WorldWideScience

Sample records for reporter gene methods

  1. A BAC-bacterial recombination method to generate physically linked multiple gene reporter DNA constructs

    Directory of Open Access Journals (Sweden)

    Gong Shiaochin

    2009-03-01

    Full Text Available Abstract Background Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. Results We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1 subclone genes of interest into BAC linking vectors, (2 insert desired reporter genes into respective genes and (3 link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. Conclusion The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.

  2. A BAC-bacterial recombination method to generate physically linked multiple gene reporter DNA constructs.

    Science.gov (United States)

    Maye, Peter; Stover, Mary Louise; Liu, Yaling; Rowe, David W; Gong, Shiaochin; Lichtler, Alexander C

    2009-03-13

    Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP) reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1) subclone genes of interest into BAC linking vectors, (2) insert desired reporter genes into respective genes and (3) link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.

  3. Radionuclide reporter gene imaging

    International Nuclear Information System (INIS)

    Min, Jung Joon

    2004-01-01

    Recent progress in the development of non-invasive imaging technologies continues to strengthen the role of molecular imaging biological research. These tools have been validated recently in variety of research models, and have been shown to provide continuous quantitative monitoring of the location(s), magnitude, and time-variation of gene expression. This article reviews the principles, characteristics, categories and the use of radionuclide reporter gene imaging technologies as they have been used in imaging cell trafficking, imaging gene therapy, imaging endogenous gene expression and imaging molecular interactions. The studies published to date demonstrate that reporter gene imaging technologies will help to accelerate model validation as well as allow for clinical monitoring of human diseases

  4. Radionuclide reporter gene imaging

    Energy Technology Data Exchange (ETDEWEB)

    Min, Jung Joon [School of Medicine, Chonnam National Univ., Gwangju (Korea, Republic of)

    2004-04-01

    Recent progress in the development of non-invasive imaging technologies continues to strengthen the role of molecular imaging biological research. These tools have been validated recently in variety of research models, and have been shown to provide continuous quantitative monitoring of the location(s), magnitude, and time-variation of gene expression. This article reviews the principles, characteristics, categories and the use of radionuclide reporter gene imaging technologies as they have been used in imaging cell trafficking, imaging gene therapy, imaging endogenous gene expression and imaging molecular interactions. The studies published to date demonstrate that reporter gene imaging technologies will help to accelerate model validation as well as allow for clinical monitoring of human diseases.

  5. Imaging reporter gene for monitoring gene therapy

    International Nuclear Information System (INIS)

    Beco, V. de; Baillet, G.; Tamgac, F.; Tofighi, M.; Weinmann, P.; Vergote, J.; Moretti, J.L.; Tamgac, G.

    2002-01-01

    Scintigraphic images can be obtained to document gene function at cellular level. This approach is presented here and the use of a reporter gene to monitor gene therapy is described. Two main ways are presented: either the use of a reporter gene coding for an enzyme the action of which will be monitored by radiolabeled pro-drug, or a cellular receptor gene, the action of which is documented by a radio labeled cognate receptor ligand. (author)

  6. Radionuclide reporter gene imaging for cardiac gene therapy

    International Nuclear Information System (INIS)

    Inubushi, Masayuki; Tamaki, Nagara

    2007-01-01

    In the field of cardiac gene therapy, angiogenic gene therapy has been most extensively investigated. The first clinical trial of cardiac angiogenic gene therapy was reported in 1998, and at the peak, more than 20 clinical trial protocols were under evaluation. However, most trials have ceased owing to the lack of decisive proof of therapeutic effects and the potential risks of viral vectors. In order to further advance cardiac angiogenic gene therapy, remaining open issues need to be resolved: there needs to be improvement of gene transfer methods, regulation of gene expression, development of much safer vectors and optimisation of therapeutic genes. For these purposes, imaging of gene expression in living organisms is of great importance. In radionuclide reporter gene imaging, ''reporter genes'' transferred into cell nuclei encode for a protein that retains a complementary ''reporter probe'' of a positron or single-photon emitter; thus expression of the reporter genes can be imaged with positron emission tomography or single-photon emission computed tomography. Accordingly, in the setting of gene therapy, the location, magnitude and duration of the therapeutic gene co-expression with the reporter genes can be monitored non-invasively. In the near future, gene therapy may evolve into combination therapy with stem/progenitor cell transplantation, so-called cell-based gene therapy or gene-modified cell therapy. Radionuclide reporter gene imaging is now expected to contribute in providing evidence on the usefulness of this novel therapeutic approach, as well as in investigating the molecular mechanisms underlying neovascularisation and safety issues relevant to further progress in conventional gene therapy. (orig.)

  7. Advances in study of reporter gene imaging for monitoring gene therapy

    International Nuclear Information System (INIS)

    Mu Chuanjie; Zhou Jiwen

    2003-01-01

    To evaluate the efficiency of gene therapy, it is requisite to monitor localization and expression of the therapeutic gene in vivo. Monitoring expression of reporter gene using radionuclide reporter gene technique is the best method. Adenoviral vectors expressing reporter gene are constructed using gene fusion, bicistronic, double promoter or bidirectional transcriptional recombination techniques, and transferred into target cells and tissues, then injected radiolabeled reporter probes which couple to the reporter genes. The reporter genes can be imaged invasively, repeatedly, quantitatively with γ-camera, PET and SPECT. Recently, several reporter gene and reporter probe systems have been used in studies of gene therapy. The part of them has been used for clinic trials

  8. Reporter gene imaging: potential impact on therapy

    International Nuclear Information System (INIS)

    Serganova, Inna; Blasberg, Ronald

    2005-01-01

    Positron emission tomography (PET)-based molecular-genetic imaging in living organisms has enjoyed exceptional growth over the past 5 years; this is particularly striking since it has been identified as a new discipline only within the past decade. Positron emission tomography is one of three imaging technologies (nuclear, magnetic resonance and optical) that has begun to incorporate methods that are established in molecular and cell biology research. The convergence of these disciplines and the wider application of multi-modality imaging are at the heart of this success story. Most current molecular-genetic imaging strategies are 'indirect,' coupling a 'reporter gene' with a complimentary 'reporter probe.' Reporter gene constructs can be driven by constitutive promoter elements and used to monitor gene therapy vectors and the efficacy of trans gene targeting and transduction, as well as to monitor adoptive cell-based therapies. Inducible promoters can be used as 'sensors' to regulate the magnitude of reporter gene expression and can be used to provide information about endogenous cell processes. Reporter systems can also be constructed to monitor mRNA stabilization and specific protein-protein interactions. Promoters can be cell specific and restrict transgene expression to certain tissue and organs. The translation of reporter gene imaging to specific clinical applications is discussed. Several examples that have potential for patient imaging studies in the near future include monitoring adenoviral-based gene therapy, oncolytic herpes virus therapy, adoptive cell-based therapies and Salmonella-based tumor-targeted cancer therapy and imaging. The primary translational applications of noninvasive in vivo reporter gene imaging are likely to be (a) quantitative monitoring of the gene therapy vector and the efficacy of transduction in clinical protocols, by imaging the location, extent and duration of transgene expression; (b) monitoring cell trafficking, targeting

  9. Investigation progress of PET reporter gene imaging

    International Nuclear Information System (INIS)

    Chen Yumei; Huang Gang

    2006-01-01

    Molecular imaging for gene therapy and gene expression has been more and more attractive, while the use of gene therapy has been widely investigated and intense research have allowed it to the clinical setting in the last two-decade years. In vivo imaging with positron emission tomography (PET) by combination of appropriate PET reporter gene and PET reporter probe could provide qualitative and quantitative information for gene therapy. PET imaging could also obtain some valuable parameters not available by other techniques. This technology is useful to understand the process and development of gene therapy and how to apply it into clinical practice in the future. (authors)

  10. MRI Reporter Genes for Noninvasive Molecular Imaging

    Directory of Open Access Journals (Sweden)

    Caixia Yang

    2016-05-01

    Full Text Available Magnetic resonance imaging (MRI is one of the most important imaging technologies used in clinical diagnosis. Reporter genes for MRI can be applied to accurately track the delivery of cell in cell therapy, evaluate the therapy effect of gene delivery, and monitor tissue/cell-specific microenvironments. Commonly used reporter genes for MRI usually include genes encoding the enzyme (e.g., tyrosinase and β-galactosidase, the receptor on the cells (e.g., transferrin receptor, and endogenous reporter genes (e.g., ferritin reporter gene. However, low sensitivity limits the application of MRI and reporter gene-based multimodal imaging strategies are common including optical imaging and radionuclide imaging. These can significantly improve diagnostic efficiency and accelerate the development of new therapies.

  11. Improvement Method of Gene Transfer in Kappaphycus Alvarezii

    OpenAIRE

    Triana, St. Hidayah; Alimuddin,; Widyastuti, Utut; Suharsono,; Suryati, Emma; Parenrengi, Andi

    2016-01-01

    Method of foreign gene transfer in red seaweed Kappaphycus alvarezii has been reported, however, li-mited number of transgenic F0 (broodstock) was obtained. This study was conducted to improve the method of gene transfer mediated by Agrobacterium tumefaciens in order to obtain high percentage of K. alvarezii transgenic. Superoxide dismutase gene from Melastoma malabatrichum (MmCu/Zn-SOD) was used as model towards increasing adaptability of K. alvarezii to environmental stress. The treat-ment...

  12. Methods for monitoring multiple gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Berka, Randy [Davis, CA; Bachkirova, Elena [Davis, CA; Rey, Michael [Davis, CA

    2012-05-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  13. Methods for monitoring multiple gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Berka, Randy; Bachkirova, Elena; Rey, Michael

    2013-10-01

    The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

  14. HMM-Based Gene Annotation Methods

    Energy Technology Data Exchange (ETDEWEB)

    Haussler, David; Hughey, Richard; Karplus, Keven

    1999-09-20

    Development of new statistical methods and computational tools to identify genes in human genomic DNA, and to provide clues to their functions by identifying features such as transcription factor binding sites, tissue, specific expression and splicing patterns, and remove homologies at the protein level with genes of known function.

  15. Combining gene prediction methods to improve metagenomic gene annotation

    Directory of Open Access Journals (Sweden)

    Rosen Gail L

    2011-01-01

    Full Text Available Abstract Background Traditional gene annotation methods rely on characteristics that may not be available in short reads generated from next generation technology, resulting in suboptimal performance for metagenomic (environmental samples. Therefore, in recent years, new programs have been developed that optimize performance on short reads. In this work, we benchmark three metagenomic gene prediction programs and combine their predictions to improve metagenomic read gene annotation. Results We not only analyze the programs' performance at different read-lengths like similar studies, but also separate different types of reads, including intra- and intergenic regions, for analysis. The main deficiencies are in the algorithms' ability to predict non-coding regions and gene edges, resulting in more false-positives and false-negatives than desired. In fact, the specificities of the algorithms are notably worse than the sensitivities. By combining the programs' predictions, we show significant improvement in specificity at minimal cost to sensitivity, resulting in 4% improvement in accuracy for 100 bp reads with ~1% improvement in accuracy for 200 bp reads and above. To correctly annotate the start and stop of the genes, we find that a consensus of all the predictors performs best for shorter read lengths while a unanimous agreement is better for longer read lengths, boosting annotation accuracy by 1-8%. We also demonstrate use of the classifier combinations on a real dataset. Conclusions To optimize the performance for both prediction and annotation accuracies, we conclude that the consensus of all methods (or a majority vote is the best for reads 400 bp and shorter, while using the intersection of GeneMark and Orphelia predictions is the best for reads 500 bp and longer. We demonstrate that most methods predict over 80% coding (including partially coding reads on a real human gut sample sequenced by Illumina technology.

  16. Advances in study of molecular imaging reporte gene systems

    International Nuclear Information System (INIS)

    Wu Tao; An Rui

    2010-01-01

    The use of molecular imaging reporter gene systems has allowed gene therapy to move from the laboratory to the clinical application, which provides methodology to monitor the expression of therapeutic gene noninvasively and achieve quantitative outcome in vivo. Recently, the radionuclide reporter gene still is the focus many studies, but MRI and optical reporter gene have gradually played a important part in reporter gene systems. On the basis of combination of multi-subject, for example applied chemistry and molecular biology, more and more new modified reporter genes and molecular probes have spread out. This paper mainly introduces the advantages and disadvantages of reporter gene system and development trends. (authors)

  17. a positive control plasmid for reporter gene assay

    African Journals Online (AJOL)

    STORAGESEVER

    2008-07-04

    Jul 4, 2008 ... qualification as a positive control for luciferase reporter gene assays. Key words: Reporter gene plasmid, luciferase assay, cytomegalovirus promoter/enhancer, human melanoma cell line. INTRODUCTION. Reporter genes, often called reporters, have become a precious tool in studies of gene expression ...

  18. Advances of reporter gene monitoring stem cell therapy

    International Nuclear Information System (INIS)

    Zhou Xiang; Yin Hongyan; Zhang Yifan

    2010-01-01

    Stem cell therapy research has made great progress, demonstrating a broad application prospects. However, stem cell therapy as a new disease treatment, there are still many problems to be solved. Reporter gene imaging is a rapid development in recent years, a non-invasive, sensitive method of monitoring of stem cells, in particular radionuclide reporter gene imaging has high sensitivity and specificity of the advantages of strong and can carry out imaging of deep tissue and repeat imaging, is a tracer in vivo conditions, the most promising stem cell transplantation technique, showing good prospects for development. (authors)

  19. Impact of ubiquitous inhibitors on the GUS gene reporter system: evidence from the model plants Arabidopsis, tobacco and rice and correction methods for quantitative assays of transgenic and endogenous GUS

    Directory of Open Access Journals (Sweden)

    Gerola Paolo D

    2009-12-01

    Full Text Available Abstract Background The β-glucuronidase (GUS gene reporter system is one of the most effective and employed techniques in the study of gene regulation in plant molecular biology. Improving protocols for GUS assays have rendered the original method described by Jefferson amenable to various requirements and conditions, but the serious limitation caused by inhibitors of the enzyme activity in plant tissues has thus far been underestimated. Results We report that inhibitors of GUS activity are ubiquitous in organ tissues of Arabidopsis, tobacco and rice, and significantly bias quantitative assessment of GUS activity in plant transformation experiments. Combined with previous literature reports on non-model species, our findings suggest that inhibitors may be common components of plant cells, with variable affinity towards the E. coli enzyme. The reduced inhibitory capacity towards the plant endogenous GUS discredits the hypothesis of a regulatory role of these compounds in plant cells, and their effect on the bacterial enzyme is better interpreted as a side effect due to their interaction with GUS during the assay. This is likely to have a bearing also on histochemical analyses, leading to inaccurate evaluations of GUS expression. Conclusions In order to achieve reliable results, inhibitor activity should be routinely tested during quantitative GUS assays. Two separate methods to correct the measured activity of the transgenic and endogenous GUS are presented.

  20. Nucleofection: A New Method for Cutaneous Gene Transfer?

    Directory of Open Access Journals (Sweden)

    Frank Jacobsen

    2006-01-01

    Full Text Available Background. Transfection efficacy after nonviral gene transfer in primary epithelial cells is limited. The aim of this study was to compare transfection efficacy of the recently available method of nucleofection with the established transfection reagent FuGENE6. Methods. Primary human keratinocytes (HKC, primary human fibroblasts (HFB, and a human keratinocyte cell line (HaCaT were transfected with reporter gene construct by FuGENE6 or Amaxa Nucleofector device. At corresponding time points, β-galactosidase expression, cell proliferation (MTT-Test, transduction efficiency (X-gal staining, cell morphology, and cytotoxicity (CASY were determined. Results. Transgene expression after nucleofection was significantly higher in HKC and HFB and detected earlier (3 h vs. 24 h than in FuGENE6. After lipofection 80%–90% of the cells remained proliferative without any influence on cell morphology. In contrast, nucleofection led to a decrease in keratinocyte cell size, with only 20%–42% proliferative cells. Conclusion. Related to the method-dependent increase of cytotoxicity, transgene expression after nucleofection was earlier and higher than after lipofection.

  1. Nucleofection: A New Method for Cutaneous Gene Transfer?

    Science.gov (United States)

    Jacobsen, Frank; Mertens-Rill, Janine; Beller, Juergen; Hirsch, Tobias; Daigeler, Adrien; Langer, Stefan; Lehnhardt, Marcus; Steinau, Hans-Ulrich; Steinstraesser, Lars

    2006-01-01

    Background. Transfection efficacy after nonviral gene transfer in primary epithelial cells is limited. The aim of this study was to compare transfection efficacy of the recently available method of nucleofection with the established transfection reagent FuGENE6. Methods. Primary human keratinocytes (HKC), primary human fibroblasts (HFB), and a human keratinocyte cell line (HaCaT) were transfected with reporter gene construct by FuGENE6 or Amaxa Nucleofector device. At corresponding time points, β-galactosidase expression, cell proliferation (MTT-Test), transduction efficiency (X-gal staining), cell morphology, and cytotoxicity (CASY) were determined. Results. Transgene expression after nucleofection was significantly higher in HKC and HFB and detected earlier (3 h vs. 24 h) than in FuGENE6. After lipofection 80%–90% of the cells remained proliferative without any influence on cell morphology. In contrast, nucleofection led to a decrease in keratinocyte cell size, with only 20%–42% proliferative cells. Conclusion. Related to the method-dependent increase of cytotoxicity, transgene expression after nucleofection was earlier and higher than after lipofection. PMID:17489014

  2. Repetitive Imaging of Reporter Gene Expression in the Lung

    Directory of Open Access Journals (Sweden)

    Jean-Christophe Richard

    2003-10-01

    Full Text Available Positron emission tomographic imaging is emerging as a powerful technology to monitor reporter transgene expression in the lungs and other organs. However, little information is available about its usefulness for studying gene expression over time. Therefore, we infected 20 rats with a replication-deficient adenovirus containing a fusion gene encoding for a mutant Herpes simplex virus type-1 thymidine kinase and an enhanced green fluorescent protein. Five additional rats were infected with a control virus. Pulmonary gene transfer was performed via intratracheal administration of vector using a surfactant-based method. Imaging was performed 4–6 hr, and 4, 7, and 10 days after gene transfer, using 9-(4-[18F]-fluoro-3-hydroxymethylbutylguanine, an imaging substrate for the mutant kinase. Lung tracer uptake assessed with imaging was moderately but significantly increased 4–6 hr after gene transfer, was maximal after 4 days, and was no longer detectable by 10 days. The temporal pattern of transgene expression measured ex vivo with in vitro assays of thymidine kinase activity and green fluorescent protein was similar to imaging. In conclusion, positron emission tomography is a reliable new tool to evaluate the onset and duration of reporter gene expression noninvasively in the lungs of intact animals.

  3. IMPROVEMENT METHOD OF GENE TRANSFER IN Kappaphycus alvarezii

    Directory of Open Access Journals (Sweden)

    St. Hidayah Triana

    2016-11-01

    Full Text Available Method of foreign gene transfer in red seaweed Kappaphycus alvarezii has been reported, however, li-mited number of transgenic F0 (broodstock was obtained. This study was conducted to improve the method of gene transfer mediated by Agrobacterium tumefaciens in order to obtain high percentage of K. alvarezii transgenic. Superoxide dismutase gene from Melastoma malabatrichum (MmCu/Zn-SOD was used as model towards increasing adaptability of K. alvarezii to environmental stress. The treat-ments were the culture media and recovery duration, and each treatment consisted of three replica-tions. The best method was co-cultivation using liquid media, then recovery was conducted in liquid media for 10 days. That treatment allowed higher transformation percentage (90%, regeneration effi-ciency (90%, putative bud efficiency (100%, number of buds and explants sprouted (100% and transgenic explants (100%. The transgenic explants showed an amplification PCR product of Mm-Cu/Zn-SOD gene fragment, whereas the non-transgenic explants showed no amplification product.  All results revealed that suitable method of transgenesis for K. alvarezii has been developed. Keywords:       Agrobacterium tumefaciens, culture media, Kappaphycus alvarezii, recovery duration, transformation

  4. A review for detecting gene-gene interactions using machine learning methods in genetic epidemiology.

    Science.gov (United States)

    Koo, Ching Lee; Liew, Mei Jing; Mohamad, Mohd Saberi; Salleh, Abdul Hakim Mohamed

    2013-01-01

    Recently, the greatest statistical computational challenge in genetic epidemiology is to identify and characterize the genes that interact with other genes and environment factors that bring the effect on complex multifactorial disease. These gene-gene interactions are also denoted as epitasis in which this phenomenon cannot be solved by traditional statistical method due to the high dimensionality of the data and the occurrence of multiple polymorphism. Hence, there are several machine learning methods to solve such problems by identifying such susceptibility gene which are neural networks (NNs), support vector machine (SVM), and random forests (RFs) in such common and multifactorial disease. This paper gives an overview on machine learning methods, describing the methodology of each machine learning methods and its application in detecting gene-gene and gene-environment interactions. Lastly, this paper discussed each machine learning method and presents the strengths and weaknesses of each machine learning method in detecting gene-gene interactions in complex human disease.

  5. Reporter gene bioassays in environmental analysis.

    Science.gov (United States)

    Köhler, S; Belkin, S; Schmid, R D

    2000-01-01

    In parallel to the continuous development of increasingly more sophisticated physical and chemical analytical technologies for the detection of environmental pollutants, there is a progressively more urgent need also for bioassays which report not only on the presence of a chemical but also on its bioavailability and its biological effects. As a partial fulfillment of that need, there has been a rapid development of biosensors based on genetically engineered bacteria. Such microorganisms typically combine a promoter-operator, which acts as the sensing element, with reporter gene(s) coding for easily detectable proteins. These sensors have the ability to detect global parameters such as stress conditions, toxicity or DNA-damaging agents as well as specific organic and inorganic compounds. The systems described in this review, designed to detect different groups of target chemicals, vary greatly in their detection limits, specificity, response times and more. These variations reflect on their potential applicability which, for most of the constructs described, is presently rather limited. Nevertheless, present trends promise that additional improvements will make microbial biosensors an important tool for future environmental analysis.

  6. Core seismic methods verification report

    International Nuclear Information System (INIS)

    Olsen, B.E.; Shatoff, H.D.; Rakowski, J.E.; Rickard, N.D.; Thompson, R.W.; Tow, D.; Lee, T.H.

    1979-12-01

    This report presents the description and validation of the analytical methods for calculation of the seismic loads on an HTGR core and the core support structures. Analytical modeling, integration schemes, parameter assignment, parameter sensitivity, and correlation with test data are key topics which have been covered in detail. Much of the text concerns the description and the results of a series of scale model tests performed to obtain data for code correlation. A discussion of scaling laws, model properties, seismic excitation, instrumentation, and data reduction methods is also presented, including a section on the identification and calculation of statistical errors in the test data

  7. Methods Data Qualification Interim Report

    International Nuclear Information System (INIS)

    Alessi, R. Sam; Grimmett, Tami; Vang, Leng; McGrath, Dave

    2010-01-01

    The overall goal of the Next Generation Nuclear Plant (NGNP) Data Management and Analysis System (NDMAS) is to maintain data provenance for all NGNP data including the Methods component of NGNP data. Multiple means are available to access data stored in NDMAS. A web portal environment allows users to access data, view the results of qualification tests and view graphs and charts of various attributes of the data. NDMAS also has methods for the management of the data output from VHTR simulation models and data generated from experiments designed to verify and validate the simulation codes. These simulation models represent the outcome of mathematical representation of VHTR components and systems. The methods data management approaches described herein will handle data that arise from experiment, simulation, and external sources for the main purpose of facilitating parameter estimation and model verification and validation (V and V). A model integration environment entitled ModelCenter is used to automate the storing of data from simulation model runs to the NDMAS repository. This approach does not adversely change the why computational scientists conduct their work. The method is to be used mainly to store the results of model runs that need to be preserved for auditing purposes or for display to the NDMAS web portal. This interim report demonstrates the currently development of NDMAS for Methods data and discusses data and its qualification that is currently part of NDMAS.

  8. Computerized accounting methods. Final report

    International Nuclear Information System (INIS)

    1994-01-01

    This report summarizes the results of the research performed under the Task Order on computerized accounting methods in a period from 03 August to 31 December 1994. Computerized nuclear material accounting methods are analyzed and evaluated. Selected methods are implemented in a hardware-software complex developed as a prototype of the local network-based CONMIT system. This complex has been put into trial operation for test and evaluation of the selected methods at two selected ''Kurchatov Institute'' Russian Research Center (''KI'' RRC) nuclear facilities. Trial operation is carried out since the beginning of Initial Physical Inventory Taking in these facilities that was performed in November 1994. Operation of CONMIT prototype system was demonstrated in the middle of December 1994. Results of evaluation of CONMIT prototype system features and functioning under real operating conditions are considered. Conclusions are formulated on the ways of further development of computerized nuclear material accounting methods. The most important conclusion is a need to strengthen computer and information security features supported by the operating environment. Security provisions as well as other LANL Client/Server System approaches being developed by Los Alamos National Laboratory are recommended for selection of software and hardware components to be integrated into production version of CONMIT system for KI RRC

  9. Methods Data Qualification Interim Report

    Energy Technology Data Exchange (ETDEWEB)

    R. Sam Alessi; Tami Grimmett; Leng Vang; Dave McGrath

    2010-09-01

    The overall goal of the Next Generation Nuclear Plant (NGNP) Data Management and Analysis System (NDMAS) is to maintain data provenance for all NGNP data including the Methods component of NGNP data. Multiple means are available to access data stored in NDMAS. A web portal environment allows users to access data, view the results of qualification tests and view graphs and charts of various attributes of the data. NDMAS also has methods for the management of the data output from VHTR simulation models and data generated from experiments designed to verify and validate the simulation codes. These simulation models represent the outcome of mathematical representation of VHTR components and systems. The methods data management approaches described herein will handle data that arise from experiment, simulation, and external sources for the main purpose of facilitating parameter estimation and model verification and validation (V&V). A model integration environment entitled ModelCenter is used to automate the storing of data from simulation model runs to the NDMAS repository. This approach does not adversely change the why computational scientists conduct their work. The method is to be used mainly to store the results of model runs that need to be preserved for auditing purposes or for display to the NDMAS web portal. This interim report demonstrates the currently development of NDMAS for Methods data and discusses data and its qualification that is currently part of NDMAS.

  10. In vivo characterization of a reporter gene system for imaging hypoxia-induced gene expression

    International Nuclear Information System (INIS)

    Carlin, Sean; Pugachev, Andrei; Sun Xiaorong; Burke, Sean; Claus, Filip; O'Donoghue, Joseph; Ling, C. Clifton; Humm, John L.

    2009-01-01

    Purpose: To characterize a tumor model containing a hypoxia-inducible reporter gene and to demonstrate utility by comparison of reporter gene expression to the uptake and distribution of the hypoxia tracer 18 F-fluoromisonidazole ( 18 F-FMISO). Methods: Three tumors derived from the rat prostate cancer cell line R3327-AT were grown in each of two rats as follows: (1) parental R3327-AT, (2) positive control R3327-AT/PC in which the HSV1-tkeGFP fusion reporter gene was expressed constitutively, (3) R3327-AT/HRE in which the reporter gene was placed under the control of a hypoxia-inducible factor-responsive promoter sequence (HRE). Animals were coadministered a hypoxia-specific marker (pimonidazole) and the reporter gene probe 124 I-2'-fluoro-2'-deoxy-1-β-D-arabinofuranosyl-5-iodouracil ( 124 I-FIAU) 3 h prior to sacrifice. Statistical analysis of the spatial association between 124 I-FIAU uptake and pimonidazole fluorescent staining intensity was then performed on a pixel-by-pixel basis. Utility of this system was demonstrated by assessment of reporter gene expression versus the exogenous hypoxia probe 18 F-FMISO. Two rats, each bearing a single R3327-AT/HRE tumor, were injected with 124 I-FIAU (3 h before sacrifice) and 18 F-FMISO (2 h before sacrifice). Statistical analysis of the spatial association between 18 F-FMISO and 124 I-FIAU on a pixel-by-pixel basis was performed. Results: Correlation coefficients between 124 I-FIAU uptake and pimonidazole staining intensity were: 0.11 in R3327-AT tumors, -0.66 in R3327-AT/PC and 0.76 in R3327-AT/HRE, confirming that only in the R3327-AT/HRE tumor was HSV1-tkeGFP gene expression associated with hypoxia. Correlation coefficients between 18 F-FMISO and 124 I-FIAU uptakes in R3327-AT/HRE tumors were r=0.56, demonstrating good spatial correspondence between the two tracers. Conclusions: We have confirmed hypoxia-specific expression of the HSV1-tkeGFP fusion gene in the R3327-AT/HRE tumor model and demonstrated the utility of

  11. Research progress in machine learning methods for gene-gene interaction detection.

    Science.gov (United States)

    Peng, Zhe-Ye; Tang, Zi-Jun; Xie, Min-Zhu

    2018-03-20

    Complex diseases are results of gene-gene and gene-environment interactions. However, the detection of high-dimensional gene-gene interactions is computationally challenging. In the last two decades, machine-learning approaches have been developed to detect gene-gene interactions with some successes. In this review, we summarize the progress in research on machine learning methods, as applied to gene-gene interaction detection. It systematically examines the principles and limitations of the current machine learning methods used in genome wide association studies (GWAS) to detect gene-gene interactions, such as neural networks (NN), random forest (RF), support vector machines (SVM) and multifactor dimensionality reduction (MDR), and provides some insights on the future research directions in the field.

  12. Developmentally regulated expression of reporter gene in adult ...

    Indian Academy of Sciences (India)

    pression of reporter gene in adult brain specific GAL4 enhancer traps of. Drosophila ... genes based on their expression pattern, thus enabling us to overcome the ... order association and storage centres of olfactory learning and memory, and ...

  13. Human reporter genes: potential use in clinical studies

    Energy Technology Data Exchange (ETDEWEB)

    Serganova, Inna [Department of Neurology, Memorial Sloan-Kettering Cancer Center, New York, NY 10021 (United States); Ponomarev, Vladimir [Department of Radiology, Memorial Sloan-Kettering Cancer Center, New York, NY 10021 (United States); Blasberg, Ronald [Department of Neurology, Memorial Sloan-Kettering Cancer Center, New York, NY 10021 (United States); Department of Radiology, Memorial Sloan-Kettering Cancer Center, New York, NY 10021 (United States)], E-mail: blasberg@neuro1.mskcc.org

    2007-10-15

    The clinical application of positron-emission-tomography-based reporter gene imaging will expand over the next several years. The translation of reporter gene imaging technology into clinical applications is the focus of this review, with emphasis on the development and use of human reporter genes. Human reporter genes will play an increasingly more important role in this development, and it is likely that one or more reporter systems (human gene and complimentary radiopharmaceutical) will take leading roles. Three classes of human reporter genes are discussed and compared: receptors, transporters and enzymes. Examples of highly expressed cell membrane receptors include specific membrane somatostatin receptors (hSSTrs). The transporter group includes the sodium iodide symporter (hNIS) and the norepinephrine transporter (hNET). The endogenous enzyme classification includes human mitochondrial thymidine kinase 2 (hTK2). In addition, we also discuss the nonhuman dopamine 2 receptor and two viral reporter genes, the wild-type herpes simplex virus 1 thymidine kinase (HSV1-tk) gene and the HSV1-tk mutant (HSV1-sr39tk). Initial applications of reporter gene imaging in patients will be developed within two different clinical disciplines: (a) gene therapy and (b) adoptive cell-based therapies. These studies will benefit from the availability of efficient human reporter systems that can provide critical monitoring information for adenoviral-based, retroviral-based and lenteviral-based gene therapies, oncolytic bacterial and viral therapies, and adoptive cell-based therapies. Translational applications of noninvasive in vivo reporter gene imaging are likely to include: (a) quantitative monitoring of gene therapy vectors for targeting and transduction efficacy in clinical protocols by imaging the location, extent and duration of transgene expression; (b) monitoring of cell trafficking, targeting, replication and activation in adoptive T-cell and stem/progenitor cell therapies

  14. Human reporter genes: potential use in clinical studies

    International Nuclear Information System (INIS)

    Serganova, Inna; Ponomarev, Vladimir; Blasberg, Ronald

    2007-01-01

    The clinical application of positron-emission-tomography-based reporter gene imaging will expand over the next several years. The translation of reporter gene imaging technology into clinical applications is the focus of this review, with emphasis on the development and use of human reporter genes. Human reporter genes will play an increasingly more important role in this development, and it is likely that one or more reporter systems (human gene and complimentary radiopharmaceutical) will take leading roles. Three classes of human reporter genes are discussed and compared: receptors, transporters and enzymes. Examples of highly expressed cell membrane receptors include specific membrane somatostatin receptors (hSSTrs). The transporter group includes the sodium iodide symporter (hNIS) and the norepinephrine transporter (hNET). The endogenous enzyme classification includes human mitochondrial thymidine kinase 2 (hTK2). In addition, we also discuss the nonhuman dopamine 2 receptor and two viral reporter genes, the wild-type herpes simplex virus 1 thymidine kinase (HSV1-tk) gene and the HSV1-tk mutant (HSV1-sr39tk). Initial applications of reporter gene imaging in patients will be developed within two different clinical disciplines: (a) gene therapy and (b) adoptive cell-based therapies. These studies will benefit from the availability of efficient human reporter systems that can provide critical monitoring information for adenoviral-based, retroviral-based and lenteviral-based gene therapies, oncolytic bacterial and viral therapies, and adoptive cell-based therapies. Translational applications of noninvasive in vivo reporter gene imaging are likely to include: (a) quantitative monitoring of gene therapy vectors for targeting and transduction efficacy in clinical protocols by imaging the location, extent and duration of transgene expression; (b) monitoring of cell trafficking, targeting, replication and activation in adoptive T-cell and stem/progenitor cell therapies

  15. Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data.

