[Conformation analysis of the N-glycosylation site Asn-X-Thr/Ser in glycoproteins].
Avanov, A Ia; Lipkind, G M
1990-03-01
Theoretical conformational analysis of oligopeptides CH3CO-Asn-X-Thr-NHCH3 (X = Gly, Ala, Pro), modelling N-glycosylation site, and their glycosylated derivatives CH3CO-(GlcNAc beta 1-4GlcNAc beta 1) Asn-X-Thr-NHCH3 has been carried out. Active conformations of the site are found, corresponding to structural prerequisities of N-glycosylation: Asn residue's position in beta-turn and hydrogen bond formation between side chains of Asn and Thr/Ser residues. In this case the L conformation of the central residue X is most probable. Since Pro residue does not possess this conformation, sequences with X = Pro are not glycosylated. It is shown that glycosylation of the above-mentioned sites is accompanied by reorientation of the Asn residue's side chains.
Changes in FGFR2 amino-acid residue Asn549 lead to Crouzon and Pfeiffer syndrome with hydrocephalus
Directory of Open Access Journals (Sweden)
Caroline Apra
2016-10-01
Full Text Available Mutations in Fibroblast Growth Factor Receptor II (FGFR2 have been identified in patients with Crouzon and Pfeiffer syndrome, among which rare mutations of the intracellular tyrosine kinase domain. Correlating subtle phenotypes with each rare mutation is still in progress. In Necker-Enfants Malades Hospital, we identified three patients harboring three different pathogenic variants of the same amino acid residue Asn-549 located in this domain: in addition to a very typical crouzonoid appearance, they all developed clinically relevant hydrocephalus, which is an inconstant feature of Crouzon and Pfeiffer syndrome. Overall, FGFR2 tyrosine kinase domain mutations account for 5/67 (7.4% cases in our hospital. We describe a novel mutation, p.Asn549Ser, and new cases of p.Asn549His and p.Asn549Thr mutations, each reported once before. Our three cases of Asn-549 mutations, alongside with rare previously reported cases, show that these patients are at higher risk of hydrocephalus. Clinical and imaging follow-up, with possible early surgery, may help prevent secondary intellectual disability.
Kim, Tae-Kang; Colman, Roberta F.
2005-01-01
The mammalian mitochondrial NADP-dependent isocitrate dehydrogenase is a citric acid cycle enzyme and an important contributor to cellular defense against oxidative stress. The Mn2+-isocitrate complex of the porcine enzyme was recently crystallized; its structure indicates that Ser95, Asn97, and Thr78 are within hydrogen-bonding distance of the γ-carboxylate of enzyme-bound isocitrate. We used site-directed mutagenesis to replace each of these residues by Ala and Asp. The wild-type and mutant...
B S, Gnanesh Kumar; Surolia, Avadhesha
2017-05-01
Carboxypeptidase Y from Saccharomyces cerivisiae was characterized for its site specific N-glycosylation through mass spectrometry. The N-glycopeptides were derived using non specific proteases and are analysed directly on liquid chromatography coupled to ion trap mass spectrometer in tandem mode. The evaluation of glycan fragment ions and the Y 1 ions (peptide+HexNAc) +n revealed the glycan sequence and the corresponding site of attachment. We observed the microheterogeneity in N-glycans such as Man 11-15 GlcNAc 2 at Asn 13 , Man 8-12 GlcNAc 2 at Asn 87 , Man 9-14 GlcNAc 2 at Asn 168 and phosphorylated Man 12-17 GlcNAc 2 as well as Man 11-16 GlcNAc 2 at Asn 368 . The presence of N-glycans with Man <18 GlcNAc 2 indicated that in vacuoles the steady release of mannose/phospho mannose residues from glycans occurs initially at Asn 13 or Asn 168 followed by at Asn 368 . However, glycans at Asn 87 which comprises Man 8-12 residues as reported earlier remain intact suggesting its inaccessibility for a similar processing. This in turn indicates the interaction of the glycan at Asn 87 with the polypeptide chain implicating it in the folding of the protein. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Betül Ozan
2017-08-01
Full Text Available Migraine is a common neurovascular brain disorder with heterogeneous clinical presentation, including recurrent headache attacks. The pathophysiology of migraine is complex, and a number of genomic regions have been associated with the development of migraine. In this study, we analyzed the allele and genotype frequencies of the urotensin-II gene (UTS2 polymorphisms, Thr21Met and Ser89Asn, among Turkish patients with migraine. A total of 146 patients with migraine (14 with aura [MA group] and 132 without aura [MO group] were genotyped for Thr21Met and Ser89Asn polymorphisms and compared with 154 age- and sex-matched healthy controls. The UTS2 gene polymorphisms were analyzed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP. No significant differences were observed in allele and genotype frequencies for Thr21Met and Ser89Asn polymorphisms between the patients with migraine and control group. Similarly, we did not observe significant differences in allele and genotype frequencies between MA and MO and control group. Moreover, the haplotype analysis showed no association between UTS2 gene haplotypes (MN, MS, TN, and TS and migraine. In summary, Thr21Met and Ser89Asn polymorphisms of the UTS2 gene are not risk factors for migraine in our sample of Turkish migraine patients.
25 CFR 168.14 - Livestock trespass.
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Livestock trespass. 168.14 Section 168.14 Indians BUREAU... PARTITIONED LANDS AREA § 168.14 Livestock trespass. The owner of any livestock grazing in trespass on the Hopi... Hopi Partitioned Lands of any livestock without an approved grazing or crossing permit; (b) Allowing...
Reymer, P.W.A.; Gagné, S E; Groenemeyer, B E; Zhang, H; Forsyth, I; Jansen, H; Seidell, J C; Kromhout, D.; Lie, K E; Kastelein, J.J.
1995-01-01
A reduction of high density lipoprotein cholesterol (HDC) is recognized as an important risk factor for coronary artery disease (CAD). We now show in approximately 1 in 20 males with proven atherosclerosis that an Asn291Ser mutation in the human lipoprotein lipase (LPL) gene is associated with
Feng, Yue; Liu, Song; Jiao, Yun; Gao, Hui; Wang, Miao; Du, Guocheng; Chen, Jian
2017-02-01
L-asparaginase (EC 3.5.1.1, ASN) exhibits great commercial value due to its uses in the food and medicine industry. In this study, we reported the enhanced expression of type II ASN from Bacillus subtilis 168 in B. subtilis WB600 through a combined strategy. First, eight signal peptides (the signal peptide of the ASN, ywbN, yvgO, amyE, oppA, vpr, lipA, and wapA) were used for ASN secretion in B. subtilis by using Hpa II promoter, respectively. The signal peptide wapA achieved the highest extracellular ASN activity (28.91 U/mL). Second, Hpa II promoter was replaced by a strong promoter, P43 promoter, resulting in 38.1 % enhanced ASN activity. By two rounds of error-prone PCR mutation, the P43 promoter variants with remarkably enhanced strength (D7, E2, H6, B2, and F3) were identified. B2 (-28: A → G, -13: A → G) achieved ASN activity up to 51.13 U/mL. Third, after deletion of the N-terminal 25-residues, ASN activity reached 102.41 U/mL, which was 100 % higher than that of the intact ASN. At last, the extracellular ASN of the B. subtilis arrived at 407.6 U/mL (2.5 g/L of ASN protein) in a 3-L bioreactor by using a fed-batch strategy. The purified ASN showed maximal activity at 65 °C and its half-life at 65 °C was 61 min. The K m and k cat of the ASN were 5.29 mM and 54.4 s -1 , respectively. To the best of our knowledge, we obtained the highest yield of ASN in a food-grade host ever reported, which may benefit the industrial production and application of ASN.
Directory of Open Access Journals (Sweden)
Song YM
2014-12-01
Full Text Available Yanmin Song, Qunfang Li, Lili Long, Ning Zhang, Yunhai Liu Department of Neurology, Xiangya Hospital, Central South University, Changsha, Hunan Province, People’s Republic of China Background: CD31, also called platelet endothelial cell adhesion molecule-1 (PECAM-1, is thought to play a role in the pathological mechanisms of atherosclerosis. Leu125Val polymorphism and elevated plasma levels of soluble PECAM-1 (sPECAM-1 were found to be associated with cerebral infarction. Our aim was to investigate the association between the Asn563Ser polymorphism of CD31/PECAM-1, plasma level of sPECAM-1, and the risk of atherosclerotic cerebral infarction (ACI in the southern Han population of the People’s Republic of China.Subjects and methods: A total of 147 subjects with ACI and 114 controls were enrolled in the study. The Asn563Ser CD31/PECAM-1 polymorphism was detected using the polymerase chain reaction–restriction fragment length polymorphism method. The plasma spECAM-1 level was measured using the enzyme-linked immunosorbent assay method.Results: In this study, statistically significant differences in Asn563Ser genotype and allele distribution were found between the cases and controls (P<0.05. Furthermore, logistic regression analysis showed that the GG genotype is associated with increase in ACI risk (odds ratio =4.862, P<0.001. The plasma level of sPECAM-1 was associated with ACI (odds ratio =1.431, P=0.038. In both the ACI and the control groups, the plasma sPECAM-1 level in subjects with the GG genotype was higher than that in subjects carrying the AA or GA genotype (P<0.05.Conclusion: Our study showed that the Asn563Ser polymorphism of CD31/PECAM-1 gene and elevated plasma sPECAM-1 level are related to ACI risk in the southern Han population of People’s Republic of China. Keywords: genetic polymorphism, CD31, platelet endothelial cell adhesion molecule-1 (PECAM-1
25 CFR 168.7 - Kind of livestock.
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Kind of livestock. 168.7 Section 168.7 Indians BUREAU OF... LANDS AREA § 168.7 Kind of livestock. Unless determined otherwise by the Area Director for conservation purposes, the Hopi Tribe may determine, subject to the authorized carrying capacity, the kind of livestock...
Directory of Open Access Journals (Sweden)
Zafer Gashi
2016-08-01
Full Text Available In women undergoing natural cycles, just one oocyte is usually selected for ovulation, yet routine clinical techniques to support the development of multiple follicles using additional gonadotrophins result in numerous ovulations. Several parameters have been postulated as predictors of ovarian response (inhibin B, 17-β-estradiol and antiMüllerian hormone. Nevertheless, the FSH level on the day 3 of menstrual cycle remains, the most widely used biomarker due to its low cost, although, the genetic background of individuals seems to determine the response of patients to rFSH stimulation better than the stimulation design. Consequently, the variants of FSHR were explored and they may be involved in the role of FSH receptor in mediated signal transduction and with ovarian response in infertile women submitted to ovarian stimulation. In this study we examined, for the first time, the prevalence of genotype variants Asn680Ser in population Albanian women from Kosovo Dukagjin region who took part in IVF / ICSI program. The frequencies of the Asn680Ser genotype variants were as follows: Asn/Asn 22.1%, Asn/Ser 47.1%, and Ser/Ser 30.8%, respectively (Table 1. bE2 levels between the three genotype variants showed slight but statistically significant difference (p= 0.0308. No difference was also found between the genotype groups either in terms of AFC, amount of the FSH required for ovulation induction, stimulation length days, number of dominant follicles, oocyte retrieval number or endometrial thickness (Table 2. BMI was significantly higher in the Ser/Ser group as compared to those from the Asn/Ser or the Asn/Asn group (p= 0.0010 (Table 2. In the study population of Albanian women Dukagjin region of Kosovo had a higher incidence of Ser / SER genotype compared to Asn / Asn genotype. Our research results in the Albanian population differ from published data for other ethnic groups in the Balkans.
Volpon, Laurent; Tsan, Pascale; Majer, Zsuzsa; Vass, Elemer; Hollósi, Miklós; Noguéra, Valérie; Lancelin, Jean-Marc; Besson, Françoise
2007-08-01
Iturins are a group of antifungal produced by Bacillus subtilis. All are cyclic lipopeptides with seven α-amino acids of configuration LDDLLDL and one β-amino fatty acid. The bacillomycin L is a member of this family and its NMR structure was previously resolved using the sequence Asp-Tyr-Asn-Ser-Gln-Ser-Thr. In this work, we carefully examined the NMR spectra of this compound and detected an error in the sequence. In fact, Asp1 and Gln5 need to be changed into Asn1 and Glu5, which therefore makes it identical to bacillomycin Lc. As a consequence, it now appears that all iturinic peptides with antibiotic activity share the common β-amino fatty acid 8- L-Asn1- D-Tyr2- D-Asn3 sequence. To better understand the conformational influence of the acidic residue L-Asp1, present, for example in the inactive iturin C, the NMR structure of the synthetic analogue SCP [cyclo ( L-Asp1- D-Tyr2- D-Asn3- L-Ser4- L-Gln5- D-Ser6- L-Thr7-β-Ala8)] was determined and compared with bacillomycin Lc recalculated with the corrected sequence. In both cases, the conformers obtained were separated into two families of similar energy which essentially differ in the number and type of turns. A detailed analysis of both cyclopeptide structures is presented here. In addition, CD and FTIR spectra were performed and confirmed the conformational differences observed by NMR between both cyclopeptides.
Takayama, Mitsuo
2012-01-01
The backbone flexibility of a protein has been studied from the standpoint of the susceptibility of amino acid residues to in-source decay (ISD) in matrix-assisted laser desorption/ionization mass spectrometry (MALDI MS). Residues more susceptible to MALDI-ISD, namely Xxx-Asp/Asn and Gly-Xxx, were identified from the discontinuous intense peak of c'-ions originating from specific cleavage at N-Cα bonds of the backbone of equine cytochrome c. The identity of the residues susceptible to ISD was consistent with the known flexible backbone amides as estimated by hydrogen/deuterium exchange (HDX) experiments. The identity of these flexible amino acid residues (Asp, Asn, and Gly) is consistent with the fact that these residues are preferred in flexible secondary structure free from intramolecular hydrogen-bonded structures such as α-helix and β-sheet. The MALDI-ISD spectrum of equine cytochrome c gave not only intense N-terminal side c'-ions originating from N-Cα bond cleavage at Xxx-Asp/Asn and Gly-Xxx residues, but also C-terminal side complement z'-ions originating from the same cleavage sites. The present study implies that MALDI-ISD can give information about backbone flexibility of proteins, comparable with the protection factors estimated by HDX.
Takayama, Mitsuo
2012-01-01
The backbone flexibility of a protein has been studied from the standpoint of the susceptibility of amino acid residues to in-source decay (ISD) in matrix-assisted laser desorption/ionization mass spectrometry (MALDI MS). Residues more susceptible to MALDI-ISD, namely Xxx–Asp/Asn and Gly–Xxx, were identified from the discontinuous intense peak of c′-ions originating from specific cleavage at N–Cα bonds of the backbone of equine cytochrome c. The identity of the residues susceptible to ISD was consistent with the known flexible backbone amides as estimated by hydrogen/deuterium exchange (HDX) experiments. The identity of these flexible amino acid residues (Asp, Asn, and Gly) is consistent with the fact that these residues are preferred in flexible secondary structure free from intramolecular hydrogen-bonded structures such as α-helix and β-sheet. The MALDI-ISD spectrum of equine cytochrome c gave not only intense N-terminal side c′-ions originating from N–Cα bond cleavage at Xxx–Asp/Asn and Gly–Xxx residues, but also C-terminal side complement z′-ions originating from the same cleavage sites. The present study implies that MALDI-ISD can give information about backbone flexibility of proteins, comparable with the protection factors estimated by HDX. PMID:24349908
Drawz, Sarah M; Bethel, Christopher R; Hujer, Kristine M; Hurless, Kelly N; Distler, Anne M; Caselli, Emilia; Prati, Fabio; Bonomo, Robert A
2009-06-02
Inhibitor-resistant class A beta-lactamases of the TEM and SHV families that arise by single amino acid substitutions are a significant threat to the efficacy of beta-lactam/beta-lactamase inhibitor combinations. To better understand the basis of the inhibitor-resistant phenotype in SHV, we performed mutagenesis to examine the role of a second-shell residue, Asn276. Of the 19 variants expressed in Escherichia coli, only the Asn276Asp enzyme demonstrated reduced susceptibility to ampicillin/clavulanate (MIC increased from 50/2 --> 50/8 microg/mL) while maintaining high-level resistance to ampicillin (MIC = 8192 microg/mL). Steady-state kinetic analyses of Asn276Asp revealed slightly diminished k(cat)/K(m) for all substrates tested. In contrast, we observed a 5-fold increase in K(i) for clavulanate (7.4 +/- 0.9 microM for Asn276Asp vs 1.4 +/- 0.2 microM for SHV-1) and a 40% reduction in k(inact)/K(I) (0.013 +/- 0.002 microM(-1 )s(-1) for Asn276Asp vs 0.021 +/- 0.004 microM(-1) s(-1) for SHV-1). Timed electrospray ionization mass spectrometry of clavulanate-inhibited SHV-1 and SHV Asn276Asp showed nearly identical mass adducts, arguing for a similar pathway of inactivation. Molecular modeling shows that novel electrostatic interactions are formed between Arg244Neta2 and both 276AspOdelta1 and Odelta2; these new forces restrict the spatial position of Arg244, a residue important in the recognition of the C(3)/C(4) carboxylate of beta-lactam substrates and inhibitors. Testing the functional consequences of this interaction, we noted considerable free energy costs (+DeltaDeltaG) for substrates and inhibitors. A rigid carbapenem (meropenem) was most affected by the Asn276Asp substitution (46-fold increase in K(i) vs SHV-1). We conclude that residue 276 is an important second-shell residue in class A beta-lactamase-mediated resistance to substrates and inhibitors, and only Asn is able to precisely modulate the conformational flexibility of Arg244 required for successful
Asn12 and Asn278: Critical Residues for In Vitro Biological Activity of Reteplase
Directory of Open Access Journals (Sweden)
Naganath Mandi
2010-01-01
Full Text Available Reteplase (rPA is a thrombolytic agent used for the treatment of acute myocardial infarction. We studied the expression of rPA and its selected asparagine mutants after integration into the Pichia genome. Though methanol induction of the native and the rPA mutants showed similar expression levels (~200–250 mg/L, the mutants displayed significant loss of protease activity. Strikingly, the clot lysis activities of these mutants were considerably different. While mutation of Asn12 (N12P of the Kringle 2 domain showed delayed clot lysis activity (1/2=38 min compared to the native rPA (1/2=33 min, a faster rate of clot lysis (1/2=27 min was observed when the Asn278 (N278S of the serine protease domain was mutated. Interestingly, the slowest clot lysis activity (1/2=49 min demonstrated by the double mutant (N12P, N278S suggests the dominant role of Asn12 in regulating the fibrinolytic activity of rPA. The results presented in this paper indicate that the fibrinolytic and the proteolytic activities of rPA are independent of each other.
25 CFR 168.16 - Impoundment and disposal of unauthorized livestock.
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Impoundment and disposal of unauthorized livestock. 168... REGULATIONS FOR THE HOPI PARTITIONED LANDS AREA § 168.16 Impoundment and disposal of unauthorized livestock. Unauthorized livestock within any range unit of the Hopi Partitioned Lands which are not removed therefrom...
25 CFR 168.15 - Control of livestock diseases and parasites.
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Control of livestock diseases and parasites. 168.15... REGULATIONS FOR THE HOPI PARTITIONED LANDS AREA § 168.15 Control of livestock diseases and parasites. Whenever... parasites or have been exposed thereto, such livestock must be treated and the movement thereof restricted...
Beinfeld, M. C.; Bourdais, J.; Kuks, P.; Morel, A.; Cohen, P.
1989-01-01
We have extracted, characterized, and partially purified an enzyme from secretory granules from rat small intestinal mucosa which cleaves a synthetic prosomatostatin substrate on the carboxyl side of a single arginine residue. This substrate Leu-Gln-Arg-Ser-Ala-Asn-Ser-NH2 contains the monobasic
Agarwal, Sonya; Döring, Kristina; Gierusz, Leszek A.; Iyer, Pooja; Lane, Fiona M.; Graham, James F.; Goldmann, Wilfred; Pinheiro, Teresa J. T.; Gill, Andrew C.
2015-10-01
The β2-α2 loop of PrPC is a key modulator of disease-associated prion protein misfolding. Amino acids that differentiate mouse (Ser169, Asn173) and deer (Asn169, Thr173) PrPC appear to confer dramatically different structural properties in this region and it has been suggested that amino acid sequences associated with structural rigidity of the loop also confer susceptibility to prion disease. Using mouse recombinant PrP, we show that mutating residue 173 from Asn to Thr alters protein stability and misfolding only subtly, whilst changing Ser to Asn at codon 169 causes instability in the protein, promotes oligomer formation and dramatically potentiates fibril formation. The doubly mutated protein exhibits more complex folding and misfolding behaviour than either single mutant, suggestive of differential effects of the β2-α2 loop sequence on both protein stability and on specific misfolding pathways. Molecular dynamics simulation of protein structure suggests a key role for the solvent accessibility of Tyr168 in promoting molecular interactions that may lead to prion protein misfolding. Thus, we conclude that ‘rigidity’ in the β2-α2 loop region of the normal conformer of PrP has less effect on misfolding than other sequence-related effects in this region.
Snijder, H.J.; van Eerde, J.H.; Kalk, K.H.; Dekker, N.; Egmond, M.R.; Dijkstra, B.W.
2010-01-01
Outer membrane phospholipase A (OMPLA) from Escherichia coli is an integral-membrane enzyme with a unique His-Ser-Asn catalytic triad. In serine proteases and serine esterases usually an Asp occurs in the catalytic triad; its role has been the subject of much debate. Here the role of the uncharged
ASN annual report 2004; ASN Rapport annuel 2004
Energy Technology Data Exchange (ETDEWEB)
NONE
2005-07-01
The Nuclear Safety Authority (ASN) groups the Directorate General for Nuclear Safety and Radiation Protection (DGSNR), reporting to the Ministries for Health, Environment and Industry, and the devolved services of the State on which it relies for nuclear safety and radiation protection supervision, primarily DRIRE, DRASS and DDASS. The main topic of 2004, discussed in this report are: nuclear Safety and Transparency bill, shaping the new ASN, setting up inspection of non-BNI nuclear activities, Radiation protection and monitoring of patients, the safety of the EPR reactor project, the national plan for radioactive waste management, the future of high-level long-lived waste, harmonizing nuclear safety in Europe and ASN international involvement. (A.L.B.)
Hutchinson, Steve; Erbacher, Robert F.
2015-05-01
Network security monitoring is currently challenged by its reliance on human analysts and the inability for tools to generate indications and warnings for previously unknown attacks. We propose a reputation system based on IP address set membership within the Autonomous System Number (ASN) system. Essentially, a metric generated based on the historic behavior, or misbehavior, of nodes within a given ASN can be used to predict future behavior and provide a mechanism to locate network activity requiring inspection. This will provide reinforcement of notifications and warnings and lead to inspection for ASNs known to be problematic even if initial inspection leads to interpretation of the event as innocuous. We developed proof of concept capabilities to generate the IP address to ASN set membership and analyze the impact of the results. These results clearly show that while some ASNs are one-offs with individual or small numbers of misbehaving IP addresses, there are definitive ASNs with a history of long term and wide spread misbehaving IP addresses. These ASNs with long histories are what we are especially interested in and will provide an additional correlation metric for the human analyst and lead to new tools to aid remediation of these IP address blocks.
Boulling, Arnaud; Masson, Emmanuelle; Zou, Wen-Bin; Paliwal, Sumit; Wu, Hao; Issarapu, Prachand; Bhaskar, Seema; Génin, Emmanuelle; Cooper, David N; Li, Zhao-Shen; Chandak, Giriraj R; Liao, Zhuan; Chen, Jian-Min; Férec, Claude
2017-08-01
The haplotype harboring the SPINK1 c.101A>G (p.Asn34Ser) variant (also known as rs17107315:T>C) represents the most important heritable risk factor for idiopathic chronic pancreatitis identified to date. The causal variant contained within this risk haplotype has however remained stubbornly elusive. Herein, we set out to resolve this enigma by employing a hypothesis-driven approach. First, we searched for variants in strong linkage disequilibrium (LD) with rs17107315:T>C using HaploReg v4.1. Second, we identified two candidate SNPs by visual inspection of sequences spanning all 25 SNPs found to be in LD with rs17107315:T>C, guided by prior knowledge of pancreas-specific transcription factors and their cognate binding sites. Third, employing a novel cis-regulatory module (CRM)-guided approach to further filter the two candidate SNPs yielded a solitary candidate causal variant. Finally, combining data from phylogenetic conservation and chromatin accessibility, cotransfection transactivation experiments, and population genetic studies, we suggest that rs142703147:C>A, which disrupts a PTF1L-binding site within an evolutionarily conserved HNF1A-PTF1L CRM located ∼4 kb upstream of the SPINK1 promoter, contributes to the aforementioned chronic pancreatitis risk haplotype. Further studies are required not only to improve the characterization of this functional SNP but also to identify other functional components that might contribute to this high-risk haplotype. © 2017 Wiley Periodicals, Inc.
Gashi, Zafer; Elezaj, Shkelzen; Zeqiraj, Afrim; Grabanica, Driton; Shabani, Isak; Gruda, Bujar; Gashi, Fitore
2016-01-01
Introduction: This study investigated association of Asn680Ser FSHR polymorphism with the ovarian response in 104 women of Albanian ethnic population enrolled in ICSI program. The reason of infertility in all cases has been identified as male factor. Methods: Analysis of the Asn680Ser polymorphism was performed using TaqMan® SNP Genotyping Assay. Clinical and endocrinologic parameters were analyzed based on the genotype, age, BMI, oocyte yield, number of transferred embryos and pregnancy rate. Results: The frequencies of the Asn680 Ser genotype variants were as follows: Asn/Asn 22.1%, Asn/Ser 47.1%, and Ser/Ser 30.8%, respectively. BMI was significantly higher in the Ser/Ser group as compared to those from the Asn/Ser or the Asn/Asn group (p= 0.0010). The genotype variants Ser/Ser indicates a higher rate of oocyte retrieval (25.9%) in the immature form, metaphase I (MI) as opposed to the other two groups (Asn/Asn 23.7 % vs. Asn/Ser 21.9%), which was statistically significant (p = 0.3020). Conclusions: FSH receptor polymorphism is associated with different ovarian response to controlled ovarian stimulation (COS), but is not an important factor in increasing the degree of pregnancy. Polymorphisms of the FSH receptor is associated with normal morphology and genetic maturation (metaphase II) oocytes in dependence of genotypic variation polymorphisms. PMID:27994298
2010-04-01
... 25 Indians 2 2010-04-01 2010-04-01 false Is it mandatory to go through the information phase before initiating the negotiation phase? 1000.168 Section 1000.168 Indians OFFICE OF THE ASSISTANT SECRETARY, INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ANNUAL FUNDING AGREEMENTS UNDER THE TRIBAL SELF-GOVERNMENT ACT AMENDMENTS TO THE INDIAN...
van Weely, S.; van den Berg, M.; Barranger, J. A.; Sa Miranda, M. C.; Tager, J. M.; Aerts, J. M.
1993-01-01
The properties of control and 370Asn-->Ser glucocerebrosidase, the frequently encountered mutated form of the enzyme in type 1 Gaucher disease, were studied in vitro as well as in situ. The catalytic properties of purified 370Asn-->Ser glucocerebrosidase were highly dependent on the assay
Nakamura, Kenta; Katayama, Tsutomu
2010-04-01
Escherichia coli ATP-DnaA initiates chromosomal replication. For preventing extra-initiations, a complex of ADP-Hda and the DNA-loaded replicase clamp promotes DnaA-ATP hydrolysis, yielding inactive ADP-DnaA. However, the Hda-DnaA interaction mode remains unclear except that the Hda Box VII Arg finger (Arg-153) and DnaA sensor II Arg-334 within each AAA(+) domain are crucial for the DnaA-ATP hydrolysis. Here, we demonstrate that direct and functional interaction of ADP-Hda with DnaA requires the Hda residues Ser-152, Phe-118 and Asn-122 as well as Hda Arg-153 and DnaA Arg-334. Structural analyses suggest intermolecular interactions between Hda Ser-152 and DnaA Arg-334 and between Hda Phe-118 and the DnaA Walker B motif region, in addition to an intramolecular interaction between Hda Asn-122 and Arg-153. These interactions likely sustain a specific association of ADP-Hda and DnaA, promoting DnaA-ATP hydrolysis. Consistently, ATP-DnaA and ADP-DnaA interact with the ADP-Hda-DNA-clamp complex with similar affinities. Hda Phe-118 and Asn-122 are contained in the Box VI region, and their hydrophobic and electrostatic features are basically conserved in the corresponding residues of other AAA(+) proteins, suggesting a conserved role for Box VI. These findings indicate novel interaction mechanisms for Hda-DnaA as well as a potentially fundamental mechanism in AAA(+) protein interactions.
Lin, Songyi; Xue, Peiyu; Yang, Shuailing; Li, Xingfang; Dong, Xiuping; Chen, Feng
2017-08-01
This study has elucidated moisture dynamics in the soybean peptide, Ser-His-Glu-Cys-Asn (SHECN) powder by using dynamic vapor sorption (DVS) and nuclear magnetic resonance (NMR). We also tried to investigate the effects of moisture absorption on the biological activity and chemical properties of SHECN with some effective methods such as mid-infrared (MIR) spectroscopy and gas chromatography-mass spectrometry (GC-MS). DVS results showed that the moisture absorption of SHECN could reach a maximum of 33%, and the SHECN powder after synthesis actually existed in a trihydrate state of SHECN.3H 2 O. Low-field NMR revealed that three water proportions including strong combined water, binding water and bulk water were involved in SHECN moisture absorption and absored water dominantly existed in the form of combined water. Magnetic resonance imaging (MRI) and MIR spectroscopy results indicated that moisture absorption could change the morphology and structure of SHECN. After moisture absorption at 50% and 75% relative humidity, 19 volatiles were identified by GC-MS analysis. Additionally, this study showed that a part of reductive groups in SHECN was oxidized and its antioxidant ability declined significantly (P moisture absorption. Water absorbed into SHECN powder can significantly change its microstructure and cause its activity to decrease. We must prevent SHECN from absorbing moisture during storage because the water can accelerate the oxidation of samples and promote microbial reactions. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Directory of Open Access Journals (Sweden)
León, Blanca Liliana Torres
2008-01-01
Full Text Available Objetivo: Avaliar o monômero residual liberado de materiais resilientes para reembasamento polimerizados por diferentes métodos. Metodologia: Dois materiais foram testados: Ever-Soft polymerizado por banho quente de água ou por energia de microondas, e Light Liner polimerizado quimicamente e por luz visível (polimerização dual. O monômero residual liberado foi mensurado em 12 espécimes (40x10x0,3mm fabricados com cada material e método de polimerização. Os espécimes foram armazenados em água destilada por 168 horas a 37ºC, e analisados diariamente por espectrometria ultravioleta (Light Liner: 204nm, Ever-Soft: 206nm. Os dados foram analisados por ANOVA de fator único e teste de Bonferroni (a=0,05. O monômero residual liberado em relação ao tempo foi determinado por análise de regressão polinomial. Resultados: O monômero residual liberado em 168 horas do teste (µg/cm2 em espécimes polimerizados por banho de água quente (0,27±0,01µg/cm2 foi significativamente maior (P < 0,05 que em espécimes processados por energia de microondas (0,25±0,02µg/cm2. Ever-Soft mostrou uma redução na liberação de monomer residual com o tempo, tendendo a se estabilizar em 96 horas. Light Liner continuou a liberar monômero com o tempo. Conclusão: Ever-Soft pode ser polimerizado por energia de microondas. Os valores de monômero residual liberado foram baixos, e os níveis de monômero diminuíram com o tempo
LENUS (Irish Health Repository)
Preston, Roger J S
2012-02-01
We report a kindred with heritable protein C (PC) deficiency in which two siblings with severe thrombosis showed a composite type I and IIb PC deficiency phenotype, identified using commercial PC assays (proband: PC antigen 42 u\\/dl, amidolytic activity 40 u\\/dl, anticoagulant activity 9 u\\/dl). The independent PROC nucleotide variations c.669C>A (predictive of Ser181Arg) and c.131C>T (predictive of Asn2Ile) segregated with the type I and type IIb PC deficiency phenotypes respectively, but co-segregated in the siblings with severe thrombosis. Soluble thrombomodulin (sTM)-mediated inhibition of plasma thrombin generation from an individual with PC-Asn2Ile was lower (endogenous thrombin potential (ETP) 56 +\\/- 1% that of ETP determined without sTM) than control plasma (ETP 15 +\\/- 2%) indicating reduced PC anticoagulant activity. Recombinant APC-Asn2Ile exhibited normal amidolytic activity but impaired anticoagulant activity. Protein S (PS)-dependent anticoagulant activity of recombinant APC-Asn2Ile and binding of recombinant APC-Asn2Ile to endothelial protein C receptor (EPCR) were reduced compared to recombinant wild-type APC. Asn2 lies within the omega-loop of the PC\\/APC Gla domain and this region is critical for calcium-induced folding and subsequent interactions with anionic phospholipids, EPCR and PS. The disruption of these interactions in this naturally-occurring PC variant highlights their collective importance in mediating APC anticoagulant activity in vivo.
International Nuclear Information System (INIS)
2005-01-01
The Nuclear Safety Authority (ASN) groups the Directorate General for Nuclear Safety and Radiation Protection (DGSNR), reporting to the Ministries for Health, Environment and Industry, and the devolved services of the State on which it relies for nuclear safety and radiation protection supervision, primarily DRIRE, DRASS and DDASS. The main topic of 2004, discussed in this report are: nuclear Safety and Transparency bill, shaping the new ASN, setting up inspection of non-BNI nuclear activities, Radiation protection and monitoring of patients, the safety of the EPR reactor project, the national plan for radioactive waste management, the future of high-level long-lived waste, harmonizing nuclear safety in Europe and ASN international involvement. (A.L.B.)
Directory of Open Access Journals (Sweden)
Flørenes Vivi
2010-05-01
Full Text Available Abstract Background CDC25 phosphatases are important regulators of the cell cycle. Their abnormal expression detected in a number of tumors implies that their dysregulation is involved in malignant transformation. However, the role of CDC25s in vulvar cancer is still unknown. To shed light on their roles in the pathogenesis and to clarify their prognostic values, expression of CDC25A, CDC25B and CDC25C in a large series of vulvar squamous cell carcinomas were examined. Methods Expression of CDC25A, CDC25B, CDC25C and phosphorylated (phospho-CDC25C (Ser216 were examined in 300 vulvar carcinomas using immunohistochemistry. Western blot analysis was utilized to demonstrate CDC25s expression in vulvar cancer cell lines. Kinase and phosphatase assays were performed to exclude cross reactivity among CDC25s isoform antibodies. Results High nuclear CDC25A and CDC25B expression were observed in 51% and 16% of the vulvar carcinomas, respectively, whereas high cytoplasmic CDC25C expression was seen in 63% of the cases. In cytoplasm, nucleus and cytoplasm/nucleus high phospho-CDC25C (Ser216 expression was identified in 50%, 70% and 77% of the carcinomas, respectively. High expression of CDC25s correlated significantly with malignant features, including poor differentiation and infiltration of vessel for CDC25B, high FIGO stage, presence of lymph node metastases, large tumor diameter, poor differentiation for CDC25C and high FIGO stage, large tumor diameter, deep invasion and poor differentiation for phospho-CDC25C (Ser216. In univariate analysis, high expression of phospho-CDC25C (Ser216 was correlated with poor disease-specific survival (p = 0.04. However, such an association was annulled in multivariate analysis. Conclusions Our results suggest that CDC25C and phospho-CDC25C (Ser216 play a crucial role and CDC25B a minor role in the pathogenesis and/or progression of vulvar carcinomas. CDC25B, CDC25C and phospho-CDC25C (Ser216 were associated with
International Nuclear Information System (INIS)
Wang, Zhihui; Trope, Claes G; Flørenes, Vivi Ann; Suo, Zhenhe; Nesland, Jahn M; Holm, Ruth
2010-01-01
CDC25 phosphatases are important regulators of the cell cycle. Their abnormal expression detected in a number of tumors implies that their dysregulation is involved in malignant transformation. However, the role of CDC25s in vulvar cancer is still unknown. To shed light on their roles in the pathogenesis and to clarify their prognostic values, expression of CDC25A, CDC25B and CDC25C in a large series of vulvar squamous cell carcinomas were examined. Expression of CDC25A, CDC25B, CDC25C and phosphorylated (phospho)-CDC25C (Ser216) were examined in 300 vulvar carcinomas using immunohistochemistry. Western blot analysis was utilized to demonstrate CDC25s expression in vulvar cancer cell lines. Kinase and phosphatase assays were performed to exclude cross reactivity among CDC25s isoform antibodies. High nuclear CDC25A and CDC25B expression were observed in 51% and 16% of the vulvar carcinomas, respectively, whereas high cytoplasmic CDC25C expression was seen in 63% of the cases. In cytoplasm, nucleus and cytoplasm/nucleus high phospho-CDC25C (Ser216) expression was identified in 50%, 70% and 77% of the carcinomas, respectively. High expression of CDC25s correlated significantly with malignant features, including poor differentiation and infiltration of vessel for CDC25B, high FIGO stage, presence of lymph node metastases, large tumor diameter, poor differentiation for CDC25C and high FIGO stage, large tumor diameter, deep invasion and poor differentiation for phospho-CDC25C (Ser216). In univariate analysis, high expression of phospho-CDC25C (Ser216) was correlated with poor disease-specific survival (p = 0.04). However, such an association was annulled in multivariate analysis. Our results suggest that CDC25C and phospho-CDC25C (Ser216) play a crucial role and CDC25B a minor role in the pathogenesis and/or progression of vulvar carcinomas. CDC25B, CDC25C and phospho-CDC25C (Ser216) were associated with malignant features and aggressive cancer phenotypes. However, the
The French Nuclear Safety Authority - ASN
International Nuclear Information System (INIS)
2013-01-01
The ASN (Nuclear Safety Authority) was created by the act of 13 June 2006 concerning the transparency and safety of nuclear activities. The ASN is an independent administrative body that is in charge of controlling nuclear activities in France. The ASN has a workforce of 471 people and a budget of about 76 millions euros. This article details its missions and how it is organized to cover all the French territory. (A.C.)
Kotsakis, Stathis D; Miriagou, Vivi; Tzelepi, Eva; Tzouvelekis, Leonidas S
2010-11-01
In GES-type β-lactamases, positions 104 and 170 are occupied by Glu or Lys and by Gly, Asn, or Ser, respectively. Previous studies have indicated an important role of these amino acids in the interaction with β-lactams, although their precise role, especially that of residue 104, remains uncertain. In this study, we constructed GES-1 (Glu104, Gly170), GES-2 (Glu104, Asn170), GES-5 (Glu104, Ser170), GES-6 (Lys104, Ser170), GES-7 (Lys104, Gly170), and GES-13 (Lys104, Asn170) by site-specific mutagenesis and compared their hydrolytic properties. Isogenic comparisons of β-lactam resistance levels conferred by these GES variants were also performed. Data indicated the following patterns: (i) Lys104-containing enzymes exhibited enhanced hydrolysis of oxyimino-cephalosporins and reduced efficiency against imipenem in relation to enzymes possessing Glu104, (ii) Asn170-containing enzymes showed reduced hydrolysis rates of penicillins and older cephalosporins, (iii) Ser170 enabled GES to hydrolyze cefoxitin efficiently, and (iv) Asn170 and Ser170 increased the carbapenemase character of GES enzymes but reduced their activity against ceftazidime. Molecular dynamic simulations of GES apoenzyme models, as well as construction of GES structures complexed with cefoxitin and an achiral ceftazidime-like boronic acid, provided insights into the catalytic behavior of the studied mutants. There were indications that an increased stability of the hydrogen bonding network of Glu166-Lys73-Ser70 and an altered positioning of Trp105 correlated with the substrate spectra, especially with acylation of GES by imipenem. Furthermore, likely effects of Ser170 on GES interactions with cefoxitin and of Lys104 on interactions with oxyimino-cephalosporins were revealed. Overall, the data unveiled the importance of residues 104 and 170 in the function of GES enzymes.
Energy Technology Data Exchange (ETDEWEB)
NONE
2008-07-01
The 2007 annual report of the French nuclear safety authority (ASN) presents the highlights of the year in the domain of nuclear safety and radiation protection in France. The year 2007 was marked by the implementation of a new legislative and regulatory framework created by the 13 June 2006 Act on transparency and security in the nuclear field (TSN) and the 28 June Act on the sustainable management of radioactive materials and wastes. As in the previous two years, the year was relatively satisfactory from the nuclear safety viewpoint and slightly less so with regard to small-scale nuclear activities. For two years now, the medical field has been marked by the declaration to ASN of a number of serious radiotherapy accidents which have led to several deaths or the need for extensive surgery. The following main topics are reviewed in the document: 1 - the decrees implementing the 'TSN' act and the 'Waste' act; 2 - the new ASN, one year on; 3 - ASN regulatory actions in the field of radiotherapy; 4 - regulation of new installations; 5 - the key issues for regulation of existing installations; 6 - nuclear safety and radiation protection research; 7 - policy for management of the post-accident phase of a radiological emergency; 8 - sites and soils polluted by radioactive materials; 9 - international harmonization of nuclear safety and radiation protection.
Energy Technology Data Exchange (ETDEWEB)
NONE
2008-07-01
The 2007 annual report of the French nuclear safety authority (ASN) presents the highlights of the year in the domain of nuclear safety and radiation protection in France. The year 2007 was marked by the implementation of a new legislative and regulatory framework created by the 13 June 2006 Act on transparency and security in the nuclear field (TSN) and the 28 June Act on the sustainable management of radioactive materials and wastes. As in the previous two years, the year was relatively satisfactory from the nuclear safety viewpoint and slightly less so with regard to small-scale nuclear activities. For two years now, the medical field has been marked by the declaration to ASN of a number of serious radiotherapy accidents which have led to several deaths or the need for extensive surgery. The following main topics are reviewed in the document: 1 - the decrees implementing the 'TSN' act and the 'Waste' act; 2 - the new ASN, one year on; 3 - ASN regulatory actions in the field of radiotherapy; 4 - regulation of new installations; 5 - the key issues for regulation of existing installations; 6 - nuclear safety and radiation protection research; 7 - policy for management of the post-accident phase of a radiological emergency; 8 - sites and soils polluted by radioactive materials; 9 - international harmonization of nuclear safety and radiation protection.
Energy Technology Data Exchange (ETDEWEB)
NONE
2002-07-01
Since February 2002, the French authority of nuclear safety (ASN) publishes on its web site (http://www.asn.gouv.fr) the letters addressed to the operators of nuclear facilities at the end of its inspections. The ASN carries out about 700 inspections every year which concern the French nuclear facilities, the central services of nuclear operators or of their suppliers, and the transports of nuclear materials. Each inspection is followed by a follow-up letter which mentions all anomalies noticed during the inspection and eventually asks for some remedial actions or for some complements of information. This document brings together the letters published between february and May 2002 and concerning the on-site inspections of nuclear facilities (EdF nuclear power plants, CEA centers, Cogema facilities, other sites) and the off-site inspections (Andra, transports of nuclear materials). (J.S.)
International Nuclear Information System (INIS)
2009-01-01
ASN is an independent administrative authority tasked, on behalf of the state, with regulating nuclear safety and radiation protection in order to protect workers, patients and the environment from the hazards involved in nuclear activities. It also contributes to informing the public. ASN, run by a five-member commission, regulates the whole of the sector, acting in a completely impartial manner. The ASN Commission presents its report on the state of nuclear safety and radiation protection in France in 2008. Contents: A - Introduction: The year 2008. B - Key topics: 1. ASN actions to promote greater transparency; 2. EDF nuclear power plant ageing and operating life: the conditions for continued operation; 3. The prevention of malicious acts; 4. ASN regulation of the radiotherapy sector; 5. Regulating and monitoring the construction of the Flamanville 3 EPR reactor; 6. ASN's international nuclear safety responsibilities; 7. The new nuclear countries; 8. Decommissioning of basic nuclear installations and the low-level, long-lived waste disposal project. C - Overview: 1 - Nuclear activities: ionising radiations and health risks; 2 - Principles and stakeholders in the regulation of nuclear safety and radiation protection; 3 - Regulation; 4 - Regulation of nuclear activities and exposure to ionising radiations; 5 - Environmental protection; 6 - Public information and transparency; 7 - International relations; 8 - Radiological emergencies; 9 - Medical uses of ionising radiations; 10 - Industrial and research activities; 11 - Transport of radioactive materials; 12 - EDF nuclear power plants; 13 - Nuclear fuel cycle installations; 14 - Nuclear research facilities and various nuclear installations; 15 - Safe decommissioning of basic nuclear installations; 16 - Radioactive waste and polluted sites. D - Appendices: List of basic nuclear installations; ASN decisions and opinions published in 2008 in its Official Bulletin; Acronyms, abbreviations and names
Awara, W M; Guo, C H; Conn, P M
1996-02-01
GnRH receptor (GnRH-R) contains Asn87 and Asp318 instead of the more frequently observed Asp87 and Asn318 found in other G protein-coupled receptors. In the present study, site-directed mutagenesis was used to introduce Asn318 and Asp87Asn318 into GnRH-R. The effect on coupling and regulation of GnRH-R was studied by stable expression of wild and mutant mouse GnRH-R in the lactotropic GH3 cells; these normally release PRL in response to TRH stimulation. The responses to Buserelin (a metabolically stable GnRH analog) in three different cell lines, M1, N8, and ND1 (expressing wild-type, Asn318 mutant, and Asp87Asn318 mutant mouse GnRH-R, respectively) were compared with that observed in the previously characterized GGH3-1' cells, which stably express rat GnRH-R. The Asn318 and Asp87Asn318 mutations had no measurable effect on ligand binding, but abolished the initial down-regulation of receptor that was observed in M1 and GGH3-1' cells, suggesting that the normal location of Asn87 and Asp318 in GnRH-R is involved in the regulation of GnRH-R. In N8 and ND1 cells, Buserelin-stimulated inositol phosphate (IP) production was attenuated, but the release of both cAMP and PRL was stimulated in a dose- and time-dependent manner. These mutations apparently impaired the coupling between GnRH-R and G proteins involved in IP production, but not those involved in cAMP release. In M1 cells, Buserelin stimulation produced a significant increase in IP production, but neither cAMP nor PRL release was significantly stimulated. These findings are consistent with the previous suggestion that GnRH-stimulated PRL release is mediated by a cAMP second messenger system in transfected GGH3 cells.
International Nuclear Information System (INIS)
NSTec Environmental Restoration
2007-01-01
Corrective Action Unit (CAU) 168 is identified in the Federal Facility Agreement and Consent Order of 1996 as Area 25 and 26 Contaminated Materials and Waste Dumps. CAU 168 consists of twelve Corrective Action Sites (CASs) in Areas 25 and 26 of the Nevada Test Site, which is approximately 105 kilometers (65 miles) northwest of Las Vegas, Nevada. The CASs contain surface and subsurface debris, impacted soil, and contaminated materials. Site characterization activities were conducted in 2002, and the results are presented in the Corrective Action Decision Document (CADD) for CAU 168 (U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office [NNSA/NSO], 2006). Site characterization results indicated that soil at several sites exceeded the clean-up criteria for total petroleum hydrocarbons (TPH), polychlorinated biphenyls (PCBs), and radionuclides. The Nevada Division of Environmental Protection approved the proposed corrective actions specified in the CADD (NNSA/NSO, 2006). The approved corrective actions include no further action, clean closure, and closure in place with administrative controls
The French Nuclear Safety Authority (ASN)
International Nuclear Information System (INIS)
Alloso, Ph.
2011-01-01
This article presents the statutes, the organization and the missions of the Nuclear Safety Authority (ASN) whose scope includes radiation protection since 2002. Globally ASN is in charge of: -) participating to the making of laws and regulations, -) delivering administrative authorizations, -) controlling the conformity of nuclear installations and activities with the laws and regulations, -) informing the public, and -) reporting on the state of nuclear safety and radiation protection each year. (A.C.)
Mutation of Asn28 Disrupts the Dimerization and Enzymatic Activity of SARS 3CL
Energy Technology Data Exchange (ETDEWEB)
Barrila, J.; Gabelli, S; Bacha, U; Amzel, M; Freire, E
2010-01-01
Coronaviruses are responsible for a significant proportion of annual respiratory and enteric infections in humans and other mammals. The most prominent of these viruses is the severe acute respiratory syndrome coronavirus (SARS-CoV) which causes acute respiratory and gastrointestinal infection in humans. The coronavirus main protease, 3CL{sup pro}, is a key target for broad-spectrum antiviral development because of its critical role in viral maturation and high degree of structural conservation among coronaviruses. Dimerization is an indispensable requirement for the function of SARS 3CL{sup pro} and is regulated through mechanisms involving both direct and long-range interactions in the enzyme. While many of the binding interactions at the dimerization interface have been extensively studied, those that are important for long-range control are not well-understood. Characterization of these dimerization mechanisms is important for the structure-based design of new treatments targeting coronavirus-based infections. Here we report that Asn28, a residue 11 {angstrom} from the closest residue in the opposing monomer, is essential for the enzymatic activity and dimerization of SARS 3CLpro. Mutation of this residue to alanine almost completely inactivates the enzyme and results in a 19.2-fold decrease in the dimerization K{sub d}. The crystallographic structure of the N28A mutant determined at 2.35 {angstrom} resolution reveals the critical role of Asn28 in maintaining the structural integrity of the active site and in orienting key residues involved in binding at the dimer interface and substrate catalysis. These findings provide deeper insight into complex mechanisms regulating the activity and dimerization of SARS 3CL{sup pro}.
A.S.N. regulation of Flamanville 3 EPR construction
International Nuclear Information System (INIS)
Limousin, S.
2009-01-01
The EPR authorization decree for Flamanville 3 was issued by the French government (decree no. 2007-534) on the 10 April 2007. The construction activities are going on in the manufacturer workshops and at Flamanville site. The decree published in November 2007, and related to the so called TSN law (the nuclear transparency and safety nuclear law published in 2006), specifies that the commissioning licence (the agreement for first fuel load) has to be granted by an ASN decision on the basis of the assessment of the demonstration of the plant safety. In this aim, one part of ASN's work is to review, with its technical sup-port organisation (IRSN), the reactor construction in order to appreciate the safety level of the construction activities. This paper describes ASN's strategy for the regulation of Flamanville 3 EPR construction activities, endorsed by ASN commission at the end of November 2007, and the main events which have occurred on Flamanville site since the beginning of the construction. The article presents the main ASN conclusions of this regulation at this time. (author)
Impact of the Disruption of ASN3-Encoding Asparagine Synthetase on Arabidopsis Development
Directory of Open Access Journals (Sweden)
Laure Gaufichon
2016-02-01
Full Text Available The aim of this study was to investigate the role of ASN3-encoded asparagine synthetase (AS, EC 6.3.5.4 during vegetative growth, seed development and germination of Arabidopsis thaliana. Phenotypic analysis of knockout (asn3-1 and knockdown (asn3-2 T-DNA insertion mutants for the ASN3 gene (At5g10240 demonstrated wild-type contents of asparagine synthetase protein, chlorophyll and ammonium in green leaves at 35 days after sowing. In situ hybridization localized ASN3 mRNA to phloem companion cells of vasculature. Young siliques of the asn3-1 knockout line showed a decrease in asparagine but an increase in glutamate. The seeds of asn3-1 and asn3-2 displayed a wild-type nitrogen status expressed as total nitrogen content, indicating that the repression of ASN3 expression had only a limited effect on mature seeds. An analysis of amino acid labeling of seeds imbibed with (15N ammonium for 24 h revealed that asn3-1 seeds contained 20% less total asparagine while 15N-labeled asparagine ((2-15Nasparagine, (4-15Nasparagine and (2,4-15Nasparagine increased by 12% compared to wild-type seeds. The data indicate a fine regulation of asparagine synthesis and hydrolysis in Arabidopsis seeds.
Skills of Asn inspectors responsible for inspecting pressurised equipment
International Nuclear Information System (INIS)
Colonna, F.
2010-01-01
ASN relies on the unique competencies of its staff to assure that it can complete its mission of maintaining public health and safety. Since 1975, personnel at ASN Nuclear Pressure Equipment Department have played a major role in the oversight of pressure boundary equipment by verifying that equipment is manufactured in compliance with regulatory requirements. This has called for highly competent individuals trained in a variety of technical and regulatory backgrounds. ASN is meeting the challenge of keeping its staff trained and prepared to continue its oversight of nuclear boilers. This has included ensuring that its organization is welt suited to meet the demands, and relying on third-party experts when necessary. With the implementation of the 2006 transparency law, ASN has taken necessary steps to ensure that it will maintain its high level of expertise going forward. (author)
Sansenya, Sompong; Maneesan, Janjira; Cairns, James R Ketudat
2012-04-01
Os3BGlu6, Os3BGlu7, and Os4BGlu12 are rice glycoside hydrolase family 1 β-glucosidases, the structures of which have been solved by X-ray crystallography. In complex structures, Os3BGlu7 residue Asn245 hydrogen bonds to the second sugar in the +1 subsite for laminaribiose and the third sugar in the +2 subsite for cellotetraose and cellopentaose. The corresponding Os3BGlu6 residue, Met251, appears to block the binding of cellooligosaccharides at the +2 subsite, whereas His252 in this position in Os4BGlu12 could hydrogen bond to oligosaccharides. Mutation of Os3BGlu6 Met251 to Asn resulted in a 15-fold increased k(cat)/K(m) value for hydrolysis of laminaribiose compared to wild type Os3BGlu6 and 9 to 24-fold increases for cellooligosaccharides with degrees of polymerization (DP) of 2-5. On the other hand, mutation of Os3BGlu7 Asn245 to Met decreased the k(cat)/K(m) of hydrolysis by 6.5-fold for laminaribiose and 17 to 30-fold for cellooligosaccharides with DP >2, while mutation of Os4BGlu12 His252 to Met decreased the corresponding k(cat)/K(m) values 2 to 6-fold. Copyright © 2012 Elsevier Ltd. All rights reserved.
Nair, Nilendra; Raff, Hannah; Islam, Mohammed Tarek; Feen, Melanie; Garofalo, Denise M; Sheppard, Kelly
2016-02-13
Synthesis of asparaginyl-tRNA (Asn-tRNA(Asn)) in bacteria can be formed either by directly ligating Asn to tRNA(Asn) using an asparaginyl-tRNA synthetase (AsnRS) or by synthesizing Asn on the tRNA. In the latter two-step indirect pathway, a non-discriminating aspartyl-tRNA synthetase (ND-AspRS) attaches Asp to tRNA(Asn) and the amidotransferase GatCAB transamidates the Asp to Asn on the tRNA. GatCAB can be similarly used for Gln-tRNA(Gln) formation. Most bacteria are predicted to use only one route for Asn-tRNA(Asn) formation. Given that Bacillus halodurans and Bacillus subtilis encode AsnRS for Asn-tRNA(Asn) formation and Asn synthetases to synthesize Asn and GatCAB for Gln-tRNA(Gln) synthesis, their AspRS enzymes were thought to be specific for tRNA(Asp). However, we demonstrate that the AspRSs are non-discriminating and can be used with GatCAB to synthesize Asn. The results explain why B. subtilis with its Asn synthetase genes knocked out is still an Asn prototroph. Our phylogenetic analysis suggests that this may be common among Firmicutes and 30% of all bacteria. In addition, the phylogeny revealed that discrimination toward tRNA(Asp) by AspRS has evolved independently multiple times. The retention of the indirect pathway in B. subtilis and B. halodurans likely reflects the ancient link between Asn biosynthesis and its use in translation that enabled Asn to be added to the genetic code. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
International Nuclear Information System (INIS)
2008-01-01
The 2007 annual report of the French nuclear safety authority (ASN) presents the highlights of the year in the domain of nuclear safety and radiation protection in France. The year 2007 was marked by the implementation of a new legislative and regulatory framework created by the 13 June 2006 Act on transparency and security in the nuclear field (TSN) and the 28 June Act on the sustainable management of radioactive materials and wastes. As in the previous two years, the year was relatively satisfactory from the nuclear safety viewpoint and slightly less so with regard to small-scale nuclear activities. For two years now, the medical field has been marked by the declaration to ASN of a number of serious radiotherapy accidents which have led to several deaths or the need for extensive surgery. The following main topics are reviewed in the document: 1 - the decrees implementing the 'TSN' act and the 'Waste' act; 2 - the new ASN, one year on; 3 - ASN regulatory actions in the field of radiotherapy; 4 - regulation of new installations; 5 - the key issues for regulation of existing installations; 6 - nuclear safety and radiation protection research; 7 - policy for management of the post-accident phase of a radiological emergency; 8 - sites and soils polluted by radioactive materials; 9 - international harmonization of nuclear safety and radiation protection
Subramanian, Veedamali S; Sabui, Subrata; Teafatiller, Trevor; Bohl, Jennifer A; Said, Hamid M
2017-08-01
The human riboflavin (RF) transporter-3 (hRFVT-3; product of the SLC52A3 gene) plays an essential role in the intestinal RF absorption process and is expressed exclusively at the apical membrane domain of polarized enterocytes. Previous studies have characterized different physiological/biological aspects of this transporter, but nothing is known about the glycosylation status of the hRFVT-3 protein and role of this modification in its physiology/biology. Additionally, little is known about the residues in the hRFVT-3 protein that interact with the ligand, RF. We addressed these issues using appropriate biochemical/molecular approaches, a protein-docking model, and established intestinal/renal epithelial cells. Our results showed that the hRFVT-3 protein is glycosylated and that glycosylation is important for its function. Mutating the predicted N -glycosylation sites at Asn 94 and Asn 168 led to a significant decrease in RF uptake; it also led to a marked intracellular (in the endoplasmic reticulum, ER) retention of the mutated proteins as shown by live-cell confocal imaging studies. The protein-docking model used in this study has identified a number of putative substrate-interacting sites: Ser 16 , Ile 20 , Trp 24 , Phe 142 , Thr 314 , and Asn 315 Mutating these potential interacting sites was indeed found to lead to a significant inhibition in RF uptake and to intracellular (ER) retention of the mutated proteins (except for the Phe 142 mutant). These results demonstrate that the hRFVT-3 protein is glycosylated and this glycosylation is important for its function and cell surface expression. This study also identified a number of residues in the hRFVT-3 polypeptide that are important for its function/cell surface expression.
International Nuclear Information System (INIS)
2010-01-01
After a presentation of the roles, missions and organization of the ASN (the French Nuclear safety Authority), this document presents and reports its actions in various domains: ionizing radiations and health and environmental risks (knowledge on these risks and hazards, nuclear activities controlled by the ASN, surveillance of exposures to ionizing radiations), principles and actors of nuclear safety, radioprotection and environment protection control, regulation (general framework, proximity nuclear regulation, nuclear installation legal regime, radioactive material transport regulation, arrangements associated with some risks and some specific activities), control of nuclear activities and exposures to ionizing radiations, situations of radiological emergency, public information, international relationships (objectives in Europe and in the world, relationships within the EU and multilateral relationships, bilateral relationships, international convention, international conferences), regional overview of nuclear safety and radioprotection, medical and non medical uses of ionizing radiations, transport of radioactive materials, EDF nuclear plants, nuclear fuel cycle installations, nuclear research installations and other installations, basic nuclear installation dismantling safety, radioactive wastes and polluted sites. This report also provides presentations of incident and accident classification scales and law texts
Sasaki, J.; Shichida, Y.; Lanyi, J. K.; Maeda, A.
1992-01-01
The difference Fourier transform infrared spectrum for the N intermediate in the photoreaction of the light-adapted form of bacteriorhodopsin can be recorded at pH 10 at 274 K (Pfefferle, J.-M., Maeda, A., Sasaki, J., and Yoshizawa, T. (1991) Biochemistry 30, 6548-6556). Under these conditions, Asp96-->Asn bacteriorhodopsin gives a photoproduct which shows changes in protein structure similar to those observed in N of wild-type bacteriorhodopsin. However, decreased intensity of the chromophore bands and the single absorbance maximum at about 400 nm indicate that the Schiff base is unprotonated, as in the M intermediate. This photoproduct was named MN. At pH 7, where the supply of proton is not as restricted as at pH 10, Asp96-->Asn bacteriorhodopsin yields N with a protonated Schiff base. The Asn96 residue, which cannot deprotonate as Asp96 in wild-type bacteriorhodopsin, is perturbed upon formation of both MN at pH 10 and N at pH 7. We suggest that the reprotonation of the Schiff base is preceded by a large change in the protein structure including perturbation of the residue at position 96.
ASN report on nuclear safety and radioprotection status in France in 2010
International Nuclear Information System (INIS)
2011-01-01
After a general overview of the activity of the ASN (the French nuclear safety authority), of its missions and organisation, this activity report indicates the main events of 2010 concerning the actions performed by the ASN and the activities controlled by the ASN. These both aspects are then detailed. The actions performed by the ASN are dealing with nuclear activities (ionizing radiations and risks for health and for the environment), principles and actors of nuclear safety control, radioprotection and environment protection, regulation, control of nuclear activities and exposures to ionizing radiations, emergency situations, public information, international relationship, regional overview of nuclear safety and radioprotection. The activities controlled by the ASN are the medical uses of ionizing radiations, their non medical uses, the transport of radioactive materials, electronuclear plants, installations related to nuclear fuel cycle, nuclear research installations and other nuclear installations, the safety of nuclear installation dismantling, radioactive wastes and polluted sites
ASN report on nuclear safety and radiation protection in France in 2006, excerpts
International Nuclear Information System (INIS)
Lacoste, A.C.
2007-01-01
The main topics for the Nuclear Safety Authority (ASN) in 2006 were the following ones. 1) the 2006-686 bill on transparency and security in the nuclear field. This law constitutes an overhaul of the legislative framework applicable to nuclear activities. It creates the Nuclear Safety Authority as an independent administrative authority and defines its tasks. It contains significant advances in terms of transparency. 2) The 2006-739 bill concerning sustainable management of radioactive materials and waste. This law clearly states that the disposal in deep geological formations is the reference solution for high-level, long-lived radioactive wastes. 3) The EPR reactor project safety in which ASN completed technical examination of the preliminary safety case. In November 2006, ASN produced to French Authorities a draft decree concerning the EPR project on the Flamanville site. 4) An international audit of ASN was performed in 2006 by IAEA in order to assess the extent to which the standards IAEA recommends are taken into account and implemented. 5) ASN has contributed to the harmonization of nuclear safety in Europe and at world scale through its contribution to the work of the WENRA association. 6) In 2005 and 2006 4 serious radiotherapy accidents were reported in France. Cancer radiotherapy is a fully justified practice that demands a vigilant supervision of ASN. 7) ASN has amplified its means for informing the public about nuclear safety and radiation protection. And 8) ASN considers that people and organizations are fundamental factors in safety and radiation protection and that significant progress is still to be made in taking into account these factors in nuclear activities. (A.C.)
Directory of Open Access Journals (Sweden)
Oana-M. Buja
2017-01-01
Full Text Available A microfluidic setup which enables on-line monitoring of residues of malachite green (MG using surface-enhanced Raman scattering (SERS is reported. The SERS active substrate was prepared via laser induced synthesis of silver or gold nanoparticles spot on the bottom of a 200 μm inner dimension glass capillary, by focusing the laser beam during a continuous flow of a mixture of silver nitrate or gold chloride and sodium citrate. The described microfluidic setup enables within a few minutes the monitoring of several processes: the synthesis of the SERS active spot, MG adsorption to the metal surface, detection of the analyte when saturation of the SERS signal is reached, and finally, the desorption of MG from the spot. Moreover, after MG complete desorption, the regeneration of the SERS active spot was achieved. The detection of MG was possible down to 10−7 M concentration with a good reproducibility when using silver or gold spots as SERS substrate.
Energy Technology Data Exchange (ETDEWEB)
Wickline, Alfred
2006-12-01
This Corrective Action Decision Document has been prepared for Corrective Action Unit (CAU) 168: Area 25 and 26, Contaminated Materials and Waste Dumps, Nevada Test Site, Nevada. The purpose of this Corrective Action Decision Document is to identify and provide a rationale for the selection of a recommended corrective action alternative for each corrective action site (CAS) within CAU 168. The corrective action investigation (CAI) was conducted in accordance with the ''Corrective Action Investigation Plan for Corrective Action Unit 168: Area 25 and 26, Contaminated Materials and Waste Dumps, Nevada Test Site, Nevada'', as developed under the ''Federal Facility Agreement and Consent Order'' (1996). Corrective Action Unit 168 is located in Areas 25 and 26 of the Nevada Test Site, Nevada and is comprised of the following 12 CASs: CAS 25-16-01, Construction Waste Pile; CAS 25-16-03, MX Construction Landfill; CAS 25-19-02, Waste Disposal Site; CAS 25-23-02, Radioactive Storage RR Cars; CAS 25-23-13, ETL - Lab Radioactive Contamination; CAS 25-23-18, Radioactive Material Storage; CAS 25-34-01, NRDS Contaminated Bunker; CAS 25-34-02, NRDS Contaminated Bunker; CAS 25-99-16, USW G3; CAS 26-08-01, Waste Dump/Burn Pit; CAS 26-17-01, Pluto Waste Holding Area; and CAS 26-19-02, Contaminated Waste Dump No.2. Analytes detected during the CAI were evaluated against preliminary action levels (PALs) to determine contaminants of concern (COCs) for CASs within CAU 168. Radiological measurements of railroad cars and test equipment were compared to unrestricted (free) release criteria. Assessment of the data generated from the CAI activities revealed the following: (1) Corrective Action Site 25-16-01 contains hydrocarbon-contaminated soil at concentrations exceeding the PAL. The contamination is at discrete locations associated with asphalt debris. (2) No COCs were identified at CAS 25-16-03. Buried construction waste is present in at least two
Oral Bicarbonate Slows Decline of Residual Renal Function in Peritoneal Dialysis Patients.
Liu, Xiang-Yang; Gao, Xiu-Mei; Zhang, Ning; Chen, Rui; Wu, Feng; Tao, Xin-Chao; Li, Chun-Jun; Zhang, Ping; Yu, Pei
2017-01-01
Metabolic acidosis is a common consequence of end-stage renal disease (ESRD) which may result in a substantial adverse outcome. The effect of oral bicarbonate on the preservation of residual renal function (RRF) in peritoneal dialysis (PD) patients has been rarely reported. We randomly assigned 40 continuous ambulatory peritoneal dialysis (CAPD) patients to the oral bicarbonate group or placebo group at a 1: 1 ratio. All enrollments were followed for a duration of 104 weeks. We took residual creatinine clearance (CCr), a measure of residual renal function (RRF), as the primary outcome. Residual CCr was calculated as the average of urea and creatinine clearance from a 24-hour urine collection. Thirteen patients in the placebo group and 15 patients in the treatment group completed the 104 weeks of follow-up with a comparable dropout rate (placebo group: 35% vs treatment group: 25%). Compared with the placebo group, serum bicarbonate in treatment group was significantly increased at each time point, and oral bicarbonate resulted in a slower declining rate of residual CCr (F=5.113, p=0.031). Baseline residual CCr at enrollment also had a significant effect on residual CCr (F=168.779, Pcalculate a comorbidity score had no significant effect on residual CCr loss (F=0.168, P=0.685). Oral bicarbonate may have a RRF preserving effect in CAPD patients, and a normal to high level of serum bicarbonate (≥24mmol/L) may be appropriate for RRF preservation. © 2017 The Author(s). Published by S. Karger AG, Basel.
International Nuclear Information System (INIS)
Lin, Ying-Chuan; Perryman, Alexander L.; Olson, Arthur J.; Torbett, Bruce E.; Elder, John H.; Stout, C. David
2011-01-01
Crystal structures of the 6s-98S FIV protease chimera with darunavir and lopinavir bound have been determined at 1.7 and 1.8 Å resolution, respectively. A chimeric feline immunodeficiency virus (FIV) protease (PR) has been engineered that supports infectivity but confers sensitivity to the human immunodeficiency virus (HIV) PR inhibitors darunavir (DRV) and lopinavir (LPV). The 6s-98S PR has five replacements mimicking homologous residues in HIV PR and a sixth which mutated from Pro to Ser during selection. Crystal structures of the 6s-98S FIV PR chimera with DRV and LPV bound have been determined at 1.7 and 1.8 Å resolution, respectively. The structures reveal the role of a flexible 90s loop and residue 98 in supporting Gag processing and infectivity and the roles of residue 37 in the active site and residues 55, 57 and 59 in the flap in conferring the ability to specifically recognize HIV PR drugs. Specifically, Ile37Val preserves tertiary structure but prevents steric clashes with DRV and LPV. Asn55Met and Val59Ile induce a distinct kink in the flap and a new hydrogen bond to DRV. Ile98Pro→Ser and Pro100Asn increase 90s loop flexibility, Gln99Val contributes hydrophobic contacts to DRV and LPV, and Pro100Asn forms compensatory hydrogen bonds. The chimeric PR exhibits a comparable number of hydrogen bonds, electrostatic interactions and hydrophobic contacts with DRV and LPV as in the corresponding HIV PR complexes, consistent with IC 50 values in the nanomolar range
Directory of Open Access Journals (Sweden)
Mohammad Hasan Sheikhha
2011-01-01
Full Text Available Aim : The aim of the study was to investigate the association between follicle-stimulating hormone receptor (FSHR gene polymorphism at Position 680 and the outcomes of controlled ovarian hyperstimulation for in vitro fertilization and embryo transfer (IVF-ET in infertile women. Materials and Methods : One hundred and eight patients under 35 years of age who underwent IVF-ET procedures were included in this study. The hormonal profile and treatment of all patients were analyzed and FSHR polymorphism was examined by polymerase chain reaction-restriction fragment length polymorphism. Women from all groups were classified based on polymorphisms at Position 680, occupied either by asparagines (Asn or serine (Ser as Asn/Asn, Asn/Ser, and Ser/Ser genotype. Result : Our study showed that all patients in the Asn/Asn group were normal responders and in the Asn/Ser group 64.8% were normal responders and 21.1% and 14.1% were poor and hyper responders respectively. In the Ser/Ser group we did not have normal responders and 46.7% of these patients were poor responders and 53.3% were hyper responders. Conclusion : FSH receptor polymorphism is correlated with response to ovarian stimulation.
Alves, Juliano; Garay-Malpartida, Miguel; Occhiucci, João M; Belizário, José E
2017-12-01
Procaspase-7 zymogen polypeptide is composed of a short prodomain, a large subunit (p20), and a small subunit (p10) connected to an intersubunit linker. Caspase-7 is activated by an initiator caspase-8 and -9, or by autocatalysis after specific cleavage at IQAD 198 ↓S located at the intersubunit linker. Previously, we identified that PEST regions made of amino acid residues Pro (P), Glu (E), Asp (D), Ser (S), Thr (T), Asn (N), and Gln (Q) are conserved flanking amino acid residues in the cleavage sites within a prodomain and intersubunit linker of all caspase family members. Here we tested the impact of alanine substitution of PEST amino acid residues on procaspase-7 proteolytic self-activation directly in Escherichia coli. The p20 and p10 subunit cleavage were significantly delayed in double caspase-7 mutants in the prodomain (N18A/P26A) and intersubunit linker (S199A/P201A), compared with the wild-type caspase-7. The S199A/P201A mutants effectively inhibited the p10 small subunit cleavage. However, the mutations did not change the kinetic parameters (k cat /K M ) and optimal tetrapeptide specificity (DEVD) of the purified mutant enzymes. The results suggest a role of PEST-amino acid residues in the molecular mechanism for prodomain and intersubunit cleavage and caspase-7 self-activation.
