel. Emerging STs such as ST15 (identified for the first time in the Middle East, ST78 and ST25 were also detected. The predominant clonal complex was CC2. PFGE and MLST defined the MDR isolates as multi-clonal with diverse lineages. Our results lead us to believe that A. baumannii is diverse in clonal origins and / or is undergoing clonal expansion continuously while multiple lineages of MDR A. baumannii circulate in hospital wards simultaneously.

  11. Antibiotic resistance and virulence genes in coliform water isolates.

    Science.gov (United States)

    Stange, C; Sidhu, J P S; Tiehm, A; Toze, S

    2016-11-01

    Widespread fecal pollution of surface water may present a major health risk and a significant pathway for dissemination of antibiotic resistance bacteria. The River Rhine is one of the longest and most important rivers in Europe and an important raw water source for drinking water production. A total of 100 coliform isolates obtained from River Rhine (Germany) were examined for their susceptibility to seven antimicrobial agents. Resistances against amoxicillin, trimethoprim/sulfamethoxazole and tetracycline were detected in 48%, 11% and 9% of isolates respectively. The antibiotic resistance could be traced back to the resistance genes bla TEM , bla SHV , ampC, sul1, sul2, dfrA1, tet(A) and tet(B). Whereby, the ampC gene represents a special case, because its presence is not inevitably linked to a phenotypic antibiotic resistance. Multiple antibiotics resistance was often accompanied by the occurrence of class 1 or 2 integrons. E. coli isolates belonging to phylogenetic groups A and B1 (commensal) were more predominant (57%) compared to B2 and D groups (43%) which are known to carry virulent genes. Additionally, six E. coli virulence genes were also detected. However, the prevalence of virulence genes in the E. coli isolates was low (not exceeding 4.3% per gene) and no diarrheagenic E. coli pathotypes were detected. This study demonstrates that surface water is an important reservoir of ARGs for a number of antibiotic classes such as sulfonamide, trimethoprim, beta-lactam-antibiotics and tetracycline. The occurrence of antibiotic resistance in coliform bacteria isolated from River Rhine provides evidence for the need to develop management strategies to limit the spread of antibiotic resistant bacteria in aquatic environment. Copyright © 2016 Elsevier GmbH. All rights reserved.

  12. [BACTERIA WITHOUT BORDERS: A HIGH CARRIAGE RATE OF ANTIBIOTIC-RESISTANT BACTERIA AMONG SYRIAN CHILDREN HOSPITALIZED IN GALILEE MEDICAL CENTER].

    Science.gov (United States)

    Faour Kassem, Diana; Shahar, Naama; Ocampo, Smadar; Bader, Tarif; Zonis, Zeev; Glikman, Daniel

    2017-05-01

    As the civil war in Syria enters its fifth year, the Israeli government continues to provide humanitarian aid to Syrian civilians in Israeli hospitals. Many wounded Syrian children are treated at the Galilee Medical Center (GMC). Due to the patients' incomplete medical history and increasing infection rates in Syria, contact isolation and screening cultures for multi-drug resistant bacteria (MDR's) are conducted upon admission for all Syrian children. To describe the rate of MDR carriage in Syrian children and compare it to hospitalized Israeli children. Prospective collection of screening culture data of Syrian patients admitted to GMC between 6/2013-11/2014 and comparison with Israeli children admitted between 1-3/2014. Extended-spectrum beta- lactamase-producing Enterobateriaceae (ESBL), Vancomycin-resistant Enterococcus (VRE), Carbapenem-resistant Enterobacteriaceae (CRE), and Methicillin-resistant Staphylococcus aureus (MRSA) were considered MDR's. Of 47 pediatric Syrian patients, 41 were severely wounded. MDR's were found in 37 (79%) children; most of the isolates were ESBL+ Escherichia coli. Over half of the ESBL's were resistant to additional antibiotics such as sulfa and quinolones; no resistance to amikacin was found. In comparison, in 6 of 40 (15%) Israeli children, MDR's (all ESBL's) were found (p<0.001). In hospitalized Syrian children, contact isolation and screening cultures for MDR's have an important role in the prevention of nosocomial transmission and establishment of empiric antimicrobial protocols. In suspected infections in Syrian children, amikacin and carbapenems are the antimicrobials of choice. MDR's are carried to a lesser extent in Israeli children but due to their importance, further largescale research is needed.

  13. Survival of Antibiotic Resistant Bacteria and Horizontal Gene Transfer Control Antibiotic Resistance Gene Content in Anaerobic Digesters.

    Science.gov (United States)

    Miller, Jennifer H; Novak, John T; Knocke, William R; Pruden, Amy

    2016-01-01

    Understanding fate of antibiotic resistant bacteria (ARB) vs. their antibiotic resistance genes (ARGs) during wastewater sludge treatment is critical in order to reduce the spread of antibiotic resistance through process optimization. Here, we spiked high concentrations of tetracycline-resistant bacteria, isolated from mesophilic (Iso M1-1-a Pseudomonas sp.) and thermophilic (Iso T10-a Bacillus sp.) anaerobic digested sludge, into batch digesters and monitored their fate by plate counts and quantitative polymerase chain reaction (QPCR) of their corresponding tetracycline ARGs. In batch studies, spiked ARB plate counts returned to baseline (thermophilic) or 1-log above baseline (mesophilic) while levels of the ARG present in the spiked isolate [tet(G)] remained high in mesophilic batch reactors. To compare results under semi-continuous flow conditions with natural influent variation, tet(O), tet(W), and sul1 ARGs, along with the intI1 integrase gene, were monitored over a 9-month period in the raw feed sludge and effluent sludge of lab-scale thermophilic and mesophilic anaerobic digesters. sul1 and intI1 in mesophilic and thermophilic digesters correlated positively (Spearman rho = 0.457-0.829, P < 0.05) with the raw feed sludge. There was no correlation in tet(O) or tet(W) ratios in raw sludge and mesophilic digested sludge or thermophilic digested sludge (Spearman rho = 0.130-0.486, P = 0.075-0.612). However, in the thermophilic digester, the tet(O) and tet(W) ratios remained consistently low over the entire monitoring period. We conclude that the influent sludge microbial composition can influence the ARG content of a digester, apparently as a result of differential survival or death of ARBs or horizontal gene transfer of genes between raw sludge ARBs and the digester microbial community. Notably, mesophilic digestion was more susceptible to ARG intrusion than thermophilic digestion, which may be attributed to a higher rate of ARB survival and/or horizontal gene

  14. Aggressive regimens for multidrug-resistant tuberculosis decrease all-cause mortality.

    Directory of Open Access Journals (Sweden)

    Carole D Mitnick

    Full Text Available A better understanding of the composition of optimal treatment regimens for multidrug-resistant tuberculosis (MDR-TB is essential for expanding universal access to effective treatment and for developing new therapies for MDR-TB. Analysis of observational data may inform the definition of an optimized regimen.This study assessed the impact of an aggressive regimen-one containing at least five likely effective drugs, including a fluoroquinolone and injectable-on treatment outcomes in a large MDR-TB patient cohort.This was a retrospective cohort study of patients treated in a national outpatient program in Peru between 1999 and 2002. We examined the association between receiving an aggressive regimen and the rate of death.In total, 669 patients were treated with individualized regimens for laboratory-confirmed MDR-TB. Isolates were resistant to a mean of 5.4 (SD 1.7 drugs. Cure or completion was achieved in 66.1% (442 of patients; death occurred in 20.8% (139. Patients who received an aggressive regimen were less likely to die (crude hazard ratio [HR]: 0.62; 95% CI: 0.44,0.89, compared to those who did not receive such a regimen. This association held in analyses adjusted for comorbidities and indicators of severity (adjusted HR: 0.63; 95% CI: 0.43,0.93.The aggressive regimen is a robust predictor of MDR-TB treatment outcome. TB policy makers and program directors should consider this standard as they design and implement regimens for patients with drug-resistant disease. Furthermore, the aggressive regimen should be considered the standard background regimen when designing randomized trials of treatment for drug-resistant TB.

  15. Risk factors associated with multidrug resistant tuberculosis among ...

    African Journals Online (AJOL)

    Background: Multidrug resistant tuberculosis (MDR-TB) remains is an important public health problem in developing world. We conducted this study to determine risk factors associated with MDR-TB and drug susceptibility pattern to second line drug among MDR TB patients in Tanzania. Methods: Unmatched case control ...

  16. Identification of Gene Resistance to Avian InfluenzaVirus (Mx Gene among Wild Waterbirds

    Directory of Open Access Journals (Sweden)

    Dewi Elfidasari

    2013-04-01

    Full Text Available The Mx gene is an antiviral gene used to determine the resistance or the susceptibility to different types of viruses, including the Avian Influenza (AI virus subtype H5N1. The AI virus subtype H5N1 infection in chickens causes Mx gene polymorphism. The Mx+ gene shows resistant to the AIvirus subtype H5N1, whereas the Mx-gene shows signs of susceptible. The objective of thisresearch was to detect the Mxgene in wild aquatic birds using the Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP method with the primer pairs F2 and NE-R2/R and the RsaI restriction enzyme. DNA samples were obtained from eight species of wild waterbirds with positive and negative exposure to the AI virus subtype H5N1. DNA amplification results showed that the Mxgene in wild aquatic birds is found in a 100 bp fragment, which is the same as the Mx gene found in chickens. However, unlike chickens, the Mxgene in wild aquatic birds did not show any polymorphism. This study proves that Mx- based resistance to AI virus subtype H5N1 in different in wild birds than in chickens.

  17. Initial drug resistance in India

    Indian Academy of Sciences (India)

    First page Back Continue Last page Overview Graphics. Initial drug resistance in India. There is gradual increase in primary MDR all over India : Pondi= Pondicherry 1985; Bangalore =1986; Jaipur = 1991; Jaipur =2000. Overall the MDR is less than 3% (TRC studies).

  18. Qualitative analysis of MDR-reversing Anastasia Black (Russian black sweet pepper, Capsicum annuum, Solanaceae) extracts and fractions by HPLC and LC-MS-MS methods.

    Science.gov (United States)

    Schelz, Zsuzsanna; Molnár, Joseph; Fogliano, Vincenzo; Ferracane, Rosalia; Pernice, Rita; Shirataki, Yoshiaki; Motohashi, Noboru

    2006-01-01

    In earlier experiments, the MDR (multidrug resistance)-reversal activities of Anastasia Black (Russian black sweet pepper) extracts had been analysed. Recently, the most effective MDR reversing extracts and fractions have been separated by HPLC (high-performance liquid chromatography, for carotenoids) and LC-MS-MS (HPLC combined with mass spectrometry, for phenolic compounds) methods. As a result of the analytical studies, the following flavonoids had been identified: feruloyl glucopyranoside, quercetin rhamnopyranoside glucopyranoside, luteolin glucopyranoside arabinopyranoside, apigenin glucopyranoside arabinopyranoside, quercetin rhamnopyranoside, luteolin arabinopyranoside diglucopy-ranoside, hesperidine and luteolin glucuronide. According to the literature, the aglycones of these phenolic compounds exhibit MDR-reversal activity in vitro, and the connection between the phenolic content of Anastasia Black and MDR-reversal action was therefore studied by different analytical methods. The results of this study revealed that the identified flavonoids of Anastasia Black may be only partially responsible for the modulation of the MDR of mouse lymphoma cells. Other lipophilic compounds, most probably carotenoids, present in Russian black sweet pepper may act as inhibitors of MDR reversal.

  19. Antibiotic resistance pattern and prevalence of qacEΔ1 and sul1 genes in Pseudomonas aeruginosa from hospital wastewater

    Directory of Open Access Journals (Sweden)

    Rosa Maria Pinto Novaes

    2018-05-01

    Full Text Available Introduction: Hospital effluents may pose great environmental risk due to the presence of pathogenic microorganisms, drugs and chemical components. Pseudomonas aeruginosa is an opportunistic pathogen frequently found in hospital environment. Objective: To evaluate the resistome of P. aeruginosa from the hospital wastewater treatment plant (HWTP in a hospital complex of Rio de Janeiro city. Method: Twenty isolates from the five stages of the HWTP were identified as P. aeruginosa by 16S rRNA gene sequencing analysis. Susceptibility to antibiotics was determined according to CLSI and qacEΔ1 and sul1 genes were detected by PCR. Sulphonamide residues were investigated by high performance liquid chromatography coupled to sequential mass spectrometry. Results: The sulfamethoxazole has been demonstrated at a level below 50 ng L-1. Sulfonamide resistance (80% has been demonstrated followed by quinolone class (50% and 13 susceptibility patterns to antimicrobials. The qacEΔ1-sul1 genes were detected in 100% of isolates suggesting the presence of class 1 integrons in the whole HWTP. Conclusions: The results signalized limitations of HWTP and propagation of resistance genes in all stages of the HWTP. These data also contribute to the environmental sanitary surveillance in the design of prevention actions against negative impact on the public health.