    Science.gov (United States)

    Kannan, Soumya; Sams, Thomas; Maury, Jérôme; Workman, Christopher T

    2018-03-16

    Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system of ordinary differential equations for estimating dynamic promoter activity for promoters that change their activity in response to the environment that is robust to noise and changes in growth rate. Our approach, inference of dynamic promoter activity (PromAct), improves on existing methods by more accurately inferring known promoter activity profiles. This method is also capable of estimating the correct scale of promoter activity and can be applied to quantitative data sets to estimate quantitative rates.

  16. Effect of the absolute statistic on gene-sampling gene-set analysis methods.

    Science.gov (United States)

    Nam, Dougu

    2017-06-01

    Gene-set enrichment analysis and its modified versions have commonly been used for identifying altered functions or pathways in disease from microarray data. In particular, the simple gene-sampling gene-set analysis methods have been heavily used for datasets with only a few sample replicates. The biggest problem with this approach is the highly inflated false-positive rate. In this paper, the effect of absolute gene statistic on gene-sampling gene-set analysis methods is systematically investigated. Thus far, the absolute gene statistic has merely been regarded as a supplementary method for capturing the bidirectional changes in each gene set. Here, it is shown that incorporating the absolute gene statistic in gene-sampling gene-set analysis substantially reduces the false-positive rate and improves the overall discriminatory ability. Its effect was investigated by power, false-positive rate, and receiver operating curve for a number of simulated and real datasets. The performances of gene-set analysis methods in one-tailed (genome-wide association study) and two-tailed (gene expression data) tests were also compared and discussed.

  17. Evaluation of biolistic gene transfer methods in vivo using non-invasive bioluminescent imaging techniques

    Directory of Open Access Journals (Sweden)

    Daniell Henry

    2011-06-01

    Full Text Available Abstract Background Gene therapy continues to hold great potential for treating many different types of disease and dysfunction. Safe and efficient techniques for gene transfer and expression in vivo are needed to enable gene therapeutic strategies to be effective in patients. Currently, the most commonly used methods employ replication-defective viral vectors for gene transfer, while physical gene transfer methods such as biolistic-mediated ("gene-gun" delivery to target tissues have not been as extensively explored. In the present study, we evaluated the efficacy of biolistic gene transfer techniques in vivo using non-invasive bioluminescent imaging (BLI methods. Results Plasmid DNA carrying the firefly luciferase (LUC reporter gene under the control of the human Cytomegalovirus (CMV promoter/enhancer was transfected into mouse skin and liver using biolistic methods. The plasmids were coupled to gold microspheres (1 μm diameter using different DNA Loading Ratios (DLRs, and "shot" into target tissues using a helium-driven gene gun. The optimal DLR was found to be in the range of 4-10. Bioluminescence was measured using an In Vivo Imaging System (IVIS-50 at various time-points following transfer. Biolistic gene transfer to mouse skin produced peak reporter gene expression one day after transfer. Expression remained detectable through four days, but declined to undetectable levels by six days following gene transfer. Maximum depth of tissue penetration following biolistic transfer to abdominal skin was 200-300 μm. Similarly, biolistic gene transfer to mouse liver in vivo also produced peak early expression followed by a decline over time. In contrast to skin, however, liver expression of the reporter gene was relatively stable 4-8 days post-biolistic gene transfer, and remained detectable for nearly two weeks. Conclusions The use of bioluminescence imaging techniques enabled efficient evaluation of reporter gene expression in vivo. Our results

  18. Assays for noninvasive imaging of reporter gene expression

    International Nuclear Information System (INIS)

    Gambhir, S.S.; Barrio, J.R.; Herschman, H.R.; Phelps, M.E.

    1999-01-01

    Repeated, noninvasive imaging of reporter gene expression is emerging as a valuable tool for monitoring the expression of genes in animals and humans. Monitoring of organ/cell transplantation in living animals and humans, and the assessment of environmental, behavioral, and pharmacologic modulation of gene expression in transgenic animals should soon be possible. The earliest clinical application is likely to be monitoring human gene therapy in tumors transduced with the herpes simplex virus type 1 thymidine kinase (HSV1-tk) suicide gene. Several candidate assays for imaging reporter gene expression have been studied, utilizing cytosine deaminase (CD), HSV1-tk, and dopamine 2 receptor (D2R) as reporter genes. For the HSV1-tk reporter gene, both uracil nucleoside derivatives (e.g., 5-iodo-2'-fluoro-2'-deoxy-1-β-D-arabinofuranosyl-5-iodouracil [FIAU] labeled with 124 I, 131 I ) and acycloguanosine derivatives {e.g., 8-[ 18 F]fluoro-9-[[2-hydroxy-1-(hydroxymethyl)ethoxy]methyl]guanine (8-[ 18 F]-fluoroganciclovir) ([ 18 F]FGCV), 9-[(3-[ 18 F]fluoro-1-hydroxy-2-propoxy)methyl]guanine ([ 18 F]FHPG)} have been investigated as reporter probes. For the D2R reporter gene, a derivative of spiperone {3-(2'-[ 18 F]-Fluoroethyl)spiperone ([ 18 F]FESP)} has been used with positron emission tomography (PET) imaging. In this review, the principles and specific assays for imaging reporter gene expression are presented and discussed. Specific examples utilizing adenoviral-mediated delivery of a reporter gene as well as tumors expressing reporter genes are discussed

  19. A Review for Detecting Gene-Gene Interactions Using Machine Learning Methods in Genetic Epidemiology

    Directory of Open Access Journals (Sweden)

    Ching Lee Koo

    2013-01-01

    Full Text Available Recently, the greatest statistical computational challenge in genetic epidemiology is to identify and characterize the genes that interact with other genes and environment factors that bring the effect on complex multifactorial disease. These gene-gene interactions are also denoted as epitasis in which this phenomenon cannot be solved by traditional statistical method due to the high dimensionality of the data and the occurrence of multiple polymorphism. Hence, there are several machine learning methods to solve such problems by identifying such susceptibility gene which are neural networks (NNs, support vector machine (SVM, and random forests (RFs in such common and multifactorial disease. This paper gives an overview on machine learning methods, describing the methodology of each machine learning methods and its application in detecting gene-gene and gene-environment interactions. Lastly, this paper discussed each machine learning method and presents the strengths and weaknesses of each machine learning method in detecting gene-gene interactions in complex human disease.

  20. A new electrospray method for targeted gene delivery.

    Science.gov (United States)

    Boehringer, Stephan; Ruzgys, Paulius; Tamò, Luca; Šatkauskas, Saulius; Geiser, Thomas; Gazdhar, Amiq; Hradetzky, David

    2018-03-05

    A challenge for gene therapy is absence of safe and efficient local delivery of therapeutic genetic material. An efficient and reproducible physical method of electrospray for localized and targeted gene delivery is presented. Electrospray works on the principle of coulombs repulsion, under influence of electric field the liquid carrying genetic material is dispersed into micro droplets and is accelerated towards the targeted tissue, acting as a counter electrode. The accelerated droplets penetrate the targeted cells thus facilitating the transfer of genetic material into the cell. The work described here presents the principle of electrospray for gene delivery, the basic instrument design, and the various optimized parameters to enhance gene transfer in vitro. We estimate a transfection efficiency of up to 60% was achieved. We describe an efficient gene transfer method and a potential electrospray-mediated gene transfer mechanism.

  1. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  2. A copula method for modeling directional dependence of genes

    Directory of Open Access Journals (Sweden)

    Park Changyi

    2008-05-01

    Full Text Available Abstract Background Genes interact with each other as basic building blocks of life, forming a complicated network. The relationship between groups of genes with different functions can be represented as gene networks. With the deposition of huge microarray data sets in public domains, study on gene networking is now possible. In recent years, there has been an increasing interest in the reconstruction of gene networks from gene expression data. Recent work includes linear models, Boolean network models, and Bayesian networks. Among them, Bayesian networks seem to be the most effective in constructing gene networks. A major problem with the Bayesian network approach is the excessive computational time. This problem is due to the interactive feature of the method that requires large search space. Since fitting a model by using the copulas does not require iterations, elicitation of the priors, and complicated calculations of posterior distributions, the need for reference to extensive search spaces can be eliminated leading to manageable computational affords. Bayesian network approach produces a discretely expression of conditional probabilities. Discreteness of the characteristics is not required in the copula approach which involves use of uniform representation of the continuous random variables. Our method is able to overcome the limitation of Bayesian network method for gene-gene interaction, i.e. information loss due to binary transformation. Results We analyzed the gene interactions for two gene data sets (one group is eight histone genes and the other group is 19 genes which include DNA polymerases, DNA helicase, type B cyclin genes, DNA primases, radiation sensitive genes, repaire related genes, replication protein A encoding gene, DNA replication initiation factor, securin gene, nucleosome assembly factor, and a subunit of the cohesin complex by adopting a measure of directional dependence based on a copula function. We have compared

  3. DDOT MXD+ method development report.

    Science.gov (United States)

    2015-09-01

    Mixed-use development has become increasingly common across the country, including Washington, D.C. : However, a straightforward and empirically validated method for evaluating the traffic impacts of such : projects is still needed. The data presente...

  4. Methods for transient assay of gene function in floral tissues

    Directory of Open Access Journals (Sweden)

    Pathirana Nilangani N

    2007-01-01

    Full Text Available Abstract Background There is considerable interest in rapid assays or screening systems for assigning gene function. However, analysis of gene function in the flowers of some species is restricted due to the difficulty of producing stably transformed transgenic plants. As a result, experimental approaches based on transient gene expression assays are frequently used. Biolistics has long been used for transient over-expression of genes of interest, but has not been exploited for gene silencing studies. Agrobacterium-infiltration has also been used, but the focus primarily has been on the transient transformation of leaf tissue. Results Two constructs, one expressing an inverted repeat of the Antirrhinum majus (Antirrhinum chalcone synthase gene (CHS and the other an inverted repeat of the Antirrhinum transcription factor gene Rosea1, were shown to effectively induce CHS and Rosea1 gene silencing, respectively, when introduced biolistically into petal tissue of Antirrhinum flowers developing in vitro. A high-throughput vector expressing the Antirrhinum CHS gene attached to an inverted repeat of the nos terminator was also shown to be effective. Silencing spread systemically to create large zones of petal tissue lacking pigmentation, with transmission of the silenced state spreading both laterally within the affected epidermal cell layer and into lower cell layers, including the epidermis of the other petal surface. Transient Agrobacterium-mediated transformation of petal tissue of tobacco and petunia flowers in situ or detached was also achieved, using expression of the reporter genes GUS and GFP to visualise transgene expression. Conclusion We demonstrate the feasibility of using biolistics-based transient RNAi, and transient transformation of petal tissue via Agrobacterium infiltration to study gene function in petals. We have also produced a vector for high throughput gene silencing studies, incorporating the option of using T-A cloning to

  5. Advances of reporter gene imaging monitoring stem cell therapy

    International Nuclear Information System (INIS)

    Pei Zhijun; Zhang Yongxue

    2010-01-01

    Stem cell transplantation in the treatment of various tissue damage or degenerative diseases are research hotspots both at home and abroad. However, ignorance of the homing, differentiation and functional expression of the stem cell in vivo influence the further development of stem cell therapy. As an important component of molecular imaging technology, reporter gene imaging dynamically monitors the change of stem cell in vivo via monitoring the expression of transfected reporter gene. This paper briefly describes the latest research progress and the future development trend of the monitoring of reporter gene imaging in stem cell therapy in vivo. (authors)

  6. Biclustering methods: biological relevance and application in gene expression analysis.

    Directory of Open Access Journals (Sweden)

    Ali Oghabian

    Full Text Available DNA microarray technologies are used extensively to profile the expression levels of thousands of genes under various conditions, yielding extremely large data-matrices. Thus, analyzing this information and extracting biologically relevant knowledge becomes a considerable challenge. A classical approach for tackling this challenge is to use clustering (also known as one-way clustering methods where genes (or respectively samples are grouped together based on the similarity of their expression profiles across the set of all samples (or respectively genes. An alternative approach is to develop biclustering methods to identify local patterns in the data. These methods extract subgroups of genes that are co-expressed across only a subset of samples and may feature important biological or medical implications. In this study we evaluate 13 biclustering and 2 clustering (k-means and hierarchical methods. We use several approaches to compare their performance on two real gene expression data sets. For this purpose we apply four evaluation measures in our analysis: (1 we examine how well the considered (biclustering methods differentiate various sample types; (2 we evaluate how well the groups of genes discovered by the (biclustering methods are annotated with similar Gene Ontology categories; (3 we evaluate the capability of the methods to differentiate genes that are known to be specific to the particular sample types we study and (4 we compare the running time of the algorithms. In the end, we conclude that as long as the samples are well defined and annotated, the contamination of the samples is limited, and the samples are well replicated, biclustering methods such as Plaid and SAMBA are useful for discovering relevant subsets of genes and samples.

  7. Method-MS. Final report

    International Nuclear Information System (INIS)

    Skipperud, L.; Popic, J.M.; Roos, P.; Salminen, S.; Nygren, U.; Sigmarsson, O.; Palsson, S.E.

    2011-05-01

    Radiometric determination methods, such as alpha spectrometry require long counting times when low activities are to be determined. Mass spectrometric techniques as Inductively Coupled Plasma Mass Spectrometry (ICP-MS), Thermal Ionisation Mass Spectrometry (TIMS) and Accelerator Mass Spectrometry (AMS) have shown several advantages compared to traditional methods when measuring long-lived radionuclides. Mass spectrometric methods for determination of very low concentrations of elemental isotopes, and thereby isotopic ratios, have been developed using a variety of ion sources. Although primarily applied to the determination of the lighter stable element isotopes and radioactive isotopes in geological studies, the techniques can equally well be applied to the measurement of activity concentrations of long-lived low-level radionuclides in various samples using 'isotope dilution' methods such as those applied in inductively coupled plasma mass spectrometry (ICP-MS). Due to the low specific activity of long-lived radionuclides, many of these are more conveniently detected using mass spectrometric techniques. Mass spectrometry also enables the individual determination of Pu-239 and Pu-240, which cannot be obtained by alpha spectrometry. Inductively Coupled Plasma Mass Spectrometry (ICP-MS) are rapidly growing techniques for the ultra-trace analytical determination of stable and long-lived isotopes and have a wide potential within environmental science, including ecosystem tracers and radio ecological studies. Such instrumentation, of course needs good radiochemical separation, to give best performance. The objectives of the project is to identify current needs and problems within low-level determination of long-lived radioisotopes by ICP-MS, to perform intercalibration and development and improvement of ICP-MS methods for the measurement of radionuclides and isotope ratios and to develop new methods based on modified separation chemistry applied to new auxiliary

  8. Method-MS. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Skipperud, L.; Popic, J.M. (Norwegian Univ. of Life Science (UMB), Isotope Lab. (Norway)); Roos, P. (Technical Univ. of Denmark, Risoe National Lab. for Sustainable Energy, Roskilde (Denmark)); Salminen, S. (Univ. of Helsinki (UH) (Finland)); Nygren, U. (Swedish Defence Research Agency (FOI) (Sweden)); Sigmarsson, O.; Palsson, S.E. (Univ. of Iceland/Icelandic Radiation Protection Institute (Iceland))

    2011-05-15

    Radiometric determination methods, such as alpha spectrometry require long counting times when low activities are to be determined. Mass spectrometric techniques as Inductively Coupled Plasma Mass Spectrometry (ICP-MS), Thermal Ionisation Mass Spectrometry (TIMS) and Accelerator Mass Spectrometry (AMS) have shown several advantages compared to traditional methods when measuring long-lived radionuclides. Mass spectrometric methods for determination of very low concentrations of elemental isotopes, and thereby isotopic ratios, have been developed using a variety of ion sources. Although primarily applied to the determination of the lighter stable element isotopes and radioactive isotopes in geological studies, the techniques can equally well be applied to the measurement of activity concentrations of long-lived low-level radionuclides in various samples using 'isotope dilution' methods such as those applied in inductively coupled plasma mass spectrometry (ICP-MS). Due to the low specific activity of long-lived radionuclides, many of these are more conveniently detected using mass spectrometric techniques. Mass spectrometry also enables the individual determination of Pu-239 and Pu-240, which cannot be obtained by alpha spectrometry. Inductively Coupled Plasma Mass Spectrometry (ICP-MS) are rapidly growing techniques for the ultra-trace analytical determination of stable and long-lived isotopes and have a wide potential within environmental science, including ecosystem tracers and radio ecological studies. Such instrumentation, of course needs good radiochemical separation, to give best performance. The objectives of the project is to identify current needs and problems within low-level determination of long-lived radioisotopes by ICP-MS, to perform intercalibration and development and improvement of ICP-MS methods for the measurement of radionuclides and isotope ratios and to develop new methods based on modified separation chemistry applied to new

  9. Recombinant carcinoembryonic antigen as a reporter gene for molecular imaging

    International Nuclear Information System (INIS)

    Kenanova, Vania; Barat, Bhaswati; Olafsen, Tove; Chatziioannou, Arion; Herschman, Harvey R.; Wu, Anna M.; Braun, Jonathan

    2009-01-01

    Reporter genes can provide a way of noninvasively assessing gene activity in vivo. However, current reporter gene strategies may be limited by the immunogenicity of foreign reporter proteins, endogenous expression, or unwanted biological activity. We have developed a reporter gene based on carcinoembryonic antigen (CEA), a human protein with limited normal tissue expression. To construct a CEA reporter gene for PET, a CEA minigene (N-A3) was fused to the extracellular and transmembrane domains of the human FcγRIIb receptor. The NA3-FcγRIIb recombinant gene, driven by a CMV promoter, was transfected in Jurkat (human T cell leukemia) cells. Expression was analyzed by flow cytometry, immunohistochemistry (IHC), and microPET imaging. Flow cytometry identified Jurkat clones stably expressing NA3-FcγRIIb at low, medium, and high levels. High and medium NA3-FcγRIIb expression could also be detected by Western blot. Reporter gene positive and negative Jurkat cells were used to establish xenografts in athymic mice. IHC showed staining of the tumor with high reporter gene expression; medium and low N-A3 expression was not detected. MicroPET imaging, using an anti-CEA 124 I-labeled single-chain Fv-Fc antibody fragment, demonstrated that only high N-A3 expression could be detected. Specific accumulation of activity was visualized at the N-A3 positive tumor as early as 4 h. MicroPET image quantitation showed tumor activity of 1.8 ± 0.2, 15.2 ± 1.3, and 4.6 ± 1.2 percent injected dose per gram (%ID/g) at 4, 20, and 48 h, respectively. Biodistribution at 48 h demonstrated tumor uptake of 4.8 ± 0.8%ID/g. The CEA N-A3 minigene has the potential to be used as a reporter gene for imaging cells in vivo. (orig.)

  10. Compositions and Methods for Inhibiting Gene Expressions

    Science.gov (United States)

    Williams, Loren D. (Inventor); Fang, Po-Yu (Inventor); Hsiao, Chiaolong (Inventor); Williams, Justin (Inventor)

    2018-01-01

    A combined packing and assembly method that efficiently packs ribonucleic acid (RNA) into virus like particles (VLPs) has been developed. The VLPs can spontaneously assemble and load RNA in vivo, efficiently packaging specifically designed RNAs at high densities and with high purity. In some embodiments the RNA is capable of interference activity, or is a precursor of a RNA capable of causing interference activity. Compositions and methods for the efficient expression, production and purification of VLP-RNAs are provided. VLP-RNAs can be used for the storage of RNA for long periods, and provide the ability to deliver RNA in stable form that is readily taken up by cells.

  11. Cloning-free regulated monitoring of reporter and gene expression

    Directory of Open Access Journals (Sweden)

    Demirkaya Omer

    2009-03-01

    Full Text Available Abstract Background The majority of the promoters, their regulatory elements, and their variations in the human genome remain unknown. Reporter gene technology for transcriptional activity is a widely used tool for the study of promoter structure, gene regulation, and signaling pathways. Construction of transcriptional reporter vectors, including use of cis-acting sequences, requires cloning and time-demanding manipulations, particularly with introduced mutations. Results In this report, we describe a cloning-free strategy to generate transcriptionally-controllable linear reporter constructs. This approach was applied in common transcriptional models of inflammatory response and the interferon system. In addition, it was used to delineate minimal transcriptional activity of selected ribosomal protein promoters. The approach was tested for conversion of genes into TetO-inducible/repressible expression cassettes. Conclusion The simple introduction and tuning of any transcriptional control in the linear DNA product renders promoter activation and regulated gene studies simple and versatile.

  12. GAL4 enhancer trap strains with reporter gene expression during ...

    Indian Academy of Sciences (India)

    the development of adult brain in Drosophila melanogaster. C. R. VENKATESH ... vous system (CNS), at different time points during the pupal stage—a critical .... in frontal view, with further reduced reporter gene expression. Orthodenticle and ...

  13. Terminator Operon Reporter: combining a transcription termination switch with reporter technology for improved gene synthesis and synthetic biology applications.

    Science.gov (United States)

    Zampini, Massimiliano; Mur, Luis A J; Rees Stevens, Pauline; Pachebat, Justin A; Newbold, C James; Hayes, Finbarr; Kingston-Smith, Alison

    2016-05-25

    Synthetic biology is characterized by the development of novel and powerful DNA fabrication methods and by the application of engineering principles to biology. The current study describes Terminator Operon Reporter (TOR), a new gene assembly technology based on the conditional activation of a reporter gene in response to sequence errors occurring at the assembly stage of the synthetic element. These errors are monitored by a transcription terminator that is placed between the synthetic gene and reporter gene. Switching of this terminator between active and inactive states dictates the transcription status of the downstream reporter gene to provide a rapid and facile readout of the accuracy of synthetic assembly. Designed specifically and uniquely for the synthesis of protein coding genes in bacteria, TOR allows the rapid and cost-effective fabrication of synthetic constructs by employing oligonucleotides at the most basic purification level (desalted) and without the need for costly and time-consuming post-synthesis correction methods. Thus, TOR streamlines gene assembly approaches, which are central to the future development of synthetic biology.

  14. GSMA: Gene Set Matrix Analysis, An Automated Method for Rapid Hypothesis Testing of Gene Expression Data

    Directory of Open Access Journals (Sweden)

    Chris Cheadle

    2007-01-01

    Full Text Available Background: Microarray technology has become highly valuable for identifying complex global changes in gene expression patterns. The assignment of functional information to these complex patterns remains a challenging task in effectively interpreting data and correlating results from across experiments, projects and laboratories. Methods which allow the rapid and robust evaluation of multiple functional hypotheses increase the power of individual researchers to data mine gene expression data more efficiently.Results: We have developed (gene set matrix analysis GSMA as a useful method for the rapid testing of group-wise up- or downregulation of gene expression simultaneously for multiple lists of genes (gene sets against entire distributions of gene expression changes (datasets for single or multiple experiments. The utility of GSMA lies in its flexibility to rapidly poll gene sets related by known biological function or as designated solely by the end-user against large numbers of datasets simultaneously.Conclusions: GSMA provides a simple and straightforward method for hypothesis testing in which genes are tested by groups across multiple datasets for patterns of expression enrichment.

  15. A comparative study of three different gene expression analysis methods.

    Science.gov (United States)

    Choe, Jae Young; Han, Hyung Soo; Lee, Seon Duk; Lee, Hanna; Lee, Dong Eun; Ahn, Jae Yun; Ryoo, Hyun Wook; Seo, Kang Suk; Kim, Jong Kun

    2017-12-04

    TNF-α regulates immune cells and acts as an endogenous pyrogen. Reverse transcription polymerase chain reaction (RT-PCR) is one of the most commonly used methods for gene expression analysis. Among the alternatives to PCR, loop-mediated isothermal amplification (LAMP) shows good potential in terms of specificity and sensitivity. However, few studies have compared RT-PCR and LAMP for human gene expression analysis. Therefore, in the present study, we compared one-step RT-PCR, two-step RT-LAMP and one-step RT-LAMP for human gene expression analysis. We compared three gene expression analysis methods using the human TNF-α gene as a biomarker from peripheral blood cells. Total RNA from the three selected febrile patients were subjected to the three different methods of gene expression analysis. In the comparison of three gene expression analysis methods, the detection limit of both one-step RT-PCR and one-step RT-LAMP were the same, while that of two-step RT-LAMP was inferior. One-step RT-LAMP takes less time, and the experimental result is easy to determine. One-step RT-LAMP is a potentially useful and complementary tool that is fast and reasonably sensitive. In addition, one-step RT-LAMP could be useful in environments lacking specialized equipment or expertise.

  16. A two-cassette reporter system for assessing target gene translation and target gene product inclusion body formation

    DEFF Research Database (Denmark)

    2016-01-01

    The present invention relates to a dual cassette reporter system capable of assessing target gene translation and target gene product folding. The present invention further relates to vectors and host cells comprising the dual cassette reporter system. In addition the invention relates to the use...... of the dual cassette reporter system for assessing target gene translation and target gene product folding....

  17. Evolutionary signatures amongst disease genes permit novel methods for gene prioritization and construction of informative gene-based networks.

    Directory of Open Access Journals (Sweden)

    Nolan Priedigkeit

    2015-02-01

    Full Text Available Genes involved in the same function tend to have similar evolutionary histories, in that their rates of evolution covary over time. This coevolutionary signature, termed Evolutionary Rate Covariation (ERC, is calculated using only gene sequences from a set of closely related species and has demonstrated potential as a computational tool for inferring functional relationships between genes. To further define applications of ERC, we first established that roughly 55% of genetic diseases posses an ERC signature between their contributing genes. At a false discovery rate of 5% we report 40 such diseases including cancers, developmental disorders and mitochondrial diseases. Given these coevolutionary signatures between disease genes, we then assessed ERC's ability to prioritize known disease genes out of a list of unrelated candidates. We found that in the presence of an ERC signature, the true disease gene is effectively prioritized to the top 6% of candidates on average. We then apply this strategy to a melanoma-associated region on chromosome 1 and identify MCL1 as a potential causative gene. Furthermore, to gain global insight into disease mechanisms, we used ERC to predict molecular connections between 310 nominally distinct diseases. The resulting "disease map" network associates several diseases with related pathogenic mechanisms and unveils many novel relationships between clinically distinct diseases, such as between Hirschsprung's disease and melanoma. Taken together, these results demonstrate the utility of molecular evolution as a gene discovery platform and show that evolutionary signatures can be used to build informative gene-based networks.

  18. The first report: An analysis of bacterial flora of the first voided urine specimens of patients with male urethritis using the 16S ribosomal RNA gene-based clone library method.

    Science.gov (United States)

    You, Chunlin; Hamasuna, Ryoichi; Ogawa, Midori; Fukuda, Kazumasa; Hachisuga, Toru; Matsumoto, Tetsuro; Taniguchi, Hatsumi

    2016-06-01

    To analyse the bacterial flora of urine from patients with male urethritis using the clone library method. Urine specimens from patients with urethritis were used. The bacterial flora was analysed according to the 16S ribosomal RNA gene-based clone library method. In addition, Neisseria gonorrhoeae, Chlamydia trachomatis, Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma urealyticum or Ureaplasma parvum were detected by the conventional PCR methods (TMA or real-time PCR) and data from the clone library and conventional PCR methods were compared. Among 58 urine specimens, 38 were successfully analysed using the clone library method. From the specimens, 2427 clones were evaluated and 95 bacterial phylotypes were detected. N. gonorrhoeae was detected from 6 specimens and as the predominant bacterial species in 5 specimens. M. genitalium was detected from 5 specimens and as the predominant bacterial species in 3 specimens. C. trachomatis was detected from 15 specimens using the TMA method, but was detected from only 1 specimen using the clone library method. U. parvum was detected from only 2 specimens using the clone library method. In addition, Haemophilus influenzae and Neisseria meningitidis were also detected in 8 and 1 specimens, respectively. Gardnerella vaginalis, which is a potential pathogen for bacterial vaginitis in women, was detected in 10 specimens. The clone library method can detect the occupancy rate of each bacteria species among the bacterial flora and may be a new method for bacterial analyses in male urethritis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. A large-scale benchmark of gene prioritization methods.

    Science.gov (United States)

    Guala, Dimitri; Sonnhammer, Erik L L

    2017-04-21

    In order to maximize the use of results from high-throughput experimental studies, e.g. GWAS, for identification and diagnostics of new disease-associated genes, it is important to have properly analyzed and benchmarked gene prioritization tools. While prospective benchmarks are underpowered to provide statistically significant results in their attempt to differentiate the performance of gene prioritization tools, a strategy for retrospective benchmarking has been missing, and new tools usually only provide internal validations. The Gene Ontology(GO) contains genes clustered around annotation terms. This intrinsic property of GO can be utilized in construction of robust benchmarks, objective to the problem domain. We demonstrate how this can be achieved for network-based gene prioritization tools, utilizing the FunCoup network. We use cross-validation and a set of appropriate performance measures to compare state-of-the-art gene prioritization algorithms: three based on network diffusion, NetRank and two implementations of Random Walk with Restart, and MaxLink that utilizes network neighborhood. Our benchmark suite provides a systematic and objective way to compare the multitude of available and future gene prioritization tools, enabling researchers to select the best gene prioritization tool for the task at hand, and helping to guide the development of more accurate methods.

  20. Stem Cell Gene Therapy for Fanconi Anemia: Report from the 1st International Fanconi Anemia Gene Therapy Working Group Meeting

    Science.gov (United States)

    Tolar, Jakub; Adair, Jennifer E; Antoniou, Michael; Bartholomae, Cynthia C; Becker, Pamela S; Blazar, Bruce R; Bueren, Juan; Carroll, Thomas; Cavazzana-Calvo, Marina; Clapp, D Wade; Dalgleish, Robert; Galy, Anne; Gaspar, H Bobby; Hanenberg, Helmut; Von Kalle, Christof; Kiem, Hans-Peter; Lindeman, Dirk; Naldini, Luigi; Navarro, Susana; Renella, Raffaele; Rio, Paula; Sevilla, Julián; Schmidt, Manfred; Verhoeyen, Els; Wagner, John E; Williams, David A; Thrasher, Adrian J

    2011-01-01

    Survival rates after allogeneic hematopoietic cell transplantation (HCT) for Fanconi anemia (FA) have increased dramatically since 2000. However, the use of autologous stem cell gene therapy, whereby the patient's own blood stem cells are modified to express the wild-type gene product, could potentially avoid the early and late complications of allogeneic HCT. Over the last decades, gene therapy has experienced a high degree of optimism interrupted by periods of diminished expectation. Optimism stems from recent examples of successful gene correction in several congenital immunodeficiencies, whereas diminished expectations come from the realization that gene therapy will not be free of side effects. The goal of the 1st International Fanconi Anemia Gene Therapy Working Group Meeting was to determine the optimal strategy for moving stem cell gene therapy into clinical trials for individuals with FA. To this end, key investigators examined vector design, transduction method, criteria for large-scale clinical-grade vector manufacture, hematopoietic cell preparation, and eligibility criteria for FA patients most likely to benefit. The report summarizes the roadmap for the development of gene therapy for FA. PMID:21540837

  1. Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs

    Directory of Open Access Journals (Sweden)

    Ye Zhi-Qiang

    2011-08-01

    Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.

  2. The progress of PET based reporter gene imaging

    International Nuclear Information System (INIS)

    Zhao Wei; Zhang Xiuli

    2005-01-01

    More than two decades of intense research have allowed gene therapy to move from the laboratory to the clinical setting, where its use for the treatment of human pathologies has been considerably increased in the last years. However, many crucial questions remain to be solved in this challenging field. In vivo imaging with positron emission tomography (PET) by combination of the appropriate PET reporter gene and PET reporter probe could provide invaluable qualitative and quantitative information to answer multiple unsolved questions about gene therapy. PET imaging could be used to define parameters not available by other techniques that are of substantial interest not only for the proper understanding of the gene therapy process, but also for its future development and clinical application in humans. (authors)

  3. An Efficient Ensemble Learning Method for Gene Microarray Classification

    Directory of Open Access Journals (Sweden)

    Alireza Osareh

    2013-01-01

    Full Text Available The gene microarray analysis and classification have demonstrated an effective way for the effective diagnosis of diseases and cancers. However, it has been also revealed that the basic classification techniques have intrinsic drawbacks in achieving accurate gene classification and cancer diagnosis. On the other hand, classifier ensembles have received increasing attention in various applications. Here, we address the gene classification issue using RotBoost ensemble methodology. This method is a combination of Rotation Forest and AdaBoost techniques which in turn preserve both desirable features of an ensemble architecture, that is, accuracy and diversity. To select a concise subset of informative genes, 5 different feature selection algorithms are considered. To assess the efficiency of the RotBoost, other nonensemble/ensemble techniques including Decision Trees, Support Vector Machines, Rotation Forest, AdaBoost, and Bagging are also deployed. Experimental results have revealed that the combination of the fast correlation-based feature selection method with ICA-based RotBoost ensemble is highly effective for gene classification. In fact, the proposed method can create ensemble classifiers which outperform not only the classifiers produced by the conventional machine learning but also the classifiers generated by two widely used conventional ensemble learning methods, that is, Bagging and AdaBoost.