Directory of Open Access Journals (Sweden)
Nicolas Dzamko
Full Text Available Mutations in leucine-rich repeat kinase 2 (LRRK2 are strongly associated with late-onset autosomal dominant Parkinson's disease. LRRK2 is highly expressed in immune cells and recent work points towards a link between LRRK2 and innate immunity. Here we demonstrate that stimulation of the Toll-Like Receptor (TLR pathway by MyD88-dependent agonists in bone marrow-derived macrophages (BMDMs or RAW264.7 macrophages induces marked phosphorylation of LRRK2 at Ser910 and Ser935, the phosphorylation sites that regulate the binding of 14-3-3 to LRRK2. Phosphorylation of these residues is prevented by knock-out of MyD88 in BMDMs, but not the alternative TLR adaptor protein TRIF. Utilising both pharmacological inhibitors, including a new TAK1 inhibitor, NG25, and genetic models, we provide evidence that both the canonical (IKKα and IKKβ and IKK-related (IKKε and TBK1 kinases mediate TLR agonist induced phosphorylation of LRRK2 in vivo. Moreover, all four IKK members directly phosphorylate LRRK2 at Ser910 and Ser935 in vitro. Consistent with previous work describing Ser910 and Ser935 as pharmacodynamic biomarkers of LRRK2 activity, we find that the TLR independent basal phosphorylation of LRRK2 at Ser910 and Ser935 is abolished following treatment of macrophages with LRRK2 kinase inhibitors. However, the increased phosphorylation of Ser910 and Ser935 induced by activation of the MyD88 pathway is insensitive to LRRK2 kinase inhibitors. Finally, employing LRRK2-deficient BMDMs, we present data indicating that LRRK2 does not play a major role in regulating the secretion of inflammatory cytokines induced by activation of the MyD88 pathway. Our findings provide the first direct link between LRRK2 and the IKKs that mediate many immune responses. Further work is required to uncover the physiological roles that phosphorylation of LRRK2 by IKKs play in controlling macrophage biology and to determine how phosphorylation of LRRK2 by IKKs impacts upon the use of Ser
Directory of Open Access Journals (Sweden)
Fazakas Ferenc
2008-04-01
Full Text Available Abstract Von Hippel-Lindau disease (VHL is a rare autosomal dominant disease characterized by development of cystic and tumorous lesions at multiple sites, including the brain, spinal cord, kidneys, adrenals, pancreas, epididymis and eyes. The clinical phenotype results from molecular abnormalities of the VHL tumor suppressor gene, mapped to human chromosome 3p25-26. The VHL gene encodes two functionally active VHL proteins due to the presence of two translational initiation sites separated by 53 codons. The majority of disease-causing mutations have been detected downstream of the second translational initiation site, but there are conflicting data as to whether few mutations located in the first 53 codons, such as the Pro25Leu could have a pathogenic role. In this paper we report a large Hungarian VHL type 2 family consisting of 32 members in whom a disease-causing AGT80AAT (Ser80Ile c.239G>A, p.Ser80Ile mutation, but not the concurrent CCT25CTT (Pro25Leu c.74C>T, p.Pro25Leu variant co-segregated with the disease. To our knowledge, the Ser80Ile mutation has not been previously described in VHL type 2 patients with high risk of pheochromocytoma and renal cell cancer. Therefore, this finding represents a novel genotype-phenotype association and VHL kindreds with Ser80Ile mutation will require careful surveillance for pheochromocytoma. We concluded that the Pro25Leu variant is a rare, neutral variant, but the presence such a rare gene variant may make genetic counseling difficult.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Lactose. 168.122 Section 168.122 Food and Drugs... § 168.122 Lactose. (a) Lactose is the carbohydrate normally obtained from whey. It may be anhydrous or... the following specifications: (1) The lactose content is not less than 98.0 percent, mass over mass (m...
International Nuclear Information System (INIS)
Anon.
2012-01-01
The French law imposes in some situations the presence of a person skilled in radiation protection (PCR). This article describes the cases when this person must belong to the staff of the enterprise or when this person may be sub-contracted. For instance in most nuclear facilities the PCR must be on the payroll, for enterprises dedicated to nuclear transport the PCR's job can be sub-contracted. A decision given by the ASN (French Nuclear Safety Authority) sets the minimal requests (in terms of training, job contract, activities) of the sub-contracted PCR. (A.C.)
Energy Technology Data Exchange (ETDEWEB)
Lin, Ying-Chuan; Perryman, Alexander L.; Olson, Arthur J.; Torbett, Bruce E.; Elder, John H.; Stout, C. David, E-mail: dave@scripps.edu [The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037 (United States)
2011-06-01
Crystal structures of the 6s-98S FIV protease chimera with darunavir and lopinavir bound have been determined at 1.7 and 1.8 Å resolution, respectively. A chimeric feline immunodeficiency virus (FIV) protease (PR) has been engineered that supports infectivity but confers sensitivity to the human immunodeficiency virus (HIV) PR inhibitors darunavir (DRV) and lopinavir (LPV). The 6s-98S PR has five replacements mimicking homologous residues in HIV PR and a sixth which mutated from Pro to Ser during selection. Crystal structures of the 6s-98S FIV PR chimera with DRV and LPV bound have been determined at 1.7 and 1.8 Å resolution, respectively. The structures reveal the role of a flexible 90s loop and residue 98 in supporting Gag processing and infectivity and the roles of residue 37 in the active site and residues 55, 57 and 59 in the flap in conferring the ability to specifically recognize HIV PR drugs. Specifically, Ile37Val preserves tertiary structure but prevents steric clashes with DRV and LPV. Asn55Met and Val59Ile induce a distinct kink in the flap and a new hydrogen bond to DRV. Ile98Pro→Ser and Pro100Asn increase 90s loop flexibility, Gln99Val contributes hydrophobic contacts to DRV and LPV, and Pro100Asn forms compensatory hydrogen bonds. The chimeric PR exhibits a comparable number of hydrogen bonds, electrostatic interactions and hydrophobic contacts with DRV and LPV as in the corresponding HIV PR complexes, consistent with IC{sub 50} values in the nanomolar range.
Development of a SERS aptasensor for detection of medical residues
DEFF Research Database (Denmark)
Frøhling, Kasper Bayer
Low levels of medical residues in environmental, industrial and domestic water systems is a growing concern. The biosensor industry is trying to accomodate the need of sensitive and specific sensor systems capable of ultra-low level detection of medical residues. In this PhD project a surface...... for sensitive and selective capture of medical residues....
Directory of Open Access Journals (Sweden)
Kequan Fu
Full Text Available Transmembrane protein 168 (TMEM168 comprises 697 amino acid residues, including some putative transmembrane domains. It is reported that TMEM168 controls methamphetamine (METH dependence in the nucleus accumbens (NAc of mice. Moreover, a strong link between METH dependence-induced adaptive changes in the brain and mood disorders has been evaluated. In the present study, we investigated the effects of accumbal TMEM168 in a battery of behavioral paradigms. The adeno-associated virus (AAV Tmem168 vector was injected into the NAc of C57BL/6J mice (NAc-TMEM mice. Subsequently, the accumbal TMEM168 mRNA was increased approximately by seven-fold when compared with the NAc-Mock mice (controls. The NAc-TMEM mice reported no change in the locomotor activity, cognitive ability, social interaction, and depression-like behaviors; however, TMEM168 overexpression enhanced anxiety in the elevated-plus maze and light/dark box test. The increased anxiety was reversed by pretreatment with the antianxiety drug diazepam (0.3 mg/kg i.p.. Moreover, the NAc-TMEM mice exhibited decreased prepulse inhibition (PPI in the startle response test, and the induced schizophrenia-like behavior was reversed by pretreatment with the antipsychotic drug risperidone (0.01 mg/kg i.p.. Furthermore, accumbal TMEM168 overexpression decreased the basal levels of extracellular GABA in the NAc and the high K+ (100 mM-stimulated GABA elevation; however, the total contents of GABA in the NAc remained unaffected. These results suggest that the TMEM168-regulated GABAergic neuronal system in the NAc might become a novel target while studying the etiology of anxiety and sensorimotor gating deficits.
Amino acids profile of sugar cane spirit (cachaça), rum, and whisky.
Aquino, Francisco W B; Boso, Lisangela M; Cardoso, Daniel R; Franco, Douglas W
2008-05-15
An analytical procedure for the separation and quantification of 20 amino acids in cachaças has been developed involving C18 solid phase cleanup, derivatization with o-phthalaldehyde/2-mercaptoethanol, and reverse phase liquid chromatography with fluorescence detection. The detection limit was between 0.0050 (Cys) and 0.25 (Ser)mgL(-1), whereas the recovery index varies from 69.5 (Lys) to 100 (Tyr)%. Relative standard deviations vary from 1.39 (Trp) to 13.4 (Glu)% and from 3.08 (Glu) to 13.5 (His) for the repeatability and intermediate precision, respectively. From the quantitative profile of amino acids in 41 cachaças, 5 rums, and 12 whisky samples, the following order of amino acids in significant quantities is observed: Gly=Ser
46 CFR 168.15-10 - Construction.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Construction. 168.15-10 Section 168.15-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS CIVILIAN NAUTICAL SCHOOL VESSELS Accommodations § 168.15-10 Construction. (a) The accommodations provided must be securely constructed, properly...
Energy Technology Data Exchange (ETDEWEB)
Xiang, Yong; Karaveg, Khanita; Moremen, Kelley W.
2016-11-17
Asn-linked glycosylation of newly synthesized polypeptides occurs in the endoplasmic reticulum of eukaryotic cells. Glycan structures are trimmed and remodeled as they transit the secretory pathway, and processing intermediates play various roles as ligands for folding chaperones and signals for quality control and intracellular transport. Key steps for the generation of these trimmed intermediates are catalyzed by glycoside hydrolase family 47 (GH47) α-mannosidases that selectively cleave α1,2-linked mannose residues. Despite the sequence and structural similarities among the GH47 enzymes, the molecular basis for residue-specific cleavage remains obscure. The present studies reveal enzyme–substrate complex structures for two related GH47 α-mannosidases and provide insights into how these enzymes recognize the same substrates differently and catalyze the complementary glycan trimming reactions necessary for glycan maturation.
BANERJI, JULIAN
2015-01-01
The present treatment of childhood T-cell leukemias involves the systemic administration of prokary-otic L-asparaginase (ASNase), which depletes plasma Asparagine (Asn) and inhibits protein synthesis. The mechanism of therapeutic action of ASNase is poorly understood, as are the etiologies of the side-effects incurred by treatment. Protein expression from genes bearing Asn homopolymeric coding regions (N-hCR) may be particularly susceptible to Asn level fluctuation. In mammals, N-hCR are rare, short and conserved. In humans, misfunctions of genes encoding N-hCR are associated with a cluster of disorders that mimic ASNase therapy side-effects which include impaired glycemic control, dislipidemia, pancreatitis, compromised vascular integrity, and neurological dysfunction. This paper proposes that dysregulation of Asn homeostasis, potentially even by ASNase produced by the microbiome, may contribute to several clinically important syndromes by altering expression of N-hCR bearing genes. By altering amino acid abundance and modulating ribosome translocation rates at codon repeats, the microbiomic environment may contribute to genome decoding and to shaping the proteome. We suggest that impaired translation at poly Asn codons elevates diabetes risk and severity. PMID:26178806
Banerji, Julian
2015-09-01
The present treatment of childhood T-cell leukemias involves the systemic administration of prokaryotic L-asparaginase (ASNase), which depletes plasma Asparagine (Asn) and inhibits protein synthesis. The mechanism of therapeutic action of ASNase is poorly understood, as are the etiologies of the side-effects incurred by treatment. Protein expression from genes bearing Asn homopolymeric coding regions (N-hCR) may be particularly susceptible to Asn level fluctuation. In mammals, N-hCR are rare, short and conserved. In humans, misfunctions of genes encoding N-hCR are associated with a cluster of disorders that mimic ASNase therapy side-effects which include impaired glycemic control, dislipidemia, pancreatitis, compromised vascular integrity, and neurological dysfunction. This paper proposes that dysregulation of Asn homeostasis, potentially even by ASNase produced by the microbiome, may contribute to several clinically important syndromes by altering expression of N-hCR bearing genes. By altering amino acid abundance and modulating ribosome translocation rates at codon repeats, the microbiomic environment may contribute to genome decoding and to shaping the proteome. We suggest that impaired translation at poly Asn codons elevates diabetes risk and severity.
2010-07-01
... 32 National Defense 1 2010-07-01 2010-07-01 false Definition. 168a.3 Section 168a.3 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE DEFENSE CONTRACTING NATIONAL DEFENSE SCIENCE AND ENGINEERING GRADUATE FELLOWSHIPS § 168a.3 Definition. Sponsoring Agency. A DoD Component or an...
28 CFR 16.8 - Business information.
2010-07-01
... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Business information. 16.8 Section 16.8... Procedures for Disclosure of Records Under the Freedom of Information Act § 16.8 Business information. (a) In general. Business information obtained by the Department from a submitter will be disclosed under the FOIA...
21 CFR 168.111 - Dextrose monohydrate.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Dextrose monohydrate. 168.111 Section 168.111 Food... Table Sirups § 168.111 Dextrose monohydrate. (a) Dextrose monohydrate is purified and crystallized D.../mass (m/m), and the reducing sugar content (dextrose equivalent), expressed as D-glucose, is not less...
Directory of Open Access Journals (Sweden)
Hussam E Salhi
2016-12-01
Full Text Available Troponin I (TnI is a major regulator of cardiac muscle contraction and relaxation. During physiological and pathological stress, TnI is differentially phosphorylated at multiple residues through different signaling pathways to match cardiac function to demand. The combination of these TnI phosphorylations can exhibit an expected or unexpected functional integration, whereby the function of two phosphorylations are different than that predicted from the combined function of each individual phosphorylation alone. We have shown that TnI Ser-23/24 and Ser-150 phosphorylation exhibit functional integration and are simultaneously increased in response to cardiac stress. In the current study, we investigated the functional integration of TnI Ser-23/24 and Ser-150 to alter cardiac contraction. We hypothesized that Ser-23/24 and Ser-150 phosphorylation each utilize distinct molecular mechanisms to alter the TnI binding affinity within the thin filament. Mathematical modeling predicts that Ser-23/24 and Ser-150 phosphorylation affect different TnI affinities within the thin filament to distinctly alter the Ca2+-binding properties of troponin. Protein binding experiments validate this assertion by demonstrating pseudo-phosphorylated Ser-150 decreases the affinity of isolated TnI for actin, whereas Ser-23/24 pseudo-phosphorylation is not different from unphosphorylated. Thus, our data supports that TnI Ser-23/24 affects TnI-TnC binding, while Ser-150 phosphorylation alters TnI-actin binding. By measuring force development in troponin-exchanged skinned myocytes, we demonstrate that the Ca2+ sensitivity of force is directly related to the amount of phosphate present on TnI. Furthermore, we demonstrate that Ser-150 pseudo-phosphorylation blunts Ser-23/24-mediated decreased Ca2+-sensitive force development whether on the same or different TnI molecule. Therefore, TnI phosphorylations can integrate across troponins along the myofilament. These data demonstrate
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Maple sirup. 168.140 Section 168.140 Food and... § 168.140 Maple sirup. (a) Maple sirup is the liquid food derived by concentration and heat treatment of the sap of the maple tree (Acer) or by solution in water of maple sugar (mapel concrete) made from...
21 CFR 168.110 - Dextrose anhydrous.
2010-04-01
... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Dextrose anhydrous. 168.110 Section 168.110 Food... Table Sirups § 168.110 Dextrose anhydrous. (a) Dextrose anhydrous is purified and crystallized D-glucose... solids content is not less than 98.0 percent m/m. (b) The name of the food is “Dextrose anhydrous” or...
Zheng, Zhong-liang; Ye, Mao-qing; Zuo, Zhen-yu; Liu, Zhi-gang; Tai, Keng-chang; Zou, Guo-lin
2006-05-01
Hydrogen bonds occurring in the catalytic triad (Asp32, His64 and Ser221) and the oxyanion hole (Asn155) are very important to the catalysis of peptide bond hydrolysis by serine proteases. For the subtilisin NK (nattokinase), a bacterial serine protease, construction and analysis of a three-dimensional structural model suggested that several hydrogen bonds formed by four residues function to stabilize the transition state of the hydrolysis reaction. These four residues are Ser33, Asp60, Ser62 and Thr220. In order to remove the effect of these hydrogen bonds, four mutants (Ser33-->Ala33, Asp60-->Ala60, Ser62-->Ala62, and Thr220-->Ala220) were constructed by site-directed mutagenesis. The results of enzyme kinetics indicated that removal of these hydrogen bonds increases the free-energy of the transition state (DeltaDeltaG(T)). We concluded that these hydrogen bonds are more important for catalysis than for binding the substrate, because removal of these bonds mainly affects the kcat but not the K(m) values. A substrate, SUB1 (succinyl-Ala-Ala-Pro-Phe-p-nitroanilide), was used during enzyme kinetics experiments. In the present study we have also shown the results of FEP (free-energy perturbation) calculations with regard to the binding and catalysis reactions for these mutant subtilisins. The calculated difference in FEP also suggested that these four residues are more important for catalysis than binding of the substrate, and the simulated values compared well with the experimental values from enzyme kinetics. The results of MD (molecular dynamics) simulations further demonstrated that removal of these hydrogen bonds partially releases Asp32, His64 and Asn155 so that the stability of the transition state decreases. Another substrate, SUB2 (H-D-Val-Leu-Lys-p-nitroanilide), was used for FEP calculations and MD simulations.
Analysis of glyphosate residues in cereals using liquid chromatography-mass spectrometry (LC-MS/MS)
DEFF Research Database (Denmark)
Granby, Kit; Johannesen, S.; Gabrielsen, Martin Vahl
2003-01-01
A fast and specific method for the determination of glyphosate in cereals is described. The method is based on extraction with water by ultrasonication. The samples are cleaned up and separated by high-performance liquid chromatography on a polystyrene-based reverse-phase column (clean-up) in ser......A fast and specific method for the determination of glyphosate in cereals is described. The method is based on extraction with water by ultrasonication. The samples are cleaned up and separated by high-performance liquid chromatography on a polystyrene-based reverse-phase column (clean...... monitored m/z 168--> 150 (glyphosate) and 170-->152 (internal standard 2- 13 (CN)-N-15-glyphosate) for quantification. The mean recovery was 85% ( n =32) at spiking levels from 0.03 to 0.33 mg kg(-1) . From 1998 to 2001, from the analysis of about 50 samples per annum, a reduction in the glyphosate residues...... was observed owing to a Danish trade decision not to use grain with glyphosate residues for milling or bread production....
ASN report of the status of nuclear safety and radiation protection in France in 2012
International Nuclear Information System (INIS)
Chevet, Pierre-Franck; Delmestre, Alain; Bardet, Marie-Christine; Covard, Fabienne; Landrin, Sophie
2013-01-01
After a presentation of the French Nuclear Safety Authority (ASN), its missions, some key figures illustrating its activities and its organisation, this report proposes an overview of marking events and of actions undertaken by the ASN after the Fukushima accident. Then, the report proposes a detailed and commented overview of actions undertaken by the ASN in different fields and domains: nuclear activities, principles and actors of nuclear safety and radiation protection control, regulation, control of nuclear activities and of exposures to ionizing radiations, radiological and post-accidental emergency situations, public information and transparency, international relationships, regional overview of nuclear safety and radiation protection. The last part addresses activities controlled by the ASN: medical use of ionizing radiations, industrial, research and veterinary uses and source safety, transport of radioactive materials, electronuclear plants, installations related to nuclear fuel cycle, nuclear research and other nuclear installations, safety of dismantling of base nuclear installations, radioactive wastes and polluted sites
Structural insight into gene transcriptional regulation and effector binding by the Lrp/AsnC family
Thaw, P.; Sedelnikova, S.E.; Muranova, T.; Wiese, S.; Ayora, S.; Alonso, J.C.; Brinkman, A.B.; Akerboom, A.P.; Oost, van der J.; Rafferty, J.B.
2006-01-01
The Lrp/AsnC family of transcriptional regulatory proteins is found in both archaea and bacteria. Members of the family influence cellular metabolism in both a global (Lrp) and specific (AsnC) manner, often in response to exogenous amino acid effectors. In the present study we have determined both
Ito, Masahiro; Kim, Yun-Gi; Tsuji, Hirokazu; Takahashi, Takuya; Kiwaki, Mayumi; Nomoto, Koji; Danbara, Hirofumi; Okada, Nobuhiko
2014-01-01
Lactobacillus casei ATCC 27139 enhances host innate immunity, and the J1 phage-resistant mutants of this strain lose the activity. A transposon insertion mutant library of L. casei ATCC 27139 was constructed, and nine J1 phage-resistant mutants out of them were obtained. Cloning and sequencing analyses identified three independent genes that were disrupted by insertion of the transposon element: asnH, encoding asparagine synthetase, and dnaJ and dnaK, encoding the molecular chaperones DnaJ and DnaK, respectively. Using an in vivo mouse model of Listeria infection, only asnH mutant showed deficiency in their ability to enhance host innate immunity, and complementation of the mutation by introduction of the wild-type asnH in the mutant strain recovered the immuno-augmenting activity. AsnH protein exhibited asparagine synthetase activity when the lysozyme-treated cell wall extracts of L. casei ATCC 27139 was added as substrate. The asnH mutants lost the thick and rigid peptidoglycan features that are characteristic to the wild-type cells, indicating that AsnH of L. casei is involved in peptidoglycan biosynthesis. These results indicate that asnH is required for the construction of the peptidoglycan composition involved in the immune-activating capacity of L. casei ATCC 27139.
Directory of Open Access Journals (Sweden)
Masahiro Ito
Full Text Available Lactobacillus casei ATCC 27139 enhances host innate immunity, and the J1 phage-resistant mutants of this strain lose the activity. A transposon insertion mutant library of L. casei ATCC 27139 was constructed, and nine J1 phage-resistant mutants out of them were obtained. Cloning and sequencing analyses identified three independent genes that were disrupted by insertion of the transposon element: asnH, encoding asparagine synthetase, and dnaJ and dnaK, encoding the molecular chaperones DnaJ and DnaK, respectively. Using an in vivo mouse model of Listeria infection, only asnH mutant showed deficiency in their ability to enhance host innate immunity, and complementation of the mutation by introduction of the wild-type asnH in the mutant strain recovered the immuno-augmenting activity. AsnH protein exhibited asparagine synthetase activity when the lysozyme-treated cell wall extracts of L. casei ATCC 27139 was added as substrate. The asnH mutants lost the thick and rigid peptidoglycan features that are characteristic to the wild-type cells, indicating that AsnH of L. casei is involved in peptidoglycan biosynthesis. These results indicate that asnH is required for the construction of the peptidoglycan composition involved in the immune-activating capacity of L. casei ATCC 27139.
How a regulator is preparing for reviewing a license application file: The case of ASN
International Nuclear Information System (INIS)
Tanguy, Loic
2014-01-01
The French Nuclear Safety Authority (ASN) is an independent administrative authority. It prepares regulation pertaining to the management of radioactive waste, monitors the control of safety of basic nuclear installations that produce or treat waste or are involved in their disposal and performs inspections of waste producers (EDF, AREVA, CEA, hospitals, research centres, etc.) and Andra, the French National Radioactive Waste Management Agency. It regulates the overall system set up by Andra for accepting waste from producers and assesses waste management policy and the practices of radioactive waste producers. It reviews license applications and authorises commissioning of nuclear installations. In order to review technical documents, ASN benefits from the expertise of technical support organisations. The French Institute for Radiation Protection and Nuclear Safety (IRSN) is the main such organisation. ASN has been making efforts to diversify its experts for several years. In preparing its decisions, ASN also calls on the opinions and recommendations of seven Advisory Committees of Experts (GPE), with expert knowledge in the areas of waste, nuclear pressure equipment, medical exposure, non-medical radiation protection, reactors, transport, and laboratories and nuclear plants. ASN consults the GPEs in preparing its main decisions. In particular, they review the preliminary, provisional and final safety analysis reports for each nuclear installation. They can also be consulted about changes in regulations or doctrine. (authors)
7 CFR 3015.168 - Disposal of equipment.
2010-01-01
..., DEPARTMENT OF AGRICULTURE UNIFORM FEDERAL ASSISTANCE REGULATIONS Property § 3015.168 Disposal of equipment. When original or replacement equipment is no longer to be used in projects or programs currently or... 7 Agriculture 15 2010-01-01 2010-01-01 false Disposal of equipment. 3015.168 Section 3015.168...
32 CFR 644.168 - Exercise of options.
2010-07-01
... 32 National Defense 4 2010-07-01 2010-07-01 true Exercise of options. 644.168 Section 644.168... ESTATE HANDBOOK Acquisition Procurement of Options Prior to Real Estate Directives (military) § 644.168 Exercise of options. Upon issuance of a real estate directive for acquisition of the optioned real property...
Prognostic impact of CD168 expression in gastric cancer
International Nuclear Information System (INIS)
Ishigami, Sumiya; Yoshiaki, Kita; Kijima, Yuko; Kitazono, Masaki; Natsugoe, Shoji; Ueno, Shinichi; Nishizono, Yuka; Matsumoto, Masataka; Kurahara, Hiroshi; Arigami, Takaaki; Uchikado, Yasuto; Setoyama, Tetsuro; Arima, Hideo
2011-01-01
Interactions of stromal hyaluronic acid (HA) with its binding protein RHAMM (receptor for HA-mediated motility) (CD168) have been reported to affect tumor extension and the migration of crucial molecules to promote tumor progression and metastases. Cancerous CD168 expression is correlated with aggressive biological features in several cancers. However, the clinical implications of CD168 positivity in gastric cancer have remained unclear. We examined the CD168 expression of 196 consecutive gastric cancer patients by immunohistochemistry. According to CD168 positivity, the 196 gastric cancer patients were divided into two groups (57 CD168-positive and 139 CD168-negative patients). The correlation between CD168 expression and clinicopathological factors (age, sex, histology, tumor depth, lymph node status, and vessel invasion) was evaluated according to the Japanese Classification of Gastric Carcinoma. Cancerous CD168 expression was detectable in 57 of the 196 tumors (29%). CD168 positivity was significantly correlated with the depth of invasion, nodal involvement, and vessel invasion (p < 0.01). Survival analysis of the 196 gastric cancer patients showed that the CD168-positive group had a significantly higher mortality than the CD168-negative group (p < 0.01). In terms of a correlation with CD168 positivity at separate clinical stages, a significance difference was only found in stages II and III. Multivariate analysis revealed that CD168 expression was a significant independent prognostic marker (p = 0.013) after depth of invasion (p < 0.005) and nodal involvement (p < 0.01). Our results suggest that cancerous CD168 positivity is strongly related to the invasion and metastasis of gastric cancer tumors. These results suggest that cancerous CD168 expression can be used as a prognostic marker of gastric cancer owing to its interactions with stromal hyaluronic acid
Study of pyruvate decarboxylase and thiamine kinase from brewer's yeast by SERS
Maskevich, Sergei A.; Chernikevich, Ivan P.; Gachko, Gennedy A.; Kivach, Leonid N.; Strekal, Nataliya D.
1993-06-01
The Surface Enhanced Raman Scattering (SERS) spectra of holopyruvate decarboxylase (PDC) and thiamine kinase (ThK) adsorbed on silver electrode were obtained. In contrast to the Raman, the SERS spectrum of PDC contained no modes of tryptophan residues, it indicates a removal of this moiety from the surface. In the SERS spectrum of ThK the bands belonging to ligands bound to the protein were observed. A correlation between the SERS signal intensity and the enzymatic activity of the ThK separate fraction and found. The influence of amino acids on SERS spectra of thiamine (Th) was studied to determine the possible composition on microsurrounding of coenzyme.
10 CFR 26.168 - Blind performance testing.
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Blind performance testing. 26.168 Section 26.168 Energy... and Human Services § 26.168 Blind performance testing. (a) Each licensee and other entity shall submit blind performance test samples to the HHS-certified laboratory. (1) During the initial 90-day period of...
About octupole states in the 158Dy and the 168Er nuclei
International Nuclear Information System (INIS)
Kvasil, Ya.; Chariev, M.M.; Choriev, B.
1984-01-01
The properties of negative parity low-lying states in 158 Dy and 168 Er in the random phase approximation based on the cranking model are investigated. Octupole-octupole forces have been used as a residual interaction. Calculated energy levels are compared with the experimental ones, and also with the energy values obtained with making allowance for dipole-dipole, octupole-octupole and dipole-octupole type forces. The resuits of calculation by the used model permit to understand the nature of negative parity low-lying states
Management of long-lived radioactive waste: stakes and ASN actions
International Nuclear Information System (INIS)
Dandrieux, G.
2011-01-01
Due to the length of time it takes to decay, long-lived radioactive waste will remain a hazard on a timescale beyond the length of a human life, and even of several generations. In the case of this waste, long-term management solutions must be implemented to protect human health and the environment without requiring human intervention. In accordance with requirements under the Law, ANDRA (national agency for the management of radioactive waste) is carrying out research on disposal solutions in deep or subsurface geological formations. Nonetheless, until such repositories become available, ASN (authority for nuclear safety) has a duty to ensure safety at current and future interim storage facilities, as well as the safety of operations to retrieve and package this type of waste. To this end, ASN acts on several levels: it is involved in drawing up regulations and reference texts, at national and international level, it examines safety analysis reports related to radioactive waste management at basic nuclear installations, by means of inspections that it performs at every step in radioactive waste management. In its capacity as joint coordinator of the national plan for the management of nuclear waste and materials (PNGMDR) working group, ASN also plays a very active role in drawing up the provisions of the PNGMDR aimed at improving and optimising radioactive waste management. (author)
Genetic and clinical predictors of ovarian response in assisted reproductive technology
Wiweko, B.; Damayanti, I.; Suryandari, D.; Natadisastra, M.; Pratama, G.; Sumapraja, K.; Meutia, K.; Iffanolia, P.; Harzief, A. K.; Hestiantoro, A.
2017-08-01
Several factors are known to influence ovarian response to rFSH stimulation such as age, antral follicle count (AFC), and basal FSH level, Mutation of allele Ser680Asn in FSHR gene was responsible to ovarian resistance toward exogenous FSH. The aim of this study is to develop a prediction model of ovarian response to COS in IVF. This study was a prospective cohort study. One hundred and thirteen women undergoing their first cycle of IVF in Yasmin IVF Clinic Jakarta were recruited to this study. Clinical datas included were age, BMI, and AFC. Basal FSH and E2 as well as serum AMH was measured from peripheral blood taken at second day of cycle. Bsr-1 enzyme is used to identify the polymorphism in exon 10 position 680 with RFLP technique. Three genotype polymorphism, Asn/Asn (255 bp ribbon), Asn/Ser (97 bp and 158 bp), and Ser/Ser (97 bp, 158 bp, and 255 bp). AFC has the highest predictor for ovarian response with AUC 0.922 (CI 95% 0.833-1.000). AMH also showed high predicting value (AUC 0.843 CI 95% 0.663-1.000). The multivariate analysis revealed combination of AFC, AMH, age, and basal FSH is a good model for ovarian response prediction (AUC=0.97). No significant relation between Asn/Asn, Asn/Ser, or Ser/Ser genotype FSHR polymorphism with ovarian response (p = 0.866) and total dose of rRSH (p = 0.08). This study showed that model combination of AFC, AMH, patient’s age and basal FSH are very good to predict number of mature oocytes.
46 CFR 168.15-35 - Hospital space.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Hospital space. 168.15-35 Section 168.15-35 Shipping... VESSELS Accommodations § 168.15-35 Hospital space. (a) Each vessel must be provided with a hospital space. This space must be situated with due regard for the comfort of the sick so that they may receive proper...
CAREM-25: Residual heat removal system
International Nuclear Information System (INIS)
Arvia, Roberto P.; Coppari, Norberto R.; Gomez de Soler, Susana M.; Ramilo, Lucia B.
2000-01-01
The objective of this work was the definition and consolidation of the residual heat removal system for the CAREM 25 reactor. The function of this system is cool down the primary circuit, removing the core decay heat from hot stand-by to cold shutdown and during refueling. In addition, this system heats the primary water from the cold shutdown condition to hot stand-by condition during the reactor start up previous to criticality. The system has been designed according to the requirements of the standards: ANSI/ANS 51.1 'Nuclear safety criteria for the design of stationary PWR plants'; ANSI/ANS 58.11 'Design criteria for safe shutdown following selected design basis events in light water reactors' and ANSI/ANS 58.9 'Single failure criteria for light water reactor safety-related fluid systems'. The suggested design fulfills the required functions and design criteria standards. (author)
On-line experience with the 168/E
International Nuclear Information System (INIS)
Carroll, J.T.; Brau, J.E.; Maruyama, T.; Parker, D.B.; Chima, J.S.; Price, D.R.; Rankin, P.; Hatley, R.W.
1981-04-01
Current 20 GeV/c photoproduction experiments at the SLAC Hybrid Facility require a decision to take a picture within 150 to 300 μs after the beam pulse. A charged track trigger is provided by a 168/E processor which finds tracks in a downstream PWC system. To meet trigger time requirements the 168/E SNOOP module CAMAC interface is augmented by a CAMAD Auxiliary Controller and dedicated I/0 cards in the 168/E chassis. Between beam pulses a floating point Fortran program executing on a 168/E monitors data acquisition. Experiences with software development and application are reviewed
Assessment of ASN inspections apart from BNI (Greater South West)
International Nuclear Information System (INIS)
Menechal, Ph.
2008-01-01
After having recalled recent evolutions of the ASN's organization (the French nuclear safety authority) and its basic missions (regulation elaboration, decisions, control of nuclear activities and installations, public information), the author presents the Bordeaux ASN's department which is in charge of the south-western part of France. He indicates and comments some data illustrating the performed actions and missions. He describes the objectives and procedures of inspection which may depend on the activity (external radiotherapy, interventional radiology, research laboratories). He assesses theses inspections in terms of radioprotection organization, of risk assessment and of definition of regulated areas, of personnel classification and dosimetric follow-on, of training of exposed personnel, of medical follow-on, of radioprotection control, of training of patients to radioprotection, of source management, and of waste and effluent management
DEFF Research Database (Denmark)
Madec, Edwige; Stensballe, Allan; Kjellström, Sven
2003-01-01
We have shown recently that PrkC, which is involved in developmental processes in Bacillus subtilis, is a Ser/Thr kinase with features of the receptor kinase family of eukaryotic Hanks kinases. In this study, we expressed and purified from Escherichia coli the cytoplasmic domain of PrkC containing...... the kinase and a short juxtamembrane region. This fragment, which we designate PrkCc, undergoes autophosphorylation in E.coli. PrkCc is further autophosphorylated in vitro, apparently through a trans-kinase, intermolecular reaction. PrkC also displays kinase activity with myelin basic protein. Using high...... mass accuracy electrospray tandem mass spectrometry (LC-MS/MS) and nanoelectrospray tandem mass spectrometry, we identified seven phosphorylated threonine and one serine residue in PrkCc. All the corresponding residues were replaced by systematic site-directed mutagenesis and the purified mutant...
Polymorphisms in XPD (Asp312Asn and Lys751Gln) genes, sunburn and arsenic-related skin lesions.
McCarty, Kathleen M; Smith, Thomas J; Zhou, Wei; Gonzalez, Ernesto; Quamruzzaman, Quazzi; Rahman, Mahmuder; Mahiuddin, Golam; Ryan, Louise; Su, Li; Christiani, David C
2007-08-01
Single-nucleotide polymorphisms in genes related to DNA repair capacity and ultraviolet exposure have not been well investigated in relation to skin lesions associated with arsenic exposure. This population based case-control study, of 600 cases and 600 controls, frequency matched on age and gender in Pabna, Bangladesh, in 2001-2002, investigated the association and potential effect modification between polymorphisms in Xeroderma Pigmentosum complementation group D (XPD) (Lys751Gln and Asp312Asn) genes, tendency to sunburn and arsenic-related skin lesions. Unconditional logistic regression was used to estimate odds ratios (ORs) and 95% confidence intervals (CIs). No significant association was observed between skin lesions and the XPD 312 Asp/Asn (adjusted OR = 0.87, 95% CI = 0.65-1.15) Asn/Asn (adjusted OR = 0.76, 95% CI = 0.50-1.15) (referent Asp/Asp); XPD 751 Lys/Gln (adjusted OR = 0.92, 95% CI = 0.69-1.23) Gln/Gln (adjusted OR = 0.98, 95% CI = 0.66-1.45) (referent Lys/Lys). While we did not observe any evidence of effect modification of these polymorphisms on the association between well arsenic concentration and skin lesions, we did observe effect modification between these polymorphisms and sunburn tendency and arsenic-related skin lesions. Individuals with the heterozygote or homozygote variant forms (Asp/Asn or Asn/Asn) had half the risk of skin lesions (OR = 0.45, 95% CI = 0.29-0.68) compared with those with the wild-type XPDAsp312Asn genotype (Asp/Asp) and individuals with heterozygote or homozygote variant forms (Lys/Gln or Gln/Gln) had half the risk of skin lesions (OR = 0.47, 95% CI = 0.31-0.72) compared with those with the wild-type XPDLys751Gln genotype (Lys/Lys), within the least sensitive strata of sunburn severity. We observed effect modification on the multiplicative scale for XPD 751 and XPD 312. XPD polymorphisms modified the relationship between tendency to sunburn and skin lesions in an arsenic exposed population. Further study is necessary
42 CFR 423.168 - Accreditation organizations.
2010-10-01
... 42 Public Health 3 2010-10-01 2010-10-01 false Accreditation organizations. 423.168 Section 423.168 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICARE PROGRAM VOLUNTARY MEDICARE PRESCRIPTION DRUG BENEFIT Cost Control and Quality...
40 CFR 68.168 - Five-year accident history.
2010-07-01
... 40 Protection of Environment 15 2010-07-01 2010-07-01 false Five-year accident history. 68.168 Section 68.168 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CHEMICAL ACCIDENT PREVENTION PROVISIONS Risk Management Plan § 68.168 Five-year accident history...
7 CFR 987.168 - Handler records.
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Handler records. 987.168 Section 987.168 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... weight and destination or name and address of the person to whom each shipment was sent; (c) If different...
Lanucara, Francesco; Lam, Connie; Mann, Jelena; Monie, Tom P; Colombo, Stefano A P; Holman, Stephen W; Boyd, James; Dange, Manohar C; Mann, Derek A; White, Michael R H; Eyers, Claire E
2016-07-01
The NF-κB signalling module controls transcription through a network of protein kinases such as the IKKs, as well as inhibitory proteins (IκBs) and transcription factors including RelA/p65. Phosphorylation of the NF-κB subunits is critical for dictating system dynamics. Using both non-targeted discovery and quantitative selected reaction monitoring-targeted proteomics, we show that the cytokine TNFα induces dynamic multisite phosphorylation of RelA at a number of previously unidentified residues. Putative roles for many of these phosphorylation sites on RelA were predicted by modelling of various crystal structures. Stoichiometry of phosphorylation determination of Ser45 and Ser42 revealed preferential early phosphorylation of Ser45 in response to TNFα. Quantitative analyses subsequently confirmed differential roles for pSer42 and pSer45 in promoter-specific DNA binding and a role for both of these phosphosites in regulating transcription from the IL-6 promoter. These temporal dynamics suggest that RelA-mediated transcription is likely to be controlled by functionally distinct NF-κB proteoforms carrying different combinations of modifications, rather than a simple 'one modification, one effect' system. © 2016 The Authors.
46 CFR 168.15-45 - Heating and cooling.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Heating and cooling. 168.15-45 Section 168.15-45 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS CIVILIAN NAUTICAL SCHOOL VESSELS Accommodations § 168.15-45 Heating and cooling. All quarters must be adequately heated and cooled...
46 CFR 168.10-5 - Civilian nautical school.
2010-10-01
... 46 Shipping 7 2010-10-01 2010-10-01 false Civilian nautical school. 168.10-5 Section 168.10-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS CIVILIAN NAUTICAL SCHOOL VESSELS Definitions of Terms Used in This Part § 168.10-5 Civilian nautical school. The term civilian...
Bonin, Patrick; Méot, Alain; Ferrand, Ludovic; Bugaïska, Aurélia
2015-09-01
We collected sensory experience ratings (SERs) for 1,659 French words in adults. Sensory experience for words is a recently introduced variable that corresponds to the degree to which words elicit sensory and perceptual experiences (Juhasz & Yap Behavior Research Methods, 45, 160-168, 2013; Juhasz, Yap, Dicke, Taylor, & Gullick Quarterly Journal of Experimental Psychology, 64, 1683-1691, 2011). The relationships of the sensory experience norms with other psycholinguistic variables (e.g., imageability and age of acquisition) were analyzed. We also investigated the degree to which SER predicted performance in visual word recognition tasks (lexical decision, word naming, and progressive demasking). The analyses indicated that SER reliably predicted response times in lexical decision, but not in word naming or progressive demasking. The findings are discussed in relation to the status of SER, the role of semantic code activation in visual word recognition, and the embodied view of cognition.
A green, reusable SERS film with high sensitivity for in-situ detection of thiram in apple juice
Sun, Hongbao; Liu, Hai; Wu, Yiyong
2017-09-01
We report a green and reusable surface-enhanced Raman scattering (SERS) film based on PMMA/Ag NPs/graphene. By using this Raman substrate, the SERS signals of R6G were significantly enhanced reaching a minimum detectable concentration of 5 × 10-8 M, due to having lots of hot spots adhered backside to the exposed graphene. The SERS film can be used for in-situ monitoring of trace thiram in apple juice with a detection limit of 1 × 10-6 M (0.24 ppm), which is below the maximal residue limit (MRL) of 7 ppm in fruit prescribed by the U.S. Environmental Protection Agency (EPA). Furthermore, reusability studies show that the SERS film can be used repeatedly. In addition, the graphene-enhanced SERS technique shows great potential applications for the in-situ detection and identification of pesticide residues in environmental water, fruits and vegetables.
2010-01-01
... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Small issues. 16.8 Section 16.8 Banks and....8 Small issues. (a) The OCC will deem offers and sales of bank issued securities that satisfy the requirements of Commission Regulation A (17 CFR part 230, Regulation A—Conditional Small Issues Exemption) to...
Using the MMPI 168 with Medical Inpatients
Erickson, Richard C.; Freeman, Charles
1976-01-01
Explores the potential utility of the MMPI 168 with two inpatient medical populations. Correlations and clinically relevant comparisons suggest that the MMPI 168 predicted the standard MMPI with a high degree accuracy. (Editor/RK)
"Minulost je bitevním polem současníků". Konference k osmdesátinám Viléma Prečana
Czech Academy of Sciences Publication Activity Database
Hoppe, Jiří
2013-01-01
Roč. 20, 1/2 (2013), s. 236-241 ISSN 1210-7050. ["Minulost je bitevním polem současníků". Konference k osmdesátinám Viléma Prečana. Praha, 24.01.2013-25.01.2013] Institutional support: RVO:68378114 Keywords : Vilém Prečan Subject RIV: AB - History
Fonseca, Fátima; Chudyk, Ewa I; van der Kamp, Marc W; Correia, António; Mulholland, Adrian J; Spencer, James
2012-11-07
Carbapenems are the most potent β-lactam antibiotics and key drugs for treating infections by Gram-negative bacteria. In such organisms, β-lactam resistance arises principally from β-lactamase production. Although carbapenems escape the activity of most β-lactamases, due in the class A enzymes to slow deacylation of the covalent acylenzyme intermediate, carbapenem-hydrolyzing class A β-lactamases are now disseminating in clinically relevant bacteria. The reasons why carbapenems are substrates for these enzymes, but inhibit other class A β-lactamases, remain to be fully established. Here, we present crystal structures of the class A carbapenemase SFC-1 from Serratia fonticola and of complexes of its Ser70 Ala (Michaelis) and Glu166 Ala (acylenzyme) mutants with the carbapenem meropenem. These are the first crystal structures of carbapenem complexes of a class A carbapenemase. Our data reveal that, in the SFC-1 acylenzyme complex, the meropenem 6α-1R-hydroxyethyl group interacts with Asn132, but not with the deacylating water molecule. Molecular dynamics simulations indicate that this mode of binding occurs in both the Michaelis and acylenzyme complexes of wild-type SFC-1. In carbapenem-inhibited class A β-lactamases, it is proposed that the deacylating water molecule is deactivated by interaction with the carbapenem 6α-1R-hydroxyethyl substituent. Structural comparisons with such enzymes suggest that in SFC-1 subtle repositioning of key residues (Ser70, Ser130, Asn132 and Asn170) enlarges the active site, permitting rotation of the carbapenem 6α-1R-hydroxyethyl group and abolishing this contact. Our data show that SFC-1, and by implication other such carbapenem-hydrolyzing enzymes, uses Asn132 to orient bound carbapenems for efficient deacylation and prevent their interaction with the deacylating water molecule.
Li, Jiang-Hua; Huang, Wan; Lin, Peng; Wu, Bo; Fu, Zhi-Guang; Shen, Hao-Miao; Jing, Lin; Liu, Zhen-Yu; Zhou, Yang; Meng, Yao; Xu, Bao-Qing; Chen, Zhi-Nan; Jiang, Jian-Li
2016-11-21
Cluster of differentiation 147 (CD147), also known as extracellular matrix metalloproteinase inducer, is a transmembrane glycoprotein that mediates oncogenic processes partly through N-glycosylation modifications. N-glycosylation has been demonstrated to be instrumental for the regulation of CD147 function during malignant transformation. However, the role that site-specific glycosylation of CD147 plays in its defective function in hepatocellular carcinomacells needs to be determined. Here, we demonstrate that the modification of N-glycosylation at Asn152 on CD147 strongly promotes hepatocellular carcinoma (HCC) invasion and migration. After the removal of N-glycans at Asn152, CD147 was more susceptible to degradation by ER-localized ubiquitin ligase-mediated endoplasmic reticulum-associated degradation (ERAD). Furthermore, N-linked glycans at Asn152 were required for CD147 to acquire and maintain proper folding in the ER. Moreover, N-linked glycans at Asn152 functioned as a recognition motif that was directly mediated by the CNX quality control system. Two phases in the retention-based ER chaperones system drove ER-localized CD147 trafficking to degradation. Deletion of N-linked glycosylation at Asn152 on CD147 significantly suppressed in situ tumour metastasis. These data could potentially shed light on the molecular regulation of CD147 through glycosylation and provide a valuable means of developing drugs that target N-glycans at Asn152 on CD147.
Pyreu, D. F.; Gridchin, S. N.
2018-05-01
The formation of mixed-ligand complexes in the M(II)-Nta, Ida-L (M = Cu(II), Ni, Zn, Co(II), L = Ser, Thr, Asp, Arg, Asn) systems, where Ida and Nta are the residues of iminodiacetic and nitrilotriacetic acids, respectively, is studied using pH measurements, calorimetry and spectrophotometry. The thermodynamic parameters (log K, Δr G 0, Δr H, Δr S) of their formation at 298.15 K and ionic strength I = 0.5 (KNO3) are determined. The most likely scenario of amino acid residue coordination in the composition of mixed complexes is discussed.
Energy Technology Data Exchange (ETDEWEB)
Rennex, D.; Hemmings, B.A.; Hofsteenge, J.; Stone, S.R. (Friedrich Miescher-Institut, Basel (Switzerland))
1991-02-26
Prolyl endopeptidase is a cytoplasmic serine protease. The enzyme was purified from porcine kidney, and oligonucleotides based on peptide sequences from this protein were used to isolate a cDNA clone from a porcine brain library. This clone contained the complete coding sequence of prolyl endopeptidase and encoded a polypeptide with a molecular mass of 80751 Da. The deduced amino acid sequence of prolyl endopeptidase showed no sequence homology with other known serine proteases. ({sup 3}H)Diisopropyl fluorophosphate was used to identify the active-site serine of prolyl endopeptidase. One labeled peptide was isolated and sequenced. The sequence surrounding the active-site serine was Asn-Gly-Gly-Ser-Asn-Gly-Gly. This sequence is different from the active-site sequences of other known serine proteases. This difference and the lack of overall homology with the known families of serine proteases suggest that prolyl endopeptidase represents a new type of serine protease.
Energy Technology Data Exchange (ETDEWEB)
Doan,L.; Martucci, W.; Vargo, M.; Atreya, C.; Anderson, K.
2007-01-01
Cryptosporidium hominis TS-DHFR exhibits an unusually high rate of catalysis at the TS domain, at least 10-fold greater than those of other TS enzymes. Using site-directed mutagenesis, we have mutated residues Ala287 and Ser290 in the folate-binding helix to phenylalanine and glycine, respectively, the corresponding residues in human and most other TS enzymes. Our results show that the mutant A287F, the mutant S290G, and the double mutant all have reduced affinities for methylene tetrahydrofolate and reduced rates of reaction at the TS domain. Interestingly, the S290G mutant enzyme had the lowest TS activity, with a catalytic efficiency {approx}200-fold lower than that of the wild type (WT). The rate of conformational change of the S290G mutant is {approx}80 times slower than that of WT, resulting in a change in the rate-limiting step from hydride transfer to covalent ternary complex formation. We have determined the crystal structure of ligand-bound S290G mutant enzyme, which shows that the primary effect of the mutation is an increase in the distance between the TS ligands. The kinetic and crystal structure data presented here provide the first evidence explaining the unusually fast TS rate in C. hominis.
Does the MMPI-168 exaggerate psychotic pathology?
Dingemans, P. M.; Wekking, E. M.
1996-01-01
Three scoring versions of the MMPI, scored on the same protocol, were compared in a multivariate design with 198 psychiatric patients. The MMPI-168 schizophrenia scale had a statistically higher elevation than the Dutch and American scoring versions. This makes MMPI-168 profiles more often
Cyclization of the N-Terminal X-Asn-Gly Motif during Sample Preparation for Bottom-Up Proteomics
DEFF Research Database (Denmark)
Zhang, Xumin; Højrup, Peter
2010-01-01
We, herein, report a novel -17 Da peptide modification corresponding to an N-terminal cyclization of peptides possessing the N-terminal motif of X-Asn-Gly. The cyclization occurs spontaneously during sample preparation for bottom-up proteomics studies. Distinct from the two well-known N-terminal ......We, herein, report a novel -17 Da peptide modification corresponding to an N-terminal cyclization of peptides possessing the N-terminal motif of X-Asn-Gly. The cyclization occurs spontaneously during sample preparation for bottom-up proteomics studies. Distinct from the two well-known N......-terminal cyclizations, cyclization of N-terminal glutamine and S-carbamoylmethylcysteine, it is dependent on pH instead of [NH(4)(+)]. The data set from our recent study on large-scale N(α)-modified peptides revealed a sequence requirement for the cyclization event similar to the well-known deamidation of Asn to iso...
International Nuclear Information System (INIS)
2010-01-01
This document brings together all the tools for the management of a significant event in radiation protection concerning a patient in radiotherapy. It contains the declaration form, a model for the reporting of significant events, and the ASN-SFRO scale which allows the event to be rated. After a presentation of the regulatory context and references, of the scope of application, this guide addresses the declaration of a significant event: general principles, definition of the 2.1 criterion, examples, delays and modalities of declaration, addressees of a declaration. It addresses the reporting of a significant event: general principles, sending delays and modalities. It addresses the rating on the ASN-SFRO scale: general principles, scale, and rating process. The last part deals with public information
International Nuclear Information System (INIS)
2015-01-01
This document is an update of the previous version from October 2010. It brings together all the tools for the management of a significant event in radiation protection concerning a patient in radiotherapy. It contains the declaration form, a model for the reporting of significant events, and the ASN-SFRO scale which allows the event to be rated. After a presentation of the regulatory context and references, of the scope of application, this guide addresses the declaration of a significant event: general principles, definition of the 2.1 criterion, examples, delays and modalities of declaration, addressees of a declaration. It addresses the reporting of a significant event: general principles, sending delays and modalities. It addresses the rating on the ASN-SFRO scale: general principles, scale, and rating process. The last part deals with public information
Contribution of cutinase serine 42 side chain to the stabilization of the oxyanion transition state.
Nicolas, A; Egmond, M; Verrips, C T; de Vlieg, J; Longhi, S; Cambillau, C; Martinez, C
1996-01-16
Cutinase from the fungus Fusarium solani pisi is a lipolytic enzyme able to hydrolyze both aggregated and soluble substrates. It therefore provides a powerful tool for probing the mechanisms underlying lipid hydrolysis. Lipolytic enzymes have a catalytic machinery similar to those present in serine proteinases. It is characterized by the triad Ser, His, and Asp (Glu) residues, by an oxyanion binding site that stabilizes the transition state via hydrogen bonds with two main chain amide groups, and possibly by other determinants. It has been suggested on the basis of a covalently bond inhibitor that the cutinase oxyanion hole may consist not only of two main chain amide groups but also of the Ser42 O gamma side chain. Among the esterases and the serine and the cysteine proteases, only Streptomyces scabies esterase, subtilisin, and papain, respectively, have a side chain residue which is involved in the oxyanion hole formation. The position of the cutinase Ser42 side chain is structurally conserved in Rhizomucor miehei lipase with Ser82 O gamma, in Rhizopus delemar lipase with Thr83 O gamma 1, and in Candida antartica B lipase with Thr40 O gamma 1. To evaluate the increase in the tetrahedral intermediate stability provided by Ser42 O gamma, we mutated Ser42 into Ala. Furthermore, since the proper orientation of Ser42 O gamma is directed by Asn84, we mutated Asn84 into Ala, Leu, Asp, and Trp, respectively, to investigate the contribution of this indirect interaction to the stabilization of the oxyanion hole. The S42A mutation resulted in a drastic decrease in the activity (450-fold) without significantly perturbing the three-dimensional structure. The N84A and N84L mutations had milder kinetic effects and did not disrupt the structure of the active site, whereas the N84W and N84D mutations abolished the enzymatic activity due to drastic steric and electrostatic effects, respectively.
Redox-active tyrosine residue in the microcin J25 molecule
International Nuclear Information System (INIS)
Chalon, Miriam C.; Wilke, Natalia; Pedersen, Jens; Rufini, Stefano; Morero, Roberto D.; Cortez, Leonardo; Chehin, Rosana N.; Farias, Ricardo N.; Vincent, Paula A.
2011-01-01
Research highlights: → Cyclic voltammetry measurements showed irreversible oxidation of MccJ25 and MccJ25 (Y9F). → Infrared spectroscopy studies showed that only Tyr9 could be deprotonated upon chemical oxidation. → Formation of a long-lived tyrosyl radical in the native MccJ25 oxidized by H 2 O 2 was demonstrated. → Tyr9 but not Tyr20 can be easily oxidized and form a tyrosyl radical. -- Abstract: Microcin J25 (MccJ25) is a 21 amino acid lasso-peptide antibiotic produced by Escherichia coli and composed of an 8-residues ring and a terminal 'tail' passing through the ring. We have previously reported two cellular targets for this antibiotic, bacterial RNA polymerase and the membrane respiratory chain, and shown that Tyr9 is essential for the effect on the membrane respiratory chain which leads to superoxide overproduction. In the present paper we investigated the redox behavior of MccJ25 and the mutant MccJ25 (Y9F). Cyclic voltammetry measurements showed irreversible oxidation of both Tyr9 and Tyr20 in MccJ25, but infrared spectroscopy studies demonstrated that only Tyr9 could be deprotonated upon chemical oxidation in solution. Formation of a long-lived tyrosyl radical in the native MccJ25 oxidized by H 2 O 2 was demonstrated by Electron Paramagnetic Resonance Spectroscopy; this radical was not detected when the reaction was carried out with the MccJ25 (Y9F) mutant. These results show that the essential Tyr9, but not Tyr20, can be easily oxidized and form a tyrosyl radical.
Redox-active tyrosine residue in the microcin J25 molecule
Energy Technology Data Exchange (ETDEWEB)
Chalon, Miriam C. [Departamento de Bioquimica de la Nutricion, Instituto Superior de Investigaciones Biologicas (Consejo Nacional de Investigaciones Cientificas y Tecnicas-Universidad Nacional de Tucuman) and Instituto de Quimica Biologica ' Dr Bernabe Bloj' , Chacabuco 461, 4000 San Miguel de Tucuman, Tucuman (Argentina); Wilke, Natalia [CIQUIBIC, Dpto. de Quimica Biologica, Facultad de Ciencias Quimicas, Universidad Nacional de Cordoba, Pabellon Argentina, Ciudad Universitaria, X5000HUA, Cordoba (Argentina); Pedersen, Jens; Rufini, Stefano [Department of Biology, University of Rome Tor Vergata 00133, Rome (Italy); Morero, Roberto D.; Cortez, Leonardo; Chehin, Rosana N.; Farias, Ricardo N. [Departamento de Bioquimica de la Nutricion, Instituto Superior de Investigaciones Biologicas (Consejo Nacional de Investigaciones Cientificas y Tecnicas-Universidad Nacional de Tucuman) and Instituto de Quimica Biologica ' Dr Bernabe Bloj' , Chacabuco 461, 4000 San Miguel de Tucuman, Tucuman (Argentina); Vincent, Paula A., E-mail: pvincent@fbqf.unt.edu.ar [Departamento de Bioquimica de la Nutricion, Instituto Superior de Investigaciones Biologicas (Consejo Nacional de Investigaciones Cientificas y Tecnicas-Universidad Nacional de Tucuman) and Instituto de Quimica Biologica ' Dr Bernabe Bloj' , Chacabuco 461, 4000 San Miguel de Tucuman, Tucuman (Argentina)
2011-03-18
Research highlights: {yields} Cyclic voltammetry measurements showed irreversible oxidation of MccJ25 and MccJ25 (Y9F). {yields} Infrared spectroscopy studies showed that only Tyr9 could be deprotonated upon chemical oxidation. {yields} Formation of a long-lived tyrosyl radical in the native MccJ25 oxidized by H{sub 2}O{sub 2} was demonstrated. {yields} Tyr9 but not Tyr20 can be easily oxidized and form a tyrosyl radical. -- Abstract: Microcin J25 (MccJ25) is a 21 amino acid lasso-peptide antibiotic produced by Escherichia coli and composed of an 8-residues ring and a terminal 'tail' passing through the ring. We have previously reported two cellular targets for this antibiotic, bacterial RNA polymerase and the membrane respiratory chain, and shown that Tyr9 is essential for the effect on the membrane respiratory chain which leads to superoxide overproduction. In the present paper we investigated the redox behavior of MccJ25 and the mutant MccJ25 (Y9F). Cyclic voltammetry measurements showed irreversible oxidation of both Tyr9 and Tyr20 in MccJ25, but infrared spectroscopy studies demonstrated that only Tyr9 could be deprotonated upon chemical oxidation in solution. Formation of a long-lived tyrosyl radical in the native MccJ25 oxidized by H{sub 2}O{sub 2} was demonstrated by Electron Paramagnetic Resonance Spectroscopy; this radical was not detected when the reaction was carried out with the MccJ25 (Y9F) mutant. These results show that the essential Tyr9, but not Tyr20, can be easily oxidized and form a tyrosyl radical.
DEFF Research Database (Denmark)
Mayer, J.; Buegger, F.; Jensen, E.S.
2004-01-01
The turnover of N derived from rhizodeposition of faba bean (Vicia faba L.), pea (Pisum sativum L.) and white lupin (Lupinus albus L.) and the effects of the rhizodeposition on the subsequent C and N turnover of its crop residues were investigated in an incubation experiment (168 days, 15 degrees....... In the experiment the turnover of C and N was compared in soils with and without previous growth of three legumes and with and without incorporation of crop residues. After 168 days, 21% (lupin), 26% (faba bean) and 27% (pea) of rhizodeposition N was mineralised in the treatments without crop residues. A smaller...... amount of 15-17% was present as microbial biomass and between 30 and 55% of mineralised rhizodeposition N was present as microbial residue pool, which consists of microbial exoenzymes, mucous substances and dead microbial biomass. The effect of rhizodeposition on the C and N turnover of crop residues...
Directory of Open Access Journals (Sweden)
Juan Jiménez-Jáimez
Full Text Available Calmodulin 1, 2 and 3 (CALM mutations have been found to cause cardiac arrest in children at a very early age. The underlying aetiology described is long QT syndrome (LQTS, catecholaminergic polymorphic ventricular tachycardia (CPVT and idiopathic ventricular fibrillation (IVF. Little phenotypical data about CALM2 mutations is available.The aim of this paper is to describe the clinical manifestations of the Asn98Ser mutation in CALM2 in two unrelated children in southern Spain with apparently unexplained cardiac arrest/death.Two unrelated children aged 4 and 7, who were born to healthy parents, were studied. Both presented with sudden cardiac arrest. The first was resuscitated after a VF episode, and the second died suddenly. In both cases the baseline QTc interval was within normal limits. Peripheral blood DNA was available to perform targeted gene sequencing.The surviving 4-year-old girl had a positive epinephrine test for LQTS, and polymorphic ventricular ectopic beats were seen on a previous 24-hour Holter recording from the deceased 7-year-old boy, suggestive of a possible underlying CPVT phenotype. A p.Asn98Ser mutation in CALM2 was detected in both cases. This affected a highly conserved across species residue, and the location in the protein was adjacent to critical calcium binding loops in the calmodulin carboxyl-terminal domain, predicting a high pathogenic effect.Human calmodulin 2 mutation p.Asn98Ser is associated with sudden cardiac death in childhood with a variable clinical penetrance. Our results provide new phenotypical information about clinical behaviour of this mutation.
Directory of Open Access Journals (Sweden)
Othman Montacir
2018-01-01
Full Text Available Eptacog alfa (NovoSeven® is a vitamin K-dependent recombinant Factor VIIa produced by genetic engineering from baby hamster kidney (BHK cells as a single peptide chain of 406 residues. After activation, it consists of a light chain (LC of 152 amino and a heavy chain (HC of 254 amino acids. Recombinant FVIIa undergoes many post-translational modifications (PTMs. The first ten glutamic acids of the N-terminal moiety are γ-carboxylated, Asn145 and Asn322 are N-glycosylated, and Ser52 and Ser60 are O-glycosylated. A head-to-head biosimilarity study was conducted for the originator and the first biosimilar AryoSeven™ to evaluate comparable bioengineering. Physicochemical properties were analyzed based on mass spectrometry, including intact mass, PTMs and higher-order structure. Both biotherapeutics exhibit a batch-to-batch variability in their N-glycan profiles. N-Glycopeptide analysis with UHPLC-QTOF-MSE confirmed N-glycosylation sites as well as two different O-glycopeptide sites. Ser60 was found to be O-fucosylated and Ser52 had O-glucose or O-glucose-(xylose1,2 motifs as glycan variants. Ion mobility spectrometry (TWIMS and NMR spectroscopy data affirm close similarity of the higher-order structure of both biologicals. Potency of the biodrugs was analyzed by a coagulation assay demonstrating comparable bioactivity. Consequently, careful process optimization led to a stable production process of the biopharmaceuticals.
The Use of the MMPI-168 with Delinquent Adolescents.
Lueger, Robert J.
1983-01-01
Compared the standard MMPI and MMPI-168 scores of 90 male delinquent adolescents. Raw score and T-score correlations were high and within acceptable limits, which indicates that MMPI-168 scores are useful with delinquent adolescents. However, two-point codetypes derived from standard MMPIs and MMPI-168s were in agreement less than half the time.…
DEFF Research Database (Denmark)
Assentoft, Mette; Larsen, Brian R; Olesen, Emma T B
2014-01-01
heterologous expression in Xenopus laevis oocytes (along with serine-to-aspartate mutants of the same residues to mimic a phosphorylation). None of the mutant AQP4 constructs displayed alterations in the unit water permeability. Thus phosphorylation of six different serine residues in the COOH terminus of AQP4....... Phosphorylation of aquaporins can regulate plasma membrane localization and, possibly, the unit water permeability via gating of the AQP channel itself. In vivo phosphorylation of six serine residues in the COOH terminus of AQP4 has been detected by mass spectrometry: Ser(276), Ser(285), Ser(315), Ser(316), Ser...
International Nuclear Information System (INIS)
Nur Ubaidah Saidin; Muhamad Daud; Siti Radiah Mohd Kamarudin
2011-01-01
This report explained the test conducted in salt fog chamber to evaluate the effectiveness of mild steel, coated with rust converter, for 168 hours in artificial seawater exposure. The samples were compared with mild steel coated with commercial primer. The tests were conducted followed ASTM B117. Individual pictures were taken of each sample before the tests began, at 24, 48, 72, 96, 120, 144 and 168 hours to see the progression of the corrosion. Results showed that the samples coated with rust converter provide a good significant protection against corrosion phenomenon than the samples coated with commercial primer that available in the market. (author)
International Nuclear Information System (INIS)
2011-03-01
Members of the French Parliament and representatives of the French nuclear safety authority (ASN) discuss the content of the ASN 2010 activity report, the missions and responsibilities of the ASN in the different fields of exploitation of radioactive materials: nuclear energy and medical care. As far as nuclear energy is concerned, the representatives of the ASN evoke the decennial inspection of the French nuclear reactors, the control of the EPR construction, activities related to fuel cycle, the issue of waste management. As far as medical care is concerned, they address activities in the medical sector, the evolution of the number of events, and the commitment of the ASN in regulation elaboration. These issues are discussed with the members of Parliament
Reflection groups established by the ASN
International Nuclear Information System (INIS)
Fournier, M.
2009-01-01
Recent observations about tritium bio-kinetics in aquatic organisms might change our usual consideration about its radio-toxicity. In order to analyse these observations more thoroughly, the French nuclear safety authority (ASN) decided at the end of the year 2007 to create two independent reflection groups gathering scientists, nuclear operators and associations: the group 'tritium impact' has in charge the establishment of a status of the scientific knowledge relative to tritium sanitary impact, while the group 'defense in depth' has in charge the examination of the technical possibilities of tritium reprocessing and the establishment of a knowledge status of its environmental impact. First meetings of both groups took place in May 2008. Abstract only. (J.S.)
ASN report on the status of nuclear safety and radiation protection in France in 2015. Extracts
International Nuclear Information System (INIS)
2016-01-01
After a recall of ASN missions, key figures and organisation, an overview of main events for 2015, and a presentation of the French law related to energy transition for a green growth, a first part of this huge document presents actions undertaken by the ASN in 2015 in different fields: ionizing radiations and risks for health and the environment, principles and actors of control of nuclear safety and radiation protection, regulation, control of nuclear activities and of exposures to ionizing radiations, emergency radiological and post-accidental situations, public information transparency and participation, international relationships, regional overview of nuclear safety and radiation protection. The second part addresses activities controlled by the ASN: medical uses of ionizing radiations, industrial, research and veterinary uses and source safety, transportation of radioactive materials, EDF nuclear power plants, installations related to nuclear fuel cycle, various industrial and research installations, safety of basic nuclear installation dismantling, radioactive wastes and polluted sites and soils
Sehar, Ujala; Mehmood, Muhammad Aamer; Hussain, Khadim; Nawaz, Salman; Nadeem, Shahid; Siddique, Muhammad Hussnain; Nadeem, Habibullah; Gull, Munazza; Ahmad, Niaz; Sohail, Iqra; Gill, Saba Shahid; Majeed, Summera
2013-01-01
This paper presents an in silico characterization of the chitin binding protein CBP50 from B. thuringiensis serovar konkukian S4 through homology modeling and molecular docking. The CBP50 has shown a modular structure containing an N-terminal CBM33 domain, two consecutive fibronectin-III (Fn-III) like domains and a C-terminal CBM5 domain. The protein presented a unique modular structure which could not be modeled using ordinary procedures. So, domain wise modeling using MODELLER and docking analyses using Autodock Vina were performed. The best conformation for each domain was selected using standard procedure. It was revealed that four amino acid residues Glu-71, Ser-74, Glu-76 and Gln-90 from N-terminal domain are involved in protein-substrate interaction. Similarly, amino acid residues Trp-20, Asn-21, Ser-23 and Val-30 of Fn-III like domains and Glu-15, Ala-17, Ser-18 and Leu-35 of C-terminal domain were involved in substrate binding. Site-directed mutagenesis of these proposed amino acid residues in future will elucidate the key amino acids involved in chitin binding activity of CBP50 protein.
International Nuclear Information System (INIS)
2009-01-01
At the request of the Government authorities of France, an international team of 24 experts visited the Autorite de Surete Nucleaire (ASN), the French regulatory authority for nuclear and radiation safety, in November 2006 to conduct the first full scope Integrated Regulatory Review Service (IRRS) mission. The purpose of the mission was to undertake a peer review of the regulatory body of France against the IAEA Safety Standards and to exchange information and experience on safety regulation. In March 2008 the Government authorities of France requested a follow-up mission to review the measures undertaken following the recommendations and suggestions presented in the report of the November 2006 IRRS mission. The scope of the IRRS follow-up mission covered the regulatory aspects of the facilities and practices regulated by ASN, nuclear power plants, research reactors, fuel cycle facilities, medical practices with further review of radiotherapy, industrial and research activities, waste facilities, decommissioning, remediation, public information and communication and, in addition, it was also extended to cover the application of the Code of Conduct of Safety and Security of Radioactive Sources. The review was conducted from March 29 to April 3 2009 by an IRRS team consisting of 12 senior regulatory experts from 11 Member States, two staff members from the IAEA, one IAEA observer and an IAEA administrative assistant. During the review the team recognized that ASN has taken a number of initiatives to improve its effectiveness and efficiency and that ASN faces new challenges. ASN supplied a package of documentation and a well prepared self-assessment, in advance of the mission, including a status report and an action plan to improve its regulatory effectiveness. Both regulatory technical and policy issues were addressed. The policy issues discussed were: regulatory independence, the relationship between ASN and IRSN and medical issues. The IRRS follow-up mission
Li, Zhiqing; Cheng, Daojun; Mon, Hiroaki; Zhu, Li; Xu, Jian; Tatsuke, Tsuneyuki; Lee, Jae Man; Xia, Qingyou; Kusakabe, Takahiro
2013-01-01
Epigenetic modifiers and transcription factors contribute to developmentally programmed gene expression. Here, we establish a functional link between epigenetic regulation by Polycomb group (PcG) proteins and transcriptional regulation by C/ebp that orchestrates the correct expression of Bombyx mori asparagine synthetase (BmASNS), a gene involved in the biosynthesis of asparagine. We show that the cis-regulatory elements of YY1-binding motifs and the CpG island present on the BmASNS promoter are required for the recruitment of PcG proteins and the subsequent deposition of the epigenetic repression mark H3K27me3. RNAi-mediated knockdown of PcG genes leads to derepression of the BmASNS gene via the recruitment of activators, including BmC/ebp, to the promoter. Intriguingly, we find that PcG proteins and BmC/ebp can dynamically modulate the transcriptional output of the BmASNS target in a cell cycle-dependent manner. It will be essential to suppress BmASNS expression by PcG proteins at the G2/M phase of the cell cycle in the presence of BmC/ebp activator. Thus, our results provide a novel insight into the molecular mechanism underlying the recruitment and regulation of the PcG system at a discrete gene locus in Bombyx mori. PMID:23382816
DEFF Research Database (Denmark)
Reinscheid, R K; Grimmelikhuijzen, C J
1994-01-01
distributed over the precursor protein. Of the 36 Antho-RFamide sequences, 29 copies are separated by the five amino acid spacer sequence Arg-Glu/Gly-Asn/Ser/Asp-Glu/Lys-Glu. This implicates processing at single Arg and single Glu residues. Endoproteolytic cleavage at the C-terminal side of paired or single......, and possibly also at other residues, and thus liberate all Antho-RFamide sequences. The processing of one precursor molecule probably yields 38 neuropeptides.(ABSTRACT TRUNCATED AT 250 WORDS)...... basic residues is a well known initial step in the maturation of precursor proteins. Cleavage at the C-terminal side of acidic residues, however, is unusual and must be catalyzed by a new type of processing enzyme. This processing enzyme is most likely to be an endoprotease, because the simplest way...
Ruggiero, Melina; Kerff, Frédéric; Herman, Raphaël; Sapunaric, Frédéric; Galleni, Moreno; Gutkind, Gabriel; Charlier, Paulette; Sauvage, Eric
2014-01-01
PER-2 belongs to a small (7 members to date) group of extended-spectrum β-lactamases. It has 88% amino acid identity with PER-1 and both display high catalytic efficiencies toward most β-lactams. In this study, we determined the X-ray structure of PER-2 at 2.20 Å and evaluated the possible role of several residues in the structure and activity toward β-lactams and mechanism-based inhibitors. PER-2 is defined by the presence of a singular trans bond between residues 166 to 167, which generates an inverted Ω loop, an expanded fold of this domain that results in a wide active site cavity that allows for efficient hydrolysis of antibiotics like the oxyimino-cephalosporins, and a series of exclusive interactions between residues not frequently involved in the stabilization of the active site in other class A β-lactamases. PER β-lactamases might be included within a cluster of evolutionarily related enzymes harboring the conserved residues Asp136 and Asn179. Other signature residues that define these enzymes seem to be Gln69, Arg220, Thr237, and probably Arg/Lys240A (“A” indicates an insertion according to Ambler's scheme for residue numbering in PER β-lactamases), with structurally important roles in the stabilization of the active site and proper orientation of catalytic water molecules, among others. We propose, supported by simulated models of PER-2 in combination with different β-lactams, the presence of a hydrogen-bond network connecting Ser70-Gln69-water-Thr237-Arg220 that might be important for the proper activity and inhibition of the enzyme. Therefore, we expect that mutations occurring in these positions will have impacts on the overall hydrolytic behavior. PMID:25070104
International Nuclear Information System (INIS)
Eun Jin Kim; Jian Feng; Bramlett, Matthew R.; Lindahl, Paul A.