  20. Heightened vulnerability to MDR-TB epidemics after controlling drug-susceptible TB.

    Directory of Open Access Journals (Sweden)

    Jason D Bishai

    2010-09-01

    Full Text Available Prior infection with one strain TB has been linked with diminished likelihood of re-infection by a new strain. This paper attempts to determine the role of declining prevalence of drug-susceptible TB in enabling future epidemics of MDR-TB.A computer simulation of MDR-TB epidemics was developed using an agent-based model platform programmed in NetLogo (See http://mdr.tbtools.org/. Eighty-one scenarios were created, varying levels of treatment quality, diagnostic accuracy, microbial fitness cost, and the degree of immunogenicity elicited by drug-susceptible TB. Outcome measures were the number of independent MDR-TB cases per trial and the proportion of trials resulting in MDR-TB epidemics for a 500 year period after drug therapy for TB is introduced.MDR-TB epidemics propagated more extensively after TB prevalence had fallen. At a case detection rate of 75%, improving therapeutic compliance from 50% to 75% can reduce the probability of an epidemic from 45% to 15%. Paradoxically, improving the case-detection rate from 50% to 75% when compliance with DOT is constant at 75% increases the probability of MDR-TB epidemics from 3% to 45%.The ability of MDR-TB to spread depends on the prevalence of drug-susceptible TB. Immunologic protection conferred by exposure to drug-susceptible TB can be a crucial factor that prevents MDR-TB epidemics when TB treatment is poor. Any single population that successfully reduces its burden of drug-susceptible TB will have reduced herd immunity to externally or internally introduced strains of MDR-TB and can experience heightened vulnerability to an epidemic. Since countries with good TB control may be more vulnerable, their self interest dictates greater promotion of case detection and DOTS implementation in countries with poor control to control their risk of MDR-TB.

  1. Drug resistance-related mutations in multidrug-resistant Mycobacterium tuberculosis isolates from diverse geographical regions

    Directory of Open Access Journals (Sweden)

    Senia Rosales-Klintz

    2012-01-01

    Conclusion: This study confirms that there are significant geographical differences in the distribution of resistance-related mutations and suggests that an increased understanding of such differences in the specific distribution of resistance conferring mutations is crucial for development of new, generally applicable, molecular tools for rapid diagnosis of drug-resistant TB. The fact that a narrower distribution of mutations in high MDR-TB prevalence settings was seen suggests that much of the problems in these settings can be a result of an ongoing transmission of certain MDR-TB strains.

  2. Spread of ISCR1 elements containing blaDHA-₁ and multiple antimicrobial resistance genes leading to increase of flomoxef resistance in extended-spectrum-beta-lactamase-producing Klebsiella pneumoniae.

    Science.gov (United States)

    Lee, Chen-Hsiang; Liu, Jien-Wei; Li, Chia-Chin; Chien, Chun-Chih; Tang, Ya-Fen; Su, Lin-Hui

    2011-09-01

    Increasing resistance to quinolones, aminoglycosides, and/or cephamycins in extended-spectrum-β-lactamase (ESBL)-producing Enterobacteriaceae exacerbates the already limited antibiotic treatment options for infections due to these microbes. In this study, the presence of resistance determinants for these antimicrobial agents was examined by PCR among ESBL-producing Klebsiella pneumoniae (ESBL-KP) isolates that caused bacteremia. Pulsed-field gel electrophoresis was used to differentiate the clonal relationship among the isolates studied. Transferability and the location of the resistance genes were analyzed by conjugation experiments, followed by DNA-DNA hybridization. Among the 94 ESBL-KP isolates studied, 20 isolates of flomoxef-resistant ESBL-KP were identified. They all carried a DHA-1 gene and were genetically diverse. CTX-M genes were found in 18 of the isolates. Among these DHA-1/CTX-M-producing K. pneumoniae isolates, ISCR1 was detected in 13 (72%) isolates, qnr genes (1 qnrA and 17 qnrB genes) were detected in 18 (100%), aac(6')-Ib-cr was detected in 11 (61%), and 16S rRNA methylase (all armA genes) was detected in 14 (78%). Four transconjugants were available for further analysis, and qnrB4, aac(6')-Ib-cr, armA, and bla(DHA-1) were all identified on these self-transferable bla(CTX-M)-carrying plasmids. The genetic environments of ISCR1 associated with armA, bla(DHA-1), and qnrB4 genes in the four transconjugants were identical. Replicon-type analysis revealed a FIIA plasmid among the four self-transferable plasmids, although the other three were nontypeable. The cotransfer of multiple resistance genes with the ISCR1 element-carrying plasmids has a clinical impact and warrants close monitoring and further study.

  3. β-Elemene Reverses Chemoresistance of Breast Cancer Cells by Reducing Resistance Transmission via Exosomes

    Directory of Open Access Journals (Sweden)

    Jun Zhang

    2015-07-01

    Full Text Available Background: Currently, exosomes that act as mediators of intercellular communication are being researched extensively. Our previous studies confirmed that these exosomes contain microRNAs (miRNAs that could alter chemo-susceptibility, which is partly attributed to the successful intercellular transfer of multidrug resistance (MDR-specific miRNAs. We also confirmed that β-elemene could influence MDR-related miRNA expression and regulate the expression of the target genes PTEN and Pgp, which may lead to the reversal of the chemoresistant breast cancer (BCA cells. We are the first to report these findings, and we propose the following logical hypothesis: β-elemene can mediate MDR-related miRNA expression in cells, thereby affecting the exosome contents, reducing chemoresistance transmission via exosomes, and reversing the drug resistance of breast cancer cells. Methods: MTT-cytotoxic, miRNA microarray, real-time quantitative PCR, Dual Luciferase Activity Assay, and Western blot analysis were performed to investigate the impact of β-elemene on the expression of chemoresistance specific miRNA and PTEN as well as Pgp in chemoresistant BCA exosomes. Results: Drug resistance can be reversed by β-elemene related to exosomes. There were 104 differentially expressed miRNAs in the exosomes of two chemoresistant BCA cells: adriacin (Adr - resistant MCF-7 cells (MCF-7/Adr and docetaxel (Doc - resistant MCF-7 cells (MCF-7/Doc that underwent treatment. Of these, 31 miRNAs were correlated with the constant changes in the MDR. The expression of miR-34a and miR-452 can lead to changes in the characteristics of two chemoresistant BCA exosomes: MCF-7/Adr exosomes (A/exo and MCF-7/Doc exosomes (D/exo. The PTEN expression affected by β-elemene was significantly increased, and the Pgp expression affected by β-elemene was significantly decreased in both cells and exosomes. β-elemene induced a significant increase in the apoptosis rate in both MCF-7/Doc and MCF-7

  4. Role of Risk Factors in the Incidence of Multidrug-Resistant Tuberculosis

    Directory of Open Access Journals (Sweden)

    Alya Putri Khairani

    2017-09-01

    Full Text Available Objective: To determine the risk factors that played roles in the incidence of multidrug-resistant tuberculosis (MDR-TB in such patients. Multidrug-Resistant Tuberculosis is a form of tuberculosis caused by Mycobacterium tuberculosis that is resistant to at least isoniazid and rifampicin. Methods: This was a case control study to compare MDR-TB to non-MDR-TB pulmonary tuberculosis outpatients in Dr. Hasan Sadikin General Hospital, Bandung on August–September 2014. Fifty MDR-TB outpatients were included as the cases and 50 non-MDR-TB outpatients as controls. Data was collected by questionnaires and patient’s registration forms. Bivariate and multivariate analyses were performed using chi-square test and multiple logistic regression test, with p<0.05 considered significant. Results: From bivariate analysis, number of previous tuberculosis treatments, regularity of previous treatment, and burden of cost were significant risk factors for developing MDR-TB (p<0.05; while from multivariate analysis, number of previous TB treatments was the only risk factor that played a significant role in the incidence of MDR-TB (OR 24.128 95% CI 6.771-85,976. Conclusions: Patients and medication factors are risk factors that play roles in the incidence of MDR-TB. The significant risk factor is the number of previous TB treatment.

  5. Rapid molecular diagnostics for multi-drug resistant tuberculosis in India.

    Science.gov (United States)

    Ramachandran, Rajeswari; Muniyandi, M

    2018-03-01

    Rapid molecular diagnostic methods help in the detection of TB and Rifampicin resistance. These methods detect TB early, are accurate and play a crucial role in reducing the burden of drug resistant tuberculosis. Areas covered: This review analyses rapid molecular diagnostic tools used in the diagnosis of MDR-TB in India, such as the Line Probe Assay and GeneXpert. We have discussed the burden of MDR-TB and the impact of recent diagnostic tools on case detection and treatment outcomes. This review also discusses the costs involved in establishing these new techniques in India. Expert commentary: Molecular methods have considerable advantages for the programmatic management of drug resistant TB. These include speed, standardization of testing, potentially high throughput and reduced laboratory biosafety requirements. There is a desperate need for India to adopt modern, rapid, molecular tools with point-of-care tests being currently evaluated. New molecular diagnostic tests appear to be cost effective and also help in detecting missing cases. There is enough evidence to support the scaling up of these new tools in India.

  6. In vitro antibacterial activity of crude extracts of 9 selected medicinal plants against UTI causing MDR bacteria

    Directory of Open Access Journals (Sweden)

    Monali P. Mishra

    2017-01-01

    Full Text Available Urinary tract infection (UTI has become a more grievous problem today, due to multidrug resistance of infecting Gram-positive (GP and Gram-negative (GN bacteria, sometimes even with multiple infections. This study examines effectivity of 9 tropical flowering plants (Anogeissus acuminata, Azadirachta indica, Bauhinia variegata, Boerhaavia diffusa, Punica granatum, Soymida febrifuga, Terminalia chebula, Tinospora cordifolia and Tribulus terrestris for possible use as source of antimicrobials for multidrug resistant (MDR bacteria, along with main-stream antibiotics. Pathogenic bacteria were isolated from urine samples of patients attending and admitted in the hospital. Antibiograms of 11 isolated bacteria (GPs, Enterococcus faecalis and Staphylococcus aureus; and GNs, Acinetobacter baumannii, Citrobacter freundii, Enterobacter aerogenes, Escherichia coli, Klebsiella oxytoca, Klebsiella pneumoniae, Proteus mirabilis, Proteus vulgaris and Pseudomonas aeruginosa were ascertained by the disc-diffusion method, and antibacterial effectivity of plant extracts was monitored by the agar-well diffusion method. Isolated bacteria were floridly MDR to most antibiotics of the day. Methanol extracts of 9 plants were used, and extracts of 3 plants, A. acuminata, P. granatum and S. febrifuga at least caused 25–29 mm as the maximum size of zone of inhibition on bacterial lawns. Minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC values of methanol extracts of 9 plants were recorded. The methanol extract of A. acuminata had 0.29 mg/ml as the lowest MIC value and 0.67 mg/ml as the lowest MBC value, against MDR S. aureus, signifying effectivity; but, it had the highest MIC value of 3.41 mg/ml. and the highest MBC value of 4.27 mg/ml for most other MDR bacteria including E. coli. Qualitative phytochemical analysis was done for these 9 plants and information on leading phytochemicals was presented retrieved from PubChem database. Thus

  7. Rapid molecular detection of rifampicin resistance facilitates early diagnosis and treatment of multi-drug resistant tuberculosis: case control study.

    Directory of Open Access Journals (Sweden)

    Philly O'Riordan

    2008-09-01

    Full Text Available Multi-drug resistant tuberculosis (MDR-TB is a major public health concern since diagnosis is often delayed, increasing the risk of spread to the community and health care workers. Treatment is prolonged, and the total cost of treating a single case is high. Diagnosis has traditionally relied upon clinical suspicion, based on risk factors and culture with sensitivity testing, a process that can take weeks or months. Rapid diagnostic molecular techniques have the potential to shorten the time to commencing appropriate therapy, but have not been put to the test under field conditions.This retrospective case-control study aimed to identify risk factors for MDR-TB, and analyse the impact of testing for rifampicin resistance using RNA polymerase B (rpoB mutations as a surrogate for MDR-TB. Forty two MDR-TB cases and 84 fully sensitive TB controls were matched by date of diagnosis; and factors including demographics, clinical presentation, microbiology findings, management and outcome were analysed using their medical records. Conventionally recognised risk factors for MDR-TB were absent in almost half (43% of the cases, and 15% of cases were asymptomatic. A significant number of MDR-TB cases were identified in new entrants to the country. Using rpoB mutation testing, the time to diagnosis of MDR-TB was dramatically shortened by a median of 6 weeks, allowing patients to be commenced on appropriate therapy a median of 51days earlier than those diagnosed by conventional culture and sensitivity testing.MDR-TB is frequently an unexpected finding, may be asymptomatic, and is particularly prevalent among TB infected new entrants to the country. Molecular resistance testing of all acid fast bacilli positive specimens has the potential to rapidly identify MDR-TB patients and commence them on appropriate therapy significantly earlier than by conventional methods.