  4. Investigation of the molecular relationship between breast cancer and obesity by candidate gene prioritization methods

    Directory of Open Access Journals (Sweden)

    Saba Garshasbi

    2015-10-01

    Full Text Available Background: Cancer and obesity are two major public health concerns. More than 12 million cases of cancer are reported annually. Many reports confirmed obesity as a risk factor for cancer. The molecular relationship between obesity and breast cancer has not been clear yet. The purpose of this study was to investigate priorities of effective genes in the molecular relationship between obesity and breast cancer. Methods: In this study, computer simulation method was used for prioritizing the genes that involved in the molecular links between obesity and breast cancer in laboratory of systems biology and bioinformatics (LBB, Tehran University, Tehran, Iran, from March to July 2014. In this study, ENDEAVOUR software was used for prioritizing the genes and integrating multiple data sources was used for data analysis. Training genes were selected from effective genes in obesity and/or breast cancer. Two groups of candidate genes were selected. The first group was included the existential genes in 5 common region chromosomes (between obesity and breast cancer and the second group was included the results of genes microarray data analysis of research Creighton, et al (In 2012 on patients with breast cancer. The microarray data were analyzed with GER2 software (R online software on GEO website. Finally, both training and candidate genes were entered in ENDEAVOUR software package. Results: The candidate genes were prioritized to four style and five genes in ten of the first priorities were repeated twice. In other word, the outcome of prioritizing of 72 genes (Product of microarray data analysis and genes of 5 common chromosome regions (Between obesity and breast cancer showed, 5 genes (TNFRSF10B, F2, IGFALS, NTRK3 and HSP90B1 were the priorities in the molecular connection between obesity and breast cancer. Conclusion: There are some common genes between breast cancer and obesity. So, molecular relationship is confirmed. In this study the possible effect

  5. Cross-organism learning method to discover new gene functionalities.

    Science.gov (United States)

    Domeniconi, Giacomo; Masseroli, Marco; Moro, Gianluca; Pinoli, Pietro

    2016-04-01

    Knowledge of gene and protein functions is paramount for the understanding of physiological and pathological biological processes, as well as in the development of new drugs and therapies. Analyses for biomedical knowledge discovery greatly benefit from the availability of gene and protein functional feature descriptions expressed through controlled terminologies and ontologies, i.e., of gene and protein biomedical controlled annotations. In the last years, several databases of such annotations have become available; yet, these valuable annotations are incomplete, include errors and only some of them represent highly reliable human curated information. Computational techniques able to reliably predict new gene or protein annotations with an associated likelihood value are thus paramount. Here, we propose a novel cross-organisms learning approach to reliably predict new functionalities for the genes of an organism based on the known controlled annotations of the genes of another, evolutionarily related and better studied, organism. We leverage a new representation of the annotation discovery problem and a random perturbation of the available controlled annotations to allow the application of supervised algorithms to predict with good accuracy unknown gene annotations. Taking advantage of the numerous gene annotations available for a well-studied organism, our cross-organisms learning method creates and trains better prediction models, which can then be applied to predict new gene annotations of a target organism. We tested and compared our method with the equivalent single organism approach on different gene annotation datasets of five evolutionarily related organisms (Homo sapiens, Mus musculus, Bos taurus, Gallus gallus and Dictyostelium discoideum). Results show both the usefulness of the perturbation method of available annotations for better prediction model training and a great improvement of the cross-organism models with respect to the single-organism ones

  6. Development and evaluation of an efficient heterologous gene knock-in reporter system in Lactococcus lactis.

    Science.gov (United States)

    Lu, Yifei; Yan, Hongxiang; Deng, Jiezhong; Huang, Zhigang; Jin, Xurui; Yu, Yanlan; Hu, Qiwen; Hu, Fuquan; Wang, Jing

    2017-09-18

    Lactococcus lactis is a food grade probiotics and widely used to express heterologous proteins. Generally, target genes are knocked into the L. lactis genome through double-crossover recombination to express heterologous proteins stably. However, creating marker-less heterologous genes knocked-in clones is laborious. In this study, an efficient heterologous gene knock-in reporter system was developed in L. lactis NZ9000. Our knock-in reporter system consists of a temperature-sensitive plasmid pJW and a recombinant L. lactis strain named NZB. The pJW contains homologous arms, and was constructed to knock-in heterologous genes at a fixed locus of NZ9000 genome. lacZ (β-galactosidase) gene was knocked into the chromosome of NZ9000 as a counter-selective marker through the plasmid pJW to generate NZB. The engineered NZB strain formed blue colonies on X-Gal plate. The desired double-crossover mutants formed white colonies distinctive from the predominantly blue colonies (parental and plasmid-integrated clones) when the embedded lacZ was replaced with the target heterologous genes carried by pJW in NZB. By using the system, the heterologous gene knocked-in clones are screened by colony phenotype change rather than by checking colonies individually. Our new knock-in reporter system provides an efficient method to create heterologous genes knocked-in clones.

  7. Empirical pillar design methods review report: Final report

    International Nuclear Information System (INIS)

    1988-02-01

    This report summarizes and evaluates empirical pillar design methods that may be of use during the conceptual design of a high-level nuclear waste repository in salt. The methods are discussed according to category (i.e, main, submain, and panel pillars; barrier pillars; and shaft pillars). Of the 21 identified for main, submain, and panel pillars, one method, the Confined Core Method, is evaluated as being most appropriate for conceptual design. Five methods are considered potentially applicable. Of six methods identified for barrier pillars, one method based on the Load Transfer Distance concept is considered most appropriate for design. Based on the evaluation of 25 methods identified for shaft pillars, an approximate sizing criterion is proposed for use in conceptual design. Aspects of pillar performance relating to creep, ground deformation, interaction with roof and floor rock, and response to high temperature environments are not adequately addressed by existing empirical design methods. 152 refs., 22 figs., 14 tabs

  8. Analyzing gene expression profiles in dilated cardiomyopathy via bioinformatics methods.

    Science.gov (United States)

    Wang, Liming; Zhu, L; Luan, R; Wang, L; Fu, J; Wang, X; Sui, L

    2016-10-10

    Dilated cardiomyopathy (DCM) is characterized by ventricular dilatation, and it is a common cause of heart failure and cardiac transplantation. This study aimed to explore potential DCM-related genes and their underlying regulatory mechanism using methods of bioinformatics. The gene expression profiles of GSE3586 were downloaded from Gene Expression Omnibus database, including 15 normal samples and 13 DCM samples. The differentially expressed genes (DEGs) were identified between normal and DCM samples using Limma package in R language. Pathway enrichment analysis of DEGs was then performed. Meanwhile, the potential transcription factors (TFs) and microRNAs (miRNAs) of these DEGs were predicted based on their binding sequences. In addition, DEGs were mapped to the cMap database to find the potential small molecule drugs. A total of 4777 genes were identified as DEGs by comparing gene expression profiles between DCM and control samples. DEGs were significantly enriched in 26 pathways, such as lymphocyte TarBase pathway and androgen receptor signaling pathway. Furthermore, potential TFs (SP1, LEF1, and NFAT) were identified, as well as potential miRNAs (miR-9, miR-200 family, and miR-30 family). Additionally, small molecules like isoflupredone and trihexyphenidyl were found to be potential therapeutic drugs for DCM. The identified DEGs (PRSS12 and FOXG1), potential TFs, as well as potential miRNAs, might be involved in DCM.

  9. Analyzing gene expression profiles in dilated cardiomyopathy via bioinformatics methods

    Directory of Open Access Journals (Sweden)

    Liming Wang

    Full Text Available Dilated cardiomyopathy (DCM is characterized by ventricular dilatation, and it is a common cause of heart failure and cardiac transplantation. This study aimed to explore potential DCM-related genes and their underlying regulatory mechanism using methods of bioinformatics. The gene expression profiles of GSE3586 were downloaded from Gene Expression Omnibus database, including 15 normal samples and 13 DCM samples. The differentially expressed genes (DEGs were identified between normal and DCM samples using Limma package in R language. Pathway enrichment analysis of DEGs was then performed. Meanwhile, the potential transcription factors (TFs and microRNAs (miRNAs of these DEGs were predicted based on their binding sequences. In addition, DEGs were mapped to the cMap database to find the potential small molecule drugs. A total of 4777 genes were identified as DEGs by comparing gene expression profiles between DCM and control samples. DEGs were significantly enriched in 26 pathways, such as lymphocyte TarBase pathway and androgen receptor signaling pathway. Furthermore, potential TFs (SP1, LEF1, and NFAT were identified, as well as potential miRNAs (miR-9, miR-200 family, and miR-30 family. Additionally, small molecules like isoflupredone and trihexyphenidyl were found to be potential therapeutic drugs for DCM. The identified DEGs (PRSS12 and FOXG1, potential TFs, as well as potential miRNAs, might be involved in DCM.

  10. Comparison of multiple gene assembly methods for metabolic engineering

    Science.gov (United States)

    Chenfeng Lu; Karen Mansoorabadi; Thomas Jeffries

    2007-01-01

    A universal, rapid DNA assembly method for efficient multigene plasmid construction is important for biological research and for optimizing gene expression in industrial microbes. Three different approaches to achieve this goal were evaluated. These included creating long complementary extensions using a uracil-DNA glycosylase technique, overlap extension polymerase...

  11. Ultrahigh-dimensional variable selection method for whole-genome gene-gene interaction analysis

    Directory of Open Access Journals (Sweden)

    Ueki Masao

    2012-05-01

    Full Text Available Abstract Background Genome-wide gene-gene interaction analysis using single nucleotide polymorphisms (SNPs is an attractive way for identification of genetic components that confers susceptibility of human complex diseases. Individual hypothesis testing for SNP-SNP pairs as in common genome-wide association study (GWAS however involves difficulty in setting overall p-value due to complicated correlation structure, namely, the multiple testing problem that causes unacceptable false negative results. A large number of SNP-SNP pairs than sample size, so-called the large p small n problem, precludes simultaneous analysis using multiple regression. The method that overcomes above issues is thus needed. Results We adopt an up-to-date method for ultrahigh-dimensional variable selection termed the sure independence screening (SIS for appropriate handling of numerous number of SNP-SNP interactions by including them as predictor variables in logistic regression. We propose ranking strategy using promising dummy coding methods and following variable selection procedure in the SIS method suitably modified for gene-gene interaction analysis. We also implemented the procedures in a software program, EPISIS, using the cost-effective GPGPU (General-purpose computing on graphics processing units technology. EPISIS can complete exhaustive search for SNP-SNP interactions in standard GWAS dataset within several hours. The proposed method works successfully in simulation experiments and in application to real WTCCC (Wellcome Trust Case–control Consortium data. Conclusions Based on the machine-learning principle, the proposed method gives powerful and flexible genome-wide search for various patterns of gene-gene interaction.

  12. Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data

    DEFF Research Database (Denmark)

    Kannan, Soumya; Sams, Thomas; Maury, Jérôme

    2018-01-01

    activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system......Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds......, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter...

  13. Reactor kinetics methods development. Final report

    International Nuclear Information System (INIS)

    Hansen, K.F.; Henry, A.F.

    1978-01-01

    This report is a qualitative summary of research conducted at MIT from 1967 to 1977 in the area of reactor kinetics methods. The objectives of the research were to find methods of integration of various mathematical models of nuclear reactor transients. From the beginning the work was aimed at numerical integration methods. Specific areas of research, discussed in more detail following, included: integration of multigroup diffusion theory models by finite difference and finite element methods; response matrix and nodal methods; coarse-mesh homogenization; and special treatment of boundary conditions

  14. Physical non-viral gene delivery methods for tissue engineering

    Science.gov (United States)

    Mellott, Adam J.; Forrest, M. Laird; Detamore, Michael S.

    2016-01-01

    The integration of gene therapy into tissue engineering to control differentiation and direct tissue formation is not a new concept; however, successful delivery of nucleic acids into primary cells, progenitor cells, and stem cells has proven exceptionally challenging. Viral vectors are generally highly effective at delivering nucleic acids to a variety of cell populations, both dividing and non-dividing, yet these viral vectors are marred by significant safety concerns. Non-viral vectors are preferred for gene therapy, despite lower transfection efficiencies, and possess many customizable attributes that are desirable for tissue engineering applications. However, there is no single non-viral gene delivery strategy that “fits-all” cell types and tissues. Thus, there is a compelling opportunity to examine different non-viral vectors, especially physical vectors, and compare their relative degrees of success. This review examines the advantages and disadvantages of physical non-viral methods (i.e., microinjection, ballistic gene delivery, electroporation, sonoporation, laser irradiation, magnetofection, and electric field-induced molecular vibration), with particular attention given to electroporation because of its versatility, with further special emphasis on Nucleofection™. In addition, attributes of cellular character that can be used to improve differentiation strategies are examined for tissue engineering applications. Ultimately, electroporation exhibits a high transfection efficiency in many cell types, which is highly desirable for tissue engineering applications, but electroporation and other physical non-viral gene delivery methods are still limited by poor cell viability. Overcoming the challenge of poor cell viability in highly efficient physical non-viral techniques is the key to using gene delivery to enhance tissue engineering applications. PMID:23099792

  15. Physical non-viral gene delivery methods for tissue engineering.

    Science.gov (United States)

    Mellott, Adam J; Forrest, M Laird; Detamore, Michael S

    2013-03-01

    The integration of gene therapy into tissue engineering to control differentiation and direct tissue formation is not a new concept; however, successful delivery of nucleic acids into primary cells, progenitor cells, and stem cells has proven exceptionally challenging. Viral vectors are generally highly effective at delivering nucleic acids to a variety of cell populations, both dividing and non-dividing, yet these viral vectors are marred by significant safety concerns. Non-viral vectors are preferred for gene therapy, despite lower transfection efficiencies, and possess many customizable attributes that are desirable for tissue engineering applications. However, there is no single non-viral gene delivery strategy that "fits-all" cell types and tissues. Thus, there is a compelling opportunity to examine different non-viral vectors, especially physical vectors, and compare their relative degrees of success. This review examines the advantages and disadvantages of physical non-viral methods (i.e., microinjection, ballistic gene delivery, electroporation, sonoporation, laser irradiation, magnetofection, and electric field-induced molecular vibration), with particular attention given to electroporation because of its versatility, with further special emphasis on Nucleofection™. In addition, attributes of cellular character that can be used to improve differentiation strategies are examined for tissue engineering applications. Ultimately, electroporation exhibits a high transfection efficiency in many cell types, which is highly desirable for tissue engineering applications, but electroporation and other physical non-viral gene delivery methods are still limited by poor cell viability. Overcoming the challenge of poor cell viability in highly efficient physical non-viral techniques is the key to using gene delivery to enhance tissue engineering applications.

  16. In vivo characterization of a reporter gene system for imaging hypoxia-induced gene expression.

    Science.gov (United States)

    Carlin, Sean; Pugachev, Andrei; Sun, Xiaorong; Burke, Sean; Claus, Filip; O'Donoghue, Joseph; Ling, C Clifton; Humm, John L

    2009-10-01

    To characterize a tumor model containing a hypoxia-inducible reporter gene and to demonstrate utility by comparison of reporter gene expression to the uptake and distribution of the hypoxia tracer (18)F-fluoromisonidazole ((18)F-FMISO). Three tumors derived from the rat prostate cancer cell line R3327-AT were grown in each of two rats as follows: (1) parental R3327-AT, (2) positive control R3327-AT/PC in which the HSV1-tkeGFP fusion reporter gene was expressed constitutively, (3) R3327-AT/HRE in which the reporter gene was placed under the control of a hypoxia-inducible factor-responsive promoter sequence (HRE). Animals were coadministered a hypoxia-specific marker (pimonidazole) and the reporter gene probe (124)I-2'-fluoro-2'-deoxy-1-beta-d-arabinofuranosyl-5-iodouracil ((124)I-FIAU) 3 h prior to sacrifice. Statistical analysis of the spatial association between (124)I-FIAU uptake and pimonidazole fluorescent staining intensity was then performed on a pixel-by-pixel basis. Utility of this system was demonstrated by assessment of reporter gene expression versus the exogenous hypoxia probe (18)F-FMISO. Two rats, each bearing a single R3327-AT/HRE tumor, were injected with (124)I-FIAU (3 h before sacrifice) and (18)F-FMISO (2 h before sacrifice). Statistical analysis of the spatial association between (18)F-FMISO and (124)I-FIAU on a pixel-by-pixel basis was performed. Correlation coefficients between (124)I-FIAU uptake and pimonidazole staining intensity were: 0.11 in R3327-AT tumors, -0.66 in R3327-AT/PC and 0.76 in R3327-AT/HRE, confirming that only in the R3327-AT/HRE tumor was HSV1-tkeGFP gene expression associated with hypoxia. Correlation coefficients between (18)F-FMISO and (124)I-FIAU uptakes in R3327-AT/HRE tumors were r=0.56, demonstrating good spatial correspondence between the two tracers. We have confirmed hypoxia-specific expression of the HSV1-tkeGFP fusion gene in the R3327-AT/HRE tumor model and demonstrated the utility of this model for the

  17. Improved methods and resources for paramecium genomics: transcription units, gene annotation and gene expression.

    Science.gov (United States)

    Arnaiz, Olivier; Van Dijk, Erwin; Bétermier, Mireille; Lhuillier-Akakpo, Maoussi; de Vanssay, Augustin; Duharcourt, Sandra; Sallet, Erika; Gouzy, Jérôme; Sperling, Linda

    2017-06-26

    The 15 sibling species of the Paramecium aurelia cryptic species complex emerged after a whole genome duplication that occurred tens of millions of years ago. Given extensive knowledge of the genetics and epigenetics of Paramecium acquired over the last century, this species complex offers a uniquely powerful system to investigate the consequences of whole genome duplication in a unicellular eukaryote as well as the genetic and epigenetic mechanisms that drive speciation. High quality Paramecium gene models are important for research using this system. The major aim of the work reported here was to build an improved gene annotation pipeline for the Paramecium lineage. We generated oriented RNA-Seq transcriptome data across the sexual process of autogamy for the model species Paramecium tetraurelia. We determined, for the first time in a ciliate, candidate P. tetraurelia transcription start sites using an adapted Cap-Seq protocol. We developed TrUC, multi-threaded Perl software that in conjunction with TopHat mapping of RNA-Seq data to a reference genome, predicts transcription units for the annotation pipeline. We used EuGene software to combine annotation evidence. The high quality gene structural annotations obtained for P. tetraurelia were used as evidence to improve published annotations for 3 other Paramecium species. The RNA-Seq data were also used for differential gene expression analysis, providing a gene expression atlas that is more sensitive than the previously established microarray resource. We have developed a gene annotation pipeline tailored for the compact genomes and tiny introns of Paramecium species. A novel component of this pipeline, TrUC, predicts transcription units using Cap-Seq and oriented RNA-Seq data. TrUC could prove useful beyond Paramecium, especially in the case of high gene density. Accurate predictions of 3' and 5' UTR will be particularly valuable for studies of gene expression (e.g. nucleosome positioning, identification of cis

  18. Prediction methods environmental-effect reporting

    International Nuclear Information System (INIS)

    Jonker, R.J.; Koester, H.W.

    1987-12-01

    This report provides a survey of prediction methods which can be applied to the calculation of emissions in cuclear-reactor accidents, in the framework of environment-effect reports (dutch m.e.r.) or risk analyses. Also emissions during normal operation are important for m.e.r.. These can be derived from measured emissions of power plants being in operation. Data concerning the latter are reported. The report consists of an introduction into reactor technology, among which a description of some reactor types, the corresponding fuel cycle and dismantling scenarios - a discussion of risk-analyses for nuclear power plants and the physical processes which can play a role during accidents - a discussion of prediction methods to be employed and the expected developments in this area - some background information. (aughor). 145 refs.; 21 figs.; 20 tabs

  19. Biological Education of IVFRU and FIAU for HSV1-TK Reporter Gene Monitoring

    Energy Technology Data Exchange (ETDEWEB)

    Hong, Su Hee; Kim, Eun Jung; Lee, Eun Ah; Lee, Jong Chan; Choi, Tae Hyun; Lee, Kyo Chul; An, Gwang Il; Cheon, Gi Jeong [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

    2006-07-01

    The Herpes Simplex Virus Type1-thymidine kinase (HSV1-TK) system is a useful gene therapy monitoring method. HSV1-TK is one of the most widely used effector gene systems used for imaging gene expression, in association with its use as a reporter gene. It has resulted the development of a number of radiolabeled HSV1-TK substrates for the non-invasive detection of HSV1-TK expression. In non-invasive imaging of the HSV1-TK system, many nucleoside derivatives have been developed as prodrugs for tumor proliferation imaging or as anti-viral drugs. Prodrug activation or sucide gene therapy has been shown to be successful in potentiating the therapeutic index by sensitizing genetically modified tumor cells to various prodrugs or enhancing the action of commonly used chemotherapeutic agents. The most studied prodrug activation approaches involve transfection of tumors with HSV1-TK gene. (Z)-5-(2-iodovinyl)-2'-fluoro- 2'-deoxyuridine (IVFRU) possesses a 2'-fluoro substituent in the ribose configuration, is considered to protect IVFRU from enzyme mediated degradation in vivo. It is obviously potential substrates for HSV1-TK imaging. 2'-Fiuoro-2'-deoxy-1-{beta}-D-arabinofuranosyl- 5-iodo-uridine (FIAU), an anticancer drug widely used in clinical practice, is an analogue of thymidine. In a series of studies using adenovirus vector for gene transfer described the appropriate combination of exogenously introduced HSV1-TK as a 'marker/reporter gene' and radiolabelled FIAU as a 'marker substrate/reporter probe' for monitoring gene therapy and gene expression.

  20. Biological Education of IVFRU and FIAU for HSV1-TK Reporter Gene Monitoring

    International Nuclear Information System (INIS)

    Hong, Su Hee; Kim, Eun Jung; Lee, Eun Ah; Lee, Jong Chan; Choi, Tae Hyun; Lee, Kyo Chul; An, Gwang Il; Cheon, Gi Jeong

    2006-01-01

    The Herpes Simplex Virus Type1-thymidine kinase (HSV1-TK) system is a useful gene therapy monitoring method. HSV1-TK is one of the most widely used effector gene systems used for imaging gene expression, in association with its use as a reporter gene. It has resulted the development of a number of radiolabeled HSV1-TK substrates for the non-invasive detection of HSV1-TK expression. In non-invasive imaging of the HSV1-TK system, many nucleoside derivatives have been developed as prodrugs for tumor proliferation imaging or as anti-viral drugs. Prodrug activation or sucide gene therapy has been shown to be successful in potentiating the therapeutic index by sensitizing genetically modified tumor cells to various prodrugs or enhancing the action of commonly used chemotherapeutic agents. The most studied prodrug activation approaches involve transfection of tumors with HSV1-TK gene. (Z)-5-(2-iodovinyl)-2'-fluoro- 2'-deoxyuridine (IVFRU) possesses a 2'-fluoro substituent in the ribose configuration, is considered to protect IVFRU from enzyme mediated degradation in vivo. It is obviously potential substrates for HSV1-TK imaging. 2'-Fiuoro-2'-deoxy-1-β-D-arabinofuranosyl- 5-iodo-uridine (FIAU), an anticancer drug widely used in clinical practice, is an analogue of thymidine. In a series of studies using adenovirus vector for gene transfer described the appropriate combination of exogenously introduced HSV1-TK as a 'marker/reporter gene' and radiolabelled FIAU as a 'marker substrate/reporter probe' for monitoring gene therapy and gene expression

  1. Comparison of methods for genomic localization of gene trap sequences

    Directory of Open Access Journals (Sweden)

    Ferrin Thomas E

    2006-09-01

    Full Text Available Abstract Background Gene knockouts in a model organism such as mouse provide a valuable resource for the study of basic biology and human disease. Determining which gene has been inactivated by an untargeted gene trapping event poses a challenging annotation problem because gene trap sequence tags, which represent sequence near the vector insertion site of a trapped gene, are typically short and often contain unresolved residues. To understand better the localization of these sequences on the mouse genome, we compared stand-alone versions of the alignment programs BLAT, SSAHA, and MegaBLAST. A set of 3,369 sequence tags was aligned to build 34 of the mouse genome using default parameters for each algorithm. Known genome coordinates for the cognate set of full-length genes (1,659 sequences were used to evaluate localization results. Results In general, all three programs performed well in terms of localizing sequences to a general region of the genome, with only relatively subtle errors identified for a small proportion of the sequence tags. However, large differences in performance were noted with regard to correctly identifying exon boundaries. BLAT correctly identified the vast majority of exon boundaries, while SSAHA and MegaBLAST missed the majority of exon boundaries. SSAHA consistently reported the fewest false positives and is the fastest algorithm. MegaBLAST was comparable to BLAT in speed, but was the most susceptible to localizing sequence tags incorrectly to pseudogenes. Conclusion The differences in performance for sequence tags and full-length reference sequences were surprisingly small. Characteristic variations in localization results for each program were noted that affect the localization of sequence at exon boundaries, in particular.

  2. SPECT imaging of cardiac reporter gene expression in living rabbits

    International Nuclear Information System (INIS)

    Liu Ying; Lan Xiaoli; Zhang Liang; Wu Tao; Jiang Rifeng; Zhang Yongxue

    2009-01-01

    This work is to demonstrate feasibility of imaging the expression of herpes simplex virus 1-thymidine kinase (HSVI-tk) reporter gene in rabbits myocardium by using the reporter probe 131 I-2'-fluoro-2'-deoxy-l-β-D-arabinofuranosyl-5-iodouracil ( 131 I-FIAU) and SPECT. Rabbits of the study group received intramyocardial injection of Ad5-tk and control group received aseptic saline injection. Two sets of experiments were performed on the study group. Rabbits of the 1st set were injected with 131 I-FIAU 600 μCi at Day 2 after intramyocardial transfection of Ad5-tk in 1xl0 9 , 5x10 8 , 1x10 8 , 5x10 7 and 1x10 7 pfu, and heart SPECT imaging was done at different hours. Rabbits of the 2nd were transferred various titers of Ad5-tk (1x10 9 , 5x10 8 , 1x10 8 , 5x10 7 , 1x10 7 pfu) to determine the threshold and optimal viral titer needed for detection of gene expression. Two days later, 131 I-FIAU was injected and heart SPECT imaging was performed at 6, 24 and 48 h, before killing them for gamma counting of the hearts. Reverse transcription-polymerase chain reaction (RT-PCR) was used to verify the transferred HSVI-tk gene expression. Semi-quantitative analysis derived of region of interest (ROI) of SPECT images and RT-PCR images was performed and the relationship of SPECT images with ex vivo gamma counting and mRNA level were evaluated. SPECT images conformed 131 I-FIAU accumulation in rabbits injected with Ad5-tk in the anterolateral wall. The optimal images quality was obtained at 24-48 h for different viral titers. The highest radioactivity in the focal myocardium was seen at 6 h, and then declined with time. The threshold was 5x10 7 pfu of virus titer. The result could be set better in 1-5x10 8 pfu by SPECT analysis and gamma counting. ROI-derived semi-quantitative study on SPECT images correlated well with ex vivo gamma counting and mRNA levels from RT-PCR analysis. The HSVI-tk/ 131 I-FIAU reporter gene/reporter probe system is feasible for cardiac SPECT reporter

  3. Environmental Application of Reporter-Genes Based Biosensors for Chemical Contamination Screening

    Directory of Open Access Journals (Sweden)

    Matejczyk Marzena

    2014-12-01

    Full Text Available The paper presents results of research concerning possibilities of applications of reporter-genes based microorganisms, including the selective presentation of defects and advantages of different new scientific achievements of methodical solutions in genetic system constructions of biosensing elements for environmental research. The most robust and popular genetic fusion and new trends in reporter genes technology – such as LacZ (β-galactosidase, xylE (catechol 2,3-dioxygenase, gfp (green fluorescent proteins and its mutated forms, lux (prokaryotic luciferase, luc (eukaryotic luciferase, phoA (alkaline phosphatase, gusA and gurA (β-glucuronidase, antibiotics and heavy metals resistance are described. Reporter-genes based biosensors with use of genetically modified bacteria and yeast successfully work for genotoxicity, bioavailability and oxidative stress assessment for detection and monitoring of toxic compounds in drinking water and different environmental samples, surface water, soil, sediments.

  4. LEGO: a novel method for gene set over-representation analysis by incorporating network-based gene weights.

    Science.gov (United States)

    Dong, Xinran; Hao, Yun; Wang, Xiao; Tian, Weidong

    2016-01-11

    Pathway or gene set over-representation analysis (ORA) has become a routine task in functional genomics studies. However, currently widely used ORA tools employ statistical methods such as Fisher's exact test that reduce a pathway into a list of genes, ignoring the constitutive functional non-equivalent roles of genes and the complex gene-gene interactions. Here, we develop a novel method named LEGO (functional Link Enrichment of Gene Ontology or gene sets) that takes into consideration these two types of information by incorporating network-based gene weights in ORA analysis. In three benchmarks, LEGO achieves better performance than Fisher and three other network-based methods. To further evaluate LEGO's usefulness, we compare LEGO with five gene expression-based and three pathway topology-based methods using a benchmark of 34 disease gene expression datasets compiled by a recent publication, and show that LEGO is among the top-ranked methods in terms of both sensitivity and prioritization for detecting target KEGG pathways. In addition, we develop a cluster-and-filter approach to reduce the redundancy among the enriched gene sets, making the results more interpretable to biologists. Finally, we apply LEGO to two lists of autism genes, and identify relevant gene sets to autism that could not be found by Fisher.

  5. State of the Art of Fuzzy Methods for Gene Regulatory Networks Inference

    Directory of Open Access Journals (Sweden)

    Tuqyah Abdullah Al Qazlan

    2015-01-01

    Full Text Available To address one of the most challenging issues at the cellular level, this paper surveys the fuzzy methods used in gene regulatory networks (GRNs inference. GRNs represent causal relationships between genes that have a direct influence, trough protein production, on the life and the development of living organisms and provide a useful contribution to the understanding of the cellular functions as well as the mechanisms of diseases. Fuzzy systems are based on handling imprecise knowledge, such as biological information. They provide viable computational tools for inferring GRNs from gene expression data, thus contributing to the discovery of gene interactions responsible for specific diseases and/or ad hoc correcting therapies. Increasing computational power and high throughput technologies have provided powerful means to manage these challenging digital ecosystems at different levels from cell to society globally. The main aim of this paper is to report, present, and discuss the main contributions of this multidisciplinary field in a coherent and structured framework.

  6. Detection of anabolic androgenic steroid abuse in doping control using mammalian reporter gene bioassays.

    Science.gov (United States)

    Houtman, Corine J; Sterk, Saskia S; van de Heijning, Monique P M; Brouwer, Abraham; Stephany, Rainer W; van der Burg, Bart; Sonneveld, Edwin

    2009-04-01

    Anabolic androgenic steroids (AAS) are a class of steroid hormones related to the male hormone testosterone. They are frequently detected as drugs in sport doping control. Being similar to or derived from natural male hormones, AAS share the activation of the androgen receptor (AR) as common mechanism of action. The mammalian androgen responsive reporter gene assay (AR CALUX bioassay), measuring compounds interacting with the AR can be used for the analysis of AAS without the necessity of knowing their chemical structure beforehand, whereas current chemical-analytical approaches may have difficulty in detecting compounds with unknown structures, such as designer steroids. This study demonstrated that AAS prohibited in sports and potential designer AAS can be detected with this AR reporter gene assay, but that also additional steroid activities of AAS could be found using additional mammalian bioassays for other types of steroid hormones. Mixtures of AAS were found to behave additively in the AR reporter gene assay showing that it is possible to use this method for complex mixtures as are found in doping control samples, including mixtures that are a result of multi drug use. To test if mammalian reporter gene assays could be used for the detection of AAS in urine samples, background steroidal activities were measured. AAS-spiked urine samples, mimicking doping positive samples, showed significantly higher androgenic activities than unspiked samples. GC-MS analysis of endogenous androgens and AR reporter gene assay analysis of urine samples showed how a combined chemical-analytical and bioassay approach can be used to identify samples containing AAS. The results indicate that the AR reporter gene assay, in addition to chemical-analytical methods, can be a valuable tool for the analysis of AAS for doping control purposes.

  7. [Gene method for inconsistent hydrological frequency calculation. 2: Diagnosis system of hydrological genes and method of hydrological moment genes with inconsistent characters].

    Science.gov (United States)

    Xie, Ping; Zhao, Jiang Yan; Wu, Zi Yi; Sang, Yan Fang; Chen, Jie; Li, Bin Bin; Gu, Hai Ting

    2018-04-01

    The analysis of inconsistent hydrological series is one of the major problems that should be solved for engineering hydrological calculation in changing environment. In this study, the diffe-rences of non-consistency and non-stationarity were analyzed from the perspective of composition of hydrological series. The inconsistent hydrological phenomena were generalized into hydrological processes with inheritance, variability and evolution characteristics or regulations. Furthermore, the hydrological genes were identified following the theory of biological genes, while their inheritance bases and variability bases were determined based on composition of hydrological series under diffe-rent time scales. To identify and test the components of hydrological genes, we constructed a diagnosis system of hydrological genes. With the P-3 distribution as an example, we described the process of construction and expression of the moment genes to illustrate the inheritance, variability and evolution principles of hydrological genes. With the annual minimum 1-month runoff series of Yunjinghong station in Lancangjiang River basin as an example, we verified the feasibility and practicability of hydrological gene theory for the calculation of inconsistent hydrological frequency. The results showed that the method could be used to reveal the evolution of inconsistent hydrological series. Therefore, it provided a new research pathway for engineering hydrological calculation in changing environment and an essential reference for the assessment of water security.