2004-01-01
OAK-B135 Carbon monoxide dehydrogenase from Moorella thermoacetica catalyzes the reversible oxidation of CO to CO2 at a nickel-iron-sulfur active-site called the C-cluster. Mutants of a proposed proton transfer pathway and of a cysteine residue recently found to form a persulfide bond with the C-cluster were characterized. Four semi-conserved histidine residues were individually mutated to alanine. His116 and His122 were essential to catalysis, while His113 and His119 attenuated catalysis but were not essential. Significant activity was ''rescued'' by a double mutant where His116 was replaced by Ala and His was also introduced at position 115. Activity was also rescued in double mutants where His122 was replaced by Ala and His was simultaneously introduced at either position 121 or 123. Activity was also ''rescued'' by replacing His with Cys at position 116. Mutation of conserved Lys587 near the C-cluster attenuated activity but did not eliminate it. Activity was virtually abolished in a double mutant where Lys587 and His113 were both changed to Ala. Mutations of conserved Asn284 also attenuated activity. These effects suggest the presence of a network of amino acid residues responsible for proton transfer rather than a single linear pathway. The Ser mutant of the persulfide-forming Cys316 was essentially inactive and displayed no EPR signals originating from the C-cluster. Electronic absorption and metal analysis suggests that the C-cluster is absent in this mutant. The persulfide bond appears to be essential for either the assembly or stability of the C-cluster, and/or for eliciting the redox chemistry of the C-cluster required for catalytic activity
Reflection groups established by the ASN; Les groupes de reflexion mis en place par l'ASN
Energy Technology Data Exchange (ETDEWEB)
Fournier, M. [ASN, 75 - Paris (France)
2009-07-01
Recent observations about tritium bio-kinetics in aquatic organisms might change our usual consideration about its radio-toxicity. In order to analyse these observations more thoroughly, the French nuclear safety authority (ASN) decided at the end of the year 2007 to create two independent reflection groups gathering scientists, nuclear operators and associations: the group 'tritium impact' has in charge the establishment of a status of the scientific knowledge relative to tritium sanitary impact, while the group 'defense in depth' has in charge the examination of the technical possibilities of tritium reprocessing and the establishment of a knowledge status of its environmental impact. First meetings of both groups took place in May 2008. Abstract only. (J.S.)
Livebearing or egg-laying mammals: 27 decisive nucleotides of FAM168.
Pramanik, Subrata; Kutzner, Arne; Heese, Klaus
2017-05-23
In the present study, we determine comprehensive molecular phylogenetic relationships of the novel myelin-associated neurite-outgrowth inhibitor (MANI) gene across the entire eukaryotic lineage. Combined computational genomic and proteomic sequence analyses revealed MANI as one of the two members of the novel family with sequence similarity 168 member (FAM168) genes, consisting of FAM168A and FAM168B, having distinct genetic differences that illustrate diversification in its biological function and genetic taxonomy across the phylogenetic tree. Phylogenetic analyses based on coding sequences of these FAM168 genes revealed that they are paralogs and that the earliest emergence of these genes occurred in jawed vertebrates such as Callorhinchus milii. Surprisingly, these two genes are absent in other chordates that have a notochord at some stage in their lives, such as branchiostoma and tunicates. In the context of phylogenetic relationships among eukaryotic species, our results demonstrate the presence of FAM168 orthologs in vertebrates ranging from Callorhinchus milii to Homo sapiens, displaying distinct taxonomic clusters, comprised of fish, amphibians, reptiles, birds, and mammals. Analyses of individual FAM168 exons in our sample provide new insights into the molecular relationships between FAM168A and FAM168B (MANI) on the one hand and livebearing and egg-laying mammals on the other hand, demonstrating that a distinctive intermediate exon 4, comprised of 27 nucleotides, appears suddenly only in FAM168A and there in the livebearing mammals only but is absent from all other species including the egg-laying mammals.
Wang, Qing; Bao, Luyao; Jia, Chenjun; Li, Mei; Li, Jian-Jun; Lu, Xuefeng
2017-03-16
Aldehyde-deformylating oxygenase (ADO) is a key enzyme involved in the biosynthetic pathway of fatty alk(a/e)nes in cyanobacteria. However, cADO (cyanobacterial ADO) showed extreme low activity with the k cat value below 1 min -1 , which would limit its application in biofuel production. To identify the activity related key residues of cADO is urgently required. The amino acid residues which might affect cADO activity were identified based on the crystal structures and sequence alignment of cADOs, including the residues close to the di-iron center (Tyr39, Arg62, Gln110, Tyr122, Asp143 of cADO-1593), the protein surface (Trp 178 of cADO-1593), and those involved in two important hydrogen bonds (Gln49, Asn123 of cADO-1593, and Asp49, Asn123 of cADO-sll0208) and in the oligopeptide whose conformation changed in the absence of the di-iron center (Leu146, Asn149, Phe150 of cADO-1593, and Thr146, Leu148, Tyr150 of cADO-sll0208). The variants of cADO-1593 from Synechococcus elongatus PCC7942 and cADO-sll0208 from Synechocystis sp. PCC6803 were constructed, overexpressed, purified and kinetically characterized. The k cat values of L146T, Q49H/N123H/F150Y and W178R of cADO-1593 and L148R of cADO-sll0208 were increased by more than two-fold, whereas that of R62A dropped by 91.1%. N123H, Y39F and D143A of cADO-1593, and Y150F of cADO-sll0208 reduced activities by ≤ 20%. Some important amino acids, which exerted some effects on cADO activity, were identified. Several enzyme variants exhibited greatly reduced activity, while the k cat values of several mutants are more than two-fold higher than the wild type. This study presents the report on the relationship between amino acid residues and enzyme activity of cADOs, and the information will provide a guide for enhancement of cADO activity through protein engineering.
Lysine as helix C-capping residue in a synthetic peptide.
Esposito, G; Dhanapal, B; Dumy, P; Varma, V; Mutter, M; Bodenhausen, G
1997-01-01
The structure of the synthetic peptide CH3CO(Leu-Ser-Leu-Leu-Leu-Ser-Leu)3Lys-NH2 in trifluoroethanol/water 60/40 (volume ratio) was characterized by two-dimensional nmr spectroscopy. The peptide, closely related to the amphiphilic helix models designed by W. F. De-Grado and co-workers to mimic protein ion channels [(1988) Science, Vol. 240, p. 1177-1181], folds into a regular helix spanning residues 1-20. Evidence for a helix C-terminal capping conformation, involving the terminal lysine residue, was observed from Overhauser effects and checked for consistency by restrained molecular dynamics simulations. The side-chain amino group of Lys22 forms a hydrogen bond with the carbonyl of Leu18, and the distorted helical geometry of the terminal dipeptide allows the inclusion of a water bridge between the backbone NH of the Lys22 residue and the carbonyls of Leu19 and Ser20.
Xu, Lei; Wen, Bin; Wang, Yuan; Tian, Changqing; Wu, Mingcai; Zhu, Guoping
2017-06-19
Cryptochromes (CRYs) and photolyases belong to the cryptochrome/photolyase family (CPF). Reduced FAD is essential for photolyases to photorepair UV-induced cyclobutane pyrimidine dimers (CPDs) or 6-4 photoproducts in DNA. In Drosophila CRY (dCRY, a type I animal CRY), FAD is converted to the anionic radical but not to the reduced state upon illumination, which might induce a conformational change in the protein to relay the light signal downstream. To explore the foundation of these differences, multiple sequence alignment of 650 CPF protein sequences was performed. We identified a site facing FAD (Ala377 in Escherichia coli CPD photolyase and Val415 in dCRY), hereafter referred to as "site 377", that was distinctly conserved across these sequences: CPD photolyases often had Ala, Ser, or Asn at this site, whereas animal CRYs had Ile, Leu, or Val. The binding affinity for reduced FAD, but not the photorepair activity of E. coli photolyase, was dramatically impaired when replacing Ala377 with any of the three CRY residues. Conversely, in V415S and V415N mutants of dCRY, FAD was photoreduced to its fully reduced state after prolonged illumination, and light-dependent conformational changes of these mutants were severely inhibited. We speculate that the residues at site 377 play a key role in the different preferences of CPF proteins for reduced FAD, which differentiate animal CRYs from CPD photolyases. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Data acquisition using the 168/E
International Nuclear Information System (INIS)
Carroll, J.T.; Cittolin, S.; Demoulin, M.; Fucci, A.; Martin, B.; Norton, A.; Porte, J.P.; Rossi, P.; Storr, K.M.
1983-03-01
Event sizes and data rates at the CERN anti p p collider compose a formidable environment for a high level trigger. A system using three 168/E processors for experiment UA1 real-time event selection is described. With 168/E data memory expanded to 512K bytes, each processor holds a complete event allowing a FORTRAN trigger algorithm access to data from the entire detector. A smart CAMAC interface reads five Remus branches in parallel transferring one word to the target processor every 0.5 μs. The NORD host computer can simultaneously read an accepted event from another processor
Ma, Min; Okuyama, Masayuki; Sato, Megumi; Tagami, Takayoshi; Klahan, Patcharapa; Kumagai, Yuya; Mori, Haruhide; Kimura, Atsuo
2017-08-01
Aspergillus niger α-glucosidase (ANG), a member of glycoside hydrolase family 31, catalyzes hydrolysis of α-glucosidic linkages at the non-reducing end. In the presence of high concentrations of maltose, the enzyme also catalyzes the formation of α-(1→6)-glucosyl products by transglucosylation and it is used for production of the industrially useful panose and isomaltooligosaccharides. The initial transglucosylation by wild-type ANG in the presence of 100 mM maltose [Glc(α1-4)Glc] yields both α-(1→6)- and α-(1→4)-glucosidic linkages, the latter constituting ~25% of the total transfer reaction product. The maltotriose [Glc(α1-4)Glc(α1-4)Glc], α-(1→4)-glucosyl product disappears quickly, whereas the α-(1→6)-glucosyl products panose [Glc(α1-6)Glc(α1-4)Glc], isomaltose [Glc(α1-6)Glc], and isomaltotriose [Glc(α1-6)Glc(α1-6)Glc] accumulate. To modify the transglucosylation properties of ANG, residue Asn694, which was predicted to be involved in formation of the plus subsites of ANG, was replaced with Ala, Leu, Phe, and Trp. Except for N694A, the mutations enhanced the initial velocity of the α-(1→4)-transfer reaction to produce maltotriose, which was then degraded at a rate similar to that by wild-type ANG. With increasing reaction time, N694F and N694W mutations led to the accumulation of larger amounts of isomaltose and isomaltotriose than achieved with the wild-type enzyme. In the final stage of the reaction, the major product was panose (N694A and N694L) or isomaltose (N694F and N694W).
Energy Technology Data Exchange (ETDEWEB)
NONE
2011-03-15
Members of the French Parliament and representatives of the French nuclear safety authority (ASN) discuss the content of the ASN 2010 activity report, the missions and responsibilities of the ASN in the different fields of exploitation of radioactive materials: nuclear energy and medical care. As far as nuclear energy is concerned, the representatives of the ASN evoke the decennial inspection of the French nuclear reactors, the control of the EPR construction, activities related to fuel cycle, the issue of waste management. As far as medical care is concerned, they address activities in the medical sector, the evolution of the number of events, and the commitment of the ASN in regulation elaboration. These issues are discussed with the members of Parliament
Accidental exposures in interventional radiology: lessons learned by the ASN
International Nuclear Information System (INIS)
Marchal, C.; Valero, M.
2009-01-01
The authors outline that interventional radiology often requires long duration exposures of patients to ionizing radiations and thus stress that interventional radiology must be optimized to improve radioprotection of patients and operators. They notice that investigations performed by the ASN (the French Nuclear Safety Authority) on declared events revealed in some cases a lack of knowledge of devices by users, notably of functionalities allowing the applied doses to be controlled
International Nuclear Information System (INIS)
2009-09-01
After a presentation of the procedure of declaration of significant radiation protection events, of the ASN-SFRO event scale, and of the indication procedure related to material vigilance, this report proposes a review and an analysis of significant radioprotection and material vigilance events which have been declared between July 2007 and June 2008. The assessment of radiation protection events declared to the ASN is as well quantitative (distribution in time, geographical distribution, status of declaring centres, declaration delays, classification according to the ASN-SFRO scale) as qualitative (origin, event typology, stage of the treatment process at which the event occurred and has been detected, personnel having detected the event, communication about events). The analysis of material vigilance events addresses the evolution of their number, their distribution in terms of declarer type, of radiotherapy equipment, or of criticality level, and so on. A review of hybrid accidents is proposed (concerned equipment, declarer origin, consequences of the declarations, classification on the ASN-SFRO scale)
Chen, Fuchao; Fang, Baoxia; Li, Peng; Zhu, Xuesong; Zhou, Benhong
2014-08-01
This study was to investigate the physical and chemical compatibility of butorphanol with tramadol or fentanyl in 0.9% sodium chloride injections for patient controlled analgesia administration. The solutions were prepared in polyvinyl chloride (PVC) infusion bags and stored without protected from light exposure at room temperature (25 degrees C) or refrigerated (4 degrees C). Over a period of 168 hours, stabilities were determined by visual inspection, pH measurement, and high-pressure liquid chromatography (HPLC) assay of drug concentrations. At both temperatures, admixtures of butorphanol-tramadol and butorphanol-fentanyl were clear in appearance, and no color change or precipitation was observed during the study period. The maximum losses obtained were lower than 5% for the three drugs after 168 hours of storage. The results indicate that, at ambient or refrigerated storage conditions, the drug mixtures of butorphanol-tramadol and butorphanol-fentanyl in 0.9% sodium chloride injections were physically and chemically stable for at least 168 hours when stored in PVC syringes.
A 168E emulator for off-line production
CERN PhotoLab
1982-01-01
By the end of 1982 seven such processors each with 184 kbyte memory were made available to a few experiments for about 3500 hours of equivalent IBM 370/168 equivalent time, at a cost of about 300 hours of equivalent IBM 370/168 time on the Computer Centre IBM. See Annual Report 1982 p. 81. In front of the computer, Christiane Ball
Directory of Open Access Journals (Sweden)
Kyle Dennis E
2006-10-01
Full Text Available Abstract Background In vitro and in vivo resistance of Plasmodium falciparum to atovaquone or atovaquone-proguanil hydrochloride combination has been associated to two point mutations in the parasite cytochrome b (cytb gene (Tyr268Ser and Tyr268Asn. However, little is known about the prevalence of codon-268 mutations in natural populations of P. falciparum without previous exposure to the drug in Africa. Methods The prevalence of codon-268 mutations in the cytb gene of African P. falciparum isolates from Nigeria, Malawi and Senegal, where atovaquone-proguanil has not been introduced for treatment of malaria was assessed. Genotyping of the cytb gene in isolates of P. falciparum was performed by PCR-restriction fragment length polymorphism and confirmed by sequencing. Results 295 samples from Nigeria (111, Malawi (91 and Senegal (93 were successfully analyzed for detection of either mutant Tyr268Ser or Tyr268Asn. No case of Ser268 or Asn268 was detected in cytb gene of parasites from Malawi or Senegal. However, Asn268 was detected in five out of 111 (4.5% unexposed P. falciparum isolates from Nigeria. In addition, one out of these five mutant Asn268 isolates showed an additional cytb mutation leading to a Pro266Thr substitution inside the ubiquinone reduction site. Conclusion No Tyr268Ser mutation is found in cytb of P. falciparum isolates from Nigeria, Malawi or Senegal. This study reports for the first time cytb Tyr268Asn mutation in unexposed P. falciparum isolates from Nigeria. The emergence in Africa of P. falciparum isolates with cytb Tyr268Asn mutation is a matter of serious concern. Continuous monitoring of atovaquone-proguanil resistant P. falciparum in Africa is warranted for the rational use of this new antimalarial drug, especially in non-immune travelers.
Happi, Christian T; Gbotosho, Grace O; Folarin, Onikepe A; Milner, Danny; Sarr, Ousmane; Sowunmi, Akintunde; Kyle, Dennis E; Milhous, Wilbur K; Wirth, Dyann F; Oduola, Ayoade M J
2006-10-04
In vitro and in vivo resistance of Plasmodium falciparum to atovaquone or atovaquone-proguanil hydrochloride combination has been associated to two point mutations in the parasite cytochrome b (cytb) gene (Tyr268Ser and Tyr268Asn). However, little is known about the prevalence of codon-268 mutations in natural populations of P. falciparum without previous exposure to the drug in Africa. The prevalence of codon-268 mutations in the cytb gene of African P. falciparum isolates from Nigeria, Malawi and Senegal, where atovaquone-proguanil has not been introduced for treatment of malaria was assessed. Genotyping of the cytb gene in isolates of P. falciparum was performed by PCR-restriction fragment length polymorphism and confirmed by sequencing. 295 samples from Nigeria (111), Malawi (91) and Senegal (93) were successfully analyzed for detection of either mutant Tyr268Ser or Tyr268Asn. No case of Ser268 or Asn268 was detected in cytb gene of parasites from Malawi or Senegal. However, Asn268 was detected in five out of 111 (4.5%) unexposed P. falciparum isolates from Nigeria. In addition, one out of these five mutant Asn268 isolates showed an additional cytb mutation leading to a Pro266Thr substitution inside the ubiquinone reduction site. No Tyr268Ser mutation is found in cytb of P. falciparum isolates from Nigeria, Malawi or Senegal. This study reports for the first time cytb Tyr268Asn mutation in unexposed P. falciparum isolates from Nigeria. The emergence in Africa of P. falciparum isolates with cytb Tyr268Asn mutation is a matter of serious concern. Continuous monitoring of atovaquone-proguanil resistant P. falciparum in Africa is warranted for the rational use of this new antimalarial drug, especially in non-immune travelers.
International Nuclear Information System (INIS)
Deproit, L.; Vieuble, J.
2016-01-01
The local branch of the ASN (Nuclear Safety Authority) in the Marseille region controls the nuclear activities in 13 departments and Corsica. The preparation of the crisis management relies on the involvement of various actors: representatives of public bodies, nuclear plant operators, the ASN and its technical assistance (IRSN - Institute for Radiation-protection and Nuclear Safety). Crisis exercises are necessary to check the right coordination of all the actors. The feedback of real situations involving incidents are also important because it allows all the actors to better know each other, the case of the accident of the Centraco facility is detailed as well as the robbery of a truck carrying a radioactive source or the discovery of a collection of radioactive sources in a private home. In each case the lesson learned by the local branch of ASN is to communicate quickly with local authorities in order to get the best technical response to the situation and to give authorities all the information necessary for an efficient information of the public. (A.C.)
Directory of Open Access Journals (Sweden)
Amit Kumar
2016-06-01
Full Text Available The production of crop residues in India is estimated to be about 500–550 million tons annually. It is estimated that about 93 million tons of crop residues is burnt annually which is not only wastage of valuable biomass resources but pollution of the environment with the production of green house gases also. Among different low cost crop residues, black gram residue as the substrate produced maximal endoglucanase, FPase, and β-glucosidase activities from Aspergillus nidulans AKB-25 under solid-state fermentation. During optimisation of cultural parameters A. nidulans AKB-25 produced maximal endoglucanase (152.14 IU/gds, FPase (3.42 FPU/gds and xylanase (2441.03 IU/gds activities. The crude enzyme was found effective for the saccharification of pearl millet stover and bio-deinking of mixed office waste paper. The crude enzyme from A. nidulans AKB-25 produced maximum fermentable sugars of 546.91 mg/g from alkali-pretreated pearl millet stover by saccharification process at a dose of 15 FPU/g of substrate. Pulp brightness and deinking efficiency of mixed office waste paper improved by 4.6% and 25.01% respectively and mitigated dirt counts by 74.70% after bio-deinking. Physical strength properties like burst index, tensile index and double fold number were also improved during bio-deinking of mixed office waste paper.
Hydrogen bond strengths in phosphorylated and sulfated amino acid residues.
Directory of Open Access Journals (Sweden)
Chaya Rapp
Full Text Available Post-translational modification by the addition of an oxoanion functional group, usually a phosphate group and less commonly a sulfate group, leads to diverse structural and functional consequences in protein systems. Building upon previous studies of the phosphoserine residue (pSer, we address the distinct nature of hydrogen bonding interactions in phosphotyrosine (pTyr and sulfotyrosine (sTyr residues. We derive partial charges for these modified residues and then study them in the context of molecular dynamics simulation of model tripeptides and sulfated protein complexes, potentials of mean force for interacting residue pairs, and a survey of the interactions of modified residues among experimental protein structures. Overall, our findings show that for pTyr, bidentate interactions with Arg are particularly dominant, as has been previously demonstrated for pSer. sTyr interactions with Arg are significantly weaker, even as compared to the same interactions made by the Glu residue. Our work sheds light on the distinct nature of these modified tyrosine residues, and provides a physical-chemical foundation for future studies with the goal of understanding their roles in systems of biological interest.
Measurement and modeling of residual stress in a welded Haynes[reg] 25 cylinder
International Nuclear Information System (INIS)
Larsson, C.; Holden, T.M.; Bourke, M.A.M.; Stout, M.; Teague, J.; Lindgren, L.-E.
2005-01-01
An experimental and simulation study of residual stresses was made in the vicinity of a gas tungsten arc weld, used to join a hemispherical end cap to a cylinder. The capped cylinder is used in a satellite application and was fabricated from a Co-based Haynes[reg] 25 alloy. The cylinder was 34.7 mm in outer diameter and 3.3 mm in thickness. The experimental measurements were made by neutron diffraction and the simulation used the implicit Marc finite element code. The experimental resolution was limited to approximately 3 mm parallel to the axis of the cylinder (the weld was 6 mm in the same direction) and comparison over the same volume of the finite element prediction showed general agreement. Subject to the limited spatial resolution, the largest experimentally measured tensile residual stress was 180 MPa, located at the middle of the weld. However, the predictions suggest that there are regions in the weld where average tensile residual stresses as much as 400 MPa exist. One qualitative disparity between the model and the experiments was that the measurement included a larger degree of asymmetry on either side of the weld than predicted by the model
Measurement and modeling of residual stress in a welded Haynes[reg] 25 cylinder
Energy Technology Data Exchange (ETDEWEB)
Larsson, C. [Div. of Eng. Mat., Department of Mech. Eng., Linkoeping University, 58183 Linkoeping (Sweden)]. E-mail: clarsson@cfl.rr.com; Holden, T.M. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Bourke, M.A.M. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Stout, M. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Teague, J. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Lindgren, L.-E. [Div. Comp. Aided Design, Lulea University of Technology and Dalarna University, 97187 Lulea (Sweden)
2005-06-15
An experimental and simulation study of residual stresses was made in the vicinity of a gas tungsten arc weld, used to join a hemispherical end cap to a cylinder. The capped cylinder is used in a satellite application and was fabricated from a Co-based Haynes[reg] 25 alloy. The cylinder was 34.7 mm in outer diameter and 3.3 mm in thickness. The experimental measurements were made by neutron diffraction and the simulation used the implicit Marc finite element code. The experimental resolution was limited to approximately 3 mm parallel to the axis of the cylinder (the weld was 6 mm in the same direction) and comparison over the same volume of the finite element prediction showed general agreement. Subject to the limited spatial resolution, the largest experimentally measured tensile residual stress was 180 MPa, located at the middle of the weld. However, the predictions suggest that there are regions in the weld where average tensile residual stresses as much as 400 MPa exist. One qualitative disparity between the model and the experiments was that the measurement included a larger degree of asymmetry on either side of the weld than predicted by the model.
Ruan, Jiawei
Weyl semimetals are new states of quantum matter with topological Weyl nodes near Fermi level in the bulk and Fermi arcs at the surface, which are paid a lot attention in recently years. Here#¬we report another topological semimetal a-Sn., which is double Weyl semimetal in the magnetic field and Dirac semimetal in an appropriate in-plane strain. By combing Landau level spectroscopy and quasiparticle interference, we obtain the linear dispersion near the Dirac point within strain while quadratic band dispersion near Γpoint without strain. We also observe the negative longitudinal magnetoresistance (LMR) in both two system, which is caused by chiral anomaly. However ,the LMR profiles of strained a-Sn have a little rise and then descend while the unstrained one drop directly, which is due to the different type of Weyl semimetal and further confirm our prediction.
PM2.5 emissions and source profiles from open burning of crop residues
Ni, Haiyan; Tian, Jie; Wang, Xiaoliang; Wang, Qiyuan; Han, Yongming; Cao, Junji; Long, Xin; Chen, L.-W. Antony; Chow, Judith C.; Watson, John G.; Huang, Ru-Jin; Dusek, Ulrike
2017-11-01
Wheat straw, rice straw, and corn stalks, the major agricultural crop residues in China, were collected from six major crop producing regions, and burned in a laboratory combustion chamber to determine PM2.5 source profiles and speciated emission factors (EFs). Organic carbon (OC) and water-soluble ions (the sum of NH4+, Na+, K+, Mg2+, Ca2+, Cl-, NO3- and SO42-) are major constituents, accounting for 43.1 ± 8.3% and 27.4 ± 14.6% of PM2.5, respectively. Chloride (Cl-) and water-soluble potassium (K+) are the dominant ionic species, with an average abundance of 14.5 ± 8.2% and 6.4 ± 4.4% in PM2.5, respectively. The average K+/Cl- ratio is ∼0.4, lower than 2.8-5.4 for wood combustion. Similarity measures (i.e., Student's t-test, coefficient of divergence, correlations, and residual to uncertainty ratios) show the crop profiles are too similar for the species measured to be resolved from one another by receptor modeling. The largest difference was found between rice straw and corn stalk emissions, with higher OC and lower Cl- and K+ abundances (50%, 8%, and 3% of PM2.5, respectively) for corn stalks; lower OC, and higher Cl- and K+ abundances (38%, 21%, and 10% of PM2.5, respectively) for rice straw. Average EFs were 4.8 ± 3.1 g kg-1 for OC, 1.3 ± 0.8 g kg-1 for Cl- and 0.59 ± 0.56 g kg-1 for K+. Flaming and smoldering combustions resulted in an average modified combustion efficiency (MCE) of 0.92 ± 0.03, and low elemental carbon (EC) EFs (0.24 ± 0.12 g kg-1). OC/EC ratios from individual source profiles ranged from 12.9 ± 4.3 for rice straw to 24.1 ± 13.5 for wheat straw. The average K+/EC ratio was 2.4 ± 1.5, an order of magnitude higher than those from residential wood combustion (0.2-0.76). Elevated emission rates were found for OC (387 Gg yr-1) and Cl- (122 Gg yr-1), accounting for 44% and 14% of 2008 PM2.5 emissions in China.
Role of a cysteine residue in the active site of ERK and the MAPKK family
International Nuclear Information System (INIS)
Ohori, Makoto; Kinoshita, Takayoshi; Yoshimura, Seiji; Warizaya, Masaichi; Nakajima, Hidenori; Miyake, Hiroshi
2007-01-01
Kinases of mitogen-activated protein kinase (MAPK) cascades, including extracellular signal-regulated protein kinase (ERK), represent likely targets for pharmacological intervention in proliferative diseases. Here, we report that FR148083 inhibits ERK2 enzyme activity and TGFβ-induced AP-1-dependent luciferase expression with respective IC 50 values of 0.08 and 0.05 μM. FR265083 (1'-2' dihydro form) and FR263574 (1'-2' and 7'-8' tetrahydro form) exhibited 5.5-fold less and no activity, respectively, indicating that both the α,β-unsaturated ketone and the conformation of the lactone ring contribute to this inhibitory activity. The X-ray crystal structure of the ERK2/FR148083 complex revealed that the compound binds to the ATP binding site of ERK2, involving a covalent bond to Sγ of ERK2 Cys166, hydrogen bonds with the backbone NH of Met108, Nζ of Lys114, backbone C=O of Ser153, Nδ2 of Asn154, and hydrophobic interactions with the side chains of Ile31, Val39, Ala52, and Leu156. The covalent bond motif in the ERK2/FR148083 complex assures that the inhibitor has high activity for ERK2 and no activity for other MAPKs such as JNK1 and p38MAPKα/β/γ/δ which have leucine residues at the site corresponding to Cys166 in ERK2. On the other hand, MEK1 and MKK7, kinases of the MAPKK family which also can be inhibited by FR148083, contain a cysteine residue corresponding to Cys166 of ERK2. The covalent binding to the common cysteine residue in the ATP-binding site is therefore likely to play a crucial role in the inhibitory activity for these MAP kinases. These findings on the molecular recognition mechanisms of FR148083 for kinases with Cys166 should provide a novel strategy for the pharmacological intervention of MAPK cascades
Gaufichon, Laure; Marmagne, Anne; Belcram, Katia; Yoneyama, Tadakatsu; Sakakibara, Yukiko; Hase, Toshiharu; Grandjean, Olivier; Clément, Gilles; Citerne, Sylvie; Boutet-Mercey, Stéphanie; Masclaux-Daubresse, Céline; Chardon, Fabien; Soulay, Fabienne; Xu, Xiaole; Trassaert, Marion; Shakiebaei, Maryam; Najihi, Amina; Suzuki, Akira
2017-08-01
Despite a general view that asparagine synthetase generates asparagine as an amino acid for long-distance transport of nitrogen to sink organs, its role in nitrogen metabolic pathways in floral organs during seed nitrogen filling has remained undefined. We demonstrate that the onset of pollination in Arabidopsis induces selected genes for asparagine metabolism, namely ASN1 (At3g47340), GLN2 (At5g35630), GLU1 (At5g04140), AapAT2 (At5g19950), ASPGA1 (At5g08100) and ASPGB1 (At3g16150), particularly at the ovule stage (stage 0), accompanied by enhanced asparagine synthetase protein, asparagine and total amino acids. Immunolocalization confined asparagine synthetase to the vascular cells of the silique cell wall and septum, but also to the outer and inner seed integuments, demonstrating the post-phloem transport of asparagine in these cells to developing embryos. In the asn1 mutant, aberrant embryo cell divisions in upper suspensor cell layers from globular to heart stages assign a role for nitrogen in differentiating embryos within the ovary. Induction of asparagine metabolic genes by light/dark and nitrate supports fine shifts of nitrogen metabolic pathways. In transgenic Arabidopsis expressing promoter Ca MV 35S ::ASN1 fusion, marked metabolomics changes at stage 0, including a several-fold increase in free asparagine, are correlated to enhanced seed nitrogen. However, specific promoter Napin2S ::ASN1 expression during seed formation and a six-fold increase in asparagine toward the desiccation stage result in wild-type seed nitrogen, underlining that delayed accumulation of asparagine impairs the timing of its use by releasing amide and amino nitrogen. Transcript and metabolite profiles in floral organs match the carbon and nitrogen partitioning to generate energy via the tricarboxylic acid cycle, GABA shunt and phosphorylated serine synthetic pathway. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Phosphorylation of Mycobacterium tuberculosis Ser/Thr phosphatase by PknA and PknB.
Directory of Open Access Journals (Sweden)
Andaleeb Sajid
2011-03-01
Full Text Available The integrated functions of 11 Ser/Thr protein kinases (STPKs and one phosphatase manipulate the phosphorylation levels of critical proteins in Mycobacterium tuberculosis. In this study, we show that the lone Ser/Thr phosphatase (PstP is regulated through phosphorylation by STPKs.PstP is phosphorylated by PknA and PknB and phosphorylation is influenced by the presence of Zn(2+-ions and inorganic phosphate (Pi. PstP is differentially phosphorylated on the cytosolic domain with Thr(137, Thr(141, Thr(174 and Thr(290 being the target residues of PknB while Thr(137 and Thr(174 are phosphorylated by PknA. The Mn(2+-ion binding residues Asp(38 and Asp(229 are critical for the optimal activity of PstP and substitution of these residues affects its phosphorylation status. Native PstP and its phosphatase deficient mutant PstP(c (D38G are phosphorylated by PknA and PknB in E. coli and addition of Zn(2+/Pi in the culture conditions affect the phosphorylation level of PstP. Interestingly, the phosphorylated phosphatase is more active than its unphosphorylated equivalent.This study establishes the novel mechanisms for regulation of mycobacterial Ser/Thr phosphatase. The results indicate that STPKs and PstP may regulate the signaling through mutually dependent mechanisms. Consequently, PstP phosphorylation may play a critical role in regulating its own activity. Since, the equilibrium between phosphorylated and non-phosphorylated states of mycobacterial proteins is still unexplained, understanding the regulation of PstP may help in deciphering the signal transduction pathways mediated by STPKs and the reversibility of the phenomena.
International Nuclear Information System (INIS)
2011-01-01
After a presentation of the French nuclear safety authority (ASN) and of some events which occurred in 2010, this report present the actions performed by the ASN in different fields: nuclear activities (ionizing radiations and risks for health and for the environment), principles and actors of control of nuclear safety, radiation protection and environment protection, regulation, control of nuclear activities and of exposures to ionizing radiations, emergency situations, public information and transparency, international relationship. It proposes a regional overview of nuclear safety and radiation protection in France. It addresses the activities controlled by the ASN: medical and non medical usages of ionizing radiations, transportation of radioactive materials, electronuclear power stations, installations involved in the nuclear fuel cycle, research nuclear installations and other nuclear installations, safety in basic nuclear installation dismantling, radioactive wastes and polluted sites
Affholter, J A; Cascieri, M A; Bayne, M L; Brange, J; Casaretto, M; Roth, R A
1990-08-21
Insulin-degrading enzyme (IDE) hydrolyzes insulin at a limited number of sites. Although the positions of these cleavages are known, the residues of insulin important in its binding to IDE have not been defined. To this end, we have studied the binding of a variety of insulin analogues to the protease in a solid-phase binding assay using immunoimmobilized IDE. Since IDE binds insulin with 600-fold greater affinity than it does insulin-like growth factor I (25 nM and approximately 16,000 nM, respectively), the first set of analogues studied were hybrid molecules of insulin and IGF I. IGF I mutants [insB1-17,17-70]IGF I, [Tyr55,Gln56]IGF I, and [Phe23,Phe24,Tyr25]IGF I have been synthesized and share the property of having insulin-like amino acids at positions corresponding to primary sites of cleavage of insulin by IDE. Whereas the first two exhibit affinities for IDE similar to that of wild type IGF I, the [Phe23,Phe24,Tyr25]IGF I analogue has a 32-fold greater affinity for the immobilized enzyme. Replacement of Phe-23 by Ser eliminates this increase. Removal of the eight amino acid D-chain region of IGF I (which has been predicted to interfere with binding to the 23-25 region) results in a 25-fold increase in affinity for IDE, confirming the importance of residues 23-25 in the high-affinity recognition of IDE. A similar role for the corresponding (B24-26) residues of insulin is supported by the use of site-directed mutant and semisynthetic insulin analogues. Insulin mutants [B25-Asp]insulin and [B25-His]insulin display 16- and 20-fold decreases in IDE affinity versus wild-type insulin.(ABSTRACT TRUNCATED AT 250 WORDS)
ASN report on the status of nuclear safety and radiation protection in France in 2011
International Nuclear Information System (INIS)
2012-01-01
The first part of this huge report proposes a detailed overview of ASN activities in different fields: ionizing radiations related to nuclear activities and risks for health and the environment, principles and actors of nuclear safety control, of radiation protection and of protection of the environment, regulation, control of nuclear activities and exposures to ionizing radiations, emergency situations, public information and transparency, international relationships, regional overview of nuclear safety and radiation protection. The second part addresses the activities controlled by the ASN: medical use of ionizing radiations, non medical use of ionizing radiations, transport of radioactive materials, electronuclear power stations, facilities involved in the nuclear fuel cycle, research facilities and other nuclear installations, the safety of dismantling of nuclear base installations, radioactive wastes and polluted sites and soils
β-γ and isomeric decay spectroscopy of 168Dy
Directory of Open Access Journals (Sweden)
Zhang G.X.
2018-01-01
Full Text Available This contribution will report on the experimental work on the level structure of 168Dy. The experimental data have been taken as part of the EURICA decay spectroscopy campaign at RIBF, RIKEN in November 2014. In the experiment, a 238U primary beam is accelerated up to 345 MeV/u with an average intensity of 12 pnA. The nuclei of interest are produced by in-flight fission of 238U impinging on Be target with a thickness of 5 mm. The excited states of 168Dy have been populated through the decay from a newly identified isomeric state and via the β decay from 168Tb. In this contribution, scientific motivations, experimental procedure and some preliminary results for this study are presented.
β-γ and isomeric decay spectroscopy of 168Dy
Zhang, G. X.; Watanabe, H.; Kondev, F. G.; Lane, G. J.; Regan, P. H.; Söderström, P.-A.; Walker, P. M.; Kanaoka, H.; Korkulu, Z.; Lee, P. S.; Liu, J. J.; Nishimura, S.; Wu, J.; Yagi, A.; Ahn, D. S.; Alharbi, T.; Baba, H.; Browne, F.; Bruce, A. M.; Carroll, R. J.; Chae, K. Y.; Dombradi, Zs.; Doornenbal, P.; Estrade, A.; Fukuda, N.; Griffin, C.; Ideguchi, E.; Inabe, N.; Isobe, T.; Kanaya, S.; Kojouharov, I.; Kubo, T.; Kubono, S.; Kurz, N.; Kuti, I.; Lalkovski, S.; Lee, C. S.; Lee, E. J.; Lorusso, G.; Lotay, G.; Moon, C.-B.; Nishizuka, I.; Nita, C. R.; Odahara, A.; Patel, Z.; Phong, V. H.; Podolyák, Zs.; Roberts, O. J.; Sakurai, H.; Schaffner, H.; Shand, C. M.; Shimizu, Y.; Sumikama, T.; Suzuki, H.; Takeda, H.; Terashima, S.; Vajta, Zs.; Valiente-Dóbon, J. J.; Xu, Z. Y.
2018-05-01
This contribution will report on the experimental work on the level structure of 168Dy. The experimental data have been taken as part of the EURICA decay spectroscopy campaign at RIBF, RIKEN in November 2014. In the experiment, a 238U primary beam is accelerated up to 345 MeV/u with an average intensity of 12 pnA. The nuclei of interest are produced by in-flight fission of 238U impinging on Be target with a thickness of 5 mm. The excited states of 168Dy have been populated through the decay from a newly identified isomeric state and via the β decay from 168Tb. In this contribution, scientific motivations, experimental procedure and some preliminary results for this study are presented.
Ma, Qingtong; Qi, Can; Tie, Chong; Guo, Zhanjun
2013-11-10
Many studies have reported the role of xeroderma pigmentosum group D (XPD) with prostate cancer risk, but the results remained controversial. To derive a more precise estimation of the relationship, a meta-analysis was performed. Odds ratios (ORs) with 95% confidence intervals (CIs) were estimated to assess the association between XPD Asp312Asn and Lys751Gln polymorphisms and prostate cancer risk. A total of 8 studies including 2620 cases and 3225 controls described Asp312Asn genotypes, among which 10 articles involving 3230 cases and 3582 controls described Lys751Gln genotypes and were also involved in this meta-analysis. When all the eligible studies were pooled into this meta-analysis, a significant association between prostate cancer risk and XPD Asp312Asn polymorphism was found. For Asp312Asn polymorphism, in the stratified analysis by ethnicity and source of controls, prostate cancer risk was observed in co-dominant, dominant and recessive models, while no evidence of any associations of XPD Lys751Gln polymorphism with prostate cancer was found in the overall or subgroup analyses. Our meta-analysis supports that the XPD Asp312Asn polymorphism contributed to the risk of prostate cancer from currently available evidence. However, a study with a larger sample size is needed to further evaluate gene-environment interaction on XPD Asp312Asn and Lys751Gln polymorphisms and prostate cancer risk. © 2013.
Solid state chemistry of new polysulphides in A/Sn/S (A = Na, K, Rb ...
Indian Academy of Sciences (India)
Administrator
Solid state chemistry of new polysulphides in A/Sn/S (A = Na, K,. Rb) systems. M SUSEELA DEVI and K VIDYASAGAR. Department of Chemistry, Indian Institute of Technology Madras,. Chennai 600 036, India. Ternary polychalcogenides containing chalocogen–chalcogen bonds are metastable compounds that have been ...
26 CFR 5c.168(f)(8)-4 - Minimum investment of lessor.
2010-04-01
... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Minimum investment of lessor. 5c.168(f)(8)-4....168(f)(8)-4 Minimum investment of lessor. (a) Minimum investment. Under section 168(f)(8)(B)(ii), an... has a minimum at risk investment which, at the time the property is placed in service under the lease...
Energy Technology Data Exchange (ETDEWEB)
Alsanousi, Nesreen [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Sugiki, Toshihiko, E-mail: sugiki@protein.osaka-u.ac.jp [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Furuita, Kyoko; So, Masatomo; Lee, Young-Ho; Fujiwara, Toshimichi [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Kojima, Chojiro, E-mail: kojima-chojiro-xk@ynu.ac.jp [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Graduate School of Engineering, Yokohama National University, Tokiwadai 79-5, Hodogaya-ku, Yokohama 240-8501 (Japan)
2016-09-02
Humanin comprising 24 amino acid residues is a bioactive peptide that has been isolated from the brain tissue of patients with Alzheimer's disease. Humanin reportedly suppressed aging-related death of various cells due to amyloid fibrils and oxidative stress. There are reports that the cytoprotective activity of Humanin was remarkably enhanced by optical isomerization of the Ser14 residue from L to D form, but details of the molecular mechanism remained unclear. Here we demonstrated that Humanin D-Ser14 exhibited potent inhibitory activity against fibrillation of amyloid-β and remarkably higher binding affinity for amyloid-β than that of the Humanin wild-type and S14G mutant. In addition, we determined the solution structure of Humanin D-Ser14 by nuclear magnetic resonance (NMR) and showed that D-isomerization of the Ser14 residue enables drastic conformational rearrangement of Humanin. Furthermore, we identified an amyloid-β-binding site on Humanin D-Ser14 at atomic resolution by NMR. These biophysical and high-resolution structural analyses clearly revealed structure–function relationships of Humanin and explained the driving force of the drastic conformational change and molecular basis of the potent anti-amyloid-β fibrillation activity of Humanin caused by D-isomerization of the Ser14 residue. This is the first study to show correlations between the functional activity, tertiary structure, and partner recognition mode of Humanin and may lead to elucidation of the molecular mechanisms of the cytoprotective activity of Humanin. - Highlights: • Humanin D-Ser14 showed the strongest inhibitory activity against Aβ40 fibrillation. • NMR structure of Humanin D-Ser14 was determined in alcohol/water mixture solution. • Humanin D-Ser14 directly bound Aβ40 stronger than Humanin wild-type and Humanin S14G. • Aβ40 and zinc ion binding sites of Humanin D-Ser14 were identified. • Structure around Ser14 of Humanin is critical for Aβ40 binding and
Directory of Open Access Journals (Sweden)
Gonzalo Palazolo
2011-05-01
Full Text Available En este trabajo se evaluó la estabilidad a la congelación de emulsiones modelo aceite en agua (o/w preparadas con cuatro aislados de soja: dos nativos (ASN-1 y ASN-2, de similar composición pero diferente solubilidad, >90% y ~75%, respectivamente y dos desnaturalizados (ASD-1 y ASD-2, resultantes de calentar los respectivos aislados nativos (90 ‹C, 5 minutos. Las emulsiones preparadas con dispersiones acuosas al 2% p/v de ASN o ASD y aceite de girasol refinado (ƒ³ =0,25, se congelaron a -20 ‹C por 24 horas y luego se descongelaron a 20 ‹C. La estabilidad se evaluo a partir de medidas de distribución de tamano de partícula (difraccion laser y aceite liberado (AL, metodo de dilucion del colorante. Las emulsiones preparadas con ASN-2 y ASD-2 resultaron muy inestables despues de ser congeladas y descongeladas, resultadoque se evidenció por el aumento del tamano de partícula y un AL>25%. Al usar el aislado ASN-1 de mayor solubilidad, las emulsiones fueron mas estables y se observó un marcado incremento de la estabilidad cuando sus proteínas eran desnaturalizadas (ASD-1, no observándose prácticamente coalescencia ni aceite separado. En conclusión, la solubilidad y la desnaturalización proteíca de los aislados de soja son factores decisivos en la estabilidad de emulsiones frente a la congelación-descongelación.
Directory of Open Access Journals (Sweden)
Eneida Pérez Candelaria
2010-01-01
Full Text Available OBJETIVO: Evaluar la seguridad y la eficacia del tratamiento con láser in situ keratomileusis en pacientes con defectos residuales posqueratotomía radial. MÉTODOS: Se realizó un estudio descriptivo de tipo prospectivo longitudinal a 55 ojos de 31 pacientes con miopía y/o astigmatismo residuales posqueratotomía radial reoperados con láser in situ keratomileusis en el Servicio de Cirugía Refractiva del Instituto Cubano de Oftalmología "Ramón Pando Ferrer" desde enero a junio del 2007. En la selección de los pacientes, se utilizaron estrictos criterios de inclusión y exclusión utilizándose las variables: error refractivo residual en equivalente esférico medio, la agudeza visual sin corrección y la mejor agudeza visual corregida preLASIK y posLASIK, así como las complicaciones transoperatorias y postoperatorias. El seguimiento promedio de los pacientes fue de 12 ± 3 meses. RESULTADOS: El equivalente esférico posLASIK disminuyó notablemente en el primer día del posoperatorio y se mantuvo estable en la última consulta. La agudeza visual sin corrección posLASIK fue 1,0 (20/20 en 22 ojos (40 % y > 0,5 (20/40 en 44 ojos (80 %. En 11 ojos (20 %, la mejor agudeza visual corregida mejoró 1 línea en la cartilla de Snellen. Se presentócomo complicación intraoperatoria un ojo con perforación central del flap corneal y dentro de las complicaciones postoperatorias se reportaron detritus y restos hemáticos en la interfase en 2 ojos, pliegues finos del colgajo en un solo ojo y epitelización de la interfase fuera del eje visual igualmente, en un solo ojo. CONCLUSIONES: El Láser in situ keratomileusis puede ser usado exitosamente en la corrección de la miopía y el astigmatismo posqueratotomía radial en casos debidamente seleccionados.OBJECTIVE: To evaluate the safety and the efficacy of the Laser in Situ Keratomileusis treatment in patients with residual defects after radial keratotomy. METHODS: A prospective, longitudinal and
DEFF Research Database (Denmark)
Sottrup-Jensen, Lars; Stepanik, T M; Jones, C M
1984-01-01
-775). These fragments account for 603 of the 1451 residues of the subunits of alpha 2-macroglobulin. CB2 contains two glucosamine-based carbohydrate groups attached to Asn-23 and Asn-38, and one internal disulfide bridge connecting Cys-16 with Cys-54. CB6 contains one glucosamine-based carbohydrate group attached...... to Asn-1 and two internal disulfide bridges (Cys-5 bound to Cys-53 and Cys-23 bound to Cys-41, respectively); Cys-32 is bound to Cys-16 in CB8. CB7 contains two glucosamine-based carbohydrate groups attached to Asn-78 and Asn-92, CB8 contains 1 Cys residue (Cys-16), bridged to Cys-32 of CB6. CB11...
Gashi, Zafer; Elezaj, Shkelzen; Zeqiraj, Afrim; Grabanica, Driton; Shabani, Isak; Gruda, Bujar; Gashi, Fitore
2016-01-01
Introduction: This study investigated association of Asn680Ser FSHR polymorphism with the ovarian response in 104 women of Albanian ethnic population enrolled in ICSI program. The reason of infertility in all cases has been identified as male factor. Methods: Analysis of the Asn680Ser polymorphism was performed using TaqMan? SNP Genotyping Assay. Clinical and endocrinologic parameters were analyzed based on the genotype, age, BMI, oocyte yield, number of transferred embryos and pregnancy rate...
International Nuclear Information System (INIS)
Dinu, A.; Nedelcu, L.
1995-01-01
The in-service experience of Zr - 2.5 % Nb pressure tubes in CANDU-type nuclear reactors has demonstrated very good performance over a long period of time. However, analyses done by AECL specialists on most failure cases, showed that a big percentage of defects are manufacturing defects, which appear mostly at the beginning of the rolled-joint zone. It has been observed that a correct rolling ensures an acceptable distribution of residual stress, but an incorrect one leads to an accumulation of big values of residual stress. This determines a preferential radial orientation of hydrides, which during operation in the reactor can produce DHC. To ensure a suitable performance of the Zr - 2.5 % Nb pressure tubes in the CANDU reactor, it is very important to have a correct rolling as mentioned in the procedure. This work presents a methodology for the measurement of the stressing state in the surfaces layers of the rolled-joint zone. The X-ray diffraction method can also be used for establishing the residual stress distribution across the tub wall, in order to ensure a good performance at Cernavoda nuclear plant. The results obtained for the investigated tube have led to the conclusion that the rolling process was correctly applied in this case, the values obtained for the residual stress being in good agreement with those accepted in literature. (Author) 2 Figs., 2 Tabs
Energy Technology Data Exchange (ETDEWEB)
U.S. Department of Energy, National Nuclear Security Administration Nevada
2001-11-21
This Corrective Action Investigation Plan contains the U.S. Department of Energy, National Nuclear Security Administration Nevada Operations Office's approach to collect data necessary to evaluate corrective action alternatives appropriate for the closure of Corrective Action Unit 168 under the Federal Facility Agreement and Consent Order. Corrective Action Unit 168 consists of a group of twelve relatively diverse Corrective Action Sites (CASs 25-16-01, Construction Waste Pile; 25-16-03, MX Construction Landfill; 25-19-02, Waste Disposal Site; 25-23-02, Radioactive Storage RR Cars; 25-23-18, Radioactive Material Storage; 25-34-01, NRDS Contaminated Bunker; 25-34-02, NRDS Contaminated Bunker; CAS 25-23-13, ETL - Lab Radioactive Contamination; 25-99-16, USW G3; 26-08-01, Waste Dump/Burn Pit; 26-17-01, Pluto Waste Holding Area; 26-19-02, Contaminated Waste Dump No.2). These CASs vary in terms of the sources and nature of potential contamination. The CASs are located and/or associated wit h the following Nevada Test Site (NTS) facilities within three areas. The first eight CASs were in operation between 1958 to 1984 in Area 25 include the Engine Maintenance, Assembly, and Disassembly Facility; the Missile Experiment Salvage Yard; the Reactor Maintenance, Assembly, and Disassembly Facility; the Radioactive Materials Storage Facility; and the Treatment Test Facility Building at Test Cell A. Secondly, the three CASs located in Area 26 include the Project Pluto testing area that operated from 1961 to 1964. Lastly, the Underground Southern Nevada Well (USW) G3 (CAS 25-99-16), a groundwater monitoring well located west of the NTS on the ridgeline of Yucca Mountain, was in operation during the 1980s. Based on site history and existing characterization data obtained to support the data quality objectives process, contaminants of potential concern (COPCs) for CAU 168 are primarily radionuclide; however, the COPCs for several CASs were not defined. To address COPC
SNOOP module CAMAC interface to the 168/E microprocessor
International Nuclear Information System (INIS)
Bernstein, D.; Carroll, J.T.; Mitnick, V.H.; Paffrath, L.; Parker, D.B.
1979-10-01
A pair of 168/E microprocessors will be used to meet the realtime computing requirements of the SLAC Hybrid Facility. A SNOOP module and 168/E Interface provide the link between the host computer and the microprocessors. By eavesdropping on normal CAMAC read operations, the SNOOP provides a direct data transfer from CAMAC to microprocessor memory. The host computer controls the processors using standard CAMAC programmed I/O to the SNOOP
Lifescience Database Archive (English)
Full Text Available TAACAAAAACTAGTAATTTAAAAA AAAAAAAAACCNAAAAAAAAAXXXXXXXXXXAATGTCCANATTTCCATANATGTGT...>SFG168Z.Seq ----------AATGTCCANATTTCCATANATGTGTTNAAANACGTGGTGGTATNTTAAGN TGTGAATTTNANCCNCCAAGACAACCAAGATCCC...GTAAAATCAATTTGTAACAAAAACTAGTAATTTAAAAA AAAAAAAAACCNAAAAAAAAA----------AATGTCCANATTTCCATANATGTGTTNAA ANACGTGG
26 CFR 1.168(h)-1 - Like-kind exchanges involving tax-exempt use property.
2010-04-01
... property. 1.168(h)-1 Section 1.168(h)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE... and Corporations § 1.168(h)-1 Like-kind exchanges involving tax-exempt use property. (a) Scope. (1... property (as defined in section 168(h)) at the time of the transfer; and (ii) Property that does not become...
DEFF Research Database (Denmark)
Gallina, Serafina; Cunsolo, Vincenzo; Saletti, Rosaria
2016-01-01
Lactoferrin, a protein showing an array of biochemical properties, including immuno-modulation, iron-binding ability, as well as antioxidant, antibacterial and antiviral activities, but which may also represent a potential milk allergen, was isolated from donkey milk by ion exchange chromatography...... characterization of donkey lactoferrin sequence, that, at least for the covered sequence, differs from the horse genomic deduced sequence (UniProtKB Acc. Nr. O77811) by five point substitutions located at positions 91 (Arg → His), 328 (Thr → Ile/Leu), 466 (Ala → Gly), 642 (Asn → Ser) and 668 (Ser → Ala). Analysis...... of the glycosylated protein showed that glycans in donkey lactoferrin are linked to the protein backbone via an amide bond to asparagine residues located at the positions 137, 281 and 476....
29 CFR 4.168 - Wage payments-deductions from wages paid.
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Wage payments-deductions from wages paid. 4.168 Section 4... Standards Compliance with Compensation Standards § 4.168 Wage payments—deductions from wages paid. (a) The wage requirements of the Act will not be met where unauthorized deductions, rebates, or refunds reduce...
Centrifugal stretching along the ground state band of 168Hf
International Nuclear Information System (INIS)
Costin, A.; Pietralla, N.; Reese, M.; Moeller, O.; Ai, H.; Casten, R. F.; Heinz, A.; McCutchan, E. A.; Meyer, D. A.; Qian, J.; Werner, V.; Dusling, K.; Fitzpatrick, C. R.; Guerdal, G.; Petkov, P.; Rainovski, G.
2009-01-01
The lifetimes of the J π =4 + , 6 + , 8 + , and 10 + levels along the ground state band in 168 Hf were measured by means of the recoil distance Doppler shift (RDDS) method using the New Yale Plunger Device (NYPD) and the SPEEDY detection array at Wright Nuclear Structure Laboratory of Yale University. Excited states in 168 Hf were populated using the 124 Sn( 48 Ti,4n) fusion evaporation reaction. The new lifetime values are sufficiently precise to clearly prove the increase of quadrupole deformation as a function of angular momentum in the deformed nucleus 168 Hf. The data agree with the predictions from the geometrical confined β-soft (CBS) rotor model that involves centrifugal stretching in a soft potential
New Promotion Patterns in Italian Universities: Less Seniority and More Productivity? Data from ASN
Marini, Giulio
2017-01-01
The new habilitation (ASN), established in Italy in 2010 and launched in 2012, was introduced to filter eligible candidates in the competition of associate and full professorships. Its purpose is to cut off poor candidates on the basis of individual scientific productivity before they might be hired in competitions where patronage may favor them.…
Directory of Open Access Journals (Sweden)
Justin W Leung
2014-03-01
Full Text Available Histone ubiquitinations are critical for the activation of the DNA damage response (DDR. In particular, RNF168 and RING1B/BMI1 function in the DDR by ubiquitinating H2A/H2AX on Lys-13/15 and Lys-118/119, respectively. However, it remains to be defined how the ubiquitin pathway engages chromatin to provide regulation of ubiquitin targeting of specific histone residues. Here we identify the nucleosome acid patch as a critical chromatin mediator of H2A/H2AX ubiquitination (ub. The acidic patch is required for RNF168- and RING1B/BMI1-dependent H2A/H2AXub in vivo. The acidic patch functions within the nucleosome as nucleosomes containing a mutated acidic patch exhibit defective H2A/H2AXub by RNF168 and RING1B/BMI1 in vitro. Furthermore, direct perturbation of the nucleosome acidic patch in vivo by the expression of an engineered acidic patch interacting viral peptide, LANA, results in defective H2AXub and RNF168-dependent DNA damage responses including 53BP1 and BRCA1 recruitment to DNA damage. The acidic patch therefore is a critical nucleosome feature that may serve as a scaffold to integrate multiple ubiquitin signals on chromatin to compose selective ubiquitinations on histones for DNA damage signaling.
Liang, Jing; Han, Qian; Ding, Haizhen; Li, Jianyong
2017-12-01
In available insect genomes, there are several L-3,4-dihydroxyphenylalanine (L-dopa) decarboxylase (DDC)-like or aromatic amino acid decarboxylase (AAAD) sequences. This contrasts to those of mammals whose genomes contain only one DDC. Our previous experiments established that two DDC-like proteins from Drosophila actually mediate a complicated decarboxylation-oxidative deamination process of dopa in the presence of oxygen, leading to the formation of 3,4-dihydroxyphenylacetaldehyde (DHPA), CO 2 , NH 3, and H 2 O 2 . This contrasts to the typical DDC-catalyzed reaction, which produces CO 2 and dopamine. These DDC-like proteins were arbitrarily named DHPA synthases based on their critical role in insect soft cuticle formation. Establishment of reactions catalyzed by these AAAD-like proteins solved a puzzle that perplexed researchers for years, but to tell a true DHPA synthase from a DDC in the insect AAAD family remains problematic due to high sequence similarity. In this study, we performed extensive structural and biochemical comparisons between DHPA synthase and DDC. These comparisons identified several target residues potentially dictating DDC-catalyzed and DHPA synthase-catalyzed reactions, respectively. Comparison of DHPA synthase homology models with crystal structures of typical DDC proteins, particularly residues in the active sites, provided further insights for the roles these identified target residues play. Subsequent site-directed mutagenesis of the tentative target residues and activity evaluations of their corresponding mutants determined that active site His192 and Asn192 are essential signature residues for DDC- and DHPA synthase-catalyzed reactions, respectively. Oxygen is required in DHPA synthase-mediated process and this oxidizing agent is reduced to H 2 O 2 in the process. Biochemical assessment established that H 2 O 2 , formed in DHPA synthase-mediated process, can be reused as oxidizing agent and this active oxygen species is reduced to H 2
40 CFR 35.168 - Award limitations.
2010-07-01
... STATE AND LOCAL ASSISTANCE Environmental Program Grants Water Pollution Control (section 106) § 35.168...) The State monitors and compiles, analyzes, and reports water quality data as described in section 106... October 18, 1972, a summary report of the current status of the State pollution control program, including...
Akiyama, Y.; Heyde, K.; Arima, A.; Yoshinaga, N.
1986-05-01
Extending the interacting boson model by incorporating besides s and d, also the g-boson, we can describe the population of positive parity states of 168Er in the 166Er(t,P) 168Er reaction rather well. In particular, the excitation of I,Kπi = 4,3 +1; 2,2 +2; 0,0 +3 and 0,0 +4 states is much improved over the sd-IBM approach.
42 CFR 460.168 - Reinstatement in other Medicare and Medicaid programs.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Reinstatement in other Medicare and Medicaid programs. 460.168 Section 460.168 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF... Reinstatement in other Medicare and Medicaid programs. To facilitate a participant's reinstatement in other...
Cockrell, Shelley K.; Huffman, Jamie B.; Toropova, Katerina; Conway, James F.; Homa, Fred L.
2011-01-01
The herpes simplex virus 1 (HSV-1) UL25 gene product is a minor capsid component that is required for encapsidation, but not cleavage, of replicated viral DNA. UL25 is located on the capsid surface in a proposed heterodimer with UL17, where five copies of the heterodimer are found at each of the capsid vertices. Previously, we demonstrated that amino acids 1 to 50 of UL25 are essential for its stable interaction with capsids. To further define the UL25 capsid binding domain, we generated recombinant viruses with either small truncations or amino acid substitutions in the UL25 N terminus. Studies of these mutants demonstrated that there are two important regions within the capsid binding domain. The first 27 amino acids are essential for capsid binding of UL25, while residues 26 to 39, which are highly conserved in the UL25 homologues of other alphaherpesviruses, were found to be critical for stable capsid binding. Cryo-electron microscopy reconstructions of capsids containing either a small tag on the N terminus of UL25 or the green fluorescent protein (GFP) fused between amino acids 50 and 51 of UL25 demonstrate that residues 1 to 27 of UL25 contact the hexon adjacent to the penton. A second region, most likely centered on amino acids 26 to 39, contacts the triplex that is one removed from the penton. Importantly, both of these UL25 capsid binding regions are essential for the stable packaging of full-length viral genomes. PMID:21411517
Kobayashi, Hiroko; Motoyoshi, Naomi; Itagaki, Tadashi; Suzuki, Mamoru; Inokuchi, Norio
2015-01-01
RNase He1 from Hericium erinaceus, a member of the RNase T1 family, has high identity with RNase Po1 from Pleurotus ostreatus with complete conservation of the catalytic sequence. However, the optimal pH for RNase He1 activity is lower than that of RNase Po1, and the enzyme shows little inhibition of human tumor cell proliferation. Hence, to investigate the potential antitumor activity of recombinant RNase He1 and to possibly enhance its optimum pH, we generated RNase He1 mutants by replacing 12 Asn/Gln residues with Asp/Glu residues; the amino acid sequence of RNase Po1 was taken as reference. These mutants were then expressed in Escherichia coli. Using site-directed mutagenesis, we successfully modified the optimal pH for enzyme activity and generated a recombinant RNase He1 that inhibited the proliferation of cells in the human leukemia cell line. These properties are extremely important in the production of anticancer biologics that are based on RNase activity.
Rapid detection of acetamiprid in foods using surface-enhanced Raman spectroscopy (SERS).
Wijaya, Wisiani; Pang, Shintaro; Labuza, Theodore P; He, Lili
2014-04-01
Acetamiprid is a neonicotinoid pesticide that is commonly used in modern farming. Acetamiprid residue in food commodities can be a potential harm to human and has been implicated in the honey bee hive die off crisis. In this study, we developed rapid, simple, and sensitive methods to detect acetamiprid in apple juice and on apple surfaces using surface-enhanced Raman spectroscopy (SERS). No pretreatment of apple juice sample was performed. A simple surface swab method was used to recover acetamiprid from the apple surface. Samples were incubated with silver dendrites for several minutes and SERS spectra were taken directly from the silver surface. Detection of a set of 5 apple juice samples can be done within 10 min. The swab-SERS method took 15 min for a set of 5 samples. Resulting spectral data were analyzed using principal component analysis. The highest acetamiprid peak at 634 cm(-1) was used to detect and quantify the amount of acetamiprid spiked in 1:1 water-methanol solvent, apple juice, and on apple surface. The SERS method was able to successfully detect acetamiprid at 0.5 μg/mL (0.5 ppm) in solvent, 3 μg/mL (3 ppm) in apple juice, and 0.125 μg/cm(2) on apple surfaces. The SERS methods provide simple, rapid, and sensitive ways to detect acetamiprid in beverages and on the surfaces of thick skinned fruits and vegetables. © 2014 Institute of Food Technologists®
DEFF Research Database (Denmark)
Zhang, Roger S; Wright, Jordan; Pless, Stephan Alexander
2015-01-01
modest effects on gating kinetics despite significant changes in ATP sensitivity and open probability. However, we identified a pair of highly conserved neighboring amino acids (Trp68, Lys170) that control the rate of channel opening and inhibition in response to ATP. Paradoxically, mutations of Trp68...... or Lys170 markedly slow the kinetics of channel opening (500 ms and 700 ms for Trp68Leu and Lys170Asn, respectively), while increasing channel open probability. Examining the functional effects of these residues using phi-value analysis revealed a steep negative slope. This finding implies...
Sun, Mei; Zhao, Aiwu; Wang, Dapeng; Wang, Jin; Chen, Ping; Sun, Henghui
2018-04-01
As a novel surface-enhanced Raman spectroscopic (SERS) nanocomposite, cube-like Fe3O4@SiO2@Au@Ag magnetic nanoparticles (NPs) were synthesized for the first time. Cube-like α-Fe2O3 NPs with uniform size were achieved by optimizing reaction temperature and time. Firstly, the cube-like Fe3O4@SiO2 with good dispersity was achieved by calcining α-Fe2O3@SiO2 NPs in hydrogen atmosphere at 360 °C for 2.5 h, followed by self-assembling a PEI shell via sonication. Furthermore, the Au@Ag particles were densely assembled on the Fe3O4@SiO2 NPs to form the Fe3O4@SiO2@Au@Ag composite structure via strong Ag-N interaction. The obtained nanocomposites exhibited an excellent SERS behavior, reflected by the low detection of limit (p-ATP) at the 5 × 10-14 M level. Moreover, these nanocubes were used for the detection of thiram, and the detection limit can reach 5 × 10-11 M. Meanwhile, the U.S. Environmental Protection Agency specifies that the residue in fruit must be lower than 7 ppm. Hence, the resulting substrate with high SERS activity has great practical potential applications in the rapid detection of chemical, biological, and environment pollutants with a simple portable Raman instrument at trace level.
Kang, Chang Soo; Son, Seung-Yeol; Bang, In Seok
2008-12-01
The cabbage butterfly (Artogeia rapae) antimicrobial peptide hinnavinII as a member of cecropin family is synthesized as 37 residues in size with an amidated lysine at C-terminus and shows the humoral immune response to a bacterial invasion. In this work, a synthetic gene for hinnavinII-38-Asn (HIN) with an additional amino acid asparagine residue containing amide group at C-terminus was cloned into pET-32a(+) vector to allow expression of HIN as a Trx fusion protein in Escherichia coli strain BL21 (DE3) pLysS. The resulting expression level of the fusion protein Trx-HIN could reach 15-20% of the total cell proteins and more than 70% of the target proteins were in soluble form. The fusion protein could be purified successfully by HiTrap Chelating HP column and a high yield of 15 mg purified fusion protein was obtained from 80 ml E. coli culture. Recombinant HIN was readily obtained by enterokinase cleavage of the fusion protein followed by FPLC chromatography, and 3.18 mg pure active recombinant HIN was obtained from 80 ml culture. The molecular mass of recombinant HIN determined by MALDI-TOF mass spectrometer is 4252.084 Da which matches the theoretical mass (4252.0 Da) of HIN. Comparing the antimicrobial activities of the recombinant hinnavinII with C-amidated terminus to that without an amidated C-terminus, we found that the amide of asparagine at C-terminus of hinnavinII improved its potency on certain microorganism such as E. coli, Enterobacter cloacae, Bacillus megaterium, and Staphylococcus aureus.
Development of SERS active fibre sensors
International Nuclear Information System (INIS)
Polwart, Ewan
2002-01-01
Surface-enhanced Raman scattering (SERS) is sensitive and selective and when coupled with fibre-optics could potentially produce an effective chemical sensing system. This thesis concerns the development of a single-fibre-based sensor, with an integral SERS-active substrate. A number of different methods for the manufacture of SERS-active surfaces on glass substrates were investigated and compared. The immobilisation of metal nanoparticles on glass functionalised with (3-aminopropyl)trimethoxysilane emerged as a suitable approach for the production of sensors. Substrates prepared by this approach were characterised using UV-visible spectroscopy, electron microscopy and Raman mapping. It was found that exposure of substrates to laser radiation led to a decrease in the signal recorded from adsorbed analytes. This speed of the decrease was shown to depend on the analyte, and the exciting wavelength and power. SERS-active fibre sensors were produced by immobilisation of silver nanoparticles at the distal end of a (3-aminopropyl)trimethoxysilane-derivatised optical fibre. These sensors were used to obtain spectra with good signal to noise ratios from 4-(benzotriazol-5-ylazo)-3,5-dimethoxyphenylamine and crystal violet. Sensing of dyes in effluent was also investigated. The development of sensors for the measurement of pH, by treating the SERS-active fibre tip with pH sensitive dyes is also described. Spectral changes were observed with these sensors as a response to the pH. Partial least squares regression was used to produce linear calibration models for the pH range 5-11 from which it was possible to predict the pH with an accuracy of ∼0.2 pH units. Some of the limitations of these sensors were explored. The feasibility of using these sensors for measurement of oxygen and thiols, was investigated. The measurement of oxygen using methylene blue as a transducer was demonstrated. Two transduction methodologies--reactions with iron porphyrins and pyrrole-2,5-diones
[TLC-FT-SERS study on ingredients of Isrhynchophylline].
Wang, Yuan; Wang, Song-ying; Zhao, Yi-xue; Ren, Gui-fen; Zi, Feng-lan
2002-02-01
A new method for analysing the ingredients of Isrhynchophylline in Uncaria Rhynchophylla Jacks by thin layer chromatography (TLC) and the surface-enhanced Raman spectroscopy (SERS) is reported in this paper. The results show that the characteristic spectra bands of Isrhynchophylline situated at the thin layer with the amount of sample about 2.5 micrograms were obtained. The difference between SERS and solid spectra was found. Great enhancement of the 1,615 cm-1 spectral band was abstained. Molecule was absorbed in surface silver sol by pi electrons in phenyl and by pair of electrons in N together. An absorption model of Isrhynchophylline and silver sol was proposed. This method can be used to analyse the chemical ingredients with high sensitivity.
Thermodynamic Effects of Replacements of Pro Residues in Helix Interiors of Maltose-Binding Protein
Prajapati, RS; Lingaraju, GM; Bacchawat, Kiran; Surolia, Avadhesha; Varadarajan, Raghavan
2003-01-01
Introduction of Pro residues into helix interiors results in protein destabilization. It is currently unclear if the converse substitution (i.e., replacement of Pro residues that naturally occur in helix interiors would be stabilizing). Maltose-binding protein is a large 370-amino acid protein that contains 21 Pro residues. Of these, three nonconserved residues (P48, P133, and P159) occur at helix interiors. Each of the residues was replaced with Ala and Ser. Stabilities were characterized by...
2010-04-01
... Evaluations § 1000.361 Will the annual review include a review of the Secretary's residual trust functions... Department official will be notified of the need for corrective action. The review of the Secretary's trust... 25 Indians 2 2010-04-01 2010-04-01 false Will the annual review include a review of the Secretary...
Clinical and Biological Manifestation of RNF168 Deficiency in Two Polish Siblings
Directory of Open Access Journals (Sweden)
Barbara Pietrucha
2017-12-01
Full Text Available Germline mutations in the RING finger protein gene RNF168 have been identified in a combined immunodeficiency disorder called RIDDLE syndrome. Since only two patients have been described with somewhat different phenotypes, there is need to identify further patients. Here, we report on two Polish siblings with RNF168 deficiency due to homozygosity for a novel frameshift mutation, c.295delG, that was identified through exome sequencing. Both patients presented with immunoglobulin deficiency, telangiectasia, cellular radiosensitivity, and increased alpha-fetoprotein (AFP levels. The younger sibling had a more pronounced neurological and morphological phenotype, and she also carried an ATM gene mutation in the heterozygous state. Immunoblot analyses showed absence of RNF168 protein, whereas ATM levels and function were proficient in lymphoblastoid cells from both patients. Consistent with the absence of RNF168 protein, 53BP1 recruitment to DNA double-strand breaks (DSBs after irradiation was undetectable in lymphoblasts or primary fibroblasts from either of the two patients. γH2AX foci accumulated normally but they disappeared with significant delay, indicating a severe defect in DSB repair. A comparison with the two previously identified patients indicates immunoglobulin deficiency, cellular radiosensitivity, and increased AFP levels as hallmarks of RNF168 deficiency. The variability in its clinical expression despite similar cellular phenotypes suggests that some manifestations of RNF168 deficiency may be modified by additional genetic or epidemiological factors.