  8. Alteration of gene expression and DNA methylation in drug-resistant gastric cancer.

    Science.gov (United States)

    Maeda, Osamu; Ando, Takafumi; Ohmiya, Naoki; Ishiguro, Kazuhiro; Watanabe, Osamu; Miyahara, Ryoji; Hibi, Yoko; Nagai, Taku; Yamada, Kiyofumi; Goto, Hidemi

    2014-04-01

    The mechanisms of drug resistance in cancer are not fully elucidated. To study the drug resistance of gastric cancer, we analyzed gene expression and DNA methylation profiles of 5-fluorouracil (5-FU)- and cisplatin (CDDP)-resistant gastric cancer cells and biopsy specimens. Drug-resistant gastric cancer cells were established with culture for >10 months in a medium containing 5-FU or CDDP. Endoscopic biopsy specimens were obtained from gastric cancer patients who underwent chemotherapy with oral fluoropyrimidine S-1 and CDDP. Gene expression and DNA methylation analyses were performed using microarray, and validated using real-time PCR and pyrosequencing, respectively. Out of 17,933 genes, 541 genes commonly increased and 569 genes decreased in both 5-FU- and CDDP-resistant AGS cells. Genes with expression changed by drugs were related to GO term 'extracellular region' and 'p53 signaling pathway' in both 5-FU- and CDDP-treated cells. Expression of 15 genes including KLK13 increased and 12 genes including ETV7 decreased, in both drug-resistant cells and biopsy specimens of two patients after chemotherapy. Out of 10,365 genes evaluated with both expression microarray and methylation microarray, 74 genes were hypermethylated and downregulated, or hypomethylated and upregulated in either 5-FU-resistant or CDDP-resistant cells. Of these genes, expression of 21 genes including FSCN1, CPT1C and NOTCH3, increased from treatment with a demethylating agent. There are alterations of gene expression and DNA methylation in drug-resistant gastric cancer; they may be related to mechanisms of drug resistance and may be useful as biomarkers of gastric cancer drug sensitivity.

  9. Treatment strategy for a multidrug-resistant Klebsiella UTI.

    Science.gov (United States)

    Fleming, Erin; Heil, Emily L; Hynicka, Lauren M

    2014-01-01

    To describe the management strategy for a multidrug-resistant (MDR) Klebsiella urinary tract infection (UTI). A 69-year-old Caucasian woman with a past medical history of recurrent UTIs and a right-lung transplant presented with fever to 101.4°F, chills, malaise, and cloudy, foul-smelling urine for approximately 1 week. She was found to have a MDR Klebsiella UTI that was sensitive to tigecycline and cefepime. To further evaluate the degree of resistance Etest minimum inhibitory concentrations were requested for cefepime, amikacin, meropenem, and ertapenem. The patient received a 14-day course of amikacin, which resulted in resolution of her symptoms. One month later, the patient's UTI symptoms returned. The urine culture again grew MDR Klebsiella, sensitive only to tigecycline. Fosfomycin was initiated and resulted in limited resolution of her symptoms. Colistin was started, however, therapy was discontinued on day 5 secondary to the development of acute kidney injury. Despite the short course of therapy, the patient's symptoms resolved. The case presented lends itself well to numerous discussion items that are important to consider when determining optimal treatment for MDR Gram-negative bacilli (GNBs). Susceptibility testing is an important tool for optimizing antibiotic therapy, however, automated systems may overestimate the susceptibility profile for a MDR GNB. Treatment strategies evaluated to treat MDR GNB, include combination therapy with a carbepenem and synergy using polymyxin. We have described the management strategy for a MDR Klebsiella UTI, the consequences of the initial management strategy, and potential strategies to manage these types of infections in future patients.

  10. Comparative Genotypes, Staphylococcal Cassette Chromosome mec (SCCmec) Genes and Antimicrobial Resistance amongst Staphylococcus epidermidis and Staphylococcus haemolyticus Isolates from Infections in Humans and Companion Animals.

    Science.gov (United States)

    McManus, Brenda A; Coleman, David C; Deasy, Emily C; Brennan, Gráinne I; O' Connell, Brian; Monecke, Stefan; Ehricht, Ralf; Leggett, Bernadette; Leonard, Nola; Shore, Anna C

    2015-01-01

    This study compares the characteristics of Staphylococcus epidermidis (SE) and Staphylococcus haemolyticus (SH) isolates from epidemiologically unrelated infections in humans (Hu) (28 SE-Hu; 8 SH-Hu) and companion animals (CpA) (12 SE-CpA; 13 SH-CpA). All isolates underwent antimicrobial susceptibility testing, multilocus sequence typing and DNA microarray profiling to detect antimicrobial resistance and SCCmec-associated genes. All methicillin-resistant (MR) isolates (33/40 SE, 20/21 SH) underwent dru and mecA allele typing. Isolates were predominantly assigned to sequence types (STs) within a single clonal complex (CC2, SE, 84.8%; CC1, SH, 95.2%). SCCmec IV predominated among MRSE with ST2-MRSE-IVc common to both Hu (40.9%) and CpA (54.5%). Identical mecA alleles and nontypeable dru types (dts) were identified in one ST2-MRSE-IVc Hu and CpA isolate, however, all mecA alleles and 2/4 dts detected among 18 ST2-MRSE-IVc isolates were closely related, sharing >96.5% DNA sequence homology. Although only one ST-SCCmec type combination (ST1 with a non-typeable [NT] SCCmec NT9 [class C mec and ccrB4]) was common to four MRSH-Hu and one MRSH-CpA, all MRSH isolates were closely related based on similar STs, SCCmec genes (V/VT or components thereof), mecA alleles and dts. Overall, 39.6% of MR isolates harbored NT SCCmec elements, and ACME was more common amongst MRSE and CpA isolates. Multidrug resistance (MDR) was detected among 96.7% of isolates but they differed in the prevalence of specific macrolide, aminoglycoside and trimethoprim resistance genes amongst SE and SH isolates. Ciprofloxacin, rifampicin, chloramphenicol [fexA, cat-pC221], tetracycline [tet(K)], aminoglycosides [aadD, aphA3] and fusidic acid [fusB] resistance was significantly more common amongst CpA isolates. SE and SH isolates causing infections in Hu and CpA hosts belong predominantly to STs within a single lineage, harboring similar but variable SCCmec genes, mecA alleles and dts. Host and

  11. Comparative Genotypes, Staphylococcal Cassette Chromosome mec (SCCmec Genes and Antimicrobial Resistance amongst Staphylococcus epidermidis and Staphylococcus haemolyticus Isolates from Infections in Humans and Companion Animals.

    Directory of Open Access Journals (Sweden)

    Brenda A McManus

    Full Text Available This study compares the characteristics of Staphylococcus epidermidis (SE and Staphylococcus haemolyticus (SH isolates from epidemiologically unrelated infections in humans (Hu (28 SE-Hu; 8 SH-Hu and companion animals (CpA (12 SE-CpA; 13 SH-CpA. All isolates underwent antimicrobial susceptibility testing, multilocus sequence typing and DNA microarray profiling to detect antimicrobial resistance and SCCmec-associated genes. All methicillin-resistant (MR isolates (33/40 SE, 20/21 SH underwent dru and mecA allele typing. Isolates were predominantly assigned to sequence types (STs within a single clonal complex (CC2, SE, 84.8%; CC1, SH, 95.2%. SCCmec IV predominated among MRSE with ST2-MRSE-IVc common to both Hu (40.9% and CpA (54.5%. Identical mecA alleles and nontypeable dru types (dts were identified in one ST2-MRSE-IVc Hu and CpA isolate, however, all mecA alleles and 2/4 dts detected among 18 ST2-MRSE-IVc isolates were closely related, sharing >96.5% DNA sequence homology. Although only one ST-SCCmec type combination (ST1 with a non-typeable [NT] SCCmec NT9 [class C mec and ccrB4] was common to four MRSH-Hu and one MRSH-CpA, all MRSH isolates were closely related based on similar STs, SCCmec genes (V/VT or components thereof, mecA alleles and dts. Overall, 39.6% of MR isolates harbored NT SCCmec elements, and ACME was more common amongst MRSE and CpA isolates. Multidrug resistance (MDR was detected among 96.7% of isolates but they differed in the prevalence of specific macrolide, aminoglycoside and trimethoprim resistance genes amongst SE and SH isolates. Ciprofloxacin, rifampicin, chloramphenicol [fexA, cat-pC221], tetracycline [tet(K], aminoglycosides [aadD, aphA3] and fusidic acid [fusB] resistance was significantly more common amongst CpA isolates. SE and SH isolates causing infections in Hu and CpA hosts belong predominantly to STs within a single lineage, harboring similar but variable SCCmec genes, mecA alleles and dts. Host and

  12. Changes of Tc-99m sestamibi uptake in P-glycoprotein expressing leukaemia cells treated in vivo with antisense oligodeoxynucleotide complementary to mdr1 mRNA

    International Nuclear Information System (INIS)

    Kinuya, S.; Yokoyama, K; Fukuoka, M.; Michigishi, T.; Tonami, N.; Shiba, K.; Mori, H.; Watanabe, N.; Shuke, N.

    2006-01-01

    We examined the feasibility of Tc-99m sestamibi to monitor changes of mRNA expression of MDRl/P-glycoprotein (Pgp) following antisense oligodeoxynucleotide (AS-ODN) treatment in vivo. Three days after the intraperitoneal inoculation of murine leukaemia P388/R cells expressing MDR1/P-gp in CDFI mice, 15-mer phosphorothioate ASODN to the initiation codon of mouse mdr1 mRNA was administered intraperitoneally at 10 mg/kg daily for 3 or 4 days. Cells collected from ascites were suspended in medium for Tc-99m sestamibi uptake studies. To know the duration of antisense effects, cells were harvested 2 days later after the 3-day treatment. AS-ODN treatment increased Tc-99m sestamibi uptake. Effects of 3-day treatment and 4-day treatment were the same. Treatment effects were not detected when uptake was observed 2 days after 3-day treatment. Based on the results it was concluded that in vivo treatment with AS-ODN specific to the coding portion of mdr1 mRNA increased Tc-99m sestamibi uptake in leukaemia cells possessing MDR function. (author)

  13. Design, synthesis, and biological activities of novel hexahydropyrazino[1,2-a]indole derivatives as potent inhibitors of apoptosis (IAP) proteins antagonists with improved membrane permeability across MDR1 expressing cells.

    Science.gov (United States)

    Shiokawa, Zenyu; Hashimoto, Kentaro; Saito, Bunnai; Oguro, Yuya; Sumi, Hiroyuki; Yabuki, Masato; Yoshimatsu, Mie; Kosugi, Yohei; Debori, Yasuyuki; Morishita, Nao; Dougan, Douglas R; Snell, Gyorgy P; Yoshida, Sei; Ishikawa, Tomoyasu

    2013-12-15

    We previously reported octahydropyrrolo[1,2-a]pyrazine derivative 2 (T-3256336) as a potent antagonist for inhibitors of apoptosis (IAP) proteins. Because compound 2 was susceptible to MDR1 mediated efflux, we developed another scaffold, hexahydropyrazino[1,2-a]indole, using structure-based drug design. The fused benzene ring of this scaffold was aimed at increasing the lipophilicity and decreasing the basicity of the scaffold to improve the membrane permeability across MDR1 expressing cells. We established a chiral pool synthetic route to yield the desired tricyclic chiral isomers. Chemical modification of the core scaffold led to a representative compound 50, which showed strong inhibition of IAP binding (X chromosome-linked IAP [XIAP]: IC50 23 nM and cellular IAP [cIAP]: IC50 1.1 nM) and cell growth inhibition (MDA-MB-231 cells: GI50 2.8 nM) with high permeability and low potential of MDR1 substrate. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Systematic study of association of four GABAergic genes: glutamic acid decarboxylase 1 gene, glutamic acid decarboxylase 2 gene, GABA(B) receptor 1 gene and GABA(A) receptor subunit beta2 gene, with schizophrenia using a universal DNA microarray.

    Science.gov (United States)

    Zhao, Xu; Qin, Shengying; Shi, Yongyong; Zhang, Aiping; Zhang, Jing; Bian, Li; Wan, Chunling; Feng, Guoyin; Gu, Niufan; Zhang, Guangqi; He, Guang; He, Lin

    2007-07-01

    Several studies have suggested the dysfunction of the GABAergic system as a risk factor in the pathogenesis of schizophrenia. In the present study, case-control association analysis was conducted in four GABAergic genes: two glutamic acid decarboxylase genes (GAD1 and GAD2), a GABA(A) receptor subunit beta2 gene (GABRB2) and a GABA(B) receptor 1 gene (GABBR1). Using a universal DNA microarray procedure we genotyped a total of 20 SNPs on the above four genes in a study involving 292 patients and 286 controls of Chinese descent. Statistically significant differences were observed in the allelic frequencies of the rs187269C/T polymorphism in the GABRB2 gene (P=0.0450, chi(2)=12.40, OR=1.65) and the -292A/C polymorphism in the GAD1 gene (P=0.0450, chi(2)=14.64 OR=1.77). In addition, using an electrophoretic mobility shift assay (EMSA), we discovered differences in the U251 nuclear protein binding to oligonucleotides representing the -292 SNP on the GAD1 gene, which suggests that the -292C allele has reduced transcription factor binding efficiency compared with the 292A allele. Using the multifactor-dimensionality reduction method (MDR), we found that the interactions among the rs187269C/T polymorphism in the GABRB2 gene, the -243A/G polymorphism in the GAD2 gene and the 27379C/T and 661C/T polymorphisms in the GAD1 gene revealed a significant association with schizophrenia (Pschizophrenia in the Chinese population.