  8. Multiplex cDNA quantification method that facilitates the standardization of gene expression data

    Science.gov (United States)

    Gotoh, Osamu; Murakami, Yasufumi; Suyama, Akira

    2011-01-01

    Microarray-based gene expression measurement is one of the major methods for transcriptome analysis. However, current microarray data are substantially affected by microarray platforms and RNA references because of the microarray method can provide merely the relative amounts of gene expression levels. Therefore, valid comparisons of the microarray data require standardized platforms, internal and/or external controls and complicated normalizations. These requirements impose limitations on the extensive comparison of gene expression data. Here, we report an effective approach to removing the unfavorable limitations by measuring the absolute amounts of gene expression levels on common DNA microarrays. We have developed a multiplex cDNA quantification method called GEP-DEAN (Gene expression profiling by DCN-encoding-based analysis). The method was validated by using chemically synthesized DNA strands of known quantities and cDNA samples prepared from mouse liver, demonstrating that the absolute amounts of cDNA strands were successfully measured with a sensitivity of 18 zmol in a highly multiplexed manner in 7 h. PMID:21415008

  9. COMPANY PERFORMANCE MEASUREMENT AND REPORTING METHODS

    Directory of Open Access Journals (Sweden)

    Nicu Ioana Elena

    2012-12-01

    Full Text Available One of the priorities of economic research has been and remains the re-evaluation of the notion of performance and especially exploring and finding some indicators that would reflect as accurately as possible the subtleties of the economic entity. The main purpose of this paper is to highlight the main company performance measurement and reporting methods. Performance is a concept that raises many question marks concerning the most accurate or the best method of reporting the performance at the company level. The research methodology has aimed at studying the Romanian and foreign specialized literature dealing with the analyzed field, studying magazines specialized on company performance measurement. If the financial performance measurement indicators are considered to offer an accurate image of the situation of the company, the modern approach through non-financial indicators offers a new perspective upon performance measurement, which is based on simplicity. In conclusion, after the theoretical study, I have noticed that the methods of performance measurement, reporting and interpretation are various, the opinions regarding the best performance measurement methods are contradictive and the companies prefer resorting to financial indicators that still play a more important role in the consolidation of the company performance measurement than the non-financial indicators do.

  10. hNIS-IRES-eGFP Dual Reporter Gene Imaging

    Directory of Open Access Journals (Sweden)

    Jiantu Che

    2005-04-01

    Full Text Available The human and rodent sodium iodide symporters (NIS have recently been cloned and are being investigated as potential therapeutic and reporter genes. We have extended this effort by constructing an internal ribosomal entry site (IRES-linked human NIS (hNIS-enhanced green fluorescent protein (eGFP hybrid reporter gene for both nuclear and optical imaging. A self-inactivating retroviral vector, termed pQCNIG, containing hNIS-IRES-eGFP dual reporter gene, driven by a constitutive CMV promoter, was constructed and used to generate RG2-pQCNIG cells and RG2-pQCNIG tumors. 131I-iodide and 99mTcO4-pertechnetate accumulation studies plus fluorescence microscopy and intensity assays were performed in vitro, and gamma camera imaging studies in RG2-pQCNIG and RG2 tumor-bearing athymic rats were performed. RG2-pQCNIG cells expressed high levels of hNIS protein and showed high intensity of eGFP fluorescence compared with RG2 wild-type cells. RG2-pQCNIG cells accumulated Na131I and 99mTcO4– to a 50:1 and a 170:1 tissue/medium ratio at 10 min, compared with 0.8:1.2 tissue/medium ratio in wild-type RG2 cells. A significant correlation between radiotracer accumulation and eGFP fluorescence intensity was demonstrated. RG2-pQCNIG and RG2 tumors were readily differentiated by in vivo gamma camera imaging; radiotracer uptake increased in RG2-pQCNIG but declined in RG2 tumors over the 50-min imaging period. Stomach and thyroid were the major organs of radionuclide accumulation. The IRES-linked hNIS-eGFP dual reporter gene is functional and stable in transduced RG2-pQCNIG cells. Optical and nuclear imaging of tumors produced from these cell lines provides the opportunity to monitor tumor growth and response to therapy. These studies indicate the potential for a wider application of hNIS reporter imaging and translation into patient studies using radioisotopes that are currently available for human use for both SPECT and PET imaging.

  11. Multimodality imaging of reporter gene expression using a novel fusion vector in living cells and animals

    Science.gov (United States)

    Gambhir, Sanjiv [Portola Valley, CA; Pritha, Ray [Mountain View, CA

    2011-06-07

    Novel double and triple fusion reporter gene constructs harboring distinct imagable reporter genes are provided, as well as applications for the use of such double and triple fusion constructs in living cells and in living animals using distinct imaging technologies.

  12. An algebra-based method for inferring gene regulatory networks.

    Science.gov (United States)

    Vera-Licona, Paola; Jarrah, Abdul; Garcia-Puente, Luis David; McGee, John; Laubenbacher, Reinhard

    2014-03-26

    The inference of gene regulatory networks (GRNs) from experimental observations is at the heart of systems biology. This includes the inference of both the network topology and its dynamics. While there are many algorithms available to infer the network topology from experimental data, less emphasis has been placed on methods that infer network dynamics. Furthermore, since the network inference problem is typically underdetermined, it is essential to have the option of incorporating into the inference process, prior knowledge about the network, along with an effective description of the search space of dynamic models. Finally, it is also important to have an understanding of how a given inference method is affected by experimental and other noise in the data used. This paper contains a novel inference algorithm using the algebraic framework of Boolean polynomial dynamical systems (BPDS), meeting all these requirements. The algorithm takes as input time series data, including those from network perturbations, such as knock-out mutant strains and RNAi experiments. It allows for the incorporation of prior biological knowledge while being robust to significant levels of noise in the data used for inference. It uses an evolutionary algorithm for local optimization with an encoding of the mathematical models as BPDS. The BPDS framework allows an effective representation of the search space for algebraic dynamic models that improves computational performance. The algorithm is validated with both simulated and experimental microarray expression profile data. Robustness to noise is tested using a published mathematical model of the segment polarity gene network in Drosophila melanogaster. Benchmarking of the algorithm is done by comparison with a spectrum of state-of-the-art network inference methods on data from the synthetic IRMA network to demonstrate that our method has good precision and recall for the network reconstruction task, while also predicting several of the

  13. The development and application of a multiple gene co-silencing system using endogenous URA3 as a reporter gene in Ganoderma lucidum.

    Directory of Open Access Journals (Sweden)

    Dashuai Mu

    Full Text Available Ganoderma lucidum is one of the most important medicinal mushrooms; however, molecular genetics research on this species has been limited due to a lack of reliable reverse genetic tools. In this study, the endogenous orotidine 5'-monophosphate decarboxylase gene (URA3 was cloned as a silencing reporter, and four gene-silencing methods using hairpin, sense, antisense, and dual promoter constructs, were introduced into G. lucidum through a simple electroporation procedure. A comparison and evaluation of silencing efficiency demonstrated that all of the four methods differentially suppressed the expression of URA3. Our data unequivocally indicate that the dual promoter silencing vector yields the highest rate of URA3 silencing compared with other vectors (up to 81.9%. To highlight the advantages of the dual promoter system, we constructed a co-silencing system based on the dual promoter method and succeeded in co-silencing URA3 and laccase in G. lucidum. The reduction of the mRNA levels of the two genes were correlated. Thus, the screening efficiency for RNAi knockdown of multiple genes may be improved by the co-silencing of an endogenous reporter gene. The molecular tools developed in this study should facilitate the isolation of genes and the characterization of the functions of multiple genes in this pharmaceutically important species, and these tools should be highly useful for the study of other basidiomycetes.

  14. Clustering based gene expression feature selection method: A computational approach to enrich the classifier efficiency of differentially expressed genes

    KAUST Repository

    Abusamra, Heba

    2016-07-20

    The native nature of high dimension low sample size of gene expression data make the classification task more challenging. Therefore, feature (gene) selection become an apparent need. Selecting a meaningful and relevant genes for classifier not only decrease the computational time and cost, but also improve the classification performance. Among different approaches of feature selection methods, however most of them suffer from several problems such as lack of robustness, validation issues etc. Here, we present a new feature selection technique that takes advantage of clustering both samples and genes. Materials and methods We used leukemia gene expression dataset [1]. The effectiveness of the selected features were evaluated by four different classification methods; support vector machines, k-nearest neighbor, random forest, and linear discriminate analysis. The method evaluate the importance and relevance of each gene cluster by summing the expression level for each gene belongs to this cluster. The gene cluster consider important, if it satisfies conditions depend on thresholds and percentage otherwise eliminated. Results Initial analysis identified 7120 differentially expressed genes of leukemia (Fig. 15a), after applying our feature selection methodology we end up with specific 1117 genes discriminating two classes of leukemia (Fig. 15b). Further applying the same method with more stringent higher positive and lower negative threshold condition, number reduced to 58 genes have be tested to evaluate the effectiveness of the method (Fig. 15c). The results of the four classification methods are summarized in Table 11. Conclusions The feature selection method gave good results with minimum classification error. Our heat-map result shows distinct pattern of refines genes discriminating between two classes of leukemia.

  15. GxGrare: gene-gene interaction analysis method for rare variants from high-throughput sequencing data.

    Science.gov (United States)

    Kwon, Minseok; Leem, Sangseob; Yoon, Joon; Park, Taesung

    2018-03-19

    With the rapid advancement of array-based genotyping techniques, genome-wide association studies (GWAS) have successfully identified common genetic variants associated with common complex diseases. However, it has been shown that only a small proportion of the genetic etiology of complex diseases could be explained by the genetic factors identified from GWAS. This missing heritability could possibly be explained by gene-gene interaction (epistasis) and rare variants. There has been an exponential growth of gene-gene interaction analysis for common variants in terms of methodological developments and practical applications. Also, the recent advancement of high-throughput sequencing technologies makes it possible to conduct rare variant analysis. However, little progress has been made in gene-gene interaction analysis for rare variants. Here, we propose GxGrare which is a new gene-gene interaction method for the rare variants in the framework of the multifactor dimensionality reduction (MDR) analysis. The proposed method consists of three steps; 1) collapsing the rare variants, 2) MDR analysis for the collapsed rare variants, and 3) detect top candidate interaction pairs. GxGrare can be used for the detection of not only gene-gene interactions, but also interactions within a single gene. The proposed method is illustrated with 1080 whole exome sequencing data of the Korean population in order to identify causal gene-gene interaction for rare variants for type 2 diabetes. The proposed GxGrare performs well for gene-gene interaction detection with collapsing of rare variants. GxGrare is available at http://bibs.snu.ac.kr/software/gxgrare which contains simulation data and documentation. Supported operating systems include Linux and OS X.

  16. An extensive analysis of disease-gene associations using network integration and fast kernel-based gene prioritization methods

    Science.gov (United States)

    Valentini, Giorgio; Paccanaro, Alberto; Caniza, Horacio; Romero, Alfonso E.; Re, Matteo

    2014-01-01

    Objective In the context of “network medicine”, gene prioritization methods represent one of the main tools to discover candidate disease genes by exploiting the large amount of data covering different types of functional relationships between genes. Several works proposed to integrate multiple sources of data to improve disease gene prioritization, but to our knowledge no systematic studies focused on the quantitative evaluation of the impact of network integration on gene prioritization. In this paper, we aim at providing an extensive analysis of gene-disease associations not limited to genetic disorders, and a systematic comparison of different network integration methods for gene prioritization. Materials and methods We collected nine different functional networks representing different functional relationships between genes, and we combined them through both unweighted and weighted network integration methods. We then prioritized genes with respect to each of the considered 708 medical subject headings (MeSH) diseases by applying classical guilt-by-association, random walk and random walk with restart algorithms, and the recently proposed kernelized score functions. Results The results obtained with classical random walk algorithms and the best single network achieved an average area under the curve (AUC) across the 708 MeSH diseases of about 0.82, while kernelized score functions and network integration boosted the average AUC to about 0.89. Weighted integration, by exploiting the different “informativeness” embedded in different functional networks, outperforms unweighted integration at 0.01 significance level, according to the Wilcoxon signed rank sum test. For each MeSH disease we provide the top-ranked unannotated candidate genes, available for further bio-medical investigation. Conclusions Network integration is necessary to boost the performances of gene prioritization methods. Moreover the methods based on kernelized score functions can further

  17. Advances in study of perpes simplex virus type 1-thymidine kinase reporter gene imaging

    International Nuclear Information System (INIS)

    Liu Ying; Lan Xiaoli; Zhang Yongxue

    2007-01-01

    Radionuclide reporter gene imaging is an effect way to provide qualitative and quantitative information for gene therapy. There are three systems of reporter gene including kinase reporter gene. perpes simplex virus type 1-thymidine kinase (HSV1-tk) has perfect physical and chemical characteristic which is suit for imaging as reporter gene. It has been widely investigated and intensively researched. Two substrates of HSV1-tk are purine nucleosite derivant and acyclovir derivant, which can also be used as reporter probes of HSV1-tk. (authors)

  18. An extensive analysis of disease-gene associations using network integration and fast kernel-based gene prioritization methods.

    Science.gov (United States)

    Valentini, Giorgio; Paccanaro, Alberto; Caniza, Horacio; Romero, Alfonso E; Re, Matteo

    2014-06-01

    In the context of "network medicine", gene prioritization methods represent one of the main tools to discover candidate disease genes by exploiting the large amount of data covering different types of functional relationships between genes. Several works proposed to integrate multiple sources of data to improve disease gene prioritization, but to our knowledge no systematic studies focused on the quantitative evaluation of the impact of network integration on gene prioritization. In this paper, we aim at providing an extensive analysis of gene-disease associations not limited to genetic disorders, and a systematic comparison of different network integration methods for gene prioritization. We collected nine different functional networks representing different functional relationships between genes, and we combined them through both unweighted and weighted network integration methods. We then prioritized genes with respect to each of the considered 708 medical subject headings (MeSH) diseases by applying classical guilt-by-association, random walk and random walk with restart algorithms, and the recently proposed kernelized score functions. The results obtained with classical random walk algorithms and the best single network achieved an average area under the curve (AUC) across the 708 MeSH diseases of about 0.82, while kernelized score functions and network integration boosted the average AUC to about 0.89. Weighted integration, by exploiting the different "informativeness" embedded in different functional networks, outperforms unweighted integration at 0.01 significance level, according to the Wilcoxon signed rank sum test. For each MeSH disease we provide the top-ranked unannotated candidate genes, available for further bio-medical investigation. Network integration is necessary to boost the performances of gene prioritization methods. Moreover the methods based on kernelized score functions can further enhance disease gene ranking results, by adopting both

  19. PET/CT imaging of human somatostatin receptor 2 (hsstr2) as reporter gene for gene therapy

    International Nuclear Information System (INIS)

    Hofmann, M.; Gazdhar, A.; Weitzel, T.; Schmid, R.; Krause, T.

    2006-01-01

    Localized information on region-selective gene expression in small animals is widely obtained by use of reporter genes inducing light emission. Using these reporter genes for imaging deep inside the human body fluorescent probes are hindered by attenuation, scattering and possible fluorescence quenching. This can be overcome by use of radio-peptide receptors as reporter genes. Therefore, the feasibility of the somatostatin receptor 2 expression vector system for expression imaging was checked against a control vector containing luciferase gene. For in vivo transduction of vector DNA into the rat forelimb muscles the in vivo electroporation technique was chosen because of its high regio-selectivity. The gene expression was imaged by high-sensitive CCD camera (luciferase activity) and by PET/CT using a Ga-68-DOTATOC as radio peptide probe. The relative sstr2 expression was enhanced by gene transduction at maximum to a factor of 15. The PET/CT images could be fully quantified. The above demonstrated feasibility of radio-peptide PET/CT reporter gene imaging may serve in the future as a tool for full quantitative understanding of regional gene expression, especially in large animals and humans

  20. PET/CT imaging of human somatostatin receptor 2 (hsstr2) as reporter gene for gene therapy

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, M. [Molecular Imaging and Therapy Group (MIT-Bern), Clinic of Nuclear Medicine, Inselspital, Medical School Bern (Switzerland)]. E-mail: Michael.Hofmann@insel.ch; Gazdhar, A. [Division of Pulmonary Medicine, University Hospital Bern (Switzerland); Weitzel, T. [Molecular Imaging and Therapy Group (MIT-Bern), Clinic of Nuclear Medicine, Inselspital, Medical School Bern (Switzerland); Schmid, R. [Division of Thoracic Surgery, University Hospital Bern (Switzerland); Krause, T. [Molecular Imaging and Therapy Group (MIT-Bern), Clinic of Nuclear Medicine, Inselspital, Medical School Bern (Switzerland)

    2006-12-20

    Localized information on region-selective gene expression in small animals is widely obtained by use of reporter genes inducing light emission. Using these reporter genes for imaging deep inside the human body fluorescent probes are hindered by attenuation, scattering and possible fluorescence quenching. This can be overcome by use of radio-peptide receptors as reporter genes. Therefore, the feasibility of the somatostatin receptor 2 expression vector system for expression imaging was checked against a control vector containing luciferase gene. For in vivo transduction of vector DNA into the rat forelimb muscles the in vivo electroporation technique was chosen because of its high regio-selectivity. The gene expression was imaged by high-sensitive CCD camera (luciferase activity) and by PET/CT using a Ga-68-DOTATOC as radio peptide probe. The relative sstr2 expression was enhanced by gene transduction at maximum to a factor of 15. The PET/CT images could be fully quantified. The above demonstrated feasibility of radio-peptide PET/CT reporter gene imaging may serve in the future as a tool for full quantitative understanding of regional gene expression, especially in large animals and human000.

  1. Ratiometric Gas Reporting: A Nondisruptive Approach To Monitor Gene Expression in Soils.

    Science.gov (United States)

    Cheng, Hsiao-Ying; Masiello, Caroline A; Del Valle, Ilenne; Gao, Xiaodong; Bennett, George N; Silberg, Jonathan J

    2018-03-16

    Fluorescent proteins are ubiquitous tools that are used to monitor the dynamic functions of natural and synthetic genetic circuits. However, these visual reporters can only be used in transparent settings, a limitation that complicates nondisruptive measurements of gene expression within many matrices, such as soils and sediments. We describe a new ratiometric gas reporting method for nondisruptively monitoring gene expression within hard-to-image environmental matrices. With this approach, C 2 H 4 is continuously synthesized by ethylene forming enzyme to provide information on viable cell number, and CH 3 Br is conditionally synthesized by placing a methyl halide transferase gene under the control of a conditional promoter. We show that ratiometric gas reporting enables the creation of Escherichia coli biosensors that report on acylhomoserine lactone (AHL) autoinducers used for quorum sensing by Gram-negative bacteria. Using these biosensors, we find that an agricultural soil decreases the bioavailable concentration of a long-chain AHL up to 100-fold. We also demonstrate that these biosensors can be used in soil to nondisruptively monitor AHLs synthesized by Rhizobium leguminosarum and degraded by Bacillus thuringiensis. Finally, we show that this new reporting approach can be used in Shewanella oneidensis, a bacterium that lives in sediments.

  2. Detection of biomarkers for Hepatocellular Carcinoma using a hybrid univariate gene selection methods

    Directory of Open Access Journals (Sweden)

    Abdel Samee Nagwan M

    2012-08-01

    Full Text Available Abstract Background Discovering new biomarkers has a great role in improving early diagnosis of Hepatocellular carcinoma (HCC. The experimental determination of biomarkers needs a lot of time and money. This motivates this work to use in-silico prediction of biomarkers to reduce the number of experiments required for detecting new ones. This is achieved by extracting the most representative genes in microarrays of HCC. Results In this work, we provide a method for extracting the differential expressed genes, up regulated ones, that can be considered candidate biomarkers in high throughput microarrays of HCC. We examine the power of several gene selection methods (such as Pearson’s correlation coefficient, Cosine coefficient, Euclidean distance, Mutual information and Entropy with different estimators in selecting informative genes. A biological interpretation of the highly ranked genes is done using KEGG (Kyoto Encyclopedia of Genes and Genomes pathways, ENTREZ and DAVID (Database for Annotation, Visualization, and Integrated Discovery databases. The top ten genes selected using Pearson’s correlation coefficient and Cosine coefficient contained six genes that have been implicated in cancer (often multiple cancers genesis in previous studies. A fewer number of genes were obtained by the other methods (4 genes using Mutual information, 3genes using Euclidean distance and only one gene using Entropy. A better result was obtained by the utilization of a hybrid approach based on intersecting the highly ranked genes in the output of all investigated methods. This hybrid combination yielded seven genes (2 genes for HCC and 5 genes in different types of cancer in the top ten genes of the list of intersected genes. Conclusions To strengthen the effectiveness of the univariate selection methods, we propose a hybrid approach by intersecting several of these methods in a cascaded manner. This approach surpasses all of univariate selection methods when

  3. The Integrative Method Based on the Module-Network for Identifying Driver Genes in Cancer Subtypes

    Directory of Open Access Journals (Sweden)

    Xinguo Lu

    2018-01-01

    Full Text Available With advances in next-generation sequencing(NGS technologies, a large number of multiple types of high-throughput genomics data are available. A great challenge in exploring cancer progression is to identify the driver genes from the variant genes by analyzing and integrating multi-types genomics data. Breast cancer is known as a heterogeneous disease. The identification of subtype-specific driver genes is critical to guide the diagnosis, assessment of prognosis and treatment of breast cancer. We developed an integrated frame based on gene expression profiles and copy number variation (CNV data to identify breast cancer subtype-specific driver genes. In this frame, we employed statistical machine-learning method to select gene subsets and utilized an module-network analysis method to identify potential candidate driver genes. The final subtype-specific driver genes were acquired by paired-wise comparison in subtypes. To validate specificity of the driver genes, the gene expression data of these genes were applied to classify the patient samples with 10-fold cross validation and the enrichment analysis were also conducted on the identified driver genes. The experimental results show that the proposed integrative method can identify the potential driver genes and the classifier with these genes acquired better performance than with genes identified by other methods.

  4. A Screening Method for the ALK Fusion Gene in NSCLC

    International Nuclear Information System (INIS)

    Murakami, Yoshiko; Mitsudomi, Tetsuya; Yatabe, Yasushi

    2012-01-01

    Lung cancer research has recently made significant progress in understanding the molecular pathogenesis of lung cancer and in developing treatments for it. Such achievements are directly utilized in clinical practice. Indeed, the echinoderm microtubule-associated protein-like 4–anaplastic lymphoma kinase (ALK) fusion gene was first described in non-small cell lung cancer in 2007, and a molecularly targeted drug against the fusion was approved in 2011. However, lung cancer with the ALK fusion constitutes only a small fraction of lung cancers; therefore, efficient patient selection is crucial for successful treatment using the ALK inhibitor. Currently, RT-PCR, fluorescent in situ hybridization (FISH), and immunohistochemistry are commonly used to detect the ALK fusion. Although FISH is currently the gold standard technique, there are no perfect methods for detecting these genetic alterations. In this article, we discuss the advantages and disadvantages of each method and the possible criteria for selecting patients who are more likely to have the ALK fusion. If we can successfully screen patients, then ALK inhibitor treatment will be the best example of personalized therapy in terms of selecting patients with an uncommon genotype from a larger group with the same tumor phenotype. In other words, the personalized therapy may offer a new challenge for current clinical oncology.

  5. LGscore: A method to identify disease-related genes using biological literature and Google data.

    Science.gov (United States)

    Kim, Jeongwoo; Kim, Hyunjin; Yoon, Youngmi; Park, Sanghyun

    2015-04-01

    Since the genome project in 1990s, a number of studies associated with genes have been conducted and researchers have confirmed that genes are involved in disease. For this reason, the identification of the relationships between diseases and genes is important in biology. We propose a method called LGscore, which identifies disease-related genes using Google data and literature data. To implement this method, first, we construct a disease-related gene network using text-mining results. We then extract gene-gene interactions based on co-occurrences in abstract data obtained from PubMed, and calculate the weights of edges in the gene network by means of Z-scoring. The weights contain two values: the frequency and the Google search results. The frequency value is extracted from literature data, and the Google search result is obtained using Google. We assign a score to each gene through a network analysis. We assume that genes with a large number of links and numerous Google search results and frequency values are more likely to be involved in disease. For validation, we investigated the top 20 inferred genes for five different diseases using answer sets. The answer sets comprised six databases that contain information on disease-gene relationships. We identified a significant number of disease-related genes as well as candidate genes for Alzheimer's disease, diabetes, colon cancer, lung cancer, and prostate cancer. Our method was up to 40% more accurate than existing methods. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Computational method for discovery of estrogen responsive genes

    DEFF Research Database (Denmark)

    Tang, Suisheng; Tan, Sin Lam; Ramadoss, Suresh Kumar

    2004-01-01

    Estrogen has a profound impact on human physiology and affects numerous genes. The classical estrogen reaction is mediated by its receptors (ERs), which bind to the estrogen response elements (EREs) in target gene's promoter region. Due to tedious and expensive experiments, a limited number of hu...

  7. Using the 2A Protein Coexpression System: Multicistronic 2A Vectors Expressing Gene(s) of Interest and Reporter Proteins.

    Science.gov (United States)

    Luke, Garry A; Ryan, Martin D

    2018-01-01

    To date, a huge range of different proteins-many with cotranslational and posttranslational subcellular localization signals-have been coexpressed together with various reporter proteins in vitro and in vivo using 2A peptides. The pros and cons of 2A co-expression technology are considered below, followed by a simple example of a "how to" protocol to concatenate multiple genes of interest, together with a reporter gene, into a single gene linked via 2As for easy identification or selection of transduced cells.

  8. Comparative study on gene set and pathway topology-based enrichment methods.

    Science.gov (United States)

    Bayerlová, Michaela; Jung, Klaus; Kramer, Frank; Klemm, Florian; Bleckmann, Annalen; Beißbarth, Tim

    2015-10-22

    Enrichment analysis is a popular approach to identify pathways or sets of genes which are significantly enriched in the context of differentially expressed genes. The traditional gene set enrichment approach considers a pathway as a simple gene list disregarding any knowledge of gene or protein interactions. In contrast, the new group of so called pathway topology-based methods integrates the topological structure of a pathway into the analysis. We comparatively investigated gene set and pathway topology-based enrichment approaches, considering three gene set and four topological methods. These methods were compared in two extensive simulation studies and on a benchmark of 36 real datasets, providing the same pathway input data for all methods. In the benchmark data analysis both types of methods showed a comparable ability to detect enriched pathways. The first simulation study was conducted with KEGG pathways, which showed considerable gene overlaps between each other. In this study with original KEGG pathways, none of the topology-based methods outperformed the gene set approach. Therefore, a second simulation study was performed on non-overlapping pathways created by unique gene IDs. Here, methods accounting for pathway topology reached higher accuracy than the gene set methods, however their sensitivity was lower. We conducted one of the first comprehensive comparative works on evaluating gene set against pathway topology-based enrichment methods. The topological methods showed better performance in the simulation scenarios with non-overlapping pathways, however, they were not conclusively better in the other scenarios. This suggests that simple gene set approach might be sufficient to detect an enriched pathway under realistic circumstances. Nevertheless, more extensive studies and further benchmark data are needed to systematically evaluate these methods and to assess what gain and cost pathway topology information introduces into enrichment analysis. Both

  9. The Local Maximum Clustering Method and Its Application in Microarray Gene Expression Data Analysis

    Directory of Open Access Journals (Sweden)

    Chen Yidong

    2004-01-01

    Full Text Available An unsupervised data clustering method, called the local maximum clustering (LMC method, is proposed for identifying clusters in experiment data sets based on research interest. A magnitude property is defined according to research purposes, and data sets are clustered around each local maximum of the magnitude property. By properly defining a magnitude property, this method can overcome many difficulties in microarray data clustering such as reduced projection in similarities, noises, and arbitrary gene distribution. To critically evaluate the performance of this clustering method in comparison with other methods, we designed three model data sets with known cluster distributions and applied the LMC method as well as the hierarchic clustering method, the -mean clustering method, and the self-organized map method to these model data sets. The results show that the LMC method produces the most accurate clustering results. As an example of application, we applied the method to cluster the leukemia samples reported in the microarray study of Golub et al. (1999.

  10. Feasibility of sodium/iodide symporter gene as a new imaging reporter gene: comparison with HSV1-tk

    International Nuclear Information System (INIS)

    Shin, Jae Hoon; Chung, June-Key; Lee, Yong Jin; Kim, Kwang Il; Kang, Joo Hyun; Jeong, Jae Min; Lee, Dong Soo; Kim, Chul Woo; Lee, Myung Chul

    2004-01-01

    Positron emission tomography (PET) imaging reporter genes, such as HSV1-tk and D 2 receptor genes, make it possible to visualise gene expression non-invasively and repetitively in vivo. However, these systems require the synthesis of complicated substrates and the availability of expensive PET equipment. Expression of the sodium/iodide symporter (NIS) gene can be easily monitored with radioiodines and technetium-99m using a gamma camera. To evaluate the possibility of using NIS as an imaging reporter gene, we compared its characteristics with those of the conventional HSV1-tk gene. The CM cell line was made by transfecting the HSV1-tk gene into CT-26 (mouse colon carcinoma cell line). The CTN and CMN cell lines were then made by transfecting the NIS gene into CT-26 and CM. We measured the uptake of iodine-125 iodovinyldeoxyuridine ([ 125 I]IVDU) and 125 I to evaluate the expression of the HSV1-tk and NIS genes, respectively. Each cell line was injected into four flank sites in Balb/c mice. The biodistribution study was performed after intravenously injecting [ 125 I]IVDU and 131 I, and 131 I scintigraphy was performed for the evaluation of NIS expression. In vitro studies indicated that CTN and CMN had 40- to 79-fold and 150- to 256-fold higher uptake of 125 I than CT-26 and CM, respectively. Furthermore, CM and CMN showed 57- to 69-fold higher uptake of [ 125 I]IVDU than CT-26 and CTN. NIS gene expression and 125 I accumulation were found to be directly correlated (R 2 =0.923), as were HSV1-tk gene expression and [ 125 I]IVDU accumulation (R 2 =0.956). Calculated signal per unit NIS and HSV1-tk mRNA expression was 23,240±3,755 cpm and 34,039±5,346 cpm, respectively. In vivo study indicated that CTN and CMN had 2.3- and 5.8-fold higher uptake of 131 I than CT-26 and CM, and 1.8- and 3.5-fold higher uptake of [ 125 I]IVDU than CT-26 and CTN. Scintigraphy using 131 I easily visualised CTN and CMN tumours. In conclusion, the NIS gene may be viewed as an imaging

  11. Report on the uncertainty methods study

    International Nuclear Information System (INIS)

    1998-06-01

    The Uncertainty Methods Study (UMS) Group, following a mandate from CSNI, has compared five methods for calculating the uncertainty in the predictions of advanced 'best estimate' thermal-hydraulic codes: the Pisa method (based on extrapolation from integral experiments) and four methods identifying and combining input uncertainties. Three of these, the GRS, IPSN and ENUSA methods, use subjective probability distributions, and one, the AEAT method, performs a bounding analysis. Each method has been used to calculate the uncertainty in specified parameters for the LSTF SB-CL-18 5% cold leg small break LOCA experiment in the ROSA-IV Large Scale Test Facility (LSTF). The uncertainty analysis was conducted essentially blind and the participants did not use experimental measurements from the test as input apart from initial and boundary conditions. Participants calculated uncertainty ranges for experimental parameters including pressurizer pressure, primary circuit inventory and clad temperature (at a specified position) as functions of time

  12. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Science.gov (United States)

    Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian

    2013-01-01

    We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  13. Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

    Directory of Open Access Journals (Sweden)

    Peter Schierack

    Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

  14. Efficient screening methods for glucosyltransferase genes in Lactobacillus strains

    OpenAIRE

    Kralj, S; van Geel-schutten, GH; van der Maarel, MJEC; Dijkhuizen, L

    2003-01-01

    Limited information is available about homopolysaccharide synthesis in the genus Lactobacillus . Using efficient screening techniques, extracellular glucosyltransferase (GTF) enzyme activity, resulting in alpha-glucan synthesis from sucrose, was detected in various lactobacilli. PCR with degenerate primers based on homologous boxes of known glucosyltransferase (gtf ) genes of lactic acid bacteria strains allowed cloning of fragments of 10 putative gtf genes from eight different glucan produci...

  15. Reliable gene expression analysis by reverse transcription-quantitative PCR: reporting and minimizing the uncertainty in data accuracy.

    Science.gov (United States)

    Remans, Tony; Keunen, Els; Bex, Geert Jan; Smeets, Karen; Vangronsveld, Jaco; Cuypers, Ann

    2014-10-01

    Reverse transcription-quantitative PCR (RT-qPCR) has been widely adopted to measure differences in mRNA levels; however, biological and technical variation strongly affects the accuracy of the reported differences. RT-qPCR specialists have warned that, unless researchers minimize this variability, they may report inaccurate differences and draw incorrect biological conclusions. The Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines describe procedures for conducting and reporting RT-qPCR experiments. The MIQE guidelines enable others to judge the reliability of reported results; however, a recent literature survey found low adherence to these guidelines. Additionally, even experiments that use appropriate procedures remain subject to individual variation that statistical methods cannot correct. For example, since ideal reference genes do not exist, the widely used method of normalizing RT-qPCR data to reference genes generates background noise that affects the accuracy of measured changes in mRNA levels. However, current RT-qPCR data reporting styles ignore this source of variation. In this commentary, we direct researchers to appropriate procedures, outline a method to present the remaining uncertainty in data accuracy, and propose an intuitive way to select reference genes to minimize uncertainty. Reporting the uncertainty in data accuracy also serves for quality assessment, enabling researchers and peer reviewers to confidently evaluate the reliability of gene expression data. © 2014 American Society of Plant Biologists. All rights reserved.