Purkan; Ihsanawati; Natalia, D; Syah, Y M; Retnoningrum, D S; Kusuma, H S
2016-01-01
Mutations in katG gene are often associated with isoniazid (INH) resistance in Mycobacterium tuberculosis strain. This research was perfomed to identify the katG mutation in clinical isolate (L8) that is resistant to INH at 1 μg/ml. In addition to characterize the catalase-peroxidase of KatG L8 and perform the ab initio structural study of the protein to get a more complete understanding in drug activation and the resistance mechanism. The katG gene was cloned and expressed in Escherichia coli, then followed by characterization of catalase-peroxidase of KatG. The structure modelling was performed to know a basis of alterations in enzyme activity. A substitution of A713G that correspond to Asn238Ser replacement was found in the L8 katG. The Asn238Ser modification leads to a decline in the activity of catalase-peroxidase and INH oxidation of the L8 KatG protein. The catalytic efficiency (Kcat/KM) of mutant KatGAsn238Ser respectively decreases to 41 and 52% for catalase and peroxidase. The mutant KatGAsn238Ser also shows a decrease of 62% in INH oxidation if compared to a wild type KatG (KatGwt). The mutant Asn238Ser might cause instability in the substrate binding site of KatG, because of removal of a salt bridge connecting the amine group of Asn238 to the carboxyl group of Glu233, which presents in KatGwt. The lost of the salt bridge in the substrate binding site in mutant KatGAsn238Ser created changes unfavorable for enzyme activities, which in turn emerge as INH resistance in the L8 isolate of M. tuberculosis.
Directory of Open Access Journals (Sweden)
Pamela A. Mosier-Boss
2017-11-01
Full Text Available Surface enhanced Raman spectroscopy (SERS has been widely used for chemical detection. Moreover, the inherent richness of the spectral data has made SERS attractive for use in detecting biological materials, including bacteria. This review discusses methods that have been used to obtain SERS spectra of bacteria. The kinds of SERS substrates employed to obtain SERS spectra are discussed as well as how bacteria interact with silver and gold nanoparticles. The roll of capping agents on Ag/Au NPs in obtaining SERS spectra is examined as well as the interpretation of the spectral data.
Girolami, Antonio; Vidal, Josè; Sabagh, Marcela; Salagh, Marcela; Gervan, Nora; Parody, Maria; Peroni, Edoardo; Sambado, Luisa; Guglielmone, Hugo
2014-07-01
Prekallikrein (PK) is one of the clotting factors involved in the contact phase of blood. PK has an important historical role as its deficiency state represents the second instance of a clotting defect without bleeding manifestations, the first one being factor XII deficiency. PK deficiency is a rare clotting disorder. Moreover, only 11 patients have been investigated so far by molecular biology techniques. In this article, we briefly review some of the history around PK and also present some recent data on a newly identified family from Argentina suffering from PK deficiency. Two patients are homozygous whereas other family members are heterozygous. PK activity and antigen are 1% of normal in the homozygotes and around 60 to 70% of normal in the heterozygotes. As expected, all patients are asymptomatic of bleeding or thrombosis presentations. However, the two homozygotes showed essential hypertension. The PK deficiency in this family is due to a new mutation (Arg541Gln) in exon 14. The defect segregates together with a known polymorphism, Asn124Ser, in exon 5. The significance of the presence of hypertension in the two homozygotes is discussed in view of the extra coagulation effects of PK on vasodilation, vessel permeability, and the control of blood pressure. Structure function analysis indicates that the substitution of Arg with Gln probably impedes the transmembrane diffusion of the molecule, which therefore cannot be secreted in the homozygotes. The presence of hypertension in patients with PK deficiency has been previously reported in some but not all patients. Future research activities will probably concentrate on the effect of PK and other contact phase factors on the vascular system. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.
9 CFR 381.168 - Maximum percent of skin in certain poultry products.
2010-01-01
... poultry products. 381.168 Section 381.168 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE AGENCY ORGANIZATION AND TERMINOLOGY; MANDATORY MEAT AND POULTRY PRODUCTS INSPECTION AND VOLUNTARY INSPECTION AND CERTIFICATION POULTRY PRODUCTS INSPECTION REGULATIONS Definitions and...
Homology modeling of Leishmania donovani enolase and its molecular interaction with novel inhibitors
Directory of Open Access Journals (Sweden)
Jay Prakash Mahato
2017-01-01
Full Text Available Introduction: The treatment of Indian tropical disease such as kala-azar is likely to be troublesome to the clinicians as AmpB- and miltefosine-resistant Leishmania donovani has been reported. The rationale behind designed a novel inhibitors of model of L. donovani enolase and performing a binding study with its inhibitors to gain details of the interaction between protein residues and ligand molecules. Methods and Materials: The L. donovani enolase model consists of two typical domains. The N-terminal one contains three-stranded antiparallel β-sheets, followed by six α-helices. The C-terminal domain composes of eleven-stranded mixed α/β-barrel with connectivity. The first α-helix within the C-terminal domain, H7, and the second β-strand, S7, of the barrel domain was arranged in an antiparallel fashion compared to all other α-helices and β-strands. The root-mean-square deviation between predicted model and template is 0.4 Å. The overall conformation of L. donovani enolase model is similar to those of Trypanosoma cruzi enolase and Streptococcus pneumoniae enolase crystal structures. Result: The key amino acid residues within the docking complex model involved in the interaction between model enolase structure and ligand molecule are Lys70, Asn165, Ala168, Asp17, and Asn213. Conclusion: Our theoretical prediction may lead to the establishment of prophylactic and therapeutic approaches for the treatment of kala-azar. This biomedical informatics analysis will help us to combat future kala-azar.
DEFF Research Database (Denmark)
Krogh, T N; Bachmann, E; Teisner, B
1997-01-01
By means of sequence analysis, murine fetal antigen 1 (mFA1) isolated from Mus musculus amniotic fluid was shown to be the circulating protein of the delta-like protein, stromal-cell-derived protein 1 (SCP-1) and preadipocyte factor 1 (Pref-1) gene products. The protein contains 36 cysteine...... residues arranged in six epidermal-growth-factor-like domains. The purification of several C-terminal peptides of varying lengths showed mFA1 to be C-terminal heterogeneous. O-linked glycosylations of the NeuNAc alpha2-3Gal beta1-3(NeuNAc alpha2-6)GalNAc type were present on all C-terminal peptides...... at residues Thr235, Thr244 and Thr248, although glycosylation on Thr244 was only partial. Three N-linked glycosylations were localized in mFA1 (Asn77, Asn142 and Asn151), two of which (Asn142 and Asn151) were in the unusual Asn-Xaa-Cys motif. Fucosylated biantennary complex-type and small amounts (less than 5...
Energy Technology Data Exchange (ETDEWEB)
Fellion, E.; Gacel, G.; Roques, B.P. (Institut National de la Sante et de la Recherche Medicale (INSERM), 75 - Paris (France)); Roy, J.; Morgat, J.L. (CEA Centre d' Etudes Nucleaires de Saclay, 91 - Gif-sur-Yvette (France). Service de Biochimie)
1990-08-01
The introduction of bulky residue(s) in linear enkephalin-related hexapeptides represents a new approach in the design of selective probes for {delta}-opioid receptors, displaying the appropriate criteria to investigate biological and pharmacological properties of the assumed binding site ({delta}) of endogenous enkephalins. The selectivities and high affinities of Tyr-D-Ser(O-t-Bu)-Gly-Phe-Leu-Thr(DSTBULET) and especially Tyr-D-Ser(O-t-Bu)Gly-Phe-Leu-Thr(O-t-Bu) (BUBU) associated with a satisfactory resistance to peptidases, make them the most suitable {delta}-probes reported to date. In the present paper, we report the synthesis of DSTBULET and BUBU under tritiated forms with high specific radioactivities. These radio-labelled probes will enable extensive in vitro and in vivo investigations of {delta}-opioid receptors properties to be carried out. (author).
Sood, Nitu; Patle, Sonali; Lal, Banwari
2010-03-01
Primitive wax refining techniques had resulted in almost 50,000 tonnes of acidic oily sludge (pH 1-3) being accumulated inside the Digboi refinery premises in Assam state, northeast India. A novel yeast species Candida digboiensis TERI ASN6 was obtained that could degrade the acidic petroleum hydrocarbons at pH 3 under laboratory conditions. The aim of this study was to evaluate the degradation potential of this strain under laboratory and field conditions. The ability of TERI ASN6 to degrade the hydrocarbons found in the acidic oily sludge was established by gravimetry and gas chromatography-mass spectroscopy. Following this, a feasibility study was done, on site, to study various treatments for the remediation of the acidic sludge. Among the treatments, the application of C. digboiensis TERI ASN6 with nutrients showed the highest degradation of the acidic oily sludge. This treatment was then selected for the full-scale bioremediation study conducted on site, inside the refinery premises. The novel yeast strain TERI ASN6 could degrade 40 mg of eicosane in 50 ml of minimal salts medium in 10 days and 72% of heneicosane in 192 h at pH 3. The degradation of alkanes yielded monocarboxylic acid intermediates while the polycyclic aromatic hydrocarbon pyrene found in the acidic oily sludge yielded the oxygenated intermediate pyrenol. In the feasibility study, the application of TERI ASN6 with nutrients showed a reduction of solvent extractable total petroleum hydrocarbon (TPH) from 160 to 28.81 g kg(-1) soil as compared to a TPH reduction from 183.85 to 151.10 g kg(-1) soil in the untreated control in 135 days. The full-scale bioremediation study in a 3,280-m(2) area in the refinery showed a reduction of TPH from 184.06 to 7.96 g kg(-1) soil in 175 days. Degradation of petroleum hydrocarbons by microbes is a well-known phenomenon, but most microbes are unable to withstand the low pH conditions found in Digboi refinery. The strain C. digboiensis could efficiently degrade
Gäde, G
1992-11-01
An identical neuropeptide was isolated by reversed-phase high-performance liquid chromatography from the corpora cardiaca of the king cricket, Libanasidus vittatus, and the two armoured ground crickets, Heterodes namaqua and Acanthoproctus cervinus. The crude gland extracts had adipokinetic activity in migratory locusts, hypertrehalosaemic activity in American cockroaches and a slight hypertrehalosaemic, but no adipokinetic, effect in armoured ground crickets. The primary structure of this neuropeptide was determined by pulsed-liquid phase sequencing employing Edman chemistry after enzymically deblocking the N-terminal 5-oxopyrrolidine-2-carboxylic acid residue. The C-terminus was also blocked, as indicated by the lack of digestion by carboxypeptidase A. The peptide was assigned the structure [symbol: see text]Glu-Leu-Asn-Phe-Ser-Thr-Gly-TrpNH2, previously designated Scg-AKH-II. The corpora cardiaca of the cricket Gryllodes sigillatus contained a neuropeptide which differed in retention time from the one isolated from the king and armoured ground crickets. The structure was assigned as [symbol: see text]Glu-Val-Asn-Phe-Ser-Thr-Gly-TrpNH2, previously designated Grb-AKH. This octapeptide caused hyperlipaemia in its donor species. The presence of the same peptide, Scg-AKH-II, in the two primitive infraorders of Ensifera, and the different peptide, Grb-AKH, in the most advanced infraorder of Ensifera, supports the evolutionary trends assigned formerly from morphological and physiological evidence.
Sougakoff, W; Naas, T; Nordmann, P; Collatz, E; Jarlier, V
1999-08-17
The role of the serine residue found at position 237 in the carbapenemase Sme-1 has been investigated by constructing a mutant in which Ser-237 was replaced by an alanine. The S237A mutant showed a catalytic behavior against penicillins and aztreonam very similar to that of Sme-1. By contrast, S237A was characterized by a reduced catalytic efficiency against cephems, such as cephalothin and cephaloridine. In addition, the weak activity of Sme-1 against the cephamycin cefoxitin was hardly detectable with the mutant enzyme. Finally, the Ser-237-->Ala mutation resulted in a marked decrease in catalytic activity against imipenem, showing that Ser-237 contributes to the carbapenemase activity of the class A beta-lactamase Sme-1.
Visualization of elongation measurements using an SER universal testing platform
Czech Academy of Sciences Publication Activity Database
Pivokonský, Radek; Filip, Petr; Zelenková, Jana
2015-01-01
Roč. 25, č. 1 (2015), s. 1-8 ISSN 1430-6395 R&D Projects: GA ČR(CZ) GAP105/11/2342 Institutional support: RVO:67985874 Keywords : elongational viscosity * Universal Testing Platform (SER) * polymer melts * LDPE Subject RIV: BK - Fluid Dynamics Impact factor: 1.241, year: 2015
Rapid surface enhanced Raman scattering detection method for chloramphenicol residues
Ji, Wei; Yao, Weirong
2015-06-01
Chloramphenicol (CAP) is a widely used amide alcohol antibiotics, which has been banned from using in food producing animals in many countries. In this study, surface enhanced Raman scattering (SERS) coupled with gold colloidal nanoparticles was used for the rapid analysis of CAP. Density functional theory (DFT) calculations were conducted with Gaussian 03 at the B3LYP level using the 3-21G(d) and 6-31G(d) basis sets to analyze the assignment of vibrations. Affirmatively, the theoretical Raman spectrum of CAP was in complete agreement with the experimental spectrum. They both exhibited three strong peaks characteristic of CAP at 1104 cm-1, 1344 cm-1, 1596 cm-1, which were used for rapid qualitative analysis of CAP residues in food samples. The use of SERS as a method for the measurements of CAP was explored by comparing use of different solvents, gold colloidal nanoparticles concentration and absorption time. The method of the detection limit was determined as 0.1 μg/mL using optimum conditions. The Raman peak at 1344 cm-1 was used as the index for quantitative analysis of CAP in food samples, with a linear correlation of R2 = 0.9802. Quantitative analysis of CAP residues in foods revealed that the SERS technique with gold colloidal nanoparticles was sensitive and of a good stability and linear correlation, and suited for rapid analysis of CAP residue in a variety of food samples.
Image collection: 168 [Togo Picture Gallery[Archive
Lifescience Database Archive (English)
Full Text Available 168 Choloepus_didactylus_NL.png フタユビナマケモノ Toed sloth Choloepus didactylus 27675 生物アイコン,脊索動物門,脊椎動物亜門,哺乳綱,獣亜綱,真獣下綱
DEFF Research Database (Denmark)
Wu, Kaiyu; Rindzevicius, Tomas; Schmidt, Michael Stenbæk
2017-01-01
and show that the improved structures exhibit unrivalled macroscale SERS uniformities (RSD: ∼2.5% in millimeter scale, ∼7% in wafer scale) and reproducibility (RSD: ∼1.5% across 3 wafers), while at the same time exhibiting a very large average SERS enhancement factor of >108. The obtained SERS uniformity...
27 CFR 24.168 - Identification of tanks.
2010-04-01
..., DEPARTMENT OF THE TREASURY LIQUORS WINE Construction and Equipment § 24.168 Identification of tanks. (a) General. Each tank, barrel, puncheon, or similar bulk container, used to ferment wine or used to process or store wine, spirits, or wine making materials will have the contents marked and will be marked as...
Data of evolutionary structure change: 1AIFA-2AI0L [Confc[Archive
Lifescience Database Archive (English)
Full Text Available 2> 0 n> 1AIF n>A ...n>1AIFAn> VSSSI----SSSNL...n> 2AI0 n>L 2AI...1AIFA-2AI0L 1AIF 2AI0 A L DIQLTQSPAFMAASPGEKVTITCSVSSSI----SSSNLH...SER CA 251 SER CA 276 SER CA 258 ASN CA 337 LEU CA 410
Moldes, Carlos Alberto; Cantarelli, Miguel Angel; Camiña, José Manuel; Tsai, Siu Mui; Azevedo, Ricardo Antunes
2017-10-11
Amino acid profiles are useful to analyze the responses to glyphosate in susceptible and resistant soybean lines. Comparisons of profiles for 10 amino acids (Asp, Asn, Glu, Gln, Ser, His, Gly, Thr, Tyr, Leu) by HPLC in soybean roots were performed in two near isogenic pairs (four varieties). Foliar application of glyphosate was made to soybean plants after 5 weeks of seeding. Roots of four varieties were collected at 0 and 72 h after glyphosate application (AGA) for amino acid analysis by HPLC. Univariate analysis showed a significant increase of several amino acids in susceptible as well as resistant soybean lines; however, amino acids from the major pathways of carbon (C) and nitrogen (N) metabolism, such as Asp, Asn, Glu and Gln, and Ser, increased significantly in susceptible varieties at 72 h AGA. Multivariate analysis using principal component analysis (2D PCA and 3D PCA) allowed different groups to be identified and discriminated based on the soybean genetic origin, showing the amino acid responses on susceptible and resistant varieties. Based on the results, it is possible to infer that the increase of Asn, Asp, Glu, Gln, and Ser in susceptible varieties would be related to the deregulation of C and N metabolism, as well as changes in the growth mechanisms regulated by Ser.
Probing the diphosphoglycerate binding pocket of HbA and HbPresbyterian (beta 108Asn --> Lys).
Gottfried, D S; Manjula, B N; Malavalli, A; Acharya, A S; Friedman, J M
1999-08-31
HbPresbyterian (beta 108Asn --> Lys, HbP) contains an additional positive charge (per alpha beta dimer) in the middle of the central cavity and exhibits a lower oxygen affinity than wild-type HbA in the presence of chloride. However, very little is known about the molecular origins of its altered functional properties. In this study, we have focused on the beta beta cleft of the Hb tetramer. Recently, we developed an approach for quantifying the ligand binding affinity to the beta-end of the Hb central cavity using fluorescent analogues of the natural allosteric effector 2, 3-diphosphoglycerate (DPG) [Gottfried, D. S., et al. (1997) J. Biol. Chem. 272, 1571-1578]. Time-correlated single-photon counting fluorescence lifetime studies were used to assess the binding of pyrenetetrasulfonate to both HbA and HbP in the deoxy and CO ligation states under acidic and neutral pH conditions. Both the native and mutant proteins bind the probe at a weak binding site and a strong binding site; in all cases, the binding to HbP was stronger than to HbA. The most striking finding was that for HbA the binding affinity varies as follows: deoxy (pH 6.35) > deoxy (pH 7.20) > CO (pH 6.35); however, the binding to HbP is independent of ligation or pH. The mutant oxy protein also hydrolyzes p-nitrophenyl acetate, through a reversible acyl-imidazole pathway linked to the His residues of the beta beta cleft, at a considerably higher rate than does HbA. This implies a perturbation of the microenvironment of these residues at the DPG binding pocket. Structural consequences due to the presence of the new positive charge in the middle of the central cavity have been transmitted to the beta beta cleft of the protein, even in its liganded conformation. This is consistent with a newly described quaternary state (B) for liganded HbPresbyterian and an associated change in the allosteric control mechanism.
Zhao, Yiping
2012-06-01
Since its discovery more than 30 years ago, surface-enhanced Raman scattering (SERS) has been recognized as a highly sensitive detection technique for chemical and biological sensing and medical diagnostics. However, the practical application of this remarkably sensitive technique has not been widely accepted as a viable diagnostic method due to the difficulty in preparing robust and reproducible substrates that provide maximum SERS enhancement. Here, we demonstrate that the aligned silver nanorod (AgNR) array substrates engineered by the oblique angle deposition method are capable of providing extremely high SERS enhancement factors (>108). The substrates are large area, uniform, reproducible, and compatible with general microfabrication process. The enhancement factor depends strongly on the length and shape of the Ag nanorods and the underlying substrate coating. By optimizing AgNR SERS substrates, we show that SERS is able to detect trace amount of toxins, virus, bacteria, or other chemical and biological molecules, and distinguish different viruses/bacteria and virus/bacteria strains. The substrate can be tailored into a multi-well chip for high throughput screening, integrated into fiber tip for portable sensing, incorporated into fluid/microfluidic devices for in situ real-time monitoring, fabricated onto a flexible substrate for tracking and identification, or used as on-chip separation device for ultra-thin layer chromatography and diagnostics. By combining the unique SERS substrates with a handheld Raman system, it can become a practical and portable sensor system for field applications. All these developments have demonstrated that AgNR SERS substrates could play an important role in the future for practical clinical, industrial, defense, and security sensing applications.
DEFF Research Database (Denmark)
Christensen, Lise Lotte; Bross, Peter Gerd; Ørntoft, Torben Falck
2000-01-01
Human alpha1,3-fucosyltransferase V and -VI (hFucTV and -VI) each contain four potential N-glycosylation sites (hFucTV: Asn60, Asn105, Asn167 and Asn198 and hFucTVI: Asn46, Asn91, Asn153 and Asn184). Glycosylation of the two N-terminal potential N-glycosylation sites (hFucTV: Asn60, Asn105 and h......FucTVI: Asn46 and Asn91) have never been studied in detail. In the present study, we have analysed the glycosylation of these potential N-glycosylation sites. Initially, we compared the molecular mass of hFucTV and -VI expressed in COS-7 cells treated with tunicamycin with the mass of the proteins...... in untreated cells. The difference in molecular mass between the proteins in treated and untreated cells corresponded to the presence of at least three N-linked glycans. We then made a series of mutants, in which the asparagine residues in the N-terminal potential N-glycosylation sites were replaced...
International Nuclear Information System (INIS)
Moisan, J.
2008-06-01
Studies with the INDRA multidetector of the 129 Xe + nat Sn reactions showed the unexpected existence of heavy fragments with a charge as large as Z=70. The charges of Xe and Sn are 54 and 50 respectively. Reactions between nuclei with a charge product greater than 2700 are dominated by deep inelastic collisions. For Xe + Sn the product is exactly 2700. After these observations, 129 Xe + nat Sn reactions at 8, 12, 15, 20 and 25 AMeV have been done. It will then be possible to clarify if the heavy residues are formed by an incomplete fusion, massive transfers occurring in deep inelastic collisions or a very asymmetric fission of a compound system. This work will present experimental results obtained by the analysis of these experiments. We will show that heavy residues are formed with a production cross-section of 10 -2 mb. Angular distributions show that the residues can be produced by an incomplete fusion of the projectile and the target. The study of the products in coincidence with the residues shows that a compound system was formed, followed by a fission producing the residue and a lighter fragment. The comparison with a phenomenological model, HIPSE, confirms that the model is valid at these energies
Energy Technology Data Exchange (ETDEWEB)
Akiyama, Y.; Heyde, K.; Arima, A.; Yoshinaga, N.
1986-05-29
Extending the interacting boson model by incorporating besides s and d, also the g-boson, we can describe the population of positive parity states of /sup 168/Er in the /sup 166/Er(t,P)/sup 168/Er reaction rather well. In particular, the excitation of I,Ksub(i)sup(..pi..) = 4,3/sub 1//sup +/; 2,2/sub 2//sup +/; 0,0/sub 3//sup +/ and 0,0/sub 4//sup +/ states is much improved over the sd-IBM appraoch.
Data of evolutionary structure change: 1AIFA-2AI0O [Confc[Archive
Lifescience Database Archive (English)
Full Text Available s_2> 0 n> 1AIF A...n> 1AIFAn> VSSSI----SSSNL n> 2AI0 n>O 2AI...1AIFA-2AI0O 1AIF 2AI0 A O DIQLTQSPAFMAASPGEKVTITCSVSSSI----SSSNLH...e>SER CA 251 SER CA 276 SER CA 258 ASN CA 337 LEU CA 410
Design of CAREM-25 Residual Heat Removal System: Nuclear Safety Aspects
International Nuclear Information System (INIS)
Zanocco, Pablo; Gimenez, Marcelo; Schlamp, Miguel; Barrera, M.
2000-01-01
In this paper Carem-25 residual heat removal system (RHRS) design is analyzed from the nuclear safety point of view.The proposed RHRS is a condenser that transfers the heat to a pool located in the upper level of the containment.The RHRS design basis accident is a reactor loss of heat sink.The following requirements were settled to be verified: a) To remove 2 MW, for a primary circuit pressure of 12.25 MPa and a pool temperature of 100 0 C. b) No condenser tubes flooding, for a primary circuit pressure of 14 MPa and a pool temperature of 100 0 C. c) To reach hot shutdown in 48-hrs, that is to remove of 0.6 MW for a primary circuit pressure of 2.3 MPa and a pool temperature of 120 0 C.Heat transfer regimes inside and outside the condenser and flow patterns were analyzed.Steady state conditions for the above design conditions were modeled.The design requirements were verified taking into account heat transfer coefficients uncertainties and their propagation to the equipment elevation in the containment over the RPV, in order to minimize its elevation and its possible flooding.The resulting condenser tubes were 2 S CH 160 TP 347 SS, with a total area of 4 m 2 and a required minimum height of 6 m from the RPV water level to the condenser outlet headers
Application of the RPA method based on the cranked Hartree-Fock-Bogolyubov model in 168Er and 158Dy
International Nuclear Information System (INIS)
Kvasil, J.; Khariev, M.M.; Cwiok, S.; Mikhajlov, I.N.; Khoriev, B.
1984-01-01
The Random Phase Approximation (RPA) based on the Cranked Hartree-Fock-Bogolyubov (CHFB) model is used for the study of low-lying nuclear states near the yrast line in 158 Dy and 168 Er. The relation of the spurious unphysical states connected with the nucleus centre of mass rotational motion to the solutions of RPA equations of motion is cleared up. The calculated level energies and reduced probabilities B(E2) are compared with experimental ones. The dependence of the residual interaction strength constants and the nucleus moment of inertia on the angular momentum is discussed. The experimental characteristics of low-lying states up to approx. 2 MeV are reproduced by the CHFB+RPA model. (author)
1983-01-01
Five 168/E processors and associated specialized interface hardware made an importartant contribution to the UA1 experiment. The processors provided an online event display facility, and also flagged candidate events. See Annual Report 1983 p. 75, and photo 8305815X, 8395813X. This photo shows the team including DD personnel and UA1 members. On the foreground left, is Michel Demoulin. On the background, 3rd from left, is Adolfo Fucci, last Sergio Cittolin.
Directory of Open Access Journals (Sweden)
Yumiko Urano-Tashiro
Full Text Available Hsa is a large, serine-rich protein of Streptococcus gordonii DL1 that mediates binding to α2-3-linked sialic acid termini of glycoproteins, including platelet glycoprotein Ibα, and erythrocyte membrane protein glycophorin A, and band 3. The binding of Hsa to platelet glycoprotein Ibα contributes to the pathogenesis of infective endocarditis. This interaction appears to be mediated by a second non-repetitive region (NR2 of Hsa. However, the molecular details of the interaction between the Hsa NR2 region and these glycoproteins are not well understood. In the present study, we identified the amino acid residues of the Hsa NR2 region that are involved in sialic acid recognition. To identify the sialic acid-binding site of Hsa NR2 region, we prepared various mutants of Hsa NR2 fused with glutathione transferase. Fusion proteins harboring Arg340 to Asn (R340N or Arg365 to Asn (R365N substitutions in the NR2 domain exhibited significantly reduced binding to human erythrocytes and platelets. A sugar-binding assay showed that these mutant proteins abolished binding to α2-3-linked sialic acid. Furthermore, we established S. gordonii DL1 derivatives that encoded the corresponding Hsa mutant protein. In whole-cell assays, these mutant strains showed significant reductions in hemagglutination, in platelet aggregation, and in adhesion to human leukocytes. These results indicate that the Arg340 and Arg365 residues of Hsa play an important role in the binding of Hsa to α2-3-linked sialic acid-containing glycoproteins.
Criatividade em ação: ser criativo é ser criança
Directory of Open Access Journals (Sweden)
Antonio Mendes Silva Filho
2012-11-01
Full Text Available Todo ser humano é criativo e isso decorre da capacidade de imaginação. Essa capacidade é acentuada quando você tem a possibilidade de explorar e a curiosidade aguçada. Não exemplo melhor do que uma criança. Ser criativo é ser criança. Esta capacidade alcança o ápice quando se busca criar como criança fazendo uso de sagacidade, persistência, desorganização e com a possibilidade de errar. Isso é explorar e experimentar, deixando o cérebro livre e sem pressão, agindo despreocupadamente em determinado período de tempo. Nesse sentido, este artigo explora a importancia dar oportunidade do ser humano explorar sua capacidade de criar via imaginação
2013-01-01
Background Mycoplasma hyopneumoniae is the causative agent of porcine enzootic pneumonia (EP), a mild, chronic pneumonia of swine. Despite presenting with low direct mortality, EP is responsible for major economic losses in the pig industry. To identify the virulence-associated determinants of M. hyopneumoniae, we determined the whole genome sequence of M. hyopneumoniae strain 168 and its attenuated high-passage strain 168-L and carried out comparative genomic analyses. Results We performed the first comprehensive analysis of M. hyopneumoniae strain 168 and its attenuated strain and made a preliminary survey of coding sequences (CDSs) that may be related to virulence. The 168-L genome has a highly similar gene content and order to that of 168, but is 4,483 bp smaller because there are 60 insertions and 43 deletions in 168-L. Besides these indels, 227 single nucleotide variations (SNVs) were identified. We further investigated the variants that affected CDSs, and compared them to reported virulence determinants. Notably, almost all of the reported virulence determinants are included in these variants affected CDSs. In addition to variations previously described in mycoplasma adhesins (P97, P102, P146, P159, P216, and LppT), cell envelope proteins (P95), cell surface antigens (P36), secreted proteins and chaperone protein (DnaK), mutations in genes related to metabolism and growth may also contribute to the attenuated virulence in 168-L. Furthermore, many mutations were located in the previously described repeat motif, which may be of primary importance for virulence. Conclusions We studied the virulence attenuation mechanism of M. hyopneumoniae by comparative genomic analysis of virulent strain 168 and its attenuated high-passage strain 168-L. Our findings provide a preliminary survey of CDSs that may be related to virulence. While these include reported virulence-related genes, other novel virulence determinants were also detected. This new information will form
33 CFR 110.168 - Hampton Roads, Virginia and adjacent waters (Datum: NAD 83).
2010-07-01
... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Hampton Roads, Virginia and adjacent waters (Datum: NAD 83). 110.168 Section 110.168 Navigation and Navigable Waters COAST GUARD..., Virginia and adjacent waters (Datum: NAD 83). (a) Anchorage Grounds—(1) Anchorage A [Naval Anchorage]. The...
32 CFR 168a.4 - Policy and procedures.
2010-07-01
... to pursue graduate degrees in science, engineering, or other fields of study that are designated, in... DEFENSE SCIENCE AND ENGINEERING GRADUATE FELLOWSHIPS § 168a.4 Policy and procedures. (a) Sponsoring... nationwide competition in which all appropriate actions have been taken to encourage applications from...
Stěžejní východiska a koncepce současné anglické náboženské pedagogiky
Directory of Open Access Journals (Sweden)
Karim Sidibe
2017-08-01
Full Text Available Tento článek si klade za cíl analyzovat didaktické koncepce výuky náboženství pěti hlavních teoretiků současné anglické náboženské pedagogiky, Harolda Loukese, Niniana Smarta, Davida Haye, Cliva Errickera a Andrewa Wrighta. Loukes a Smart položili základy současné náboženské pedagogiky v Anglii v 60. letech 20. století. Loukes využil poznatky vývojové psychologie a Smart výuku sekularizoval. Hayovo pojetí z 80. let 20. století akcentuje niternou duchovní skutečnost žáků. V současné době Erricker aplikuje postmoderní filosofická východiska na výuku a akcentuje individualitu a nezávislost žáků, zatímco Wright vychází z filosofických východisek kritického realismu a akcentuje nutnost teologické a filosofické diskuze na hodinách náboženství.
Ruíz-Esculpi, María; Ricse-Chaupis, Estela; Villanueva-Vega, Judith; Torres-Maita, Liz
2014-01-01
La primera aplicación del láser en un diente fue realizada en 1965. Desde entonces ha presentado una constante evolución y desarrollo. La tecnología láser permite realizar procedimientos en tejidos duros y blandos, pudiendo ser utilizado con las siguientes finalidades: como prevención de la desmineralización, en la adhesión y remoción de brackets, en la reducción del dolor producto del movimiento dental, en la reparación ósea después de la expansión, en diversas cirugías y otras aplicaciones ...
Energy Technology Data Exchange (ETDEWEB)
David, Catalina; Guillot, Nicolas; Chapelle, Marc Lamy de la [Laboratoire CSPBAT (FRE 3043), UFR SMBH, Universite Paris XIII, 74 rue Marcel Cachin, F-93017 Bobigny (France); Shen, Hong; Toury, Timothee, E-mail: marc.lamydelachapelle@univ-paris13.fr [ICD-LNIO-UMR, CNRS 6279, Universite de technologie de Troyes, 12 rue Marie Curie, F-10010 Troyes (France)
2010-11-26
In this paper we highlight the accurate spectral detection of bovine serum albumin and ribonuclease-A using a surface-enhanced Raman scattering (SERS) substrate based on gold nanocylinders obtained by electron-beam lithography (EBL). The nanocylinders have diameters from 100 to 180 nm with a gap of 200 nm. We demonstrate that optimizing the size and the shape of the lithographed gold nanocylinders, we can obtain SERS spectra of proteins at low concentration. This SERS study enabled us to estimate high enhancement factors (10{sup 5} for BSA and 10{sup 7} for RNase-A) of important bands in the protein Raman spectrum measured for 1 mM concentration. We demonstrate that, to reach the highest enhancement, it is necessary to optimize the SERS signal and that the main parameter of optimization is the LSPR position. The LSPR have to be suitably located between the laser excitation wavelength, which is 632.8 nm, and the position of the considered Raman band. Our study underlines the efficiency of gold nanocylinder arrays in the spectral detection of proteins.
33 CFR 165.168 - Safety Zones; Coast Guard Captain of the Port New York Fireworks Displays.
2010-07-01
... of the Port New York Fireworks Displays. 165.168 Section 165.168 Navigation and Navigable Waters... Guard District § 165.168 Safety Zones; Coast Guard Captain of the Port New York Fireworks Displays. (a... Upper New York Bay within a 360-yard radius of the fireworks barge in approximate position 40°41′16.5″ N...
Report by the ASN on the situation of nuclear safety and radiation protection in France in 2013
International Nuclear Information System (INIS)
Chevet, Pierre-Franck; Delmestre, Alain; Bardet, Marie-Christine; Covard, Fabienne; Javay, Olivier
2014-01-01
In its first chapters, this huge report presents the various actions undertaken by the ASN. It proposes a detailed overview of the issue of ionizing radiations and risks for health and for the environment in the field of nuclear activities, presents and comments the principles and actors of the control of nuclear safety and of radiation protection, presents the different elements of the legal framework, describes and comments the control of nuclear activities and of exposures to ionizing radiations. The next chapters address the actions controlled by the ASN: radiological and post-accidental radiological situations, present measures related to public information and transparency, overview of international relationships, regional overview of nuclear safety and radiation protection, medical use of ionizing radiations, industrial, research and veterinary uses and the issue of source safety, the issue of radioactive material transportation. Issues of nuclear safety and radiation protection are then discussed for electronuclear plants, for installations dedicated to the nuclear fuel cycle, for various research and industrial nuclear installations, for the dismantling of base nuclear installations, and for radioactive wastes and polluted sites and soils
Li, Wei; Cui, Xiao; Meng, Zhaolu; Huang, Xiahe; Xie, Qi; Wu, Heng; Jin, Hailing; Zhang, Dabing; Liang, Wanqi
2012-03-01
The accumulation of a number of small RNAs in plants is affected by abscisic acid (ABA) and abiotic stresses, but the underlying mechanisms are poorly understood. The miR168-mediated feedback regulatory loop regulates ARGONAUTE1 (AGO1) homeostasis, which is crucial for gene expression modulation and plant development. Here, we reveal a transcriptional regulatory mechanism by which MIR168 controls AGO1 homeostasis during ABA treatment and abiotic stress responses in Arabidopsis (Arabidopsis thaliana). Plants overexpressing MIR168a and the AGO1 loss-of-function mutant ago1-27 display ABA hypersensitivity and drought tolerance, while the mir168a-2 mutant shows ABA hyposensitivity and drought hypersensitivity. Both the precursor and mature miR168 were induced under ABA and several abiotic stress treatments, but no obvious decrease for the target of miR168, AGO1, was shown under the same conditions. However, promoter activity analysis indicated that AGO1 transcription activity was increased under ABA and drought treatments, suggesting that transcriptional elevation of MIR168a is required for maintaining a stable AGO1 transcript level during the stress response. Furthermore, we showed both in vitro and in vivo that the transcription of MIR168a is directly regulated by four abscisic acid-responsive element (ABRE) binding factors, which bind to the ABRE cis-element within the MIR168a promoter. This ABRE motif is also found in the promoter of MIR168a homologs in diverse plant species. Our findings suggest that transcriptional regulation of miR168 and posttranscriptional control of AGO1 homeostasis may play an important and conserved role in stress response and signal transduction in plants.
Fessenheim 2: ASN's green light for continuing operation - Beginning of the works for unit 1
International Nuclear Information System (INIS)
Anon.
2013-01-01
Every 10 years a nuclear power plant operator has to make a re-assessment of the nuclear safety standard of his plant. This re-assessment is made of 2 parts: first the review of the safety conformity and secondly a thorough re-examination of the safety that takes into account today's safety standards and feedback experience from similar plants. This detailed assessment of the safety aims at checking that the consequences of the different aging phenomena are well mastered for the next 10 years at least. At the end of this re-assessment, the ASN (French Nuclear Safety Authorities) decide or not the continuation of plant activity or can prescribe safety improvements. In the case of the unit 2 of the Fessenheim plant that has just finished its third decennial safety re-assessment, the ASN has prescribed the same improvements as for the unit 1, that is to say the reinforcement of the resistance to corium of the foundation raft and an improvement on the emergency cooling system. The works on the unit 1 have begun despite contestation from anti-nuclear associations that question the cost of the safety upgrading (20 to 30 millions euros) while the unit is expected to be decommissioned by end 2016. (A.C.)
Surface-enhanced Raman spectroscopy (SERS) is an emerging analytical tool that boasts the feature of high detection sensitivity and molecular fingerprint specificity attracting increased attention and showing promise in applications including detecting residues of veterinary drugs. In practice, spec...
HOST GALAXY PROPERTIES OF THE SUBLUMINOUS GRB 120422A/SN 2012bz
Energy Technology Data Exchange (ETDEWEB)
Levesque, Emily M. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado 389-UCB, Boulder, CO 80309 (United States); Chornock, Ryan; Soderberg, Alicia M.; Berger, Edo; Lunnan, Ragnhild, E-mail: Emily.Levesque@colorado.edu [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)
2012-10-20
GRB 120422A is a nearby (z = 0.283) long-duration gamma-ray burst (LGRB) detected by Swift with E {sub {gamma},iso} {approx} 4.5 Multiplication-Sign 10{sup 49} erg. It is also associated with the spectroscopically confirmed broad-lined Type Ic SN 2012bz. These properties establish GRB 120422A/SN 2012bz as the sixth and newest member of the class of subluminous GRBs supernovae (SNe). Observations also show that GRB 120422A/SN 2012bz occurred at an unusually large offset ({approx}8 kpc) from the host galaxy nucleus, setting it apart from other nearby LGRBs and leading to speculation that the host environment may have undergone prior interaction activity. Here, we present spectroscopic observations using the 6.5 m Magellan telescope at Las Campanas. We extract spectra at three specific locations within the GRB/SN host galaxy, including the host nucleus, the explosion site, and the 'bridge' of diffuse emission connecting these two regions. We measure a metallicity of log(O/H) + 12 = 8.3 {+-} 0.1 and a star formation rate (SFR) per unit area of 0.08 M {sub Sun} yr{sup -1} kpc{sup -2} at the host nucleus. At the GRB/SN explosion site we measure a comparable metallicity of log(O/H) + 12 = 8.2 {+-} 0.1 but find a much lower SFR per unit area of 0.01 M {sub Sun} yr{sup -1} kpc{sup -2}. We also compare the host galaxy of this event to the hosts of other LGRBs, including samples of subluminous LGRBs and cosmological LGRBs, and find no systematic metallicity difference between the environments of these different subtypes.
Coulomb-nuclear interference measurements of hexadecapole deformations in 168Yb and 178,180Hf
International Nuclear Information System (INIS)
Nettles, W.G.; Mississippi Coll., Clinton; Ramayya, A.V.; Hamilton, J.H.
1988-01-01
Coulomb-nuclear interference studies of 168 Yb and 178,180 Hf have been carried out with alpha particles from the Pittsburgh tandem. From coupled channel fits to the data at 18 MeV for 168 Yb and 19.5 MeV for 178,180 Hf, β 4 c values of -0.030(20), -0.166(18), and -0.180(6) were obtained, respectively. These data agree with the positive M 04 value from sub-Coulomb studies of 168 Yb but with the large negative M 04 values from sub-Coulomb studies of 178,180 Hf. (author)
Mapping Escherichia coli elongation factor Tu residues involved in binding of aminoacyl-tRNA
DEFF Research Database (Denmark)
Wiborg, Ove; Andersen, C; Knudsen, Charlotte Rohde
1996-01-01
Two residues of Escherichia coli elongation factor Tu involved in binding of aminoacyl-tRNA were identified and subjected to mutational analysis. Lys-89 and Asn-90 were each replaced by either Ala or Glu. The four single mutants were denoted K89A, K89E, N90A, and N90E, respectively. The mutants...... were characterized with respect to thermal and chemical stability, GTPase activity, tRNA affinity, and activity in an in vitro translation assay. Most conspicuously tRNA affinities were reduced for all mutants. The results verify our structural analysis of elongation factor Tu in complex with aminoacyl....... Their functional roles are discussed in relation to the structure of elongation factor Tu in complex with aminoacyl-tRNA. Udgivelsesdato: 1996-Aug-23...
Missimer, John H; Steinmetz, Michel O; van Gunsteren, Wilfred F; Dolenc, Jožica
2012-10-23
Phosphorylation is an important mechanism regulating protein-protein interactions involving intrinsically disordered protein regions. Stathmin, an archetypical example of an intrinsically disordered protein, is a key regulator of microtubule dynamics in which phosphorylation of 63Ser within the helical nucleation sequence strongly down-regulates the tubulin binding and microtubule destabilizing activities of the protein. Experimental studies on a peptide encompassing the 19-residue helical nucleation sequence of stathmin (residues 55-73) indicate that phosphorylation of 63Ser destabilizes the peptide's secondary structure by disrupting the salt bridges supporting its helical conformation. In order to investigate this hypothesis at atomic resolution, we performed molecular dynamics simulations of nonphosphorylated and phosphorylated stathmin-[55-73] at room temperature and pressure, neutral pH, and explicit solvation using the recently released GROMOS force field 54A7. In the simulations of nonphosphorylated stathmin-[55-73] emerged salt bridges associated with helical configurations. In the simulations of 63Ser phosphorylated stathmin-[55-73] these configurations dispersed and were replaced by a proliferation of salt bridges yielding disordered configurations. The transformation of the salt bridges was accompanied by emergence of numerous interactions between main and side chains, involving notably the oxygen atoms of the phosphorylated 63Ser. The loss of helical structure induced by phosphorylation is reversible, however, as a final simulation showed. The results extend the hypothesis of salt bridge derangement suggested by experimental observations of the stathmin nucleation sequence, providing new insights into regulation of intrinsically disordered protein systems mediated by phosphorylation.
Roles of s3 site residues of nattokinase on its activity and substrate specificity.
Wu, Shuming; Feng, Chi; Zhong, Jin; Huan, Liandong
2007-09-01
Nattokinase (Subtilisin NAT, NK) is a bacterial serine protease with high fibrinolytic activity. To probe their roles on protease activity and substrate specificity, three residues of S3 site (Gly(100), Ser(101) and Leu(126)) were mutated by site-directed mutagenesis. Kinetics parameters of 20 mutants were measured using tetrapeptides as substrates, and their fibrinolytic activities were determined by fibrin plate method. Results of mutation analysis showed that Gly(100) and Ser(101) had reverse steric and electrostatic effects. Residues with bulky or positively charged side chains at position 100 decreased the substrate binding and catalytic activity drastically, while residues with the same characters at position 101 could obviously enhance protease and fibrinolytic activity of NK. Mutation of Leu(126) might impair the structure of the active cleft and drastically decreased the activity of NK. Kinetics studies of the mutants showed that S3 residues were crucial to keep protease activity while they moderately affected substrate specificity of NK. The present study provided some original insight into the P3-S3 interaction in NK and other subtilisins, as well as showed successful protein engineering cases to improve NK as a potential therapeutic agent.
Lifetimes Measurements in 160Yb,162Yb,164Yb,166Yb,168Yb
International Nuclear Information System (INIS)
Araddad, S. Y.; El-barouni, A. M.; Rateb, G. M.; Mosbah, D. S.; Elahrash, M. S.; Sergiwa, S. M.
2004-01-01
From our measurements of the lifetimes of high spin states in 168 Yb along with the published lifetime data for the nearby even even ytterbium isotopes, 160-168 Yb using the Recoil Distance Method (RDM) and the Doppler Shift Attenuation Method (DSAM) present a great opportunity to probe systematically the relationship between the nuclear shape changes and the reduction in collectivity. (authors)
Singhal, Anshika; Joshi, Jayadev; Virmani, Richa; Gupta, Meetu; Verma, Nupur; Maji, Abhijit; Misra, Richa; Baronian, Grégory; Pandey, Amit K.; Molle, Virginie; Singh, Yogendra
2014-01-01
Background Mycobacterium ulcerans, the causative agent of Buruli ulcer in humans, is unique among the members of Mycobacterium genus due to the presence of the virulence determinant megaplasmid pMUM001. This plasmid encodes multiple virulence-associated genes, including mup011, which is an uncharacterized Ser/Thr protein kinase (STPK) PknQ. Methodology/Principal Findings In this study, we have characterized PknQ and explored its interaction with MupFHA (Mup018c), a FHA domain containing protein also encoded by pMUM001. MupFHA was found to interact with PknQ and suppress its autophosphorylation. Subsequent protein-protein docking and molecular dynamic simulation analyses showed that this interaction involves the FHA domain of MupFHA and PknQ activation loop residues Ser170 and Thr174. FHA domains are known to recognize phosphothreonine residues, and therefore, MupFHA may be acting as one of the few unusual FHA-domain having overlapping specificity. Additionally, we elucidated the PknQ-dependent regulation of MupDivIVA (Mup012c), which is a DivIVA domain containing protein encoded by pMUM001. MupDivIVA interacts with MupFHA and this interaction may also involve phospho-threonine/serine residues of MupDivIVA. Conclusions/Significance Together, these results describe novel signaling mechanisms in M. ulcerans and show a three-way regulation of PknQ, MupFHA, and MupDivIVA. FHA domains have been considered to be only pThr specific and our results indicate a novel mechanism of pSer as well as pThr interaction exhibited by MupFHA. These results signify the need of further re-evaluating the FHA domain –pThr/pSer interaction model. MupFHA may serve as the ideal candidate for structural studies on this unique class of modular enzymes. PMID:25412098
Directory of Open Access Journals (Sweden)
Gunjan Arora
2014-11-01
Full Text Available Mycobacterium ulcerans, the causative agent of Buruli ulcer in humans, is unique among the members of Mycobacterium genus due to the presence of the virulence determinant megaplasmid pMUM001. This plasmid encodes multiple virulence-associated genes, including mup011, which is an uncharacterized Ser/Thr protein kinase (STPK PknQ.In this study, we have characterized PknQ and explored its interaction with MupFHA (Mup018c, a FHA domain containing protein also encoded by pMUM001. MupFHA was found to interact with PknQ and suppress its autophosphorylation. Subsequent protein-protein docking and molecular dynamic simulation analyses showed that this interaction involves the FHA domain of MupFHA and PknQ activation loop residues Ser170 and Thr174. FHA domains are known to recognize phosphothreonine residues, and therefore, MupFHA may be acting as one of the few unusual FHA-domain having overlapping specificity. Additionally, we elucidated the PknQ-dependent regulation of MupDivIVA (Mup012c, which is a DivIVA domain containing protein encoded by pMUM001. MupDivIVA interacts with MupFHA and this interaction may also involve phospho-threonine/serine residues of MupDivIVA.Together, these results describe novel signaling mechanisms in M. ulcerans and show a three-way regulation of PknQ, MupFHA, and MupDivIVA. FHA domains have been considered to be only pThr specific and our results indicate a novel mechanism of pSer as well as pThr interaction exhibited by MupFHA. These results signify the need of further re-evaluating the FHA domain -pThr/pSer interaction model. MupFHA may serve as the ideal candidate for structural studies on this unique class of modular enzymes.
Serafin, Scott V; Maranan, Rhonda; Zhang, Kangling; Morton, Thomas Hellman
2005-09-01
MS/MS of electrosprayed ions is shown to have the capacity to discriminate between peptides that differ by configuration about their alpha-carbons. It is not necessary for the peptides to possess tertiary structures that are affected by stereochemistry, since five epimers of the pentapeptide, H2N-Gly-Leu-Ser-Phe-Ala-OH (GLSFA) all display different collisionally activated dissociation (CAD) patterns of their protonated parent ions. The figure of merit, r, is a ratio of ratios of fragment ion abundances between stereoisomers, where r = 1 corresponds to no stereochemical effect. Values of r as high as 3.8 are seen for diastereomer pairs. Stereochemical effects are also seen for the diprotonated dodecapeptide H2N-Leu-Val-Phe-Phe-Ala-Glu-Asp-Val-Gly-Ser-Asn-Lys-OH (LVFFAEDVGSNK), a tryptic fragment from the amyloid beta-protein. Triply charged complexes of the protonated dodecapeptide with cobalt(II) ions undergo CAD at lower collision energies than do doubly protonated LVFFAEDVGSNK ions. Statistically significant (p < 0.01) differences between the all-L-dodecapeptide and the ones containing a d-serine or a D-aspartic acid are observed.
Study of the 1.25Cr-1Mo-0.25V steel microstructure after a carburization phenomenon
Energy Technology Data Exchange (ETDEWEB)
Simonetti, S., E-mail: ssimonet@uns.edu.ar [Departamento de Fisica, Universidad Nacional del Sur, Av. Alem 1253, 8000 Bahia Blanca (Argentina); Departamentos de Ciencias Basicas e Ingenieria Mecanica, Universidad Tecnologica Nacional, 11 de Abril 461, 8000 Bahia Blanca (Argentina); Lanz, C. [Departamento de Ingenieria, Universidad Nacional del Sur, Av. Alem 1253, 8000 Bahia Blanca (Argentina); Brizuela, G.; Juan, A. [Departamento de Fisica, Universidad Nacional del Sur, Av. Alem 1253, 8000 Bahia Blanca (Argentina)
2010-08-20
We studied the changes in the structure and carbide particle size in 1.25Cr-1Mo-0.25V steel under 600 deg. C and 168 MPa, after 4000 h service. We used microscopy and microanalysis techniques to analyze the carbide particles. We performed a complementary theoretical study on the chemical bonding and electronic structure of the carbide-Fe matrix interaction. The results contribute to the understanding of the changes in the alloy microstructure caused by the carburization phenomenon.
Rhein, Bethany A; Brouillette, Rachel B; Schaack, Grace A; Chiorini, John A; Maury, Wendy
2016-07-01
Phosphatidylserine (PtdSer) receptors that are responsible for the clearance of dying cells have recently been found to mediate enveloped virus entry. Ebola virus (EBOV), a member of the Filoviridae family of viruses, utilizes PtdSer receptors for entry into target cells. The PtdSer receptors human and murine T-cell immunoglobulin mucin (TIM) domain proteins TIM-1 and TIM-4 mediate filovirus entry by binding to PtdSer on the virion surface via a conserved PtdSer binding pocket within the amino-terminal IgV domain. While the residues within the TIM-1 IgV domain that are important for EBOV entry are characterized, the molecular details of virion-TIM-4 interactions have yet to be investigated. As sequences and structural alignments of the TIM proteins suggest distinct differences in the TIM-1 and TIM-4 IgV domain structures, we sought to characterize TIM-4 IgV domain residues required for EBOV entry. Using vesicular stomatitis virus pseudovirions bearing EBOV glycoprotein (EBOV GP/VSVΔG), we evaluated virus binding and entry into cells expressing TIM-4 molecules mutated within the IgV domain, allowing us to identify residues important for entry. Similar to TIM-1, residues in the PtdSer binding pocket of murine and human TIM-4 (mTIM-4 and hTIM-4) were found to be important for EBOV entry. However, additional TIM-4-specific residues were also found to impact EBOV entry, with a total of 8 mTIM-4 and 14 hTIM-4 IgV domain residues being critical for virion binding and internalization. Together, these findings provide a greater understanding of the interaction of TIM-4 with EBOV virions. With more than 28,000 cases and over 11,000 deaths during the largest and most recent Ebola virus (EBOV) outbreak, there has been increased emphasis on the development of therapeutics against filoviruses. Many therapies under investigation target EBOV cell entry. T-cell immunoglobulin mucin (TIM) domain proteins are cell surface factors important for the entry of many enveloped viruses
Energy Technology Data Exchange (ETDEWEB)
Xu, Mengjia; Xu, Jijin, E-mail: xujijin_1979@sjtu.edu.cn; Lu, Hao; Chen, Jieshi; Chen, Junmei; Wei, Xiao
2015-12-30
Graphical abstract: - Highlights: • Statistical and fractal analysis is applied to study the creep fracture surface. • The tensile residual stresses promote the initiation of creep crack. • The fractal dimension of a mixed mode fracture surface shows a wavy variation. • The fractal dimension increases with increasing intergranular fracture percentage. • Height coordinates of intergranular fracture surface fit Gaussian distribution. - Abstract: In order to clarify creep crack growth behavior in 2.25Cr–1.6W steel incorporating residual stresses, creep crack tests were carried out on the tension creep specimens, in which the residual stresses were generated by local remelting and cooling. Residual stresses in the specimens were measured using Synchrotron X-ray diffraction techniques. The fracture surface of the creep specimen was analyzed using statistical methods and fractal analysis. The relation between fractal dimension of the fracture surface and fracture mode of the creep specimen was discussed. Due to different fracture mechanisms, the probability density functions of the height coordinates vary with the intergranular crack percentage. Good fitting was found between Gaussian distribution and the probability function of height coordinates of the high percentage intergranular crack surface.
International Nuclear Information System (INIS)
Xu, Mengjia; Xu, Jijin; Lu, Hao; Chen, Jieshi; Chen, Junmei; Wei, Xiao
2015-01-01
Graphical abstract: - Highlights: • Statistical and fractal analysis is applied to study the creep fracture surface. • The tensile residual stresses promote the initiation of creep crack. • The fractal dimension of a mixed mode fracture surface shows a wavy variation. • The fractal dimension increases with increasing intergranular fracture percentage. • Height coordinates of intergranular fracture surface fit Gaussian distribution. - Abstract: In order to clarify creep crack growth behavior in 2.25Cr–1.6W steel incorporating residual stresses, creep crack tests were carried out on the tension creep specimens, in which the residual stresses were generated by local remelting and cooling. Residual stresses in the specimens were measured using Synchrotron X-ray diffraction techniques. The fracture surface of the creep specimen was analyzed using statistical methods and fractal analysis. The relation between fractal dimension of the fracture surface and fracture mode of the creep specimen was discussed. Due to different fracture mechanisms, the probability density functions of the height coordinates vary with the intergranular crack percentage. Good fitting was found between Gaussian distribution and the probability function of height coordinates of the high percentage intergranular crack surface.
The decisions taken in 2012 by the ASN: additional requirements
International Nuclear Information System (INIS)
Lacoste, Andre-Claude; Comets, Marie-Pierre; Dumont, Jean-Jacques; Bourguignon, Michel; Jamet, Philippe
2012-01-01
After the publication of conclusions of the Additions Safety Assessments (ECS, evaluations complementaires de surete), this document gathers 32 decisions taken by the ASN in June 2012 which specify additional requirements for EDF nuclear power plants, AREVA installations, and some CEA reactors. These measures will lead to a significant strengthening of safety margins beyond their sizing. These decisions impose huge works to operators. They comprise the implementation of an organisation and the construction of premises resistant to a big event which would affect several installations. Other measures concern a deeper training of agents intervening in case of earthquake or severe accident, robust means of power supply for warehousing pools, efficient means to reduce accidental leakage of different compounds, the storing of fissile materials in an installation sufficiently strong to resist earthquakes, and improvements regarding the flood risk management and sodium fire risk management
ASN.1 notation for exchange of data in computer-based railway control systems
Directory of Open Access Journals (Sweden)
Zbigniew ŁUKASIK
2009-01-01
Full Text Available Development of railway control systems aims at computerization. In most cases these systems are Distributed Real Time Systems. However, a huge problem in their putting into practice is the lack of interface standardization in the range of data structures and information exchange methods. It results in a variety of solutions, and thus in problems concerning cooperation of systems that come from different software vendors. Specification of protocols for data exchanging applications should therefore be created with the use of generally accepted standards. One of them is ASN.1 (Abstract Syntax Notation One language, which shall be presented in this article.
Li, Yan-Xiao; Yi, Ping; Yan, Qiao-Juan; Qin, Zhen; Liu, Xue-Qiang; Jiang, Zheng-Qiang
2017-01-01
β-Mannanase randomly cleaves the β-1,4-linked mannan backbone of hemicellulose, which plays the most important role in the enzymatic degradation of mannan. Although the industrial applications of β-mannanase have tremendously expanded in recent years, the wild-type β-mannanases are still defective for some industries. The glycoside hydrolase (GH) family 5 β-mannanase ( Rm Man5A) from Rhizomucor miehei shows many outstanding properties, such as high specific activity and hydrolysis property. However, owing to the low catalytic activity in acidic and thermophilic conditions, the application of Rm Man5A to the biorefinery of mannan biomasses is severely limited. To overcome the limitation, Rm Man5A was successfully engineered by directed evolution. Through two rounds of screening, a mutated β-mannanase (m Rm Man5A) with high catalytic activity in acidic and thermophilic conditions was obtained, and then characterized. The mutant displayed maximal activity at pH 4.5 and 65 °C, corresponding to acidic shift of 2.5 units in optimal pH and increase by 10 °C in optimal temperature. The catalytic efficiencies ( k cat / K m ) of m Rm Man5A towards many mannan substrates were enhanced more than threefold in acidic and thermophilic conditions. Meanwhile, the high specific activity and excellent hydrolysis property of Rm Man5A were inherited by the mutant m Rm Man5A after directed evolution. According to the result of sequence analysis, three amino acid residues were substituted in m Rm Man5A, namely Tyr233His, Lys264Met, and Asn343Ser. To identify the function of each substitution, four site-directed mutations (Tyr233His, Lys264Met, Asn343Ser, and Tyr233His/Lys264Met) were subsequently generated, and the substitutions at Tyr233 and Lys264 were found to be the main reason for the changes of m Rm Man5A. Through directed evolution of Rm Man5A, two key amino acid residues that controlled its catalytic efficiency under acidic and thermophilic conditions were identified
Leukaemia risks and exposure to ionizing radiations. ASN seminar, Tuesday, June 9, 2015, report
International Nuclear Information System (INIS)
Niel, Jean-Christophe; Samain, Jean-Paul; Colonna, Marc; Maynadie, Marc; Richardson, David; Bey, Pierre; Leuraud, Klervi; Laurier, Dominique; Hemon, Denis; Spycher, Ben; Kosti, Ourania; Bouville, Andre; Grosche, Bernd; Ziegelberger, Gunde; Kesminiene, Ausrele; Clavel, Jacqueline; Smeesters, Patrick; Murith, Christophe
2015-08-01
This seminar aims at proposing a review of present knowledge on leukaemia risks for children and adults associated with ionizing radiations, and at sharing knowledge between experts. After an introduction which outlined the interest of the ASN in research issues, and the importance awarded by the ASN to the variety of points of view, a first session addressed leukaemia and exposures to ionizing radiations. The contributions addressed some general aspects (an overview of leukaemia in France, the different types of adult and child leukaemia), leukaemia and acute exposures to ionizing radiations (ionizing radiation and leukaemia among Japanese bomb survivors, risks of leukaemia after radiotherapy), leukaemia and chronic exposures to ionizing radiations (assessment of epidemiological studies for adult chronic exposures). The second session addressed childhood leukaemia and ionizing radiations. The contributions of this second session more particularly addressed the following topics: childhood leukaemia and natural radioactivity (French studies, synthesis of international studies and a new Swiss study), childhood leukaemia and proximity of nuclear base installations (assessment of national and international studies, analysis of cancer risks in populations near nuclear facilities in the US, calculation of dose at the medulla as example of dosimetry of ionizing radiations and leukaemia, conclusions of the 2012 MELODI workshop), childhood leukaemia and scanner (recent results and perspectives), childhood leukaemia and other risk factors (etiology of childhood leukaemia - presentation of French studies initiated by the INSERM, and presentation of studies initiated by BfS)
Kempkes, L.J.M.; Martens, J.; Grzetic, J.; Berden, G.; Oomens, J.
2016-01-01
Deamidation is a major fragmentation channel upon activation by collision induced dissociation (CID) for protonated peptides containing glutamine (Gln) and asparagine (Asn) residues. Here, we investigate these NH3-loss reactions for four Asn- and Gln-containing protonated peptides in terms of the
28 CFR 0.168 - Redelegation by Assistant Attorneys General.
2010-07-01
..., Penalties, and Forfeitures § 0.168 Redelegation by Assistant Attorneys General. (a) Assistant Attorneys... the Assistant Attorney General level must be presented to the Assistant Attorney General for... the Deputy Attorney General or the Associate Attorney General, as appropriate, before taking effect...
International Nuclear Information System (INIS)
Yamauchi, Motohiro; Suzuki, Keiji; Kodama, Seiji; Watanabe, Masami
2004-01-01
Phosphorylation of p53 at Ser15, Thr18, and Ser20 has been thought to be important for p53 stabilization in response to ionizing radiation. In the present study, we examined the X-ray-induced stabilization of Ala-substituted p53 protein at Ser15, Thr18, and Ser20, whose gene expression was controlled under an ecdyson-inducible promoter. We found that all single-, double-, or triple-Ala-substituted p53 at Ser15, Yhr18, and Ser20 were accumulated in the nucleus similarly to wild-type p53 after X-irradiation. These results indicate that the phosphorylation of p53 at Ser15, Thr18, and Ser20 is not necessarily needed for p53 stabilization in response to ionizing radiation
Data of evolutionary structure change: 1AIFL-2AI0L [Confc[Archive
Lifescience Database Archive (English)
Full Text Available /ss_2> 0 n> 1AIF L...n> 1AIFLn> VSSSI----SSSNL 2AI0 Ln> 2AI0L...1AIFL-2AI0L 1AIF 2AI0 L L DIQLTQSPAFMAASPGEKVTITCSVSSSI----SSSNLH...line> SER CA 273 SER CA 260 ASN CA 337 LEU CA 408
DEFF Research Database (Denmark)
Nygaard, Rie; Hansen, Louise Valentin; Mokrosinski, Jacek
2010-01-01
Five highly conserved polar residues connected by a number of structural water molecules together with two rotamer micro-switches, TrpVI:13 and TyrVII:20, constitute an extended hydrogen bond network between the intracellular segments of TM-I, -II, -VI, and -VII of 7TM receptors. Molecular dynamics...... to apparently function as a catching trap for water molecules. Mutational analysis of the beta2-adrenergic receptor demonstrated that the highly conserved polar residues of the hydrogen bond network were all important for receptor signaling but served different functions, some dampening constitutive activity...... (AsnI:18, AspII:10, and AsnVII:13), whereas others (AsnVII:12 and AsnVII:16) located one helical turn apart and sharing a water molecule were shown to be essential for agonist-induced signaling. It is concluded that the conserved water hydrogen bond network of 7TM receptors constitutes an extended...
Cody, Vivian; Pace, Jim; Piraino, Jennifer; Queener, Sherry F.
2011-01-01
In order to produce a more potent replacement for trimethoprim (TMP) used as a therapy for Pneumocystis pneumonia and targets dihydrofolate reductase from Pneumocystis jirovecii (pjDHFR), it is necessary to understand the determinants of potency and selectivity against DHFR from the mammalian host and fungal pathogen cells. To this end, active site residues in human (h)DHFR were replaced with those from pjDHFR. Structural data are reported for two complexes of TMP with the double mutants Gln35Ser/Asn64Phe (Q35S/N64F) and Gln35Lys/Asn64Phe (Q35K/N64F) of hDHFR that unexpectedly show evidence for the binding of two molecules of TMP: one molecule that binds in the normal folate binding site and the second molecule that binds in a novel subpocket site such that the mutated residue Phe64 is involved in van der Waals contacts to the trimethoxyphenyl ring of the second TMP molecule. Kinetic data for the binding of TMP to hDHFR and pjDHFR reveal an 84-fold selectivity of TMP against pjDHFR (Ki 49 nM) compared to hDHFR (Ki 4093 nM). Two mutants that contain one substitution from pj- and one from the closely related Pneumocystis carinii DHFR (pcDHFR) (Q35K/N64F and Q35S/N64F) show Ki values of 593 and 617 nM, respectively; these Ki values are well above both the Ki for pjDHFR and are similar to pcDHFR (Q35K/N64F) and Q35S/N64F) (305 nM). These results suggest that active site residues 35 and 64 play key roles in determining selectivity for pneumocystis DHFR, but that other residues contribute to the unique binding of inhibitors to these enzymes. PMID:21684339
SERS-Active Nanoinjector for Intracellular Spectroscopy
Vitol, Elina; Orynbayeva, Zulfiya; Bouchard, Michael; Azizkhan-Clifford, Jane; Friedman, Gary; Gogotsi, Yury
2009-03-01
We developed a multifunctional nanopipette which allows simultaneous cell injection and intacellular surface-enhanced Raman spectroscopy (SERS) analysis. SERS spectra contain the characteristic frequencies of molecular bond vibrations. This is a unique method for studying cell biochemistry and physiology on a single organelle level. Unlike the fluorescence spectroscopy, it does not require any specific staining. The principle of SERS is based on very large electromagnetic field enhancement localized around a nano-rough metallic surface. Gold colloids are widely used SERS substrates. Previously, the colloidal nanoparticles were introduced into a cell by the mechanism of endocytosis. The disadvantage of this method is the uncontrollable aggregation and distribution of gold nanoparticles inside a cell which causes a significant uncertainty in the origin of the acquired data. At the same time, the nanoparticle uptake is irreversible. We present a SERS-active nanoinjector, coated with gold nanoparticles, which enables selective signal acquisition from any point-of-interest inside a cell. The nanoinjector provides a highly localized SERS signal with sub-nanometer resolution in real time.
Interaction between viologen-phosphorus dendrimers and α-synuclein
International Nuclear Information System (INIS)
Milowska, Katarzyna; Grochowina, Justyna; Katir, Nadia; El Kadib, Abdelkrim; Majoral, Jean-Pierre; Bryszewska, Maria; Gabryelak, Teresa
2013-01-01
In this study the interaction between viologen-phosphorus dendrimers and α-synuclein (ASN) was examined. Polycationic viologen-phosphorus dendrimers (two positive charges per viologen unit) are novel compounds with relatively unknown properties. The influence of these viologen dendrimers on ASN was tested using fluorimetric and circular dichroism methods. ASN contains four tyrosine residues; therefore, the influence of dendrimers on protein molecular conformation by measuring the changes in the ASN fluorescence in the presence of dendrimers was evaluated. The interaction of dendrimers with free L-tyrosine was also monitored. Results show that viologen-phosphorus dendrimers interact with ASN; they quenched the fluorescence of ASN as well as free tyrosine by dynamic and static ways. However, the quenching was not accompanied by modifications in the ASN secondary structure. - Highlights: ► Interaction between viologen-phosphorus dendrimers and α-synuclein (ASN) was investigated. ► Viologen-phosphorus dendrimers can quench the fluorescence of tyrosine in ASN. ► Dendrimers caused red-shift in maximum of fluorescence. ► Viologen-phosphorus dendrimers did not change the secondary structure of ASN.
Leucipo, Demócrito e Kant: uma Reflexão sobre a Equivalência entre Ser e Não-Ser
Directory of Open Access Journals (Sweden)
Eberth Eleuterio dos Santos
2015-08-01
Full Text Available De início, apresentaremos a tese de Demócrito e Leucipo, segundo a qual o ser não é mais que o não-ser, tendo como contraponto o pensamento eleata acerca da inexistência necessária do não-ser. Esta discussão nos remete à oposição entre o pleno (cheio e o vazio que será posteriormente traduzida na oposição entre o ser e o nada (ou o não-ser. Desse modo, a oposição entre o pleno e o vazio é uma oposição que se desloca para o ser e o não-ser. Em seguida, faremos a apreciação do escrito pré-crítico kantiano Ensaio para introduzir em filosofia o conceito de grandeza negativa, no qual distinguimos certo tipo de oposição tomada entre grandezas em geral que, acreditamos, poderia ser interpretado como estando de acordo com o posicionamento de Demócrito e Leucipo sobre o estatuto ontológico do não-ser como princípio equivalente ao ser, e não como sua contradição em sentido puramente lógico.
The 168/E at CERN and the MARK 2. An improved processor design
International Nuclear Information System (INIS)
Kunz, P.; Botterill, D.R.; Lord, D.; Edwards, A.; Fucci, A.; Lee, G.; Martin, B.; Mornacchi, G.; Scharff-Hansen, P.; Storr, M.
1981-01-01
In the first part of this paper the history of the 168/E work at CERN is reviewed, this is followed by a short description of the hardware and software in use and finally some examples of future applications are given. In the second part of the paper the limitations of the present 168/E design are discussed and the ways that a new design, Mark 2, could overcome them are presented. (orig.)
Malikanti, Ramesh; Vadija, Rajender; Veeravarapu, Hymavathi; Mustyala, Kiran Kumar; Malkhed, Vasavi; Vuruputuri, Uma
2017-12-01
Tuberculosis (Tb) is one of the major health challenges for the global scientific community. The 3-hydroxy butyryl-CoA dehydrogenase (Fad B2) protein belongs to 3-hydroxyl acetyl-CoA dehydrogenase family, which plays a key role in the fatty acid metabolism and β-oxidation in the cell membrane of Mycobacterium tuberculosis (Mtb). In the present study the Fad B2 protein is targeted for the identification of potential drug candidates for tuberculosis. The 3D model of the target protein Fad B2, was generated using homology modeling approach and was validated. The plausible binding site of the Fad B2 protein was identified from computational binding pocket prediction tools, which ranges from ASN120 to VAL150 amino acid residues. Virtual screening was carried out with the databases, Ligand box UOS and hit definder, at the binding site region. 133 docked complex structures were generated as an output. The identified ligands show good glide scores and glide energies. All the ligand molecules contain benzyl amine pharmacophore in common, which show specific and selective binding interactions with the SER122 and ASN146 residues of the Fad B2 protein. The ADME properties of all the ligand molecules were observed to be within the acceptable range. It is suggested from the result of the present study that the docked molecular structures with a benzyl amine pharmacophore act as potential ligands for Fad B2 protein binding and as leads in Tb drug discovery.
Directory of Open Access Journals (Sweden)
Josefa Aida Delgado
2005-01-01
Full Text Available Es un estudio basado en la filosofía fenomenológica heideggeriana, su propósito es desvelar los elementos estructurales de la existencia del "ser de la familia". El camino metodológico fue construido con base en el pensamiento de Heidegger. Los datos de la familia fueron recolectados por medio de las entrevistas y las observaciones. Cada uno de nosotros contribuye para su existencia, y ella posibilita el desarrollo de nuestro "ser-en el-mundo" al vivenciar y compartir experiencias cotidianas de la familia. Allí surge la posibilidad de compartir un modo de ser en el mundo, un modo de cuidado para "ser familia en el mundo". Un mundo que genera esa unidad de relacionamiento que emerge de sentimientos interligados entre los integrantes, respondiendo a las exigencias de cada miembro, por el sentimiento de pertenencia primaria generado en ellos. Esa unidad da la posibilidad de nacer a cada uno de nosotros, asi también, nos da la posibilidad de poder ser ser humano, llegando a ser un referencial de sí misma en cada ser humano.