  15. Identification and characterization of two novel bla(KLUC resistance genes through large-scale resistance plasmids sequencing.

    Directory of Open Access Journals (Sweden)

    Teng Xu

    Full Text Available Plasmids are important antibiotic resistance determinant carriers that can disseminate various drug resistance genes among species or genera. By using a high throughput sequencing approach, two groups of plasmids of Escherichia coli (named E1 and E2, each consisting of 160 clinical E. coli strains isolated from different periods of time were sequenced and analyzed. A total of 20 million reads were obtained and mapped onto the known resistance gene sequences. As a result, a total of 9 classes, including 36 types of antibiotic resistant genes, were identified. Among these genes, 25 and 27 single nucleotide polymorphisms (SNPs appeared, of which 9 and 12 SNPs are nonsynonymous substitutions in the E1 and E2 samples. It is interesting to find that a novel genotype of bla(KLUC, whose close relatives, bla(KLUC-1 and bla(KLUC-2, have been previously reported as carried on the Kluyvera cryocrescens chromosome and Enterobacter cloacae plasmid, was identified. It shares 99% and 98% amino acid identities with Kluc-1 and Kluc-2, respectively. Further PCR screening of 608 Enterobacteriaceae family isolates yielded a second variant (named bla(KLUC-4. It was interesting to find that Kluc-3 showed resistance to several cephalosporins including cefotaxime, whereas bla(KLUC-4 did not show any resistance to the antibiotics tested. This may be due to a positively charged residue, Arg, replaced by a neutral residue, Leu, at position 167, which is located within an omega-loop. This work represents large-scale studies on resistance gene distribution, diversification and genetic variation in pooled multi-drug resistance plasmids, and provides insight into the use of high throughput sequencing technology for microbial resistance gene detection.

  16. Identification of acquired antimicrobial resistance genes

    DEFF Research Database (Denmark)

    Zankari, Ea; Hasman, Henrik; Cosentino, Salvatore

    2012-01-01

    ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic laborato......ObjectivesIdentification of antimicrobial resistance genes is important for understanding the underlying mechanisms and the epidemiology of antimicrobial resistance. As the costs of whole-genome sequencing (WGS) continue to decline, it becomes increasingly available in routine diagnostic...... laboratories and is anticipated to substitute traditional methods for resistance gene identification. Thus, the current challenge is to extract the relevant information from the large amount of generated data.MethodsWe developed a web-based method, ResFinder that uses BLAST for identification of acquired...... antimicrobial resistance genes in whole-genome data. As input, the method can use both pre-assembled, complete or partial genomes, and short sequence reads from four different sequencing platforms. The method was evaluated on 1862 GenBank files containing 1411 different resistance genes, as well as on 23 de...

  17. Captive and free-living urban pigeons (Columba livia) from Brazil as carriers of multidrug-resistant pathogenic Escherichia coli.

    Science.gov (United States)

    Borges, Clarissa A; Maluta, Renato P; Beraldo, Lívia G; Cardozo, Marita V; Guastalli, Elisabete A L; Kariyawasam, Subhashinie; DebRoy, Chitrita; Ávila, Fernando A

    2017-01-01

    Thirty Escherichia coli isolates from captive and free-living pigeons in Brazil were characterised. Virulence-associated genes identified in pigeons included those which occur relatively frequently in avian pathogenic E. coli (APEC) from commercial poultry worldwide. Eleven of 30 E. coli isolates from pigeons, belonging mainly to B1 and B2 phylogenetic groups, had high or intermediate pathogenicity for 1-day-old chicks. The frequency of multi-drug resistant (MDR) E. coli in captive pigeons was relatively high and included one isolate positive for the extended-spectrum β-lactamase (ESBL) gene bla CTX-M-8 . Pulsed field gel electrophoresis (PFGE) showed high heterogeneity among isolates. There is potential for pigeons to transmit antibiotic resistant pathogenic E. coli to other species through environmental contamination or direct contact. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Fine Mapping of Two Wheat Powdery Mildew Resistance Genes Located at the Pm1 Cluster

    Directory of Open Access Journals (Sweden)

    Junchao Liang

    2016-07-01

    Full Text Available Powdery mildew caused by (DC. f. sp. ( is a globally devastating foliar disease of wheat ( L.. More than a dozen genes against this disease, identified from wheat germplasms of different ploidy levels, have been mapped to the region surrounding the locus on the long arm of chromosome 7A, which forms a resistance (-gene cluster. and from einkorn wheat ( L. were two of the genes belonging to this cluster. This study was initiated to fine map these two genes toward map-based cloning. Comparative genomics study showed that macrocolinearity exists between L. chromosome 1 (Bd1 and the – region, which allowed us to develop markers based on the wheat sequences orthologous to genes contained in the Bd1 region. With these and other newly developed and published markers, high-resolution maps were constructed for both and using large F populations. Moreover, a physical map of was constructed through chromosome walking with bacterial artificial chromosome (BAC clones and comparative mapping. Eventually, and were restricted to a 0.12- and 0.86-cM interval, respectively. Based on the closely linked common markers, , , and (another powdery mildew resistance gene in the cluster were not allelic to one another. Severe recombination suppression and disruption of synteny were noted in the region encompassing . These results provided useful information for map-based cloning of the genes in the cluster and interpretation of their evolution.

  19. The fourth national anti-tuberculosis drug resistance survey in Viet Nam.

    Science.gov (United States)

    Nhung, N V; Hoa, N B; Sy, D N; Hennig, C M; Dean, A S

    2015-06-01

    Viet Nam's Fourth National Anti-Tuberculosis Drug Resistance Survey was conducted in 2011. To determine the prevalence of resistance to the four main first-line anti-tuberculosis drugs in Viet Nam. Eighty clusters were selected using a probability proportion to size approach. Drug susceptibility testing (DST) against the four main first-line anti-tuberculosis drugs was performed. A total of 1629 smear-positive tuberculosis (TB) patients were eligible for culture. Of these, DST results were available for 1312 patients, including 1105 new TB cases, 195 previously treated TB cases and 12 cases with an unknown treatment history. The proportion of cases with resistance to any drug was 32.7% (95%CI 29.1-36.5) among new cases and 54.2% (95%CI 44.3-63.7) among previously treated cases. The proportion of multidrug-resistant TB (MDR-TB) cases was 4.0% (95%CI 2.5-5.4) in new cases and 23.3 (95%CI 16.7-29.9) in previously treated cases. The fourth drug resistance survey in Viet Nam found that the proportion of MDR-TB among new and previously treated cases was not significantly different from that in the 2005 survey. The National TB Programme should prioritise the detection and treatment of MDR-TB to reduce transmission of MDR-TB in the community.

  20. An ace-1 gene duplication resorbs the fitness cost associated with resistance in Anopheles gambiae, the main malaria mosquito.

    Science.gov (United States)

    Assogba, Benoît S; Djogbénou, Luc S; Milesi, Pascal; Berthomieu, Arnaud; Perez, Julie; Ayala, Diego; Chandre, Fabrice; Makoutodé, Michel; Labbé, Pierrick; Weill, Mylène

    2015-10-05

    Widespread resistance to pyrethroids threatens malaria control in Africa. Consequently, several countries switched to carbamates and organophophates insecticides for indoor residual spraying. However, a mutation in the ace-1 gene conferring resistance to these compounds (ace-1(R) allele), is already present. Furthermore, a duplicated allele (ace-1(D)) recently appeared; characterizing its selective advantage is mandatory to evaluate the threat. Our data revealed that a unique duplication event, pairing a susceptible and a resistant copy of the ace-1 gene spread through West Africa. Further investigations revealed that, while ace-1(D) confers less resistance than ace-1(R), the high fitness cost associated with ace-1(R) is almost completely suppressed by the duplication for all traits studied. ace-1 duplication thus represents a permanent heterozygote phenotype, selected, and thus spreading, due to the mosaic nature of mosquito control. It provides malaria mosquito with a new evolutionary path that could hamper resistance management.

  1. Candidate gene association mapping of Sclerotinia stalk rot resistance in sunflower (Helianthus annuus L.) uncovers the importance of COI1 homologs.

    Science.gov (United States)

    Talukder, Zahirul I; Hulke, Brent S; Qi, Lili; Scheffler, Brian E; Pegadaraju, Venkatramana; McPhee, Kevin; Gulya, Thomas J

    2014-01-01

    Functional markers for Sclerotinia basal stalk rot resistance in sunflower were obtained using gene-level information from the model species Arabidopsis thaliana. Sclerotinia stalk rot, caused by Sclerotinia sclerotiorum, is one of the most destructive diseases of sunflower (Helianthus annuus L.) worldwide. Markers for genes controlling resistance to S. sclerotiorum will enable efficient marker-assisted selection (MAS). We sequenced eight candidate genes homologous to Arabidopsis thaliana defense genes known to be associated with Sclerotinia disease resistance in a sunflower association mapping population evaluated for Sclerotinia stalk rot resistance. The total candidate gene sequence regions covered a concatenated length of 3,791 bp per individual. A total of 187 polymorphic sites were detected for all candidate gene sequences, 149 of which were single nucleotide polymorphisms (SNPs) and 38 were insertions/deletions. Eight SNPs in the coding regions led to changes in amino acid codons. Linkage disequilibrium decay throughout the candidate gene regions declined on average to an r (2) = 0.2 for genetic intervals of 120 bp, but extended up to 350 bp with r (2) = 0.1. A general linear model with modification to account for population structure was found the best fitting model for this population and was used for association mapping. Both HaCOI1-1 and HaCOI1-2 were found to be strongly associated with Sclerotinia stalk rot resistance and explained 7.4 % of phenotypic variation in this population. These SNP markers associated with Sclerotinia stalk rot resistance can potentially be applied to the selection of favorable genotypes, which will significantly improve the efficiency of MAS during the development of stalk rot resistant cultivars.

  2. Converging risk factors but no association between HIV infection and multidrug-resistant tuberculosis in Kazakhstan.

    Science.gov (United States)

    van den Hof, S; Tursynbayeva, A; Abildaev, T; Adenov, M; Pak, S; Bekembayeva, G; Ismailov, S

    2013-04-01

    Kazakhstan is a country with a low HIV/AIDS (human immunodeficiency virus/acquired immune-deficiency syndrome) burden, but a high prevalence of multidrug-resistant tuberculosis (MDR-TB). We describe the epidemiology of multidrug resistance and HIV among TB patients, using the 2007-2011 national electronic TB register. HIV test results were available for 97.2% of TB patients. HIV prevalence among TB patients increased from 0.6% in 2007 to 1.5% in 2011. Overall, 41.6% of patients had a positive smear at diagnosis, 38.6% a positive culture and 51.7% either a positive smear or culture. Drug susceptibility testing (DST) results were available for 92.7% of culture-positive cases. Socio-economic factors independently associated with both HIV and MDR-TB were urban residency, drug use, homelessness and a history of incarceration. In adjusted analysis, HIV positivity was not associated with MDR-TB (OR 1.0, 95%CI 0.86-1.2). Overall, among TB patients with DST and HIV test results available, 65.0% were positive for neither HIV nor MDR-TB, 33.5% only for MDR-TB, 0.9% only for HIV and 0.6% for both HIV and MDR-TB. Among injection drug users, 12.5% were positive for HIV and MDR-TB. We showed increasing HIV prevalence among TB patients in Kazakhstan. HIV was not an independent risk factor for MDR-TB, but risk factors were largely overlapping and we did identify subgroups at particular risk of HIV-MDR-TB co-infection, notably drug users. Enhanced efforts are necessary to provide care to these socially vulnerable populations.