  16. The Ability of Different Imputation Methods to Preserve the Significant Genes and Pathways in Cancer

    Directory of Open Access Journals (Sweden)

    Rosa Aghdam

    2017-12-01

    Full Text Available Deciphering important genes and pathways from incomplete gene expression data could facilitate a better understanding of cancer. Different imputation methods can be applied to estimate the missing values. In our study, we evaluated various imputation methods for their performance in preserving significant genes and pathways. In the first step, 5% genes are considered in random for two types of ignorable and non-ignorable missingness mechanisms with various missing rates. Next, 10 well-known imputation methods were applied to the complete datasets. The significance analysis of microarrays (SAM method was applied to detect the significant genes in rectal and lung cancers to showcase the utility of imputation approaches in preserving significant genes. To determine the impact of different imputation methods on the identification of important genes, the chi-squared test was used to compare the proportions of overlaps between significant genes detected from original data and those detected from the imputed datasets. Additionally, the significant genes are tested for their enrichment in important pathways, using the ConsensusPathDB. Our results showed that almost all the significant genes and pathways of the original dataset can be detected in all imputed datasets, indicating that there is no significant difference in the performance of various imputation methods tested. The source code and selected datasets are available on http://profiles.bs.ipm.ir/softwares/imputation_methods/.

  17. The Ability of Different Imputation Methods to Preserve the Significant Genes and Pathways in Cancer.

    Science.gov (United States)

    Aghdam, Rosa; Baghfalaki, Taban; Khosravi, Pegah; Saberi Ansari, Elnaz

    2017-12-01

    Deciphering important genes and pathways from incomplete gene expression data could facilitate a better understanding of cancer. Different imputation methods can be applied to estimate the missing values. In our study, we evaluated various imputation methods for their performance in preserving significant genes and pathways. In the first step, 5% genes are considered in random for two types of ignorable and non-ignorable missingness mechanisms with various missing rates. Next, 10 well-known imputation methods were applied to the complete datasets. The significance analysis of microarrays (SAM) method was applied to detect the significant genes in rectal and lung cancers to showcase the utility of imputation approaches in preserving significant genes. To determine the impact of different imputation methods on the identification of important genes, the chi-squared test was used to compare the proportions of overlaps between significant genes detected from original data and those detected from the imputed datasets. Additionally, the significant genes are tested for their enrichment in important pathways, using the ConsensusPathDB. Our results showed that almost all the significant genes and pathways of the original dataset can be detected in all imputed datasets, indicating that there is no significant difference in the performance of various imputation methods tested. The source code and selected datasets are available on http://profiles.bs.ipm.ir/softwares/imputation_methods/. Copyright © 2017. Production and hosting by Elsevier B.V.

  18. A hybrid network-based method for the detection of disease-related genes

    Science.gov (United States)

    Cui, Ying; Cai, Meng; Dai, Yang; Stanley, H. Eugene

    2018-02-01

    Detecting disease-related genes is crucial in disease diagnosis and drug design. The accepted view is that neighbors of a disease-causing gene in a molecular network tend to cause the same or similar diseases, and network-based methods have been recently developed to identify novel hereditary disease-genes in available biomedical networks. Despite the steady increase in the discovery of disease-associated genes, there is still a large fraction of disease genes that remains under the tip of the iceberg. In this paper we exploit the topological properties of the protein-protein interaction (PPI) network to detect disease-related genes. We compute, analyze, and compare the topological properties of disease genes with non-disease genes in PPI networks. We also design an improved random forest classifier based on these network topological features, and a cross-validation test confirms that our method performs better than previous similar studies.

  19. A hybrid computational method for the discovery of novel reproduction-related genes.

    Science.gov (United States)

    Chen, Lei; Chu, Chen; Kong, Xiangyin; Huang, Guohua; Huang, Tao; Cai, Yu-Dong

    2015-01-01

    Uncovering the molecular mechanisms underlying reproduction is of great importance to infertility treatment and to the generation of healthy offspring. In this study, we discovered novel reproduction-related genes with a hybrid computational method, integrating three different types of method, which offered new clues for further reproduction research. This method was first executed on a weighted graph, constructed based on known protein-protein interactions, to search the shortest paths connecting any two known reproduction-related genes. Genes occurring in these paths were deemed to have a special relationship with reproduction. These newly discovered genes were filtered with a randomization test. Then, the remaining genes were further selected according to their associations with known reproduction-related genes measured by protein-protein interaction score and alignment score obtained by BLAST. The in-depth analysis of the high confidence novel reproduction genes revealed hidden mechanisms of reproduction and provided guidelines for further experimental validations.

  20. Molecular MR imaging of cancer gene therapy. Ferritin transgene reporter takes the stage

    International Nuclear Information System (INIS)

    Hasegawa, Sumitaka; Furukawa, Takako; Saga, Tsuneo

    2010-01-01

    Molecular imaging using magnetic resonance (MR) imaging has been actively investigated and made rapid progress in the past decade. Applied to cancer gene therapy, the technique's high spatial resolution allows evaluation of gene delivery into target tissues. Because noninvasive monitoring of the duration, location, and magnitude of transgene expression in tumor tissues or cells provides useful information for assessing therapeutic efficacy and optimizing protocols, molecular imaging is expected to become a critical step in the success of cancer gene therapy in the near future. We present a brief overview of the current status of molecular MR imaging, especially in vivo reporter gene imaging using ferritin and other reporters, discuss its application to cancer gene therapy, and present our research of MR imaging detection of electroporation-mediated cancer gene therapy using the ferritin reporter gene. (author)

  1. Confocal quantification of cis-regulatory reporter gene expression in living sea urchin.

    Science.gov (United States)

    Damle, Sagar; Hanser, Bridget; Davidson, Eric H; Fraser, Scott E

    2006-11-15

    Quantification of GFP reporter gene expression at single cell level in living sea urchin embryos can now be accomplished by a new method of confocal laser scanning microscopy (CLSM). Eggs injected with a tissue-specific GFP reporter DNA construct were grown to gastrula stage and their fluorescence recorded as a series of contiguous Z-section slices that spanned the entire embryo. To measure the depth-dependent signal decay seen in the successive slices of an image stack, the eggs were coinjected with a freely diffusible internal fluorescent standard, rhodamine dextran. The measured rhodamine fluorescence was used to generate a computational correction for the depth-dependent loss of GFP fluorescence per slice. The intensity of GFP fluorescence was converted to the number of GFP molecules using a conversion constant derived from CLSM imaging of eggs injected with a measured quantity of GFP protein. The outcome is a validated method for accurately counting GFP molecules in given cells in reporter gene transfer experiments, as we demonstrate by use of an expression construct expressed exclusively in skeletogenic cells.

  2. Method-MS, final report 2010

    DEFF Research Database (Denmark)

    Skipperud, Lindis; Popic, Jelena M.; Roos, Per

    Radiometric determination methods, such as alpha spectrometry require long counting times when low activities are to be determined. Mass spectrometric techniques as Inductively Coupled Plasma Mass Spectrometry (ICP-MS), Thermal Ionisation Mass Spectrometry (TIMS) and Accelerator Mass Spectrometry...

  3. A method to identify differential expression profiles of time-course gene data with Fourier transformation.

    Science.gov (United States)

    Kim, Jaehee; Ogden, Robert Todd; Kim, Haseong

    2013-10-18

    Time course gene expression experiments are an increasingly popular method for exploring biological processes. Temporal gene expression profiles provide an important characterization of gene function, as biological systems are both developmental and dynamic. With such data it is possible to study gene expression changes over time and thereby to detect differential genes. Much of the early work on analyzing time series expression data relied on methods developed originally for static data and thus there is a need for improved methodology. Since time series expression is a temporal process, its unique features such as autocorrelation between successive points should be incorporated into the analysis. This work aims to identify genes that show different gene expression profiles across time. We propose a statistical procedure to discover gene groups with similar profiles using a nonparametric representation that accounts for the autocorrelation in the data. In particular, we first represent each profile in terms of a Fourier basis, and then we screen out genes that are not differentially expressed based on the Fourier coefficients. Finally, we cluster the remaining gene profiles using a model-based approach in the Fourier domain. We evaluate the screening results in terms of sensitivity, specificity, FDR and FNR, compare with the Gaussian process regression screening in a simulation study and illustrate the results by application to yeast cell-cycle microarray expression data with alpha-factor synchronization.The key elements of the proposed methodology: (i) representation of gene profiles in the Fourier domain; (ii) automatic screening of genes based on the Fourier coefficients and taking into account autocorrelation in the data, while controlling the false discovery rate (FDR); (iii) model-based clustering of the remaining gene profiles. Using this method, we identified a set of cell-cycle-regulated time-course yeast genes. The proposed method is general and can be

  4. Direct methods for seismic profiling. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Bleistein, N.; Cohen, J.K.; Hagin, F.G.

    1979-12-12

    A coordinated research program in inverse problems was concluded. The program evolved from formulation to analytical solution to implemented computer algorithms. There were two main lines of research in this program: a velocity inversion method, with application to seismic exploration, and a physical optics inverse scattering method for reflector mapping, with application to nondestructive evaluation. In each case, computer algorithms based on the theoretical results were tested on real or testbed data from the area of the cited application. Research goals of both a theoretical and practical nature were achieved. 34 figures.

  5. Manufacturing Methods and Technology Project Summary Reports

    Science.gov (United States)

    1984-12-01

    Powder ME-16 Type Recoil Mechanism Testing Machine (Powder Gymnasticator ) Projects 677, 78 7814 - Synthetic Quenchants for ME-18 Heat Treating Weapon...were deemed most urgent. These two were the prime candidates for the GEPTTA. Figure I is an artist depiction of the General Purpose Transportability...REPORT (RCS DRCMT-302) MMT Project 677 7753 titled "Noise Suppressor for Powder Type Recoil Mecha- nism Testing Machine (Powder Gymnasticator )" was

  6. Evaluation of gene association methods for coexpression network construction and biological knowledge discovery.

    Directory of Open Access Journals (Sweden)

    Sapna Kumari

    Full Text Available BACKGROUND: Constructing coexpression networks and performing network analysis using large-scale gene expression data sets is an effective way to uncover new biological knowledge; however, the methods used for gene association in constructing these coexpression networks have not been thoroughly evaluated. Since different methods lead to structurally different coexpression networks and provide different information, selecting the optimal gene association method is critical. METHODS AND RESULTS: In this study, we compared eight gene association methods - Spearman rank correlation, Weighted Rank Correlation, Kendall, Hoeffding's D measure, Theil-Sen, Rank Theil-Sen, Distance Covariance, and Pearson - and focused on their true knowledge discovery rates in associating pathway genes and construction coordination networks of regulatory genes. We also examined the behaviors of different methods to microarray data with different properties, and whether the biological processes affect the efficiency of different methods. CONCLUSIONS: We found that the Spearman, Hoeffding and Kendall methods are effective in identifying coexpressed pathway genes, whereas the Theil-sen, Rank Theil-Sen, Spearman, and Weighted Rank methods perform well in identifying coordinated transcription factors that control the same biological processes and traits. Surprisingly, the widely used Pearson method is generally less efficient, and so is the Distance Covariance method that can find gene pairs of multiple relationships. Some analyses we did clearly show Pearson and Distance Covariance methods have distinct behaviors as compared to all other six methods. The efficiencies of different methods vary with the data properties to some degree and are largely contingent upon the biological processes, which necessitates the pre-analysis to identify the best performing method for gene association and coexpression network construction.

  7. Visualization of ecdysteroid activity using a reporter gene in the crustacean, Daphnia.

    Science.gov (United States)

    Asada, Miki; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime

    2014-02-01

    Ecdysone is a hormone known to play a pivotal role in crustaceans and insects. In order to evaluate the ecdysone activities in the environment and within the organism, we have developed a biomonitoring Daphnia strain by introducing a reporter gene. In this study, the ecdysone response element was inserted in the upstream region of a reporter gene, and the DNA construct was injected into Daphnia eggs. The expression of the reporter gene was detected during the early embryonic development stage. In addition, when the eggs expressing the reporter gene were exposed to ecdysone, there was enhanced expression of the reporter gene at detectable levels, while the presence of an antagonist led to its downregulation. These results suggested that this system could be potentially developed for monitoring ecdysone activities in media. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Maria V. Fernández

    2018-04-01

    Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

  9. Genes related to xylose fermentation and methods of using same for enhanced biofuel production

    Science.gov (United States)

    Wohlbach, Dana J.; Gasch, Audrey P.

    2014-08-05

    The present invention provides isolated gene sequences involved in xylose fermentation and related recombinant yeast which are useful in methods of enhanced biofuel production, particularly ethanol production. Methods of bioengineering recombinant yeast useful for biofuel production are also provided.

  10. Nailfold capillaroscopic report: qualitative and quantitative methods

    Directory of Open Access Journals (Sweden)

    S. Zeni

    2011-09-01

    Full Text Available Nailfold capillaroscopy (NVC is a simple and non-invasive method used for the assessment of patients with Raynaud’s phenomenon (RP and in the differential diagnosis of various connective tissue diseases. The scleroderma pattern abnormalities (giant capillaries, haemorrages and/or avascular areas have a positive predictive value for the development of scleroderma spectrum disorders. Thus, an analytical approach to nailfold capillaroscopy can be useful in quantitatively and reproducibly recording various parameters. We developed a new method to assess patients with RP that is capable of predicting the 5-year transition from isolated RP to RP secondary to scleroderma spectrum disorders. This model is a weighted combination of different capillaroscopic parameters (giant capillaries, microhaemorrages, number of capillaries that allows physicians to stratify RP patients easily using a relatively simple diagram to deduce prognosis.

  11. Manufacturing Methods and Technology Project Summary Reports.

    Science.gov (United States)

    1980-12-01

    process using Glidden’s epoxy modified t polyester varnish offered potential economic advantages over the current finish and method of application...fabricate hose and gaskets for fuel service at arctic conditions. Fluorophosphazene polymers with varying concentrations of fluorine content were used to...determine the optimum fluorine content needed to provide the essential fuel resistance and low temperature flexibility. The polymers used in this

  12. Methods for the Isolation of Genes Encoding Novel PHA Metabolism Enzymes from Complex Microbial Communities.

    Science.gov (United States)

    Cheng, Jiujun; Nordeste, Ricardo; Trainer, Maria A; Charles, Trevor C

    2017-01-01

    Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bio-plastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti and Pseudomonas putida, allows the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates the functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

  13. Methods for the isolation of genes encoding novel PHB cycle enzymes from complex microbial communities.

    Science.gov (United States)

    Nordeste, Ricardo F; Trainer, Maria A; Charles, Trevor C

    2010-01-01

    Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bioplastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti allows for the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates finding functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

  14. Identification of human circadian genes based on time course gene expression profiles by using a deep learning method.

    Science.gov (United States)

    Cui, Peng; Zhong, Tingyan; Wang, Zhuo; Wang, Tao; Zhao, Hongyu; Liu, Chenglin; Lu, Hui

    2018-06-01

    Circadian genes express periodically in an approximate 24-h period and the identification and study of these genes can provide deep understanding of the circadian control which plays significant roles in human health. Although many circadian gene identification algorithms have been developed, large numbers of false positives and low coverage are still major problems in this field. In this study we constructed a novel computational framework for circadian gene identification using deep neural networks (DNN) - a deep learning algorithm which can represent the raw form of data patterns without imposing assumptions on the expression distribution. Firstly, we transformed time-course gene expression data into categorical-state data to denote the changing trend of gene expression. Two distinct expression patterns emerged after clustering of the state data for circadian genes from our manually created learning dataset. DNN was then applied to discriminate the aperiodic genes and the two subtypes of periodic genes. In order to assess the performance of DNN, four commonly used machine learning methods including k-nearest neighbors, logistic regression, naïve Bayes, and support vector machines were used for comparison. The results show that the DNN model achieves the best balanced precision and recall. Next, we conducted large scale circadian gene detection using the trained DNN model for the remaining transcription profiles. Comparing with JTK_CYCLE and a study performed by Möller-Levet et al. (doi: https://doi.org/10.1073/pnas.1217154110), we identified 1132 novel periodic genes. Through the functional analysis of these novel circadian genes, we found that the GTPase superfamily exhibits distinct circadian expression patterns and may provide a molecular switch of circadian control of the functioning of the immune system in human blood. Our study provides novel insights into both the circadian gene identification field and the study of complex circadian-driven biological

  15. The All Particle Method: 1991 status report

    International Nuclear Information System (INIS)

    Cullen, D.E.; Ballinger, C.T.; Perkins, S.T.

    1991-07-01

    At the present time a Monte Carlo transport computer code is being designed and implemented at Lawrence Livermore National Laboratory to include the transport of: neutrons, photons, electrons and light charged particles as well as the coupling between all species of particles, e.g. photon induced electron emission. Since this code is being designed to handle all particles, this approach is called the ''All Particle Method.'' This paper describes the current design philosophy and status of the Monte Carlo transport code and its supporting data bases. The treatment of neutrons and photons used by the All Particle Method code is conventional and as such this topic will not be discussed in this paper. Here emphasis is on discussion of our recent work to extend our ability to perform electron transport, as well as photon transport, as it is effected by coupling to electron transport, and atomic relaxation. First we discuss our new extended photon and electron interaction and atomic relaxation data bases. Next we illustrate the extended capabilities that these new data bases provide by presenting the results of several Monte Carlo transport calculations

  16. Two-Way Gene Interaction From Microarray Data Based on Correlation Methods.

    Science.gov (United States)

    Alavi Majd, Hamid; Talebi, Atefeh; Gilany, Kambiz; Khayyer, Nasibeh

    2016-06-01

    Gene networks have generated a massive explosion in the development of high-throughput techniques for monitoring various aspects of gene activity. Networks offer a natural way to model interactions between genes, and extracting gene network information from high-throughput genomic data is an important and difficult task. The purpose of this study is to construct a two-way gene network based on parametric and nonparametric correlation coefficients. The first step in constructing a Gene Co-expression Network is to score all pairs of gene vectors. The second step is to select a score threshold and connect all gene pairs whose scores exceed this value. In the foundation-application study, we constructed two-way gene networks using nonparametric methods, such as Spearman's rank correlation coefficient and Blomqvist's measure, and compared them with Pearson's correlation coefficient. We surveyed six genes of venous thrombosis disease, made a matrix entry representing the score for the corresponding gene pair, and obtained two-way interactions using Pearson's correlation, Spearman's rank correlation, and Blomqvist's coefficient. Finally, these methods were compared with Cytoscape, based on BIND, and Gene Ontology, based on molecular function visual methods; R software version 3.2 and Bioconductor were used to perform these methods. Based on the Pearson and Spearman correlations, the results were the same and were confirmed by Cytoscape and GO visual methods; however, Blomqvist's coefficient was not confirmed by visual methods. Some results of the correlation coefficients are not the same with visualization. The reason may be due to the small number of data.

  17. Method for Screening Compounds That Influence Virulence Gene Expression in Staphylococcus aureus

    DEFF Research Database (Denmark)

    Nielsen, A.; Nielsen, Kristian Fog; Frees, D.

    2010-01-01

    We present a simple assay to examine effects of compounds on virulence gene expression in the human pathogen Staphylococcus aureus. The assay employs transcriptional reporter strains carrying lacZ fused to central virulence genes. Compounds affecting virulence gene expression and activity...... of the agr locus are scored based on color change in the presence of a chromogenic beta-galactosidase substrate. The assay can be used to screen for novel antivirulence compounds from many different sources, such as fungi, as demonstrated here....

  18. Noninvasive imaging of transplanted living functional cells transfected with a reporter estrogen receptor gene

    Energy Technology Data Exchange (ETDEWEB)

    Takamatsu, Shinji [Biomedical Imaging Research Center, University of Fukui, 23-3 Shimoaizuki, Matsuoka, Yoshida, Fukui 910-1193 (Japan)]. E-mail: shinjit@fmsrsa.fukui-med.ac.jp; Furukawa, Takako [Biomedical Imaging Research Center, University of Fukui, 23-3 Shimoaizuki, Matsuoka, Yoshida, Fukui 910-1193 (Japan); Mori, Tetsuya [Biomedical Imaging Research Center, University of Fukui, 23-3 Shimoaizuki, Matsuoka, Yoshida, Fukui 910-1193 (Japan); Yonekura, Yoshiharu [Biomedical Imaging Research Center, University of Fukui, 23-3 Shimoaizuki, Matsuoka, Yoshida, Fukui 910-1193 (Japan); Fujibayashi, Yasuhisa [Biomedical Imaging Research Center, University of Fukui, 23-3 Shimoaizuki, Matsuoka, Yoshida, Fukui 910-1193 (Japan)

    2005-11-01

    The transplantation of functional cells such as dopaminergic cells into damaged tissue is now clinically ongoing, but at present the population of surviving cells at the transplantation site mostly cannot be noninvasively examined. To visualize surviving transplanted functional cells using a noninvasive method, we chose the estrogen receptor ligand binding domain (ERL) as a reporter molecule and 16{alpha}-[{sup 18}F]-fluoro-17{beta}-estradiol (FES) for its ligand. We used a mouse embryonic stem (ES) cell line for recipient cells as a model. To obtain ES cells that constitutively or inducibly express ERL, we transfected two types of expression vectors into EB5 parental ES cell line using the lipofection method and obtained about 30 clones for each of the two types of transfectants. Then, to examine the expression level of ERL, we performed Western blotting analysis. Ligand uptake experiments were carried out using [{sup 3}H]-estradiol with or without excessive unlabeled estradiol for control cells and ERL transfectants. Each selected clone was also used for in vivo positron emission tomography (PET) imaging studies involving FES in nude mice transplanted with control cells and ERL transfectants. In some of the clones transfected with the inducible-type ERL gene, protein was expressed much higher than in the controls. However, constitutive-type ERL gene-transfected ES cells showed no protein production in spite of their gene expression activity being considerably high. All clones also expressed equal levels of the Oct-3/4 gene, a marker of pluripotency, in comparison with the parental cells. Also, the specific uptake of [{sup 3}H]-estradiol was over 30 times higher in inducer-treated ERL-expressing ES cells compared to untreated control cells. Finally, by performing dynamic PET imaging, we successfully visualized ERL-expressing teratomas using FES.

  19. Noninvasive imaging of transplanted living functional cells transfected with a reporter estrogen receptor gene

    International Nuclear Information System (INIS)

    Takamatsu, Shinji; Furukawa, Takako; Mori, Tetsuya; Yonekura, Yoshiharu; Fujibayashi, Yasuhisa

    2005-01-01

    The transplantation of functional cells such as dopaminergic cells into damaged tissue is now clinically ongoing, but at present the population of surviving cells at the transplantation site mostly cannot be noninvasively examined. To visualize surviving transplanted functional cells using a noninvasive method, we chose the estrogen receptor ligand binding domain (ERL) as a reporter molecule and 16α-[ 18 F]-fluoro-17β-estradiol (FES) for its ligand. We used a mouse embryonic stem (ES) cell line for recipient cells as a model. To obtain ES cells that constitutively or inducibly express ERL, we transfected two types of expression vectors into EB5 parental ES cell line using the lipofection method and obtained about 30 clones for each of the two types of transfectants. Then, to examine the expression level of ERL, we performed Western blotting analysis. Ligand uptake experiments were carried out using [ 3 H]-estradiol with or without excessive unlabeled estradiol for control cells and ERL transfectants. Each selected clone was also used for in vivo positron emission tomography (PET) imaging studies involving FES in nude mice transplanted with control cells and ERL transfectants. In some of the clones transfected with the inducible-type ERL gene, protein was expressed much higher than in the controls. However, constitutive-type ERL gene-transfected ES cells showed no protein production in spite of their gene expression activity being considerably high. All clones also expressed equal levels of the Oct-3/4 gene, a marker of pluripotency, in comparison with the parental cells. Also, the specific uptake of [ 3 H]-estradiol was over 30 times higher in inducer-treated ERL-expressing ES cells compared to untreated control cells. Finally, by performing dynamic PET imaging, we successfully visualized ERL-expressing teratomas using FES

  20. Application of biclustering of gene expression data and gene set enrichment analysis methods to identify potentially disease causing nanomaterials

    Directory of Open Access Journals (Sweden)

    Andrew Williams

    2015-12-01

    Full Text Available Background: The presence of diverse types of nanomaterials (NMs in commerce is growing at an exponential pace. As a result, human exposure to these materials in the environment is inevitable, necessitating the need for rapid and reliable toxicity testing methods to accurately assess the potential hazards associated with NMs. In this study, we applied biclustering and gene set enrichment analysis methods to derive essential features of altered lung transcriptome following exposure to NMs that are associated with lung-specific diseases. Several datasets from public microarray repositories describing pulmonary diseases in mouse models following exposure to a variety of substances were examined and functionally related biclusters of genes showing similar expression profiles were identified. The identified biclusters were then used to conduct a gene set enrichment analysis on pulmonary gene expression profiles derived from mice exposed to nano-titanium dioxide (nano-TiO2, carbon black (CB or carbon nanotubes (CNTs to determine the disease significance of these data-driven gene sets.Results: Biclusters representing inflammation (chemokine activity, DNA binding, cell cycle, apoptosis, reactive oxygen species (ROS and fibrosis processes were identified. All of the NM studies were significant with respect to the bicluster related to chemokine activity (DAVID; FDR p-value = 0.032. The bicluster related to pulmonary fibrosis was enriched in studies where toxicity induced by CNT and CB studies was investigated, suggesting the potential for these materials to induce lung fibrosis. The pro-fibrogenic potential of CNTs is well established. Although CB has not been shown to induce fibrosis, it induces stronger inflammatory, oxidative stress and DNA damage responses than nano-TiO2 particles.Conclusion: The results of the analysis correctly identified all NMs to be inflammogenic and only CB and CNTs as potentially fibrogenic. In addition to identifying several

  1. Comparative analysis of clustering methods for gene expression time course data

    Directory of Open Access Journals (Sweden)

    Ivan G. Costa

    2004-01-01

    Full Text Available This work performs a data driven comparative study of clustering methods used in the analysis of gene expression time courses (or time series. Five clustering methods found in the literature of gene expression analysis are compared: agglomerative hierarchical clustering, CLICK, dynamical clustering, k-means and self-organizing maps. In order to evaluate the methods, a k-fold cross-validation procedure adapted to unsupervised methods is applied. The accuracy of the results is assessed by the comparison of the partitions obtained in these experiments with gene annotation, such as protein function and series classification.

  2. Transient expression of β-glucuronidase reporter gene in ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-18

    May 18, 2009 ... Therefore, special attention must be given to the use of genetic manipulation for .... of gus gene was used as a visual marker in transformation. Bacteria ... selective culture (SC) medium containing 200 mg/l carbenicillin and. 50 mg/l .... clones had caused the difference of host-plant response to bacterial ...

  3. Network-Based Method for Identifying Co- Regeneration Genes in Bone, Dentin, Nerve and Vessel Tissues.

    Science.gov (United States)

    Chen, Lei; Pan, Hongying; Zhang, Yu-Hang; Feng, Kaiyan; Kong, XiangYin; Huang, Tao; Cai, Yu-Dong

    2017-10-02

    Bone and dental diseases are serious public health problems. Most current clinical treatments for these diseases can produce side effects. Regeneration is a promising therapy for bone and dental diseases, yielding natural tissue recovery with few side effects. Because soft tissues inside the bone and dentin are densely populated with nerves and vessels, the study of bone and dentin regeneration should also consider the co-regeneration of nerves and vessels. In this study, a network-based method to identify co-regeneration genes for bone, dentin, nerve and vessel was constructed based on an extensive network of protein-protein interactions. Three procedures were applied in the network-based method. The first procedure, searching, sought the shortest paths connecting regeneration genes of one tissue type with regeneration genes of other tissues, thereby extracting possible co-regeneration genes. The second procedure, testing, employed a permutation test to evaluate whether possible genes were false discoveries; these genes were excluded by the testing procedure. The last procedure, screening, employed two rules, the betweenness ratio rule and interaction score rule, to select the most essential genes. A total of seventeen genes were inferred by the method, which were deemed to contribute to co-regeneration of at least two tissues. All these seventeen genes were extensively discussed to validate the utility of the method.

  4. A systemic gene silencing method suitable for high throughput, reverse genetic analyses of gene function in fern gametophytes

    Directory of Open Access Journals (Sweden)

    Tanurdzic Milos

    2004-04-01

    Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.

  5. Rapid and sensitive reporter gene assays for detection of antiandrogenic and estrogenic effects of environmental chemicals

    DEFF Research Database (Denmark)

    Vinggaard, Anne; Jørgensen, E.C.B.; Larsen, John Christian

    1999-01-01

    Reports on increasing incidences in developmental abnormalities of the human male reproductive tract and the recent identifications of environmental chemicals with antiandrogenic activity necessitate the screening of a larger number of compounds in order to get an overview of potential antiandrog......Reports on increasing incidences in developmental abnormalities of the human male reproductive tract and the recent identifications of environmental chemicals with antiandrogenic activity necessitate the screening of a larger number of compounds in order to get an overview of potential...... antiandrogenic chemicals present in our environment. Thus, there is a great need for an effective in vitro screening method for (anti)androgenic chemicals. We have developed a rapid, sensitive, and reproducible reporter gene assay for detection of antiandrogenic chemicals. Chinese Hamster Ovary cells were...... calcium phosphate transfection method, this method has the advantage of being more feasible, as the assay can be scaled down to the microtiter plate format. Furthermore, the transfection reagent is noncytotoxic, allowing its addition together with the test compounds thereby reducing the hands...

  6. A Comparative Study of Feature Selection and Classification Methods for Gene Expression Data

    KAUST Repository

    Abusamra, Heba

    2013-01-01

    Different experiments have been applied to compare the performance of the classification methods with and without performing feature selection. Results revealed the important role of feature selection in classifying gene expression data. By performing feature selection, the classification accuracy can be significantly boosted by using a small number of genes. The relationship of features selected in different feature selection methods is investigated and the most frequent features selected in each fold among all methods for both datasets are evaluated.

  7. Effect of secretory pathway gene overexpression on secretion of a fluorescent reporter protein in Aspergillus nidulans

    DEFF Research Database (Denmark)

    Schalén, Martin; Anyaogu, Diana Chinyere; Hoof, Jakob Blæsbjerg

    2016-01-01

    roles in the process have been identified through transcriptomics. The assignment of function to these genes has been enabled in combination with gene deletion studies. In this work, 14 genes known to play a role in protein secretion in filamentous fungi were overexpressed in Aspergillus nidulans....... The background strain was a fluorescent reporter secreting mRFP. The overall effect of the overexpressions could thus be easily monitored through fluorescence measurements, while the effects on physiology were determined in batch cultivations and surface growth studies. Results: Fourteen protein secretion...... pathway related genes were overexpressed with a tet-ON promoter in the RFP-secreting reporter strain and macromorphology, physiology and protein secretion were monitored when the secretory genes were induced. Overexpression of several of the chosen genes was shown to cause anomalies on growth, micro...

  8. Effect of external and internal factors on the expression of reporter genes driven by the N resistance gene promoter.

    Science.gov (United States)

    Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor

    2013-07-01

    The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.

  9. Inventory of LCIA selection methods for assessing toxic releases. Methods and typology report part B

    DEFF Research Database (Denmark)

    Larsen, Henrik Fred; Birkved, Morten; Hauschild, Michael Zwicky

    method(s) in Work package 8 (WP8) of the OMNIITOX project. The selection methods and the other CRS methods are described in detail, a set of evaluation criteria are developed and the methods are evaluated against these criteria. This report (Deliverable 11B (D11B)) gives the results from task 7.1d, 7.1e......This report describes an inventory of Life Cycle Impact Assessment (LCIA) selection methods for assessing toxic releases. It consists of an inventory of current selection methods and other Chemical Ranking and Scoring (CRS) methods assessed to be relevant for the development of (a) new selection...... and 7.1f of WP 7 for selection methods. The other part of D11 (D11A) is reported in another report and deals with characterisation methods. A selection method is a method for prioritising chemical emissions to be included in an LCIA characterisation of toxic releases, i.e. calculating indicator scores...

  10. A Novel ‘Gene Insertion/Marker Out’ (GIMO) Method for Transgene Expression and Gene Complementation in Rodent Malaria Parasites

    Science.gov (United States)

    Sajid, Mohammed; Chevalley-Maurel, Séverine; Ramesar, Jai; Klop, Onny; Franke-Fayard, Blandine M. D.; Janse, Chris J.; Khan, Shahid M.