Li, Wei; Cui, Xiao; Meng, Zhaolu; Huang, Xiahe; Xie, Qi; Wu, Heng; Jin, Hailing; Zhang, Dabing; Liang, Wanqi
2012-01-01
The accumulation of a number of small RNAs in plants is affected by abscisic acid (ABA) and abiotic stresses, but the underlying mechanisms are poorly understood. The miR168-mediated feedback regulatory loop regulates ARGONAUTE1 (AGO1) homeostasis, which is crucial for gene expression modulation and plant development. Here, we reveal a transcriptional regulatory mechanism by which MIR168 controls AGO1 homeostasis during ABA treatment and abiotic stress responses in Arabidopsis (Arabidopsis thaliana). Plants overexpressing MIR168a and the AGO1 loss-of-function mutant ago1-27 display ABA hypersensitivity and drought tolerance, while the mir168a-2 mutant shows ABA hyposensitivity and drought hypersensitivity. Both the precursor and mature miR168 were induced under ABA and several abiotic stress treatments, but no obvious decrease for the target of miR168, AGO1, was shown under the same conditions. However, promoter activity analysis indicated that AGO1 transcription activity was increased under ABA and drought treatments, suggesting that transcriptional elevation of MIR168a is required for maintaining a stable AGO1 transcript level during the stress response. Furthermore, we showed both in vitro and in vivo that the transcription of MIR168a is directly regulated by four abscisic acid-responsive element (ABRE) binding factors, which bind to the ABRE cis-element within the MIR168a promoter. This ABRE motif is also found in the promoter of MIR168a homologs in diverse plant species. Our findings suggest that transcriptional regulation of miR168 and posttranscriptional control of AGO1 homeostasis may play an important and conserved role in stress response and signal transduction in plants. PMID:22247272
THE ANALYSIS TOWARDS STATE APPARATUS COMMISSION ROLE IN ASN MANAGEMENT SYSTEM IN INDONESIA
Directory of Open Access Journals (Sweden)
Ajib Rakhmawanto
2015-05-01
Full Text Available In administrating bureaurcy business process, professional state apparatus are needed. Law number 5 of 2014 about the state civil apparatus mentions management based on merit that supposed to be supervised by an independen institution: State Apparatuss Commision (KASN. This article aims to analyze the KASN, and identify its task, function, and responsibilities. The analysis showed that KASN was formed to create professional state apparatus and supervise the merit system based management. The function of KASN becomes ineffective considering there is NCSA, an establish body with a role to supervise the ASN management. KASN will cause an overlapping and conflict of interest between the two institutions.
Stamping SERS for creatinine sensing
Li, Ming; Du, Yong; Zhao, Fusheng; Zeng, Jianbo; Santos, Greggy M.; Mohan, Chandra; Shih, Wei-Chuan
2015-03-01
Urine can be obtained easily, readily and non-invasively. The analysis of urine can provide metabolic information of the body and the condition of renal function. Creatinine is one of the major components of human urine associated with muscle metabolism. Since the content of creatinine excreted into urine is relatively constant, it is used as an internal standard to normalize water variations. Moreover, the detection of creatinine concentration in urine is important for the renal clearance test, which can monitor the filtration function of kidney and health status. In more details, kidney failure can be imminent when the creatinine concentration in urine is high. A simple device and protocol for creatinine sensing in urine samples can be valuable for point-of-care applications. We reported quantitative analysis of creatinine in urine samples by using stamping surface enhanced Raman scattering (S-SERS) technique with nanoporous gold disk (NPGD) based SERS substrate. S-SERS technique enables label-free and multiplexed molecular sensing under dry condition, while NPGD provides a robust, controllable, and high-sensitivity SERS substrate. The performance of S-SERS with NGPDs is evaluated by the detection and quantification of pure creatinine and creatinine in artificial urine within physiologically relevant concentration ranges.
Asn792 participates in the hydrogen bond network around the K+-binding pocket of gastric H,K-ATPase.
Swarts, H.G.P.; Koenderink, J.B.; Willems, P.H.G.M.; Krieger, E.; Pont, J.J.H.H.M. de
2005-01-01
Asn792 present in M5 of gastric H,K-ATPase is highly conserved within the P-type ATPase family. A direct role in K+ binding was postulated for Na,K-ATPase but was not found in a recent model for gastric H,K-ATPase (Koenderink, J. B., Swarts, H. G. P., Willems, P. H. G. M., Krieger, E., and De Pont,
Kaufmann, Martin; Morse, Nicole; Molloy, Billy Joe; Cooper, Donald P; Schlingmann, Karl Peter; Molin, Arnaud; Kottler, Marie Laure; Gallagher, J Christopher; Armas, Laura; Jones, Glenville
2017-07-01
CYP24A1 mutations are now accepted as a cause of idiopathic infantile hypercalcemia (IIH). A rapid liquid-chromatography tandem mass spectrometry (LC-MS/MS)-based blood test enabling measurement of the 25-OH-D 3 :24,25-(OH) 2 D 3 ratio (R) can identify IIH patients on the basis of reduced C24-hydroxylation of 25-OH-D 3 by CYP24A1 in vivo. Although values of this ratio are significantly elevated in IIH, somewhat surprisingly, serum 24,25-(OH) 2 D 3 remains detectable. The current study explores possible explanations for this including: residual CYP24A1 enzyme activity in individuals with certain CYP24A1 genotypes, expression of alternative C24-hydroxylases, and the possibility of isobaric contamination of the 24,25-(OH) 2 D 3 peak on LC-MS/MS. We employed an extended 20-min run time on LC-MS/MS to study serum vitamin D metabolites in patients with IIH due to mutations of CYP24A1 or SLC34A1; in unaffected heterozygotes and dialysis patients; in patients with vitamin D deficiency; as well as in normal subjects exhibiting a broad range of 25-OH-D levels. We identified 25,26-(OH) 2 D 3 as a contaminant of the 24,25-(OH) 2 D 3 peak. In normals, the concentration of 24,25-(OH) 2 D 3 greatly exceeds 25,26-(OH) 2 D 3 ; however, 25,26-(OH) 2 D 3 becomes more significant in IIH with CYP24A1 mutations and in dialysis patients, where 24,25-(OH) 2 D 3 levels are low when CYP24A1 function is compromised. Mean R in 30 IIH-CYP24A1 patients was 700 (range, 166 to 2168; cutoff = 140) as compared with 31 in 163 controls. Furthermore, patients possessing CYP24A1 L409S alleles exhibited higher 24,25-(OH) 2 D 3 levels and lower R (mean R = 268; n = 8) than patients with other mutations. We conclude that a chromatographic approach which resolves 24,25-(OH) 2 D 3 from 25,26-(OH) 2 D 3 produces a more accurate R that can be used to differentiate pathological states where CYP24A1 activity is altered. The origin of the residual serum 24,25-(OH) 2 D 3 in IIH patients appears to be
Wang, Mei-Chun; Tsai, Kuo-Wang; Chu, Chih-Hsun; Yu, Ming-Sun; Lam, Hing-Chung
2015-01-01
Glycosylated hemoglobin (Hb A1C) is a crucial indicator for the long-term control and the diagnosis of diabetes. However, the presence of hemoglobin (Hb) variants may affect the measured value of Hb A1C and result in an abnormal graph trend and inconsistency between the clinical blood sugar test and Hb A1C values. In this study, laboratory data of 41,267 patients with diabetes were collected. The Hb A1C levels and the graph results were examined. We identified 74 cases containing abnormal Hb A1C graph trends. The conducted blood cell counts and capillary Hb electrophoresis were used to analyze Hb variants. We also determined gene variation for the Hb variants by a sequence approach. Fifteen different types of Hb variants were identified in this study. Among these, we found a novel variant in which the α1 subunit of Hb showed an insertion of 24 nucleotides (nts) between the 56th and 57th residues. We named this novel variant Hb Kaohsiung Veterans General Hospital (Hb KSVGH) (HBA1: p.Lys57_Gly58insSerHisGlySerAlaGlnValLys).
Controllable Ag nanostructure patterning in a microfluidic channel for real-time SERS systems.
Leem, Juyoung; Kang, Hyun Wook; Ko, Seung Hwan; Sung, Hyung Jin
2014-03-07
We present a microfluidic patterning system for fabricating nanostructured Ag thin films via a polyol method. The fabricated Ag thin films can be used immediately in a real-time SERS sensing system. The Ag thin films are formed on the inner surfaces of a microfluidic channel so that a Ag-patterned Si wafer and a Ag-patterned PDMS channel are produced by the fabrication. The optimum sensing region and fabrication duration for effective SERS detection were determined. As SERS active substrates, the patterned Ag thin films exhibit an enhancement factor (EF) of 4.25 × 10(10). The Ag-patterned polymer channel was attached to a glass substrate and used as a microfluidic sensing system for the real-time monitoring of biomolecule concentrations. This microfluidic patterning system provides a low-cost process for the fabrication of materials that are useful in medical and pharmaceutical detection and can be employed in mass production.
Engineering Metal Nanostructure for SERS Application
Directory of Open Access Journals (Sweden)
Yanqin Cao
2013-01-01
Full Text Available Surface-enhanced Raman scattering (SERS has attracted great attention due to its remarkable enhancement and excellent selectivity in the detection of various molecules. Noble metal nanomaterials have usually been employed for producing substrates that can be used in SERS because of their unique local plasma resonance. As the SERS enhancement of signals depends on parameters such as size, shape, morphology, arrangement, and dielectric environment of the nanostructure, there have been a number of studies on tunable nanofabrication and synthesis of noble metals. In this work, we will illustrate progress in engineering metallic nanostructures with various morphologies using versatile methods. We also discuss their SERS applications in different fields and the challenges.
ASN guide project. Safety policy and management in INBs (base nuclear installations)
International Nuclear Information System (INIS)
2010-01-01
This guide presents the recommendations of the French Nuclear Safety Authority (ASN) in the field of safety policy and management (PMS) for base nuclear installations (INBs). It gives an overview and comments of some prescriptions of the so-called INB order and PMS decision. These regulatory texts define a framework for provisions any INB operator must implement to establish his safety policy, to define and implement a system which allows the safety to be maintained, the improvement of his INB safety to be permanently looked for. The following issues are addressed: operator's safety policy, identification of elements important for safety, of activities pertaining to safety, and of associated requirements, safety management organization and system, management of activities pertaining to safety, documentation and archiving
Fasting mediated increase in p-BAD(ser155) and p-AKT(ser473) in the prefrontal cortex of mice.
Pitchaimani, Vigneshwaran; Arumugam, Somasundaram; Thandavarayan, Rajarajan Amirthalingam; Karuppagounder, Vengadeshprabhu; Sreedhar, Remya; Afrin, Rejina; Harima, Meilei; Suzuki, Hiroshi; Miyashita, Shizuka; Nomoto, Mayumi; Sone, Hirohito; Suzuki, Kenji; Watanabe, Kenichi
2014-09-05
BAD-deficient mice and fasting have several common functional roles in seizures, beta-hydroxybutyrate (BHB) uptake in brain and alteration in counterregulatory hormonal regulation during hypoglycemia. Neuronal specific insulin receptor knockout (NIRKO) mice display impaired counterregulatory hormonal responses during hypoglycemia. In this study we investigated the fasting mediated expression of p-BAD(ser155) and p-AKT(ser473) in different regions of brain (prefrontal cortex, hippocampus, midbrain and hypothalamus). Fasting specifically increases p-BAD(ser155) and p-AKT(ser473) in prefrontal cortex and decreases in other regions of brain. Our results suggest that fasting may increase the uptake BHB by decreasing p-BAD(ser155) in the brain during hypoglycemia except prefrontal cortex and it uncovers specific functional area of p-BAD(ser155) and p-AKT(ser473) that may regulates counter regulatory hormonal response. Overall in support with previous findings, fasting mediated hypoglycemia activates prefrontal cortex insulin signaling which influences the hypothalamic paraventricular nucleus mediated activation of sympathoadrenal hormonal responses. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Identification of Key Residues for Enzymatic Carboxylate Reduction
Directory of Open Access Journals (Sweden)
Holly Stolterfoht
2018-02-01
Full Text Available Carboxylate reductases (CARs, E.C. 1.2.1.30 generate aldehydes from their corresponding carboxylic acid with high selectivity. Little is known about the structure of CARs and their catalytically important amino acid residues. The identification of key residues for carboxylate reduction provides a starting point to gain deeper understanding of enzymatic carboxylate reduction. A multiple sequence alignment of CARs with confirmed activity recently identified in our lab and from the literature revealed a fingerprint of conserved amino acids. We studied the function of conserved residues by multiple sequence alignments and mutational replacements of these residues. In this study, single-site alanine variants of Neurospora crassa CAR were investigated to determine the contribution of conserved residues to the function, expressability or stability of the enzyme. The effect of amino acid replacements was investigated by analyzing enzymatic activity of the variants in vivo and in vitro. Supported by molecular modeling, we interpreted that five of these residues are essential for catalytic activity, or substrate and co-substrate binding. We identified amino acid residues having significant impact on CAR activity. Replacement of His 237, Glu 433, Ser 595, Tyr 844, and Lys 848 by Ala abolish CAR activity, indicating their key role in acid reduction. These results may assist in the functional annotation of CAR coding genes in genomic databases. While some other conserved residues decreased activity or had no significant impact, four residues increased the specific activity of NcCAR variants when replaced by alanine. Finally, we showed that NcCAR wild-type and mutants efficiently reduce aliphatic acids.
Carvalho, S; Catarino, TA; Dias, AM; Kato, M; Almeida, A; Hessling, B; Figueiredo, J; Gärtner, F; Sanches, JM; Ruppert, T; Miyoshi, E; Pierce, M; Carneiro, F; Kolarich, D; Seruca, R; Yamaguchi, Y; Taniguchi, N; Reis, CA; Pinho, SS
2016-01-01
E-cadherin is a central molecule in the process of gastric carcinogenesis and its posttranslational modifications by N-glycosylation have been described to induce a deleterious effect on cell adhesion associated with tumor cell invasion. However, the role that site-specific glycosylation of E-cadherin has in its defective function in gastric cancer cells needs to be determined. Using transgenic mice models and human clinical samples, we demonstrated that N-acetylglucosaminyltransferase V (GnT-V)-mediated glycosylation causes an abnormal pattern of E-cadherin expression in the gastric mucosa. In vitro models further indicated that, among the four potential N-glycosylation sites of E-cadherin, Asn-554 is the key site that is selectively modified with β1,6 GlcNAc-branched N-glycans catalyzed by GnT-V. This aberrant glycan modification on this specific asparagine site of E-cadherin was demonstrated to affect its critical functions in gastric cancer cells by affecting E-cadherin cellular localization, cis-dimer formation, molecular assembly and stability of the adherens junctions and cell–cell aggregation, which was further observed in human gastric carcinomas. Interestingly, manipulating this site-specific glycosylation, by preventing Asn-554 from receiving the deleterious branched structures, either by a mutation or by silencing GnT-V, resulted in a protective effect on E-cadherin, precluding its functional dysregulation and contributing to tumor suppression. PMID:26189796
Dong, Xiao; Gu, Huaimin; Liu, Fangfang
2012-03-01
The paper investigated the residual ions in hydroxylamine-reduced silver colloid (HRSC) and the relationship between the condition of HRSC and the enhanced mechanisms of this colloid. We also detected the SERS of MB and studied the effects of anions on the Raman signal. In the case of HRSC, the bands of residual ions diminish while the bands of Ag-anions increase gradually with increasing the concentrations of Cl(-) and NO(3)(-). It means the affinity of residual ions on the silver surface is weaker than that of Cl(-) and NO(3)(-) and the residual ions are replaced gradually by the added Cl(-) or NO(3)(-). The Raman signal of residual ions can be detected by treatment with anions that do not bind strongly to the silver surface, such as SO(4)(2-). The most intense band of Ag-anions bonds can be also observed when adding weakly binding anions to the colloid. However, the anions which make up the Ag-anions bonds are residual Cl(-) and the effect of weakly binding anions is only to aggregate the silver particles. Residual Cl(-) can be replaced by I(-) which has the highest affinity. From the detection of methylene blue (MB), the effects of anions on the enhancement of Raman signal are discussed in detail, and these findings could make the conditions suitable for detecting analytes in high efficiency. This study will have a profound implication to SERS users about their interpretation of SERS spectra when obtaining these anomalous bands. Copyright © 2011 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Jensen, Sanne B.; Serre, Stephanie B. N.; Humes, Daryl G.
2015-01-01
to nine PIs (telaprevir, boceprevir, simeprevir, asunaprevir, vaniprevir, faldaprevir, paritaprevir, deldeprevir, and grazoprevir) in Huh7.5 cells. We found that most variants showed decreased fitness compared to original viruses. Overall, R155K-, A156G/S-, and D/Q168A/E/H/N/V-variants showed highest...... resistant. For the remaining PIs, most genotype 2-, 4-, 5-, and 6-, but not genotype 3-variants, showed varying resistance levels. Overall, grazoprevir (MK-5172) had the highest efficacy against original viruses and variants.This is the first comprehensive study revealing the impact of described key PI...
Han, Chuan-Hsiao; Lin, Yin-Shiou; Lin, Shyr-Yi; Hou, Wen-Chi
2014-03-15
Previous studies have shown that the Trp residue contributes to a high oxygen radical absorbance capacity (ORAC). Therefore, in this study, a Trp-containing dipeptide derived from a computer-aided simulation of pepsin hydrolysis of the yam tuber, dioscorin-namely, Asn-Trp (NW), and its analogue, Gln-Trp (QW)-were synthesised to compare their antioxidant and antiglycation activities with carnosine, homocarnosine, or glutathione (GSH). The antioxidant assays included hydroxyl radical-scavenging activity, anti-AAPH-induced hemolysis, and ORAC activity. NW had a significantly higher antioxidant activity than had QW and performed much better than carnosine, homocarnosine, or GSH. Using bovine serum albumin (BSA)/galactose or BSA/glucose as experimental models, NW had better antiglycation effects than had QW, as detected by an anti-N(ε)-(carboxymethyl)lysine (anti-CML) antibody. Moreover, NW and QW (50-200 μM) showed protection against methylglyoxal-induced cell deaths in human umbilical vein endothelial cells. These results suggest that NW, derived from computer-aided simulation of dioscorin hydrolysis, exhibits antioxidant and antiglycation activities, which thus shows the benefits of the yam tuber as an antioxidant-rich food. Copyright © 2013 Elsevier Ltd. All rights reserved.
Interaction between viologen-phosphorus dendrimers and {alpha}-synuclein
Energy Technology Data Exchange (ETDEWEB)
Milowska, Katarzyna, E-mail: milowska@biol.uni.lodz.pl [Department of General Biophysics, Faculty of Biology and Environmental Protection, University of Lodz, Pomorska 141/143, 90-236 Lodz (Poland); Grochowina, Justyna [Department of General Biophysics, Faculty of Biology and Environmental Protection, University of Lodz, Pomorska 141/143, 90-236 Lodz (Poland); Katir, Nadia [Laboratoire de Chimie de Coordination CNRS, 205 route de Narbonne, 31077 Toulouse (France); El Kadib, Abdelkrim [Institute of Nanomaterials and Nanotechnology (INANOTECH)-MAScIR (Moroccan Foundation for Advanced Science, Innovation and Research), ENSET, Avenue de I' Armee Royale, Madinat El Irfane, 10100 Rabat (Morocco); Majoral, Jean-Pierre [Laboratoire de Chimie de Coordination CNRS, 205 route de Narbonne, 31077 Toulouse (France); Bryszewska, Maria; Gabryelak, Teresa [Department of General Biophysics, Faculty of Biology and Environmental Protection, University of Lodz, Pomorska 141/143, 90-236 Lodz (Poland)
2013-02-15
In this study the interaction between viologen-phosphorus dendrimers and {alpha}-synuclein (ASN) was examined. Polycationic viologen-phosphorus dendrimers (two positive charges per viologen unit) are novel compounds with relatively unknown properties. The influence of these viologen dendrimers on ASN was tested using fluorimetric and circular dichroism methods. ASN contains four tyrosine residues; therefore, the influence of dendrimers on protein molecular conformation by measuring the changes in the ASN fluorescence in the presence of dendrimers was evaluated. The interaction of dendrimers with free L-tyrosine was also monitored. Results show that viologen-phosphorus dendrimers interact with ASN; they quenched the fluorescence of ASN as well as free tyrosine by dynamic and static ways. However, the quenching was not accompanied by modifications in the ASN secondary structure. - Highlights: Black-Right-Pointing-Pointer Interaction between viologen-phosphorus dendrimers and {alpha}-synuclein (ASN) was investigated. Black-Right-Pointing-Pointer Viologen-phosphorus dendrimers can quench the fluorescence of tyrosine in ASN. Black-Right-Pointing-Pointer Dendrimers caused red-shift in maximum of fluorescence. Black-Right-Pointing-Pointer Viologen-phosphorus dendrimers did not change the secondary structure of ASN.
International Nuclear Information System (INIS)
Solier, N.
2009-01-01
Radiotherapy recent development in cancer treatment needs strong procedures and quality assessment to improve safety both for patients and professionals. In Ile de France territory, a coordinated action between ASN inspectors and medical doctors specialized in public health (MISP), working as civil servants in health administration, was initiated at the end of 2007. An inspection guideline was implemented in a workshop between ASN and Regional Hospital Agency (ARH). The MISP as health administrator has to verify if care organisation responds to treatment cancer regulatory framework: as a doctor he is authorized to access to patient records to know which treatment was chosen. He has to assure if the therapeutic guidelines are respected. His comprehensive approach is essentially patient-oriented. The MISP inspection coordinated with ASN inspectors is a very pertinent pluri-disciplinary approach, undeniably necessary in such a medical technic. The effectiveness of the radiotherapy pluri-disciplinary team is funded on sharing procedures and experiences, respecting different knowledge and practices in daily work. This on site audit'. seems to be very fertile both for the radiotherapy team, the MISP and ASN inspectors. Continuous quality improvement in radiotherapy in the Ile de France region is a fertile issue between ANS and ARH teams. Confronting knowledge and procedures during the 'on site audit' in a transparent way will contribute improving radiotherapy for the 30.000 Francilian patients which receive this treatment each year. This challenge is our main concern to facilitate the patients access to the best standards treatments. (author)
Energy Technology Data Exchange (ETDEWEB)
Narjis, A., E-mail: narjis78@gmail.com [Research Group ESNPS, Physics Department, University Ibn Zohr, Faculty of Sciences, B.P 8106, Hay Dakhla, 80000 Agadir (Morocco); El Kaaouachi, A.; Limouny, L.; Dlimi, S.; Errai, M.; Sybous, A. [Research Group ESNPS, Physics Department, University Ibn Zohr, Faculty of Sciences, B.P 8106, Hay Dakhla, 80000 Agadir (Morocco); Kumaresavanji, M. [Centro Brasileiro de Pesquisas Fisicas (CBPF), Rua Dr. Xavier Sigaud, 150 Urca, Rio de Janeiro (Brazil)
2013-04-15
The transport properties in the La{sub 1.32}Sr{sub 1.68}Mn{sub 2}O{sub 7} layered manganite system have been studied in the presence of magnetic field up to 5 T. An analysis of the low temperature (T<45 K) dependence of the resistivity under hydrostatic pressure up to 25 kbars shows the spin-dependent Coulomb Blockade phenomenon. The surface phase and the link condition in grain boundaries are suggested to be responsible for the magnetoresistance data while influencing the charge transfer probability between grains. - Highlights: ►Magnetotransport in a colossal magnetoresistive material La{sub 1.32}Sr{sub 1.68}Mn{sub 2}O{sub 7}. ► The effect of the forming pressure on the magnetoresistance (MR). ► The grain size effect and charge transfer probability between grains. ► A simple model to explain the negative MR.
Batch fabrication of disposable screen printed SERS arrays.
Qu, Lu-Lu; Li, Da-Wei; Xue, Jin-Qun; Zhai, Wen-Lei; Fossey, John S; Long, Yi-Tao
2012-03-07
A novel facile method of fabricating disposable and highly reproducible surface-enhanced Raman spectroscopy (SERS) arrays using screen printing was explored. The screen printing ink containing silver nanoparticles was prepared and printed on supporting materials by a screen printing process to fabricate SERS arrays (6 × 10 printed spots) in large batches. The fabrication conditions, SERS performance and application of these arrays were systematically investigated, and a detection limit of 1.6 × 10(-13) M for rhodamine 6G could be achieved. Moreover, the screen printed SERS arrays exhibited high reproducibility and stability, the spot-to-spot SERS signals showed that the intensity variation was less than 10% and SERS performance could be maintained over 12 weeks. Portable high-throughput analysis of biological samples was accomplished using these disposable screen printed SERS arrays.
Achieving optimal SERS through enhanced experimental design.
Fisk, Heidi; Westley, Chloe; Turner, Nicholas J; Goodacre, Royston
2016-01-01
One of the current limitations surrounding surface-enhanced Raman scattering (SERS) is the perceived lack of reproducibility. SERS is indeed challenging, and for analyte detection, it is vital that the analyte interacts with the metal surface. However, as this is analyte dependent, there is not a single set of SERS conditions that are universal. This means that experimental optimisation for optimum SERS response is vital. Most researchers optimise one factor at a time, where a single parameter is altered first before going onto optimise the next. This is a very inefficient way of searching the experimental landscape. In this review, we explore the use of more powerful multivariate approaches to SERS experimental optimisation based on design of experiments and evolutionary computational methods. We particularly focus on colloidal-based SERS rather than thin film preparations as a result of their popularity. © 2015 The Authors. Journal of Raman Spectroscopy published by John Wiley & Sons, Ltd.
Wang, Hong; Brautigan, David L
2006-11-01
Human lemur (Lmr) kinases are predicted to be Tyr kinases based on sequences and are related to neurotrophin receptor Trk kinases. This study used homogeneous recombinant KPI-2 (Lmr2, LMTK2, Cprk, brain-enriched protein kinase) kinase domain and a library of 1,154 peptides on a microarray to analyze substrate specificity. We found that KPI-2 is strictly a Ser/Thr kinase that reacts with Ser either preceded by or followed by Pro residues but unlike other Pro-directed kinases does not strictly require an adjacent Pro residue. The most reactive peptide in the library corresponds to Ser-737 of cystic fibrosis transmembrane conductance regulator, and the recombinant R domain of cystic fibrosis transmembrane conductance regulator was a preferred substrate. Furthermore the KPI-2 kinase phosphorylated peptides corresponding to the single site in phosphorylase and purified phosphorylase b, making this only the second known phosphorylase b kinase. Phosphorylase was used as a specific substrate to show that KPI-2 is inhibited in living cells by addition of nerve growth factor or serum. The results demonstrate the utility of the peptide library to probe specificity and discover kinase substrates and offer a specific assay that reveals hormonal regulation of the activity of this unusual transmembrane kinase.
Bermuda Triangle: a subsystem of the 168/E interfacing scheme used by Group B at SLAC
International Nuclear Information System (INIS)
Oxoby, G.J.; Levinson, L.J.; Trang, Q.H.
1979-12-01
The Bermuda Triangle system is a method of interfacing several 168/E microprocessors to a central system for control of the processors and overlaying their memories. The system is a three-way interface with I/O ports to a large buffer memory, a PDP11 Unibus and a bus to the 168/E processors. Data may be transferred bidirectionally between any two ports. Two Bermuda Triangles are used, one for the program memory and one for the data memory. The program buffer memory stores the overlay programs for the 168/E, and the data buffer memory, the incoming raw data, the data portion of the overlays, and the outgoing processed events. This buffering is necessary since the memories of 168/E microprocessors are small compared to the main program and the amount of data being processed. The link to the computer facility is via a Unibus to IBM channel interface. A PDP11/04 controls the data flow. 7 figures, 4 tables
26 CFR 1.168(i)-4 - Changes in use.
2010-04-01
... property because the equipment was used by Z in its steam production plant for 8 months in 2004. If the... classification of the equipment under section 168(e) changes from 7-year property to 5-year property and the... equipment in its combustion turbine production plant for 4 months and then uses the equipment in its steam...
Label-free in situ SERS imaging of biofilms.
Ivleva, Natalia P; Wagner, Michael; Szkola, Agathe; Horn, Harald; Niessner, Reinhard; Haisch, Christoph
2010-08-12
Surface-enhanced Raman scattering (SERS) is a promising technique for the chemical characterization of biological systems. It yields highly informative spectra, can be applied directly in aqueous environment, and has high sensitivity in comparison with normal Raman spectroscopy. Moreover, SERS imaging can provide chemical information with spatial resolution in the micrometer range (chemical imaging). In this paper, we report for the first time on the application of SERS for in situ, label-free imaging of biofilms and demonstrate the suitability of this technique for the characterization of the complex biomatrix. Biofilms, being communities of microorganisms embedded in a matrix of extracellular polymeric substances (EPS), represent the predominant mode of microbial life. Knowledge of the chemical composition and the structure of the biofilm matrix is important in different fields, e.g., medicine, biology, and industrial processes. We used colloidal silver nanoparticles for the in situ SERS analysis. Good SERS measurement reproducibility, along with a significant enhancement of Raman signals by SERS (>10(4)) and highly informative SERS signature, enables rapid SERS imaging (1 s for a single spectrum) of the biofilm matrix. Altogether, this work illustrates the potential of SERS for biofilm analysis, including the detection of different constituents and the determination of their distribution in a biofilm even at low biomass concentration.
2010-01-01
... 12 Banks and Banking 6 2010-01-01 2010-01-01 false What is required if you rely on an estimated residual value greater than 25% of the original cost of the leased property? 714.5 Section 714.5 Banks and Banking NATIONAL CREDIT UNION ADMINISTRATION REGULATIONS AFFECTING CREDIT UNIONS LEASING § 714.5 What is...
International Nuclear Information System (INIS)
Doukov, T.; Hemmi, H.; Drennan, C.; Ragsdale, S.
2007-01-01
The methyltetrahydrofolate (CH 3 -H 4 folate) corrinoid-ironsulfur protein (CFeSP) methyltransferase (MeTr) catalyzes transfer of the methyl group of CH3-H4folate to cob(I)amide. This key step in anaerobic CO and CO 2 fixation is similar to the first half-reaction in the mechanisms of other cobalamin-dependent methyltransferases. Methyl transfer requires electrophilic activation of the methyl group of CH 3 -H 4 folate, which includes proton transfer to the N5 group of the pterin ring and poises the methyl group for reaction with the Co(I) nucleophile. The structure of the binary CH 3 -H 4 folate/MeTr complex (revealed here) lacks any obvious proton donor near the N5 group. Instead, an Asn residue and water molecules are found within H-bonding distance of N5. Structural and kinetic experiments described here are consistent with the involvement of an extended H-bonding network in proton transfer to N5 of the folate that includes an Asn (Asn-199 in MeTr), a conserved Asp (Asp-160), and a water molecule. This situation is reminiscent of purine nucleoside phosphorylase, which involves protonation of the purine N7 in the transition state and is accomplished by an extended H-bond network that includes water molecules, a Glu residue, and an Asn residue (Kicska, G. A., Tyler, P. C., Evans, G. B., Furneaux, R. H., Shi, W., Fedorov, A., Lewandowicz, A., Cahill, S. M., Almo, S. C., and Schramm, V. L. (2002) Biochemistry 41, 14489-14498). In MeTr, the Asn residue swings from a distant position to within H-bonding distance of the N5 atom upon CH 3 -H 4 folate binding. An N199A variant exhibits only ∼20-fold weakened affinity for CH 3 -H 4 folate but a much more marked 20,000-40,000-fold effect on catalysis, suggesting that Asn-199 plays an important role in stabilizing a transition state or high energy intermediate for methyl transfer
An improved method to unravel phosphoacceptors in Ser/Thr protein kinase-phosphorylated substrates.
Molle, Virginie; Leiba, Jade; Zanella-Cléon, Isabelle; Becchi, Michel; Kremer, Laurent
2010-11-01
Identification of the phosphorylated residues of bacterial Ser/Thr protein kinase (STPK) substrates still represents a challenging task. Herein, we present a new strategy allowing the rapid determination of phosphoacceptors in kinase substrates, essentially based on the dual expression of the kinase with its substrate in the surrogate E. coli, followed by MS analysis in a single-step procedure. The performance of this strategy is illustrated using two distinct proteins from Mycobacterium tuberculosis as model substrates, the GroEL2 and HspX chaperones. A comparative analysis with a standard method that includes mass spectrometry analysis of in vitro phosphorylated substrates is also addressed.
Energy Technology Data Exchange (ETDEWEB)
Francke, U.; Berg, M.A.; Tynan, K. [Stanford Univ. Medical Center, CA (United States)] [and others
1995-06-01
Ascending aortic disease, ranging from mild aortic root enlargement to aneurysm and/or dissection, has been identified in 10 individuals of a kindred, none of whom had classical Marfan syndrome (MFS). Single-strand conformation analysis of the entire fibrillin-1 (FBN1) cDNA of an affected family member revealed a G-to-A transition at nucleotide 3379, predicting a Gly1127Ser substitution. The glycine in this position is highly conserved in EGF-like domains of FBN1 and other proteins. This mutation was present in 9 of 10 affected family members and in 1 young unaffected member but was not found in other unaffected members, in 168 chromsomes from normal controls, and in 188 chromosomes from other individuals with MFS or related phenotypes. FBN1 intragenic marker haplotypes ruled out the possibility that the other allele played a significant role in modulating the phenotype in this family. Pulse-chase studies revealed normal fibrillin synthesis but reduced fibrillin deposition into the extracellular matrix in cultured fibroblasts from a Gly1127Ser carrier. We postulate that the Gly1127Ser FBN1 mutation is responsible for reduced matrix deposition. We suggest that mutations such as this one may disrupt EFG-like domain folding less drastically than do substitutions of cysteine or of other amino acids important for calcium-binding that cause classical MFS. The Gly 1127Ser mutation, therefore, produces a mild form of autosomal dominantly inherited weakness of elastic tissue, which predisposes to ascending aortic aneurysm and dissection later in life. 33 refs., 6 figs.
Directory of Open Access Journals (Sweden)
Sagar Dhakal
2018-02-01
Full Text Available Therapeutic and subtherapeutic use of veterinary drugs has increased the risk of residue contamination in animal food products. Antibiotics such as tetracycline are used for mastitis treatment of lactating cows. Milk expressed from treated cows before the withdrawal period has elapsed may contain tetracycline residue. This study developed a simple surface-enhanced Raman spectroscopic (SERS method for on-site screening of tetracycline residue in milk and water. Six batches of silver colloid nanoparticles were prepared for surface enhancement measurement. Milk-tetracycline and water-tetracycline solutions were prepared at seven concentration levels (1000, 500, 100, 10, 1, 0.1, and 0.01 ppm and spiked with silver colloid nanoparticles. A 785 nm Raman spectroscopic system was used for spectral measurement. Tetracycline vibrational modes were observed at 1285, 1317 and 1632 cm−1 in water-tetracycline solutions and 1322 and 1621 cm−1 (shifted from 1317 and 1632 cm−1, respectively in milk-tetracycline solutions. Tetracycline residue concentration as low as 0.01 ppm was detected in both the solutions. The peak intensities at 1285 and 1322 cm−1 were used to estimate the tetracycline concentrations in water and milk with correlation coefficients of 0.92 for water and 0.88 for milk. Results indicate that this SERS method is a potential tool that can be used on-site at field production for qualitative and quantitative detection of tetracycline residues.
Dhakal, Sagar; Chao, Kuanglin; Huang, Qing; Kim, Moon; Schmidt, Walter; Qin, Jianwei; Broadhurst, C Leigh
2018-02-01
Therapeutic and subtherapeutic use of veterinary drugs has increased the risk of residue contamination in animal food products. Antibiotics such as tetracycline are used for mastitis treatment of lactating cows. Milk expressed from treated cows before the withdrawal period has elapsed may contain tetracycline residue. This study developed a simple surface-enhanced Raman spectroscopic (SERS) method for on-site screening of tetracycline residue in milk and water. Six batches of silver colloid nanoparticles were prepared for surface enhancement measurement. Milk-tetracycline and water-tetracycline solutions were prepared at seven concentration levels (1000, 500, 100, 10, 1, 0.1, and 0.01 ppm) and spiked with silver colloid nanoparticles. A 785 nm Raman spectroscopic system was used for spectral measurement. Tetracycline vibrational modes were observed at 1285, 1317 and 1632 cm -1 in water-tetracycline solutions and 1322 and 1621 cm -1 (shifted from 1317 and 1632 cm -1 , respectively) in milk-tetracycline solutions. Tetracycline residue concentration as low as 0.01 ppm was detected in both the solutions. The peak intensities at 1285 and 1322 cm -1 were used to estimate the tetracycline concentrations in water and milk with correlation coefficients of 0.92 for water and 0.88 for milk. Results indicate that this SERS method is a potential tool that can be used on-site at field production for qualitative and quantitative detection of tetracycline residues.
Investigation of the 168Hf electron capture decay using fast radiochemical separation
International Nuclear Information System (INIS)
Trubert, D.; Hussonnois, M.; Brillard, L.; Barci, V.; Ardisson, G.; Szeglowski, Z.; Constantinescu, O.
1995-01-01
The (EC + β + ) decay of 168 Hf, produced by the 156 Gd ( 16 O,4n) reaction, has been studied, with high efficiency HPGe coaxial detectors, using on-line measurements carried out with the RACHEL setup, built to investigate the chemical properties of transactinide elements. Off-line measurements were also carried out using catcher collection technique. Energies and intensities of 119 γ-lines are reported among which only two were known in the earlier study of Chu and Reednick. The 168 Lu level scheme built on the basis of single and γ-γ coincidence measurements, allows the interpretation of more than 79 γ-transitions, between 38 excited states reported for the first time. (orig.)
Ohkuri, Takatoshi; Murase, Eri; Sun, Shu-Lan; Sugitani, Jun; Ueda, Tadashi
2013-10-01
A method was previously established for evaluating Asn deamidation by matrix-assisted laser desorption/ionization time of flight-mass spectrometry using endoproteinase Asp-N. In this study, we demonstrated that this method could be applied to the identification of the deamidation site of the humanized fragment antigen-binding (Fab). First, a system for expressing humanized Fab from methylotrophic yeast Pichia pastoris was constructed, resulting in the preparation of ∼30 mg of the purified humanized Fab from 1 l culture. Analysis of the L-chain derived from recombinant humanized Fab that was heated at pH 7 and 100°C for 1 h showed the deamidation at Asn138 in the constant region. Then, we prepared L-N138D Fab and L-N138A Fab and examined their properties. The circular dichroism (CD) spectrum of the L-N138D Fab was partially different from that of the wild-type Fab. The measurement of the thermostability showed that L-N138D caused a significant decrease in the thermostability of Fab. On the other hand, the CD spectrum and thermostability of L-N138A Fab showed the same behaviour as the wild-type Fab. Thus, it was suggested that the introduction of a negative charge at position 138 in the L-chain by the deamidation significantly affected the stability of humanized Fab.
Pemanfaatan Residu Pembakaran Sampah Organik Rumah Tangga
Directory of Open Access Journals (Sweden)
Eko Naryono
2013-09-01
Full Text Available Pembakaran sampah organik rumah tangga menghasilkan residu padat 25-30% yang terdiri dari abu bawah (BA, abu atas (FA dan kondensat air yang mengandung tar. Abu bawah sebagian besar terdiri dari bahan anorganik seperti Si, Al, Fe, Ca, Mg, K, Na, Cl dan logam berat antara lain Cd, Cr, Cu, Hg, Ni, Pb dan Zn, sedangkan abu atas tersusun dari bahan organik dan anorganik. Bahan organik yang terdapat dalam residu antara lain polycyclic aromatic hydrocarbon (PAH, chloro benzene (CB, polychlorinated biphenyl (PCB, polychlorinated dibenzo-p-dioksin (PCDD dan furan (PCDF. Residu pembakaran biomass perlu diolah atau dimanfaatkan agar tidak mengganggu lingkungan. Salah satu metode pengolahan yang mudah diterapkan dan aman terhadap lingkungan adalah pemadatan dan stabilisasi menggunakan semen atau lempung sebagai binder. Pemanfaatan produk ini dapat digunakan untuk batako atau batu bata. Berdasarkan prediksi, pembakaran sampah kota Malang sebesar 400 ton/hari menghasilkan abu 72 ton/hari. Pemakaian abu sebesar 25% pada pembuatan batako dengan perbandingan semen : pasir : abu sebesar 3,75 : 30 : 1,25 dapat menghasilkan batako setiap hari 366545 buah. Kata kunci : Abu, Batako, Residu, Pemadatan, Sampah organik rumah tangga
The 25. CLI national conference
International Nuclear Information System (INIS)
Niel, Jean-Christophe; Dumont, Jean-Jacques; Godet, Jean-Luc; Delalonde, Jean-Claude; Revol, Henri; Boissin, Serge; Calafat, Alexis; Monot, Bernard; Quintin, Christophe; Rousselet, Yannick; Charre, Jean-Pierre; Gaudouen, Gael; Rollinger, Francois; Schneider, Thierry; Villers, Anita
2013-12-01
This document gathers contributions presented during a conference held in December 2013. After a presentation of the ANCCLI (National association of CLIs) activity, this conference comprised two round tables. The first one addressed the issue of radioactive substance transportation, and comprised a film on this issue produced by the ASN, a presentation of some key figures, and an overview of flows related to the nuclear industry. The second round table addressed the territorial approach to the management of consequences of a nuclear accident, and comprised a film produced by the ASN on the main doctrinal issues related to the post-accidental management of a nuclear accident (it is based on works performed by the CODIR-PA committee), a contribution of the ANCCLI on its implication on these issues and on the possible involvement of CLIs
Peng, Tao; Huang, Bingzhen; Sun, Yao; Lu, Yongbo; Bonewald, Lynda; Chen, Shuo; Butler, William T; Feng, Jerry Q; D'Souza, Rena N; Qin, Chunlin
2009-01-01
Dentin matrix protein 1 (DMP1) is present in the extracellular matrix (ECM) of dentin and bone as processed NH(2)- and COOH-terminal fragments, resulting from proteolytic cleavage at the NH(2) termini of 4 aspartic acid residues during rat DMP1 processing. One cleavage site residue, Asp(181) (corresponding to Asp(197) of mouse DMP1), and its flanking region are highly conserved across species. We speculate that cleavage at the NH(2) terminus of Asp(197) of mouse DMP1 represents an initial, first-step scission in the whole cascade of proteolytic processing. To test if Asp(197) is critical for initiating the proteolytic processing of mouse DMP1, we substituted Asp(197) with Ala(197) by mutating the corresponding nucleotides of mouse cDNA that encode this amino acid residue. This mutant DMP1 cDNA was cloned into a pcDNA3.1 vector. Data from transfection experiments indicated that this single substitution blocked the proteolytic processing of mouse DMP1 in HEK-293 cells, indicating that cleavage at the NH(2) terminus of Asp(197) is essential for exposing other cleavage sites for the conversion of DMP1 to its fragments. The NH(2)-terminal fragment of DMP1 occurs as a proteoglycan form (DMP1-PG) that contains a glycosaminoglycan (GAG) chain. Previously, we showed that a GAG chain is linked to Ser(74) in rat DMP1 (Ser(89) in mouse DMP1). To confirm that mouse DMP1-PG possesses a single GAG chain attached to Ser(89), we substituted Ser(89) by Gly(89). Data from transfection analysis indicated that this substitution completely prevented formation of the GAG-containing form, confirming that DMP1-PG contains a single GAG chain attached to Ser(89) in mouse DMP1. Copyright 2008 S. Karger AG, Basel.
International Nuclear Information System (INIS)
Shenderovich, M.D.; Sekatsis, I.P.; Liepin'sh, E.E.; Nikiforovich, G.V.; Papsuevich, O.S.
1986-01-01
An assignment of the 1 H NMR signals of des-Gly 9 -[Arg 8 ]vasopressin in dimethyl sulfoxide has been made by 2D spectroscopy. The SSCCs and temperature coefficients Δδ/Δ T have been obtained for the amide protons and the system of NOE cross-peaks in the two-dimensional NOESY spectrum has been analyzed. The most important information on the spatial structure of des-Gly 9 -[Arg 8 ]vasopressin is given by the low value of the temperature coefficient Δδ/Δ T of the Asn 5 amide proton and the NOE between the α-protons of Cys 1 and Cys 6 . It is assumed that the screening of the NH proton of the Asn 5 residue from the solvent is connected with a β-bend of the backbone in the 2-5 sequence, and the distance between the C/sup α/H atoms of the Cys 1 and Cys 6 residues does not exceed 4 A. Bearing these limitations in mind, a theoretical conformational analysis of the molecule has been made. The group of low-energy conformations of the backbone obtained has been compared with the complete set of NMR characteristics
Molecular Features Underlying Selectivity in Chicken Bitter Taste Receptors
Directory of Open Access Journals (Sweden)
Antonella Di Pizio
2018-01-01
Full Text Available Chickens sense the bitter taste of structurally different molecules with merely three bitter taste receptors (Gallus gallus taste 2 receptors, ggTas2rs, representing a minimal case of bitter perception. Some bitter compounds like quinine, diphenidol and chlorpheniramine, activate all three ggTas2rs, while others selectively activate one or two of the receptors. We focus on bitter compounds with different selectivity profiles toward the three receptors, to shed light on the molecular recognition complexity in bitter taste. Using homology modeling and induced-fit docking simulations, we investigated the binding modes of ggTas2r agonists. Interestingly, promiscuous compounds are predicted to establish polar interactions with position 6.51 and hydrophobic interactions with positions 3.32 and 5.42 in all ggTas2rs; whereas certain residues are responsible for receptor selectivity. Lys3.29 and Asn3.36 are suggested as ggTas2r1-specificity-conferring residues; Gln6.55 as ggTas2r2-specificity-conferring residue; Ser5.38 and Gln7.42 as ggTas2r7-specificity conferring residues. The selectivity profile of quinine analogs, quinidine, epiquinidine and ethylhydrocupreine, was then characterized by combining calcium-imaging experiments and in silico approaches. ggTas2r models were used to virtually screen BitterDB compounds. ~50% of compounds known to be bitter to human are likely to be bitter to chicken, with 25, 20, 37% predicted to be ggTas2r1, ggTas2r2, ggTas2r7 agonists, respectively. Predicted ggTas2rs agonists can be tested with in vitro and in vivo experiments, contributing to our understanding of bitter taste in chicken and, consequently, to the improvement of chicken feed.
Strieker, Matthias; Kopp, Florian; Mahlert, Christoph; Essen, Lars-Oliver; Marahiel, Mohamed A
2007-03-20
Non-ribosomally synthesized lipopeptide antibiotics of the daptomycin type are known to contain unnatural beta-modified amino acids, which are essential for bioactivity. Here we present the biochemical and structural basis for the incorporation of 3-hydroxyasparagine at position 9 in the 11-residue acidic lipopeptide lactone calcium-dependent antibiotic (CDA). Direct hydroxylation of l-asparagine by AsnO, a non-heme Fe(2+)/alpha-ketoglutarate-dependent oxygenase encoded by the CDA biosynthesis gene cluster, was validated by Fmoc derivatization of the reaction product and LC/MS analysis. The 1.45, 1.92, and 1.66 A crystal structures of AsnO as apoprotein, Fe(2+) complex, and product complex, respectively, with (2S,3S)-3-hydroxyasparagine and succinate revealed the stereoselectivity and substrate specificity of AsnO. The comparison of native and product-complex structures of AsnO showed a lid-like region (residues F208-E223) that seals the active site upon substrate binding and shields it from sterically demanding peptide substrates. Accordingly, beta-hydroxylated asparagine is synthesized prior to its incorporation into the growing CDA peptide. The AsnO structure could serve as a template for engineering novel enzymes for the synthesis of beta-hydroxylated amino acids.
SERS Technique for Rapid Bacterial Screening
This study reports the feasibility of citrate-reduced colloidal silver SERS for differentiating E. coli, Listeria, and Salmonella. FT-Raman and SERS spectra of both silver colloids and colloid-K3PO4 mixtures were collected and analyzed to evaluate the reproducibility and stability of silver colloids...
Buxton, R S; Ward, J B
1980-10-01
Three heat-sensitive mutants of Bacillus subtilis 168, which lysed at the non-permissive temperature, have been shown under these conditions to be defective in the synthesis of peptidoglycan. This was caused by lesions in three different stages of peptidoglycan synthesis.In one mutant (ddl), D-alanine: D-alanine ligase was defective, leading to the accumulation of UDP-MurAc-L-Ala-D-Glu-meso-A,pm ; the ddl mutation was closely linked(87 yo cotransducible) with dal, specifying alanine racemase. In a second mutant (dapE),the lesion was in N-acetyl-L-diaminopimelate deacylase, resulting in UDP-MurAc-L-Ala-D-Glu being accumulated, whilst in a third mutant (ptg-1435), UDP-MurAc-L-Ala-D-Glumeso-A,pm-D-Ala-D-Ala was the peptidoglycan precursor accumulated although the enzyme defect has not been ascertained. Both dapE and ptg-1435 were located between metC and pyr(AD), dapE being 25% cotransducible and ptg-1435 were located between metC and pyr(AD), dapE being 25% cotransducible with pyr(AD).
Moguilevsky, N; Varsalona, F; Guillaume, J P; Noyer, M; Gillard, M; Daliers, J; Henichart, J P; Bollen, A
1995-01-01
A cDNA clone for the human histamine H1 receptor was isolated from a lung cDNA library and stably expressed in CHO cells. The recombinant receptor protein present in the cell membranes, displayed the functional and binding characteristics of histamine H1 receptors. Mutation of Ser155 to Ala in the fourth transmembrane domain did not significantly change the affinity of the receptor for histamine and H1 antagonists. However, mutation of the fifth transmembrane Asn198 to Ala resulted in a dramatic decrease of the affinity for histamine binding, and for the histamine-induced polyphosphoinositides breakdown, whereas the affinity towards antagonists was not significantly modified. In addition, mutation of another fifth transmembrane amino acid, Thr194 to Ala also diminished, but to a lesser extent, the affinity for histamine. These data led us to propose a molecular model for histamine interaction with the human H1 receptor. In this model, the amide moiety of Asn198 and the hydroxyl group of Thr194 are involved in hydrogen bonding with the nitrogen atoms of the imidazole ring of histamine. Moreover, mutation of Thr194 to Ala demonstrated that this residue is responsible for the discrimination between enantiomers of cetirizine.
Energy Technology Data Exchange (ETDEWEB)
Nakano, Noboru; Kumarevel, Thirumananseri, E-mail: tskvel@spring8.or.jp; Matsunaga, Emiko; Shinkai, Akeo [RIKEN SPring-8 Center, Harima Institute, 1-1-1 Kouto, Sayo, Hyogo 679-5148 (Japan); Kuramitsu, Seiki [RIKEN SPring-8 Center, Harima Institute, 1-1-1 Kouto, Sayo, Hyogo 679-5148 (Japan); Department of Biological Sciences, Graduate School of Science, Osaka University, Tayonaka, Osaka 560-0043 (Japan); Yokoyama, Shigeyuki, E-mail: tskvel@spring8.or.jp [RIKEN SPring-8 Center, Harima Institute, 1-1-1 Kouto, Sayo, Hyogo 679-5148 (Japan); Genomic Sciences Center, Yokohama Institute, RIKEN, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045 (Japan); Department of Biophysics and Biochemistry, Graduate School of Science, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 (Japan)
2007-11-01
A putative member of the Lrp/AsnC family of transcriptional regulators, ST1022 from S. tokodaii strain 7, has been purified and crystallized in the absence and presence of the effector l-glutamine. A molecular-replacement solution was found using the FL11 transcriptional regulator from Pyrococcus sp. OT3 as a model and structural refinement is under way. The Lrp/AsnC family of transcriptional regulators, also known as feast/famine transcriptional regulators, are widely distributed among bacteria and archaea. This family of proteins are likely to be involved in cellular metabolism, with exogenous amino acids functioning as effectors. Here, the crystallization and preliminary X-ray diffraction analysis of ST1022, a member of the Lrp/AsnC family of proteins, is reported with and without exogenous glutamine as the effector molecule. The crystals of native ST1022 and of the putative complex belong to the tetragonal space group I422, with unit-cell parameters a = b = 103.771, c = 73.297 Å and a = b = 103.846, c = 73.992 Å, respectively. Preliminary X-ray diffraction data analysis and molecular-replacement solution revealed the presence of one monomer per asymmetric unit.
International Nuclear Information System (INIS)
Nakano, Noboru; Kumarevel, Thirumananseri; Matsunaga, Emiko; Shinkai, Akeo; Kuramitsu, Seiki; Yokoyama, Shigeyuki
2007-01-01
A putative member of the Lrp/AsnC family of transcriptional regulators, ST1022 from S. tokodaii strain 7, has been purified and crystallized in the absence and presence of the effector l-glutamine. A molecular-replacement solution was found using the FL11 transcriptional regulator from Pyrococcus sp. OT3 as a model and structural refinement is under way. The Lrp/AsnC family of transcriptional regulators, also known as feast/famine transcriptional regulators, are widely distributed among bacteria and archaea. This family of proteins are likely to be involved in cellular metabolism, with exogenous amino acids functioning as effectors. Here, the crystallization and preliminary X-ray diffraction analysis of ST1022, a member of the Lrp/AsnC family of proteins, is reported with and without exogenous glutamine as the effector molecule. The crystals of native ST1022 and of the putative complex belong to the tetragonal space group I422, with unit-cell parameters a = b = 103.771, c = 73.297 Å and a = b = 103.846, c = 73.992 Å, respectively. Preliminary X-ray diffraction data analysis and molecular-replacement solution revealed the presence of one monomer per asymmetric unit
SERS microscopy: plasmonic nanoparticle probes and biomedical applications
Gellner, M.; Schütz, M.; Salehi, M.; Packeisen, J.; Ströbel, P.; Marx, A.; Schmuck, C.; Schlücker, S.
2010-08-01
Nanoparticle probes for use in targeted detection schemes and readout by surface-enhanced Raman scattering (SERS) comprise a metal core, Raman reporter molecules and a protective shell. One design of SERS labels specifically optimized for biomedical applications in conjunction with red laser excitation is based on tunable gold/silver nanoshells, which are completely covered by a self-assembled monolayer (SAM) of Raman reporters. A shell around the SAM-coated metal core stabilizes the colloid and prevents particle aggregation. The optical properties and SERS efficiencies of these plasmonic nanostructures are characterized both experimentally and theoretically. Subsequent bioconjugation of SERS probes to ligands such as antibodies is a prerequisite for the selective detection of the corresponding target molecule via the characteristic Raman signature of the label. Biomedical imaging applications of SERS-labeled antibodies for tumor diagnostics by SERS microscopy are presented, using the localization of the tumor suppressor p63 in prostate tissue sections as an example.
Directory of Open Access Journals (Sweden)
Huanxi Shen
Full Text Available DNA damage to cochlear hair cells caused by 8-oxoguanine (8-oxoG is essential for the development of noise-induced hearing loss (NIHL. Human 8-oxoG DNA glycosylase1 (hOGG1 is a key enzyme in the base excision repair (BER pathway that eliminates 8-oxoG. Many epidemiological and functional studies have suggested that the hOGG1 Ser326Cys polymorphism (rs1052133 is associated with many diseases. The purpose of this investigation was to investigate whether the hOGG1 Ser326Cys polymorphism in the human BER pathway is associated with genetic susceptibility to NIHL in a Chinese population. This polymorphism was genotyped among 612 workers with NIHL and 615 workers with normal hearing. We found that individuals with the hOGG1 Cys/Cys genotype had a statistically significantly increased risk of NIHL compared with those who carried the hOGG1 Ser/Ser genotype (adjusted OR=1.59, 95% CI=1.13-2.25 and this increased risk was more pronounced among the workers in the 15- to 25- and >25-year noise exposure time, 85-92 dB(A noise exposure level, ever smoking, and ever drinking groups, similar effects were also observed in a recessive model. In summary, our data suggested that the hOGG1 Cys/Cys genotype may be a genetic susceptibility marker for NIHL in the Chinese Han population.
Ser lo mismo, ser diferente: contra la masificación
Saldarriaga Roa, Alberto
2005-01-01
La sociedad moderna se ha configurado, en los dos últimos siglos, como una sociedad de masas. Esto parece ser una condición sine qua non de su estructura y operatividad. La masificación se manifiesta no sólo en el comportamiento social sino también en el
A novel bacteriocin-like substance (BLIS) from a pathogenic strain of Vibrio harveyi.
Prasad, Sathish; Morris, Peter C; Hansen, Rasmus; Meaden, Philip G; Austin, Brian
2005-09-01
Inter-strain and inter-species inhibition mediated by a bacteriocin-like inhibitory substance (BLIS) from a pathogenic Vibrio harveyi strain VIB 571 was demonstrated against four isolates of the same species, and one culture each of a Vibrio sp., Vibrio fischeri, Vibrio gazogenes and Vibrio parahaemolyticus. The crude BLIS, which was obtained by ammonium-sulphate precipitation of the cell-free supernatant of a 72 h broth culture of strain VIB 571, was inactivated by lipase, proteinase K, pepsin, trypsin, pronase E, SDS and incubation at > or =60 degrees C for 10 min. The activity was stable between pH 2-11 for at least 5 h. Anion-exchange chromatography, gel filtration, SDS-PAGE and two-dimensional gel electrophoresis revealed the presence of a single major peak, comprising a protein with a pI of approximately 5.4 and a molecular mass of approximately 32 kDa. The N-terminal amino acid sequence of the protein comprised Asp-Glu-Tyr-Ile-Ser-X-Asn-Lys-X-Ser-Ser-Ala-Asp-Ile (with X representing cysteine or modified amino acid residues). A similarity search based on the matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) generated peptide masses and the N-terminal sequence did not yield any significant matches.
SERS-Based Prognosis of Kidney Transplant Outcome
Chi, Jingmao
Kidney transplant is the predominant procedure of all organ transplants around the world. The number of patients on the waiting list for a kidney is growing rapidly, yet the number of donations does not keep up with the fast-growing need. This thesis focuses on the surface-enhanced Raman scattering (SERS) analysis of urine samples for prognosis of kidney transplant outcome, which can potentially let patients have a more timely treatment as well as expand the organ pool for transplant. We have observed unique SERS spectral features from urine samples of kidney transplant recipients that have strong associations with the kidney acute rejection (AR) based on the analysis of urine one day after the transplant. Our ability to provide an early prognosis of transplant outcome is a significant advance over the current gold standard of clinical diagnosis, which occurs weeks or months after the surgical procedure. The SERS analysis has also been applied to urine samples from deceased kidney donors. Excellent classification ability was achieved when the enhanced PCA-LDA analysis was used to classify and identify urine samples from different cases. The sensitivity of the acute tubular necrosis (ATN) class is more than 90%, which can indicate the usable kidneys in the high failure risk category. This analysis can help clinicians identify usable kidneys which would be discarded using conventional clinic methods as high failure risk. To investigate the biomarkers that cause the unique SERS features, an HPLC-SERS-MS approach was established. The high-performance liquid chromatography (HPLC) was used to separate the urinary components to reduce the sample complexity. The mass spectrometry (MS) was used to determine the formulas and the structures of the biomarkers. The presence of 1-methyl-2-pyrrolidone (NMP) and adenine in urine samples were confirmed by both MS and SERS analysis. Succinylmonocholine, a metabolite of suxamethonium, has a potential to be the biomarker that causes
Ocular Toxicity Profile of ST-162 and ST-168 as Novel Bifunctional MEK/PI3K Inhibitors.
Smith, Andrew; Pawar, Mercy; Van Dort, Marcian E; Galbán, Stefanie; Welton, Amanda R; Thurber, Greg M; Ross, Brian D; Besirli, Cagri G
2018-04-30
ST-162 and ST-168 are small-molecule bifunctional inhibitors of MEK and PI3K signaling pathways that are being developed as novel antitumor agents. Previous small-molecule and biologic MEK inhibitors demonstrated ocular toxicity events that were dose limiting in clinical studies. We evaluated in vitro and in vivo ocular toxicity profiles of ST-162 and ST-168. Photoreceptor cell line 661W and adult retinal pigment epithelium cell line ARPE-19 were treated with increasing concentrations of bifunctional inhibitors. Western blots, cell viability, and caspase activity assays were performed to evaluate MEK and PI3K inhibition and dose-dependent in vitro toxicity, and compared with monotherapy. In vivo toxicity profile was assessed by intravitreal injection of ST-162 and ST-168 in Dutch-Belted rabbits, followed by ocular examination and histological analysis of enucleated eyes. Retinal cell lines treated with ST-162 or ST-168 exhibited dose-dependent inhibition of MEK and PI3K signaling. Compared with inhibition by monotherapies and their combinations, bifunctional inhibitors demonstrated reduced cell death and caspase activity. In vivo, both bifunctional inhibitors exhibited a more favorable toxicity profile when compared with MEK inhibitor PD0325901. Novel MEK and PI3K bifunctional inhibitors ST-162 and ST-168 demonstrate favorable in vitro and in vivo ocular toxicity profiles, supporting their further development as potential therapeutic agents targeting multiple aggressive tumors.
Bobbili, Kishore Babu; Bandari, Shyam; Grobe, Kay; Swamy, Musti J
2014-07-18
The pumpkin phloem lectin (PP2) is an RNA-binding, defense-related, chitooligosaccharide-specific, homodimeric lectin of Mr 48 kDa expressed at high concentrations in the sieve elements and companion cells of pumpkin (Cucurbita maxima). In the present study, PP2 was expressed in the methylotrophic yeast Pichia pastoris with the Saccharomyces α-factor sequence to direct the recombinant protein into the secretory pathway as a prerequisite for unimpaired folding and posttranslational glycosylation of recombinant PP2. Previous computational modeling and ligand docking studies predicted a putative chitooligosaccharide-binding site on the PP2 surface, which was divided into three subsites, with two amino acid residues in each subsite identified as possible candidates for interaction with chitooligosaccharides (CHOs). In this work, mutational analysis and hemagglutination assays were employed to verify the role of the predicted residues in the carbohydrate binding activity of the protein. The results obtained revealed that mutation of Ser-104 to Ala (S104A) at subsite-2 resulted in about 90% loss of agglutination activity of the protein, indicating that Ser-104 is crucial for the binding of CHOs to PP2. Also, L100A (at subsite-1) and K200A (at subsite-3) independently decreased the lectin activity by about 40%, indicating that these two residues also contribute significantly to sugar binding by PP2. Together, these findings confirm that all the three subsites contribute to varying degrees toward PP2-carbohydrate interaction, and confirm the validity of the computational model, as proposed earlier. Copyright © 2014 Elsevier Inc. All rights reserved.
The sdg interacting-boson model applied to 168Er
Yoshinaga, N.; Akiyama, Y.; Arima, A.
1986-03-01
The sdg interacting-boson model is applied to 168Er. Energy levels and E2 transitions are calculated. This model is shown to solve the problem of anharmonicity regarding the excitation energy of the first Kπ=4+ band relative to that of the first Kπ=2+ one. The level scheme including the Kπ=3+ band is well reproduced and the calculated B(E2)'s are consistent with the experimental data.
Kusumawati, R.; Nasrullah, A. H.; Pesik, R. N.; Muthmainah; Indarto, D.
2018-03-01
Altered energy metabolism from phosphorylated oxidation to aerobic glycolysis is one of the cancer hallmarks. Lactate dehydrogenase A (LDHA) is a major enzyme that catalyses pyruvate to lactate in such condition. The aim of this study was to explore LDHA inhibitors derived from Indonesian herbal plants. In this study, LDHA and oxamate molecular structures were obtained from protein data bank. As a standard ligand inhibitor, oxamate was molecularly re-validated using Autodock Vina 1.1.2 software and showed binding energy -4.26 ± 0.006 kcal/mol and interacted with LDHA at Gln99, Arg105, Asn137, Arg168, His192, and Thr247 residues. Molecular docking was used to visualize interaction between Indonesian phytochemicals and LDHA. Indonesian phytochemicals with the lowest binding energy and similar residues with standard ligand was Miraxanthin-III (-8.53 ± 0.006 kcal/mol), Vulgaxanthin-I (-8.46 ± 0.006 kcal/mol), Miraxanthin-II (-7.9 ± 0.2 kcal/mol) and Miraxanthin-V (-7.96 ± kcal/mol). Lower energy binding to LDHA and binding site at these residues was predicted to inhibit LDHA activity better than standard ligand. All phytochemicals were found in Mirabilis jalapa plant. Secondary metabolites in Mirabilis jalapa have LDHA inhibitor property in silico. Further in vitro study should be performed to confirm this result.
40 CFR 180.176 - Mancozeb; tolerances for residues.
2010-07-01
... Asparagus (negligible residue) 0.1 Banana 4.0 Banana, pulp 0.5 Barley, bran 20 Barley, flour 20 Barley..., straw 25 Onion, bulb 0.5 Papaya (whole fruit with no residue present in the edible pulp after the peel...
Liu, Jing; Li, Jie; Dong, Hong; Chen, Yunfu; Wang, Yansheng; Wu, Hang; Li, Changrun; Weaver, David T; Zhang, Lixin; Zhang, Buchang
2017-07-01
Lrp/AsnC family regulators have been found in many bacteria as crucial regulators controlling diverse cellular processes. By genomic alignment, we found that SCO3361, an Lrp/AsnC family protein from Streptomyces coelicolor, shared the highest similarity to the SACE_Lrp from Saccharopolyspora erythraea. Deletion of SCO3361 led to dramatic reduction in actinorhodin (Act) production and delay in aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of SCO3361 in Act production revealed that it altered the transcription of the cluster-situated regulator gene actII-ORF4 by directly binding to its promoter. SCO3361 was an auto-regulator and simultaneously activated the transcription of its adjacent divergently transcribed gene SCO3362. SCO3361 affected aerial hyphae formation and sporulation of S. coelicolor by activating the expression of amfC, whiB, and ssgB. Phenylalanine and cysteine were identified as the effector molecules of SCO3361, with phenylalanine reducing the binding affinity, whereas cysteine increasing it. Moreover, interactional regulation between SCO3361 and SACE_Lrp was discovered for binding to each other's target gene promoter in this work. Our findings indicate that SCO3361 functions as a pleiotropic regulator controlling secondary metabolism and morphological development in S. coelicolor.
Conocer y ser en el paradigma constructivista
Directory of Open Access Journals (Sweden)
Jose Antonio Camargo Rodriguez
2014-03-01
Full Text Available Toda teoría acerca del aprendizaje se fundamenta en una interpretación del conocimiento, la cual se encuentra, a su vez, ligada a una cierta concepción de «ser». No será posible asimilar verdaderamente cualquiera de tales teorías si se ignoran, o no se consideran con el debido detenimiento, las ideas de conocer y «ser» que le sirven de base. Sc pone de presente que el constructivismo, en contraste con la teoría transmisionista de la enseñanza y el aprendizaje, predominante en la pedagogía tradicional, tiene su fundamento en la interpretación según la cual el conocer es una actividad humana en la que, a medida quo conoce, el hombre construye el «ser». Antes de todo conocimiento, las cosas no tienen un «ser»; están ahí, pero no se sabe lo que son. El «ser», quo constituye el objeto de todo conocer, aquello que el sujeto persigue a través de su conocimiento, no toes dada de antemano, ni le viene de fuera, sino quo es una elaboración quo el mismo realiza a través de su actividad cognoscitiva, un contenido de su propia conciencia. Hay, pues, una cierta paradoja entre las ideas de conocer y «ser» que sirven de fundamento al constructivismo, cuya reflexión se propone en aras de ganar una mejor comprensión, de encontrarle a este paradigma un sentido más allá de la pedagogía y la didáctica.
Identification of excited states in 167Os and 168Os: shape coexistence at extreme neutron deficiency
International Nuclear Information System (INIS)
Joss, D.T.; King, S.L.; Page, R.D.; Simpson, J.; Keenan, A.; Amzal, N.; Baeck, T.; Bentley, M.A.; Cederwall, B.; Cocks, J.F.C.; Cullen, D.M.; Greenlees, P.T.; Helariutta, K.; Jones, P.M.; Julin, R.; Juutinen, S.; Kankaanpaeae, H.; Kettunen, H.; Kuusiniemi, P.; Leino, M.; Muikku, M.; Savelius, A.; Uusitalo, J.; Williams, S.J.
2001-01-01
Excited states in the very neutron-deficient isotopes 167 Os and 168 Os have been observed using the reaction 112 Sn( 58 Ni, 2pxn). The JUROSPHERE γ-ray spectrometer array was used in conjunction with the RITU gas-filled recoil separator to collect prompt γ radiation in coincidence with recoils implanted in a silicon strip detector located at the focal plane of RITU. Using a selective recoil decay tagging technique it has been possible to unambiguously assign γ-ray transitions to 167 Os and 168 Os through the characteristic α radioactivity of these nuclides. The high-spin structure of the bands is discussed in terms of quasiparticle configurations within the framework of the cranked shell model. The role of shape coexistence in 168 Os is examined with phenomenological three-band mixing calculations
Isomer spectroscopy of neutron-rich 168 Tb 103
Energy Technology Data Exchange (ETDEWEB)
Gurgi, L. A.; Regan, P. H.; Söderström, P. -A.; Watanabe, H.; Walker, P. M.; Podolyák, Zs.; Nishimura, S.; Berry, T. A.; Doornenbal, P.; Lorusso, G.; Isobe, T.; Baba, H.; Xu, Z. Y.; Sakurai, H.; Sumikama, T.; Catford, W. N.; Bruce, A. M.; Browne, F.; Lane, G. J.; Kondev, F. G.; Odahara, A.; Wu, J.; Liu, H. L.; Xu, F. R.; Korkulu, Z.; Lee, P.; Liu, J. J.; Phong, V. H.; Yag, A.; Zhang, G. X.; Alharbi, T.; Carroll, R. J.; Chae, K. Y.; Dombradi, Zs.; Estrade, A.; Fukuda, N.; Griffin, C.; Ideguchi, E.; Inabe, N.; Kanaoka, H.; Kojouharov, I.; Kubo, T.; Kubono, S.; Kurz, N.; Kuti, I.; Lalkovski, S.; Lee, E. J.; Lee, C. S.; Lotay, G.; Moon, C. -B.; Nishizuka, I.; Nita, C. R.; Patel, Z.; Roberts, O. J.; Schaffner, H.; Shand, C. M.; Suzuki, H.; Takeda, H.; Terashima, S.; Vajta, Zs.; Yoshida, S.; Valiente-Dòbon, J. J.
2017-11-01
In-flight fission of a 345 MeV per nucleon 238U primary beam on a 2 mm thick 9Be target has been used to produce and study the decays of a range of neutron-rich nuclei centred around the doubly mid-shell nucleus 170Dy at the RIBF Facility, RIKEN, Japan. The produced secondary fragments of interest were identified event-by-event using the BigRIPS separator. The fragments were implanted into the WAS3ABI position sensitive silicon active stopper which allowed pixelated correlations between implants and their subsequent β-decay. Discrete γ-ray transitions emitted following decays from either metastable states or excited states populated following beta decay were identified using the 84 coaxial high-purity germanium (HPGe) detectors of the EURICA spectrometer, which was complemented by 18 additional cerium-doped lanthanum bromide (LaBr3) fast-timing scintillation detectors from the FATIMA collaboration. This paper presents the internal decay of a metastable isomeric excited state in the odd-odd nucleus 168Tb, which corresponds to a single proton-neutron hole configuration in the valence maximum nucleus 170Dy. These data represent the first information on excited states in this nucleus, which is the most neutron-rich odd-odd isotope of terbium (Z=65) studied to date. Nilsson configurations associated with an axially symmetric, prolate-deformed nucleus are proposed for the 168Tb ground state the observed isomeric state by comparison with Blocked BCS-Nilsson calculations.
BEPS redesign of 168 commercial buildings: summary report
Energy Technology Data Exchange (ETDEWEB)
Stoops, J.L.; Deringer, J.J.; Moreno, S.; Misuriello, H.P.
1984-05-01
The objective of this report is to present, in usable form, summary data from the Building Energy Performance Standards (BEPS) Phase II commercial buildings energy research conducted in 1978-1979. Summary data presented were obtained from two major research efforts: the BEPS Phase II Redesign experiment; and the related research on ASHRAE Standard 90-75R. The bulk of this report consists of data tabulations of key energy parameters for the 168 sample buildings, which were tabulated from computer-stored files of the 1978-1979 data. Two kinds of tabulations are included: numerical tabulations that extracted information from the computer-stored data base for the 168 sample buildings; and graphic presentations of the computer-generated data, plus data extracted from other sources. The intent is to provide a single data compendium of key energy-related factors from the 1978 redesign experiment and the associated 1978-1979 ASHRAE Standard 90-75R research. This report also supplements the information for which there was not space in the magazine articles. Thus, for some building types, additional analysis, comments, and data tabulations are included that could not be included in the articles because space was limited. These additional analysis items are not consistent across building types because both the energy conservation opportunities and the design strategies applied by the building designers varied considerably by building type. The chapters have been entered individually into EDB and ERA.