  3. Healthcare- and Community-Associated Methicillin-Resistant Staphylococcus aureus (MRSA) and Fatal Pneumonia with Pediatric Deaths in Krasnoyarsk, Siberian Russia: Unique MRSA's Multiple Virulence Factors, Genome, and Stepwise Evolution

    Science.gov (United States)

    Khokhlova, Olga E.; Hung, Wei-Chun; Wan, Tsai-Wen; Iwao, Yasuhisa; Takano, Tomomi; Higuchi, Wataru; Yachenko, Svetlana V.; Teplyakova, Olga V.; Kamshilova, Vera V.; Kotlovsky, Yuri V.; Nishiyama, Akihito; Reva, Ivan V.; Sidorenko, Sergey V.; Peryanova, Olga V.; Reva, Galina V.; Teng, Lee-Jene; Salmina, Alla B.; Yamamoto, Tatsuo

    2015-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) is a common multidrug-resistant (MDR) pathogen. We herein discussed MRSA and its infections in Krasnoyarsk, Siberian Russia between 2007 and 2011. The incidence of MRSA in 3,662 subjects was 22.0% and 2.9% for healthcare- and community-associated MRSA (HA- and CA-MRSA), respectively. The 15-day mortality rates for MRSA hospital- and community-acquired pneumonia (HAP and CAP) were 6.5% and 50%, respectively. MRSA CAP cases included pediatric deaths; of the MRSA pneumonia episodes available, ≥27.3% were associated with bacteremia. Most cases of HA-MRSA examined exhibited ST239/spa3(t037)/SCCmecIII.1.1.2 (designated as ST239Kras), while all CA-MRSA cases examined were ST8/spa1(t008)/SCCmecIV.3.1.1(IVc) (designated as ST8Kras). ST239Kras and ST8Kras strongly expressed cytolytic peptide (phenol-soluble modulin α, PSMα; and δ-hemolysin, Hld) genes, similar to CA-MRSA. ST239Kras pneumonia may have been attributed to a unique set of multiple virulence factors (MVFs): toxic shock syndrome toxin-1 (TSST-1), elevated PSMα/Hld expression, α-hemolysin, the staphylococcal enterotoxin SEK/SEQ, the immune evasion factor SCIN/SAK, and collagen adhesin. Regarding ST8Kras, SEA was included in MVFs, some of which were common to ST239Kras. The ST239Kras (strain OC3) genome contained: a completely unique phage, φSa7-like (W), with no att repetition; S. aureus pathogenicity island SaPI2R, the first TSST-1 gene-positive (tst+) SaPI in the ST239 lineage; and a super copy of IS256 (≥22 copies/genome). ST239Kras carried the Brazilian SCCmecIII.1.1.2 and United Kingdom-type tst. ST239Kras and ST8Kras were MDR, with the same levofloxacin resistance mutations; small, but transmissible chloramphenicol resistance plasmids spread widely enough to not be ignored. These results suggest that novel MDR and MVF+ HA- and CA-MRSA (ST239Kras and ST8Kras) emerged in Siberian Russia (Krasnoyarsk) associated with fatal pneumonia, and also with ST

  4. Risk score modeling of multiple gene to gene interactions using aggregated-multifactor dimensionality reduction

    Directory of Open Access Journals (Sweden)

    Dai Hongying

    2013-01-01

    Full Text Available Abstract Background Multifactor Dimensionality Reduction (MDR has been widely applied to detect gene-gene (GxG interactions associated with complex diseases. Existing MDR methods summarize disease risk by a dichotomous predisposing model (high-risk/low-risk from one optimal GxG interaction, which does not take the accumulated effects from multiple GxG interactions into account. Results We propose an Aggregated-Multifactor Dimensionality Reduction (A-MDR method that exhaustively searches for and detects significant GxG interactions to generate an epistasis enriched gene network. An aggregated epistasis enriched risk score, which takes into account multiple GxG interactions simultaneously, replaces the dichotomous predisposing risk variable and provides higher resolution in the quantification of disease susceptibility. We evaluate this new A-MDR approach in a broad range of simulations. Also, we present the results of an application of the A-MDR method to a data set derived from Juvenile Idiopathic Arthritis patients treated with methotrexate (MTX that revealed several GxG interactions in the folate pathway that were associated with treatment response. The epistasis enriched risk score that pooled information from 82 significant GxG interactions distinguished MTX responders from non-responders with 82% accuracy. Conclusions The proposed A-MDR is innovative in the MDR framework to investigate aggregated effects among GxG interactions. New measures (pOR, pRR and pChi are proposed to detect multiple GxG interactions.

  5. Sponge microbiota are a reservoir of functional antibiotic resistance genes

    Directory of Open Access Journals (Sweden)

    Dennis Versluis

    2016-11-01

    Full Text Available Wide application of antibiotics has contributed to the evolution of multi-drug resistant human pathogens, resulting in poorer treatment outcomes for infections. In the marine environment, seawater samples have been investigated as a resistance reservoir; however, no studies have methodically examined sponges as a reservoir of antibiotic resistance. Sponges could be important in this respect because they often contain diverse microbial communities that have the capacity to produce bioactive metabolites. Here, we applied functional metagenomics to study the presence and diversity of functional resistance genes in the sponges Aplysina aerophoba, Petrosia ficiformis and Corticium candelabrum. We obtained 37 insert sequences facilitating resistance to D-cycloserine (n=6, gentamicin (n=1, amikacin (n=7, trimethoprim (n=17, chloramphenicol (n=1, rifampicin (n=2 and ampicillin (n=3. Fifteen of 37 inserts harboured resistance genes that shared <90% amino acid identity with known gene products, whereas on 13 inserts no resistance gene could be identified with high confidence, in which case we predicted resistance to be mainly mediated by antibiotic efflux. One marine-specific ampicillin-resistance-conferring β-lactamase was identified in the genus Pseudovibrio with 41% global amino acid identity to the closest β-lactamase with demonstrated functionality, and subsequently classified into a new family termed PSV. Taken together, our results show that sponge microbiota host diverse and novel resistance genes that may be harnessed by phylogenetically distinct bacteria.

  6. Molecular characterization and antimicrobial resistance of faecal and urinary Escherichia coli isolated from dogs and humans in Italy

    Directory of Open Access Journals (Sweden)

    Clara Tramuta

    2014-03-01

    Full Text Available During this study, 109 faecal Escherichia coli samples isolated from 61 dogs and 48 humans were characterised according to phylogenetic group, extraintestinal virulence factors and antibiotic resistance. The isolates from dogs were predominantly distributed within phylogroup B1 (36%, while the majority of human strains belonged to phylogroup B2 (54%. The prevalence of cnf1, hlyA, papC and sfa virulence genes was significantly associated with the group B2. Canine isolates showed multidrug resistance (MDR more frequently than human strains. Since group B2 contains most of the strains that cause extraintestinal infections, all 46 B2 faecal strains were confronted against an addition population of 57 urinary E. coli strains belonging to the same phylogroup. The comparison shows that there was no significant difference in the occurrence of virulence factors or in the distribution of antibiotic resistance between faecal and urinary E. coli isolates fromd dogs. At the same time, a highly significant association was detected between multiple resistence and the source of the strains and between MDR and E. coli isolated from urine in human. This study highlighted similar features of E. coli isolated across sources and hosts. The data suggest a high prevalence of antibiotic resistance in faecal strains, which may represent a serious health risk since these strains can function as a reservoir for uropathogenic E. coli.

  7. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Science.gov (United States)

    Sahoo, Dipak K; Abeysekara, Nilwala S; Cianzio, Silvia R; Robertson, Alison E; Bhattacharyya, Madan K

    2017-01-01

    Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs) (F7 families) were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR)-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  8. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Directory of Open Access Journals (Sweden)

    Dipak K Sahoo

    Full Text Available Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs (F7 families were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  9. Surveillance of extensively drug-resistant tuberculosis in Europe, 2003-2007.

    NARCIS (Netherlands)

    Devaux, I.; Manissero, D.; Fernandez de la Hoz, K.; Kremer, K.; Soolingen, D. van

    2010-01-01

    This paper describes the results of second-line drug (SLD) susceptibility tests among multidrug-resistant tuberculosis (MDR TB) cases reported in 20 European countries aiming to identify extensively drug-resistant tuberculosis (XDR TB) cases. A project on molecular surveillance of MDR TB cases was

  10. Distribution of resistance genetic determinants among Vibrio cholerae isolates of 2012 and 2013 outbreaks in IR Iran.

    Science.gov (United States)

    Rezaie, Niloofar; Bakhshi, Bita; Najar-Peerayeh, Shahin

    2017-03-01

    The objective of this study was to characterize antimicrobial resistance determinants in relation to antimicrobial susceptibility and genotyping profile in 20 clinical isolates of Vibrio cholerae. All of the isolates were resistant to streptomycin. The second most prevalent resistance was observed to trimethoprim (75%), co-trimoxazole (60%), tetracycline (50%), and minocycline (45%). About 50% of the isolates fulfilled the criteria of Multi Drug Resistance (MDR) phenotype. None of the isolates carried tet A, B, C, and, D determinants. This finding shows that tetracycline resistance determinants recognized so far, does not satisfactorily describe the 50% tetracycline resistance phenotype in this study, suggesting the possible contribution of other not yet characterized resistance mechanisms involved. Class 1 integron, widely distributed among enteric bacteria, was not detected among V. cholerae strains under study. Conversely, 100% of the isolates harbored SXT constin (int) , among which 70% were positive for dfrA1, strA, and strB genes. The sul1gene was present in 60% of the isolates while none of them contained floR gene. All the isolates uniformly appeared to be identical in fingerprinting profiles expected from outbreak strains. In conclusion, SXT element with its mosaic structure was the exclusive antimicrobial resistance determinant of clonal V. cholerae isolates taken from outbreaks of 2012 and 2013 in Iran. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Molecular epidemiological survey of the quinolone- and carbapenem-resistant genotype and its association with the type III secretion system in Pseudomonas aeruginosa.

    Science.gov (United States)

    Ferreira, Melina Lorraine; Dantas, Raquel Cavalcanti; Faria, Ana Luiza Souza; Gonçalves, Iara Rossi; Silveira de Brito, Cristiane; Queiroz, Lícia Ludendorff; Gontijo-Filho, Paulo P; Ribas, Rosineide Marques

    2015-03-01

    This study evaluated the predictors of mortality and the impact of inappropriate therapy on the outcomes of patients with bacteraemia and ventilator-associated pneumonia (VAP). Additionally, we evaluated the correlation of the type III secretion system (TTSS) effector genotype with resistance to carbapenems and fluoroquinolones, mutations in the quinolone resistance-determining regions (QRDRs), metallo-β-lactamase and virulence factors. A retrospective cohort was conducted at a tertiary hospital in patients with multidrug-resistant (MDR) P. aeruginosa bacteraemia (157 patients) and VAP (60 patients). The genes for blaIMP, blaVIM, blaSIM, blaGIM and blaSPM and virulence genes (exoT, exoS, exoY, exoU, lasB, algD and toxA) were detected; sequencing was conducted for QRDR genes on fluoroquinolone-resistant strains. The multivariate analyses showed that the predictors independently associated with death in patients with bacteraemia were cancer and inappropriate therapy. Carbapenem resistance was more frequent among strains causing VAP (53.3 %), and in blood we observed the blaSPM genotype (66.6 %) and blaVIM genotype (33.3 %). The exoS gene was found in all isolates, whilst the frequency was low for exoU (9.4 %). Substitution of threonine to isoleucine at position 83 in gyrA was the most frequent mutation among fluoroquinolone-resistant strains. Our study showed a mutation at position 91 in the parC gene (Glu91Lys) associated with a mutation in gyrA (Thre83Ile) in a strain of extensively drug-resistant P. aeruginosa, with the exoT(+)exoS(+)exoU(+) genotype, that has not yet been described in Brazil to the best of our knowledge. This comprehensive analysis of resistance mechanisms to carbapenem and fluoroquinolones and their association with TTSS virulence genes, covering MDR P. aeruginosa in Brazil, is the largest reported to date. © 2015 The Authors.

  12. Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China

    Science.gov (United States)

    Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.

    2011-01-01

    Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

  13. Multidrug-resistant tuberculosis

    Directory of Open Access Journals (Sweden)

    McNerney Ruth

    2008-01-01

    Full Text Available Abstract Background With almost 9 million new cases each year, tuberculosis remains one of the most feared diseases on the planet. Led by the STOP-TB Partnership and WHO, recent efforts to combat the disease have made considerable progress in a number of countries. However, the emergence of mutated strains of Mycobacterium tuberculosis that are resistant to the major anti-tuberculosis drugs poses a deadly threat to control efforts. Multidrug-resistant tuberculosis (MDR-TB has been reported in all regions of the world. More recently, extensively drug resistant-tuberculosis (XDR-TB that is also resistant to second line drugs has emerged in a number of countries. To ensure that adequate resources are allocated to prevent the emergence and spread of drug resistance it is important to understand the scale of the problem. In this article we propose that current methods of describing the epidemiology of drug resistant tuberculosis are not adequate for this purpose and argue for the inclusion of population based statistics in global surveillance data. Discussion Whereas the prevalence of tuberculosis is presented as the proportion of individuals within a defined population having disease, the prevalence of drug resistant tuberculosis is usually presented as the proportion of tuberculosis cases exhibiting resistance to anti-tuberculosis drugs. Global surveillance activities have identified countries in Eastern Europe, the former Soviet Union and regions of China as having a high proportion of MDR-TB cases and international commentary has focused primarily on the urgent need to improve control in these settings. Other regions, such as sub-Saharan Africa have been observed as having a low proportion of drug resistant cases. However, if one considers the incidence of new tuberculosis cases with drug resistant disease in terms of the population then countries of sub-Saharan Africa have amongst the highest rates of transmitted MDR-TB in the world. We propose

  14. Modeling the fate of antibiotic resistance genes and class 1 integrons during thermophilic anaerobic digestion of municipal wastewater solids.

    Science.gov (United States)

    Burch, Tucker R; Sadowsky, Michael J; LaPara, Timothy M

    2015-10-19

    This study investigated the use of thermophilic anaerobic digestion for removing antibiotic resistance genes (ARGs) from residual municipal wastewater solids. Four laboratory-scale anaerobic digesters were operated in 8-day batch cycles at temperatures of 40, 56, 60, and 63 °C. Two tetracycline resistance genes (tet(W) and tet(X)), a fluoroquinolone resistance gene (qnrA), the integrase gene of class 1 integrons (intI1), 16S rRNA genes of all Bacteria, and 16S rRNA genes of methanogens were quantified using real-time quantitative PCR. ARG and intI1 quantities decreased at all temperatures and were described well by a modified form of the Collins-Selleck disinfection kinetic model. The magnitudes of Collins-Selleck kinetic parameters were significantly greater at thermophilic temperatures compared to 40 °C, but few statistically significant differences were observed among these parameters for the thermophilic anaerobic digesters. This model allows for the direct comparison of different operating conditions (e.g., temperature) on anaerobic digestion performance in mitigating the quantity of ARGs in wastewater solids and could be used to design full-scale anaerobic digesters to specifically treat for ARGs as a "pollutant" of concern.