    2011-01-01

    Research on the biology of malaria parasites has greatly benefited from the application of reverse genetic technologies, in particular through the analysis of gene deletion mutants and studies on transgenic parasites that express heterologous or mutated proteins. However, transfection in Plasmodium is limited by the paucity of drug-selectable markers that hampers subsequent genetic modification of the same mutant. We report the development of a novel ‘gene insertion/marker out’ (GIMO) method for two rodent malaria parasites, which uses negative selection to rapidly generate transgenic mutants ready for subsequent modifications. We have created reference mother lines for both P. berghei ANKA and P. yoelii 17XNL that serve as recipient parasites for GIMO-transfection. Compared to existing protocols GIMO-transfection greatly simplifies and speeds up the generation of mutants expressing heterologous proteins, free of drug-resistance genes, and requires far fewer laboratory animals. In addition we demonstrate that GIMO-transfection is also a simple and fast method for genetic complementation of mutants with a gene deletion or mutation. The implementation of GIMO-transfection procedures should greatly enhance Plasmodium reverse-genetic research. PMID:22216235

  11. Transient expression of β-glucuronidase reporter gene in ...

    African Journals Online (AJOL)

    Agrobacterium tumefaciens strain LBA4404 carrying the pBI.121 binary plasmid was used in transformation to introduce the gus (ß-glucuronidase/GUS) gene into teak shoot-tissues. In vitro regenerated shoots from various teak clones, i.e. the ITB, GT, P97, P96, P75, P20, and P108 clones were vacuum-infiltrated for 5 min in ...

  12. Methods and compositions for controlling gene expression by RNA processing

    Science.gov (United States)

    Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.

    2017-08-29

    The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.

  13. Molecular Imaging of Human Embryonic Stem Cells Stably Expressing Human PET Reporter Genes After Zinc Finger Nuclease-Mediated Genome Editing.

    Science.gov (United States)

    Wolfs, Esther; Holvoet, Bryan; Ordovas, Laura; Breuls, Natacha; Helsen, Nicky; Schönberger, Matthias; Raitano, Susanna; Struys, Tom; Vanbilloen, Bert; Casteels, Cindy; Sampaolesi, Maurilio; Van Laere, Koen; Lambrichts, Ivo; Verfaillie, Catherine M; Deroose, Christophe M

    2017-10-01

    Molecular imaging is indispensable for determining the fate and persistence of engrafted stem cells. Standard strategies for transgene induction involve the use of viral vectors prone to silencing and insertional mutagenesis or the use of nonhuman genes. Methods: We used zinc finger nucleases to induce stable expression of human imaging reporter genes into the safe-harbor locus adeno-associated virus integration site 1 in human embryonic stem cells. Plasmids were generated carrying reporter genes for fluorescence, bioluminescence imaging, and human PET reporter genes. Results: In vitro assays confirmed their functionality, and embryonic stem cells retained differentiation capacity. Teratoma formation assays were performed, and tumors were imaged over time with PET and bioluminescence imaging. Conclusion: This study demonstrates the application of genome editing for targeted integration of human imaging reporter genes in human embryonic stem cells for long-term molecular imaging. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.

  14. Gene set analysis: limitations in popular existing methods and proposed improvements.

    Science.gov (United States)

    Mishra, Pashupati; Törönen, Petri; Leino, Yrjö; Holm, Liisa

    2014-10-01

    Gene set analysis is the analysis of a set of genes that collectively contribute to a biological process. Most popular gene set analysis methods are based on empirical P-value that requires large number of permutations. Despite numerous gene set analysis methods developed in the past decade, the most popular methods still suffer from serious limitations. We present a gene set analysis method (mGSZ) based on Gene Set Z-scoring function (GSZ) and asymptotic P-values. Asymptotic P-value calculation requires fewer permutations, and thus speeds up the gene set analysis process. We compare the GSZ-scoring function with seven popular gene set scoring functions and show that GSZ stands out as the best scoring function. In addition, we show improved performance of the GSA method when the max-mean statistics is replaced by the GSZ scoring function. We demonstrate the importance of both gene and sample permutations by showing the consequences in the absence of one or the other. A comparison of asymptotic and empirical methods of P-value estimation demonstrates a clear advantage of asymptotic P-value over empirical P-value. We show that mGSZ outperforms the state-of-the-art methods based on two different evaluations. We compared mGSZ results with permutation and rotation tests and show that rotation does not improve our asymptotic P-values. We also propose well-known asymptotic distribution models for three of the compared methods. mGSZ is available as R package from cran.r-project.org. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  15. A method for CRISPR/Cas9 mutation of genes in fathead minnow

    Science.gov (United States)

    Product Description: CRISPR/Cas9 is a system that can be used to disrupt a gene of interest in any animal. It allows us to study each gene’s role by observing changes in the animal when the gene isn’t functional. We worked out a method to use this technology in the f...

  16. Dual-therapeutic reporter genes fusion for enhanced cancer gene therapy and imaging.

    Science.gov (United States)

    Sekar, T V; Foygel, K; Willmann, J K; Paulmurugan, R

    2013-05-01

    Two of the successful gene-directed enzyme prodrug therapies include herpes simplex virus-thymidine kinase (HSV1-TK) enzyme-ganciclovir prodrug and the Escherichia coli nitroreductase (NTR) enzyme-CB1954 prodrug strategies; these enzyme-prodrug combinations produce activated cytotoxic metabolites of the prodrugs capable of tumor cell death by inhibiting DNA synthesis and killing quiescent cells, respectively. Both these strategies also affect significant bystander cell killing of neighboring tumor cells that do not express these enzymes. We have developed a dual-combination gene strategy, where we identified HSV1-TK and NTR fused in a particular orientation can effectively kill tumor cells when the tumor cells are treated with a fusion HSV1-TK-NTR gene- along with a prodrug combination of GCV and CB1954. In order to determine whether the dual-system demonstrate superior therapeutic efficacy than either HSV1-TK or NTR systems alone, we conducted both in vitro and in vivo tumor xenograft studies using triple negative SUM159 breast cancer cells, by evaluating the efficacy of cell death by apoptosis and necrosis upon treatment with the dual HSV1-TK genes-GCV-CB1954 prodrugs system, and compared the efficiency to HSV1-TK-GCV and NTR-CB1954. Our cell-based studies, tumor regression studies in xenograft mice, histological analyses of treated tumors and bystander studies indicate that the dual HSV1-TK-NTR-prodrug system is two times more efficient even with half the doses of both prodrugs than the respective single gene-prodrug system, as evidenced by enhanced apoptosis and necrosis of tumor cells in vitro in culture and xenograft of tumor tissues in animals.

  17. Autoradiography study and SPECT imaging of reporter gene HSV1-tk expression in heart

    Energy Technology Data Exchange (ETDEWEB)

    Lan Xiaoli [Department of Nuclear Medicine, Union Hospital, Tongji Medical College of Huazhong University of Science and Technology, Hubei Province Key Laboratory of Molecular Imaging, Wuhan, Hubei Province, 430022 (China)], E-mail: LXL730724@hotmail.com; Liu Ying; He Yong; Wu Tao; Zhang Binqing; Gao Zairong; An Rui [Department of Nuclear Medicine, Union Hospital, Tongji Medical College of Huazhong University of Science and Technology, Hubei Province Key Laboratory of Molecular Imaging, Wuhan, Hubei Province, 430022 (China); Zhang Yongxue [Department of Nuclear Medicine, Union Hospital, Tongji Medical College of Huazhong University of Science and Technology, Hubei Province Key Laboratory of Molecular Imaging, Wuhan, Hubei Province, 430022 (China)], E-mail: zhyx1229@163.com

    2010-04-15

    Aim: To demonstrate the feasibility and optimal conditions of imaging herpes simplex virus 1-thymidine kinase (HSV1-tk) gene transferred into hearts with {sup 131}I-2'-fluoro-2'-deoxy-1-{beta}-D-arabinofuranosyl-5-iodouracil ({sup 131}I-FIAU) using autoradiography (ARG) and single photon emission computed tomography (SPECT) in animal models. Methods: HSV1-tk inserted into adenovirus vector (Ad5-tk) and adenovirus (Ad5-null) was prepared. Rats or rabbits were divided into a study group receiving intramyocardial injection of Ad5-tk, and a control group receiving Ad-null injection. In the study group of rats, two sets of experiments, time-course study and dose-dependence study, were performed. In time-course experiments, rats were injected with {sup 131}I-FIAU on Days 1, 2, 3, 5 and 7, after transfection of 1x10{sup 8} pfu Ad5-tk, to study the feasibility and suitable time course for reporter gene imaging. In dose-dependence study, various titers of Ad5-tk (5x10{sup 8}, 1x10{sup 8}, 5x10{sup 7} and 1x10{sup 7} pfu) were used to determine the threshold and optimal viral titer needed for detection of gene expression. The gamma counts of hearts were measured. The rat myocardium was analyzed by ARG and reverse transcriptase-polymerase chain reaction (RT-PCR). SPECT whole-body planar imaging and cardiac tomographic imaging were performed in the rabbit models. Results: From the ARG images, rats injected with Ad5-tk showed significant {sup 131}I-FIAU activity in the anterolateral wall compared with background signals seen in the control Ad5-null rats. In time-course study, the highest radioactivity in the focal myocardium could be seen on Day 1, and then progressively declined with time. In dose-dependence study, the level of {sup 131}I-FIAU accumulation in the transfected myocardium declined with the decrease of Ad viral titers. From the ARG analysis and gamma counting, the threshold viral titer was 5x10{sup 7} pfu, and the optimal Ad titer was 1x10{sup 8} pfu

  18. Statistical Genetics Methods for Localizing Multiple Breast Cancer Genes

    National Research Council Canada - National Science Library

    Ott, Jurg

    1998-01-01

    .... For a number of variables measured on a trait, a method, principal components of heritability, was developed that combines these variables in such a way that the resulting linear combination has highest heritability...

  19. An Entropy-based gene selection method for cancer classification using microarray data

    Directory of Open Access Journals (Sweden)

    Krishnan Arun

    2005-03-01

    Full Text Available Abstract Background Accurate diagnosis of cancer subtypes remains a challenging problem. Building classifiers based on gene expression data is a promising approach; yet the selection of non-redundant but relevant genes is difficult. The selected gene set should be small enough to allow diagnosis even in regular clinical laboratories and ideally identify genes involved in cancer-specific regulatory pathways. Here an entropy-based method is proposed that selects genes related to the different cancer classes while at the same time reducing the redundancy among the genes. Results The present study identifies a subset of features by maximizing the relevance and minimizing the redundancy of the selected genes. A merit called normalized mutual information is employed to measure the relevance and the redundancy of the genes. In order to find a more representative subset of features, an iterative procedure is adopted that incorporates an initial clustering followed by data partitioning and the application of the algorithm to each of the partitions. A leave-one-out approach then selects the most commonly selected genes across all the different runs and the gene selection algorithm is applied again to pare down the list of selected genes until a minimal subset is obtained that gives a satisfactory accuracy of classification. The algorithm was applied to three different data sets and the results obtained were compared to work done by others using the same data sets Conclusion This study presents an entropy-based iterative algorithm for selecting genes from microarray data that are able to classify various cancer sub-types with high accuracy. In addition, the feature set obtained is very compact, that is, the redundancy between genes is reduced to a large extent. This implies that classifiers can be built with a smaller subset of genes.

  20. The construction and identification of hypoxia-regulated recombinant plasmid with reporter gene hNIS

    International Nuclear Information System (INIS)

    Hu Qunchao; Wu Jinchang; Zhou Jundong; Gu Ke

    2011-01-01

    Objective: To construct pShuttle-5 × HRE-CMV-NIS recombinant plasmid regulated by hypoxia-responsive element, which can possibly by used to detect the expression of hypoxia induced factor-α (HIF-1α) gene under hypoxia condition. Methods: Artificially synthesize the nucleotide sequences of five copies of hypoxia response elements (HREs) were cloned into pGL3-promoter vector to construct pGL3-promoter-5 × HRE vector. Human sodium/iodide symporter (hNIS) gene cDNA was amplified from human genome by RT-PCR, and subcloned into pGL3-promoter-5 × HRE vector then was sequenced. After treated with CoCl 2 as hypoxia mimic, HEK293 cells were transfected with recombinant plasmid with hNIS gene, while cells treated with DMSO as the control. Meanwhile, pcDNA3.1-HIF-1α and recombinant hNIS gene vectors were transfected into HEK293 cells at the ratio of 3 to 1, while co-transfection with pcDNA3.1 and pShuttle-NIS vectors cells were taken as the control. NIS mRNA expression was analyzed by qRT-PCR while function of NIS protein was tested by 99m TcO 4 - -uptake. Results: The sequence data of hNIS gene in recombinant plasmid were in accordance with those reported in the literatures. Compared with control groups, HEK293 cells co-transfected with both pShuttle-5 × HRE-CMV-NIS and HIF-1α gene vectors and CoCl 2 -treated after pShuttle-NIS transfecting presented higher mRNA expressions of NIS and 99m TcO 4 - uptake (P<0.01). Conclusion: HIF-1α can be bound to and activate pShuttle-5 × HRE-CMV-NIS in cells to accumulate radioactive nuclide 99m TcO 4 - and this technique is potential for detection of expression and activity of HIF-1α, the indicator of cell hypoxia. (authors)

  1. A relative variation-based method to unraveling gene regulatory networks.

    Directory of Open Access Journals (Sweden)

    Yali Wang

    Full Text Available Gene regulatory network (GRN reconstruction is essential in understanding the functioning and pathology of a biological system. Extensive models and algorithms have been developed to unravel a GRN. The DREAM project aims to clarify both advantages and disadvantages of these methods from an application viewpoint. An interesting yet surprising observation is that compared with complicated methods like those based on nonlinear differential equations, etc., methods based on a simple statistics, such as the so-called Z-score, usually perform better. A fundamental problem with the Z-score, however, is that direct and indirect regulations can not be easily distinguished. To overcome this drawback, a relative expression level variation (RELV based GRN inference algorithm is suggested in this paper, which consists of three major steps. Firstly, on the basis of wild type and single gene knockout/knockdown experimental data, the magnitude of RELV of a gene is estimated. Secondly, probability for the existence of a direct regulation from a perturbed gene to a measured gene is estimated, which is further utilized to estimate whether a gene can be regulated by other genes. Finally, the normalized RELVs are modified to make genes with an estimated zero in-degree have smaller RELVs in magnitude than the other genes, which is used afterwards in queuing possibilities of the existence of direct regulations among genes and therefore leads to an estimate on the GRN topology. This method can in principle avoid the so-called cascade errors under certain situations. Computational results with the Size 100 sub-challenges of DREAM3 and DREAM4 show that, compared with the Z-score based method, prediction performances can be substantially improved, especially the AUPR specification. Moreover, it can even outperform the best team of both DREAM3 and DREAM4. Furthermore, the high precision of the obtained most reliable predictions shows that the suggested algorithm may be

  2. A general method for identifying major hybrid male sterility genes in Drosophila.

    Science.gov (United States)

    Zeng, L W; Singh, R S

    1995-10-01

    The genes responsible for hybrid male sterility in species crosses are usually identified by introgressing chromosome segments, monitored by visible markers, between closely related species by continuous backcrosses. This commonly used method, however, suffers from two problems. First, it relies on the availability of markers to monitor the introgressed regions and so the portion of the genome examined is limited to the marked regions. Secondly, the introgressed regions are usually large and it is impossible to tell if the effects of the introgressed regions are the result of single (or few) major genes or many minor genes (polygenes). Here we introduce a simple and general method for identifying putative major hybrid male sterility genes which is free of these problems. In this method, the actual hybrid male sterility genes (rather than markers), or tightly linked gene complexes with large effects, are selectively introgressed from one species into the background of another species by repeated backcrosses. This is performed by selectively backcrossing heterozygous (for hybrid male sterility gene or genes) females producing fertile and sterile sons in roughly equal proportions to males of either parental species. As no marker gene is required for this procedure, this method can be used with any species pairs that produce unisexual sterility. With the application of this method, a small X chromosome region of Drosophila mauritiana which produces complete hybrid male sterility (aspermic testes) in the background of D. simulans was identified. Recombination analysis reveals that this region contains a second major hybrid male sterility gene linked to the forked locus located at either 62.7 +/- 0.66 map units or at the centromere region of the X chromosome of D. mauritiana.

  3. A fast, simple method for screening radiation susceptibility genes by RNA interference

    International Nuclear Information System (INIS)

    Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Otsuki, Marika; Miyagishi, Makoto; Taira, Kazunari; Imai, Takashi; Harada, Yoshi-nobu

    2005-01-01

    Radiotherapy can cause unacceptable levels of damage to normal tissues in some cancer patients. To understand the molecular mechanisms underlying radiation-induced physiological responses, and to be able to predict the radiation susceptibility of normal tissues in individual patients, it is important to identify a comprehensive set of genes responsible for radiation susceptibility. We have developed a simple and rapid 96-well screening protocol using cell proliferation assays and RNA interference to identify genes associated with radiation susceptibility. We evaluated the performance of alamarBlue-, BrdU-, and sulforhodamine B-based cell proliferation assays using the 96-well format. Each proliferation assay detected the known radiation susceptibility gene, PRKDC. In a trial screen using 28 shRNA vectors, another known gene, CDKN1A, and one new radiation susceptibility gene, ATP5G3, were identified. Our results indicate that this method may be useful for large-scale screens designed to identify novel radiation susceptibility genes

  4. Molecular methods for bacterial genotyping and analyzed gene regions

    Directory of Open Access Journals (Sweden)

    İbrahim Halil Yıldırım1, Seval Cing Yıldırım2, Nadir Koçak3

    2011-06-01

    Full Text Available Bacterial strain typing is an important process for diagnosis, treatment and epidemiological investigations. Current bacterial strain typing methods may be classified into two main categories: phenotyping and genotyping. Phenotypic characters are the reflection of genetic contents. Genotyping, which refers discrimination of bacterial strains based on their genetic content, has recently become widely used for bacterial strain typing. The methods already used in genotypingof bacteria are quite different from each other. In this review we tried to summarize the basic principles of DNA-based methods used in genotyping of bacteria and describe some important DNA regions that are used in genotyping of bacteria. J Microbiol Infect Dis 2011;1(1:42-46.

  5. Gene polymorphisms in association with self-reported stroke in US adults

    Directory of Open Access Journals (Sweden)

    Amy Z Fan

    2010-03-01

    Full Text Available Amy Z Fan1, Jing Fang1, Ajay Yesupriya2, Man-huei Chang2, Greta Kilmer1, Meaghan House3, Donald Hayes1, Renée M Ned2, Nicole F Dowling2, Ali H Mokdad1 1National Center for Chronic Disease Prevention and Health Promotion, Centers for Disease Control and Prevention, Atlanta, GA, USA; 2Office of Public Health Genomics, Coordinating Center for Health Promotion, Centers for Disease Control and Prevention, Atlanta, GA, USA; 3School of Public Health, Emory University, Atlanta, GA, USAPurpose: Epidemiologic studies suggest that several gene variants increase the risk of stroke, and population-based studies help provide further evidence. We identified polymorphisms associated with the prevalence of self-reported stroke in US populations using a representative sample.Methods: Our sample comprised US adults in the Third National Health and Nutrition Examination (NHANES III DNA bank. We examined nine candidate gene variants within ACE, F2, F5, ITGA2, MTHFR, and NOS3 for associations with self-reported stroke. We used multivariate regression and Cox proportional hazards models to test the association between these variants and history of stroke.Results: In regression models, the rs4646994 variant of ACE (I/I and I/D genotypes was associated with higher prevalence adjusted prevalence odds ratio [APOR] = 2.66 [1.28, 5.55] and 2.23 [1.30, 3.85], respectively compared with the D/D genotype. The heterozygous genotype of MTHFR rs1801131 (A/C was associated with lower prevalence of stroke (APOR = 0.48 [0.25, 0.92] compared with A/A and C/C genotypes. For rs2070744 of NOS3, both the C/T genotype (APOR = 1.91 [1.12, 3.27] and C/C genotype (APOR = 3.31 [1.66, 6.60] were associated with higher prevalence of stroke compared with the T/T genotype.Conclusion: Our findings suggest an association between the prevalence of self-reported stroke and polymorphisms in ACE, MTHFR, and NOS3 in a population-based sample. Keywords: stroke, gene, polymorphisms, NHANES III, gene

  6. Novel method to load multiple genes onto a mammalian artificial chromosome.

    Science.gov (United States)

    Tóth, Anna; Fodor, Katalin; Praznovszky, Tünde; Tubak, Vilmos; Udvardy, Andor; Hadlaczky, Gyula; Katona, Robert L

    2014-01-01

    Mammalian artificial chromosomes are natural chromosome-based vectors that may carry a vast amount of genetic material in terms of both size and number. They are reasonably stable and segregate well in both mitosis and meiosis. A platform artificial chromosome expression system (ACEs) was earlier described with multiple loading sites for a modified lambda-integrase enzyme. It has been shown that this ACEs is suitable for high-level industrial protein production and the treatment of a mouse model for a devastating human disorder, Krabbe's disease. ACEs-treated mutant mice carrying a therapeutic gene lived more than four times longer than untreated counterparts. This novel gene therapy method is called combined mammalian artificial chromosome-stem cell therapy. At present, this method suffers from the limitation that a new selection marker gene should be present for each therapeutic gene loaded onto the ACEs. Complex diseases require the cooperative action of several genes for treatment, but only a limited number of selection marker genes are available and there is also a risk of serious side-effects caused by the unwanted expression of these marker genes in mammalian cells, organs and organisms. We describe here a novel method to load multiple genes onto the ACEs by using only two selectable marker genes. These markers may be removed from the ACEs before therapeutic application. This novel technology could revolutionize gene therapeutic applications targeting the treatment of complex disorders and cancers. It could also speed up cell therapy by allowing researchers to engineer a chromosome with a predetermined set of genetic factors to differentiate adult stem cells, embryonic stem cells and induced pluripotent stem (iPS) cells into cell types of therapeutic value. It is also a suitable tool for the investigation of complex biochemical pathways in basic science by producing an ACEs with several genes from a signal transduction pathway of interest.

  7. Novel method to load multiple genes onto a mammalian artificial chromosome.

    Directory of Open Access Journals (Sweden)

    Anna Tóth

    Full Text Available Mammalian artificial chromosomes are natural chromosome-based vectors that may carry a vast amount of genetic material in terms of both size and number. They are reasonably stable and segregate well in both mitosis and meiosis. A platform artificial chromosome expression system (ACEs was earlier described with multiple loading sites for a modified lambda-integrase enzyme. It has been shown that this ACEs is suitable for high-level industrial protein production and the treatment of a mouse model for a devastating human disorder, Krabbe's disease. ACEs-treated mutant mice carrying a therapeutic gene lived more than four times longer than untreated counterparts. This novel gene therapy method is called combined mammalian artificial chromosome-stem cell therapy. At present, this method suffers from the limitation that a new selection marker gene should be present for each therapeutic gene loaded onto the ACEs. Complex diseases require the cooperative action of several genes for treatment, but only a limited number of selection marker genes are available and there is also a risk of serious side-effects caused by the unwanted expression of these marker genes in mammalian cells, organs and organisms. We describe here a novel method to load multiple genes onto the ACEs by using only two selectable marker genes. These markers may be removed from the ACEs before therapeutic application. This novel technology could revolutionize gene therapeutic applications targeting the treatment of complex disorders and cancers. It could also speed up cell therapy by allowing researchers to engineer a chromosome with a predetermined set of genetic factors to differentiate adult stem cells, embryonic stem cells and induced pluripotent stem (iPS cells into cell types of therapeutic value. It is also a suitable tool for the investigation of complex biochemical pathways in basic science by producing an ACEs with several genes from a signal transduction pathway of interest.

  8. A Comparative Study of Feature Selection and Classification Methods for Gene Expression Data

    KAUST Repository

    Abusamra, Heba

    2013-05-01

    Microarray technology has enriched the study of gene expression in such a way that scientists are now able to measure the expression levels of thousands of genes in a single experiment. Microarray gene expression data gained great importance in recent years due to its role in disease diagnoses and prognoses which help to choose the appropriate treatment plan for patients. This technology has shifted a new era in molecular classification, interpreting gene expression data remains a difficult problem and an active research area due to their native nature of “high dimensional low sample size”. Such problems pose great challenges to existing classification methods. Thus, effective feature selection techniques are often needed in this case to aid to correctly classify different tumor types and consequently lead to a better understanding of genetic signatures as well as improve treatment strategies. This thesis aims on a comparative study of state-of-the-art feature selection methods, classification methods, and the combination of them, based on gene expression data. We compared the efficiency of three different classification methods including: support vector machines, k- nearest neighbor and random forest, and eight different feature selection methods, including: information gain, twoing rule, sum minority, max minority, gini index, sum of variances, t- statistics, and one-dimension support vector machine. Five-fold cross validation was used to evaluate the classification performance. Two publicly available gene expression data sets of glioma were used for this study. Different experiments have been applied to compare the performance of the classification methods with and without performing feature selection. Results revealed the important role of feature selection in classifying gene expression data. By performing feature selection, the classification accuracy can be significantly boosted by using a small number of genes. The relationship of features selected in

  9. An ensemble method to predict target genes and pathways in uveal melanoma

    Directory of Open Access Journals (Sweden)

    Wei Chao

    2018-04-01

    Full Text Available This work proposes to predict target genes and pathways for uveal melanoma (UM based on an ensemble method and pathway analyses. Methods: The ensemble method integrated a correlation method (Pearson correlation coefficient, PCC, a causal inference method (IDA and a regression method (Lasso utilizing the Borda count election method. Subsequently, to validate the performance of PIL method, comparisons between confirmed database and predicted miRNA targets were performed. Ultimately, pathway enrichment analysis was conducted on target genes in top 1000 miRNA-mRNA interactions to identify target pathways for UM patients. Results: Thirty eight of the predicted interactions were matched with the confirmed interactions, indicating that the ensemble method was a suitable and feasible approach to predict miRNA targets. We obtained 50 seed miRNA-mRNA interactions of UM patients and extracted target genes from these interactions, such as ASPG, BSDC1 and C4BP. The 601 target genes in top 1,000 miRNA-mRNA interactions were enriched in 12 target pathways, of which Phototransduction was the most significant one. Conclusion: The target genes and pathways might provide a new way to reveal the molecular mechanism of UM and give hand for target treatments and preventions of this malignant tumor.

  10. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

    Science.gov (United States)

    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

    1997-03-01

    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

  11. A novel binary T-vector with the GFP reporter gene for promoter characterization.

    Directory of Open Access Journals (Sweden)

    Shu-Ye Jiang

    Full Text Available Several strategies have been developed to clone PCR fragments into desired vectors. However, most of commercially available T-vectors are not binary vectors and cannot be directly used for Agrobacterium-mediated plant genetic transformation. In this study, a novel binary T-vector was constructed by integrating two AhdI restriction sites into the backbone vector pCAMBIA 1300. The T-vector also contains a GFP reporter gene and thus, can be used to analyze promoter activity by monitoring the reporter gene. On the other hand, identification and characterization of various promoters not only benefit the functional annotation of their genes but also provide alternative candidates to be used to drive interesting genes for plant genetic improvement by transgenesis. More than 1,000 putative pollen-specific rice genes have been identified in a genome-wide level. Among them, 67 highly expressed genes were further characterized. One of the pollen-specific genes LOC_Os10g35930 was further surveyed in its expression patterns with more details by quantitative real-time reverse-transcription PCR (qRT-PCR analysis. Finally, its promoter activity was further investigated by analyzing transgenic rice plants carrying the promoter::GFP cassette, which was constructed from the newly developed T-vector. The reporter GFP gene expression in these transgenic plants showed that the promoter was active only in mature but not in germinated pollens.

  12. A simple and robust method for connecting small-molecule drugs using gene-expression signatures

    Directory of Open Access Journals (Sweden)

    Gant Timothy W

    2008-06-01

    Full Text Available Abstract Background Interaction of a drug or chemical with a biological system can result in a gene-expression profile or signature characteristic of the event. Using a suitably robust algorithm these signatures can potentially be used to connect molecules with similar pharmacological or toxicological properties by gene expression profile. Lamb et al first proposed the Connectivity Map [Lamb et al (2006, Science 313, 1929–1935] to make successful connections among small molecules, genes, and diseases using genomic signatures. Results Here we have built on the principles of the Connectivity Map to present a simpler and more robust method for the construction of reference gene-expression profiles and for the connection scoring scheme, which importantly allows the valuation of statistical significance of all the connections observed. We tested the new method with two randomly generated gene signatures and three experimentally derived gene signatures (for HDAC inhibitors, estrogens, and immunosuppressive drugs, respectively. Our testing with this method indicates that it achieves a higher level of specificity and sensitivity and so advances the original method. Conclusion The method presented here not only offers more principled statistical procedures for testing connections, but more importantly it provides effective safeguard against false connections at the same time achieving increased sensitivity. With its robust performance, the method has potential use in the drug development pipeline for the early recognition of pharmacological and toxicological properties in chemicals and new drug candidates, and also more broadly in other 'omics sciences.

  13. A new computational method for the detection of horizontal gene transfer events.

    Science.gov (United States)

    Tsirigos, Aristotelis; Rigoutsos, Isidore

    2005-01-01

    In recent years, the increase in the amounts of available genomic data has made it easier to appreciate the extent by which organisms increase their genetic diversity through horizontally transferred genetic material. Such transfers have the potential to give rise to extremely dynamic genomes where a significant proportion of their coding DNA has been contributed by external sources. Because of the impact of these horizontal transfers on the ecological and pathogenic character of the recipient organisms, methods are continuously sought that are able to computationally determine which of the genes of a given genome are products of transfer events. In this paper, we introduce and discuss a novel computational method for identifying horizontal transfers that relies on a gene's nucleotide composition and obviates the need for knowledge of codon boundaries. In addition to being applicable to individual genes, the method can be easily extended to the case of clusters of horizontally transferred genes. With the help of an extensive and carefully designed set of experiments on 123 archaeal and bacterial genomes, we demonstrate that the new method exhibits significant improvement in sensitivity when compared to previously published approaches. In fact, it achieves an average relative improvement across genomes of between 11 and 41% compared to the Codon Adaptation Index method in distinguishing native from foreign genes. Our method's horizontal gene transfer predictions for 123 microbial genomes are available online at http://cbcsrv.watson.ibm.com/HGT/.

  14. Benchmarking of methods for identification of antimicrobial resistance genes in bacterial whole genome data

    DEFF Research Database (Denmark)

    Clausen, Philip T. L. C.; Zankari, Ea; Aarestrup, Frank Møller

    2016-01-01

    to two different methods in current use for identification of antibiotic resistance genes in bacterial WGS data. A novel method, KmerResistance, which examines the co-occurrence of k-mers between the WGS data and a database of resistance genes, was developed. The performance of this method was compared...... with two previously described methods; ResFinder and SRST2, which use an assembly/BLAST method and BWA, respectively, using two datasets with a total of 339 isolates, covering five species, originating from the Oxford University Hospitals NHS Trust and Danish pig farms. The predicted resistance...... was compared with the observed phenotypes for all isolates. To challenge further the sensitivity of the in silico methods, the datasets were also down-sampled to 1% of the reads and reanalysed. The best results were obtained by identification of resistance genes by mapping directly against the raw reads...

  15. AGROBEST: an efficient Agrobacterium-mediated transient expression method for versatile gene function analyses in Arabidopsis seedlings

    Science.gov (United States)

    2014-01-01

    Background Transient gene expression via Agrobacterium-mediated DNA transfer offers a simple and fast method to analyze transgene functions. Although Arabidopsis is the most-studied model plant with powerful genetic and genomic resources, achieving highly efficient and consistent transient expression for gene function analysis in Arabidopsis remains challenging. Results We developed a highly efficient and robust Agrobacterium-mediated transient expression system, named AGROBEST (Agrobacterium-mediated enhanced seedling transformation), which achieves versatile analysis of diverse gene functions in intact Arabidopsis seedlings. Using β-glucuronidase (GUS) as a reporter for Agrobacterium-mediated transformation assay, we show that the use of a specific disarmed Agrobacterium strain with vir gene pre-induction resulted in homogenous GUS staining in cotyledons of young Arabidopsis seedlings. Optimization with AB salts in plant culture medium buffered with acidic pH 5.5 during Agrobacterium infection greatly enhanced the transient expression levels, which were significantly higher than with two existing methods. Importantly, the optimized method conferred 100% infected seedlings with highly increased transient expression in shoots and also transformation events in roots of ~70% infected seedlings in both the immune receptor mutant efr-1 and wild-type Col-0 seedlings. Finally, we demonstrated the versatile applicability of the method for examining transcription factor action and circadian reporter-gene regulation as well as protein subcellular localization and protein–protein interactions in physiological contexts. Conclusions AGROBEST is a simple, fast, reliable, and robust transient expression system enabling high transient expression and transformation efficiency in Arabidopsis seedlings. Demonstration of the proof-of-concept experiments elevates the transient expression technology to the level of functional studies in Arabidopsis seedlings in addition to previous

  16. A computational method based on the integration of heterogeneous networks for predicting disease-gene associations.

    Directory of Open Access Journals (Sweden)

    Xingli Guo

    Full Text Available The identification of disease-causing genes is a fundamental challenge in human health and of great importance in improving medical care, and provides a better understanding of gene functions. Recent computational approaches based on the interactions among human proteins and disease similarities have shown their power in tackling the issue. In this paper, a novel systematic and global method that integrates two heterogeneous networks for prioritizing candidate disease-causing genes is provided, based on the observation that genes causing the same or similar diseases tend to lie close to one another in a network of protein-protein interactions. In this method, the association score function between a query disease and a candidate gene is defined as the weighted sum of all the association scores between similar diseases and neighbouring genes. Moreover, the topological correlation of these two heterogeneous networks can be incorporated into the definition of the score function, and finally an iterative algorithm is designed for this issue. This method was tested with 10-fold cross-validation on all 1,126 diseases that have at least a known causal gene, and it ranked the correct gene as one of the top ten in 622 of all the 1,428 cases, significantly outperforming a state-of-the-art method called PRINCE. The results brought about by this method were applied to study three multi-factorial disorders: breast cancer, Alzheimer disease and diabetes mellitus type 2, and some suggestions of novel causal genes and candidate disease-causing subnetworks were provided for further investigation.