Dependence of α-helical and β-sheet amino acid propensities on the overall protein fold type
Directory of Open Access Journals (Sweden)
Fujiwara Kazuo
2012-08-01
Full Text Available Abstract Background A large number of studies have been carried out to obtain amino acid propensities for α-helices and β-sheets. The obtained propensities for α-helices are consistent with each other, and the pair-wise correlation coefficient is frequently high. On the other hand, the β-sheet propensities obtained by several studies differed significantly, indicating that the context significantly affects β-sheet propensity. Results We calculated amino acid propensities for α-helices and β-sheets for 39 and 24 protein folds, respectively, and addressed whether they correlate with the fold. The propensities were also calculated for exposed and buried sites, respectively. Results showed that α-helix propensities do not differ significantly by fold, but β-sheet propensities are diverse and depend on the fold. The propensities calculated for exposed sites and buried sites are similar for α-helix, but such is not the case for the β-sheet propensities. We also found some fold dependence on amino acid frequency in β-strands. Folds with a high Ser, Thr and Asn content at exposed sites in β-strands tend to have a low Leu, Ile, Glu, Lys and Arg content (correlation coefficient = −0.90 and to have flat β-sheets. At buried sites in β-strands, the content of Tyr, Trp, Gln and Ser correlates negatively with the content of Val, Ile and Leu (correlation coefficient = −0.93. "All-β" proteins tend to have a higher content of Tyr, Trp, Gln and Ser, whereas "α/β" proteins tend to have a higher content of Val, Ile and Leu. Conclusions The α-helix propensities are similar for all folds and for exposed and buried residues. However, β-sheet propensities calculated for exposed residues differ from those for buried residues, indicating that the exposed-residue fraction is one of the major factors governing amino acid composition in β-strands. Furthermore, the correlations we detected suggest that amino acid composition is related to folding
New levels in 168Er: Use of a Compton-suppressed Ge array with the (n,γ) reaction
International Nuclear Information System (INIS)
Gill, R.L.; Casten, R.F.; Phillips, W.R.; Varley, B.J.; Lister, C.J.; Durell, J.L.; Shannon, J.A.; Warner, D.D.
1996-01-01
For the first time an (n,γ) reaction has been extensively studied using a large array of Compton-suppressed Ge detectors (the TESSA array). The nucleus 168 Er was studied and the data show substantial improvement, in both quantity and quality, over previous coincidence data. Even though 168 Er is perhaps the best studied deformed nucleus, over 250 new coincidence relations and a number of new levels in 168 Er were disclosed, demonstrating the usefulness of this approach. Nuclear physics applications relate to the extension of nearly complete spectroscopy to higher excitation energies and to the study of statistical and chaotic features of the decay of low spin compound nuclear levels. copyright 1996 The American Physical Society
Saha, Sujoy; Purath, Ahammed Shabeer Thekkum; Jadhav, Manjusha R; Loganathan, M; Banerjee, Kaushik; Rai, A B
2014-01-01
This paper reports the in vitro and in vivo bioefficacy of a combination fungicide trifloxystrobin (25%) + tebuconazole (50%) against early blight disease of tomato (Lycopersicon esculentum Mill.) caused by Alternaria solani and their corresponding pre-harvest intervals (PHI) with reference to the maximum residue limits (European Union). Bioefficacy of the test fungicide combination revealed that in vitro conditions manifested the best control (75.1%) at 350 mg kg(-1) against 76.2% control under field conditions. A sample preparation method based on ethyl acetate extraction and estimation by LC-MS multiple reaction monitoring (MRM) was validated in tomato fruits at 0.01 mg/kg and dissipation studies were conducted in field at single and double doses. The residues of both the compounds on all the sampling days were below the European Union maximum residue limits (EU-MRLs) and the maximum permissible intakes (MPIs) were calculated on the basis of prescribed acceptable daily intake (ADI). The combined bioefficacy and residue dynamics information will support label-claim of this fungicide combination for the management of early blight in tomato.
Directory of Open Access Journals (Sweden)
Zhu Li
Full Text Available The reversibility of thermal denaturation and catalytic efficiency of Bacillus licheniformis α-amylase were improved through site-directed mutagenesis. By using multiple sequence alignment and PoPMuSiC algorithm, Ser187 and Asn188, which located within a long loop in Domain B of Bacillus licheniformis α-amylase, were selected for mutation. In addition, Ala269, which is adjacent to Ser187 and Asn188, was also investigated. Seven mutants carrying the mutations S187D, N188T, N188S, A269K, A269K/S187D, S187D/N188T, and A269K/S187D/N188T were generated and characterized. The most thermostable mutant, A269K/S187D/N188T, exhibited a 9-fold improvement in half-life at 95°C and pH 5.5, compared with that of the wild-type enzyme. Mutant A269K/S187D/N188T also exhibited improved catalytic efficiency. The catalytic efficiency of mutant A269K/S187D/N188T reached 5.87×103±0.17 g·L-1·s-1 at pH 5.5, which is 1.84-fold larger than the corresponding value determined for the wild-type enzyme. Furthermore, the structure analysis showed that immobilization of the loop containing Ser187 and Asn188 plays a significant role in developing the properties of Bacillus licheniformis α-amylase.
Li, Zhu; Duan, Xuguo; Chen, Sheng; Wu, Jing
2017-01-01
The reversibility of thermal denaturation and catalytic efficiency of Bacillus licheniformis α-amylase were improved through site-directed mutagenesis. By using multiple sequence alignment and PoPMuSiC algorithm, Ser187 and Asn188, which located within a long loop in Domain B of Bacillus licheniformis α-amylase, were selected for mutation. In addition, Ala269, which is adjacent to Ser187 and Asn188, was also investigated. Seven mutants carrying the mutations S187D, N188T, N188S, A269K, A269K/S187D, S187D/N188T, and A269K/S187D/N188T were generated and characterized. The most thermostable mutant, A269K/S187D/N188T, exhibited a 9-fold improvement in half-life at 95°C and pH 5.5, compared with that of the wild-type enzyme. Mutant A269K/S187D/N188T also exhibited improved catalytic efficiency. The catalytic efficiency of mutant A269K/S187D/N188T reached 5.87×103±0.17 g·L-1·s-1 at pH 5.5, which is 1.84-fold larger than the corresponding value determined for the wild-type enzyme. Furthermore, the structure analysis showed that immobilization of the loop containing Ser187 and Asn188 plays a significant role in developing the properties of Bacillus licheniformis α-amylase.
Directory of Open Access Journals (Sweden)
Christian B. Oehlenschlæger
2017-11-01
Full Text Available PSY1R is a leucine-rich repeat (LRR receptor-like kinase (RLK previously shown to act as receptor for the plant peptide hormone PSY1 (peptide containing sulfated tyrosine 1 and to regulate cell expansion. PSY1R phosphorylates and thereby regulates the activity of plasma membrane-localized H+-ATPases. While this mechanism has been studied in detail, little is known about how PSY1R itself is activated. Here we studied the activation mechanism of PSY1R. We show that full-length PSY1R interacts with members of the SERK co-receptor family in planta. We identified seven in vitro autophosphorylation sites on serine and threonine residues within the kinase domain of PSY1R using mass spectrometry. We furthermore show that PSY1R autophosphorylation occurs in trans and that the initial transphosphorylation takes place within the activation loop at residues Ser951, Thr959, and Thr963. While Thr959 and Thr963 are conserved among other related plant LRR RLKs, Ser951 is unique to PSY1R. Based on homology modeling we propose that phosphorylation of Ser951 stabilize the inactive conformation of PSY1R.
International Nuclear Information System (INIS)
Chen, Kaihang; Shen, Zuguang; Luo, Jiwen; Wang, Xiaoying; Sun, Runcang
2015-01-01
Graphical abstract: - Highlights: • Synthesis optimization of Ag NPs with quaternized chitosan (QCS) was studied. • The size of Ag NPs was tuned by changing the DS and Mw of QCS. • QCS/Ag NPs exhibited much better SERS performance than Ag NPs without free QCS. • QCS/Ag NPs as SERS substrate detected tricyclazole in low concentration of 50 ppb. • QCS/Ag NPs as SERS substrate detected Sudan I with the detection limit of 10 ppm. - Abstract: There is an urgent need to develop a highly sensitive detection system for detecting trace amounts of food contaminants. In this study, optimal synthesis of silver nanoparticles (Ag NPs) with stable and narrow size distribution in the range of 15–25 nm was performed under microwave irradiation, using quaternized chitosan (QCS) as reducing and stabilizing agent. The results showed that the ratio of QCS to [Ag(NH 3 ) 2 ] + , reaction temperature, irradiation time, the degree of substitution (DS) and molecular weight (Mw) of QCS had obvious effects on the formation, particle size and size distribution of Ag NPs. In addition, utilizing QCS/Ag NPs composite as SERS substrate, tricyclazole and Sudan I could be rapidly and sensitively detected with the limit of detection (LOD) as low as 50 ppb and 10 ppm, respectively. Compared with previously reported works, our detection system are of great stability and operability. The QCS was coated on the surface of Ag core, avoiding aggregation of Ag NPs and creating hot spots, in turn, providing superior amplification of SERS. Thus, it is believed that the QCS/Ag NPs composite could be considered as an ideal SERS-active substrate for detection of food contaminants
DEFF Research Database (Denmark)
Wittrup, HH; Andersen, RV; Tybjærg-Hansen, A
2006-01-01
CONTEXT: Genetic variants in lipoprotein lipase may affect triglycerides, high-density lipoprotein (HDL), and risk of ischemic heart disease (IHD). OBJECTIVE: The objective of this study was to investigate the influence of T(-93)G, G(-53)C, Asp9Asn, Gly188Glu, Asn291Ser, and Ser447Ter lipoprotein...... lipase genotypes on triglycerides, HDL, and IHD. DESIGN: The cross-sectional study involved 9004 adults. The prospective study consisted of 8817 adults developing 1001 IHD events over 23 yr. The case-control study involved 7818 non-IHD individuals vs. cohorts of 915 and 1062 IHD patients, respectively....... SETTING: The study was performed in the Danish general population (the Copenhagen City Heart Study). PARTICIPANTS: IHD was angina pectoris or myocardial infarction. MAIN OUTCOME MEASURES: Triglycerides, HDL, and IHD were the main outcome measures. RESULTS: Cross-sectionally, triglycerides varied...
26 CFR 1.168(k)-1 - Additional first year depreciation deduction.
2010-04-01
... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Additional first year depreciation deduction. 1... Corporations § 1.168(k)-1 Additional first year depreciation deduction. (a) Scope and definitions—(1) Scope. This section provides the rules for determining the 30-percent additional first year depreciation...
Ouyang, Lei; Yao, Ling; Zhou, Taohong; Zhu, Lihua
2018-10-16
Malachite Green (MG) is a banned pesticide for aquaculture products. As a required inspection item, its fast and accurate determination before the products' accessing market is very important. Surface enhanced Raman scattering (SERS) is a promising tool for MG sensing, but it requires the overcoming of several problems such as fairly poor sensitivity and reproducibility, especially laser induced chemical conversion and photo-bleaching during SERS observation. By using a graphene wrapped Ag array based flexible membrane sensor, a modified SERS strategy was proposed for the sensitive and accurate detection of MG. The graphene layer functioned as an inert protector for impeding chemical transferring of the bioproduct Leucomalachite Green (LMG) to MG during the SERS detection, and as a heat transmitter for preventing laser induced photo-bleaching, which enables the separate detection of MG and LMG in fish extracts. The combination of the Ag array and the graphene cover also produced plentiful densely and uniformly distributed hot spots, leading to analytical enhancement factor up to 3.9 × 10 8 and excellent reproducibility (relative standard deviation low to 5.8% for 70 runs). The proposed method was easily used for MG detection with limit of detection (LOD) as low as 2.7 × 10 -11 mol L -1 . The flexibility of the sensor enable it have a merit for in-field fast detection of MG residues on the scale of a living fish through a surface extraction and paste transferring manner. The developed strategy was successfully applied in the analysis of real samples, showing good prospects for both the fast inspection and quantitative detection of MG. Copyright © 2018 Elsevier B.V. All rights reserved.
Dynamic SERS nanosensor for neurotransmitter sensing near neurons.
Lussier, Félix; Brulé, Thibault; Bourque, Marie-Josée; Ducrot, Charles; Trudeau, Louis-Éric; Masson, Jean-François
2017-12-04
Current electrophysiology and electrochemistry techniques have provided unprecedented understanding of neuronal activity. However, these techniques are suited to a small, albeit important, panel of neurotransmitters such as glutamate, GABA and dopamine, and these constitute only a subset of the broader range of neurotransmitters involved in brain chemistry. Surface-enhanced Raman scattering (SERS) provides a unique opportunity to detect a broader range of neurotransmitters in close proximity to neurons. Dynamic SERS (D-SERS) nanosensors based on patch-clamp-like nanopipettes decorated with gold nanoraspberries can be located accurately under a microscope using techniques analogous to those used in current electrophysiology or electrochemistry experiments. In this manuscript, we demonstrate that D-SERS can measure in a single experiment ATP, glutamate (glu), acetylcholine (ACh), GABA and dopamine (DA), among other neurotransmitters, with the potential for detecting a greater number of neurotransmitters. The SERS spectra of these neurotransmitters were identified with a barcoding data processing method and time series of the neurotransmitter levels were constructed. The D-SERS nanosensor was then located near cultured mouse dopaminergic neurons. The detection of neurotransmitters was performed in response to a series of K + depolarisations, and allowed the detection of elevated levels of both ATP and dopamine. Control experiments were also performed near glial cells, showing only very low basal detection neurotransmitter events. This paper demonstrates the potential of D-SERS to detect neurotransmitter secretion events near living neurons, but also constitutes a strong proof-of-concept for the broad application of SERS to the detection of secretion events by neurons or other cell types in order to study normal or pathological cell functions.
Directory of Open Access Journals (Sweden)
Peter Mirau
2015-09-01
Full Text Available Despite enormous efforts, our understanding the structure and dynamics of α-synuclein (ASN, a disordered protein (that plays a key role in neurodegenerative disease is far from complete. In order to better understand sequence-structure-property relationships in α-SYNUCLEIN we have developed a coarse-grained model using knowledge-based residue-residue interactions and used it to study the structure of free ASN as a function of temperature (T with a large-scale Monte Carlo simulation. Snapshots of the simulation and contour contact maps show changes in structure formation due to self-assembly as a function of temperature. Variations in the residue mobility profiles reveal clear distinction among three segments along the protein sequence. The N-terminal (1-60 and C-terminal (96-140 regions contain the least mobile residues, which are separated by the higher mobility non-amyloid component (NAC (61-95. Our analysis of the intra-protein contact profile shows a higher frequency of residue aggregation (clumping in the N-terminal region relative to that in the C-terminal region, with little or no aggregation in the NAC region. The radius of gyration (Rg of ASN decays monotonically with decreasing the temperature, consistent with the finding of Allison et al. (JACS, 2009. Our analysis of the structure function provides an insight into the mass (N distribution of ASN, and the dimensionality (D of the structure as a function of temperature. We find that the globular structure with D ≈ 3 at low T, a random coil, D ≈ 2 at high T and in between (2 ≤ D ≤ 3 at the intermediate temperatures. The magnitudes of D are in agreement with experimental estimates (J. Biological Chem 2002.
Lee, Minwoo; Oh, Kyudeok; Choi, Han-Kyu; Lee, Sung Gun; Youn, Hye Jung; Lee, Hak Lae; Jeong, Dae Hong
2018-01-26
As a cost-effective approach for detecting trace amounts of pesticides, filter paper-based SERS sensors have been the subject of intensive research. One of the hurdles to overcome is the difficulty of retaining nanoparticles on the surface of the paper because of the hydrophilic nature of the cellulose fibers in paper. This reduces the sensitivity and reproducibility of paper-based SERS sensors due to the low density of nanoparticles and short retention time of analytes on the paper surface. In this study, filter paper was treated with alkyl ketene dimer (AKD) to modify its property from hydrophilic to hydrophobic. AKD treatment increased the contact angle of the aqueous silver nanoparticle (AgNP) dispersion, which consequently increased the density of AgNPs. The retention time of the analyte was also increased by preventing its rapid absorption into the filter paper. The SERS signal was strongly enhanced by the increased number of SERS hot spots owing to the increased density of AgNPs on a small contact area of the filter surface. The reproducibility and sensitivity of the SERS signal were optimized by controlling the distribution of AgNPs on the surface of the filter paper by adjusting the concentration of the AgNP solution. Using this SERS sensor with a hydrophobicity-modified filter paper, the spot-to-spot variation of the SERS intensity of 25 spots of 4-aminothiophenol was 6.19%, and the limits of detection of thiram and ferbam as test pesticides were measured to be 0.46 nM and 0.49 nM, respectively. These proof-of-concept results indicate that this paper-based SERS sensor can serve for highly sensitive pesticide detection with low cost and easy fabrication.
Directory of Open Access Journals (Sweden)
Javier García de María
2008-07-01
Full Text Available Ser y estar: uno de los temas difíciles de la enseñanza/aprendizaje del español. Este trabajo expone un enfoque que recurre a la significación como hilo conductor. Por una parte, a la significación de ser y de estar como verbos, en sí mismos. Por otra, a la significación de los adjetivos. El planteamiento no es ya qué significa un determinado adjetivo con ser o con estar, sino cuál de estos verbos puede expresar su significado único o cada uno de sus significados. Sobre esta base el análisis considera, primero, los significados de ser/estar y los significados de un adjetivo dado y, segundo, los resultados significativos que arroja la relación entre verbos y adjetivo. Cuando el significado de un adjetivo se pueda expresar con los dos verbos, la elección vendrá determinada por la intencionalidad del hablante en el contexto comunicativo en que se encuentre. A partir de aquí las construcciones en las que aparecen ser y estar son tratadas como proposiciones retórico-argumentativas.Ser and estar: a difficult aspect of Spanish as a foreign language. This essay presents an approach that takes signification as guide line. On the one hand, the signification of ser and estar for their own cause; on the other hand the signification of the adjectives. The question is no longer what the meaning of a given adjective is with ser or with estar, but with which of the two verbs is it possible to express the unique meaning or each of the meanings of that adjective. Starting from this basis the approach considers first, the isolated meanings of the verbs and of the adjectives and, second, the resultant signification out of the relation between the two sides. If the meaning of a given adjective can be expressed by both verbs, the selection of the verb is determined by the intentionality of the speaker in the communicative context in which he negotiates. From this background on the syntactical constructions in which ser and estar appear are treated as
Reassessing SERS enhancement factors: using thermodynamics to drive substrate design.
Guicheteau, J A; Tripathi, A; Emmons, E D; Christesen, S D; Fountain, Augustus W
2017-12-04
Over the past 40 years fundamental and application research into Surface-Enhanced Raman Scattering (SERS) has been explored by academia, industry, and government laboratories. To date however, SERS has achieved little commercial success as an analytical technique. Researchers are tackling a variety of paths to help break through the commercial barrier by addressing the reproducibility in both the SERS substrates and SERS signals as well as continuing to explore the underlying mechanisms. To this end, investigators use a variety of methodologies, typically studying strongly binding analytes such as aromatic thiols and azarenes, and report SERS enhancement factor calculations. However a drawback of the traditional SERS enhancement factor calculation is that it does not yield enough information to understand substrate reproducibility, application potential with another analyte, or the driving factors behind the molecule-metal interaction. Our work at the US Army Edgewood Chemical Biological Center has focused on these questions and we have shown that thermodynamic principles play a key role in the SERS response and are an essential factor in future designs of substrates and applications. This work will discuss the advantages and disadvantages of various experimental techniques used to report SERS enhancement with planar SERS substrates and present our alternative SERS enhancement value. We will report on three types of analysis scenarios that all yield different information concerning the effectiveness of the SERS substrate, practical application of the substrate, and finally the thermodynamic properties of the substrate. We believe that through this work a greater understanding for designing substrates will be achieved, one that is based on both thermodynamic and plasmonic properties as opposed to just plasmonic properties. This new understanding and potential change in substrate design will enable more applications for SERS based methodologies including targeting
International Nuclear Information System (INIS)
2002-01-01
This decision from the French authority of nuclear safety (ASN) aims at fixing the conditions to be respected by Electricite de France (EdF) during its in-service follow-up programs for the monitoring and preventive maintenance of the primary and secondary cooling loops of EdF's PWR reactors. The components and the particular points to be controlled are listed in appendixes. (J.S.)
Reclamation of plutonium from pyrochemical processing residues
International Nuclear Information System (INIS)
Gray, L.W.; Gray, J.H.; Holcomb, H.P.; Chostner, D.F.
1987-04-01
Savannah River Laboratory (SRL), Savannah River Plant (SRP), and Rocky Flats Plant (RFP) have jointly developed a process to recover plutonium from molten salt extraction residues. These NaCl, KCL, and MgCl 2 residues, which are generated in the pyrochemical extraction of 241 Am from aged plutonium metal, contain up to 25 wt % dissolved plutonium and up to 2 wt % americium. The overall objective was to develop a process to convert these residues to a pure plutonium metal product and discardable waste. To meet this objective a combination of pyrochemical and aqueous unit operations was used. The first step was to scrub the salt residue with a molten metal (aluminum and magnesium) to form a heterogeneous ''scrub alloy'' containing nominally 25 wt % plutonium. This unit operation, performed at RFP, effectively separated the actinides from the bulk of the chloride salts. After packaging in aluminum cans, the ''scrub alloy'' was then dissolved in a nitric acid - hydrofluoric acid - mercuric nitrate solution at SRP. Residual chloride was separated from the dissolver solution by precipitation with Hg 2 (NO 3 ) 2 followed by centrifuging. Plutonium was then separated from the aluminum, americium and magnesium using the Purex solvent extraction system. The 241 Am was diverted to the waste tank farm, but could be recovered if desired
Directory of Open Access Journals (Sweden)
Olga Žukovskaja
2017-07-01
Full Text Available Pyocyanin (PYO is a metabolite specific for Pseudomonas aeruginosa. In the case of immunocompromised patients, it is currently considered a biomarker for life-threating Pseudomonas infections. In the frame of this study it is shown, that PYO can be detected in aqueous solution by employing surface-enhanced Raman spectroscopy (SERS combined with a microfluidic platform. The achieved limit of detection is 0.5 μM. This is ~2 orders of magnitude below the concentration of PYO found in clinical samples. Furthermore, as proof of principle, the SERS detection of PYO in the saliva of three volunteers was also investigated. This body fluid can be collected in a non-invasive manner and is highly chemically complex, making the detection of the target molecule challenging. Nevertheless, PYO was successfully detected in two saliva samples down to 10 μM and in one sample at a concentration of 25 μM. This indicates that the molecules present in saliva do not inhibit the efficient adsorption of PYO on the surface of the employed SERS active substrates.
2013-08-16
... DEPARTMENT OF LABOR Employee Benefits Security Administration 168th Meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans; Notice of Teleconference Meeting Pursuant to the.... 1142, the 168th open meeting of the Advisory Council on Employee Welfare and Pension Benefit Plans...
International Nuclear Information System (INIS)
Franchi, Vincent; Marchal, Carole
2009-10-01
This report proposes an assessment of patient radiation protection in external radiotherapy. It is based on inter-regional syntheses of inspections performed by the ASN in external radiotherapy departments during 2008. It addresses 6 main themes related to patient radiation protection: human and material resources, organisation of medical physics, training in patient radiation protection, mastering of equipment (maintenance, internal quality controls of medical devices), safety and care quality management (formalization of the patient care process and definition of responsibilities, patient identity control, treatment preparation, and treatment execution), and risk management (a priori risk analysis, declaration, recording and internal processing of dysfunctions, improvements of care quality and safety management system)
Energy Technology Data Exchange (ETDEWEB)
Chen, Kaihang; Shen, Zuguang [State Key Laboratory of Pulp and Paper Engineering, South China University of Technology, Guangzhou 510640 (China); Luo, Jiwen, E-mail: holdit@126.com [State Key Laboratory of Pulp and Paper Engineering, South China University of Technology, Guangzhou 510640 (China); Key Laboratory of Theoretical Chemistry of Environment, Ministry of Education, School of Chemistry and Environment, South China Normal University, Guangzhou 510006 (China); Wang, Xiaoying, E-mail: xyw@scut.edu.cn [State Key Laboratory of Pulp and Paper Engineering, South China University of Technology, Guangzhou 510640 (China); Sun, Runcang [State Key Laboratory of Pulp and Paper Engineering, South China University of Technology, Guangzhou 510640 (China); Institute of Biomass Chemistry and Technology, Beijing Forestry University, Beijing 100083 (China)
2015-10-01
Graphical abstract: - Highlights: • Synthesis optimization of Ag NPs with quaternized chitosan (QCS) was studied. • The size of Ag NPs was tuned by changing the DS and Mw of QCS. • QCS/Ag NPs exhibited much better SERS performance than Ag NPs without free QCS. • QCS/Ag NPs as SERS substrate detected tricyclazole in low concentration of 50 ppb. • QCS/Ag NPs as SERS substrate detected Sudan I with the detection limit of 10 ppm. - Abstract: There is an urgent need to develop a highly sensitive detection system for detecting trace amounts of food contaminants. In this study, optimal synthesis of silver nanoparticles (Ag NPs) with stable and narrow size distribution in the range of 15–25 nm was performed under microwave irradiation, using quaternized chitosan (QCS) as reducing and stabilizing agent. The results showed that the ratio of QCS to [Ag(NH{sub 3}){sub 2}]{sup +}, reaction temperature, irradiation time, the degree of substitution (DS) and molecular weight (Mw) of QCS had obvious effects on the formation, particle size and size distribution of Ag NPs. In addition, utilizing QCS/Ag NPs composite as SERS substrate, tricyclazole and Sudan I could be rapidly and sensitively detected with the limit of detection (LOD) as low as 50 ppb and 10 ppm, respectively. Compared with previously reported works, our detection system are of great stability and operability. The QCS was coated on the surface of Ag core, avoiding aggregation of Ag NPs and creating hot spots, in turn, providing superior amplification of SERS. Thus, it is believed that the QCS/Ag NPs composite could be considered as an ideal SERS-active substrate for detection of food contaminants.
Zgiby, S M; Thomson, G J; Qamar, S; Berry, A
2000-03-01
Fructose 1,6-bisphosphate aldolase catalyses the reversible condensation of glycerone-P and glyceraldehyde 3-phosphate into fructose 1,6-bisphosphate. A recent structure of the Escherichia coli Class II fructose 1,6-bisphosphate aldolase [Hall, D.R., Leonard, G.A., Reed, C.D., Watt, C.I., Berry, A. & Hunter, W.N. (1999) J. Mol. Biol. 287, 383-394] in the presence of the transition state analogue phosphoglycolohydroxamate delineated the roles of individual amino acids in binding glycerone-P and in the initial proton abstraction steps of the mechanism. The X-ray structure has now been used, together with sequence alignments, site-directed mutagenesis and steady-state enzyme kinetics to extend these studies to map important residues in the binding of glyceraldehyde 3-phosphate. From these studies three residues (Asn35, Ser61 and Lys325) have been identified as important in catalysis. We show that mutation of Ser61 to alanine increases the Km value for fructose 1, 6-bisphosphate 16-fold and product inhibition studies indicate that this effect is manifested most strongly in the glyceraldehyde 3-phosphate binding pocket of the active site, demonstrating that Ser61 is involved in binding glyceraldehyde 3-phosphate. In contrast a S61T mutant had no effect on catalysis emphasizing the importance of an hydroxyl group for this role. Mutation of Asn35 (N35A) resulted in an enzyme with only 1.5% of the activity of the wild-type enzyme and different partial reactions indicate that this residue effects the binding of both triose substrates. Finally, mutation of Lys325 has a greater effect on catalysis than on binding, however, given the magnitude of the effects it is likely that it plays an indirect role in maintaining other critical residues in a catalytically competent conformation. Interestingly, despite its proximity to the active site and high sequence conservation, replacement of a fourth residue, Gln59 (Q59A) had no significant effect on the function of the enzyme. In a
SERS-based application in food analytics (Conference Presentation)
Cialla-May, Dana; Radu, Andreea; Jahn, Martin; Weber, Karina; Popp, Jürgen
2017-02-01
To establish detection schemes in life science applications, specific and sensitive methods allowing for fast detection times are required. Due to the interaction of molecules with strong electromagnetic fields excited at metallic nanostructures, the molecular fingerprint specific Raman spectrum is increased by several orders of magnitude. This effect is described as surface-enhanced Raman spectroscopy (SERS) and became a very powerful analytical tool in many fields of application. Within this presentation, we will introduce innovative bottom-up strategies to prepare SERS-active nanostructures coated with a lipophilic sensor layer. To do so, the food colorant Sudan III, an indirect carcinogen substance found in chili powder, palm oil or spice mixtures, is detected quantitatively in the background of the competitor riboflavin as well as paprika powder extracts. The SERS-based detection of azorubine (E122) in commercial available beverages with different complexity (e.g. sugar content, alcohol concentration) illustrates the strong potential of SERS as a qualitative as well as semiquantitative prescan method in food analytics. Here, a good agreement between the estimated concentration employing SERS as well as the gold standard technique HPLC, a highly laborious method, is found. Finally, SERS is applied to detect vitamin B2 and B12 in cereals as well as the estimate the ratio of lycopene and β-carotene in tomatoes. Acknowledgement: Funding the projects "QuantiSERS" and "Jenaer Biochip Initiative 2.0" within the framework "InnoProfile Transfer - Unternehmen Region" the Federal Ministry of Education and Research, Germany (BMBF) is gratefully acknowledged.
International Nuclear Information System (INIS)
Nakada, Shinichiro
2016-01-01
The E3 ubiquitin ligases ring finger protein (RNF) 8 and RNF168 transduce the DNA double-strand break (DSB) response (DDR) signal by ubiquitinating DSB sites. The depletion of RNF8 or RNF168 suppresses the accumulation of DNA-repair regulating factors such as 53BP1 and RAP80 at DSB sites, suggesting roles for RNF8- and RNF168-mediated ubiquitination in DSB repair. This mini-review provides a brief overview of the RNF8- and RNF168-dependent DDR-signaling and DNA-repair pathways. The choice of DNA-repair pathway when RNF8- and RNF168-mediated ubiquitination-dependent DDR signaling is negatively regulated by deubiquitinating enzymes (DUBs) is reviewed to clarify how the opposing roles of RNF8/RNF168 and DUBs regulate ubiquitination-dependent DDR signaling and the choice of DNA-repair pathway
Directory of Open Access Journals (Sweden)
Annie Nguyen
Full Text Available Cystatin C (Cys C is a small, potent, cysteine protease inhibitor. An Ala25Thr (A25T polymorphism in Cys C has been associated with both macular degeneration and late-onset Alzheimer's disease. Previously, studies have suggested that this polymorphism may compromise the secretion of Cys C. Interestingly, we found that untagged A25T, A25T tagged C-terminally with FLAG, or A25T FLAG followed by green fluorescent protein (GFP, were all secreted as efficiently from immortalized human cells as their wild-type (WT counterparts (e.g., 112%, 100%, and 88% of WT levels from HEK-293T cells, respectively. Supporting these observations, WT and A25T Cys C variants also showed similar intracellular steady state levels. Furthermore, A25T Cys C did not activate the unfolded protein response and followed the same canonical endoplasmic reticulum (ER-Golgi trafficking pathway as WT Cys C. WT Cys C has been shown to undergo signal sequence cleavage between residues Gly26 and Ser27. While the A25T polymorphism did not affect Cys C secretion, we hypothesized that it may alter where the Cys C signal sequence is preferentially cleaved. Under normal conditions, WT and A25T Cys C have the same signal sequence cleavage site after Gly26 (referred to as 'site 2' cleavage. However, in particular circumstances when the residues around site 2 are modified (such as by the presence of an N-terminal FLAG tag immediately after Gly26, or by a Gly26Lys (G26K mutation, A25T has a significantly higher likelihood than WT Cys C of alternative signal sequence cleavage after Ala20 ('site 1' or even earlier in the Cys C sequence. Overall, our results indicate that the A25T polymorphism does not cause a significant reduction in Cys C secretion, but instead predisposes the protein to be cleaved at an alternative signal sequence cleavage site if site 2 is hindered. Additional N-terminal amino acids resulting from alternative signal sequence cleavage may, in turn, affect the protease
Energy Technology Data Exchange (ETDEWEB)
Guo, Hongyan; Zhao, Aiwu, E-mail: awzhao@iim.ac.cn [University of Science and Technology of China, Department of Chemistry (China); Wang, Rujing [Chinese Academy of Sciences, Institute of Intelligent Machines (China); Wang, Dapeng [University of Science and Technology of China, Department of Chemistry (China); Wang, Liusan; Gao, Qian; Sun, Henghui [Chinese Academy of Sciences, Institute of Intelligent Machines (China); Li, Lei; He, Qinye [University of Science and Technology of China, Department of Chemistry (China)
2015-12-15
This paper reports the generalized green synthesis of a series of Fe{sub 3}O{sub 4}/Ag composites by magnetron sputtering method. The amounts of silver nanoparticles located on the hollow Fe{sub 3}O{sub 4} magnetic nanoparticles can be tuned by controlling the sputtering time. The surfaces of Fe{sub 3}O{sub 4}/Ag composites are rough with high density and numerous Ag nanogaps (which can serve as Raman active hot spots to amplify the Raman signal), providing the sound reliability and reproducibility of Raman detection. With p-aminothiophenol and Rhodamine 6G (R6G) for probe molecules, the surface-enhanced Raman scattering (SERS) properties of these Fe{sub 3}O{sub 4}/Ag composites were studied. It was found that the SERS signal reached the maximum with the sputtering time of 130 s, indicating that this compound had most hot spots. In this paper, we used the composite with the strongest SERS signal for thiram detection, and the detection limit can reach 5 × 10{sup −7} mol/L (about 0.012 ppm), which is lower than the maximal residue limit of 7 ppm in fruit prescribed by the U.S. Environmental Protection Agency. The Fe{sub 3}O{sub 4}/Ag composites are readily available, easy to carry, and show great potential for applications in universal SERS substrates in practical SERS detection.
Structural-functional analysis of the oligomeric protein R-phycoerythrin
Directory of Open Access Journals (Sweden)
JOSÉ MARTÍNEZ-OYANEDEL
2004-01-01
Full Text Available The structure of phycobiliproteins and their spatial organization in the phycobilisome provide the environment for high efficiency in light harvesting and conduction towards photosystem II. This article focuses on the analysis of R-phycoerythrin, a light harvesting hexameric phycobiliprotein that is part of the phycobilisomes. The interaction surfaces and the environment of the chromophores of R-phycoerythrin were studied in order to explain its structural stability and spectroscopic sensitivity, properties revealed by perturbation experiments. Three interaction surfaces are described (ab, (ab3 and (ab6. The analysis shows the importance of a subunits in the interaction between trimers, the homodimeric nature of the monomer (ab and also the presence of anchor points in every interaction surface studied: a18Phe and b18Tyr for (ab, b76Asn for (ab3 and a25Asn for (ab6 . Side chains of arginine, lysine or glutamine residues are located in the proximity of the chromophores providing the correct stabilization of their carboxylates. Aspartic acids residues are associated through H-bonds to the N atom of the two central rings of the tetrapyrrolic chromophores. Changes in the spectroscopic properties are observed in perturbation experiments, confirming the spatial requirement for an efficient resonance energy transfer among chromophores and through the phycobilisome
International Nuclear Information System (INIS)
Brennan, S.O.; Myles, T.; Peach, R.J.; George, P.M.; Donaldson, D.
1990-01-01
Albumin Redhill is an electrophoretically slow genetic variant of human serum albumin that does not bind 63 Ni 2+ and has a molecular mass 2.5 kDa higher than normal albumin. Its inability to bind Ni 2+ was explained by the finding of an additional residue of Arg at position -1. This did not explain the molecular basis of the genetic variation or the increase in apparent molecular mass. Fractionation of tryptic digests on concanavalin A-Sepharose followed by peptide mapping of the bound and unbound fractions and sequence analysis of the glycopeptides identified a mutation of 320 Ala → Thr. This introduces as Asn-Tyr-Thr oligosaccharide attachment sequence centered on Asn-318 and explains the increase in molecular mass. This, however, did not satisfactorily explain the presence of the additional Arg residue at position -1. DNA sequencing of polymerase chain reaction-amplified genomic DNA encoding the prepro sequence of albumin indicated an additional mutation of -2 Arg → Cys. The authors propose that the new Phe-Cys-Arg sequence in the propeptide is an aberrant signal peptidase cleavage site and that the signal peptidase cleaves the propeptide of albumin Redhill in the lumen of the endoplasmic reticulum before it reaches the Golgi vesicles, the site of the diarginyl-specific proalbumin convertase
Lowry, Philip J.; Bennett, Hugh P. J.; McMartin, Colin; Scott, Alexander P.
1974-01-01
An adrenocorticotrophic hormone (ACTH) was isolated from extracts of the pars distalis of the pituitary of the dogfish Squalus acanthias by gel filtration and ion-exchange chromatography. It had 15% of the potency of human ACTH in promoting cortico-steroidogenesis in isolated rat adrenal cells. Sequence analysis revealed it to be a nonatria-contapeptide with the following primary structure: Ser-Tyr-Ser-Met-Glu-His-Phe-Arg-Trp-Gly-Lys-Pro-Met-Gly-Arg-Lys-Arg-Arg-Pro-Ile-Lys-Val-Tyr-Pro-Asn-Ser-Phe-Glu-Asp-Glu-Ser-Val-Glu-Asn-Met-Gly-Pro-Glu-Leu. The N-terminal tridecapeptide sequence was identical with the proposed structure of dogfish α-melanocyte-stimulating hormone (α-MSH). On comparison with human ACTH eleven amino acid differences were seen, nine of which are in the 20–39 region of the molecule which is not essential for the steroidogenic activity of ACTH. A peptide identical with the 18–39 portion of this new ACTH was similarly isolated from the neurointermediate lobe of the pituitary where considerable amounts of dogfish α-MSH were found. This supported our view that ACTH as well as having a distinct biological role of its own is also the precursor of α-MSH. PMID:4375977
Graphene-Plasmonic Hybrid Platform for Label-Free SERS Biomedical Detection
Wang, Pu
Surface Enhanced Raman Scattering (SERS) has attracted explosive interest for the wealth of vibrational information it provides with minimal invasive effects to target analyte. Nanotechnology, especially in the form of noble metal nanoparticles exhibit unique electromagnetic and chemical characteristics that are explored to realize ultra-sensitive SERS detection in chemical and biological analysis. Graphene, atom-thick carbon monolayer, exhibits superior chemical stability and bio-compatibility. A combination of SERS-active metal nanostructures and graphene will create various synergies in SERS. The main objective of this research was to exploit the applications of the graphene-Au tip hybrid platform in SERS. The hybrid platform consists of a periodic Au nano-pyramid substrate to provide reproducible plasmonic enhancement, and the superimposed monolayer graphene sheet, serving as "built-in" Raman marker. Extensive theoretical and experimental studies were conducted to determine the potentials of the hybrid platform as SERS substrate. Results from both Finite-Domain Time-Domain (FDTD) numerical simulation and Raman scattering of graphene suggested that the hybrid platform boosted a high density of hotspots yielding 1000 times SERS enhancement of graphene bands. Ultra-high sensitivity of the hybrid platform was demonstrated by bio-molecules including dye, protein and neurotransmitters. Dopamine and serotonin can be detected and distinguished at 10-9 M concentration in the presence of human body fluid. Single molecule detection was obtained using a bi-analyte technique. Graphene supported a vibration mode dependent SERS chemical enhancement of ˜10 to the analyte. Quantitative evaluation of hotspots was presented using spatially resolved Raman mapping of graphene SERS enhancement. Graphene plays a crucial role in quantifying SERS hotspots and paves the path for defining SERS EF that could be universally applied to various SERS systems. A reproducible and statistically
Weng, MeiZhi; Zheng, ZhongLiang; Bao, Wei; Cai, YongJun; Yin, Yan; Zou, GuoLin; Zou, GouLin
2009-11-01
Nattokinase (subtilisin NAT, NK) is a bacterial serine protease with strong fibrinolytic activity and it is a potent cardiovascular drug. In medical and commercial applications, however, it is susceptible to chemical oxidation, and subsequent inactivation or denaturation. Here we show that the oxidative stability of NK was substantially increased by optimizing the amino acid residues Thr(220) and Met(222), which were in the vicinity of the catalytic residue Ser(221) of the enzyme. Two nonoxidative amino acids (Ser and Ala) were introduced at these sites using site-directed mutagenesis. Active enzymes were successfully expressed in Escherichia coli with periplasmic secretion and enzymes were purified to homogeneity. The purified enzymes were analyzed with respect to oxidative stability, kinetic parameters, fibrinolytic activity and thermal stability. M222A mutant was found to have a greatly increased oxidative stability compared with wild-type enzyme and it was resistant to inactivation by more than 1 M H(2)O(2), whereas the wild-type enzyme was inactivated by 0.1 M H(2)O(2) (t(1/2) approximately 11.6 min). The other mutant (T220S) also showed an obvious increase in antioxidative ability. Molecular dynamic simulations on wild-type and T220S mutant proteins suggested that a hydrogen bond was formed between Ser(220) and Asn(155), and the spatial structure of Met(222) was changed compared with the wild-type. The present study demonstrates the feasibility of improving oxidative stability of NK by site-directed mutagenesis and shows successful protein engineering cases to improve stability of NK as a potent therapeutic agent.
Dietary Fat, Fat Metabolizing Genes, and Prostate Cancer Risk in African-Americans and Whites
National Research Council Canada - National Science Library
Ingles, Sue A
2004-01-01
... African-Americans and whites in Los Angels County. In the first year of the study, we finished genotyping three LOX gene polymorphisms, including 12-LOX G1n261Arg, Ser322Asn, and the 5_LOX promoter Sp1 motif polymorphism...
Nie, Yonghui; Teng, Yuanjie; Li, Pan; Liu, Wenhan; Shi, Qianwei; Zhang, Yuchao
2018-02-01
A novel label-free aptamer surface-enhanced Raman scattering (SERS) sensor for trace malathion residue detection was proposed. In this process, the binding of malathion molecule with aptamer is identified directly. The silver nanoparticles modified with positively charged spermine served as enhancing and capture reagents for the negatively charged aptamer. Then, the silver nanoparticles modified by aptamer were used to specifically capture the malathion. The SERS background spectra of spermine, aptamer, and malathion were recorded and distinguished with the spectrum of malathion-aptamer. To enhance the characteristic peak signal of malathion captured by the aptamer, the aggregate reagents (NaCl, KCl, MgCl2) were compared and selected. The selectivity of this method was verified in the mixed-pesticide standard solution, which included malathion, phosmet, chlorpyrifos-methyl, and fethion. Results show that malathion can be specifically identified when the mixed-pesticide interferences existed. The standard curve was established, presenting a good linear range of 5 × 10- 7 to 1 × 10- 5 mol·L- 1. The spiked experiments for tap water show good recoveries from 87.4% to 110.5% with a relative standard deviation of less than 4.22%. Therefore, the proposed label-free aptamer SERS sensor is convenient, specifically detects trace malathion residues, and can be applied for qualitative and quantitative analysis of other pesticides.
Wilczynski, Andrzej; Wilson, Krista R; Scott, Joseph W; Edison, Arthur S; Haskell-Luevano, Carrie
2005-04-21
The melanocortin receptor system consists of endogenous agonists, antagonists, G-protein coupled receptors, and auxiliary proteins that are involved in the regulation of complex physiological functions such as energy and weight homeostasis, feeding behavior, inflammation, sexual function, pigmentation, and exocrine gland function. Herein, we report the structure-activity relationship (SAR) of a new chimeric hAGRP-melanocortin agonist peptide template Tyr-c[beta-Asp-His-DPhe-Arg-Trp-Asn-Ala-Phe-Dpr]-Tyr-NH(2) that was characterized using amino acids previously reported in other melanocortin agonist templates. Twenty peptides were examined in this study, and six peptides were selected for (1)H NMR and computer-assisted molecular modeling structural analysis. The most notable results include the identification that modification of the chimeric template at the His position with Pro and Phe resulted in ligands that were nM mouse melanocortin-3 receptor (mMC3R) antagonists and nM mouse melanocortin-4 receptor (mMC4R) agonists. The peptides Tyr-c[beta-Asp-His-DPhe-Ala-Trp-Asn-Ala-Phe-Dpr]-Tyr-NH(2) and Tyr-c[beta-Asp-His-DNal(1')-Arg-Trp-Asn-Ala-Phe-Dpr]-Tyr-NH(2) resulted in 730- and 560-fold, respectively, mMC4R versus mMC3R selective agonists that also possessed nM agonist potency at the mMC1R and mMC5R. Structural studies identified a reverse turn occurring in the His-DPhe-Arg-Trp domain, with subtle differences observed that may account for the differences in melanocortin receptor pharmacology. Specifically, a gamma-turn secondary structure involving the DPhe(4) in the central position of the Tyr-c[beta-Asp-Phe-DPhe-Arg-Trp-Asn-Ala-Phe-Dpr]-Tyr-NH(2) peptide may differentiate the mixed mMC3R antagonist and mMC4R agonist pharmacology.
Jeong, Seon-Ju; Park, Ji Yeong; Lee, Jae Yong; Lee, Kang Wook; Cho, Kye Man; Kim, Gyoung Min; Shin, Jung-Hye; Kim, Jong-Sang; Kim, Jeong Hwan
2015-11-01
Fibrinolytic enzyme genes (aprE2, aprE176, and aprE179) were introduced into the Bacillus subtilis 168 chromosome without any antibiotic resistance gene. An integration vector, pDG1662, was used to deliver the genes into the amyE site of B. subtilis 168. Integrants, SJ3-5nc, SJ176nc, and SJ179nc, were obtained after two successive homologous recombinations. The integration of each fibrinolytic gene into the middle of the amyE site was confirmed by phenotypes (Amy(-), Spec(S)) and colony PCR results for these strains. The fibrinolytic activities of the integrants were higher than that of B. subtilis 168 by at least 3.2-fold when grown in LB broth. Cheonggukjang was prepared by inoculating each of B. subtilis 168, SJ3-5nc, SJ176nc, and SJ179nc, and the fibrinolytic activity of cheonggukjang was 4.6 ± 0.7, 10.8 ± 0.9, 7.0 ± 0.6, and 8.0 ± 0.2 (U/g of cheonggukjang), respectively at 72 h. These results showed that construction of B. subtilis strains with enhanced fibrinolytic activities is possible by integration of a strong fibrinolytic gene via a marker-free manner.
DEFF Research Database (Denmark)
Krintel, Christian; Osmark, Peter; Larsen, Martin Røssel
2008-01-01
Hormone-sensitive lipase (HSL) is a key enzyme in the mobilization of fatty acids from stored triacylglycerols. Its activity is regulated by reversible protein phosphorylation. In rat HSL Ser563, Ser659 and Ser660 have been shown to be phosphorylated by protein kinase A (PKA) in vitro as well...
Primary structure of human pancreatic elastase 2 determined by sequence analysis of the cloned mRNA
International Nuclear Information System (INIS)
Fletcher, T.S.; Shen, W.F.; Largman, C.
1987-01-01
A cDNA encoding elastase 2 has been cloned from a human pancreatic cDNA library. The cDNA contains a translation initiation site and a poly(A) recognition site and encodes a protein of 269 amino acids, including a proposed 16-residue signal peptide. The amino acid sequence of the deduced mature protein contains a 12-residue activation peptide containing a cysteine at residue 1 similar to that of chymotryspin. The proposed active enzyme contains all of the characteristic active-site amino acids, including His-57, Asp-102, and Ser-195. The S1 binding pocket is bounded by Gly-216 and Ser-226, making this pocket intermediate in size between chymotrypsins and elastase 1 or protease E, consistent with the substrate specificity of elastase 2 for long-chain aliphatic or aromatic amino acids. Computer modeling studies using the amino acid sequence of elastase 2 superimposed on the X-ray structure of porcine elastase 1 suggest that a change of Gln-192 in elastase 1 to Asn-192 in elastase 2 may account for the lower catalytic efficiency of the latter enzyme. Several basic residues appear to be near the ends of the extended binding pocket of elastases which might serve to anchor the enzyme to the elastin substrate. These studies indicate that elastases 2 and elastase 1 both contain an Arg-65A as well as a basic dipeptide at 223/224 which is not present in chymotrypsins. In addition, Arg-217A is present in humaan elastase 2 but absent in rat pancreatic protein which has been proposed to be an elastase 2 on the basis of sequence homology, but which was not isolated during screening of rat pancreatic tissue extracts for elastolytic activity
Energy Technology Data Exchange (ETDEWEB)
Wu, Di, E-mail: DiWu@mail.nankai.edu.cn; Wu, Shian
2013-04-19
Highlights: •Ser-17 is key for the stability of Drosophila Sav. •Ala mutation of Ser-17 promotes the proteasomal degradation of Sav. •Ser-17 residue is not the main target of Hpo-induced Sav stabilization. •Hpo-dependent and -independent mechanisms regulate Sav stability. •This mechanism is conserved in the homologue of Sav, human WW45. -- Abstract: The Hippo (Hpo) pathway is a conserved tumor suppressor pathway that controls organ size through the coordinated regulation of apoptosis and proliferation. Drosophila Salvador (Sav), which limits organ size, is a core component of the Hpo pathway. In this study, Ser-17 was shown to be important for the stability of Sav. Alanine mutation of Ser-17 promoted the proteasomal degradation of Sav. Destabilization and stabilization of the Sav protein mediated by alanine mutation of Ser-17 and by Hpo, respectively, were independent of each other. This implies that the stability of Sav is controlled by two mechanisms, one that is Ser-17-dependent and Hpo-independent, and another that is Ser-17-independent and Hpo-dependent. These dual mechanisms also regulated the human counterpart of Drosophila Sav, WW domain-containing adaptor 45 (WW45). The conservation of this regulation adds to its significance in normal physiology and tumorigenesis.
The ASN imposes on EDF complementary requirements for the setting of the hard-core unit
International Nuclear Information System (INIS)
Anon.
2014-01-01
In January 2014, the ASN (French Authority for Nuclear Safety) published a list of 19 decisions concerning the implementation of a 'post-Fukushima' hard-core unit in each EDF nuclear power plant. The purpose of the hard-core unit is to have structures and equipment able to resist very extreme events and able to assure the vital functions necessary for the reactor safety. The 19 decisions detail the rules for the design of the hard-core unit. For example the hard-core unit will have to resist earthquakes for which the probability of occurrence is about 1 every 20.000 years while the probability taking into account for the design of the reactor is only 1 every 1000 or 10.000 years
Chirollo, Claudia; Radovnikovic, Anita; Veneziano, Vincenzo; Marrone, Raffaele; Pepe, Tiziana; Danaher, Martin; Anastasio, Aniello
2014-01-01
The aim of this study was to measure the persistence of residues of the pyrethroid insecticide α-cypermethrin (ACYP) in the milk of lactating donkeys following pour-on treatment. Milk was collected from animals (n = 7) before the treatment and at 12, 24, 36, 48, 60, 72 and 84 h post-treatment. The last sampling was taken 7 days post-treatment (168 h). Milk samples were analysed by ultra-high-performance liquid chromatography coupled to tandem mass spectrometry (UHPLC-MS/MS). The analytical method was validated following requirements of Commission Decision 2002/657/EC. All samples showed levels of ACYP below the maximum residue limit (MRL) of 20 μg kg(-1) established for bovine milk (Commission Regulation (EU) No. 37/2010). The results demonstrate that there is minimal partitioning of ACYP into milk in lactating donkeys from pour-on treatment.
Directory of Open Access Journals (Sweden)
Angelo Serpa
2017-10-01
Full Text Available Este ensaio busca aprofundar uma abordagem existencialista dos conceitos de lugar e território assumindo o pressuposto de que eles remetem, antes de tudo, a experiências geográficas que ora se distinguem, ora se aproximam e carregam em si a marca do espaço vivido. Para esta análise, parte-se do conceito de geograficidade – a base pré-consciente e pré-conceitual da geografia – assumindo também que, antes de qualquer conceituação ou estratégia de representação conceitual, as pessoas são seres essencialmente espaciais e que viver é produzir/experienciar espaço. O ensaio está dividido em seis seções: a introdução, uma problematização da dialética entre interior e exterior e seu desdobramento numa abordagem de como lugar e território se exprimem como modos geográficos de existência no espaço público; nas duas últimas seções, reflete-se sobre o papel do corpo nos processos de apropriação do espaço e sobre como ser lugar e ser território se exprimem como facetas do ser-no-mundo em seu sentido mais político.
Security effectiveness review (SER)
International Nuclear Information System (INIS)
Kouprianova, I.; Ek, D.; Showalter, R.; Bergman, M.
1998-01-01
As part of the on-going DOE/Russian MPC and A activities at the Institute of Physics and Power Engineering (IPPE) and in order to provide a basis for planning MPC and A enhancements, an expedient method to review the effectiveness of the MPC and A system has been adopted. These reviews involve the identification of appropriate and cost-effective enhancements of facilities at IPPE. This effort requires a process that is thorough but far less intensive than a traditional vulnerability assessment. The SER results in a quick assessment of current and needed enhancements. The process requires preparation and coordination between US and Russian analysts before, during, and after information gathering at the facilities in order that the analysis is accurate, effective, and mutually agreeable. The goal of this paper is to discuss the SER process, including the objectives, time scale, and lessons learned at IPPE
and Au nanoparticles for SERS applications
Directory of Open Access Journals (Sweden)
Fazio Enza
2018-01-01
Full Text Available The morphological and optical properties of noble metal nanoparticles prepared by picosecond laser generated plasmas in water were investigated. First, the ablation efficiency was maximized searching the optimal focusing conditions. The nanoparticle size, measured by Scanning Transmission Electron Microscopy, strongly depends on the laser fluence, keeping fixed the other deposition parameters such as the target to scanner objective distance and laser repetition frequency. STEM images indicate narrow gradients of NP sizes. Hence the optimization of ablation parameters favours a fine tuning of nanoparticles. UV-Visible spectroscopy helped to determine the appropriate laser wavelength to resonantly excite the localized surface plasmon to carry out Surface Enhanced Raman Scattering (SERS measurements. The SERS activity of Ag and Au substrates, obtained spraying the colloids synthesized in water, was tested using crystal violet as a probe molecule. The good SERS performance, observed at excitation wavelength 785 nm, is attributed to aggregation phenomena of nanoparticles sprayed on the support.
High-spin spectroscopy of {sup 168}Yb and the reduction of pairing correlations
Energy Technology Data Exchange (ETDEWEB)
Oliveira, J R.B. [Sao Paulo Univ., SP (Brazil); Stephens, F S; Deleplanque, M A; Diamond, R M [Lawrence Berkeley Lab., CA (United States); Draper, J E; Rubel, E; Duyar, C [California Univ., Davis, CA (United States); Beacker, J A; Henry, E A; Roy, N [Lawrence Livermore National Lab., CA (United States); Beausang, C W [Liverpool Univ. (United Kingdom); Frauendorf, S [Institut fur Kern und Hadronen Physik, F2-Rossendorf, Dresden (Germany)
1992-08-01
The high spin states of {sup 168}Yb were investigated by means of in-beam gamma spectroscopy with the High Energy Resolution Array at the 88 in. cyclotron of the Lawrence Berkeley Laboratory. The {sup 168}Yb nucleus was produced in the reaction {sup 48}Ca({sup 124}Sn,4n) at 210 MeV. Five bands previously reported were confirmed; additionally, four other bands, two extending to spins as high as 36 {Dirac_h} were observed. Cranked shell models suggest that one of the new bands can be interpreted as the continuation of the ground state band (above the AB crossing frequency) crossing into the four-quasiparticle band ABCD at about 0.38 MeV. Both relative alignment and Routhians are in good agreement with the experimental values. However, these calculations were done at constant pairing strength, which is not expected to be good at high rotational frequencies where one or more crossings have occurred in each band. Particle-hole calculations (with no pairing) were done for {sup 168}Yb as well as for other N {approx_equal} 98 nuclei for which good experimental data are available. In most cases, it is possible to associate a particle-hole configuration for each band observed at very high rotational frequencies, and the overall description is good. At frequencies below the first crossing, a full pairing calculation is necessary to describe the bands properly. At intermediate frequencies, the pairing strength is believed to be intermediate. 3 figs.
International Nuclear Information System (INIS)
Li, Lei; Zhao, Aiwu; Wang, Dapeng; Guo, Hongyan; Sun, Henghui; He, Qinye
2016-01-01
The cube-like Fe 3 O 4 @SiO 2 @Ag (FSA) nanocomposites with great SERS activity have been successfully synthesized by a layer-by-layer procedure in this paper. The cube-like Fe 3 O 4 @SiO 2 core–shell structures were prepared via a new route and Ag nanoparticles were introduced onto their surface through a one-pot hydrothermal reaction. By controlling the reaction time, the coverage rate of Ag on the FSA surface could be tuned, and then a series of FSA composites were obtained. The SERS properties of these FSA composites were investigated using p-aminothiophenol (p-ATP) as the probe molecule. It was found that the FSA composites synthesized with a reaction time of 6 h showed the best SERS performance, and the detection limit for p-ATP could reach 1 × 10 −7 M. For practical application, the FSA composites were also used to detect thiram, one of the dithiocarbamate fungicides that has been widely used as a pesticide in agriculture. The detection limit is as low as 1 × 10 −6 M (0.24 ppm), lower than the maximal residue limit of 7 ppm in fruit prescribed by the US Environmental Protection Agency. The resulting substrate with high SERS activity, stability and strong magnetic responsivity makes the FSA composite a perfect choice for practical SERS detection applications.
Kang, Wei Cherng Malvin; Wong, Yen Lynn; Piotrowski, Marek; Teo, Woon Pei J.; He, Shuai; Kah, James C.
2017-04-01
The ever-increasing spread and emergence of antibiotic resistance poses a serious threat to global public health. With the existence of Carbapenem-resistant Enterobacteriaceae (CRE) produced by the Klebsiella Pneumoniae bacteria, it renders the use of carbapenems, the last-resort class of β-lactam antibiotics, useless against combating against bacterial infections. Such infections reduce the ability to treat complex infections due to the lack of antibiotic options for treatment, leading to CRE-associated mortalities. Current methods of detection, like CarbaNP test and Modified Hodge's Test, have significant limitations in that the time taken for detection of carbapenemase activity ranges between hours to days, and are non-specific in detecting the specific phenotype, making it challenging to isolate patients rapidly and to devise appropriate treatment for infected patients. We propose a methodology by utilising Surface Enhanced Raman Spectroscopy (SERS) to study bacterial β-lactamase activity. This is done via the use of gold nanostars (AuNS), which have reported excellent SERS properties, conjugated with a β-lactam antibiotic ceftriaxole, as a proof-of-concept study to analyse the changes in the SERS spectra associated with cleavage of the β-lactam ring upon interaction with the New Delhi Metalloproteinase (NDM)- producing Escherichia coli (Class B β-lactamase). We are able to obtain detection of carbapenemase activity within 25 minutes, with the associated changes in SERS spectra being diminishing of SERS peaks at 1358cm-1 and 1495cm-1. This project can be further extended to study the activity of other classes of β-lactamases and other β-lactam antibiotics to improve this state of technology for potential adoption by healthcare institutions.
Guatemala: Ozbrojený konflikt 1960-1996 a současná situace: se zvláštním zaměřením na Máje
Vilímková, Olga
2009-01-01
Tématem disertační práce je Guatemala: ozbrojený konflikt v letech 1960 - 1996 a současná situace se zvláštním zaměřením na Máje. Příčiny ozbrojeného konfliktu druhé ploviny XX. století (a mnoha současných problémů) v Guatemale se nacházejí v hluboké minulosti země. Už v době koloniální se začaly formovat ekonomicko - sociální vztahy mezi dvěma antagonistickými vrstvami společnosti: kolonizátory a původním obyvatelstvem, které bylo porobeno, vytlačeno na okraj společnosti a využíváno jako pra...
Impact of UK NICE clinical guidelines 168 on referrals to a specialist academic leg ulcer service.
Davies, Huw Ob; Popplewell, Matthew; Bate, Gareth; Kelly, Lisa; Darvall, Katy; Bradbury, Andrew W
2018-03-01
Background Leg ulcers are a common cause of morbidity and disability and result in significant health and social care expenditure. The UK National Institute for Health and Care Excellence (NICE) Clinical Guideline (CG)168, published in July 2013, sought to improve care of patients with leg ulcers, recommending that patients with a break in the skin below the knee that had not healed within two weeks be referred to a specialist vascular service for diagnosis and management. Aim Determine the impact of CG168 on referrals to a leg ulcer service. Methods Patients referred with leg ulceration during an 18-month period prior to CG168 (January 2012-June 2013) and an 18-month period commencing six months after (January 2014-June 2015) publication of CG168 were compared. Results There was a two-fold increase in referrals (181 patients, 220 legs vs. 385 patients, 453 legs) but no change in mean age, gender or median-duration of ulcer at referral (16.6 vs. 16.2 weeks). Mean-time from referral to specialist appointment increased (4.8 vs. 6 weeks, p = 0.0001), as did legs with superficial venous insufficiency (SVI) (36% vs. 44%, p = 0.05). There was a trend towards more SVI endovenous interventions (32% vs. 39%, p = 0.271) with an increase in endothermal (2 vs. 32 legs, p = 0.001) but no change in sclerotherapy (24 vs. 51 legs) treatments. In both groups, 62% legs had compression. There was a reduction in legs treated conservatively with simple dressings (26% vs. 15%, p = 0.0006). Conclusions Since CG168, there has been a considerable increase in leg ulcer referrals. However, patients are still not referred until ulceration has been present for many months. Although many ulcers are multi-factorial and the mainstay of treatment remains compression, there has been an increase in SVI endovenous intervention. Further efforts are required to persuade community practitioners to refer patients earlier, to educate patients and encourage further investment in
26 CFR 5c.168(f)(8)-7 - Reporting of income, deductions and investment tax credit; at risk rules.
2010-04-01
... tax credit; at risk rules. 5c.168(f)(8)-7 Section 5c.168(f)(8)-7 Internal Revenue INTERNAL REVENUE... investment tax credit; at risk rules. (a) In general. The fact that the lessor's payments of interest and... property shall be limited to the extent the at risk rules under the investment tax credit provisions and...
Energy Technology Data Exchange (ETDEWEB)
Hu, Hao [Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); Yu, Wen-bo [State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, Shanghai 200433 (China); Li, Shu-xing [Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); Ding, Xiang-ming; Yu, Long [State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, Shanghai 200433 (China); Bi, Ru-Chang [Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China)
2006-02-01
The homogeneity of septin 1 has been improved by site-directed mutation of serine residues and only a small alteration in the secondary structure is observed to arise from the mutations. Crystals of the septin 1 mutant were grown and diffraction data were collected to 2.5 Å resolution. Septin 1 is a member of an evolutionarily conserved family of GTP-binding and filament-forming proteins named septins, which function in diverse processes including cytokinasis, vesicle trafficking, apoptosis, remodelling of the cytoskeleton, infection, neurodegeneration and neoplasia. Human septin 1 has been expressed and purified, but suffers from severe aggregation. Studies have shown that septin 1 with site-directed mutations of five serine residues (Ser19, Ser206, Ser307, Ser312 and Ser315) has a much lower degree of aggregation and better structural homogeneity and that the mutations cause only slight perturbations in the secondary structure of septin 1. This septin 1 mutant was crystallized and diffraction data were collected to 2.5 Å resolution. The space group is P422, with unit-cell parameters a = b = 106.028, c = 137.852 Å.
International Nuclear Information System (INIS)
Hu, Hao; Yu, Wen-bo; Li, Shu-xing; Ding, Xiang-ming; Yu, Long; Bi, Ru-Chang
2006-01-01
The homogeneity of septin 1 has been improved by site-directed mutation of serine residues and only a small alteration in the secondary structure is observed to arise from the mutations. Crystals of the septin 1 mutant were grown and diffraction data were collected to 2.5 Å resolution. Septin 1 is a member of an evolutionarily conserved family of GTP-binding and filament-forming proteins named septins, which function in diverse processes including cytokinasis, vesicle trafficking, apoptosis, remodelling of the cytoskeleton, infection, neurodegeneration and neoplasia. Human septin 1 has been expressed and purified, but suffers from severe aggregation. Studies have shown that septin 1 with site-directed mutations of five serine residues (Ser19, Ser206, Ser307, Ser312 and Ser315) has a much lower degree of aggregation and better structural homogeneity and that the mutations cause only slight perturbations in the secondary structure of septin 1. This septin 1 mutant was crystallized and diffraction data were collected to 2.5 Å resolution. The space group is P422, with unit-cell parameters a = b = 106.028, c = 137.852 Å
Especificação e Implementação de Templates GDMO e Tipos ASN 1 para Linguagem C++
Junior, Rivalino Matias; Specialski, Elizabeth Sueli; May, Karina; Ropelato, Patricia
1996-01-01
Este artigo descreve a especificação e implementação de regras para o mapeamento de templates GDMO (GuideUnes lor the Definition 01 Managed Objects) [1 l, além da implementação dos tipos ASN.1, em linguagem de programação C++[2l. Estas regras serao utilizadas no mapeamentotemplate - GDMO para classes (dass) em C++, linguagem utilizada em todo o projeto da Plataforma de Gerencia da Rede Local UFSC, a qual segue o modelo de gerenciamento de redes OSI.
König, Simone; Marco, Heather; Gäde, Gerd
2017-11-01
It has been known for more than 20 years that the neurosecretory glands of the cicadas, the corpora cardiaca, synthesize two isobaric peptides with hypertrehalosemic activity. Both decapeptides have exactly the same amino acid sequence (pGlu-Val-Asn-Phe-Ser-Pro-Ser-Trp-Gly-Asn-NH 2 ) and mass but differ in their retention time in reversed-phase liquid chromatography. A synthetic peptide with the same sequence elutes together with the second more hydrophobic peptide peak of the natural cicada extract. It is not clear what modification is causing the described observations. Therefore, in the current study, ion mobility separation in conjunction with high-resolution mass spectrometry was used to investigate this phenomenon as it was sensitive to changes in conformation. It detected different drift times in buffer gas for both the intact peptides and some of their fragment ions. Based on the ion mobility and fragment ion intensity of the corresponding ions, it is concluded that the region Pro 6 -Ser 7 -Trp 8 contains a structural feature differing from the L-amino acids present in the known peptide. Whether the conformer is the result of racemization or other biochemical processes needs to be further investigated.
Shi, Guochao; Wang, Mingli; Zhu, Yanying; Shen, Lin; Wang, Yuhong; Ma, Wanli; Chen, Yuee; Li, Ruifeng
2018-04-01
In this work, we presented an eco-friendly and low-cost method to fabricate a kind of flexible and stable Au nanoparticles/graphene oxide/cicada wing (AuNPs/GO/CW) substrate. By controlling the ratio of reactants, the optimum SERS substrate with average AuNPs size of 65 nm was obtained. The Raman enhancement factor for rhodamine 6G (R6G) was 1.08 ×106 and the limit of detection (LOD) was as low as 10-8 M. After calibrating the Raman peak intensities of R6G, it could be quantitatively detected. In order to better understand the experimental results, the 3D finite-different time-domain simulation was used to simulate the AuNPs/GO/CW-1 (the diameter of the AuNPs was 65 nm) to further investigate the SERS enhancement effect. More importantly, the AuNPs/GO/CW-1 substrates not only can provide strong enhancement factors but also can be stable and reproducible. This SERS substrates owned a good stability for the SERS intensity which was reduced only by 25% after the aging time of 60 days and the relative standard deviation was lower than 20%, revealing excellent uniformity and reproducibility. Our positive findings can pave a new way to optimize the application of SERS substrate as well as provide more SERS platforms for quantitative detection of organic contaminants vestige, which makes it very promising in the trace detection of biological molecules.
Photonic Crystal Fibre SERS Sensors Based on Silver Nanoparticle Colloid
International Nuclear Information System (INIS)
Zhi-Guo, Xie; Yong-Hua, Lu; Pei, Wang; Kai-Qun, Lin; Jie, Yan; Hai, Ming
2008-01-01
A photonic crystal fibre (PCF) surface enhanced Raman scattering (SERS) sensor is developed based on silver nanoparticle colloid. Analyte solution and silver nanoparticles are injected into the air holes of PCF by a simple modified syringe to overcome mass-transport constraints, allowing more silver nanoparticles involved in SERS activity. This sensor offers significant benefit over the conventional SERS sensor with high flexibility, easy manufacture. We demonstrate the detection of 4-mercaptobenzoic acid (4-MBA) molecules with the injecting way and the common dipping measurement. The injecting way shows obviously better results than the dipping one. Theoretical analysis indicates that this PCF SERS substrate offers enhancement of about 7 orders of magnitude in SERS active area
Single molecule SERS: Perspectives of analytical applications
Czech Academy of Sciences Publication Activity Database
Vlčková, B.; Pavel, I.; Sládková, M.; Šišková, K.; Šlouf, Miroslav
834-836, - (2007), s. 42-47 ISSN 0022-2860. [European Congress on Molecular Spectroscopy /28./. Istanbul, 03.09.2006-08.09.2006] R&D Projects: GA ČR GA203/04/0688 Institutional research plan: CEZ:AV0Z40500505 Keywords : surface-enhanced Raman scattering (SERS) * surface-enhanced resonance Raman (SERRS) * single molecule SERS Subject RIV: CD - Macromolecular Chemistry Impact factor: 1.486, year: 2007
Advanced Gas Sensors Using SERS-Activated Waveguides
Lascola, Robert; McWhorter, Scott; Murph, Simona Hunyadi
2010-08-01
This contribution describes progress towards the development and testing of a functionalized capillary that will provide detection of low-concentration gas-phase analytes through SERS. Measurement inside a waveguide allows interrogation of a large surface area, potentially overcoming the short distance dependence of the SERS effect. The possible use of Raman spectroscopy for gas detection is attractive for IR-inactive molecules or scenarios where infrared technology is inconvenient. However, the weakness of Raman scattering limits the use of the technique to situations where low detection limits are not required or large gas pressures are present. With surface-enhanced Raman spectroscopy (SERS), signal enhancements of 106 are often claimed, and higher values are seen in specific instances. However, most of the examples of SERS analysis are on liquid-phase samples, where the molecular density is high, usually combined with some sort of sample concentration at the surface. Neither of these factors is present in gas-phase samples. Because the laser is focused to a small point in the typical experimental setup, and the spatial extent of the effect above the surface is small (microns), the excitation volume is miniscule. Thus, exceptionally large enhancements are required to generate a signal comparable to that obtained by conventional Raman measurements. A reflective waveguide offers a way to increase the interaction volume of the laser with a SERS-modified surface. The use of a waveguide to enhance classical Raman measurements was recently demonstrated by S.M. Angel and coworkers, who obtained 12- to 30-fold sensitivity improvements for nonabsorbing gases (CO2, CH4) with a silvered capillary (no SERS enhancement). Shi et al.. demonstrated 10-to 100-fold enhancement of aqueous Rhodamine 6G in a capillary coated with silver nanoparticles. They observed enhancements of 10- to 100-fold compared to direct sampling, but this relied on a "double substrate", which required
Superhydrophobic Ag nanostructures on polyaniline membranes with strong SERS enhancement.