  15. The Lr34 adult plant rust resistance gene provides seedling resistance in durum wheat without senescence.

    Science.gov (United States)

    Rinaldo, Amy; Gilbert, Brian; Boni, Rainer; Krattinger, Simon G; Singh, Davinder; Park, Robert F; Lagudah, Evans; Ayliffe, Michael

    2017-07-01

    The hexaploid wheat (Triticum aestivum) adult plant resistance gene, Lr34/Yr18/Sr57/Pm38/Ltn1, provides broad-spectrum resistance to wheat leaf rust (Lr34), stripe rust (Yr18), stem rust (Sr57) and powdery mildew (Pm38) pathogens, and has remained effective in wheat crops for many decades. The partial resistance provided by this gene is only apparent in adult plants and not effective in field-grown seedlings. Lr34 also causes leaf tip necrosis (Ltn1) in mature adult plant leaves when grown under field conditions. This D genome-encoded bread wheat gene was transferred to tetraploid durum wheat (T. turgidum) cultivar Stewart by transformation. Transgenic durum lines were produced with elevated gene expression levels when compared with the endogenous hexaploid gene. Unlike nontransgenic hexaploid and durum control lines, these transgenic plants showed robust seedling resistance to pathogens causing wheat leaf rust, stripe rust and powdery mildew disease. The effectiveness of seedling resistance against each pathogen correlated with the level of transgene expression. No evidence of accelerated leaf necrosis or up-regulation of senescence gene markers was apparent in these seedlings, suggesting senescence is not required for Lr34 resistance, although leaf tip necrosis occurred in mature plant flag leaves. Several abiotic stress-response genes were up-regulated in these seedlings in the absence of rust infection as previously observed in adult plant flag leaves of hexaploid wheat. Increasing day length significantly increased Lr34 seedling resistance. These data demonstrate that expression of a highly durable, broad-spectrum adult plant resistance gene can be modified to provide seedling resistance in durum wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  16. Circumvention of the multidrug-resistance protein (MRP-1) by an antitumor drug through specific inhibition of gene transcription in breast tumor cells.

    Science.gov (United States)

    Mansilla, Sylvia; Rojas, Marta; Bataller, Marc; Priebe, Waldemar; Portugal, José

    2007-04-01

    Multidrug-resistance protein 1 (MRP-1) confers resistance to a number of clinically important chemotherapeutic agents. The promoter of the mrp-1 gene contains an Sp1-binding site, which we targeted using the antitumor bis-anthracycline WP631. When MCF-7/VP breast cancer cells, which overexpress MRP-1 protein, were incubated with WP631 the expression of the multidrug-resistance protein gene decreased. Conversely, doxorubicin did not alter mrp-1 gene expression. The inhibition of gene expression was followed by a decrease in the activity of the MRP-1 protein. The IC(75) for WP631 (drug concentration required to inhibit cell growth by 75%) circumvented the drug-efflux pump, without addition of resistant modifiers. After treatment with WP631, MCF-7/VP cells were committed to die after entering mitosis (mitotic catastrophe), while treatment with doxorubicin did not affect cell growth. This is the first report on an antitumor drug molecule inhibiting the mrp-1 gene directly, rather than being simply a poor substrate for the transporter-mediated efflux. However, both situations appeared to coexist, thereby a superior cytotoxic effect was attained. Ours results suggest that WP631 offers great potential for the clinical treatment of tumors displaying a multidrug-resistance phenotype.

  17. Clinical and programmatic considerations in the treatment of MDR-TB in children: a series of 16 patients from Lima, Peru.

    Science.gov (United States)

    Mukherjee, J S; Joseph, J K; Rich, M L; Shin, S S; Furin, J J; Seung, K J; Sloutsky, A; Socci, A R; Vanderwarker, C; Vasquez, L; Palacios, E; Guerra, D; Viru, F A; Farmer, P; Del Castillo, H E

    2003-07-01

    Since 2000, the directly observed treatment, short-course (DOTS) strategy has been expanded in several countries to include treatment of multidrug-resistant tuberculosis (MDR-TB). This strategy is known as DOTS-Plus. Tuberculosis is a common cause of morbidity and mortality for children throughout the developing world. Children may also be infected with MDR-TB, yet most developing countries do not specifically address pediatric MDR-TB. To present the intermediate outcomes of the first 16 children enrolled in the Peruvian DOTS-Plus program and to demonstrate the tolerability of second-line anti-tuberculosis drugs. Three children completed therapy and are cured, one child had bacteriologic and clinical failure after 12 months of therapy and died of respiratory insufficiency, and 12 have intermediate outcomes demonstrating favorable clinical, bacteriologic, and radiographic evidence of improvement after 9-19 months of therapy. Of the 16 pediatric DOTS-Plus patients, 15 have tolerated therapy well and have had favorable clinical evolution. However, the diagnosis of pediatric MDR-TB is often extremely delayed due to reliance on the adult case definition and should be changed to prevent progressive, chronic illness in such children. Programmatic changes could facilitate earlier diagnosis and treatment of pediatric MDR-TB in Peru and in other DOTS-Plus programs.

  18. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China.

    Science.gov (United States)

    Zhao, Yongda; Guo, Lili; Li, Jie; Huang, Xianhui; Fang, Binghu

    2018-01-01

    Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase ( gyrA and gyrB ) and topoisomerase IV ( parC and parE ). The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%), levofloxacin (20.28%), norfloxacin (22.38%), ciprofloxacin (23.78%), however, high resistance levels were found to nalidixic acid (82.52%) and enrofloxacin (55.94%). In addition, we found 14 antimicrobial resistance genes were present in these isolates, including bla TEM-1 , bla ROB-1 , ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3')-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes ( tetB, tetC, flor, rmtB, sul1 ). The genes tetB , rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G) were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target gene mutations. These data provide novel

  19. Genetic makeup of amantadine-resistant and oseltamivir-resistant human influenza A/H1N1 viruses.

    Science.gov (United States)

    Zaraket, Hassan; Saito, Reiko; Suzuki, Yasushi; Baranovich, Tatiana; Dapat, Clyde; Caperig-Dapat, Isolde; Suzuki, Hiroshi

    2010-04-01

    The emergence and widespread occurrence of antiviral drug-resistant seasonal human influenza A viruses, especially oseltamivir-resistant A/H1N1 virus, are major concerns. To understand the genetic background of antiviral drug-resistant A/H1N1 viruses, we performed full genome sequencing of prepandemic A/H1N1 strains. Seasonal influenza A/H1N1 viruses, including antiviral-susceptible viruses, amantadine-resistant viruses, and oseltamivir-resistant viruses, obtained from several areas in Japan during the 2007-2008 and 2008-2009 influenza seasons were analyzed. Sequencing of the full genomes of these viruses was performed, and the phylogenetic relationships among the sequences of each individual genome segment were inferred. Reference genome sequences from the Influenza Virus Resource database were included to determine the closest ancestor for each segment. Phylogenetic analysis revealed that the oseltamivir-resistant strain evolved from a reassortant oseltamivir-susceptible strain (clade 2B) which circulated in the 2007-2008 season by acquiring the H275Y resistance-conferring mutation in the NA gene. The oseltamivir-resistant lineage (corresponding to the Northern European resistant lineage) represented 100% of the H1N1 isolates from the 2008-2009 season and further acquired at least one mutation in each of the polymerase basic protein 2 (PB2), polymerase basic protein 1 (PB1), hemagglutinin (HA), and neuraminidase (NA) genes. Therefore, a reassortment event involving two distinct oseltamivir-susceptible lineages, followed by the H275Y substitution in the NA gene and other mutations elsewhere in the genome, contributed to the emergence of the oseltamivir-resistant lineage. In contrast, amantadine-resistant viruses from the 2007-2008 season distinctly clustered in clade 2C and were characterized by extensive amino acid substitutions across their genomes, suggesting that a fitness gap among its genetic components might have driven these mutations to maintain it in the

  20. Strategies to overcome or circumvent P-glycoprotein mediated multidrug resistance.

    Science.gov (United States)

    Yuan, Hongyu; Li, Xun; Wu, Jifeng; Li, Jinpei; Qu, Xianjun; Xu, Wenfang; Tang, Wei

    2008-01-01

    Cancer patients who receive chemotherapy often experience intrinsic or acquired resistance to a broad spectrum of chemotherapeutic agents. The phenomenon, termed multidrug resistance (MDR), is often associated with the over-expression of P-glycoprotein, a transmembrane protein pump, which can enhance efflux of a various chemicals structurally unrelated at the expense of ATP depletion, resulting in decrease of the intracellular cytotoxic drug accumulation. The MDR has been a big threaten to the human health and the war fight for it continues. Although several other mechanisms for MDR are elucidated in recent years, considerable efforts attempting to inverse MDR are involved in exploring P-glycoprotein modulators and suppressing P-glycoprotein expression. In this review, we will report on the recent advances in various strategies for overcoming or circumventing MDR mediated by P-glycoprotein.

  1. Higher Desolvation Energy Reduces Molecular Recognition in Multi-Drug Resistant HIV-1 Protease

    Directory of Open Access Journals (Sweden)

    Ladislau C. Kovari

    2012-05-01

    Full Text Available Designing HIV-1 protease inhibitors that overcome drug-resistance is still a challenging task. In this study, four clinical isolates of multi-drug resistant HIV-1 proteases that exhibit resistance to all the US FDA-approved HIV-1 protease inhibitors and also reduce the substrate recognition ability were examined. A multi-drug resistant HIV-1 protease isolate, MDR 769, was co-crystallized with the p2/NC substrate and the mutated CA/p2 substrate, CA/p2 P1’F. Both substrates display different levels of molecular recognition by the wild-type and multi-drug resistant HIV-1 protease. From the crystal structures, only limited differences can be identified between the wild-type and multi-drug resistant protease. Therefore, a wild-type HIV-1 protease and four multi-drug resistant HIV-1 proteases in complex with the two peptides were modeled based on the crystal structures and examined during a 10 ns-molecular dynamics simulation. The simulation results reveal that the multi-drug resistant HIV-1 proteases require higher desolvation energy to form complexes with the peptides. This result suggests that the desolvation of the HIV-1 protease active site is an important step of protease-ligand complex formation as well as drug resistance. Therefore, desolvation energy could be considered as a parameter in the evaluation of future HIV-1 protease inhibitor candidates.

  2. Isolation of NBS-LRR class resistant gene (I2 gene) from tomato ...

    African Journals Online (AJOL)

    aghomotsegin

    2013-10-16

    Oct 16, 2013 ... type of F. oxysporum f. sp. lycopersici observed commonly which require presence of I1 gene in tomato plant for the incompatibility ... Key words: Fusarium wilt, race, R-gene, resistance, tomato. ... MATERIALS AND METHODS.

  3. Molecular epidemiology and drug resistant mechanism in carbapenem-resistant Klebsiella pneumoniae isolated from pediatric patients in Shanghai, China.