  17. Non-invasive imaging using reporter genes altering cellular water permeability

    Science.gov (United States)

    Mukherjee, Arnab; Wu, Di; Davis, Hunter C.; Shapiro, Mikhail G.

    2016-12-01

    Non-invasive imaging of gene expression in live, optically opaque animals is important for multiple applications, including monitoring of genetic circuits and tracking of cell-based therapeutics. Magnetic resonance imaging (MRI) could enable such monitoring with high spatiotemporal resolution. However, existing MRI reporter genes based on metalloproteins or chemical exchange probes are limited by their reliance on metals or relatively low sensitivity. Here we introduce a new class of MRI reporters based on the human water channel aquaporin 1. We show that aquaporin overexpression produces contrast in diffusion-weighted MRI by increasing tissue water diffusivity without affecting viability. Low aquaporin levels or mixed populations comprising as few as 10% aquaporin-expressing cells are sufficient to produce MRI contrast. We characterize this new contrast mechanism through experiments and simulations, and demonstrate its utility in vivo by imaging gene expression in tumours. Our results establish an alternative class of sensitive, metal-free reporter genes for non-invasive imaging.

  18. Multiplex PCR assay for detection of recombinant genes encoding fatty acid desaturases fused with lichenase reporter protein in GM plants.

    Science.gov (United States)

    Berdichevets, Iryna N; Shimshilashvili, Hristina R; Gerasymenko, Iryna M; Sindarovska, Yana R; Sheludko, Yuriy V; Goldenkova-Pavlova, Irina V

    2010-07-01

    Thermostable lichenase encoded by licB gene of Clostridium thermocellum can be used as a reporter protein in plant, bacterial, yeast, and mammalian cells. It has important advantages of high sensitivity and specificity in qualitative and quantitative assays. Deletion variants of LicB (e.g., LicBM3) retain its enzymatic activity and thermostability and can be expressed in translational fusion with target proteins without compromising with their properties. Fusion with the lichenase reporter is especially convenient for the heterologous expression of proteins whose analysis is difficult or compromised by host enzyme activities, as it is in case of fatty acid desaturases occurring in all groups of organisms. Recombinant desaturase-lichenase genes can be used for creating genetically modified (GM) plants with improved chill tolerance. Development of an analytical method for detection of fused desaturase-lichenase transgenes is necessary both for production of GM plants and for their certification. Here, we report a multiplex polymerase chain reaction method for detection of desA and desC desaturase genes of cyanobacteria Synechocystis sp. PCC6803 and Synechococcus vulcanus, respectively, fused to licBM3 reporter in GM plants.

  19. Mixed Methods Analysis of Medical Error Event Reports: A Report from the ASIPS Collaborative

    National Research Council Canada - National Science Library

    Harris, Daniel M; Westfall, John M; Fernald, Douglas H; Duclos, Christine W; West, David R; Niebauer, Linda; Marr, Linda; Quintela, Javan; Main, Deborah S

    2005-01-01

    .... This paper presents a mixed methods approach to analyzing narrative error event reports. Mixed methods studies integrate one or more qualitative and quantitative techniques for data collection and analysis...

  20. Fluorescence recovery allows theimplementation of a fluorescence reporter gene platform applicable for the detection and quantification of horizontal gene transfer in anoxic environments

    DEFF Research Database (Denmark)

    Pinilla-Redondo, Rafael; Riber, Leise; Sørensen, Søren Johannes

    2018-01-01

    H limitations, and provide experimental tools that will help broaden its horizon of application to other fields.IMPORTANCEMany anaerobic environments, like the gastrointestinal tract, anaerobic digesters, and the interiors of dense biofilms, have been shown to be hotspots for horizontal gene transfer (HGT......). Despite the increasing wealth of reports warning about the alarming spread of antibiotic resistance determinants, to date, HGT studies mainly rely on cultivation-based methods. Unfortunately, the relevance of these studies is often questionable, as only a minor fraction of bacteria can be cultivated...

  1. Methods for simultaneously identifying coherent local clusters with smooth global patterns in gene expression profiles

    Directory of Open Access Journals (Sweden)

    Lee Yun-Shien

    2008-03-01

    Full Text Available Abstract Background The hierarchical clustering tree (HCT with a dendrogram 1 and the singular value decomposition (SVD with a dimension-reduced representative map 2 are popular methods for two-way sorting the gene-by-array matrix map employed in gene expression profiling. While HCT dendrograms tend to optimize local coherent clustering patterns, SVD leading eigenvectors usually identify better global grouping and transitional structures. Results This study proposes a flipping mechanism for a conventional agglomerative HCT using a rank-two ellipse (R2E, an improved SVD algorithm for sorting purpose seriation by Chen 3 as an external reference. While HCTs always produce permutations with good local behaviour, the rank-two ellipse seriation gives the best global grouping patterns and smooth transitional trends. The resulting algorithm automatically integrates the desirable properties of each method so that users have access to a clustering and visualization environment for gene expression profiles that preserves coherent local clusters and identifies global grouping trends. Conclusion We demonstrate, through four examples, that the proposed method not only possesses better numerical and statistical properties, it also provides more meaningful biomedical insights than other sorting algorithms. We suggest that sorted proximity matrices for genes and arrays, in addition to the gene-by-array expression matrix, can greatly aid in the search for comprehensive understanding of gene expression structures. Software for the proposed methods can be obtained at http://gap.stat.sinica.edu.tw/Software/GAP.

  2. Combining random gene fission and rational gene fusion to discover near-infrared fluorescent protein fragments that report on protein-protein interactions.

    Science.gov (United States)

    Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J

    2015-05-15

    Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.

  3. A Pathway Based Classification Method for Analyzing Gene Expression for Alzheimer's Disease Diagnosis.

    Science.gov (United States)

    Voyle, Nicola; Keohane, Aoife; Newhouse, Stephen; Lunnon, Katie; Johnston, Caroline; Soininen, Hilkka; Kloszewska, Iwona; Mecocci, Patrizia; Tsolaki, Magda; Vellas, Bruno; Lovestone, Simon; Hodges, Angela; Kiddle, Steven; Dobson, Richard Jb

    2016-01-01

    Recent studies indicate that gene expression levels in blood may be able to differentiate subjects with Alzheimer's disease (AD) from normal elderly controls and mild cognitively impaired (MCI) subjects. However, there is limited replicability at the single marker level. A pathway-based interpretation of gene expression may prove more robust. This study aimed to investigate whether a case/control classification model built on pathway level data was more robust than a gene level model and may consequently perform better in test data. The study used two batches of gene expression data from the AddNeuroMed (ANM) and Dementia Case Registry (DCR) cohorts. Our study used Illumina Human HT-12 Expression BeadChips to collect gene expression from blood samples. Random forest modeling with recursive feature elimination was used to predict case/control status. Age and APOE ɛ4 status were used as covariates for all analysis. Gene and pathway level models performed similarly to each other and to a model based on demographic information only. Any potential increase in concordance from the novel pathway level approach used here has not lead to a greater predictive ability in these datasets. However, we have only tested one method for creating pathway level scores. Further, we have been able to benchmark pathways against genes in datasets that had been extensively harmonized. Further work should focus on the use of alternative methods for creating pathway level scores, in particular those that incorporate pathway topology, and the use of an endophenotype based approach.

  4. Comparison of information-theoretic to statistical methods for gene-gene interactions in the presence of genetic heterogeneity

    Directory of Open Access Journals (Sweden)

    Sucheston Lara

    2010-09-01

    Full Text Available Abstract Background Multifactorial diseases such as cancer and cardiovascular diseases are caused by the complex interplay between genes and environment. The detection of these interactions remains challenging due to computational limitations. Information theoretic approaches use computationally efficient directed search strategies and thus provide a feasible solution to this problem. However, the power of information theoretic methods for interaction analysis has not been systematically evaluated. In this work, we compare power and Type I error of an information-theoretic approach to existing interaction analysis methods. Methods The k-way interaction information (KWII metric for identifying variable combinations involved in gene-gene interactions (GGI was assessed using several simulated data sets under models of genetic heterogeneity driven by susceptibility increasing loci with varying allele frequency, penetrance values and heritability. The power and proportion of false positives of the KWII was compared to multifactor dimensionality reduction (MDR, restricted partitioning method (RPM and logistic regression. Results The power of the KWII was considerably greater than MDR on all six simulation models examined. For a given disease prevalence at high values of heritability, the power of both RPM and KWII was greater than 95%. For models with low heritability and/or genetic heterogeneity, the power of the KWII was consistently greater than RPM; the improvements in power for the KWII over RPM ranged from 4.7% to 14.2% at for α = 0.001 in the three models at the lowest heritability values examined. KWII performed similar to logistic regression. Conclusions Information theoretic models are flexible and have excellent power to detect GGI under a variety of conditions that characterize complex diseases.

  5. Identification of a novel CLRN1 gene mutation in Usher syndrome type 3: two case reports.

    Science.gov (United States)

    Yoshimura, Hidekane; Oshikawa, Chie; Nakayama, Jun; Moteki, Hideaki; Usami, Shin-Ichi

    2015-05-01

    This study examines the CLRN1 gene mutation analysis in Japanese patients who were diagnosed with Usher syndrome type 3 (USH3) on the basis of clinical findings. Genetic analysis using massively parallel DNA sequencing (MPS) was conducted to search for 9 causative USH genes in 2 USH3 patients. We identified the novel pathogenic mutation in the CLRN1 gene in 2 patients. The missense mutation was confirmed by functional prediction software and segregation analysis. Both patients were diagnosed as having USH3 caused by the CLRN1 gene mutation. This is the first report of USH3 with a CLRN1 gene mutation in Asian populations. Validating the presence of clinical findings is imperative for properly differentiating among USH subtypes. In addition, mutation screening using MPS enables the identification of causative mutations in USH. The clinical diagnosis of this phenotypically variable disease can then be confirmed. © The Author(s) 2015.

  6. WellReader: a MATLAB program for the analysis of fluorescence and luminescence reporter gene data.

    Science.gov (United States)

    Boyer, Frédéric; Besson, Bruno; Baptist, Guillaume; Izard, Jérôme; Pinel, Corinne; Ropers, Delphine; Geiselmann, Johannes; de Jong, Hidde

    2010-05-01

    Fluorescent and luminescent reporter gene systems in combination with automated microplate readers allow real-time monitoring of gene expression on the population level at high precision and sampling density. This generates large amounts of data for the analysis of which computer tools are missing to date. We have developed WellReader, a MATLAB program for the analysis of fluorescent and luminescent reporter gene data. WellReader allows the user to load the output files of microplate readers, remove outliers, correct for background effects and smooth and fit the data. Moreover, it computes biologically relevant quantities from the measured signals, notably promoter activities and protein concentrations, and compares the resulting expression profiles of different genes under different conditions. WellReader is available under a LGPL licence at http://prabi1.inrialpes.fr/trac/wellreader.

  7. High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.

    Science.gov (United States)

    Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert

    2018-01-01

    Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.

  8. Feasibility of dual reporter gene in rat myoblast cell line using human sodium iodide symporter (hNIS) and enhanced green fluorescent protein (EGFP) gene

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Yong Jin; Lee, You La; Ahn, Sohn Joo; Choi, Chang Ik; Lee, Sang Woo; Ahn, Byeong Cheol; Lee, Jae Tae [School of Medicine, Kyungpook National University, Daegu (Korea, Republic of)

    2007-07-01

    To develop a non-invasive combined imaging method of gamma camera and optical imaging to assess rat myoblast cell line, H9c2, we constructed retrovirus containing hNIS and EGFP gene, and transfected to rat myoblast cell and monitored hNIS and EGFP expression. Rat myoblast cell line, H9C2, was transfected with hNIS and EGFP gene using retrovirus (H9C2-NG). The expression of hNIS and EGFP gene was determined by RT-PCR and fluorescence microscopy, respectively. The uptake and efflux of I-125 were measured in the transfected and wild type cell lines. Each cell line was injected to 4 flank sites (H9c2: 1X107 or 2X107, H9C2-NG: 1X107 or 2X107) in nude mouse. Scintigraphic image was performed at 3h, 1 day after H9C2 and H9C2-NG cell inoculation. We performed gamma camera and animal PET imaging to evaluate NIS expression. Also, GFP image obtained using optical imaging system. The expression of hNIS and EGFP gene was confirmed by RT-PCR. In iodide uptake, H9C2-NG cells accumulated 274.52.2 pmol/ mg protein at 30 min. But wild type cell line did not uptake iodide. In fluorescent microscopy, H9C2-NG cells were highly fluorescent than that of H9C2 cells. In iodide efflux study, 50% of radioactivity flowed out during the first 10min. Scintigraphy showed increased uptake of Tc-99m in H9c2-NG than in H9C2 for 1 day. Also, H9C2-NG cells showed high signal-to-background fluorescent spots in animal body. In this study, NIS and EGFP reporter gene were successfully transfected by a retrovirus in myoblast cell line, and the transfected cell can be easily visualized in vivo. These results suggest that NIS and EGFP gene has an excellent feasibility as a reporter gene, and it can be used to monitor cell trafficking for monitoring.

  9. Alpha-fetoprotein-targeted reporter gene expression imaging in hepatocellular carcinoma.

    Science.gov (United States)

    Kim, Kwang Il; Chung, Hye Kyung; Park, Ju Hui; Lee, Yong Jin; Kang, Joo Hyun

    2016-07-21

    Hepatocellular carcinoma (HCC) is one of the most common cancers in Eastern Asia, and its incidence is increasing globally. Numerous experimental models have been developed to better our understanding of the pathogenic mechanism of HCC and to evaluate novel therapeutic approaches. Molecular imaging is a convenient and up-to-date biomedical tool that enables the visualization, characterization and quantification of biologic processes in a living subject. Molecular imaging based on reporter gene expression, in particular, can elucidate tumor-specific events or processes by acquiring images of a reporter gene's expression driven by tumor-specific enhancers/promoters. In this review, we discuss the advantages and disadvantages of various experimental HCC mouse models and we present in vivo images of tumor-specific reporter gene expression driven by an alpha-fetoprotein (AFP) enhancer/promoter system in a mouse model of HCC. The current mouse models of HCC development are established by xenograft, carcinogen induction and genetic engineering, representing the spectrum of tumor-inducing factors and tumor locations. The imaging analysis approach of reporter genes driven by AFP enhancer/promoter is presented for these different HCC mouse models. Such molecular imaging can provide longitudinal information about carcinogenesis and tumor progression. We expect that clinical application of AFP-targeted reporter gene expression imaging systems will be useful for the detection of AFP-expressing HCC tumors and screening of increased/decreased AFP levels due to disease or drug treatment.

  10. Development of functional genomic tools in trematodes: RNA interference and luciferase reporter gene activity in Fasciola hepatica.

    Directory of Open Access Journals (Sweden)

    Gabriel Rinaldi

    2008-07-01

    Full Text Available The growing availability of sequence information from diverse parasites through genomic and transcriptomic projects offer new opportunities for the identification of key mediators in the parasite-host interaction. Functional genomics approaches and methods for the manipulation of genes are essential tools for deciphering the roles of genes and to identify new intervention targets in parasites. Exciting advances in functional genomics for parasitic helminths are starting to occur, with transgene expression and RNA interference (RNAi reported in several species of nematodes, but the area is still in its infancy in flatworms, with reports in just three species. While advancing in model organisms, there is a need to rapidly extend these technologies to other parasites responsible for several chronic diseases of humans and cattle. In order to extend these approaches to less well studied parasitic worms, we developed a test method for the presence of a viable RNAi pathway by silencing the exogenous reporter gene, firefly luciferase (fLUC. We established the method in the human blood fluke Schistosoma mansoni and then confirmed its utility in the liver fluke Fasciola hepatica. We transformed newly excysted juveniles of F. hepatica by electroporation with mRNA of fLUC and three hours later were able to detect luciferase enzyme activity, concentrated mainly in the digestive ceca. Subsequently, we tested the presence of an active RNAi pathway in F. hepatica by knocking down the exogenous luciferase activity by introduction into the transformed parasites of double-stranded RNA (dsRNA specific for fLUC. In addition, we tested the RNAi pathway targeting an endogenous F. hepatica gene encoding leucine aminopeptidase (FhLAP, and observed a significant reduction in specific mRNA levels. In summary, these studies demonstrated the utility of RNAi targeting reporter fLUC as a reporter gene assay to establish the presence of an intact RNAi pathway in helminth

  11. Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method

    Directory of Open Access Journals (Sweden)

    Javad Mohammadi

    2017-06-01

    Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary

  12. Expression of Root Genes in Arabidopsis Seedlings Grown by Standard and Improved Growing Methods.

    Science.gov (United States)

    Qu, Yanli; Liu, Shuai; Bao, Wenlong; Xue, Xian; Ma, Zhengwen; Yokawa, Ken; Baluška, František; Wan, Yinglang

    2017-05-03

    Roots of Arabidopsis thaliana seedlings grown in the laboratory using the traditional plant-growing culture system (TPG) were covered to maintain them in darkness. This new method is based on a dark chamber and is named the improved plant-growing method (IPG). We measured the light conditions in dark chambers, and found that the highest light intensity was dramatically reduced deeper in the dark chamber. In the bottom and side parts of dark chambers, roots were almost completely shaded. Using the high-throughput RNA sequencing method on the whole RNA extraction from roots, we compared the global gene expression levels in roots of seedlings from these two conditions and identified 141 differently expressed genes (DEGs) between them. According to the KEGG (Kyoto Encyclopedia of Genes and Genomes) enrichment, the flavone and flavonol biosynthesis and flavonoid biosynthesis pathways were most affected among all annotated pathways. Surprisingly, no genes of known plant photoreceptors were identified as DEGs by this method. Considering that the light intensity was decreased in the IPG system, we collected four sections (1.5 cm for each) of Arabidopsis roots grown in TPG and IPG conditions, and the spatial-related differential gene expression levels of plant photoreceptors and polar auxin transporters, including CRY1 , CRY2 , PHYA , PHYB , PHOT1 , PHOT2 , and UVR8 were analyzed by qRT-PCR. Using these results, we generated a map of the spatial-related expression patterns of these genes under IPG and TPG conditions. The expression levels of light-related genes in roots is highly sensitive to illumination and it provides a background reference for selecting an improved culture method for laboratory-maintained Arabidopsis seedlings.

  13. The first report of prion-related protein gene (PRNT) polymorphisms in goat.

    Science.gov (United States)

    Kim, Yong-Chan; Jeong, Byung-Hoon

    2017-06-01

    Prion protein is encoded by the prion protein gene (PRNP). Polymorphisms of several members of the prion gene family have shown association with prion diseases in several species. Recent studies on a novel member of the prion gene family in rams have shown that prion-related protein gene (PRNT) has a linkage with codon 26 of prion-like protein (PRND). In a previous study, codon 26 polymorphism of PRND has shown connection with PRNP haplotype which is strongly associated with scrapie vulnerability. In addition, the genotype of a single nucleotide polymorphism (SNP) at codon 26 of PRND is related to fertilisation capacity. These findings necessitate studies on the SNP of PRNT gene which is connected with PRND. In goat, several polymorphism studies have been performed for PRNP, PRND, and shadow of prion protein gene (SPRN). However, polymorphism on PRNT has not been reported. Hence, the objective of this study was to determine the genotype and allelic distribution of SNPs of PRNT in 238 Korean native goats and compare PRNT DNA sequences between Korean native goats and several ruminant species. A total of five SNPs, including PRNT c.-114G > T, PRNT c.-58A > G in the upstream of PRNT gene, PRNT c.71C > T (p.Ala24Val) and PRNT c.102G > A in the open reading frame (ORF) and c.321C > T in the downstream of PRNT gene, were found in this study. All five SNPs of caprine PRNT gene in Korean native goat are in complete linkage disequilibrium (LD) with a D' value of 1.0. Interestingly, comparative sequence analysis of the PRNT gene revealed five mismatches between DNA sequences of Korean native goats and those of goats deposited in the GenBank. Korean native black goats also showed 5 mismatches in PRNT ORF with cattle. To the best of our knowledge, this is the first genetic research of the PRNT gene in goat.

  14. [Myocardial single photon emission tomography imaging of reporter gene expression in rabbits].

    Science.gov (United States)

    Liu, Ying; Lan, Xiao-li; Zhang, Liang; Wu, Tao; Jiang, Ri-feng; Zhang, Yong-xue

    2009-06-01

    To explore the feasibility of single photon emission computed tomography (SPECT) detection of heart reporter gene expression and observed the optimal transfecting titer and imaging time by using herpes simplex virus 1-thymidine kinase (HSV1-tk) as reporter gene and 131I-2'-fluoro-2'-deoxy-1-beta-D-arabinofuranosyl-5-iodouracil (131I-FIAU) as reporter probe in rabbit myocardium. The recombinant Ad-tk carrying HSV1-tk gene and adenovirus (Ad) as vector was constructed and intramyocardially injected to rabbits at various concentrations (1 x 10(9) pfu, 5 x 10(8) pfu, 1 x 10(8) pfu, 5 x 10(7) pfu, 1 x 10(7) pfu). Two days later, rabbits were injected with 600 microCi 131I-FIAU in ear-margin vein and then underwent SPECT myocardium imaging for detection of HSV1-tk expression at 6 h, 24 h, 48 h and 72 h after injection, rabbits with 1 x 10(9) pfu Ad-tk injection were imaged at 96 h and 120 h. Rabbits were sacrificed after imaging and the total myocardial 131I-FIAU accumulation was quantified in percent of injected dose per gram myocardium (% ID/g). The myocardial Ad-tk expression was determined with RT-PCR. Reporter gene was detected by SPECT imaging in the injection site while not detected in the control myocardium and site remote from injection. RT-PCR results also evidenced HSV1-tk express in the injection site. The SPECT target/nontarget ratio was correlated with ex vivo gamma-counting (r2 = 0.933, Ppfu by SPECT imaging. The cardiac SPECT reporter gene imaging with HSV1-tk as reporter gene and 131I-FIAU as reporter probe is feasible.

  15. A Comparative Study of Feature Selection and Classification Methods for Gene Expression Data of Glioma

    KAUST Repository

    Abusamra, Heba

    2013-11-01

    Microarray gene expression data gained great importance in recent years due to its role in disease diagnoses and prognoses which help to choose the appropriate treatment plan for patients. This technology has shifted a new era in molecular classification. Interpreting gene expression data remains a difficult problem and an active research area due to their native nature of “high dimensional low sample size”. Such problems pose great challenges to existing classification methods. Thus, effective feature selection techniques are often needed in this case to aid to correctly classify different tumor types and consequently lead to a better understanding of genetic signatures as well as improve treatment strategies. This paper aims on a comparative study of state-of-the- art feature selection methods, classification methods, and the combination of them, based on gene expression data. We compared the efficiency of three different classification methods including: support vector machines, k-nearest neighbor and random forest, and eight different feature selection methods, including: information gain, twoing rule, sum minority, max minority, gini index, sum of variances, t-statistics, and one-dimension support vector machine. Five-fold cross validation was used to evaluate the classification performance. Two publicly available gene expression data sets of glioma were used in the experiments. Results revealed the important role of feature selection in classifying gene expression data. By performing feature selection, the classification accuracy can be significantly boosted by using a small number of genes. The relationship of features selected in different feature selection methods is investigated and the most frequent features selected in each fold among all methods for both datasets are evaluated.

  16. A Comparative Study of Feature Selection and Classification Methods for Gene Expression Data of Glioma

    KAUST Repository

    Abusamra, Heba

    2013-01-01

    Microarray gene expression data gained great importance in recent years due to its role in disease diagnoses and prognoses which help to choose the appropriate treatment plan for patients. This technology has shifted a new era in molecular classification. Interpreting gene expression data remains a difficult problem and an active research area due to their native nature of “high dimensional low sample size”. Such problems pose great challenges to existing classification methods. Thus, effective feature selection techniques are often needed in this case to aid to correctly classify different tumor types and consequently lead to a better understanding of genetic signatures as well as improve treatment strategies. This paper aims on a comparative study of state-of-the- art feature selection methods, classification methods, and the combination of them, based on gene expression data. We compared the efficiency of three different classification methods including: support vector machines, k-nearest neighbor and random forest, and eight different feature selection methods, including: information gain, twoing rule, sum minority, max minority, gini index, sum of variances, t-statistics, and one-dimension support vector machine. Five-fold cross validation was used to evaluate the classification performance. Two publicly available gene expression data sets of glioma were used in the experiments. Results revealed the important role of feature selection in classifying gene expression data. By performing feature selection, the classification accuracy can be significantly boosted by using a small number of genes. The relationship of features selected in different feature selection methods is investigated and the most frequent features selected in each fold among all methods for both datasets are evaluated.

  17. Using reporter gene assays to identify cis regulatory differences between humans and chimpanzees.

    Science.gov (United States)

    Chabot, Adrien; Shrit, Ralla A; Blekhman, Ran; Gilad, Yoav

    2007-08-01

    Most phenotypic differences between human and chimpanzee are likely to result from differences in gene regulation, rather than changes to protein-coding regions. To date, however, only a handful of human-chimpanzee nucleotide differences leading to changes in gene regulation have been identified. To hone in on differences in regulatory elements between human and chimpanzee, we focused on 10 genes that were previously found to be differentially expressed between the two species. We then designed reporter gene assays for the putative human and chimpanzee promoters of the 10 genes. Of seven promoters that we found to be active in human liver cell lines, human and chimpanzee promoters had significantly different activity in four cases, three of which recapitulated the gene expression difference seen in the microarray experiment. For these three genes, we were therefore able to demonstrate that a change in cis influences expression differences between humans and chimpanzees. Moreover, using site-directed mutagenesis on one construct, the promoter for the DDA3 gene, we were able to identify three nucleotides that together lead to a cis regulatory difference between the species. High-throughput application of this approach can provide a map of regulatory element differences between humans and our close evolutionary relatives.

  18. The utility of optical detection system (qPCR) and bioinformatics methods in reference gene expression analysis

    Science.gov (United States)

    Skarzyńska, Agnieszka; Pawełkowicz, Magdalena; PlÄ der, Wojciech; Przybecki, Zbigniew

    2016-09-01

    Real-time quantitative polymerase chain reaction is consider as the most reliable method for gene expression studies. However, the expression of target gene could be misinterpreted due to improper normalization. Therefore, the crucial step for analysing of qPCR data is selection of suitable reference genes, which should be validated experimentally. In order to choice the gene with stable expression in the designed experiment, we performed reference gene expression analysis. In this study genes described in the literature and novel genes predicted as control genes, based on the in silico analysis of transcriptome data were used. Analysis with geNorm and NormFinder algorithms allow to create the ranking of candidate genes and indicate the best reference for flower morphogenesis study. According to the results, genes CACS and CYCL were characterised the most stable expression, but the least suitable genes were TUA and EF.

  19. A postprocessing method in the HMC framework for predicting gene function based on biological instrumental data

    Science.gov (United States)

    Feng, Shou; Fu, Ping; Zheng, Wenbin

    2018-03-01

    Predicting gene function based on biological instrumental data is a complicated and challenging hierarchical multi-label classification (HMC) problem. When using local approach methods to solve this problem, a preliminary results processing method is usually needed. This paper proposed a novel preliminary results processing method called the nodes interaction method. The nodes interaction method revises the preliminary results and guarantees that the predictions are consistent with the hierarchy constraint. This method exploits the label dependency and considers the hierarchical interaction between nodes when making decisions based on the Bayesian network in its first phase. In the second phase, this method further adjusts the results according to the hierarchy constraint. Implementing the nodes interaction method in the HMC framework also enhances the HMC performance for solving the gene function prediction problem based on the Gene Ontology (GO), the hierarchy of which is a directed acyclic graph that is more difficult to tackle. The experimental results validate the promising performance of the proposed method compared to state-of-the-art methods on eight benchmark yeast data sets annotated by the GO.

  20. Development of an ELA-DRA gene typing method based on pyrosequencing technology.

    Science.gov (United States)

    Díaz, S; Echeverría, M G; It, V; Posik, D M; Rogberg-Muñoz, A; Pena, N L; Peral-García, P; Vega-Pla, J L; Giovambattista, G

    2008-11-01

    The polymorphism of equine lymphocyte antigen (ELA) class II DRA gene had been detected by polymerase chain reaction-single-strand conformational polymorphism (PCR-SSCP) and reference strand-mediated conformation analysis. These methodologies allowed to identify 11 ELA-DRA exon 2 sequences, three of which are widely distributed among domestic horse breeds. Herein, we describe the development of a pyrosequencing-based method applicable to ELA-DRA typing, by screening samples from eight different horse breeds previously typed by PCR-SSCP. This sequence-based method would be useful in high-throughput genotyping of major histocompatibility complex genes in horses and other animal species, making this system interesting as a rapid screening method for animal genotyping of immune-related genes.

  1. Comparison of normalization methods for the analysis of metagenomic gene abundance data.

    Science.gov (United States)

    Pereira, Mariana Buongermino; Wallroth, Mikael; Jonsson, Viktor; Kristiansson, Erik

    2018-04-20

    In shotgun metagenomics, microbial communities are studied through direct sequencing of DNA without any prior cultivation. By comparing gene abundances estimated from the generated sequencing reads, functional differences between the communities can be identified. However, gene abundance data is affected by high levels of systematic variability, which can greatly reduce the statistical power and introduce false positives. Normalization, which is the process where systematic variability is identified and removed, is therefore a vital part of the data analysis. A wide range of normalization methods for high-dimensional count data has been proposed but their performance on the analysis of shotgun metagenomic data has not been evaluated. Here, we present a systematic evaluation of nine normalization methods for gene abundance data. The methods were evaluated through resampling of three comprehensive datasets, creating a realistic setting that preserved the unique characteristics of metagenomic data. Performance was measured in terms of the methods ability to identify differentially abundant genes (DAGs), correctly calculate unbiased p-values and control the false discovery rate (FDR). Our results showed that the choice of normalization method has a large impact on the end results. When the DAGs were asymmetrically present between the experimental conditions, many normalization methods had a reduced true positive rate (TPR) and a high false positive rate (FPR). The methods trimmed mean of M-values (TMM) and relative log expression (RLE) had the overall highest performance and are therefore recommended for the analysis of gene abundance data. For larger sample sizes, CSS also showed satisfactory performance. This study emphasizes the importance of selecting a suitable normalization methods in the analysis of data from shotgun metagenomics. Our results also demonstrate that improper methods may result in unacceptably high levels of false positives, which in turn may lead

  2. Early Infantile Leigh-like Gene Defects Have a Poor Prognosis: Report and Review

    Directory of Open Access Journals (Sweden)

    Majid Alfadhel

    2017-10-01

    Full Text Available Solute carrier family 19 (thiamine transporter, member 3 ( SCL19A3 gene defect produces an autosomal recessive neurodegenerative disorder associated with different phenotypes and acronyms. One of the common presentations is early infantile lethal Leigh-like syndrome. We report a case of early infantile Leigh-like SLC19A3 gene defects of patients who died at 4 months of age with no response to a high dose of biotin and thiamine. In addition, we report a novel mutation that was not reported previously. Finally, we review the literature regarding early infantile Leigh-like SLC19A3 gene defects and compare the literature with our patient.