Liu, Weiyu; Miao, Peng; Xiong, Lu; Du, Yunchen; Han, Xijiang; Xu, Ping
2014-11-07
We demonstrate here a facile fabrication of n-dodecyl mercaptan-modified superhydrophobic Ag nanostructures on polyaniline membranes for molecular detection based on SERS technique, which combines the superhydrophobic condensation effect and the high enhancement factor. It is calculated that the as-fabricated superhydrophobic substrate can exhibit a 21-fold stronger molecular condensation, and thus further amplifies the SERS signal to achieve more sensitive detection. The detection limit of the target molecule, methylene blue (MB), on this superhydrophobic substrate can be 1 order of magnitude higher than that on the hydrophilic substrate. With high reproducibility, the feasibility of using this SERS-active superhydrophobic substrate for quantitative molecular detection is explored. A partial least squares (PLS) model was established for the quantification of MB by SERS, with correlation coefficient R(2) = 95.1% and root-mean-squared error of prediction (RMSEP) = 0.226. We believe this superhydrophobic SERS substrate can be widely used in trace analysis due to its facile fabrication, high signal reproducibility and promising SERS performance.
Surface enhanced Raman scattering (SERS) fabrics for trace analysis
International Nuclear Information System (INIS)
Liu, Jun; Zhou, Ji; Tang, Bin; Zeng, Tian; Li, Yaling; Li, Jingliang; Ye, Yong; Wang, Xungai
2016-01-01
Highlights: • Gold nanoparticles are in-situ synthesized on silk fabrics by heating. • Flexible silk fabrics with gold nanoparticles are used for surface-enhanced Raman scattering (SERS). • SERS activities of silk fabrics with different gold contents are investigated. - Abstract: Flexible SERS active substrates were prepared by modification of silk fabrics with gold nanoparticles. Gold nanoparticles were in-situ synthesized after heating the silk fabrics immersed in gold ion solution. Localized surface plasmon resonance (LSPR) properties of the treated silk fabrics varied as the concentration of gold ions changed, in relation to the morphologies of gold nanoparticles on silk. In addition, X-ray diffraction (XRD) was used to observe the structure of the gold nanoparticle treated silk fabrics. The SERS enhancement effect of the silk fabrics treated with gold nanoparticles was evaluated by collecting Raman signals of different concentrations of p-aminothiophenol (PATP), 4-mercaptopyridine (4-MPy) and crystal violet (CV) solutions. The results demonstrate that the silk fabrics corresponding to 0.3 and 0.4 mM of gold ions possess high SERS activity compared to the other treated fabrics. It is suggested that both the gold content and morphologies of gold nanoparticles dominate the SERS effect of the treated silk fabrics.
Surface enhanced Raman scattering (SERS) fabrics for trace analysis
Energy Technology Data Exchange (ETDEWEB)
Liu, Jun [National Engineering Laboratory for Advanced Yarn and Fabric Formation and Clean Production, Wuhan Textile University, Wuhan 430073 (China); Hubei Collaborative Innovation Center for Advanced Organic Chemical Materials & Key Laboratory for the Synthesis and Application of Organic Functional Molecules, Ministry of Education & College of Chemistry & Chemical Engineering, Hubei University, Wuhan 430062 (China); Zhou, Ji [Hubei Collaborative Innovation Center for Advanced Organic Chemical Materials & Key Laboratory for the Synthesis and Application of Organic Functional Molecules, Ministry of Education & College of Chemistry & Chemical Engineering, Hubei University, Wuhan 430062 (China); Tang, Bin, E-mail: bin.tang@deakin.edu.au [National Engineering Laboratory for Advanced Yarn and Fabric Formation and Clean Production, Wuhan Textile University, Wuhan 430073 (China); Institute for Frontier Materials, Deakin University, Geelong, Victoria 3216 (Australia); Zeng, Tian; Li, Yaling [Hubei Collaborative Innovation Center for Advanced Organic Chemical Materials & Key Laboratory for the Synthesis and Application of Organic Functional Molecules, Ministry of Education & College of Chemistry & Chemical Engineering, Hubei University, Wuhan 430062 (China); Li, Jingliang [Institute for Frontier Materials, Deakin University, Geelong, Victoria 3216 (Australia); Ye, Yong, E-mail: yeyong@hubu.edu.cn [Hubei Collaborative Innovation Center for Advanced Organic Chemical Materials & Key Laboratory for the Synthesis and Application of Organic Functional Molecules, Ministry of Education & College of Chemistry & Chemical Engineering, Hubei University, Wuhan 430062 (China); Wang, Xungai [National Engineering Laboratory for Advanced Yarn and Fabric Formation and Clean Production, Wuhan Textile University, Wuhan 430073 (China); Institute for Frontier Materials, Deakin University, Geelong, Victoria 3216 (Australia)
2016-11-15
Highlights: • Gold nanoparticles are in-situ synthesized on silk fabrics by heating. • Flexible silk fabrics with gold nanoparticles are used for surface-enhanced Raman scattering (SERS). • SERS activities of silk fabrics with different gold contents are investigated. - Abstract: Flexible SERS active substrates were prepared by modification of silk fabrics with gold nanoparticles. Gold nanoparticles were in-situ synthesized after heating the silk fabrics immersed in gold ion solution. Localized surface plasmon resonance (LSPR) properties of the treated silk fabrics varied as the concentration of gold ions changed, in relation to the morphologies of gold nanoparticles on silk. In addition, X-ray diffraction (XRD) was used to observe the structure of the gold nanoparticle treated silk fabrics. The SERS enhancement effect of the silk fabrics treated with gold nanoparticles was evaluated by collecting Raman signals of different concentrations of p-aminothiophenol (PATP), 4-mercaptopyridine (4-MPy) and crystal violet (CV) solutions. The results demonstrate that the silk fabrics corresponding to 0.3 and 0.4 mM of gold ions possess high SERS activity compared to the other treated fabrics. It is suggested that both the gold content and morphologies of gold nanoparticles dominate the SERS effect of the treated silk fabrics.
Directory of Open Access Journals (Sweden)
Seunghee Cho
Full Text Available Cyanuric acid hydrolase (CAH catalyzes the hydrolytic ring-opening of cyanuric acid (2,4,6-trihydroxy-1,3,5-triazine, an intermediate in s-triazine bacterial degradation and a by-product from disinfection with trichloroisocyanuric acid. In the present study, an X-ray crystal structure of the CAH-barbituric acid inhibitor complex from Azorhizobium caulinodans ORS 571 has been determined at 2.7 Å resolution. The CAH protein fold consists of three structurally homologous domains forming a β-barrel-like structure with external α-helices that result in a three-fold symmetry, a dominant feature of the structure and active site that mirrors the three-fold symmetrical shape of the substrate cyanuric acid. The active site structure of CAH is similar to that of the recently determined AtzD with three pairs of active site Ser-Lys dyads. In order to determine the role of each Ser-Lys dyad in catalysis, a mutational study using a highly sensitive, enzyme-coupled assay was conducted. The 10⁹-fold loss of activity by the S226A mutant was at least ten times lower than that of the S79A and S333A mutants. In addition, bioinformatics analysis revealed the Ser226/Lys156 dyad as the only absolutely conserved dyad in the CAH/barbiturase family. These data suggest that Lys156 activates the Ser226 nucleophile which can then attack the substrate carbonyl. Our combination of structural, mutational, and bioinformatics analyses differentiates this study and provides experimental data for mechanistic insights into this unique protein family.
International Nuclear Information System (INIS)
Mendonça, Glaydson L.F.; Costa, Stefane N.; Freire, Valder N.; Casciano, Paulo N.S.; Correia, Adriana N.; Lima-Neto, Pedro de
2017-01-01
Highlights: • Corrosion inhibition of carbon steel and of copper by the amino acids was studied. • Inhibition efficiencies were experimentally achieved by electrochemical impedance. • DFT and Monte Carlo methods allowed correlating molecular properties with inhibition efficiency. • The corrosion inhibition followed the electron donation the electron-back donations process. - Abstract: Six amino acids were evaluated as corrosion inhibitors for carbon steel and copper in 0.5 mol L"−"1 H_2SO_4 solution by potentiodynamic polarization and electrochemical impedance techniques allied to Density Functional Theory (DFT) and Monte Carlo computations The corrosion inhibitor rankings were: Arg > Gln > Asn > Met > Cys > Ser, for copper, and Met > Cys > Ser > Arg > Gln > Asn, for carbon steel. The DFT approach failed to explain the corrosion inhibition rating based on the HOMO and LUMO energies of the isolated amino acid molecules, while the simpler classical Monte Carlo approach, performed considering the interaction energies between the corrosion inhibitor and the metallic substrate, was successful.
SERS substrates for in-situ biosensing (Conference Presentation)
Venugopalan, Priyamvada; Quilis, Nestor; Jakub, Dostalek; Wolfgang, Knoll
2017-06-01
Abstract: Recent years have seen a rapid progress in the field of surface-enhanced Raman spectroscopy (SERS) which is attributed to the thriving field of plasmonics [1]. SERS is a susceptible technique that can address basic scientific questions and technological problems. In both cases, it is highly dependent upon the plasmonic substrate, where excitation of the localized surface plasmon resonance enhances the vibrational scattering signal of the analyte molecules adsorbed on to the surface [2]. In this work, using finite difference time domain (FDTD) method we investigate the optical properties of plasmonic nanostructures with tuned plasmonic resonances as a function of dielectric environment and geometric parameters. An optimized geometry will be discussed based on the plasmonic resonant position and the SERS intensity. These SERS substrates will be employed for the detection of changes in conformation caused by interactions between an aptamer and analyte molecules. This will be done by using a microfluidic channel designed within the configuration of the lab-on-a-chip concept based on the intensity changes of the SERS signal. More efficient and reproducible results are obtained for such a quantitative measurement of analytes at low concentration levels. We will also demonstrate that the plasmonic substrates fabricated by top down approach such as e-beam lithography (EBL) and laser interference lithography (LIL) are highly reproducible, robust and can result in high electric field enhancement. Our results demonstrate the potential to use SERS substrates for highly sensitive detection schemes opening up the window for a wide range of applications including biomedical diagnostics, forensic investigation etc. Acknowledgement: This work was supported by the Austrian Science Fund (FWF), project NANOBIOSENSOR (I 2647). References: [1] J. N. Anker, W. P. Hall, O. Lyandres, N. C. Shah, J. Zhao and R. P. V. Duyne., " Biosensing with plasmonic nanosensors," Nature
Energy Technology Data Exchange (ETDEWEB)
Shafferman, A.
1994-07-15
Specificity determinants of human acetylcholinesterase (HuAChE) towards ligands (substrate and some reversible and irreversible inhibitors) were identified by combination of site-directed mutagenesis, molecular modeling and kinetic studies with enzymes mutated in active center residues Trp86, Glu202, Trp286, Phe295, Phe297, Tyr337, Phe338 and Glu450. Thus, the anionic and hydrophobic subsites as well as the acyl pocket were identified. Enzymes with resistance to OP aging were engineered.The role of N-glycosylation in the function, biosynthesis and stability of HuAChE was examined by site-directed mutagenesis (Asn to GIn substitution) of the three potential N glycosylation sites, Asn265, Asn350 and Asn464. Large scale preparation of recombinant HuAChE was performed utilizing the microcarrier technology. Over 500 milligrams of enzyme was prepared for x-ray crystallography.
Functional importance of PAI-1 glycosylation
DEFF Research Database (Denmark)
Christensen, Anni; Naessens, Dominik; Skottrup, Peter
susceptible PAI-1 variant was not necessarily the one used when raising the antibody. This and other observations indicated that the carbohydrate moieties or the glycosylation sites are unlikely to be part of the epitopes for these antibodies. The antibody susceptibility characteristic for non......Structure-function studies of plasminogen activator inhibitor-1 (PAI-1) have previously been performed mostly with non-glycosylated material expressed in E. coli. We have now studied the importance of PAI-1 glycosylation for its functional properties. PAI-1 has 3 potential sites for N......-linked glycosylation. Biochemical analysis of PAI-1 variants with substitutions of the Asn residues in each of these sites and expression in human embryonic kidney 293 (HEK293) cells showed that only Asn211 and Asn 267, but not Asn331 are glycosylated, and revealed a differential composition of the carbohydrate...
Directory of Open Access Journals (Sweden)
Xiaoyi Wang
Full Text Available During the process of HIV-1 fusion with the target cell, the N-terminal heptad repeat (NHR of gp41 interacts with the C-terminal heptad repeat (CHR to form fusogenic six-helix bundle (6-HB core. We previously identified a crucial residue for 6-HB formation and virus entry--Lys63 (K63 in the C-terminal region of NHR (aa 54-70, which forms a hydrophobic cavity. It can form an important salt bridge with Asp121 (D121 in gp41 CHR. Here, we found another important conserved residue for virus fusion and entry, Arg46 (R46, in the N-terminal region of NHR (aa 35-53, which forms a hydrogen bond with a polar residue, Asn43 (N43, in NHR, as a part of the hydrogen-bond network. R46 can also form a salt bridge with a negatively charged residue, Glu137 (E137, in gp41 CHR. Substitution of R46 with the hydrophobic residue Ala (R46A or the negatively charged residue Glu (R46E resulted in disruption of the hydrogen bond network, breakage of the salt bridge and reduction of 6-HB's stability, leading to impairment of viral fusion and decreased inhibition of N36, an NHR peptide. Similarly, CHR peptide C34 with substitution of E137 for Ala (E137A or Arg (E137R also exhibited reduced inhibitory activity against HIV-1 infection and HIV-1-mediated cell-to-cell fusion. These results suggest that the positively charged residue R46 and its hydrogen bond network, together with the salt bridge between R46 and E137, are important for viral fusion and entry and may therefore serve as a target for designing novel HIV fusion/entry inhibitors.
International Nuclear Information System (INIS)
2009-07-01
This short presentation, given by the national safety authority (ASN) at the meeting of July 1, 2009 of the high committee for the nuclear safety transparency and information (HCTISN), presents, first, the second French national plan of radioactive materials and wastes management (PNGMDR) with its main priorities, and then, the choice of the sites to survey in view of the setting up of a disposal facility for low level/long living wastes. The ASN expresses its opinion about the criteria retained by the ANDRA (the national agency of radioactive waste management) to select the most suitable sites. (J.S.)
Wang, Zhihui; Trope, Claes G; Fl?renes, Vivi Ann; Suo, Zhenhe; Nesland, Jahn M; Holm, Ruth
2010-01-01
Background CDC25 phosphatases are important regulators of the cell cycle. Their abnormal expression detected in a number of tumors implies that their dysregulation is involved in malignant transformation. However, the role of CDC25s in vulvar cancer is still unknown. To shed light on their roles in the pathogenesis and to clarify their prognostic values, expression of CDC25A, CDC25B and CDC25C in a large series of vulvar squamous cell carcinomas were examined. ...
RSARF: Prediction of residue solvent accessibility from protein sequence using random forest method
Ganesan, Pugalenthi; Kandaswamy, Krishna Kumar Umar; Chou -, Kuochen; Vivekanandan, Saravanan; Kolatkar, Prasanna R.
2012-01-01
Prediction of protein structure from its amino acid sequence is still a challenging problem. The complete physicochemical understanding of protein folding is essential for the accurate structure prediction. Knowledge of residue solvent accessibility gives useful insights into protein structure prediction and function prediction. In this work, we propose a random forest method, RSARF, to predict residue accessible surface area from protein sequence information. The training and testing was performed using 120 proteins containing 22006 residues. For each residue, buried and exposed state was computed using five thresholds (0%, 5%, 10%, 25%, and 50%). The prediction accuracy for 0%, 5%, 10%, 25%, and 50% thresholds are 72.9%, 78.25%, 78.12%, 77.57% and 72.07% respectively. Further, comparison of RSARF with other methods using a benchmark dataset containing 20 proteins shows that our approach is useful for prediction of residue solvent accessibility from protein sequence without using structural information. The RSARF program, datasets and supplementary data are available at http://caps.ncbs.res.in/download/pugal/RSARF/. - See more at: http://www.eurekaselect.com/89216/article#sthash.pwVGFUjq.dpuf
SERS substrates fabricated using ceramic filters for the detection of bacteria
Mosier-Boss, P. A.; Sorensen, K. C.; George, R. D.; Obraztsova, A.
2016-01-01
SERS substrates were fabricated by filtering either Ag or Au colloidal particles onto rigid, ceramic filters - onto which suspensions of bacteria were then filtered. SERS spectra of the bacteria were obtained using a Raman spectrometer that has an 'orbital raster scan' capability. It was shown that bacteria samples prepared in this manner were uniformly distributed onto the surface of the SERS substrate. The effect of common buffer systems on the SERS spectra was investigated and the utility of using the SERS technique for speciation of bacteria was explored.
Development of optimized nanogap plasmonic substrate for improved SERS enhancement
Directory of Open Access Journals (Sweden)
Jayakumar Perumal
2017-05-01
Full Text Available SERS enhancement factor (EF of planar substrates depends on the size and shape of the fine nanostructure forming a defect free, well-arranged matrix. Nano-lithographic process is considered to be the most advanced methods employed for the fabrication SERS substrates. Nanostructured plasmonic substrates with nanogap (NG pattern often results in stable, efficient and reproducible SERS enhancement. For such substrates, NG and their diagonal length (DL need to be optimized. Theoretically smaller NGs (∼30-40 nm or smaller results in higher SERS enhancement. However, fabrication of NG substrates below such limit is a challenge even for the most advanced lithography process. In this context, herein, we report the optimization of fabrication process, where higher SERS enhancement can be realized from larger NGs substrates by optimizing their DL of nanostructures between the NGs. Based on simulation we could demonstrate that, by optimizing the DL, SERS enhancement from larger NG substrate such as 60 and 80 nm could be comparable to that of smaller (40nm NG substrates. We envision that this concept will open up new regime in the nanofabrication of practically feasible NG based plasmonic substrates with higher SERS enhancement. Initial results of our experiments are in close agreement with our simulated study.
Residual stress analysis in thick uranium films
International Nuclear Information System (INIS)
Hodge, A.M.; Foreman, R.J.; Gallegos, G.F.
2005-01-01
Residual stress analysis was performed on thick, 1-25 μm, depleted uranium (DU) films deposited on an Al substrate by magnetron sputtering. Two distinct characterization techniques were used to measure substrate curvature before and after deposition. Stress evaluation was performed using the Benabdi/Roche equation, which is based on beam theory of a bi-layer material. The residual stress evolution was studied as a function of coating thickness and applied negative bias voltage (0, -200, -300 V). The stresses developed were always compressive; however, increasing the coating thickness and applying a bias voltage presented a trend towards more tensile stresses and thus an overall reduction of residual stresses
Analytical characterization using surface-enhanced Raman scattering (SERS) and microfluidic sampling
International Nuclear Information System (INIS)
Wang, Chao; Yu, Chenxu
2015-01-01
With the rapid development of analytical techniques, it has become much easier to detect chemical and biological analytes, even at very low detection limits. In recent years, techniques based on vibrational spectroscopy, such as surface enhanced Raman spectroscopy (SERS), have been developed for non-destructive detection of pathogenic microorganisms. SERS is a highly sensitive analytical tool that can be used to characterize chemical and biological analytes interacting with SERS-active substrates. However, it has always been a challenge to obtain consistent and reproducible SERS spectroscopic results at complicated experimental conditions. Microfluidics, a tool for highly precise manipulation of small volume liquid samples, can be used to overcome the major drawbacks of SERS-based techniques. High reproducibility of SERS measurement could be obtained in continuous flow generated inside microfluidic devices. This article provides a thorough review of the principles, concepts and methods of SERS-microfluidic platforms, and the applications of such platforms in trace analysis of chemical and biological analytes. (topical review)
Silva de Almeida, Francylaine; Bussler, Larissa; Marcio Lima, Sandro; Fiorucci, Antonio Rogério; da Cunha Andrade, Luis Humberto
2016-07-01
In this work, low-cost substrates with rough silver surfaces were prepared from commercial copper foil-covered phenolic board (CPB) and an aqueous solution of AgNO3, and were used for surface-enhanced Raman scattering (SERS) and surface-enhanced resonance Raman scattering (SERRS) measurements. A maximum SERS amplification factor of 1.2 × 10(7) was obtained for Rhodamine 6G (R6G), and use of the CPB resulted in a detection limit for Thiram pesticide of 0.5 µmol L(-1) The minimum detection level was limited by residual traces of phenolic groups that originated from the substrate resin, which became solubilized in the aqueous Ag(+) solution. It was found that the bands corresponding to the impurities had less influence in the Thiram analysis, which could be explained by the high affinity of sulfur for Ag surfaces. The influence of impurities in the SERS analyses therefore depended on the linkage between the rough silver surface and the analyte. The findings demonstrated the ease and effectiveness of using CPB to prepare a nanostructured surface for SERS. © The Author(s) 2016.
Moulin, Jean-Claude; Silvano, Jérémy; Barban, Véronique; Riou, Patrice; Allain, Caroline
2013-07-01
The neurovirulence of two new candidate 17D-204 Stamaril™ working seed lots and that of two reference preparations were compared. The Stamaril™ working seed lots have been used for more than twenty years for the manufacturing of vaccines of acceptable safety and efficacy. The preparation designated RK 168-73 and provided by the Robert Koch Institute was used as a reference. It was confirmed that RK 168-73 strain was not a good virus control in our study because it has a very low neurovirulence regarding both the clinical and histopathological scores in comparison with Stamaril™ strain and is not representative of a vaccine known to be satisfactory in use. The results were reinforced by the phenotypic characterization by plaque assay demonstrating that RK 168-73 was very different from the Stamaril™ vaccine, and by sequencing results showing 4 mutations between Stamaril™ and RK 168-73 viruses leading to amino acid differences in the NS4B and envelop proteins. Copyright © 2013 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
H. Takei
2015-01-01
Full Text Available We report on a thin layer chromatograph (TLC with a built-in surface enhanced Raman scattering (SERS layer for in-situ identification of chemical species separated by TLC. Our goal is to monitor mixture samples or diluted target molecules suspended in a host material, as happens often in environmental monitoring or detection of food additives. We demonstrate that the TLC-SERS can separate mixture samples and provide in-situ SERS spectra. One sample investigated was a mixture consisting of equal portions of Raman-active chemical species, rhodamine 6 G (R6G, crystal violet (CV, and 1,2-di(4-pyridylethylene (BPE. The three components could be separated and their SERS spectra were obtained from different locations. Another sample was skim milk with a trace amount of melamine. Without development, no characteristic peaks were observed, but after development, a peak was observed at 694 cm−1. Unlike previous TLC-SERS whereby noble metal nanoparticles are added after development of a sample, having a built-in SERS layer greatly facilitates analysis as well as maintaining high uniformity of noble metal nanoparticles.
Bruins, Wendy; Bruning, Oskar; Jonker, Martijs J.; Zwart, Edwin; van der Hoeven, Tessa V.; Pennings, Jeroen L. A.; Rauwerda, Han; de Vries, Annemieke; Breit, Timo M.
2008-01-01
Phosphorylation is important in p53-mediated DNA damage responses. After UV irradiation, p53 is phosphorylated specifically at murine residue Ser389. Phosphorylation mutant p53.S389A cells and mice show reduced apoptosis and compromised tumor suppression after UV irradiation. We investigated the
SERS Engineering Collaboration
2012-06-01
laser beam. In the second approach, a pulsed laser was used to texture a silicon wafer to form sharp features. Silver was evaporated onto the wafer...orders of magnitude larger than that measured on a gold nanoparticle array on a glass substrate. The largest SERS enhancement for a silver device was...surface plasmons," Yizhuo Chu and Kenneth B. Crozier, Optics Letters vol. 34, 244 (2009) K3. "Gold nanorings as substrates for surface-enhanced Raman
CAN THE STABILITY OF PROTEIN MUTANTS BE PREDICTED BY FREE-ENERGY CALCULATIONS
YUNYU, S; MARK, AE; WANG, CX; HUANG, FH; BERENDSEN, HJC; VANGUNSTEREN, WF
The use of free energy simulation techniques in the study of protein stability is critically evaluated. Results from two simulations of the thermostability mutation Asn218 to Ser218 in Subtilisin are presented. It is shown that components of the free energy change can be highly sensitive to the
Directory of Open Access Journals (Sweden)
Quirino Cordeiro
Full Text Available Typical antipsychotics have a high affinity for dopamine receptors. It is therefore of interest to investigate such loci in pharmacogenetic studies on psychosis. We investigated the hypothesis that Ser9Gly polymorphism of the DRD3 gene may play a role in the differences in individual response to typical antipsychotics between schizophrenic patients. The sample was composed of 53 good responders and 59 poor ones. No significant differences between the good and poor responders were found in the allelic distribution (good responders: Ser9 61.32%, Gly9 38.67%; poor responders: Ser9 64.40%, Gly9 35.59%; odds ratio, OR = 0.88, 0.49 < OR < 1.56; chi2 = 0.23, 1 degree of freedom, df, p = 0.63 and genotype distribution (good responders: Ser9/Ser9 37.73%, Ser9/Gly9 47.16%, Gly9/Gly9 15.09%; poor responders: Ser9/Ser9 42.37%, Ser9/Gly9 44.06%, Gly9/Gly9 13.55%; chi2 = 0.25, 2 df, p = 0.88. Nor was there any association with homozygosity (good responders: homozygous: 52.82%, heterozygous: 47.16%; poor responders: homozygous: 55.92%, heterozygous: 44.06%; odds ratio, OR = 0.88, 0.39 < OR < 1.99; chi2 = 0.11, 1 df, p = 0.74. The results did not support the hypothesis that Ser9Gly polymorphism of the DRD3 gene influences the response to typical antipsychotics in our sample of schizophrenics.
Porcine dentin sialoprotein glycosylation and glycosaminoglycan attachments.
Yamakoshi, Yasuo; Nagano, Takatoshi; Hu, Jan Cc; Yamakoshi, Fumiko; Simmer, James P
2011-02-03
Dentin sialophosphoprotein (Dspp) is a multidomain, secreted protein that is critical for the formation of tooth dentin. Mutations in DSPP cause inherited dentin defects categorized as dentin dysplasia type II and dentinogenesis imperfecta type II and type III. Dentin sialoprotein (Dsp), the N-terminal domain of dentin sialophosphoprotein (Dspp), is a highly glycosylated proteoglycan, but little is known about the number, character, and attachment sites of its carbohydrate moieties. To identify its carbohydrate attachment sites we isolated Dsp from developing porcine molars and digested it with endoproteinase Glu-C or pronase, fractionated the digestion products, identified fractions containing glycosylated peptides using a phenol sulfuric acid assay, and characterized the glycopeptides by N-terminal sequencing, amino acid analyses, or LC/MSMS. To determine the average number of sialic acid attachments per N-glycosylation, we digested Dsp with glycopeptidase A, labeled the released N-glycosylations with 2-aminobenzoic acid, and quantified the moles of released glycosylations by comparison to labeled standards of known concentration. Sialic acid was released by sialidase digestion and quantified by measuring β-NADH reduction of pyruvic acid, which was generated stoichiometrically from sialic acid by aldolase. To determine its forms, sialic acid released by sialidase digestion was labeled with 1,2-diamino-4,5-methyleneoxybenzene (DMB) and compared to a DMB-labeled sialic acid reference panel by RP-HPLC. To determine the composition of Dsp glycosaminoglycan (GAG) attachments, we digested Dsp with chondroitinase ABC and compared the chromotagraphic profiles of the released disaccharides to commercial standards. N-glycosylations were identified at Asn37, Asn77, Asn136, Asn155, Asn161, and Asn176. Dsp averages one sialic acid per N-glycosylation, which is always in the form of N-acetylneuraminic acid. O-glycosylations were tentatively assigned at Thr200, Thr216 and Thr
Porcine dentin sialoprotein glycosylation and glycosaminoglycan attachments
Directory of Open Access Journals (Sweden)
Yamakoshi Fumiko
2011-02-01
Full Text Available Abstract Background Dentin sialophosphoprotein (Dspp is a multidomain, secreted protein that is critical for the formation of tooth dentin. Mutations in DSPP cause inherited dentin defects categorized as dentin dysplasia type II and dentinogenesis imperfecta type II and type III. Dentin sialoprotein (Dsp, the N-terminal domain of dentin sialophosphoprotein (Dspp, is a highly glycosylated proteoglycan, but little is known about the number, character, and attachment sites of its carbohydrate moieties. Results To identify its carbohydrate attachment sites we isolated Dsp from developing porcine molars and digested it with endoproteinase Glu-C or pronase, fractionated the digestion products, identified fractions containing glycosylated peptides using a phenol sulfuric acid assay, and characterized the glycopeptides by N-terminal sequencing, amino acid analyses, or LC/MSMS. To determine the average number of sialic acid attachments per N-glycosylation, we digested Dsp with glycopeptidase A, labeled the released N-glycosylations with 2-aminobenzoic acid, and quantified the moles of released glycosylations by comparison to labeled standards of known concentration. Sialic acid was released by sialidase digestion and quantified by measuring β-NADH reduction of pyruvic acid, which was generated stoichiometrically from sialic acid by aldolase. To determine its forms, sialic acid released by sialidase digestion was labeled with 1,2-diamino-4,5-methyleneoxybenzene (DMB and compared to a DMB-labeled sialic acid reference panel by RP-HPLC. To determine the composition of Dsp glycosaminoglycan (GAG attachments, we digested Dsp with chondroitinase ABC and compared the chromotagraphic profiles of the released disaccharides to commercial standards. N-glycosylations were identified at Asn37, Asn77, Asn136, Asn155, Asn161, and Asn176. Dsp averages one sialic acid per N-glycosylation, which is always in the form of N-acetylneuraminic acid. O-glycosylations were
CisSERS: Customizable In Silico Sequence Evaluation for Restriction Sites.
Sharpe, Richard M; Koepke, Tyson; Harper, Artemus; Grimes, John; Galli, Marco; Satoh-Cruz, Mio; Kalyanaraman, Ananth; Evans, Katherine; Kramer, David; Dhingra, Amit
2016-01-01
High-throughput sequencing continues to produce an immense volume of information that is processed and assembled into mature sequence data. Data analysis tools are urgently needed that leverage the embedded DNA sequence polymorphisms and consequent changes to restriction sites or sequence motifs in a high-throughput manner to enable biological experimentation. CisSERS was developed as a standalone open source tool to analyze sequence datasets and provide biologists with individual or comparative genome organization information in terms of presence and frequency of patterns or motifs such as restriction enzymes. Predicted agarose gel visualization of the custom analyses results was also integrated to enhance the usefulness of the software. CisSERS offers several novel functionalities, such as handling of large and multiple datasets in parallel, multiple restriction enzyme site detection and custom motif detection features, which are seamlessly integrated with real time agarose gel visualization. Using a simple fasta-formatted file as input, CisSERS utilizes the REBASE enzyme database. Results from CisSERS enable the user to make decisions for designing genotyping by sequencing experiments, reduced representation sequencing, 3'UTR sequencing, and cleaved amplified polymorphic sequence (CAPS) molecular markers for large sample sets. CisSERS is a java based graphical user interface built around a perl backbone. Several of the applications of CisSERS including CAPS molecular marker development were successfully validated using wet-lab experimentation. Here, we present the tool CisSERS and results from in-silico and corresponding wet-lab analyses demonstrating that CisSERS is a technology platform solution that facilitates efficient data utilization in genomics and genetics studies.
Directory of Open Access Journals (Sweden)
Mayra Garcimuño
2013-01-01
Full Text Available En el presente trabajo, la técnica Espectroscopia de plasmas producidos por láser (Laser-induced breakdown spectroscopy –LIBS– se aplicó a la determinación cuan- titativa de Na en agua natural dulce, de interés en agricultura para el estudio de la alcalinidad de aguas de regadío. Para efectuar el análisis, se prepararon soluciones con concentraciones conocidas del analito, se mezclaron con óxido de calcio y se compactaron en pastillas sólidas. Los plasmas se produjeron en aire a presión atmos- férica utilizando un láser pulsado Nd:YAG. Se construyó una curva de calibración y se calculó el límite de detección. Se analizaron muestras de agua natural y los resultados se compararon con los obtenidos mediante espectroscopia de absorción atómica. Se demostró la factibilidad del método para la determinación de Na en agua natural dulce.
A SERS-based pH sensor utilizing 3-amino-5-mercapto-1,2,4-triazole functionalized Ag nanoparticles.
Piotrowski, Piotr; Wrzosek, Beata; Królikowska, Agata; Bukowska, Jolanta
2014-03-07
We report the first use of 3-amino-5-mercapto-1,2,4-triazole (AMT) to construct a surface-enhanced Raman scattering (SERS) based pH nano- and microsensor, utilizing silver nanoparticles. We optimize the procedure of homogenous attachment of colloidal silver to micrometer-sized silica beads via an aminosilane linker. Such micro-carriers are potential optically trappable SERS microprobes. It is demonstrated that the SERS spectrum of AMT is strongly dependent on the pH of the surroundings, as the transformation between two different adsorption modes, upright (A form) and lying flat (B form) orientation, is provoked by pH variation. The possibility of tuning the nanosensor working range by changing the concentration of AMT in the surrounding solution is demonstrated. A strong correlation between the pH response of the nanosensor and the AMT concentration in solution is found to be controlled by the interactions between the surface and solution molecules. In the absence of the AMT monomer, the performance of both the nano- and microsensor is shifted substantially to the strongly acidic pH range, from 1.5 to 2.5 and from 1.0 to 2.0, respectively, which is quite unique even for SERS-based sensors.
Historia de una coma. Gadamer y el sentido del ser
Vattimo, Gianni
2005-01-01
A partir de la doble posibilidad de traducir en las lenguas románicas la expresión gadameriana «Sein, das verstanden werden kann, ist Sprache» como «El ser, que puede ser comprendido, es lenguaje» o como «El ser que puede ser comprendido es lenguaje», se consideran las importantes repercusiones ontológicas que tendría una interpretación más moderada (y más habitual) de ese enunciado (la primera exhibida), o una lectura más radical y nihilista (la que aquí se defiende) del mismo (la ...
Superhydrophobic SERS substrates based on silicon hierarchical nanostructures
Chen, Xuexian; Wen, Jinxiu; Zhou, Jianhua; Zheng, Zebo; An, Di; Wang, Hao; Xie, Weiguang; Zhan, Runze; Xu, Ningsheng; Chen, Jun; She, Juncong; Chen, Huanjun; Deng, Shaozhi
2018-02-01
Silicon nanostructures have been cultivated as promising surface enhanced Raman scattering (SERS) substrates in terms of their low-loss optical resonance modes, facile functionalization, and compatibility with today’s state-of-the-art CMOS techniques. However, unlike their plasmonic counterparts, the electromagnetic field enhancements induced by silicon nanostructures are relatively small, which restrict their SERS sensing limit to around 10-7 M. To tackle this problem, we propose here a strategy for improving the SERS performance of silicon nanostructures by constructing silicon hierarchical nanostructures with a superhydrophobic surface. The hierarchical nanostructures are binary structures consisted of silicon nanowires (NWs) grown on micropyramids (MPs). After being modified with perfluorooctyltriethoxysilane (PFOT), the nanostructure surface shows a stable superhydrophobicity with a high contact angle of ˜160°. The substrate can allow for concentrating diluted analyte solutions into a specific area during the evaporation of the liquid droplet, whereby the analytes are aggregated into a small volume and can be easily detected by the silicon nanostructure SERS substrate. The analyte molecules (methylene blue: MB) enriched from an aqueous solution lower than 10-8 M can be readily detected. Such a detection limit is ˜100-fold lower than the conventional SERS substrates made of silicon nanostructures. Additionally, the detection limit can be further improved by functionalizing gold nanoparticles onto silicon hierarchical nanostructures, whereby the superhydrophobic characteristics and plasmonic field enhancements can be combined synergistically to give a detection limit down to ˜10-11 M. A gold nanoparticle-functionalized superhydrophobic substrate was employed to detect the spiked melamine in liquid milk. The results showed that the detection limit can be as low as 10-5 M, highlighting the potential of the proposed superhydrophobic SERS substrate in
Is α‐T catenin (VR22) an Alzheimer's disease risk gene?
Bertram, Lars; Mullin, Kristina; Parkinson, Michele; Hsiao, Monica; Moscarillo, Thomas J; Wagner, Steven L; Becker, K David; Velicelebi, Gonul; Blacker, Deborah; Tanzi, Rudolph E
2007-01-01
Background Recently, conflicting reports have been published on the potential role of genetic variants in the α‐T catenin gene (VR22; CTNNA3) on the risk for Alzheimer's disease. In these papers, evidence for association is mostly observed in multiplex families with Alzheimer's disease, whereas case–control samples of sporadic Alzheimer's disease are predominantly negative. Methods After sequencing VR22 in multiplex families with Alzheimer's disease linked to chromosome 10q21, we identified a novel non‐synonymous (Ser596Asn; rs4548513) single nucleotide polymorphism (SNP). This and four non‐coding SNPs were assessed in two independent samples of families with Alzheimer's disease, one with 1439 subjects from 437 multiplex families with Alzheimer's disease and the other with 489 subjects from 217 discordant sibships. Results A weak association with the Ser596Asn SNP in the multiplex sample, predominantly in families with late‐onset Alzheimer's disease (p = 0.02), was observed. However, this association does not seem to contribute substantially to the chromosome 10 Alzheimer's disease linkage signal that we and others have reported previously. No evidence was found of association with any of the four additional SNPs tested in the multiplex families with Alzheimer's disease. Finally, the Ser596Asn change was not associated with the risk for Alzheimer's disease in the independent discordant sibship sample. Conclusions This is the first study to report evidence of an association between a potentially functional, non‐synonymous SNP in VR22 and the risk for Alzheimer's disease. As the underlying effects are probably small, and are only seen in families with multiple affected members, the population‐wide significance of this finding remains to be determined. PMID:17209133
On-line use of the 168/E emulator at the CERN ISR SFM detector
International Nuclear Information System (INIS)
Bertuzzi, C.; Drijard, D.; Frehse, H.; Gavillet, P.; Gokieli, R.; Innocenti, P.G.; Messerli, R.; Mornacchi, G.; Norton, A.; Porte, J.P.
1981-01-01
The Split Field Magnet Detector at the CERN ISR has been used in recent years to study events with a high transverse momentum charged particle. As a first level computer based trigger a linear estimate of the track momentum by fixed point arithmethic was calculated on-line by a minicomputer. In addition appreciable further rejection was obtained by off-line filtering on the IBM-370/168, using pattern recognition and a fit of the triggering particle in the magnetic field. The availability of the 168/E emulator makes it possible to transfer the proven methods used off-line to real time data reduction. Preliminary results on filter efficiency and speed for an experiment triggering on a high Psub(T) hadron at 10 to 20 0 with respect to the outgoing beam (Exp. R 419) are given. Possible improvements and extensions are discussed. (orig.)
Effect of residual stresses on hydrogen permeation in iron
International Nuclear Information System (INIS)
Mouanga, M.; Bercot, P.; Takadoum, J.
2010-01-01
The effect of residual stresses on electrochemical permeation in iron membrane was investigated. Four thermal and mechanical treatments were chosen to obtain different surface states in relation to the residual stresses. Residual stresses were determined by X-ray diffraction (XRD) using the Macherauch and Mueller method. The results were completed by the microhardness measurements. For all iron membranes, compressive residual stresses were obtained. Electrochemical permeation experiments using a Devanathan and Stachurski cell were employed to determine the hydrogen permeation behaviour of the various iron membranes. The latter was charged with hydrogen by galvanostatic cathodic polarization in 0.1 M NaOH at 25 deg. C. The experimental results revealed that hydrogen permeation rate increases with increasing residual stresses introduced in iron membranes.
Energy Technology Data Exchange (ETDEWEB)
Kuwasako, Kenji, E-mail: kuwasako@med.miyazaki-u.ac.jp [Frontier Science Research Center, University of Miyazaki, Miyazaki, 889-1692 (Japan); Sekiguchi, Toshio [Noto Marine Laboratory, Division of Marine Environmental Studies, Institute of Nature and Environmental Technology, Kanazawa University, Ishikawa, 927-0553 (Japan); Nagata, Sayaka [Division of Circulatory and Body Fluid Regulation, Faculty of Medicine, University of Miyazaki, Miyazaki, 889-1692 (Japan); Jiang, Danfeng; Hayashi, Hidetaka [Frontier Science Research Center, University of Miyazaki, Miyazaki, 889-1692 (Japan); Murakami, Manabu [Department of Pharmacology, Hirosaki University, Graduate School of Medicine, Hirosaki, 036-8562 (Japan); Hattori, Yuichi [Department of Molecular and Medical Pharmacology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Toyama, 930-0194 (Japan); Kitamura, Kazuo [Division of Circulatory and Body Fluid Regulation, Faculty of Medicine, University of Miyazaki, Miyazaki, 889-1692 (Japan); Kato, Johji [Frontier Science Research Center, University of Miyazaki, Miyazaki, 889-1692 (Japan)
2016-02-19
Receptor activity-modifying protein 2 (RAMP2) enables the calcitonin receptor-like receptor (CLR, a family B GPCR) to form the type 1 adrenomedullin receptor (AM{sub 1} receptor). Here, we investigated the effects of the five non-visual GPCR kinases (GRKs 2 through 6) on the cell surface expression of the human (h)AM{sub 1} receptor by cotransfecting each of these GRKs into HEK-293 cells that stably expressed hRAMP2. Flow cytometric analysis revealed that when coexpressed with GRK4 or GRK5, the cell surface expression of the AM{sub 1} receptor was markedly decreased prior to stimulation with AM, thereby attenuating both the specific [{sup 125}I]AM binding and AM-induced cAMP production. These inhibitory effects of both GRKs were abolished by the replacement of the cytoplasmic C-terminal tail (C-tail) of CLR with that of the calcitonin receptor (a family B GPCR) or β{sub 2}-adrenergic receptor (a family A GPCR). Among the sequentially truncated CLR C-tail mutants, those lacking the five residues 449–453 (Ser-Phe-Ser-Asn-Ser) abolished the inhibition of the cell surface expression of CLR via the overexpression of GRK4 or GRK5. Thus, we provided new insight into the function of GRKs in agonist-unstimulated GPCR trafficking using a recombinant AM{sub 1} receptor and further determined the region of the CLR C-tail responsible for this GRK function. - Highlights: • We discovered a novel function of GRKs in GPCR trafficking using human CLR/RAMP2. • GRKs 4 and 5 markedly inhibited the cell surface expression of human CLR/RAMP2. • Both GRKs exhibited highly significant receptor signaling inhibition. • Five residues of the C-terminal tail of CLR govern this function of GRKs.
International Nuclear Information System (INIS)
Kuwasako, Kenji; Sekiguchi, Toshio; Nagata, Sayaka; Jiang, Danfeng; Hayashi, Hidetaka; Murakami, Manabu; Hattori, Yuichi; Kitamura, Kazuo; Kato, Johji
2016-01-01
Receptor activity-modifying protein 2 (RAMP2) enables the calcitonin receptor-like receptor (CLR, a family B GPCR) to form the type 1 adrenomedullin receptor (AM_1 receptor). Here, we investigated the effects of the five non-visual GPCR kinases (GRKs 2 through 6) on the cell surface expression of the human (h)AM_1 receptor by cotransfecting each of these GRKs into HEK-293 cells that stably expressed hRAMP2. Flow cytometric analysis revealed that when coexpressed with GRK4 or GRK5, the cell surface expression of the AM_1 receptor was markedly decreased prior to stimulation with AM, thereby attenuating both the specific ["1"2"5I]AM binding and AM-induced cAMP production. These inhibitory effects of both GRKs were abolished by the replacement of the cytoplasmic C-terminal tail (C-tail) of CLR with that of the calcitonin receptor (a family B GPCR) or β_2-adrenergic receptor (a family A GPCR). Among the sequentially truncated CLR C-tail mutants, those lacking the five residues 449–453 (Ser-Phe-Ser-Asn-Ser) abolished the inhibition of the cell surface expression of CLR via the overexpression of GRK4 or GRK5. Thus, we provided new insight into the function of GRKs in agonist-unstimulated GPCR trafficking using a recombinant AM_1 receptor and further determined the region of the CLR C-tail responsible for this GRK function. - Highlights: • We discovered a novel function of GRKs in GPCR trafficking using human CLR/RAMP2. • GRKs 4 and 5 markedly inhibited the cell surface expression of human CLR/RAMP2. • Both GRKs exhibited highly significant receptor signaling inhibition. • Five residues of the C-terminal tail of CLR govern this function of GRKs.
Glycosylation at Asn91 of H1N1 haemagglutinin affects binding to glycan receptors.
Jayaraman, Akila; Koh, Xiaoying; Li, Jing; Raman, Rahul; Viswanathan, Karthik; Shriver, Zachary; Sasisekharan, Ram
2012-06-15
The glycoprotein HA (haemagglutinin) on the surface of influenza A virus plays a central role in recognition and binding to specific host cell-surface glycan receptors and in fusion of viral membrane to the host nuclear membrane during viral replication. Given the abundance of HA on the viral surface, this protein is also the primary target for host innate and adaptive immune responses. Although addition of glycosylation sites on HA are a part of viral evolution to evade the host immune responses, there are specific glycosylation sites that are conserved during most of the evolution of the virus. In the present study, it was demonstrated that one such conserved glycosylation site at Asn(91) in H1N1 HA critically governs the glycan receptor-binding specificity and hence would potentially impinge on the host adaptation of the virus.
Energy Technology Data Exchange (ETDEWEB)
Yu, Jiajie [Chemicobiology and Functional Materials Institute, Nanjing University of Science and Technology, Nanjing 210094 (China); Shen, Muzhong [School of Engineering, AnHui Agricultural University, Hefei 230036 (China); Liu, Siyu; Li, Feng [Chemicobiology and Functional Materials Institute, Nanjing University of Science and Technology, Nanjing 210094 (China); Sun, Dongping, E-mail: sundpe301@163.com [School of Engineering, AnHui Agricultural University, Hefei 230036 (China); Wang, Tianhe, E-mail: thwang56@126.com [Chemicobiology and Functional Materials Institute, Nanjing University of Science and Technology, Nanjing 210094 (China)
2017-06-01
Graphical abstract: A simple technique for direct growth of gold nanoparticles (GNPs) into a nanostructured porous alumina layer on conductive glass slide (PAOCG). Gold was uniformly distributed in porous alumina layer. Au/PAOCG can serve as a portable, durable and reusable SERS substrate. - Highlights: • A simple method of producing nanoporous alumina layer on conductive glasses. • A facile technique for direct growth of gold nanoparticles (GNPs) into PAOCG. • It presents a general protocol for preparation of (MNPs) on conductive glasses. • Au/PAOCG exhibits high SERS sensitivity and excellent reusability. - Abstract: In this paper, we describe a simple technique for direct growth of gold nanoparticles (GNPs) into a nanostructured porous alumina layer on conductive glass slide (PAOCG). PAOCG was attached firmly with a small piece of steel and was then immersed in a HAuCl{sub 4} solution. Electro-induced electrons from steel were employed to reduce AuCl{sub 4}{sup −} on PAOCG. The galvanic replacement reaction (GRR) was adopted as the fundamental mechanism for reducing metal precursors. This mechanism was further studied by open circuit potential-time (OCP-t) experiment and the result demonstrated that steel induced the continuous proceeding of this reaction. This strategy presents a simple and general protocol for preparation of metal nanoparticles (MNPs) on conductive glass substrates. The SERS properties of Au/PAOCG were investigated using aqueous crystal violet (CV) and 4-mercaptopyridine (4-Mpy) as probe molecules. Au/PAOCG allowed as low as 10{sup −9} M CV and 10{sup −8} M 4-Mpy to be detected. The reusability of this substrate was achieved by measuring the SERS spectrum of the probe molecules followed with a 400 °C heat treatment for 10 min to remove the residuals. This substrate could be reused for at least ten cycles without any significantly reduced SERS performance. Therefore, this surface can serve as a portable, durable and reusable SERS
Normal Raman and SERS spectroscopy of the vitamin E
International Nuclear Information System (INIS)
Cai Tiantian; Gu Huaimin; Yuan Xiaojuan; Liu Fangfang
2011-01-01
In this study, surface-enhanced Raman scattering(SERS)spectra of vitamin E were obtained on colloidal silver(Ag). Alpha-(-) tocopherol which is the only form that is recognized to meet human requirements was selected to study. The analytes (±)- -tocopherol were dissolved in chloroform (CHCl 3 ) and the silver colloid was poured into the compound. Silver colloid was reduced by hydroxylamine hydrochloride. The analytes were the supernatant after standing the mixture for the reason that chloroform have no signals in surface-enhanced Raman scattering in the Ag colloid, and it would not affect the determination of the (±)- -tocopherol. The Normal Raman and SERS spectrum of Vitamin E were contrastively studied to realize how the vitamin E stuck to the silver nanoparticles. The results show the fat-soluble substances can be analysed by SERS. The spectra indicate that the molecules are adsorbed on the surface through the COO- groups by the simultaneous involvement of a and -type coordination. These results suggest some important criteria for consideration in SERS measurements and also provide important insights into the problem of predicting SERS activities for different fat-soluble substances.
Normal Raman and SERS spectroscopy of the vitamin E
Energy Technology Data Exchange (ETDEWEB)
Cai Tiantian; Gu Huaimin; Yuan Xiaojuan; Liu Fangfang, E-mail: guhm@scnu.edu.cn [MOE Key Laboratory of Laser Life Science, College of Biophotonics, South China Normal University, 510631, Guangzhou (China)
2011-01-01
In this study, surface-enhanced Raman scattering(SERS)spectra of vitamin E were obtained on colloidal silver(Ag). Alpha-(-) tocopherol which is the only form that is recognized to meet human requirements was selected to study. The analytes ({+-})- -tocopherol were dissolved in chloroform (CHCl{sub 3}) and the silver colloid was poured into the compound. Silver colloid was reduced by hydroxylamine hydrochloride. The analytes were the supernatant after standing the mixture for the reason that chloroform have no signals in surface-enhanced Raman scattering in the Ag colloid, and it would not affect the determination of the ({+-})- -tocopherol. The Normal Raman and SERS spectrum of Vitamin E were contrastively studied to realize how the vitamin E stuck to the silver nanoparticles. The results show the fat-soluble substances can be analysed by SERS. The spectra indicate that the molecules are adsorbed on the surface through the COO- groups by the simultaneous involvement of a and -type coordination. These results suggest some important criteria for consideration in SERS measurements and also provide important insights into the problem of predicting SERS activities for different fat-soluble substances.
CisSERS: Customizable In Silico Sequence Evaluation for Restriction Sites.
Directory of Open Access Journals (Sweden)
Richard M Sharpe
Full Text Available High-throughput sequencing continues to produce an immense volume of information that is processed and assembled into mature sequence data. Data analysis tools are urgently needed that leverage the embedded DNA sequence polymorphisms and consequent changes to restriction sites or sequence motifs in a high-throughput manner to enable biological experimentation. CisSERS was developed as a standalone open source tool to analyze sequence datasets and provide biologists with individual or comparative genome organization information in terms of presence and frequency of patterns or motifs such as restriction enzymes. Predicted agarose gel visualization of the custom analyses results was also integrated to enhance the usefulness of the software. CisSERS offers several novel functionalities, such as handling of large and multiple datasets in parallel, multiple restriction enzyme site detection and custom motif detection features, which are seamlessly integrated with real time agarose gel visualization. Using a simple fasta-formatted file as input, CisSERS utilizes the REBASE enzyme database. Results from CisSERS enable the user to make decisions for designing genotyping by sequencing experiments, reduced representation sequencing, 3'UTR sequencing, and cleaved amplified polymorphic sequence (CAPS molecular markers for large sample sets. CisSERS is a java based graphical user interface built around a perl backbone. Several of the applications of CisSERS including CAPS molecular marker development were successfully validated using wet-lab experimentation. Here, we present the tool CisSERS and results from in-silico and corresponding wet-lab analyses demonstrating that CisSERS is a technology platform solution that facilitates efficient data utilization in genomics and genetics studies.
Enhancing SERS by Means of Supramolecular Charge Transfer
Wong, Eric; Flood, Amar; Morales, Alfredo
2009-01-01
In a proposed method of sensing small quantities of molecules of interest, surface enhanced Raman scattering (SERS) spectroscopy would be further enhanced by means of intermolecular or supramolecular charge transfer. There is a very large potential market for sensors based on this method for rapid detection of chemical and biological hazards. In SERS, the Raman signals (vibrational spectra) of target molecules become enhanced by factors of the order of 108 when those molecules are in the vicinities of nanostructured substrate surfaces that have been engineered to have plasmon resonances that enhance local electric fields. SERS, as reported in several prior NASA Tech Briefs articles and elsewhere, has remained a research tool and has not yet been developed into a practical technique for sensing of target molecules: this is because the short range (5 to 20 nm) of the field enhancement necessitates engineering of receptor molecules to attract target molecules to the nanostructured substrate surfaces and to enable reliable identification of the target molecules in the presence of interferants. Intermolecular charge-transfer complexes have been used in fluorescence-, photoluminescence-, and electrochemistry-based techniques for sensing target molecules, but, until now, have not been considered for use in SERS-based sensing. The basic idea of the proposed method is to engineer receptor molecules that would be attached to nanostructured SERS substrates and that would interact with the target molecules to form receptor-target supramolecular charge-transfer complexes wherein the charge transfer could be photoexcited.
Characterization of active site residues of nitroalkane oxidase.
Valley, Michael P; Fenny, Nana S; Ali, Shah R; Fitzpatrick, Paul F
2010-06-01
The flavoenzyme nitroalkane oxidase catalyzes the oxidation of primary and secondary nitroalkanes to the corresponding aldehydes and ketones plus nitrite. The structure of the enzyme shows that Ser171 forms a hydrogen bond to the flavin N5, suggesting that it plays a role in catalysis. Cys397 and Tyr398 were previously identified by chemical modification as potential active site residues. To more directly probe the roles of these residues, the S171A, S171V, S171T, C397S, and Y398F enzymes have been characterized with nitroethane as substrate. The C397S and Y398 enzymes were less stable than the wild-type enzyme, and the C397S enzyme routinely contained a substoichiometric amount of FAD. Analysis of the steady-state kinetic parameters for the mutant enzymes, including deuterium isotope effects, establishes that all of the mutations result in decreases in the rate constants for removal of the substrate proton by approximately 5-fold and decreases in the rate constant for product release of approximately 2-fold. Only the S171V and S171T mutations alter the rate constant for flavin oxidation. These results establish that these residues are not involved in catalysis, but rather are required for maintaining the protein structure. 2009 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Hu, Yumei; Jia, Shiru; Ren, Feifei; Huang, Chun-Hsiang; Ko, Tzu-Ping; Mitchell, Douglas A.; Guo, Rey-Ting; Zheng, Yingying
2012-01-01
A bacteria biofilm formation involved enzyme, BsYisP, from Bacillus subtilis subsp. subtilis strain 168, was crystallized and diffracted to 1.92 Å. YisP is an enzyme involved in the pathway of biofilm formation in bacteria and is predicted to possess squalene synthase activity. A BlastP search using the YisP protein sequence from Bacillus subtilis subsp. subtilis strain 168 shows that it shares 23% identity with the dehydrosqualene synthase from Staphylococcus aureus. The YisP from B. subtilis 168 was expressed in Escherichia coli and the recombinant protein was purified and crystallized. The crystals, which belong to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 43.966, b = 77.576, c = 91.378 Å, were obtained by the sitting-drop vapour-diffusion method and diffracted to 1.92 Å resolution. Structure determination using MAD and MIR methods is in progress
Directory of Open Access Journals (Sweden)
Lorelei Ortega Díaz
2011-06-01
Full Text Available OBJETIVO: Describir las modificaciones de la curvatura posterior corneal en pacientes sometidos a cirugía refractiva láser en el Instituto Cubano de Oftalmología "Ramón Pando Ferrer" en el período de mayo a octubre de 2010. MÉTODOS: Se realizó un estudio descriptivo, longitudinal y prospectivo, con un universo de 257 pacientes (504 ojos sometidos a cirugía refractiva láser. La muestra quedó conformada por 31 pacientes (59 ojos. Se analizaron variables como edad, sexo, equivalente esférico, paquimetría preoperatoria, cantidad de ablación, estroma residual y diferencia de elevación posterior corneal, esta última obtenida del mapa de diferencia del topógrafo Galilei, con medición preoperatoria al mes y a los tres meses de la cirugía. Mediante análisis de regresión múltiple fueron valorados dichos cambios de la paquimetría, la cantidad de ablación y el estroma residual. RESULTADOS: El equivalente esférico, la paquimetría, la cantidad de ablación y el estroma residual se encontraron dentro de los parámetros de seguridad establecidos. La diferencia promedio de la elevación corneal posterior fue de 15,62 µm al mes y de 11,78 µm a los tres meses, con disminución significativa con el tiempo (p= 0,000. Se observó asociación con la paquimetría preoperatoria y el estroma residual, y se encontró una correlación inversa entre este último y la elevación corneal posterior a los tres meses. CONCLUSIONES: La cirugía refractiva láser induce un aumento precoz en la elevación corneal posterior, con disminución progresiva hacia el tercer mes. Los factores que más influyeron en estos cambios fueron el estroma residual y la paquimetría preoperatoria.OBJECTIVES: To describe the modifications in the corneal posterior curve in patients underwent laser refractive surgery in the "Ramón Pando Ferrer" Cuban Institute of Ophthalmology from May to October, 2020. METHODS: A prospective, longitudinal and descriptive study was conducted
Unidad did??ctica: concepciones filos??ficas del ser humano
Mart??nez Moreno, Roc??o
2012-01-01
Esta unidad did??ctica se justifica en tanto que ofrece la posibilidad de estudiar al ser humano desde varias perspectivas filos??ficas, consider??ndolo desde sus diferentes dimensiones. Esto nos aleja del dogmatismo o la creencia de que el ser humano es un constructo cerrado y definible. Quiz?? desde las ciencias nos acerquemos a una visi??n de lo que ??ste es en su versi??n mec??nica o biol??gica; pero no debemos olvidar que el ser humano tambi??n est?? sujeto al paso del tiempo, a la socie...
Nanosphere Lithography on Fiber: Towards Engineered Lab-On-Fiber SERS Optrodes
Directory of Open Access Journals (Sweden)
Giuseppe Quero
2018-02-01
Full Text Available In this paper we report on the engineering of repeatable surface enhanced Raman scattering (SERS optical fiber sensor devices (optrodes, as realized through nanosphere lithography. The Lab-on-Fiber SERS optrode consists of polystyrene nanospheres in a close-packed arrays configuration covered by a thin film of gold on the optical fiber tip. The SERS surfaces were fabricated by using a nanosphere lithography approach that is already demonstrated as able to produce highly repeatable patterns on the fiber tip. In order to engineer and optimize the SERS probes, we first evaluated and compared the SERS performances in terms of Enhancement Factor (EF pertaining to different patterns with different nanosphere diameters and gold thicknesses. To this aim, the EF of SERS surfaces with a pitch of 500, 750 and 1000 nm, and gold films of 20, 30 and 40 nm have been retrieved, adopting the SERS signal of a monolayer of biphenyl-4-thiol (BPT as a reliable benchmark. The analysis allowed us to identify of the most promising SERS platform: for the samples with nanospheres diameter of 500 nm and gold thickness of 30 nm, we measured values of EF of 4 × 105, which is comparable with state-of-the-art SERS EF achievable with highly performing colloidal gold nanoparticles. The reproducibility of the SERS enhancement was thoroughly evaluated. In particular, the SERS intensity revealed intra-sample (i.e., between different spatial regions of a selected substrate and inter-sample (i.e., between regions of different substrates repeatability, with a relative standard deviation lower than 9 and 15%, respectively. Finally, in order to determine the most suitable optical fiber probe, in terms of excitation/collection efficiency and Raman background, we selected several commercially available optical fibers and tested them with a BPT solution used as benchmark. A fiber probe with a pure silica core of 200 µm diameter and high numerical aperture (i.e., 0.5 was found to be the
Directory of Open Access Journals (Sweden)
Paddy KC Janssen
2014-08-01
Full Text Available It has been postulated that the persistent short intravaginal ejaculation latency time (IELT of men with lifelong premature ejaculation (LPE is related to 5-hydroxytryptamine (HT2C receptor functioning. The aim of this study was to investigate the relationship of Cys23Ser 5-HT2C receptor gene polymorphism and the duration of IELT in men with LPE. Therefore, a prospective study was conducted in 64 Dutch Caucasian men with LPE. Baseline IELT during coitus was assessed by stopwatch over a 1-month period. All men were genotyped for Cys23Ser 5-HT2C receptor gene polymorphism. Allele frequencies and genotypes of Cys and Ser variants of 5-HT2C receptor gene polymorphism were determined. Association between Cys/Cys and Ser/Ser genotypes and the natural logarithm of the IELT in men with LPE were investigated. As a result, the geometric mean, median and natural mean IELT were 25.2, 27.0, 33.9 s, respectively. Of all men, 20.0%, 10.8%, 23.1% and 41.5% ejaculated within 10, 10-20, 20-30 and 30-60 s after vaginal penetration. Of the 64 men, the Cys/Cys and Ser/Ser genotype frequency for the Cys23Ser polymorphism of the 5-HT2C receptor gene was 81% and 19%, respectively. The geometric mean IELT of the wildtypes (Cys/Cys is significantly lower (22.6 s; 95% CI 18.3-27.8 s than in male homozygous mutants (Ser/Ser (40.4 s; 95% CI 20.3-80.4 s (P = 0.03. It is concluded that Cys23Ser 5-HT2C receptor gene polymorphism is associated with the IELT in men with LPE. Men with Cys/Cys genotype have shorter IELTs than men with Ser/Ser genotypes.
Janssen, Paddy Kc; Schaik, Ron van; Olivier, Berend; Waldinger, Marcel D
2014-01-01
It has been postulated that the persistent short intravaginal ejaculation latency time (IELT) of men with lifelong premature ejaculation (LPE) is related to 5-hydroxytryptamine (HT)2C receptor functioning. The aim of this study was to investigate the relationship of Cys23Ser 5-HT2C receptor gene polymorphism and the duration of IELT in men with LPE. Therefore, a prospective study was conducted in 64 Dutch Caucasian men with LPE. Baseline IELT during coitus was assessed by stopwatch over a 1-month period. All men were genotyped for Cys23Ser 5-HT2C receptor gene polymorphism. Allele frequencies and genotypes of Cys and Ser variants of 5-HT2C receptor gene polymorphism were determined. Association between Cys/Cys and Ser/Ser genotypes and the natural logarithm of the IELT in men with LPE were investigated. As a result, the geometric mean, median and natural mean IELT were 25.2, 27.0, 33.9 s, respectively. Of all men, 20.0%, 10.8%, 23.1% and 41.5% ejaculated within 10, 10-20, 20-30 and 30-60 s after vaginal penetration. Of the 64 men, the Cys/Cys and Ser/Ser genotype frequency for the Cys23Ser polymorphism of the 5-HT2C receptor gene was 81% and 19%, respectively. The geometric mean IELT of the wildtypes (Cys/Cys) is significantly lower (22.6 s; 95% CI 18.3-27.8 s) than in male homozygous mutants (Ser/Ser) (40.4 s; 95% CI 20.3-80.4 s) (P = 0.03). It is concluded that Cys23Ser 5-HT2C receptor gene polymorphism is associated with the IELT in men with LPE. Men with Cys/Cys genotype have shorter IELTs than men with Ser/Ser genotypes.
IR, Raman and SERS studies of methyl salicylate
Varghese, Hema Tresa; Yohannan Panicker, C.; Philip, Daizy; Mannekutla, James R.; Inamdar, S. R.
2007-04-01
The IR and Raman spectra of methyl salicylate (MS) were recorded and analysed. Surface enhanced Raman scattering (SERS) spectrum was recorded in silver colloid. The vibrational wave numbers of the compound have been computed using the Hartree-Fock/6-31G * basis and compared with the experimental values. SERS studies suggest a flat orientation of the molecule at the metal surface.
Au coated PS nanopillars as a highly ordered and reproducible SERS substrate
Kim, Yong-Tae; Schilling, Joerg; Schweizer, Stefan L.; Sauer, Guido; Wehrspohn, Ralf B.
2017-07-01
Noble metal nanostructures with nanometer gap size provide strong surface-enhanced Raman scattering (SERS) which can be used to detect trace amounts of chemical and biological molecules. Although several approaches were reported to obtain active SERS substrates, it still remains a challenge to fabricate SERS substrates with high sensitivity and reproducibility using low-cost techniques. In this article, we report on the fabrication of Au sputtered PS nanopillars based on a template synthetic method as highly ordered and reproducible SERS substrates. The SERS substrates are fabricated by anodic aluminum oxide (AAO) template-assisted infiltration of polystyrene (PS) resulting in hemispherical structures, and a following Au sputtering process. The optimum gap size between adjacent PS nanopillars and thickness of the Au layers for high SERS sensitivity are investigated. Using the Au sputtered PS nanopillars as an active SERS substrate, the Raman signal of 4-methylbenzenethiol (4-MBT) with a concentration down to 10-9 M is identified with good signal reproducibility, showing great potential as promising tool for SERS-based detection.
Energy Technology Data Exchange (ETDEWEB)
Li, Lei; Zhao, Aiwu, E-mail: awzhao@iim.ac.cn; Wang, Dapeng; Guo, Hongyan; Sun, Henghui; He, Qinye [Chinese Academy of Sciences, Institute of Intelligent Machines (China)
2016-07-15
The cube-like Fe{sub 3}O{sub 4}@SiO{sub 2}@Ag (FSA) nanocomposites with great SERS activity have been successfully synthesized by a layer-by-layer procedure in this paper. The cube-like Fe{sub 3}O{sub 4}@SiO{sub 2} core–shell structures were prepared via a new route and Ag nanoparticles were introduced onto their surface through a one-pot hydrothermal reaction. By controlling the reaction time, the coverage rate of Ag on the FSA surface could be tuned, and then a series of FSA composites were obtained. The SERS properties of these FSA composites were investigated using p-aminothiophenol (p-ATP) as the probe molecule. It was found that the FSA composites synthesized with a reaction time of 6 h showed the best SERS performance, and the detection limit for p-ATP could reach 1 × 10{sup −7} M. For practical application, the FSA composites were also used to detect thiram, one of the dithiocarbamate fungicides that has been widely used as a pesticide in agriculture. The detection limit is as low as 1 × 10{sup −6} M (0.24 ppm), lower than the maximal residue limit of 7 ppm in fruit prescribed by the US Environmental Protection Agency. The resulting substrate with high SERS activity, stability and strong magnetic responsivity makes the FSA composite a perfect choice for practical SERS detection applications.
Fabrication of Semiconductor ZnO Nanostructures for Versatile SERS Application
Directory of Open Access Journals (Sweden)
Lili Yang
2017-11-01
Full Text Available Since the initial discovery of surface-enhanced Raman scattering (SERS in the 1970s, it has exhibited a huge potential application in many fields due to its outstanding advantages. Since the ultra-sensitive noble metallic nanostructures have increasingly exposed themselves as having some problems during application, semiconductors have been gradually exploited as one of the critical SERS substrate materials due to their distinctive advantages when compared with noble metals. ZnO is one of the most representative metallic oxide semiconductors with an abundant reserve, various and cost-effective fabrication techniques, as well as special physical and chemical properties. Thanks to the varied morphologies, size-dependent exciton, good chemical stability, a tunable band gap, carrier concentration, and stoichiometry, ZnO nanostructures have the potential to be exploited as SERS substrates. Moreover, other distinctive properties possessed by ZnO such as biocompatibility, photocatcalysis and self-cleaning, and gas- and chemo-sensitivity can be synergistically integrated and exerted with SERS activity to realize the multifunctional potential of ZnO substrates. In this review, we discuss the inevitable development trend of exploiting the potential semiconductor ZnO as a SERS substrate. After clarifying the root cause of the great disparity between the enhancement factor (EF of noble metals and that of ZnO nanostructures, two specific methods are put forward to improve the SERS activity of ZnO, namely: elemental doping and combination of ZnO with noble metals. Then, we introduce a distinctive advantage of ZnO as SERS substrate and illustrate the necessity of reporting a meaningful average EF. We also summarize some fabrication methods for ZnO nanostructures with varied dimensions (0–3 dimensions. Finally, we present an overview of ZnO nanostructures for the versatile SERS application.
Zhang, Haibo; Zhang, Panyue; Ye, Jie; Wu, Yan; Liu, Jianbo; Fang, Wei; Xu, Dong; Wang, Bei; Yan, Li; Zeng, Guangming
2018-01-01
The rumen digested residue of rice straw contains high residual carbohydrates, which makes it a potential cellulosic ethanol feedstock. This study evaluated the feasibility and effectiveness of applying microwave assisted alkali (MAP), ultrasound assisted alkali (UAP), and ball milling pretreatment (BMP) to enhance ethanol production from two digested residues (2.5%-DR and 10%-DR) after rumen fluid digestion of rice straw at 2.5% and 10.0% solid content. Results revealed that 2.5%-DR and 10%-DR had a cellulose content of 36.4% and 41.7%, respectively. MAP and UAP improved enzymatic hydrolysis of digested residue by removing the lignin and hemicellulose, while BMP by decreasing the particle size and crystallinity. BMP was concluded as the suitable pretreatment, resulting in an ethanol yield of 116.65 and 147.42mgg -1 for 2.5%-DR and 10%-DR, respectively. The integrated system including BMP for digested residue at 2.5% solid content achieved a maximum energy output of 7010kJkg -1 . Copyright © 2017 Elsevier Ltd. All rights reserved.
Low temperature magnetoresistance in La1.32Sr1.68Mn2O7 layered manganite under hydrostatic pressure
International Nuclear Information System (INIS)
Kumaresavanji, M.; Fontes, M.B.
2010-01-01
The La 1.32 Sr 1.68 Mn 2 O 7 layered manganite system has been studied by the low temperature electrical resistance and magnetoresistance under hydrostatic pressure up to 25 kbar. We have observe both, a Curie temperature (T C ) and a metal-insulator transition (T MI ) at 118 K in the ambient pressure. The applied pressure shifts the T MI to higher temperature values and induces a second metal-insulator transition (T 2 MI ) at 90 K, in the temperature dependence of resistivity measurements. Also, the pressure suppresses the peak resistance abruptly at T C . When an external field of 5 T is applied, we have observed a large negative magnetoresistance of 300% at the transition temperature and a 128% at 4.5 K. However, the increased pressure decreases the magnetoresistance ratio gradually. When the pressure reaches its maximum available value of 25 kbar, the magnetoresistance ratio decreases at a rate of 1.3%/kbar. From our experimental results, the decrease of magnetoresistance ratio with pressure is explained by the pressure induced canted spin state which is not favor for the spin polarized intergrain tunneling in layered manganites.
Kögler, Martin; Paul, Andrea; Anane, Emmanuel; Birkholz, Mario; Bunker, Alex; Viitala, Tapani; Maiwald, Michael; Junne, Stefan; Neubauer, Peter
2018-06-08
The application of Raman spectroscopy as a monitoring technique for bioprocesses is severely limited by a large background signal originating from fluorescing compounds in the culture media. Here we compare time-gated Raman (TG-Raman)-, continuous wave NIR-process Raman (NIR-Raman) and continuous wave micro-Raman (micro-Raman) approaches in combination with surface enhanced Raman spectroscopy (SERS) for their potential to overcome this limit. For that purpose, we monitored metabolite concentrations of Escherichia coli bioreactor cultivations in cell-free supernatant samples. We investigated concentration transients of glucose, acetate, AMP and cAMP at alternating substrate availability, from deficiency to excess. Raman and SERS signals were compared to off-line metabolite analysis of carbohydrates, carboxylic acids and nucleotides. Results demonstrate that SERS, in almost all cases, led to a higher number of identifiable signals and better resolved spectra. Spectra derived from the TG-Raman were comparable to those of micro-Raman resulting in well-discernable Raman peaks, which allowed for the identification of a higher number of compounds. In contrast, NIR-Raman provided a superior performance for the quantitative evaluation of analytes, both with and without SERS nanoparticles when using multivariate data analysis. This article is protected by copyright. All rights reserved. © 2018 American Institute of Chemical Engineers.