    Science.gov (United States)

    Zhang, Xingyu; Chen, Di; Xu, Guifeng; Huang, Weichun; Wang, Xing

    2018-01-01

    Infection by carbapenem-resistant Klebsiella pneumoniae (CR-KP) is a public health challenge worldwide, in particular among children, which was associated with high morbidity and mortality rates. There was limited data in pediatric populations, thus this study aimed to investigate molecular epidemiology and drug resistant mechanism of CR-KP strains from pediatric patients in Shanghai, China. A total of 41 clinical CR-KP isolates from sputum, urine, blood or drainage fluid were collected between July 2014 and May 2015 in Shanghai Children's Medical Center. Multilocus sequence typing (MLST), antibiotic susceptibility testing, PCR amplification and sequencing of the drug resistance associated genes were applied to all these isolates. MLST analysis revealed 16 distinct STs identified within the 41 isolates, among which the most frequently represented were ST11(19.5%),ST25(14.6%),ST76(14.6%),ST37(9.8%).One new ST was first identified. All CR-KP isolates showed MDR phenotypes and were resistance to ceftazidime, imipenem, piperacillin / tazobactam, ceftriaxone, ampicillin /sulbactam, aztreonam. They were confirmed as carbapenemase producer, NDM-1 (56.1%, 23/41), IMP (26.8%, 11/41), KPC-2 (22.0%, 9/41) were detected. Of note, two isolates carried simultaneously both NDM-1 and IMP-4. All CR-KP strains contained at least one of extended spectrum β-lactamase genes tested(TEM, SHV, OXA-1, CTX-M group) and six isolates carried both ESBL and AmpC genes(DHA-1). Among the penicllinase and β-lactamase genes, the most frequently one is SHV(92.7%,38/41), followed by TEM-1(68.3%,28/41), CTX-M-14(43.9%,18/41), CTX-M-15(43.9%,14/41), OXA-1(14.6%,6/41). In the present study, NDM-1-producing isolates was the predominant CR-KP strains in children, follow by IMP and KPC-producing strains. NDM-1and IMP-4 were more frequent than KPC-2 and showed a multiclonal background. Those suggested carbapenem-resistant in children is diverse, and certain resistance mechanisms differ from prevalent

  4. Gene-gene interactions and gene polymorphisms of VEGFA and EG-VEGF gene systems in recurrent pregnancy loss.

    Science.gov (United States)

    Su, Mei-Tsz; Lin, Sheng-Hsiang; Chen, Yi-Chi; Kuo, Pao-Lin

    2014-06-01

    Both vascular endothelial growth factor A (VEGFA) and endocrine gland-derived vascular endothelial growth factor (EG-VEGF) systems play major roles in angiogenesis. A body of evidence suggests VEGFs regulate critical processes during pregnancy and have been associated with recurrent pregnancy loss (RPL). However, little information is available regarding the interaction of these two major major angiogenesis-related systems in early human pregnancy. This study was conducted to investigate the association of gene polymorphisms and gene-gene interaction among genes in VEGFA and EG-VEGF systems and idiopathic RPL. A total of 98 women with history of idiopathic RPL and 142 controls were included, and 5 functional SNPs selected from VEGFA, KDR, EG-VEGF (PROK1), PROKR1 and PROKR2 were genotyped. We used multifactor dimensionality reduction (MDR) analysis to choose a best model and evaluate gene-gene interactions. Ingenuity pathways analysis (IPA) was introduced to explore possible complex interactions. Two receptor gene polymorphisms [KDR (Q472H) and PROKR2 (V331M)] were significantly associated with idiopathic RPL (P<0.01). The MDR test revealed that the KDR (Q472H) polymorphism was the best loci to be associated with RPL (P=0.02). IPA revealed EG-VEGF and VEGFA systems shared several canonical signaling pathways that may contribute to gene-gene interactions, including the Akt, IL-8, EGFR, MAPK, SRC, VHL, HIF-1A and STAT3 signaling pathways. Two receptor gene polymorphisms [KDR (Q472H) and PROKR2 (V331M)] were significantly associated with idiopathic RPL. EG-VEGF and VEGFA systems shared several canonical signaling pathways that may contribute to gene-gene interactions, including the Akt, IL-8, EGFR, MAPK, SRC, VHL, HIF-1A and STAT3.

  5. Fine mapping of the Bsr1 barley stripe mosaic virus resistance gene in the model grass Brachypodium distachyon.

    Directory of Open Access Journals (Sweden)

    Yu Cui

    Full Text Available The ND18 strain of Barley stripe mosaic virus (BSMV infects several lines of Brachypodium distachyon, a recently developed model system for genomics research in cereals. Among the inbred lines tested, Bd3-1 is highly resistant at 20 to 25 °C, whereas Bd21 is susceptible and infection results in an intense mosaic phenotype accompanied by high levels of replicating virus. We generated an F(6:7 recombinant inbred line (RIL population from a cross between Bd3-1 and Bd21 and used the RILs, and an F(2 population of a second Bd21 × Bd3-1 cross to evaluate the inheritance of resistance. The results indicate that resistance segregates as expected for a single dominant gene, which we have designated Barley stripe mosaic virus resistance 1 (Bsr1. We constructed a genetic linkage map of the RIL population using SNP markers to map this gene to within 705 Kb of the distal end of the top of chromosome 3. Additional CAPS and Indel markers were used to fine map Bsr1 to a 23 Kb interval containing five putative genes. Our study demonstrates the power of using RILs to rapidly map the genetic determinants of BSMV resistance in Brachypodium. Moreover, the RILs and their associated genetic map, when combined with the complete genomic sequence of Brachypodium, provide new resources for genetic analyses of many other traits.

  6. Two whitebacked planthopper resistance genes in rice share the same loci with those for brown planthopper resistance.

    Science.gov (United States)

    Tan, G X; Weng, Q M; Ren, X; Huang, Z; Zhu, L L; He, G C

    2004-03-01

    The whitebacked planthopper (WBPH), Sogatella furcifera, and brown planthopper (BPH) Nilaparvata lugens Stål are important sucking insects of rice (Oryza sativa L.) crops throughout the world. Rice 'B5', which has derived its resistance genes from the wild rice O. officinalis Wall ex Watt, is a line that is highly resistant to both WBPH and BPH. Previously, two resistance genes against BPH, Qbp1, and Qbp2 in 'B5' had been mapped onto chromosome 3 and chromosome 4, respectively. In this study, we employed a mapping population composed of 187 recombinant inbred lines (RILs), produced from a cross between 'B5' and susceptible variety 'Minghui63', to locate the WBPH and BPH resistance genes. A RFLP survey of the bulked extremes from the RIL population identified two genomic regions, one on chromosome 3 and the other on chromosome 4, likely containing the resistance genes to planthoppers. QTL analysis of the RILs further confirmed that two WBPH resistance genes were mapped on the same loci as Qbp1 and Qbp2, using a linkage map with 242 molecular markers distributed on 12 rice chromosomes. Of the two WBPH resistance genes, one designated Wbph7(t) was located within a 1.1-cM region between R1925 and G1318 on chromosome 3, the other designated Wbph8(t) was within a 0.3-cM region flanked by R288 and S11182 on chromosome 4. A two-way analysis of variance showed that two loci acted independently with each other in determining WBPH resistance. The results have significant implications in studying the interactions between sucking insects and plants and in breeding programs of resistance to rice planthoppers.

  7. Childhood multidrug-resistant tuberculosis in the European Union and European Economic Area: an analysis of tuberculosis surveillance data from 2007 to 2015.

    Science.gov (United States)

    Ködmön, Csaba; van den Boom, Martin; Zucs, Phillip; van der Werf, Marieke Johanna

    2017-11-01

    BackgroundConfirming tuberculosis (TB) in children and obtaining information on drug susceptibility is essential to ensure adequate treatment. We assessed whether there are gaps in diagnosis and treatment of multidrug-resistant (MDR) TB in children in the European Union and European Economic Area (EU/EEA), quantified the burden of MDR TB in children and characterised cases. Methods : We analysed surveillance data from 2007 to 2015 for paediatric cases younger than 15 years. Results : In that period, 26 EU/EEA countries reported 18,826 paediatric TB cases of whom 4,129 (21.9%) were laboratory-confirmed. Drug susceptibility testing results were available for 3,378 (17.9%), representing 81.8% of the confirmed cases. The majority (n = 2,967; 87.8%) had drug-sensitive TB, 249 (7.4%) mono-resistant TB, 64 (1.9%) poly-resistant TB, 90 (2.7%) MDR TB and eight (0.2%) had extensively drug-resistant (XDR) TB. MDR TB was more frequently reported among paediatric cases with foreign background (adjusted odds ratio (aOR) = 1.73; 95% confidence interval (95% CI): 1.12-2.67) or previous TB treatment (aOR: 6.42; 95% CI: 3.24-12.75). Successful treatment outcome was reported for 58 of 74 paediatric MDR TB cases with outcome reported from 2007 to 2013; only the group of 5-9 years-olds was significantly associated with unsuccessful treatment outcome (crude odds ratio (cOR) = 11.45; 95% CI: 1.24-106.04). Conclusions : The burden of MDR TB in children in the EU/EEA appears low, but may be underestimated owing to challenges in laboratory confirmation. Diagnostic improvements are needed for early detection and adequate treatment of MDR TB. Children previously treated for TB or of foreign origin may warrant higher attention.

  8. Celastraceae sesquiterpenes as a new class of modulators that bind specifically to human P-glycoprotein and reverse cellular multidrug resistance.

    Science.gov (United States)

    Muñoz-Martínez, Francisco; Lu, Peihua; Cortés-Selva, Fernando; Pérez-Victoria, José María; Jiménez, Ignacio A; Ravelo, Angel G; Sharom, Frances J; Gamarro, Francisco; Castanys, Santiago

    2004-10-01

    Overexpression of ABCB1 (MDR1) P-glycoprotein, a multidrug efflux pump, is one mechanism by which tumor cells may develop multidrug resistance (MDR), preventing the successful chemotherapeutic treatment of cancer. Sesquiterpenes from Celastraceae family are natural compounds shown previously to reverse MDR in several human cancer cell lines and Leishmania strains. However, their molecular mechanism of reversion has not been characterized. In the present work, we have studied the ability of 28 dihydro-beta-agarofuran sesquiterpenes to reverse the P-glycoprotein-dependent MDR phenotype and elucidated their molecular mechanism of action. Cytotoxicity assays using human MDR1-transfected NIH-3T3 cells allowed us to select the most potent sesquiterpenes reversing the in vitro resistance to daunomycin and vinblastine. Flow cytometry experiments showed that the above active compounds specifically inhibited drug transport activity of P-glycoprotein in a saturable, concentration-dependent manner (K(i) down to 0.24 +/- 0.01 micromol/L) but not that of ABCC1 (multidrug resistance protein 1; MRP1), ABCC2 (MRP2), and ABCG2 (breast cancer resistance protein; BCRP) transporters. Moreover, sesquiterpenes inhibited at submicromolar concentrations the P-glycoprotein-mediated transport of [(3)H]colchicine and tetramethylrosamine in plasma membrane from CH(R)B30 cells and P-glycoprotein-enriched proteoliposomes, supporting that P-glycoprotein is their molecular target. Photoaffinity labeling in plasma membrane and fluorescence spectroscopy experiments with purified protein suggested that sesquiterpenes interact with transmembrane domains of P-glycoprotein. Finally, sesquiterpenes modulated P-glycoprotein ATPase-activity in a biphasic, concentration-dependent manner: they stimulated at very low concentrations but inhibited ATPase activity as noncompetitive inhibitors at higher concentrations. Sesquiterpenes from Celastraceae are promising P-glycoprotein modulators with potential

  9. Hepatocyte SLAMF3 reduced specifically the multidrugs resistance protein MRP-1 and increases HCC cells sensitization to anti-cancer drugs.

    Science.gov (United States)

    Fouquet, Grégory; Debuysscher, Véronique; Ouled-Haddou, Hakim; Eugenio, Mélanie Simoes; Demey, Baptiste; Singh, Amrathlal Rabbind; Ossart, Christèle; Al Bagami, Mohammed; Regimbeau, Jean-Marc; Nguyen-Khac, Eric; Naassila, Mickael; Marcq, Ingrid; Bouhlal, Hicham

    2016-05-31

    Multidrug resistance MDR proteins (MRPs) are members of the C family of a group of proteins named ATP binding cassette (ABC) transporters. MRPs can transport drugs including anticancer drugs, nucleoside analogs, antimetabolites and tyrosine kinase inhibitors. Drugs used in HCC therapy, such as tyrosine kinase inhibitor sorafenib, are substrates of uptake and/or efflux transporters. Variable expression of MRPs at the plasma membrane of tumor cells may contribute to drug resistance and subsequent clinical response. Recently, we reported that the hepatocyte SLAMF3 expression (Signaling Lymphocytic Activation Molecule Family member 3) was reduced in tumor cells from hepatocellular carcinoma (HCC) compared to its high expression in adjacent tissues. In the present study, we make a strong correlation between induced SLAMF3 overexpression and the specific loss of MRP-1 expression and its functionalities as a drugs resistance transporter. No changes were observed on expression of ABCG2 and MDR. More importantly, we highlight a strong inverse correlation between MRP-1 and SLAMF3 expression in patients with HCC. We propose that the SLAMF3 overexpression in cancerous cells could represent a potential therapeutic strategy to improve the drugs sensibility of resistant cells and thus control the therapeutic failure in HCC patients.

  10. Tagging of resistance gene(s) to rhizomania disease in sugar beet ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... plasmodiophoride-like fungus, Polymyxa betae Keskin. (1964) (Tamada and Richard, 1992). Source of resistance to rhizomania were found in Holly sugar beet company source (Lewellen, 1987). Resistance in Holly is simply inherited by a single dominant gene(Rz1). (Lewellen et al., 1987; Scholten et al., ...

  11. Drug-resistant tuberculosis: time for visionary political leadership.

    Science.gov (United States)

    Abubakar, Ibrahim; Zignol, Matteo; Falzon, Dennis; Raviglione, Mario; Ditiu, Lucica; Masham, Susan; Adetifa, Ifedayo; Ford, Nathan; Cox, Helen; Lawn, Stephen D; Marais, Ben J; McHugh, Timothy D; Mwaba, Peter; Bates, Matthew; Lipman, Marc; Zijenah, Lynn; Logan, Simon; McNerney, Ruth; Zumla, Adam; Sarda, Krishna; Nahid, Payam; Hoelscher, Michael; Pletschette, Michel; Memish, Ziad A; Kim, Peter; Hafner, Richard; Cole, Stewart; Migliori, Giovanni Battista; Maeurer, Markus; Schito, Marco; Zumla, Alimuddin

    2013-06-01

    Two decades ago, WHO declared tuberculosis a global emergency, and invested in the highly cost-effective directly observed treatment short-course programme to control the epidemic. At that time, most strains of Mycobacterium tuberculosis were susceptible to first-line tuberculosis drugs, and drug resistance was not a major issue. However, in 2013, tuberculosis remains a major public health concern worldwide, with prevalence of multidrug-resistant (MDR) tuberculosis rising. WHO estimates roughly 630 000 cases of MDR tuberculosis worldwide, with great variation in the frequency of MDR tuberculosis between countries. In the past 8 years, extensively drug-resistant (XDR) tuberculosis has emerged, and has been reported in 84 countries, heralding the possibility of virtually untreatable tuberculosis. Increased population movement, the continuing HIV pandemic, and the rise in MDR tuberculosis pose formidable challenges to the global control of tuberculosis. We provide an overview of the global burden of drug-resistant disease; discuss the social, health service, management, and control issues that fuel and sustain the epidemic; and suggest specific recommendations for important next steps. Visionary political leadership is needed to curb the rise of MDR and XDR tuberculosis worldwide, through sustained funding and the implementation of global and regional action plans. Copyright © 2013 World Health Organization. Published by Elsevier Ltd/Inc/BV. All rights reserved. Published by Elsevier Ltd. All rights reserved.

  12. Targeting protein kinases to reverse multidrug resistance in sarcoma.

    Science.gov (United States)

    Chen, Hua; Shen, Jacson; Choy, Edwin; Hornicek, Francis J; Duan, Zhenfeng

    2016-02-01

    Sarcomas are a group of cancers that arise from transformed cells of mesenchymal origin. They can be classified into over 50 subtypes, accounting for approximately 1% of adult and 15% of pediatric cancers. Wide surgical resection, radiotherapy, and chemotherapy are the most common treatments for the majority of sarcomas. Among these therapies, chemotherapy can palliate symptoms and prolong life for some sarcoma patients. However, sarcoma cells can have intrinsic or acquired resistance after treatment with chemotherapeutics drugs, leading to the development of multidrug resistance (MDR). MDR attenuates the efficacy of anticancer drugs and results in treatment failure for sarcomas. Therefore, overcoming MDR is an unmet need for sarcoma therapy. Certain protein kinases demonstrate aberrant expression and/or activity in sarcoma cells, which have been found to be involved in the regulation of sarcoma cell progression, such as cell cycle, apoptosis, and survival. Inhibiting these protein kinases may not only decrease the proliferation and growth of sarcoma cells, but also reverse their resistance to chemotherapeutic drugs to subsequently reduce the doses of anticancer drugs and decrease drug side-effects. The discovery of novel strategies targeting protein kinases opens a door to a new area of sarcoma research and provides insight into the mechanisms of MDR in chemotherapy. This review will focus on the recent studies in targeting protein kinase to reverse chemotherapeutic drug resistance in sarcoma. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Marker-assisted pyramiding of brown planthopper (Nilaparvata lugens Stål) resistance genes Bph1 and Bph2 on rice chromosome 12.

    Science.gov (United States)

    Sharma, Prem N; Torii, Akihide; Takumi, Shigeo; Mori, Naoki; Nakamura, Chiharu

    2004-01-01

    Brown planthopper (BPH) (Nilaparvata lugens Stål) is a significant insect pest of rice (Oryza sativa L.). We constructed a gene-pyramided japonica line, in which two BPH resistance genes Bph1 and Bph2 on the long arm of chromosome 12 independently derived from two indica resistance lines were combined through the recombinant selection. The gene-pyramiding was achieved based on the previously constructed high-resolution linkage maps of the two genes. Two co-dominant and four dominant PCR-based markers flanking the loci were used to select for a homozygous recombinant line in a segregating population that was derived from a cross between the parental homozygous single-gene introgression lines. BPH bioassay showed that the resistance level of the pyramided line was equivalent to that of the Bph1-single introgression line, which showed a higher level of resistance than the Bph2-single introgression line. The pyramid line should provide a useful experimental means for studying the fine structure of the chromosomal region covering these two major BPH resistance genes.

  14. Cancer multidrug resistance: mechanisms involved and strategies for circumvention using a drug delivery system.

    Science.gov (United States)

    Kibria, Golam; Hatakeyama, Hiroto; Harashima, Hideyoshi

    2014-01-01

    Multidrug resistance (MDR), the principal mechanism by which many cancers develop resistance to chemotherapy, is one of the major obstacles to the successful clinical treatment of various types of cancer. Several key regulators are responsible for mediating MDR, a process that renders chemotherapeutic drugs ineffective in the internal organelles of target cells. A nanoparticulate drug delivery system (DDS) is a potentially promising tool for circumventing such MDR, which can be achieved by targeting tumor cells themselves or tumor endothelial cells that support the survival of MDR cancer cells. The present article discusses key factors that are responsible for MDR in cancer cells, with a specific focus on the application of DDS to overcome MDR via the use of chemotherapy or macromolecules.

  15. Molecular Scree ning of Blast Resistance Genes in Rice Germplasms Resistant to Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Liang Yan

    2017-01-01

    Full Text Available Molecular screening of major rice blast resistance genes was determined with molecular markers, which showed close-set linkage to 11 major rice blast resistance genes (Pi-d2, Pi-z, Piz-t, Pi-9, Pi-36, Pi-37, Pi5, Pi-b, Pik-p, Pik-h and Pi-ta2, in a collection of 32 accessions resistant to Magnaporthe oryzae. Out of the 32 accessions, the Pi-d2 and Pi-z appeared to be omnipresent and gave positive express. As the second dominant, Pi-b and Piz-t gene frequencies were 96.9% and 87.5%. And Pik-h and Pik-p gene frequencies were 43.8% and 28.1%, respectively. The molecular marker linkage to Pi-ta2 produced positive bands in eleven accessions, while the molecular marker linkage to Pi-36 and Pi-37 in only three and four accessions, respectively. The natural field evaluation analysis showed that 30 of the 32 accessions were resistant, one was moderately resistant and one was susceptible. Infection types were negatively correlated with the genotype scores of Pi-9, Pi5, Pi-b, Pi-ta2 and Pik-p, although the correlation coefficients were very little. These results are useful in identification and incorporation of functional resistance genes from these germplasms into elite cultivars through marker-assisted selection for improved blast resistance in China and worldwide.

  16. Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India.

    Science.gov (United States)

    Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind

    2014-04-01

    A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

  17. Low-level quinolone-resistance in multi-drug resistant typhoid

    Energy Technology Data Exchange (ETDEWEB)

    Mirza, S H; Khan, M A [Armed Forces Inst. of Pathology, Rawalpindi (Pakistan). Dept. of Microbiolgy

    2008-01-15

    To find out the frequency of low-level quinolone-resistance in Multi-Drug Resistant (MDR) typhoid using nalidixic acid screening disc. Blood was obtained from suspected cases of typhoid fever and cultured in to BacT/ALERT. The positive blood cultures bottles were subcultured. The isolates were identified by colony morphology and biochemical tests using API-20E galleries. Susceptibility testing of isolates was done by modified Kirby-Bauer disc diffusion method on Muellar Hinton Agar. For the isolates, which were resistant to nalidixic acid by disc diffusion method, Minimal Inhibitory Concentrations (MICs) of ciprofloxacin and nalidixic acid were determined by using the E-test strips. Disc diffusion susceptibility tests and MICs were interpreted according to the guidelines provided by National Committee for Control Laboratory Standard (NCCLS). A total of 21(65.5%) out of 32 isolates of Salmonellae were nalidixic acid-resistant by disk diffusion method. All the nalidixic acid-resistant isolates by disc diffusion method were confirmed by MICs for both ciprofloxacin and nalidixic acid. All the nalidixic acid-resistant isolates had a ciprofloxacin MIC of 0.25-1 microg/ml (reduced susceptibility) and nalidixic acid MICs > 32 microg (resistant). Out of all Salmonella isolates, 24 (75%) were found to be MDR, and all were S. typbi. Low-level quinolone-resistance in typhoid was high in this small series. Screening for nalidixic acid resistance with a 30 microg nalidixic acid disk is a reliable and cost-effective method to detect low-level fluoroquinolone resistance, especially in the developing countries. (author)

  18. Low-level quinolone-resistance in multi-drug resistant typhoid

    International Nuclear Information System (INIS)

    Mirza, S.H.; Khan, M.A.

    2008-01-01

    To find out the frequency of low-level quinolone-resistance in Multi-Drug Resistant (MDR) typhoid using nalidixic acid screening disc. Blood was obtained from suspected cases of typhoid fever and cultured in to BacT/ALERT. The positive blood cultures bottles were subcultured. The isolates were identified by colony morphology and biochemical tests using API-20E galleries. Susceptibility testing of isolates was done by modified Kirby-Bauer disc diffusion method on Muellar Hinton Agar. For the isolates, which were resistant to nalidixic acid by disc diffusion method, Minimal Inhibitory Concentrations (MICs) of ciprofloxacin and nalidixic acid were determined by using the E-test strips. Disc diffusion susceptibility tests and MICs were interpreted according to the guidelines provided by National Committee for Control Laboratory Standard (NCCLS). A total of 21(65.5%) out of 32 isolates of Salmonellae were nalidixic acid-resistant by disk diffusion method. All the nalidixic acid-resistant isolates by disc diffusion method were confirmed by MICs for both ciprofloxacin and nalidixic acid. All the nalidixic acid-resistant isolates had a ciprofloxacin MIC of 0.25-1 microg/ml (reduced susceptibility) and nalidixic acid MICs > 32 microg (resistant). Out of all Salmonella isolates, 24 (75%) were found to be MDR, and all were S. typbi. Low-level quinolone-resistance in typhoid was high in this small series. Screening for nalidixic acid resistance with a 30 microg nalidixic acid disk is a reliable and cost-effective method to detect low-level fluoroquinolone resistance, especially in the developing countries. (author)

  19. Multidrug resistance among new tuberculosis cases: detecting local variation through lot quality-assurance sampling.

    Science.gov (United States)

    Hedt, Bethany Lynn; van Leth, Frank; Zignol, Matteo; Cobelens, Frank; van Gemert, Wayne; Nhung, Nguyen Viet; Lyepshina, Svitlana; Egwaga, Saidi; Cohen, Ted

    2012-03-01

    Current methodology for multidrug-resistant tuberculosis (MDR TB) surveys endorsed by the World Health Organization provides estimates of MDR TB prevalence among new cases at the national level. On the aggregate, local variation in the burden of MDR TB may be masked. This paper investigates the utility of applying lot quality-assurance sampling to identify geographic heterogeneity in the proportion of new cases with multidrug resistance. We simulated the performance of lot quality-assurance sampling by applying these classification-based approaches to data collected in the most recent TB drug-resistance surveys in Ukraine, Vietnam, and Tanzania. We explored 3 classification systems- two-way static, three-way static, and three-way truncated sequential sampling-at 2 sets of thresholds: low MDR TB = 2%, high MDR TB = 10%, and low MDR TB = 5%, high MDR TB = 20%. The lot quality-assurance sampling systems identified local variability in the prevalence of multidrug resistance in both high-resistance (Ukraine) and low-resistance settings (Vietnam). In Tanzania, prevalence was uniformly low, and the lot quality-assurance sampling approach did not reveal variability. The three-way classification systems provide additional information, but sample sizes may not be obtainable in some settings. New rapid drug-sensitivity testing methods may allow truncated sequential sampling designs and early stopping within static designs, producing even greater efficiency gains. Lot quality-assurance sampling study designs may offer an efficient approach for collecting critical information on local variability in the burden of multidrug-resistant TB. Before this methodology is adopted, programs must determine appropriate classification thresholds, the most useful classification system, and appropriate weighting if unbiased national estimates are also desired.

  20. Antibiotic-resistant genes and antibiotic-resistant bacteria in the effluent of urban residential areas, hospitals, and a municipal wastewater treatment plant system.

    Science.gov (United States)

    Li, Jianan; Cheng, Weixiao; Xu, Like; Strong, P J; Chen, Hong

    2015-03-01

    In this study, we determined the abundance of 8 antibiotics (3 tetracyclines, 4 sulfonamides, and 1 trimethoprim), 12 antibiotic-resistant genes (10 tet, 2 sul), 4 antibiotic-resistant bacteria (tetracycline, sulfamethoxazole, and combined resistance), and class 1 integron integrase gene (intI1) in the effluent of residential areas, hospitals, and municipal wastewater treatment plant (WWTP) systems. The concentrations of total/individual targets (antibiotics, genes, and bacteria) varied remarkably among different samples, but the hospital samples generally had a lower abundance than the residential area samples. The WWTP demonstrated removal efficiencies of 50.8% tetracyclines, 66.8% sulfonamides, 0.5 logs to 2.5 logs tet genes, and less than 1 log of sul and intI1 genes, as well as 0.5 log to 1 log removal for target bacteria. Except for the total tetracycline concentration and the proportion of tetracycline-resistant bacteria (R (2) = 0.330, P antibiotics and the corresponding resistant bacteria (P > 0.05). In contrast, various relationships were identified between antibiotics and antibiotic resistance genes (P antibiotic-resistant bacteria (P < 0.01).