DEFF Research Database (Denmark)
Mosbech, Anna; Lukas, Claudia; Bekker-Jensen, Simon
2013-01-01
Protein recruitment to DNA double-strand breaks (DSBs) relies on ubiquitylation of the surrounding chromatin by the RING finger ubiquitin ligases RNF8 and RNF168. Flux through this pathway is opposed by several deubiquitylating enzymes (DUBs), including OTUB1 and USP3. By analyzing the effect...... of individually overexpressing the majority of human DUBs on RNF8/RNF168-mediated 53BP1 retention at DSB sites, we found that USP44 and USP29 powerfully inhibited this response at the level of RNF168 accrual. Both USP44 and USP29 promoted efficient deubiquitylation of histone H2A, but unlike USP44, USP29...... displayed non-specific reactivity towards ubiquitylated substrates. Moreover, USP44 but not other H2A DUBs was recruited to RNF168-generated ubiquitylation products at DSB sites. Individual depletion of these DUBs only mildly enhanced accumulation of ubiquitin conjugates and 53BP1 at DSBs, suggesting...
DEFF Research Database (Denmark)
Brøgger, Anna Line
This Ph.D. thesis explores the engineering of a portable sensor system for detection of rare and small molecules. The Ph.D. project is part of the research project 'Multi-Sensor DVD platform' (MUSE), aiming to integrate different sensors on a rotating disc. The sensors are chosen to complement each...... other, creating more reliable and stable results for the end user. The rotating disc comprises microfluidic channels, which can be utilized for handling and manipulating liquid samples such as blood or water. The focus of this Ph.D. thesis, is on the integration of one specific sensor on a rotating disc....... The sensor is based upon surface enhanced Raman spectroscopy (SERS), which detects molecular vibrations. The aim of this thesis is to cover the different aspects of the sensor system. SERS substrates, consisting of nanopillars with gold or silver caps on top, have been fabricated by standard micro and nano...
Tetracycline residues in porcine stomach after administration via drinking water on a swine farm.
Lindquist, Danielle; Wu, Huali; Mason, Sharon; Yeatts, Jim; Brooks, Jim; Barlow, Beth; Schill, Kaitlyn; Baynes, Ronald
2014-01-01
Tetracycline is a broad-spectrum antibiotic used to treat infections in swine. The maximum residue levels of tetracycline in pork stomach tissue in Russia, Europe, and the United States are 10, 200, and 2,000 ppb, respectively. This difference in accepted safety levels may be the reason why stomach tissues that the United States exports continue to be residue violators in overseas markets. In this study, 30 pigs at two different stages of production (weanling and finisher) were treated with tetracycline at 22 mg/kg of body weight per day for a total of 5 days via a water medicator. Blood samples were collected at 0, 72, 78, 96, and 102 h after the start of medication. The medication was stopped at 120 h, and blood samples were again collected at 126, 144, 168, 192, and 216 h after exposure. Five animals were slaughtered for stomach tissue 0, 24, 48, 96, and 192 h after the drug was flushed from the water line. All blood and tissue samples were analyzed by high-performance liquid chromatography-UV methods. The tetracycline levels in plasma were below the level of detection after the U.S.-labeled withdrawal time of 4 days. The stomach tissue residues averaged 671.72, 330.31, 297.77, 136.36, and 268.08 ppb on withdrawal days 0, 1, 2, 4, and 8, respectively. Using the U.S. Food and Drug Administration tolerance limit method and a population-based pharmacokinetic model with Monte Carlo simulation, a withdrawal interval was estimated. This study demonstrated that tetracycline residues are still detectable in the stomach tissues after the established United States withdrawal time of 4 days. These residue levels may explain why stomach tissues tested in Russia and Europe show positive residues for tetracycline, even though the meat may pass inspection here in the United States prior to export.
Brange, J
1992-01-01
Insulin decomposes by a multitude of chemical reactions [1-3]. It deamidates at two different residues by entirely different mechanisms. In acid, deamidation at AsnA21 is intramolecularly catalyzed by the protonated C-terminal, whereas above pH 6 an intermediate imide formation at residue AsnB3 leads to isoAsp and Asp derivatives. The imide formation requires a large rotation around the alpha-carbon/peptide carbonyl carbon bond at B3, corresponding to a 10 A movement of the B-chain N-terminal. The main determinant for the rate of B3 deamidation, as well as for the ratio between the two products formed, is the local conformational structure, which is highly influenced by various excipients and the physical state of the insulin. An amazing thermolysin-like, autoproteolytic cleavage of the A-chain takes place in rhombohedral insulin crystals, mediated by a concerted catalytic action by several, inter-hexameric functional groups and Zn2+. Intermolecular, covalent cross-linking of insulin molecules occurs via several mechanisms. The most prominent type of mechanism is aminolysis by the N-terminals, leading to isopeptide linkages with the A-chain side-chain amides of residues GlnA15, AsnA18 and AsnA21. The same type of reaction also leads to covalent cross-linking of the N-terminal in protamine with insulin. Disulfide exchange reactions, initiated by lysis of the A7-B7 disulfide bridge, lead mainly to formation of covalent oligo- and polymers. Activation energy (Ea) for the neutral deamidation and the aminolysis reactions was found to be 80 and 119 KJ/mol, respectively.
Yang, Libin; Sang, Qinqin; Du, Juan; Yang, Ming; Li, Xiuling; Shen, Yu; Han, Xiaoxia; Jiang, Xin; Zhao, Bing
2018-06-06
Ag simultaneously deposited and doped TiO2 (Ag-TiO2) hybrid nanoparticles (NPs) were prepared via a sol-hydrothermal method, as both a sensitive surface-enhanced Raman scattering (SERS) substrate and a superior photocatalyst for the first time. Ag-TiO2 hybrid NPs exhibit excellent SERS performance for several probe molecules and the enhancement factor is calculated to be 1.86 × 105. The detection limit of the 4-mercaptobenzoic acid (4-MBA) probe on the Ag-TiO2 substrate is 1 × 10-9 mol L-1, which is four orders of magnitude lower than that on pure TiO2 as a consequence of the synergistic effects of TiO2 and Ag. This is the highest SERS sensitivity among the reported semiconductor substrates and even comparable to noble metal substrates, and a SERS enhancement mechanism from the synergistic contribution of the semiconductor and noble metal was proposed. And importantly, the Ag-TiO2 hybrid shows excellent photocatalytic degradation activity for the detected species under UV light irradiation at lower concentration conditions, even for the hard to degrade 4-MBA molecule. This makes the Ag-TiO2 hybrid promising as a dual-function platform for both highly sensitive SERS detection and photocatalytic degradation of a pollutant system. Moreover, it also proves that the Ag-TiO2 hybrid can serve as a promising recyclable SERS-active substrate by virtue of its photocatalytic self-cleaning properties for some specific applications, for instance comparative studies of different species on the same SERS platform, in addition to the economic benefit.
La polémica sobre el ser en el Avicena y Averroes latinos
García-Marqués, A. (Alfonso)
1987-01-01
Fiosofía medieval; recepción del aristotelismo árabe en Occidente; metafísica; aristotelismo platonizante; esencia; universal; accidentalidad del ser; ser y esencia; ser veritativo y ser extramental; crítica de Averroes a Avicena.
Bachmann, M.; Shiraishi, N.; Campbell, W. H.; Yoo, B. C.; Harmon, A. C.; Huber, S. C.; Davies, E. (Principal Investigator)
1996-01-01
Spinach leaf NADH:nitrate reductase (NR) responds to light/dark signals and photosynthetic activity in part as a result of rapid regulation by reversible protein phosphorylation. We have identified the major regulatory phosphorylation site as Ser-543, which is located in the hinge 1 region connecting the cytochrome b domain with the molybdenum-pterin cofactor binding domain of NR, using recombinant NR fragments containing or lacking the phosphorylation site sequence. Studies with NR partial reactions indicated that the block in electron flow caused by phosphorylation also could be localized to the hinge 1 region. A synthetic peptide (NR6) based on the phosphorylation site sequence was phosphorylated readily by NR kinase (NRk) in vitro. NR6 kinase activity tracked the ATP-dependent inactivation of NR during several chromatographic steps and completely inhibited inactivation/phosphorylation of native NR in vitro. Two forms of NRk were resolved by using anion exchange chromatography. Studies with synthetic peptide analogs indicated that both forms of NRk had similar specificity determinants, requiring a basic residue at P-3 (i.e., three amino acids N-terminal to the phosphorylated serine) and a hydrophobic residue at P-5. Both forms are strictly calcium dependent but belong to distinct families of protein kinases because they are distinct immunochemically.
Phosphorylation of the Yeast Choline Kinase by Protein Kinase C
Choi, Mal-Gi; Kurnov, Vladlen; Kersting, Michael C.; Sreenivas, Avula; Carman, George M.
2005-01-01
The Saccharomyces cerevisiae CKI1-encoded choline kinase catalyzes the committed step in phosphatidylcholine synthesis via the Kennedy pathway. The enzyme is phosphorylated on multiple serine residues, and some of this phosphorylation is mediated by protein kinase A. In this work, we examined the hypothesis that choline kinase is also phosphorylated by protein kinase C. Using choline kinase as a substrate, protein kinase C activity was dose- and time-dependent, and dependent on the concentrations of choline kinase (Km = 27 μg/ml) and ATP (Km = 15 μM). This phosphorylation, which occurred on a serine residue, was accompanied by a 1.6-fold stimulation of choline kinase activity. The synthetic peptide SRSSS25QRRHS (Vmax/Km = 17.5 mM-1 μmol min-1 mg-1) that contains the protein kinase C motif for Ser25 was a substrate for protein kinase C. A Ser25 to Ala (S25A) mutation in choline kinase resulted in a 60% decrease in protein kinase C phosphorylation of the enzyme. Phosphopeptide mapping analysis of the S25A mutant enzyme confirmed that Ser25 was a protein kinase C target site. In vivo, the S25A mutation correlated with a decrease (55%) in phosphatidylcholine synthesis via the Kennedy pathway whereas an S25D phosphorylation site mimic correlated with an increase (44%) in phosphatidylcholine synthesis. Whereas the S25A (protein kinase C site) mutation did not affect the phosphorylation of choline kinase by protein kinase A, the S30A (protein kinase A site) mutation caused a 46% reduction in enzyme phosphorylation by protein kinase C. A choline kinase synthetic peptide (SQRRHS30LTRQ) containing Ser30 was a substrate (Vmax/Km = 3.0 mM−1 μmol min−1 mg−1) for protein kinase C. Comparison of phosphopeptide maps of the wild type and S30A mutant choline kinase enzymes phosphorylated by protein kinase C confirmed that Ser30 was also a target site for protein kinase C. PMID:15919656
Energy Technology Data Exchange (ETDEWEB)
Lima,Santiago; Kumar,Sunil; Gawandi,Vijay; Momany,Cory; Phillips,Robert S.; (Georgia)
2009-02-23
Homo sapiens kynureninase is a pyridoxal-5'-phosphate dependent enzyme that catalyzes the hydrolytic cleavage of 3-hydroxykynurenine to yield 3-hydroxyanthranilate and L-alanine as part of the tryptophan catabolic pathway leading to the de novo biosynthesis of NAD{sup +}. This pathway results in quinolinate, an excitotoxin that is an NMDA receptor agonist. High levels of quinolinate have been correlated with the etiology of neurodegenerative disorders such as AIDS-related dementia and Alzheimer's disease. We have synthesized a novel kynureninase inhibitor, 3-hydroxyhippurate, cocrystallized it with human kynureninase, and solved the atomic structure. On the basis of an analysis of the complex, we designed a series of His-102, Ser-332, and Asn-333 mutants. The H102W/N333T and H102W/S332G/N333T mutants showed complete reversal of substrate specificity between 3-hydroxykynurenine and L-kynurenine, thus defining the primary residues contributing to substrate specificity in kynureninases.
Amala, Mathimaran; Rajamanikandan, Sundaraj; Prabhu, Dhamodharan; Surekha, Kanagarajan; Jeyakanthan, Jeyaraman
2018-02-06
Lymphatic filariasis is a debilitating vector borne parasitic disease that infects human lymphatic system by nematode Brugia malayi. Currently available anti-filarial drugs are effective only on the larval stages of parasite. So far, no effective drugs are available for humans to treat filarial infections. In this regard, aspartate semialdehyde dehydrogenase (ASDase) in lysine biosynthetic pathway from Wolbachia endosymbiont Brugia malayi represents an attractive therapeutic target for the development of novel anti-filarial agents. In this present study, molecular modeling combined with molecular dynamics simulations and structure-based virtual screening were performed to identify potent lead molecules against ASDase. Based on Glide score, toxicity profile, binding affinity and mode of interactions with the ASDase, five potent lead molecules were selected. The molecular docking and dynamics results revealed that the amino acid residues Arg103, Asn133, Cys134, Gln161, Ser164, Lys218, Arg239, His246, and Asn321 plays a crucial role in effective binding of Top leads into the active site of ASDase. The stability of the ASDase-lead complexes was confirmed by running the 30 ns molecular dynamics simulations. The pharmacokinetic properties of the identified lead molecules are in the acceptable range. Furthermore, density functional theory and binding free energy calculations were performed to rank the lead molecules. Thus, the identified lead molecules can be used for the development of anti-filarial agents to combat the pathogenecity of Brugia malayi.
Alsenaidy, Mohammad A; Okbazghi, Solomon Z; Kim, Jae Hyun; Joshi, Sangeeta B; Middaugh, C Russell; Tolbert, Thomas J; Volkin, David B
2014-06-01
The structural integrity and conformational stability of various IgG1-Fc proteins produced from the yeast Pichia pastoris with different glycosylation site occupancy (di-, mono-, and nonglycosylated) were determined. In addition, the physical stability profiles of three different forms of nonglycosylated Fc molecules (varying amino-acid residues at site 297 in the CH 2 domain due to the point mutations and enzymatic digestion of the Fc glycoforms) were also examined. The physical stability of these IgG1-Fc glycoproteins was examined as a function of pH and temperature by high-throughput biophysical analysis using multiple techniques combined with data visualization tools (three index empirical phase diagrams and radar charts). Across the pH range of 4.0-6.0, the di- and monoglycosylated forms of the IgG1-Fc showed the highest and lowest levels of physical stability, respectively, with the nonglycosylated forms showing intermediate stability depending on solution pH. In the aglycosylated Fc proteins, the introduction of Asp (D) residues at site 297 (QQ vs. DN vs. DD forms) resulted in more subtle changes in structural integrity and physical stability depending on solution pH. The utility of evaluating the conformational stability profile differences between the various IgG1-Fc glycoproteins is discussed in the context of analytical comparability studies. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.
Improving SERS uniformity by isolating hot spots in gold rod-in-shell nanoparticles
International Nuclear Information System (INIS)
Wang, Shanshan; Liu, Zhonghui; Bartic, Carmen; Xu, Hong; Ye, Jian
2016-01-01
Surface-enhanced Raman scattering (SERS) tags show ultrasensitivity and multiplexing abilities due to strong and characteristic Raman signals and therefore can be utilized as optical labeling agents similar to fluorescent dyes and quantum dots for biosensing and bioimaging. However, SERS tags have the difficulty to realize quantitative analysis due to the uniformity and reproducibility issue. In this work, we have reported on a new type of SERS tag called Au rod-in-shell (RIS) gap-enhanced Raman tag (GERT). With the high-resolution transmission electron microscopy (TEM) and optical absorbance measurements, we have demonstrated the subnanometer sized gap junctions inside the RIS GERTs. SERS measurements and FDTD calculations show that the core–shell subnanometer gap geometry in the RIS GERTs not only generates strong SERS hot spots but also isolates SERS hot spots by Au shells to avoid the influence when the particle aggregates form, therefore showing better SERS uniformity and stronger SERS intensity than normal Au nanorods. Those RIS NPs exhibit great potential as the labeling agents for SERS-based bioimaging and biosensing applications.
Improving SERS uniformity by isolating hot spots in gold rod-in-shell nanoparticles
Energy Technology Data Exchange (ETDEWEB)
Wang, Shanshan; Liu, Zhonghui [Shanghai Jiao Tong University, School of Biomedical Engineering & Med-X Research Institute (China); Bartic, Carmen [KU Leuven, Department of Physics (Belgium); Xu, Hong, E-mail: xuhong@sjtu.edu.cn; Ye, Jian, E-mail: yejian78@sjtu.edu.cn [Shanghai Jiao Tong University, School of Biomedical Engineering & Med-X Research Institute (China)
2016-08-15
Surface-enhanced Raman scattering (SERS) tags show ultrasensitivity and multiplexing abilities due to strong and characteristic Raman signals and therefore can be utilized as optical labeling agents similar to fluorescent dyes and quantum dots for biosensing and bioimaging. However, SERS tags have the difficulty to realize quantitative analysis due to the uniformity and reproducibility issue. In this work, we have reported on a new type of SERS tag called Au rod-in-shell (RIS) gap-enhanced Raman tag (GERT). With the high-resolution transmission electron microscopy (TEM) and optical absorbance measurements, we have demonstrated the subnanometer sized gap junctions inside the RIS GERTs. SERS measurements and FDTD calculations show that the core–shell subnanometer gap geometry in the RIS GERTs not only generates strong SERS hot spots but also isolates SERS hot spots by Au shells to avoid the influence when the particle aggregates form, therefore showing better SERS uniformity and stronger SERS intensity than normal Au nanorods. Those RIS NPs exhibit great potential as the labeling agents for SERS-based bioimaging and biosensing applications.
Directory of Open Access Journals (Sweden)
Avraham Ben-Shimon
2011-11-01
Full Text Available Protein kinases are key signaling enzymes that catalyze the transfer of γ-phosphate from an ATP molecule to a phospho-accepting residue in the substrate. Unraveling the molecular features that govern the preference of kinases for particular residues flanking the phosphoacceptor is important for understanding kinase specificities toward their substrates and for designing substrate-like peptidic inhibitors. We applied ANCHORSmap, a new fragment-based computational approach for mapping amino acid side chains on protein surfaces, to predict and characterize the preference of kinases toward Arginine binding. We focus on positions P-2 and P-5, commonly occupied by Arginine (Arg in substrates of basophilic Ser/Thr kinases. The method accurately identified all the P-2/P-5 Arg binding sites previously determined by X-ray crystallography and produced Arg preferences that corresponded to those experimentally found by peptide arrays. The predicted Arg-binding positions and their associated pockets were analyzed in terms of shape, physicochemical properties, amino acid composition, and in-silico mutagenesis, providing structural rationalization for previously unexplained trends in kinase preferences toward Arg moieties. This methodology sheds light on several kinases that were described in the literature as having non-trivial preferences for Arg, and provides some surprising departures from the prevailing views regarding residues that determine kinase specificity toward Arg. In particular, we found that the preference for a P-5 Arg is not necessarily governed by the 170/230 acidic pair, as was previously assumed, but by several different pairs of acidic residues, selected from positions 133, 169, and 230 (PKA numbering. The acidic residue at position 230 serves as a pivotal element in recognizing Arg from both the P-2 and P-5 positions.
Tuning SERS for living erythrocytes
DEFF Research Database (Denmark)
Brazhe, Nadezda; Parshina, E.Y.; Khabanova, V.V.
2013-01-01
Surface-enhanced Raman spectroscopy (SERS) is a unique technique to study submembrane hemoglobin (Hbsm) in erythrocytes. We report the detailed design of SERS experiments on living erythrocytes to estimate dependence of the enhancemen t factor for main Raman bands of Hbsm on silver nanoparticle (Ag......NP) properties. We demonstrate that the enhancement factor for 4/A1g, 10/B1g and A2g Raman bands of Hbsm varies from 105 to 107 under proposed experimental conditions with 473 nm laser excitation. For the first time we show that the enhancement of Raman scattering increases with the increase in the relative...... between small AgNPs and Hbsm and, consequently, leads to the higher enhancement of Raman scattering of Hbsm. The enhancement of higher wavenumber bands 10/B1g and A2g is more sensitive to AgNPs' size and the relative amount of small AgNPs than the enhancement of the lower wavenumber band 4/A1g. This can...
Fufezan, Christian; Simionato, Diana; Morosinotto, Tomas
2012-01-01
Plants are often exposed to saturating light conditions, which can lead to oxidative stress. The carotenoid zeaxanthin, synthesized from violaxanthin by Violaxanthin De-Epoxidase (VDE) plays a major role in the protection from excess illumination. VDE activation is triggered by a pH reduction in the thylakoids lumen occurring under saturating light. In this work the mechanism of the VDE activation was investigated on a molecular level using multi conformer continuum electrostatic calculations, site directed mutagenesis and molecular dynamics. The pK(a) values of residues of the inactive VDE were determined to identify target residues that could be implicated in the activation. Five such target residues were investigated closer by site directed mutagenesis, whereas variants in four residues (D98, D117, H168 and D206) caused a reduction in enzymatic activity indicating a role in the activation of VDE while D86 mutants did not show any alteration. The analysis of the VDE sequence showed that the four putative activation residues are all conserved in plants but not in diatoms, explaining why VDE in these algae is already activated at higher pH. Molecular dynamics showed that the VDE structure was coherent at pH 7 with a low amount of water penetrating the hydrophobic barrel. Simulations carried out with the candidate residues locked into their protonated state showed instead an increased amount of water penetrating the barrel and the rupture of the H121-Y214 hydrogen bond at the end of the barrel, which is essential for VDE activation. These results suggest that VDE activation relies on a robust and redundant network, in which the four residues identified in this study play a major role.
Directory of Open Access Journals (Sweden)
Christian Fufezan
Full Text Available Plants are often exposed to saturating light conditions, which can lead to oxidative stress. The carotenoid zeaxanthin, synthesized from violaxanthin by Violaxanthin De-Epoxidase (VDE plays a major role in the protection from excess illumination. VDE activation is triggered by a pH reduction in the thylakoids lumen occurring under saturating light. In this work the mechanism of the VDE activation was investigated on a molecular level using multi conformer continuum electrostatic calculations, site directed mutagenesis and molecular dynamics. The pK(a values of residues of the inactive VDE were determined to identify target residues that could be implicated in the activation. Five such target residues were investigated closer by site directed mutagenesis, whereas variants in four residues (D98, D117, H168 and D206 caused a reduction in enzymatic activity indicating a role in the activation of VDE while D86 mutants did not show any alteration. The analysis of the VDE sequence showed that the four putative activation residues are all conserved in plants but not in diatoms, explaining why VDE in these algae is already activated at higher pH. Molecular dynamics showed that the VDE structure was coherent at pH 7 with a low amount of water penetrating the hydrophobic barrel. Simulations carried out with the candidate residues locked into their protonated state showed instead an increased amount of water penetrating the barrel and the rupture of the H121-Y214 hydrogen bond at the end of the barrel, which is essential for VDE activation. These results suggest that VDE activation relies on a robust and redundant network, in which the four residues identified in this study play a major role.
Use of demolition residues construction in soil-lime bricks
International Nuclear Information System (INIS)
Figueiredo, S.S.; Silva, C.G.; Silva, I.A.; Neves, G.A.
2011-01-01
Besides being responsible for several environmental damage caused by its residues, the construction industry is also considered the greatest natural resources consumer. When finely ground, such residues can exhibit cementing properties, which may replace part of the lime used in the manufacture of soil-lime bricks. This study aimed to verify the viability of using demolition residues (DR) in soil-lime bricks without structural function. For this, test specimens were prepared using mixes in a 1:10 ratio of lime:soil and embedding residue in partial replacement of lime in the proportions of 25%, 50% and 75%. The test specimens were submitted to curing periods of 28 and 52 days, then it was determined the compression strength. The results showed that when embedded on moderate percentages, demolition residues construction can be used in the production of soil-lime bricks. (author)
Potential application of SERS for arsenic speciation in biological matrices.
Yang, Mingwei; Matulis, Shannon; Boise, Lawrence H; McGoron, Anthony J; Cai, Yong
2017-08-01
Speciation of arsenic is usually carried out using chromatography-based methods coupled with spectroscopic determination; however, the inevitable procedures involving sample preparation and separation could potentially alter the integrity of the arsenic metabolites present in biological samples. Surface-enhanced Raman spectroscopy (SERS) could be a promising alternative for providing a reliable arsenic analysis under the influence of a cellular matrix. A method for arsenic speciation using SERS in cellular matrix was developed in this study and four arsenicals were selected, including arsenite (As III ), arsenate (As V ), monomethylarsonic acid (MMA V ) and dimethylarsinic acid (DMA V ). Silver nanoparticles in the form of colliodal suspension with different surface charges, i.e., coated with citrate (AgNPs-Citrate) and spermine (AgNPs-Spermine) were employed as SERS substrates. Adsorption of arsenicals on nanoparticles in colloidal suspensions and the cellular matrix and the pH, size, and zeta potential of the colloidal suspensions were investigated for a better understanding of the SERS signal response of arsenicals in the colloidal suspensions or under the influence of cellular matrix. Arsenicals showed substantially different SERS responses in the two colloidal suspensions, mainly because of the distinct difference in the interaction between the arsenicals and the nanoparticles. Arsenic speciation in cell lysate could be successfully carried out in AgNPs-Spermine suspension, while AgNPs-Citrate could not yield significant SERS signals under the experimental conditions. This study proved that AgNPs-Spermine colloidal suspension could be a promising SERS substrate for studying arsenic metabolism in a biological matrix, reducing the bias caused by traditional techniques that involve sample extraction and pretreatment.
DEFF Research Database (Denmark)
Smeenk, G.; Wiegant, W.W.; Luijsterburg, M.S.
2013-01-01
Ionizing radiation (IR)-induced DNA double-strand breaks (DSBs) arising in native chromatin elicit an RNF8/RNF168-dependent ubiquitylation response, which triggers the recruitment of various repair factors. Precisely how this response is regulated in the context of chromatin remains largely...... unexplored. Here, we show that SMARCA5/SNF2H, the catalytic subunit of ISWI chromatin remodeling complexes, is recruited to DSBs in a poly(ADP-ribose) polymerase 1 (PARP1)-dependent manner. Remarkably, PARP activity, although dispensable for the efficient spreading of νH2AX into damaged chromatin......, selectively promotes spreading of SMARCA5, the E3 ubiquitin ligase RNF168, ubiquitin conjugates and the ubiquitin-binding factors RAD18 and the RAP80-BRCA1 complex throughout DSB-flanking chromatin. This suggests that PARP regulates the spatial organization of the RNF168-driven ubiquitin response to DNA...
Correlative SEM SERS for quantitative analysis of dimer nanoparticles.
Timmermans, F J; Lenferink, A T M; van Wolferen, H A G M; Otto, C
2016-11-14
A Raman microscope integrated with a scanning electron microscope was used to investigate plasmonic structures by correlative SEM-SERS analysis. The integrated Raman-SEM microscope combines high-resolution electron microscopy information with SERS signal enhancement from selected nanostructures with adsorbed Raman reporter molecules. Correlative analysis is performed for dimers of two gold nanospheres. Dimers were selected on the basis of SEM images from multi aggregate samples. The effect of the orientation of the dimer with respect to the polarization state of the laser light and the effect of the particle gap size on the Raman signal intensity is observed. Additionally, calculations are performed to simulate the electric near field enhancement. These simulations are based on the morphologies observed by electron microscopy. In this way the experiments are compared with the enhancement factor calculated with near field simulations and are subsequently used to quantify the SERS enhancement factor. Large differences between experimentally observed and calculated enhancement factors are regularly detected, a phenomenon caused by nanoscale differences between the real and 'simplified' simulated structures. Quantitative SERS experiments reveal the structure induced enhancement factor, ranging from ∼200 to ∼20 000, averaged over the full nanostructure surface. The results demonstrate correlative Raman-SEM microscopy for the quantitative analysis of plasmonic particles and structures, thus enabling a new analytical method in the field of SERS and plasmonics.
Directory of Open Access Journals (Sweden)
Mukesh Kumar Meena
2015-09-01
Full Text Available Calcium signaling plays an important role in adaptation and developmental processes in plants and animals. A class of calcium sensors, known as Calcineurin B-like (CBL proteins sense specific temporal changes in cytosolic Ca2+ concentration and regulate activities of a group of ser/thr protein kinases called CBL-interacting protein kinases (CIPKs. Although a number of CIPKs have been shown to play crucial roles in the regulation of stress signaling, no study on the function of CIPK25 or its orthologues has been reported so far. In the present study, an orthologue of Arabidopsis CIPK25 was cloned from chickpea (Cicer arietinum. CaCIPK25 gene expression in chickpea increased upon salt, dehydration, and different hormonal treatments. CaCIPK25 gene showed differential tissue-specific expression. 5'-upstream activation sequence (5'-UAS of the gene and its different truncated versions were fused to a reporter gene and studied in Arabidopsis to identify promoter regions directing its tissue-specific expression. Replacement of a conserved threonine residue with an aspartic acid at its catalytic site increased the kinase activity of CaCIPK25 by 2.5-fold. Transgenic tobacco plants overexpressing full-length and the high active versions of CaCIPK25 displayed a differential germination period and longer root length in comparison to the control plants. Expression of CaCIPK25 and its high active form differentially increased salt and water-deficit tolerance demonstrated by improved growth and reduced leaf chlorosis suggesting that the kinase activity of CaCIPK25 was required for these functions. Expressions of the abiotic stress marker genes were enhanced in the CaCIPK25-expressing tobacco plants. Our results suggested that CaCIPK25 functions in root development and abiotic stress tolerance.
Baisre, J. A.
2007-01-01
Se responde a las preguntas ¿por qué los mamíferos marinos son los animales más grandes del planeta?, ¿Por qué los peces no pueden ser más grandes?. Éstas y otras interrogantes son respondidas de forma sencilla y clara.
The ASN and nuclear facilities: towards a strengthening of safety margins
International Nuclear Information System (INIS)
Anon.
2012-01-01
The new measures taken by the French Nuclear Safety Authority (ASN) as a consequence of the complementary safety assessments performed recently on nuclear facilities are reviewed in this article. The main measures are the following. Concerning EDF: -) the setting of a hard core of measures in order to assure a few safety-vital functions in any case, for instance one of this measures is to bunker some of the emergency diesel sets; -) the setting of a rapid intervention force able to provide any damaged nuclear plant with extra means in cooling and power in a very short time; -) a better training of the staff in case of severe accident. Concerning AREVA: the setting of robust means to assure the water supply of the fuel pool at La Hague plant and the setting of efficient means to mitigate the consequences of a leak of ClF 3 , HF, UF 6 in the premises of Eurodif, Socatri, TU5, GB 2 and Comurhex. Concerning CEA: -) the removal of fissile materials from the Masurca facility, -) the setting up of improved means concerning flood and sodium fires at the Phenix reactor, -) the setting up of improved means concerning the loss of coolant at the Osiris reactor, -) the setting up of improved means in case of flood, earthquake and loss of coolant at the Jules Horowitz reactor. (A.C.)
International Nuclear Information System (INIS)
Pratt, M.L.; Hsu, P.Y.; DeMoss, J.A.
1986-01-01
Tryptophan synthase (TS), which catalyzes the final step of tryptophan biosynthesis, is a multifunctional protein requiring pyridoxal phosphate (B6P) for two of its three distinct enzyme activities. TS from Neurospora has a blocked N-terminal, is a homodimer of 150 KDa and binds one mole of B6P per mole of subunit. The authors shown the N-terminal residue to be acyl-serine. The B6P-active site of holoenzyme was labelled by reduction of the B6P-Schiff base with [ 3 H]-NaBH 4 , and resulted in a proportionate loss of activity in the two B6P-requiring reactions. SDS-polyacrylamide gel electrophoresis of CNBr-generated peptides showed the labelled, active site peptide to be 6 KDa. The sequence of this peptide, purified to apparent homogeneity by a combination of C-18 reversed phase and TSK gel filtration HPLC is: gly-arg-pro-gly-gln-leu-his-lys-ala-glu-arg-leu-thr-glu-tyr-ala-gly-gly-ala-gln-ile-xxx-leu-lys-arg-glu-asp-leu-asn-his-xxx-gly-xxx-his-/sub ***/-ile-asn-asn-ala-leu. Although four residues (xxx, /sub ***/) are unidentified, this peptide is minimally 78% homologous with the corresponding peptide from yeast TS, in which residue (/sub ***/) is the lysine that binds B6P
40 CFR 180.627 - Fluopicolide; tolerances for residues.
2010-07-01
... combined residues of fluopicolide and its metabolite, 2,6-dichlorobenzamide (BAM). Commodity Parts per... brassica, group 4 25 Vegetable, leaves of root and tuber, group 2 15.0 Vegetable, root, subgroup 1A, except...
Fabián Andrés Ospina López; Alejandra Rodríguez González; Juan Manuel González Guzmán
2017-01-01
El presente artículo presenta resultados de una revisión sobre el manejo y disposición final de lodos generados en las plantas de tratamiento de agua residual, los cuales deben ser sometidos a diferentes tratamientos para ser transformados en biosólidos y lograr determinar su uso sujeto a la clasificación que se presenta en Argentina, Chile y Colombia. Se realizó un análisis comparativo de los diferentes parámetros que se tienen en cuenta en los reglamentos de cada uno de estos países, eviden...
Directory of Open Access Journals (Sweden)
Marco Antonio Píccolo
2013-08-01
Full Text Available O objetivo deste trabalho foi avaliar a produtividade da forragem verde hidropônica de milho em diferentes substratos orgânicos e em água residuária de bovinos com diferentes concentrações de nitrogênio. O delineamento estatístico foi o de blocos casualizados, em esquema fatorial (4 x 5 + 4, com três repetições. As soluções nutritivas utilizadas foram: testemunha (solução nutritiva padrão para hidroponia de milho e água residuária de bovinos, com 0, 25, 50, 75 e 100% de nitrogênio, com volume de aplicação de 4 L m-2. Os substratos utilizados foram bagaço de cana-de-açúcar, casca de café, capim elefante cv napier e sem substrato. A densidade de semeio foi de 2,5 kg m-2 de sementes de milho pré-germinadas. A colheita foi realizada 15 dias após a instalação do experimento. Avaliou-se a produção de matéria seca da parte aérea, matéria seca da base (composta por raízes + sementes não germinadas + substrato orgânico e matéria seca da planta toda. A água residuária de bovinos pode ser utilizada em substituição à solução nutritiva padrão, não havendo necessidade de seu enriquecimento com nitrogênio. Houve efeito significativo dos substratos utilizados na produção de matéria seca da forragem, com destaque para os substratos capim napier e bagaço de cana, que promoveram incrementos na produção de matéria seca da parte aérea.
International Nuclear Information System (INIS)
2012-01-01
This document aims at specifying the modalities of application of a decision taken by the ASN in January 2008 regarding the technical rules which the elimination of effluents and wastes contaminated by radionuclides must comply with. First, it describes the objective of the 'waste zoning' concept. Then, it addresses the management of contaminated wastes: general rules, wastes contaminated by radionuclides of very short period (less than 100 days) and of period longer than 100 days, and the management of wastes with 'hybrid risks'. It addresses the management of contaminated effluents: radioactive liquid effluent with a period either shorter or longer than 100 days, radioactive gaseous effluents. It addresses the warehousing conditions (premise design, exploitation rules). The other parts deal with the convention between several establishments within a same site (notably in the case of nuclear medicine departments), with the management plan, and with the agenda for the implementation of the ASN decision
2.5-min Isostatic Gravity Grid for the United States
National Oceanic and Atmospheric Administration, Department of Commerce — The 2.5-min isostatic gravity data set was produced by regridding the 4-km residual isostatic gravity grid of the U.S. The isostatic residual gravity grid was...
Recognition specificity of individual EH domains of mammals and yeast
DEFF Research Database (Denmark)
Paoluzi, S; Castagnoli, L; Lauro, I
1998-01-01
by characterizing the peptide-binding preference of 11 different EH domains from mammal and yeast proteins. Ten of the eleven EH domains could bind at least some peptides containing an Asn-Pro-Phe (NPF) motif. By contrast, the first EH domain of End3p preferentially binds peptides containing an His-Thr/Ser-Phe (HT...
Sonochemically synthesized Ag nanoparticles as a SERS active substrate and effect of surfactant
Energy Technology Data Exchange (ETDEWEB)
Dar, Nitzan, E-mail: n58987012@mail.ncku.edu.tw [Department of Material Science and Engineering, National Cheng Kung University, Tainan 70101 Taiwan (China); Chen, Kuang-Yu [Department of Material Science and Engineering, National Cheng Kung University, Tainan 70101 Taiwan (China); Nien, Yung-Tang, E-mail: ytnien@nfu.edu.tw [Department of Materials Science and Engineering, National Formosa University, Huwei, Yunlin 63201, Taiwan (China); Perkas, Nina [Institute of nanotechnology and advanced materials, Department of Chemistry, Bar-Ilan University, Ramat-Gan 5290002 (Israel); Gedanken, Aharon, E-mail: Aharon.Gedanken@biu.ac.il [Institute of nanotechnology and advanced materials, Department of Chemistry, Bar-Ilan University, Ramat-Gan 5290002 (Israel); Chen, In-Gann, E-mail: ingann@mail.ncku.edu.tw [Department of Material Science and Engineering, National Cheng Kung University, Tainan 70101 Taiwan (China)
2015-03-15
Highlights: • Solid state Ag SERS active substrates were sonochemically synthesized. • High intensity SERS spectra of both crystal violet and rhodamine 6G were observed. • We discovered that PVP aided synthesized substrates showed higher SERS intensity. - Abstract: Surface enhanced Raman scattering (SERS) enables the detection of substances at low concentrations using silver or gold nanostructure. The SERS technique has many applications, such as environmental detection and biosensing. Sonochemistry is an excellent and cheap deposition technique for coating substrates in a form of nanostructure at ambient temperature. It can also be utilized to prepare large SERS substrates. Here, we used the advantages of sonochemistry to deposit solid SERS substrates immobilized on GaN nanostructure. Morphology was studied by scanning electron microscopy. The elemental composition and the spatial distribution were examined by energy dispersive X-ray spectroscopy. The crystal structure and atomic presence was confirmed by X-ray diffraction. SERS substrates were examined with the analytes crystal violet (10{sup −5} M) and rhodamine 6G (10{sup −6} M), they showed prominent characteristic peaks. We discovered that the SERS intensity of poly-vinyl-pyrrolidinone aided sonochemical deposition of Ag nanoparticles was increased. The reason for the effect is morphological changes of the Ag nanoparticles. Smaller nanoparticles were fabricated, which increase their SERS intensity.
Residual nilpotence and residual solubility of groups
International Nuclear Information System (INIS)
Mikhailov, R V
2005-01-01
The properties of the residual nilpotence and the residual solubility of groups are studied. The main objects under investigation are the class of residually nilpotent groups such that each central extension of these groups is also residually nilpotent and the class of residually soluble groups such that each Abelian extension of these groups is residually soluble. Various examples of groups not belonging to these classes are constructed by homological methods and methods of the theory of modules over group rings. Several applications of the theory under consideration are presented and problems concerning the residual nilpotence of one-relator groups are considered.
Designing multilayered nanoplatforms for SERS-based detection of genetically modified organisms
Uluok, Saadet; Guven, Burcu; Eksi, Haslet; Ustundag, Zafer; Tamer, Ugur; Boyaci, Ismail Hakki
2015-01-01
In this study, the multilayered surface-enhanced Raman spectroscopy (SERS) platforms were developed for the analysis of genetically modified organisms (GMOs). For this purpose, two molecules [11-mercaptoundecanoic acid (11-MUA) and 2-mercaptoethylamine (2-MEA)] were attached with Aurod and Auspherical nanoparticles to form multilayered constructions on the gold (Au)slide surface. The best multilayered platform structure was chosen depending on SERS enhancement, and this surface was characterised with atomic force microscopy (AFM) and attenuated total reflectance Fourier transform infrared spectroscopy. After the optimum multilayered SERS platform and nanoparticle interaction was identified, the oligonucleotides on the Aurod nanoparticles and Auslide were combined to determine target concentrations from the 5,5'-dithiobis (2-nitrobenzoic acid) (DTNB) signals using SERS. The correlation between the SERS intensities for DTNB and target concentrations was found to be linear within a range of 10 pM to 1 µM, and with a detection limit of 34 fM. The selectivity and specificity of the developed sandwich assay were tested using negative and positive controls, and nonsense and real sample studies. The obtained results showed that the multilayered SERS sandwich method allows for sensitive, selective, and specific detection of oligonucleotide sequences.
Mor, A; Chartrel, N; Vaudry, H; Nicolas, P
1994-10-25
Pancreatic polypeptide, peptide tyrosine-tyrosine (PYY), and neuropeptide tyrosine (NPY), three members of a family of structurally related peptides, are mainly expressed in the endocrine pancreas, in endocrine cells of the gut, and in the brain, respectively. In the present study, we have isolated a peptide of the pancreatic polypeptide family from the skin of the South American arboreal frog Phyllomedusa bicolor. The primary structure of the peptide was established as Tyr-Pro-Pro-Lys-Pro-Glu-Ser-Pro-Gly-Glu10-Asp-Ala-Ser-Pro-Glu-Glu- Met-Asn- Lys-Tyr20-Leu-Thr-Ala-Leu-Arg-His-Tyr-Ile-Asn-Leu30-Val-Thr- Arg-Gln-Arg-Tyr-NH2 . This unusual peptide, named skin peptide tyrosine-tyrosine (SPYY), exhibits 94% similarity with PYY from the frog Rana ridibunda. A synthetic replicate of SPYY inhibits melanotropin release from perifused frog neurointermediate lobes in very much the same way as NPY. These results demonstrate the occurrence of a PYY-like peptide in frog skin. Our data also suggest the existence of a pituitary-skin regulatory loop in amphibians.
SERS-based pesticide detection by using nanofinger sensors
Kim, Ansoon; Barcelo, Steven J.; Li, Zhiyong
2015-01-01
Simple, sensitive, and rapid detection of trace levels of extensively used and highly toxic pesticides are in urgent demand for public health. Surface-enhanced Raman scattering (SERS)-based sensor was designed to achieve ultrasensitive and simple pesticide sensing. We developed a portable sensor system composed of high performance and reliable gold nanofinger sensor strips and a custom-built portable Raman spectrometer. Compared to the general procedure and previously reported studies that are limited to laboratory settings, our analytical method is simple, sensitive, rapid, and cost-effective. Based on the SERS results, the chemical interaction of two pesticides, chlorpyrifos (CPF) and thiabendazole (TBZ), with gold nanofingers was studied to determine a fingerprint for each pesticide. The portable SERS-sensor system was successfully demonstrated to detect CPF and TBZ pesticides within 15 min with a detection limit of 35 ppt in drinking water and 7 ppb on apple skin, respectively.
Measurement on K-electron capture probabilities in the decay of [sup 183]Re and [sup 168]Tm
Energy Technology Data Exchange (ETDEWEB)
Prasad, N.V.S.V.; Rao, M.V.S.C.; Reddy, S.B.; Satyanarayana, G.; Sastry, D.L. (Andhra Univ., Visakhapatnam (India). Swami Jnanananda Labs. for Nuclear Research); Murty, G.S.K. (UNDNJ, Newark, NJ (United States). Dept. of Radiology); Chintalapudi, S.N. (Inter University Consortium for DAE Facilities, Calcutta (India))
1994-03-01
The K-electron capture probabilities for the 5/2[sup +] to 3/2[sup -]transition in the electron capture decay of [sup 183]Re to the 208.805 keV level in the daughter [sup 183]W and for the 3[sup (+)] to 3[sup -]and 3[sup (+)] to 4[sup -] transitions in the electron capture decay of [sup 168]Tm to the 1541.4 keV and 1093.0 keV levels, respectively, in the daughter [sup 168]Er were measured for the first time using an x-[gamma] summing method. The experimental P[sub K] values are reported in this paper, together with those due to theory, and discussed. (Author).
International Nuclear Information System (INIS)
2010-01-01
This document gathers Power Point presentations made during a meeting on the transport of radioactive materials. The contributions addressed the following topics: results of a survey based on questionnaires sent to actors of this sector, regulatory framework and radioprotection plan, case of parcels not submitted to the authority concerned, declaration of transport interesting or significant events, ASN inspections, the transport of radioactive products by the IBt Bebig company in France, the activities of the Institut de Soudure Industrie (industry welding institute), the activities of the ISO Life company specialized in health product transportation, the activities of the Securidis company (a consulting company for activities related to hazardous materials transportation, and notably radioactive materials), the activities a the ACE Environnement company (specialized in building diagnosis), the point of view of an academic research unit on radioactive material transportation, the experience of the hospital sector in radioactive source transportation, the experience of the Advanced Accelerator Applications company in radioactive material transportation, and a discussion on regulation application
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Advertising of unregistered pesticides... ENFORCEMENT POLICIES AND INTERPRETATIONS Advertising § 168.22 Advertising of unregistered pesticides.... EPA interprets these provisions as extending to advertisements in any advertising medium to which...
PKCδ-mediated IRS-1 Ser24 phosphorylation negatively regulates IRS-1 function
International Nuclear Information System (INIS)
Greene, Michael W.; Ruhoff, Mary S.; Roth, Richard A.; Kim, Jeong-a; Quon, Michael J.; Krause, Jean A.
2006-01-01
The IRS-1 PH and PTB domains are essential for insulin-stimulated IRS-1 Tyr phosphorylation and insulin signaling, while Ser/Thr phosphorylation of IRS-1 disrupts these signaling events. To investigate consensus PKC phosphorylation sites in the PH-PTB domains of human IRS-1, we changed Ser24, Ser58, and Thr191 to Ala (3A) or Glu (3E), to block or mimic phosphorylation, respectively. The 3A mutant abrogated the inhibitory effect of PKCδ on insulin-stimulated IRS-1 Tyr phosphorylation, while reductions in insulin-stimulated IRS-1 Tyr phosphorylation, cellular proliferation, and Akt activation were observed with the 3E mutant. When single Glu mutants were tested, the Ser24 to Glu mutant had the greatest inhibitory effect on insulin-stimulated IRS-1 Tyr phosphorylation. PKCδ-mediated IRS-1 Ser24 phosphorylation was confirmed in cells with PKCδ catalytic domain mutants and by an RNAi method. Mechanistic studies revealed that IRS-1 with Ala and Glu point mutations at Ser24 impaired phosphatidylinositol-4,5-bisphosphate binding. In summary, our data are consistent with the hypothesis that Ser24 is a negative regulatory phosphorylation site in IRS-1
Laser in medicine Láser en medicina
Directory of Open Access Journals (Sweden)
Juan C. Cárdenas
1993-03-01
Full Text Available The fundamentals of laser functioning and a brief historic description on the subject are presented; laser Is classified according to emission potency, materials with which it is built and pulsation. Different mechanisms of action of laser as well as Its indications and contraindications are discussed. Emphasis is given to low-power laser. Local and foreign experiences with Its medlcal use are briefly described Se revisan los principios fundamentales del funcionamiento del láser, se hace una breve revisión histórica del mismo y se lo clasifica de acuerdo con la potencia de emisión, los materiales de fabricación y la pulsación. Se enumeran los diferentes mecanismos de acción del láser y sus indicaciones y contraindicaciones haciendo énfasis en lo concerniente al láser de baja potencia, tanto pulsado como no pulsado; se alude a las experiencias nacionales y de otros países.
Effect of the size of silver nanoparticles on SERS signal enhancement
He, Rui Xiu; Liang, Robert; Peng, Peng; Norman Zhou, Y.
2017-08-01
The localized surface plasmon resonance arising from plasmonic materials is beneficial in solution-based and thin-film sensing applications, which increase the sensitivity of the analyte being tested. Silver nanoparticles from 35 to 65 nm in diameter were synthesized using a low-temperature method and deposited in a monolayer on a (3-aminopropyl)triethoxysilane (APTES)-functionalized glass slide. The effect of particle size on monolayer structure, optical behavior, and surface-enhanced Raman scattering (SERS) is studied. While increasing particle size decreases particle coverage, it also changes the localized surface plasmon resonance and thus the SERS activity of individual nanoparticles. Using a laser excitation wavelength of 633 nm, the stronger localized surface plasmon resonance coupling to this excitation wavelength at larger particle sizes trumps the loss in surface coverage, and greater SERS signals are observed. The SERS signal enhancement accounts for the higher SERS signal, which was verified using a finite element model of a silver nanoparticle dimer with various nanoparticle sizes and separation distances.
Non-radioactive verification test of ZRF25 radioactive combustible solid waste incinerator
International Nuclear Information System (INIS)
Wang Peiyi; Li Xiaohai; Yang Liguo
2013-01-01
This paper mainly introduces the construction and test run of ZRF25 radioactive combustible solid waste incinerator, by a series of simulating waste tests, such as 24 h test, 72 h test, 168 h test, making a conclusion that the incinerator runs reliably. In addition, all of the indexes (such as treatment capacity, volume reduction coefficient, clinker ignition loss of incineration ash) meet the requirements of contract and pollution discharging standards. (authors)
Thermodynamic effects of replacements of Pro residues in helix interiors of maltose-binding protein.
Prajapati, R S; Lingaraju, G M; Bacchawat, Kiran; Surolia, Avadhesha; Varadarajan, Raghavan
2003-12-01
Introduction of Pro residues into helix interiors results in protein destabilization. It is currently unclear if the converse substitution (i.e., replacement of Pro residues that naturally occur in helix interiors would be stabilizing). Maltose-binding protein is a large 370-amino acid protein that contains 21 Pro residues. Of these, three nonconserved residues (P48, P133, and P159) occur at helix interiors. Each of the residues was replaced with Ala and Ser. Stabilities were characterized by differential scanning calorimetry (DSC) as a function of pH and by isothermal urea denaturation studies as a function of temperature. The P48S and P48A mutants were found to be marginally more stable than the wild-type protein. In the pH range of 5-9, there is an average increase in T(m) values of P48A and P48S of 0.4 degrees C and 0.2 degrees C, respectively, relative to the wild-type protein. The other mutants are less stable than the wild type. Analysis of the effects of such Pro substitutions in MBP and in three other proteins studied to date suggests that substitutions are more likely to be stabilizing if the carbonyl group i-3 or i-4 to the mutation site is not hydrogen bonded in the wild-type protein. Copyright 2003 Wiley-Liss, Inc.
Amino acids analysis during lactic acid fermentation by single strain ...
African Journals Online (AJOL)
L. salivarius alone showed relatively good assimilation of various amino acids that existed at only a little amounts in MRS media (Asn, Asp, Cit, Cys, Glu, His, Lys, Orn, Phe, Pro, Tyr, Arg, Ile, Leu, Met, Ser, Thr, Trp and Val), whereas Ala and Gly accumulated in L. salivarius cultures. P. acidilactici, in contrast, hydrolyzed the ...
Secondhand smoke exposure among never-smoking youth in 168 countries.
Veeranki, Sreenivas P; Mamudu, Hadii M; Zheng, Shimin; John, Rijo M; Cao, Yan; Kioko, David; Anderson, James; Ouma, Ahmed E O
2015-02-01
To estimate the prevalence of secondhand smoke (SHS) exposure among never-smoking adolescents and identify key factors associated with such exposure. Data were obtained from nationally representative Global Youth Tobacco Surveys conducted in 168 countries during 1999-2008. SHS exposure was ascertained in relation to the location-exposure inside home, outside home, and both inside and outside home, respectively. Independent variables included parental and/or peer smoking, knowledge about smoke harm, attitudes toward smoking ban, age, sex, and World Health Organization region. Simple and multiple logistic regression analyses were conducted. Of 356,414 never-smoking adolescents included in the study, 30.4%, 44.2%, and 23.2% were exposed to SHS inside home, outside home, and both, respectively. Parental smoking, peer smoking, knowledge about smoke harm, and positive attitudes toward smoke ban were significantly associated with increased odds of SHS exposure. Approximately 14% of adolescents had both smoking parents and peers. Compared with never-smoking adolescents who did not have both smoking parents and peers, those who had both smoking parents and peers had 19 (adjusted odds ratio [aOR], 19.0; 95% confidence interval [CI], 16.86-21.41), eight (aOR, 7.71; 95% CI, 7.05-8.43), and 23 times (aOR, 23.16; 95% CI, 20.74-25.87) higher odds of exposure to SHS inside, outside, and both inside and outcome home, respectively. Approximately one third and two fifths of never-smoking adolescents were exposed to SHS inside or outside home, and smoking parents and/or peers are the key factors. Study findings highlight the need to develop and implement comprehensive smoke-free policies consistent with the World Health Organization Framework Convention on Tobacco Control. Copyright © 2015 Society for Adolescent Health and Medicine. Published by Elsevier Inc. All rights reserved.
Costa, Sara R; Marek, Magdalena; Axelsen, Kristian B; Theorin, Lisa; Pomorski, Thomas G; López-Marqués, Rosa L
2016-06-01
P-type ATPases of subfamily IV (P4-ATPases) constitute a major group of phospholipid flippases that form heteromeric complexes with members of the Cdc50 (cell division control 50) protein family. Some P4-ATPases interact specifically with only one β-subunit isoform, whereas others are promiscuous and can interact with several isoforms. In the present study, we used a site-directed mutagenesis approach to assess the role of post-translational modifications at the plant ALIS5 β-subunit ectodomain in the functionality of the promiscuous plant P4-ATPase ALA2. We identified two N-glycosylated residues, Asn(181) and Asn(231) Whereas mutation of Asn(231) seems to have a small effect on P4-ATPase complex formation, mutation of evolutionarily conserved Asn(181) disrupts interaction between the two subunits. Of the four cysteine residues located in the ALIS5 ectodomain, mutation of Cys(86) and Cys(107) compromises complex association, but the mutant β-subunits still promote complex trafficking and activity to some extent. In contrast, disruption of a conserved disulfide bond between Cys(158) and Cys(172) has no effect on the P4-ATPase complex. Our results demonstrate that post-translational modifications in the β-subunit have different functional roles in different organisms, which may be related to the promiscuity of the P4-ATPase. © 2016 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.
Tan, Joel Ming Rui; Ruan, Justina Jiexin; Lee, Hiang Kwee; Phang, In Yee; Ling, Xing Yi
2014-12-28
An analytical platform with an ultratrace detection limit in the atto-molar (aM) concentration range is vital for forensic, industrial and environmental sectors that handle scarce/highly toxic samples. Superhydrophobic surface-enhanced Raman scattering (SERS) platforms serve as ideal platforms to enhance detection sensitivity by reducing the random spreading of aqueous solution. However, the fabrication of superhydrophobic SERS platforms is generally limited due to the use of sophisticated and expensive protocols and/or suffers structural and signal inconsistency. Herein, we demonstrate a high-throughput fabrication of a stable and uniform superhydrophobic SERS platform for ultratrace molecular sensing. Large-area box-like micropatterns of the polymeric surface are first fabricated using capillary force lithography (CFL). Subsequently, plasmonic properties are incorporated into the patterned surfaces by decorating with Ag nanocubes using the Langmuir-Schaefer technique. To create a stable superhydrophobic SERS platform, an additional 25 nm Ag film is coated over the Ag nanocube-decorated patterned template followed by chemical functionalization with perfluorodecanethiol. Our resulting superhydrophobic SERS platform demonstrates excellent water-repellency with a static contact angle of 165° ± 9° and a consequent analyte concentration factor of 59-fold, as compared to its hydrophilic counterpart. By combining the analyte concentration effect of superhydrophobic surfaces with the intense electromagnetic "hot spots" of Ag nanocubes, our superhydrophobic SERS platform achieves an ultra-low detection limit of 10(-17) M (10 aM) for rhodamine 6G using just 4 μL of analyte solutions, corresponding to an analytical SERS enhancement factor of 10(13). Our fabrication protocol demonstrates a simple, cost- and time-effective approach for the large-scale fabrication of a superhydrophobic SERS platform for ultratrace molecular detection.
Directory of Open Access Journals (Sweden)
Pfeufer Arne
2009-08-01
Full Text Available Abstract Background KCNE1 represents the regulatory beta-subunit of the slowly activating delayed rectifier potassium channel (IKs. Variants of KCNE1 have repeatedly been linked to the long-QT syndrome (LQTS, a disorder which predisposes to deafness, ventricular tachyarrhythmia, syncope, and sudden cardiac death. Results We here analyze the evolution of the common Gly38Ser variant (rs1805127, using genomic DNAs, complementary DNAs, and HEK293-expressed variants of altogether 19 mammalian species. The between species comparison reveals that the human-specific Gly38Ser polymorphism evolved under strong positive Darwinian selection, probably in adaptation to specific challenges in the fine-tuning of IKs channels. The involved amino acid exchanges (Asp > Gly, Gly > Ser are moderately radical and do not induce apparent changes in posttranslational modification. According to population genetic analyses (HapMap phase II a heterozygote advantage accounts for the maintenance of the Gly38Ser polymorphism in humans. On the other hand, the expression of the 38Ser allele seems to be disadvantageous under certain conditions, as suggested by the sporadic deficiency of 38Ser-coding mRNAs in heterozygote Central Europeans and the depletion of homozygotes 38Ser in the Yoruban sample. Conclusion We speculate that individual differences in genomic imprinting or genomic recoding might have contributed to conflicting results of recent association studies between Gly38Ser polymorphism and QT phenotype. The findings thus highlight the relevance of mRNA data in future association studies of genotypes and clinical disorders. To the best of our knowledge, they moreover provide first time evidence for a unique pattern; i.e. coincidence of positive Darwinian selection and polymorphism with a sporadically suppressed expression of one allele.
Habka, S; Sohn, W Y; Vaquero-Vara, V; Géléoc, M; Tardivel, B; Brenner, V; Gloaguen, E; Mons, M
2018-01-31
Asparagine (Asn) is a powerful turn-inducer residue, with a large propensity to occupy the second position in the central region of β-turns of proteins. The present work aims at investigating the role of a local anchoring between the Asn side chain and the main chain in this remarkable property. For this purpose, the H-bonding patterns of an asparagine residue in an isolated protein chain fragment forming a γ- or a β-turn have been determined using IR/UV double resonance gas phase spectroscopy on laser-desorbed, jet-cooled short models in conjunction with relevant quantum chemistry calculations. These gas phase data provide evidence for an original double anchoring linking the Asn primary amide side chain (SC), which adopts a gauche+ rotameric form, to its main chain (MC) local environment. From both IR spectroscopic evidence (H-bond induced red shifts) and quantum chemistry, Asn SC is found to behave as a stronger H-bond acceptor than donor, resulting in stronger MC→SC H-bonds than SC→MC ones. These gas phase structural data, relevant to a hydrophobic environment, have been used as a reference to assess the anchoring taking place in high resolution crystallized proteins of the Protein Data Bank. This approach reveals that, when the SC adopts a gauche+ orientation, the stronger MC→SC bonds are preserved in many cases whereas the SC→MC bonds are always disrupted, in qualitative agreement with the gas phase ranking of these interactions. Most interestingly, when Asn occupies the second position of central part of a β-turn (i.e., the very turn-inducer position), the MC→SC H-bonds are also disrupted and replaced by a water-mediated SC to MC anchoring. Owing to the specific features of the hydrated Asn side chain, we propose that it could be a turn precursor structure, able to facilitate turn formation in the early events of the folding process.
Lifetime measurement in {sup 168}Yb using the recoil distance Doppler shift (RDDS) method
Energy Technology Data Exchange (ETDEWEB)
Reese, Michael; Moeller, Oliver; Pietralla, Norbert [TU Darmstadt (Germany); Dewald, Alfred; Pissulla, Thomas [Universitaet Koeln (Germany); Petkov, Pavel [Universitaet Koeln (Germany); INRNE, Bulgarian Academy of Sciences, Sofia (Bulgaria)
2009-07-01
In the analysis of coincidence RDDS experiments one uses the Differential Decay Curve (DDC) Method to determine lifetimes of excited states. Experiments with small recoil velocities, thus small Doppler shifts, enforce the use of narrow coincidence gates to determine peak intensities. This results in a loss of statistics. As an alternative to the application of gates, we present the fit of 2-dimensional functions to the {gamma}{gamma} coincidence data. This approach has been studied on data taken in a RDDS measurement for the ground state band of {sup 168}Yb. The {sup 18}O({sup 154}Sm,4n){sup 168}Yb{sup *} fusion evaporation reaction was induced by an 80 MeV ion beam of the tandem accelerator facility in Cologne. The target was mounted in the Cologne coincidence plunger device. Lifetimes from the 4{sub 1}{sup +} to the 10{sub 1}{sup +} states have been extracted. The method is discussed and the results are compared to the CBS rotor model in the context of centrifugal stretching.
Directory of Open Access Journals (Sweden)
Leonardo Romero
2011-05-01
Full Text Available Después de varios años de ser editor, muchos de mis jefes confunden la revista con el editor, y es común oír cosas como “conferencia a cargo de la revista” o en conversaciones se dirijan a mí para decir “y porque no te citan”, refiriéndose al motivo porqué la Rev peru biol. no es citada por otros trabajos. Aprovechando ese desquicio, en los siguientes párrafos encarnare a la revista y al editor, en la fusión mágica en la que algunos de mis jefes me imaginan.
Fugitive emission rates assessment of PM2.5 and PM10 from open storage piles in China
Cao, Yiqi; Liu, Tao; He, Jiao
2018-03-01
An assessment of the fugitive emission rates of PM2.5 and PM10 from an open static coal and mine storage piles. The experiment was conducted at a large union steel enterprises in the East China region to effectively control the fugitive particulate emissions pollution on daily work and extreme weather conditions. Wind tunnel experiments conducted on the surface of static storage piles, and it generated specific fugitive emission rates (SERs) at ground level of between ca.10-1 and ca.102 (mg/m2·s) for PM2.5 and between ca.101 and ca.103 (mg/m2·s) for PM10 under the u*(wind velocity) between ca.3.0 (m/s) and 10.0 (m/s). Research results show that SERs of different materials differ a lot. Material particulate that has lower surface moisture content generate higher SER and coal material generate higher SER than mine material. For material storage piles with good water infiltrating properties, aspersion is a very effective measure for control fugitive particulate emission.
Wang, Xiaojuan; Butterly, Clayton R; Baldock, Jeff A; Tang, Caixian
2017-06-01
Residues differing in quality and carbon (C) chemistry are presumed to contribute differently to soil pH change and long-term soil organic carbon (SOC) pools. This study examined the liming effect of different crop residues (canola, chickpea and wheat) down the soil profile (0-30cm) in two sandy soils differing in initial pH as well as the long-term stability of SOC at the amended layer (0-10cm) using mid-infrared (MIR) and solid-state 13 C nuclear magnetic resonance (NMR) spectroscopy. A field column experiment was conducted for 48months. Chickpea- and canola-residue amendments increased soil pH at 0-10cm in the Podzol by up to 0.47 and 0.36units, and in the Cambisol by 0.31 and 0.18units, respectively, at 48months when compared with the non-residue-amended control. The decomposition of crop residues was greatly retarded in the Podzol with lower initial soil pH during the first 9months. The MIR-predicted particulate organic C (POC) acted as the major C sink for residue-derived C in the Podzol. In contrast, depletion of POC and recovery of residue C in MIR-predicted humic organic C (HOC) were detected in the Cambisol within 3months. Residue types showed little impact on total SOC and its chemical composition in the Cambisol at 48months, in contrast to the Podzol. The final HOC and resistant organic C (ROC) pools in the Podzol amended with canola and chickpea residues were about 25% lower than the control. This apparent priming effect might be related to the greater liming effect of these two residues in the Podzol. Copyright © 2017 Elsevier B.V. All rights reserved.
A High Affinity Adenosine Kinase from Anopheles gambiae
Cassera, María B.; Ho, Meng-Chiao; Merino, Emilio F.; Burgos, Emmanuel S.; Rinaldo-Matthis, Agnes; Almo, Steven C.; Schramm, Vern L.
2011-01-01
Genome analysis revealed a mosquito orthologue of adenosine kinase in Anopheles gambiae (AgAK; the most important vector for the transmission of Plasmodium falciparum in Africa). P. falciparum are purine auxotrophs and do not express an adenosine kinase but rely on their hosts for purines. AgAK was kinetically characterized and found to have the highest affinity for adenosine (Km 8.1 nM) of any known adenosine kinase. AgAK is specific for adenosine at the nucleoside site but several nucleotide triphosphate phosphoryl donors are tolerated. The AgAK crystal structure with a bound bisubstrate analogue Ap4A (2.0 Å resolution) reveals interactions for adenosine, ATP and the geometry for phosphoryl transfer. The polyphosphate charge is partly neutralized by a bound Mg2+ ion and an ion pair to a catalytic site Arg. The AgAK structure consists of a large catalytic core in a three-layered α/β/α sandwich, and a small cap domain in contact with adenosine. The specificity and tight-binding for adenosine arises from hydrogen bond interactions of Asn14, Leu16, Leu40, Leu133, Leu168, Phe168 and Thr171 and the backbone of Ile39 and Phe168 with the adenine ring as well as through hydrogen bond interactions between Asp18, Gly64 and Asn68 and the ribosyl 2′- and 3′-hydroxyl groups. The structure is more similar to human adenosine kinase (48% identity) than to AK from Toxoplasma gondii (31% identity). With this extraordinary affinity for AgAK, adenosine is efficiently captured and converted to AMP at near the diffusion limit, suggesting an important role of this enzyme to maintain the adenine nucleotide pool. mRNA analysis verifies that AgAK transcripts are produced in the adult insects. PMID:21247194
2010-07-01
... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Pseudomonas fluorescens strain PRA-25... RESIDUES IN FOOD Exemptions From Tolerances § 180.1200 Pseudomonas fluorescens strain PRA-25; temporary... established for residues of the microbial pesticide, pseudomonas fluorescens strain PRA-25 when used on peas...
Liquefied Residue of Kenaf Core Wood Produced at Different Phenol-Kenaf Ratio
International Nuclear Information System (INIS)
Saiful Bahari Bakarudin; Sarani Zakaria; Chia, C.H.; Jani, S.M.
2012-01-01
Liquefactions of kenaf core wood were carried out at different phenol-kenaf (P/ k) ratios. Characterizations of kenaf core wood liquefied residue were carried out to measure the degree of liquefaction. This provides a new approach to understand some fundamental aspects of the liquefaction reaction. Functional groups on the raw kenaf core wood and liquefied residue were examined using Fourier transform infrared spectroscopy (FTIR). The crystallinity index of the kenaf wood liquefied residue, which represents crystallinity changes of the cellulose component after the liquefaction process, was studied using X-ray diffraction (XRD). The surface morphology of the wood residue was observed using scanning electron microscopy (SEM). The thermal behavior of the residues was analyzed using thermogravimetric analysis (TGA). Abroad peak around 3450-3400 cm -1 representing OH stretching in lignin start to disappear as P/K ratio increases. The results showed that the higher the P/K ratio the greater the liquefaction of the lignin component in the kenaf core wood. The crystallinity index (CrI) on the kenaf liquefied residues increased with the increase in P/K ratio. SEM images showed that the small fragments attached on the liquefied kenaf residue surface were gradually removed as the P/K ratio was increased from 1.5/ 1.0 to 2.5/ 1.0, which is mainly attributed to the greater chemical penetration toward reactive site of the kenaf fibres. Residue content decreased as the P/K ratio increased from 1.5/ 1.0 to 2.5/ 1.0. TGA results showed the increase of heat resistance in the residue as the P/K ratio was increased. (author)
Directory of Open Access Journals (Sweden)
Marina Sulastiana
2017-06-01
Full Text Available State Civil Servants Apparatus (ASN have to be more integrity, professional, neutral and capable to carrying out a public service to the community. It was an important one that can be optimized through development of human capital. Based on previous research investigated role of Human Capital towards Services and performance of Public Service, shows that staff and head divison level only has moderate degree of human capital. While, Emotional Capital was a most dominan aspect in Human Capital. Otherwise, Social Capital aspects results in the low level. It comes with consequences to optimized them through psychological intervention with group Employee Coaching and Counseling Program (ECCP. This study was action research, experimental one group preteset and postest design. The result shows that ECCP was contribute effectively to enhance Human Capital, particularly in Emotional Capital optimization.
Chemically Roughened Solid Silver: A Simple, Robust and Broadband SERS Substrate
Directory of Open Access Journals (Sweden)
Shavini Wijesuriya
2016-10-01
Full Text Available Surface-enhanced Raman spectroscopy (SERS substrates manufactured using complex nano-patterning techniques have become the norm. However, their cost of manufacture makes them unaffordable to incorporate into most biosensors. The technique shown in this paper is low-cost, reliable and highly sensitive. Chemical etching of solid Ag metal was used to produce simple, yet robust SERS substrates with broadband characteristics. Etching with ammonium hydroxide (NH4OH and nitric acid (HNO3 helped obtain roughened Ag SERS substrates. Scanning electron microscopy (SEM and interferometry were used to visualize and quantify surface roughness. Flattened Ag wires had inherent, but non-uniform roughness having peaks and valleys in the microscale. NH4OH treatment removed dirt and smoothened the surface, while HNO3 treatment produced a flake-like morphology with visibly more surface roughness features on Ag metal. SERS efficacy was tested using 4-methylbenzenethiol (MBT. The best SERS enhancement for 1 mM MBT was observed for Ag metal etched for 30 s in NH4OH followed by 10 s in HNO3. Further, MBT could be quantified with detection limits of 1 pM and 100 µM, respectively, using 514 nm and 1064 nm Raman spectrometers. Thus, a rapid and less energy intensive method for producing solid Ag SERS substrate and its efficacy in analyte sensing was demonstrated.
Surface-enhanced Raman scattering (SERS) for detection of phenylketonuria for newborn screening
Javanmard, M.; Davis, R. W.
2014-02-01
Diagnosis of Phenylketonuria (PKU) in newborns is important because it can potentially help prevent mental retardation since it is treatable by dietary means. PKU results in phenylketonurics having phenylalanine levels as high as 2 mM whereas the normal upper limit in healthy newborns is 120 uM. To this end, we are developing a microfluidic platform integrated with a SERS substrate for detection of high levels of phenylalanine. We have successfully demonstrated SERS detection of phenylalanine using various SERS substrates fabricated using nanosphere lithography, which exhibit high levels of field enhancement. We show detection of SERS at clinically relevant levels.
Malik, Ruchi; Bunkar, Devendra; Choudhary, Bhanwar Singh; Srivastava, Shubham; Mehta, Pakhuri; Sharma, Manish
2016-10-01
Human semen is principal vehicle for transmission of HIV-1 and other enveloped viruses. Several endogenous peptides present in semen, including a 39-amino acid fragments of prostatic acid phosphatase (PAP248-286) assemble into amyloid fibrils named as semen-derived enhancer of viral infection (SEVI) that promote virion attachment to target cells which dramatically enhance HIV virus infection by up to 105-fold. Epigallocatechin-3-gallate (EGCG), a polyphenolic compound, is the major catechin found in green tea which disaggregates existing SEVI fibers, and inhibits the formation of SEVI fibers. The aim of this study was to screen a number of relevant polyphenols to develop a rational approach for designing PAP248-286 aggregation inhibitors as potential anti-HIV agents. The molecular docking based virtual screening results showed that polyphenolic compounds 2-6 possessed good docking score and interacted well with the active site residues of PAP248-286. Amino acid residues of binding site namely; Lys255, Ser256, Leu258 and Asn265 are involved in binding of these compounds. In silico ADMET prediction studies on these hits were also found to be promising. Polyphenolic compounds 2-6 identified as hits may act as novel leads for inhibiting aggregation of PAP248-286 into SEVI.
International Nuclear Information System (INIS)
Pan, Yingcheng; Zhu, Jinglu; Wang, Xuan; Zhang, Han; Kang, Yan; Wu, Ting; Du, Yiping; Guo, Xiaoyu
2015-01-01
We have developed a simple, sensitive and practical substrate for surface enhanced Raman scattering (SERS). It consists of a column material that is obtained by modifying the surface of (glycidyl methacrylate)-co-(ethylene dimethacrylate) capillary monoliths with silver nanoparticles. This new SERS column substrate was applied to the determination of 4-mercaptopyridine (4-Mpy) and Rhodamine 6G (R6G) to give detection limits as low as 100 and 10 pM, respectively. The calculated enhancement factor is approximately 1.2 × 10 8 . This represents a substantial improvement over conventional colloidal substrates. The new substrate was applied to the determination of residues of the pesticide phosmet and gave a detection limit of 3 μg∙L −1 , with a linear response in the 3 to 1000 μg∙L −1 concentration range (R 2 = 0.995). Additionally, 0.2 mg∙kg −1 of phosmet on apples and oranges, and of 0.5 mg∙kg −1 on tea leaves were detectable via SERS using this column along with a simple extraction process. The above LODs are well below the tolerance level prescribed by National Standard of China. Thus, this simple method is highly efficient, sensitive, and affordable and introduces a SERS–based trace detection suitable for real-world applications, especially for the determination of pesticides. (author)