  3. EPA flow reference method testing and analysis: Findings report

    International Nuclear Information System (INIS)

    1999-06-01

    This report describes an experimental program sponsored by the US Environmental Protection Agency (EPA) to evaluate potential improvements to the Agency's current reference method for measuring volumetric flow (Method 2, 40 CFR Part 60, Appendix B). Method 2 (Determination of Stack Gas Velocity and Volumetric Flow Rate (Type S Pitot Tube)) specifies measurements to determine volumetric flow, but does not prescribe specific procedures to account for yaw or pitch angles of flow when the flow in the stack is not axial. Method 2 also allows the use of only two probe types, the Type S and the Prandtl

  4. Introduction of optical reporter gene into cancer and immune cells using lentiviral vector

    International Nuclear Information System (INIS)

    Min, Jung Joon; Le, Uyenchi N.; Moon, Sung Min; Heo, Young Jun; Song, Ho Chun; Bom, Hee Seung; Kim, Yeon Soo

    2004-01-01

    For some applications such as gene therapy or reporter gene imaging, a gene has to be introduced into the organism of interest. Adenoviral vectors are capable of transducing both replicating and non-dividing cells. The adenoviral vectors do not integrate their DNA into host DNA, but do lead to an immune response. Lentiviruses belong to the retrovirus family and are capable of infecting both dividing and non-dividing cells. The human immunodeficiency virus (HIV) is an example of a lentavirus. A disabled HIV virus has been developed and could be used for in vivo gene delivery. A portion of the viral genome which encodes for accessory proteins canbe deleted without affecting production of the vector and efficiency of infection. Lentiviral delivery into various rodent tissues shows sustained expression of the transgene of up to six months. Furthermore, there seems to be little or no immune response with these vectors. These lentiviral vectors hold significant promise for in vivo gene delivery. We constructed lentiviral vector encoding firefly luciferase (Fluc) and eGFP. Fluc-eGFP fusion gene was inserted into multiple cloning sites of pLentiM1.3 vector. Reporter gene (Fluc-eGFP) was designed to be driven by murine CMV promoter with enhanced efficacy of transgene expression as compared to human CMV promoter. We transfected pLenti1.3-Fluc into human cervix cancer cell line (HeLa) and murine T lymphocytes. We also constructed adenovirus encoding Fluc and transfected to HeLa and T cells. This LentiM1.3-Fluc was transfected into HeLa cells and murine T lymphocytes in vitro, showing consistent expression of eGFP under the fluorescence microscopy from the 2nd day of transfection. Firefly luciferase reporter gene was not expressed in immune cells when it is mediated by adenovirus. Lentivirus was validated as a useful vector for both immune and cancer cells

  5. Non-Viral Transfection Methods Optimized for Gene Delivery to a Lung Cancer Cell Line

    Science.gov (United States)

    Salimzadeh, Loghman; Jaberipour, Mansooreh; Hosseini, Ahmad; Ghaderi, Abbas

    2013-01-01

    Background Mehr-80 is a newly established adherent human large cell lung cancer cell line that has not been transfected until now. This study aims to define the optimal transfection conditions and effects of some critical elements for enhancing gene delivery to this cell line by utilizing different non-viral transfection Procedures. Methods In the current study, calcium phosphate (CaP), DEAE-dextran, superfect, electroporation and lipofection transfection methods were used to optimize delivery of a plasmid construct that expressed Green Fluorescent Protein (GFP). Transgene expression was detected by fluorescent microscopy and flowcytometry. Toxicities of the methods were estimated by trypan blue staining. In order to evaluate the density of the transfected gene, we used a plasmid construct that expressed the Stromal cell-Derived Factor-1 (SDF-1) gene and measured its expression by real-time PCR. Results Mean levels of GFP-expressing cells 48 hr after transfection were 8.4% (CaP), 8.2% (DEAE-dextran), 4.9% (superfect), 34.1% (electroporation), and 40.1% (lipofection). Lipofection had the highest intense SDF-1 expression of the analyzed methods. Conclusion This study has shown that the lipofection and electroporation methods were more efficient at gene delivery to Mehr-80 cells. The quantity of DNA per transfection, reagent concentration, and incubation time were identified as essential factors for successful transfection in all of the studied methods. PMID:23799175

  6. Gene tree rooting methods give distributions that mimic the coalescent process.

    Science.gov (United States)

    Tian, Yuan; Kubatko, Laura S

    2014-01-01

    Multi-locus phylogenetic inference is commonly carried out via models that incorporate the coalescent process to model the possibility that incomplete lineage sorting leads to incongruence between gene trees and the species tree. An interesting question that arises in this context is whether data "fit" the coalescent model. Previous work (Rosenfeld et al., 2012) has suggested that rooting of gene trees may account for variation in empirical data that has been previously attributed to the coalescent process. We examine this possibility using simulated data. We show that, in the case of four taxa, the distribution of gene trees observed from rooting estimated gene trees with either the molecular clock or with outgroup rooting can be closely matched by the distribution predicted by the coalescent model with specific choices of species tree branch lengths. We apply commonly-used coalescent-based methods of species tree inference to assess their performance in these situations. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Robust gene selection methods using weighting schemes for microarray data analysis.

    Science.gov (United States)

    Kang, Suyeon; Song, Jongwoo

    2017-09-02

    A common task in microarray data analysis is to identify informative genes that are differentially expressed between two different states. Owing to the high-dimensional nature of microarray data, identification of significant genes has been essential in analyzing the data. However, the performances of many gene selection techniques are highly dependent on the experimental conditions, such as the presence of measurement error or a limited number of sample replicates. We have proposed new filter-based gene selection techniques, by applying a simple modification to significance analysis of microarrays (SAM). To prove the effectiveness of the proposed method, we considered a series of synthetic datasets with different noise levels and sample sizes along with two real datasets. The following findings were made. First, our proposed methods outperform conventional methods for all simulation set-ups. In particular, our methods are much better when the given data are noisy and sample size is small. They showed relatively robust performance regardless of noise level and sample size, whereas the performance of SAM became significantly worse as the noise level became high or sample size decreased. When sufficient sample replicates were available, SAM and our methods showed similar performance. Finally, our proposed methods are competitive with traditional methods in classification tasks for microarrays. The results of simulation study and real data analysis have demonstrated that our proposed methods are effective for detecting significant genes and classification tasks, especially when the given data are noisy or have few sample replicates. By employing weighting schemes, we can obtain robust and reliable results for microarray data analysis.

  8. Deep-tissue reporter-gene imaging with fluorescence and optoacoustic tomography: a performance overview.

    Science.gov (United States)

    Deliolanis, Nikolaos C; Ale, Angelique; Morscher, Stefan; Burton, Neal C; Schaefer, Karin; Radrich, Karin; Razansky, Daniel; Ntziachristos, Vasilis

    2014-10-01

    A primary enabling feature of near-infrared fluorescent proteins (FPs) and fluorescent probes is the ability to visualize deeper in tissues than in the visible. The purpose of this work is to find which is the optimal visualization method that can exploit the advantages of this novel class of FPs in full-scale pre-clinical molecular imaging studies. Nude mice were stereotactically implanted with near-infrared FP expressing glioma cells to from brain tumors. The feasibility and performance metrics of FPs were compared between planar epi-illumination and trans-illumination fluorescence imaging, as well as to hybrid Fluorescence Molecular Tomography (FMT) system combined with X-ray CT and Multispectral Optoacoustic (or Photoacoustic) Tomography (MSOT). It is shown that deep-seated glioma brain tumors are possible to visualize both with fluorescence and optoacoustic imaging. Fluorescence imaging is straightforward and has good sensitivity; however, it lacks resolution. FMT-XCT can provide an improved rough resolution of ∼1 mm in deep tissue, while MSOT achieves 0.1 mm resolution in deep tissue and has comparable sensitivity. We show imaging capacity that can shift the visualization paradigm in biological discovery. The results are relevant not only to reporter gene imaging, but stand as cross-platform comparison for all methods imaging near infrared fluorescent contrast agents.

  9. An efficient parallel stochastic simulation method for analysis of nonviral gene delivery systems

    KAUST Repository

    Kuwahara, Hiroyuki

    2011-01-01

    Gene therapy has a great potential to become an effective treatment for a wide variety of diseases. One of the main challenges to make gene therapy practical in clinical settings is the development of efficient and safe mechanisms to deliver foreign DNA molecules into the nucleus of target cells. Several computational and experimental studies have shown that the design process of synthetic gene transfer vectors can be greatly enhanced by computational modeling and simulation. This paper proposes a novel, effective parallelization of the stochastic simulation algorithm (SSA) for pharmacokinetic models that characterize the rate-limiting, multi-step processes of intracellular gene delivery. While efficient parallelizations of the SSA are still an open problem in a general setting, the proposed parallel simulation method is able to substantially accelerate the next reaction selection scheme and the reaction update scheme in the SSA by exploiting and decomposing the structures of stochastic gene delivery models. This, thus, makes computationally intensive analysis such as parameter optimizations and gene dosage control for specific cell types, gene vectors, and transgene expression stability substantially more practical than that could otherwise be with the standard SSA. Here, we translated the nonviral gene delivery model based on mass-action kinetics by Varga et al. [Molecular Therapy, 4(5), 2001] into a more realistic model that captures intracellular fluctuations based on stochastic chemical kinetics, and as a case study we applied our parallel simulation to this stochastic model. Our results show that our simulation method is able to increase the efficiency of statistical analysis by at least 50% in various settings. © 2011 ACM.

  10. Implementation of plaid model biclustering method on microarray of carcinoma and adenoma tumor gene expression data

    Science.gov (United States)

    Ardaneswari, Gianinna; Bustamam, Alhadi; Sarwinda, Devvi

    2017-10-01

    A Tumor is an abnormal growth of cells that serves no purpose. Carcinoma is a tumor that grows from the top of the cell membrane and the organ adenoma is a benign tumor of the gland-like cells or epithelial tissue. In the field of molecular biology, the development of microarray technology is used in the data store of disease genetic expression. For each of microarray gene, an amount of information is stored for each trait or condition. In gene expression data clustering can be done with a bicluster algorithm, thats clustering method which not only the objects to be clustered, but also the properties or condition of the object. This research proposed Plaid Model Biclustering as one of biclustering method. In this study, we discuss the implementation of Plaid Model Biclustering Method on microarray of Carcinoma and Adenoma tumor gene expression data. From the experimental results, we found three biclusters are formed by Carcinoma gene expression data and four biclusters are formed by Adenoma gene expression data.

  11. The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

    Science.gov (United States)

    Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

    2017-01-01

    Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

  12. Non-viral transfection methods optimized for gene delivery to a lung cancer cell line.

    Science.gov (United States)

    Salimzadeh, Loghman; Jaberipour, Mansooreh; Hosseini, Ahmad; Ghaderi, Abbas

    2013-04-01

    Mehr-80 is a newly established adherent human large cell lung cancer cell line that has not been transfected until now. This study aims to define the optimal transfection conditions and effects of some critical elements for enhancing gene delivery to this cell line by utilizing different non-viral transfection Procedures. In the current study, calcium phosphate (CaP), DEAE-dextran, superfect, electroporation and lipofection transfection methods were used to optimize delivery of a plasmid construct that expressed Green Fluorescent Protein (GFP). Transgene expression was detected by fluorescent microscopy and flowcytometry. Toxicities of the methods were estimated by trypan blue staining. In order to evaluate the density of the transfected gene, we used a plasmid construct that expressed the Stromal cell-Derived Factor-1 (SDF-1) gene and measured its expression by real-time PCR. Mean levels of GFP-expressing cells 48 hr after transfection were 8.4% (CaP), 8.2% (DEAE-dextran), 4.9% (superfect), 34.1% (electroporation), and 40.1% (lipofection). Lipofection had the highest intense SDF-1 expression of the analyzed methods. This study has shown that the lipofection and electroporation methods were more efficient at gene delivery to Mehr-80 cells. The quantity of DNA per transfection, reagent concentration, and incubation time were identified as essential factors for successful transfection in all of the studied methods.

  13. Gene flow analysis method, the D-statistic, is robust in a wide parameter space.

    Science.gov (United States)

    Zheng, Yichen; Janke, Axel

    2018-01-08

    We evaluated the sensitivity of the D-statistic, a parsimony-like method widely used to detect gene flow between closely related species. This method has been applied to a variety of taxa with a wide range of divergence times. However, its parameter space and thus its applicability to a wide taxonomic range has not been systematically studied. Divergence time, population size, time of gene flow, distance of outgroup and number of loci were examined in a sensitivity analysis. The sensitivity study shows that the primary determinant of the D-statistic is the relative population size, i.e. the population size scaled by the number of generations since divergence. This is consistent with the fact that the main confounding factor in gene flow detection is incomplete lineage sorting by diluting the signal. The sensitivity of the D-statistic is also affected by the direction of gene flow, size and number of loci. In addition, we examined the ability of the f-statistics, [Formula: see text] and [Formula: see text], to estimate the fraction of a genome affected by gene flow; while these statistics are difficult to implement to practical questions in biology due to lack of knowledge of when the gene flow happened, they can be used to compare datasets with identical or similar demographic background. The D-statistic, as a method to detect gene flow, is robust against a wide range of genetic distances (divergence times) but it is sensitive to population size. The D-statistic should only be applied with critical reservation to taxa where population sizes are large relative to branch lengths in generations.

  14. GeneNetWeaver: in silico benchmark generation and performance profiling of network inference methods.

    Science.gov (United States)

    Schaffter, Thomas; Marbach, Daniel; Floreano, Dario

    2011-08-15

    Over the last decade, numerous methods have been developed for inference of regulatory networks from gene expression data. However, accurate and systematic evaluation of these methods is hampered by the difficulty of constructing adequate benchmarks and the lack of tools for a differentiated analysis of network predictions on such benchmarks. Here, we describe a novel and comprehensive method for in silico benchmark generation and performance profiling of network inference methods available to the community as an open-source software called GeneNetWeaver (GNW). In addition to the generation of detailed dynamical models of gene regulatory networks to be used as benchmarks, GNW provides a network motif analysis that reveals systematic prediction errors, thereby indicating potential ways of improving inference methods. The accuracy of network inference methods is evaluated using standard metrics such as precision-recall and receiver operating characteristic curves. We show how GNW can be used to assess the performance and identify the strengths and weaknesses of six inference methods. Furthermore, we used GNW to provide the international Dialogue for Reverse Engineering Assessments and Methods (DREAM) competition with three network inference challenges (DREAM3, DREAM4 and DREAM5). GNW is available at http://gnw.sourceforge.net along with its Java source code, user manual and supporting data. Supplementary data are available at Bioinformatics online. dario.floreano@epfl.ch.

  15. The feasibility of using a baculovirus vector to deliver the sodium-iodide symporter gene as a reporter

    Energy Technology Data Exchange (ETDEWEB)

    Zhou Xiang; Li Biao; Wang Jun; Yin Hongyan [Department of Nuclear Medicine, Ruijin Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200025 (China); Zhang Yifan [Department of Nuclear Medicine, Ruijin Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200025 (China)], E-mail: zhangyifan1992@yahoo.com.cn

    2010-04-15

    Purpose: To evaluate the efficiency of baculovirus vectors in transducing FTC-133 cells and to examine the feasibility of using baculovirus vectors for the delivery of the sodium-iodide symporter (NIS) gene as a reporter through co-transduction to monitor the expression of the target gene. Method: Two recombinant baculoviruses were constructed to express NIS and green fluorescent protein (GFP) respectively. FTC-133, 8050C, SW1116, A549 cells, were infected with Bac-GFP. The infection efficiency of Bac-GFP and the intensity of fluorescence, in either the presence or absence of sodium butyrate, were monitored by flow cytometry. The iodine uptake by FTC-133 cells infected with Bac-NIS was measured using a {gamma} counter. FTC-133 cells were infected with a mixture of equal amounts of Bac-NIS and Bac-GFP at different setting of multiplicity of infection (MOI). The changes of GFP fluorescence intensity and iodine uptake were monitored 24 h after infection in the coinfected cells. Results: We have successfully constructed recombinant baculoviruses carrying NIS and GFP under the control of the cytomegalovirus IE-1 promoter. We found that transduced efficiency of baculovirus in 8505C, SW1116, A549 cells are low in absence of sodium butyrate. Yet Bac-GFP infects FTC-133 cells at a high efficiency, 77.67%, 85.57% and 93.23% with MOI of 100, 200 and 400, respectively. The fluorescence intensity of the Bac-GFP infected tumor cells correlated positively with the MOI of the virus. Sodium butyrate induction increased both the infection efficiency and the fluorescence intensity, but increase of infection efficiency was insignificant in FTC-133 cells. Reporter gene (GFP) expression in FTC-133 is stable within 7 days after infection. The radioactivity incorporated by the tumor cells infected with Bac-NIS correlated positively with the MOI of Bac-NIS as well. In tumor cells co-infected with Bac-NIS and Bac-GFP, the amount of radioactivity incorporated significantly correlated with

  16. Form gene clustering method about pan-ethnic-group products based on emotional semantic

    Science.gov (United States)

    Chen, Dengkai; Ding, Jingjing; Gao, Minzhuo; Ma, Danping; Liu, Donghui

    2016-09-01

    The use of pan-ethnic-group products form knowledge primarily depends on a designer's subjective experience without user participation. The majority of studies primarily focus on the detection of the perceptual demands of consumers from the target product category. A pan-ethnic-group products form gene clustering method based on emotional semantic is constructed. Consumers' perceptual images of the pan-ethnic-group products are obtained by means of product form gene extraction and coding and computer aided product form clustering technology. A case of form gene clustering about the typical pan-ethnic-group products is investigated which indicates that the method is feasible. This paper opens up a new direction for the future development of product form design which improves the agility of product design process in the era of Industry 4.0.

  17. Preliminary validation of varicella zoster virus thymidine kinase as a novel reporter gene for PET

    International Nuclear Information System (INIS)

    Deroose, Christophe M.; Chitneni, Satish K.; Gijsbers, Rik; Vermaelen, Peter; Ibrahimi, Abdelilah; Balzarini, Jan; Baekelandt, Veerle; Verbruggen, Alfons; Nuyts, Johan; Debyser, Zeger; Bormans, Guy M.

    2012-01-01

    Introduction: Imaging of gene expression with positron emission tomography (PET) has emerged as a powerful tool for biomedical research during the last decade. The prototypical herpes simplex virus type 1 thymidine kinase (HSV1-TK) PET reporter gene (PRG) is widely used and many other PRGs have also been validated. We investigated varicella zoster virus thymidine kinase (VZV-tk) as new PRG with radiolabeled bicyclic nucleoside analogues (BCNAs) as PET tracers. Methods: The uptake and washout of four different radiolabeled BCNAs was evaluated in cells expressing VZV-tk after lentiviral vector (LV) transduction and in control cells. Metabolism of the tracers was assayed by high pressure liquid chromatography (HPLC). Mice bearing VZV-TK expressing xenografts were imaged with PET. Results: High uptake in VZV-tk expressing cells was seen for 3 of the 4 tracers tested. The uptake of the tracers could be blocked by the presence of excess thymidine in the incubation solution. Cellular retention was variable, with one tracer showing an acceptable half-life of ∼ 1 hour. The amount of intracellular tracer correlated with the titer of LV used to transduce the cells. VZV-TK dependent conversion into metabolites was shown by HPLC. No specific accumulation was observed in cells expressing a fusion protein containing an HSV1-TK moiety. VZV-tk expression in xenografts resulted in a 60% increase in uptake in vivo as measured with PET. Conclusions: We have validated the combination of VZV-tk and radiolabeled BCNAs as new PRG/PRP system. Further optimization of the PRPs and the PRG are warranted to increase the signal.

  18. GO-PCA: An Unsupervised Method to Explore Gene Expression Data Using Prior Knowledge.

    Science.gov (United States)

    Wagner, Florian

    2015-01-01

    Genome-wide expression profiling is a widely used approach for characterizing heterogeneous populations of cells, tissues, biopsies, or other biological specimen. The exploratory analysis of such data typically relies on generic unsupervised methods, e.g. principal component analysis (PCA) or hierarchical clustering. However, generic methods fail to exploit prior knowledge about the molecular functions of genes. Here, I introduce GO-PCA, an unsupervised method that combines PCA with nonparametric GO enrichment analysis, in order to systematically search for sets of genes that are both strongly correlated and closely functionally related. These gene sets are then used to automatically generate expression signatures with functional labels, which collectively aim to provide a readily interpretable representation of biologically relevant similarities and differences. The robustness of the results obtained can be assessed by bootstrapping. I first applied GO-PCA to datasets containing diverse hematopoietic cell types from human and mouse, respectively. In both cases, GO-PCA generated a small number of signatures that represented the majority of lineages present, and whose labels reflected their respective biological characteristics. I then applied GO-PCA to human glioblastoma (GBM) data, and recovered signatures associated with four out of five previously defined GBM subtypes. My results demonstrate that GO-PCA is a powerful and versatile exploratory method that reduces an expression matrix containing thousands of genes to a much smaller set of interpretable signatures. In this way, GO-PCA aims to facilitate hypothesis generation, design of further analyses, and functional comparisons across datasets.

  19. Reporting methods of blinding in randomized trials assessing nonpharmacological treatments.

    Directory of Open Access Journals (Sweden)

    Isabelle Boutron

    2007-02-01

    Full Text Available BACKGROUND: Blinding is a cornerstone of treatment evaluation. Blinding is more difficult to obtain in trials assessing nonpharmacological treatment and frequently relies on "creative" (nonstandard methods. The purpose of this study was to systematically describe the strategies used to obtain blinding in a sample of randomized controlled trials of nonpharmacological treatment. METHODS AND FINDINGS: We systematically searched in Medline and the Cochrane Methodology Register for randomized controlled trials (RCTs assessing nonpharmacological treatment with blinding, published during 2004 in high-impact-factor journals. Data were extracted using a standardized extraction form. We identified 145 articles, with the method of blinding described in 123 of the reports. Methods of blinding of participants and/or health care providers and/or other caregivers concerned mainly use of sham procedures such as simulation of surgical procedures, similar attention-control interventions, or a placebo with a different mode of administration for rehabilitation or psychotherapy. Trials assessing devices reported various placebo interventions such as use of sham prosthesis, identical apparatus (e.g., identical but inactivated machine or use of activated machine with a barrier to block the treatment, or simulation of using a device. Blinding participants to the study hypothesis was also an important method of blinding. The methods reported for blinding outcome assessors relied mainly on centralized assessment of paraclinical examinations, clinical examinations (i.e., use of video, audiotape, photography, or adjudications of clinical events. CONCLUSIONS: This study classifies blinding methods and provides a detailed description of methods that could overcome some barriers of blinding in clinical trials assessing nonpharmacological treatment, and provides information for readers assessing the quality of results of such trials.

  20. Detection of estrogenic activity in sediment-associated compounds using in vitro reporter gene assays

    NARCIS (Netherlands)

    Legler, J.; Dennekamp, M.; Vethaak, A.D.; Brouwer, A.; Koeman, J.H.; Burg, van der B.; Murk, A.J.

    2002-01-01

    Sediments may be the ultimate sink for persistent (xeno-) estrogenic compounds released into the aquatic environment. Sediment-associated estrogenic potency was measured with an estrogen receptor-mediated luciferase reporter gene (ER-CALUX) assay and compared with a recombinant yeast screen. The

  1. A small scale cell culture system to analyze mechanobiology using reporter gene constructs and polyurethane dishes

    DEFF Research Database (Denmark)

    Seefried, Lothar; Mueller-Deubert, Sigrid; Wentzer, Thomas Schwarz

    2010-01-01

    of mechanotransduction and its crosstalk with biochemically induced signal transduction, AP1 and SP1 luciferase reporter gene constructs were cloned and transfected into various cell lines and primary cells. A newly developed bioreactor and small-scale 24-well polyurethane dishes were used to apply cyclic stretching...

  2. Effects of Epigenetic Modulation on Reporter Gene Expression: Implications for Stem Cell Imaging

    Science.gov (United States)

    Krishnan, Manickam; Park, Jinha M.; Cao, Feng; Wang, Dongxu; Paulmurugan, Ramasay; Tseng, Jeffrey R.; Gonzalgo, Mark L.; Gambhir, Sanjiv S.; Wu, Joseph C.

    2013-01-01

    Tracking stem cell localization, survival, differentiation, and proliferation following transplantation in living subjects is essential for understanding stem cell biology and physiology. In this study, we investigated the long-term stability of reporter gene expression in an embryonic rat cardiomyoblast cell line and the role of epigenetic modulation on reversing reporter gene silencing. Cells were stably transfected with plasmids carrying cytomegalovirus promoter driving firefly luciferase reporter gene (CMV-Fluc) and passaged repeatedly for 3–8 months. Within the highest expressor clone, the firefly luciferase activity decreased progressively from passage-1 (843±28) to passage-20 (250±10) to passage-40 (44±3) to passage-60 (3±1 RLU/µg) (P<0.05 vs. passage-1). Firefly luciferase activity was maximally rescued by treatment with 5-azacytidine (DNA methyltransferase inhibitor) compared to trichostatin A (histone deacetylase inhibitor) and retinoic acid (transcriptional activator) (P<0.05). Increasing dosages of 5-azacytidine treatment led to higher levels of firefly luciferase mRNA (RT-PCR) and protein (Western blots) and inversely lower levels of methylation in the CMV promoter (DNA nucleotide sequence). These in vitro results were extended to in vivo bioluminescence imaging (BLI) of cell transplant in living animals. Cells treated with 5-azacytidine were monitored for 2 weeks compared to 1 week for untreated cells (P<0.05). These findings should have important implications for reporter gene-based imaging of stem cell transplantation. PMID:16246867

  3. New in vitro reporter gene bioassays for screening of hormonal active compounds in the environment

    Czech Academy of Sciences Publication Activity Database

    Svobodová, Kateřina; Cajthaml, Tomáš

    2010-01-01

    Roč. 88, č. 4 (2010), s. 839-847 ISSN 0175-7598 R&D Projects: GA ČR GAP503/10/0408 Institutional research plan: CEZ:AV0Z50200510 Keywords : endocrine disruptors * in vitro bioassays * reporter gene assays Subject RIV: EE - Microbiology, Virology Impact factor: 3.280, year: 2010

  4. A case report on ATP6V0A4 gene mutation: Forecast of familial ...

    African Journals Online (AJOL)

    The patient does not have hearing impairment. ATP6V0A4 gene ... This case report emphasizes the significance of early diagnosis and genetic screening of recessive forms of ... Buffer defect /low buffer type distal RTA also involves the loss of ... weight of 4 Kg with no emergency treatment at the time of birth. Afterwards, his ...

  5. Gene Transfection Method Using Atmospheric Pressure Dielectric-Barrier Discharge Plasmas

    Science.gov (United States)

    Sasaki, Shota; Kanzaki, Makoto; Kaneko, Toshiro

    2013-09-01

    Gene transfection which is the process of deliberately introducing nucleic acids into cells is expected to play an important role in medical treatment because the process is necessary for gene therapy and creation of induced pluripotent stem (iPS) cells. However, the conventional transfection methods have some problems, so we focus attention on promising transfection methods by atmospheric pressure dielectric-barrier discharge (AP-DBD) plasmas. AP-DBD He plasmas are irradiated to the living cell covered with genes. Preliminarily, we use fluorescent dye YOYO-1 instead of the genes and use LIVE/DEAD Stain for cell viability test, and we analyze the transfection efficiency and cell viability under the various conditions. It is clarified that the transfection efficiency is strongly dependence on the plasma irradiation time and cell viability rates is high rates (>90%) regardless of long plasma irradiation time. These results suggest that ROS (Reactive Oxygen Species) and electric field generated by the plasma affect the gene transfection. In addition to this (the plasma irradiation time) dependency, we now investigate the effect of the plasma irradiation under the various conditions.

  6. Effect of method of deduplication on estimation of differential gene expression using RNA-seq

    Directory of Open Access Journals (Sweden)

    Anna V. Klepikova

    2017-03-01

    Full Text Available Background RNA-seq is a useful tool for analysis of gene expression. However, its robustness is greatly affected by a number of artifacts. One of them is the presence of duplicated reads. Results To infer the influence of different methods of removal of duplicated reads on estimation of gene expression in cancer genomics, we analyzed paired samples of hepatocellular carcinoma (HCC and non-tumor liver tissue. Four protocols of data analysis were applied to each sample: processing without deduplication, deduplication using a method implemented in SAMtools, and deduplication based on one or two molecular indices (MI. We also analyzed the influence of sequencing layout (single read or paired end and read length. We found that deduplication without MI greatly affects estimated expression values; this effect is the most pronounced for highly expressed genes. Conclusion The use of unique molecular identifiers greatly improves accuracy of RNA-seq analysis, especially for highly expressed genes. We developed a set of scripts that enable handling of MI and their incorporation into RNA-seq analysis pipelines. Deduplication without MI affects results of differential gene expression analysis, producing a high proportion of false negative results. The absence of duplicate read removal is biased towards false positives. In those cases where using MI is not possible, we recommend using paired-end sequencing layout.

  7. Non-Viral Transfection Methods Optimized for Gene Delivery to a Lung Cancer Cell Line

    OpenAIRE

    Salimzadeh, Loghman; Jaberipour, Mansooreh; Hosseini, Ahmad; Ghaderi, Abbas

    2013-01-01

    Background Mehr-80 is a newly established adherent human large cell lung cancer cell line that has not been transfected until now. This study aims to define the optimal transfection conditions and effects of some critical elements for enhancing gene delivery to this cell line by utilizing different non-viral transfection Procedures. Methods In the current study, calcium phosphate (CaP), DEAE-dextran, superfect, electroporation and lipofection transfection methods were used to optimize deliver...

  8. Identification of key genes and molecular mechanisms associated with dedifferentiated liposarcoma based on bioinformatic methods

    Directory of Open Access Journals (Sweden)

    Yu H

    2017-06-01

    Full Text Available Hongliang Yu,1 Dong Pei,2 Longyun Chen,2 Xiaoxiang Zhou,2 Haiwen Zhu2 1Department of Radiation Oncology, Jiangsu Cancer Hospital and Jiangsu Institute of Cancer Research, The Affiliated Cancer Hospital of Nanjing Medical University, Nanjing, 2Department of Radiation Oncology, Yancheng Third People’s Hospital, Yancheng, Jiangsu, People’s Republic of China Background: Dedifferentiated liposarcoma (DDLPS is one of the most deadly types of soft tissue sarcoma. To date, there have been few studies dedicated to elucidating the molecular mechanisms behind the disease; therefore, the molecular mechanisms behind this malignancy remain largely unknown.Materials and methods: Microarray profiles of 46 DDLPS samples and nine normal fat controls were extracted from Gene Expression Omnibus (GEO. Quality control for these microarray profiles was performed before analysis. Hierarchical clustering and principal component analysis were used to distinguish the general differences in gene expression between DDLPS samples and the normal fat controls. Differentially expressed genes (DEGs were identified using the Limma package in R. Next, the enriched Gene Ontology (GO terms and Kyoto Encyclopedia of Genes and Genomes (KEGG pathways were obtained using the online tool DAVID (http://david.abcc.ncifcrf.gov/. A protein–protein interaction (PPI network was constructed using the STRING database and Cytoscape software. Furthermore, the hub genes within the PPI network were identified.Results: All 55 microarray profiles were confirmed to be of high quality. The gene expression pattern of DDLPS samples was significantly different from that of normal fat controls. In total, 700 DEGs were identified, and 83 enriched GO terms and three KEGG pathways were obtained. Specifically, within the DEGs of DDLPS samples, several pathways were identified as being significantly enriched, including the PPAR signaling pathway, cell cycle pathway, and pyruvate metabolism pathway

  9. METHODS IN THE POST-METHODS ERA. REPORT ON AN INTERNATIONAL SURVEY ON LANGUAGE TEACHING METHODS'

    Directory of Open Access Journals (Sweden)

    Jun Liu

    2004-06-01

    Full Text Available Do methods still have a place in 21" century language teaching? To answer this question, an international survey was conducted in the surnmer of 1999. A sample of 800 language teachers world-wide randomly drawn from 17,800 TESOLers were each given a 2-page survey. The return rate was 58.5% with the actual usable data set of448, which was analyzed by using both descriptive and inferential statistics. Among the ten commonly recognized teaching methods surveyed, both the Communicative Language Teaching Approach and an eclectic method seem to have the highest rate in familiarity, preference, and use. But when multiple factors, such as teaching contexts, instructional settings, learners' proficiency levels, class size, teaching experience and educational backgrounds of the teachers, and the status of being a native or nonnative English speaking professional were taken into consideration, various patterns and themes emerged. One interesting finding is that Grammar Translation is still used in EFL contexts, in larger classes, and with learners at low proficiency levels, though the ratio between the actual use of this method and teachers' preference does not match. Based on the results of the survey, a new theoretical framework is proposed to conceptualize language teaching methods in the post-methods era.

  10. Adaptive L1/2 Shooting Regularization Method for Survival Analysis Using Gene Expression Data

    Directory of Open Access Journals (Sweden)

    Xiao-Ying Liu

    2013-01-01

    Full Text Available A new adaptive L1/2 shooting regularization method for variable selection based on the Cox’s proportional hazards mode being proposed. This adaptive L1/2 shooting algorithm can be easily obtained by the optimization of a reweighed iterative series of L1 penalties and a shooting strategy of L1/2 penalty. Simulation results based on high dimensional artificial data show that the adaptive L1/2 shooting regularization method can be more accurate for variable selection than Lasso and adaptive Lasso methods. The results from real gene expression dataset (DLBCL also indicate that the L1/2 regularization method performs competitively.

  11. On the use of permutation in and the performance of a class of nonparametric methods to detect differential gene expression.

    Science.gov (United States)

    Pan, Wei

    2003-07-22

    Recently a class of nonparametric statistical methods, including the empirical Bayes (EB) method, the significance analysis of microarray (SAM) method and the mixture model method (MMM), have been proposed to detect differential gene expression for replicated microarray experiments conducted under two conditions. All the methods depend on constructing a test statistic Z and a so-called null statistic z. The null statistic z is used to provide some reference distribution for Z such that statistical inference can be accomplished. A common way of constructing z is to apply Z to randomly permuted data. Here we point our that the distribution of z may not approximate the null distribution of Z well, leading to possibly too conservative inference. This observation may apply to other permutation-based nonparametric methods. We propose a new method of constructing a null statistic that aims to estimate the null distribution of a test statistic directly. Using simulated data and real data, we assess and compare the performance of the existing method and our new method when applied in EB, SAM and MMM. Some interesting findings on operating characteristics of EB, SAM and MMM are also reported. Finally, by combining the idea of SAM and MMM, we outline a simple nonparametric method based on the direct use of a test statistic and a null statistic.

  12. Reprogramming Methods Do Not Affect Gene Expression Profile of Human Induced Pluripotent Stem Cells.

    Science.gov (United States)

    Trevisan, Marta; Desole, Giovanna; Costanzi, Giulia; Lavezzo, Enrico; Palù, Giorgio; Barzon, Luisa

    2017-01-20

    Induced pluripotent stem cells (iPSCs) are pluripotent cells derived from adult somatic cells. After the pioneering work by Yamanaka, who first generated iPSCs by retroviral transduction of four reprogramming factors, several alternative methods to obtain iPSCs have been developed in order to increase the yield and safety of the process. However, the question remains open on whether the different reprogramming methods can influence the pluripotency features of the derived lines. In this study, three different strategies, based on retroviral vectors, episomal vectors, and Sendai virus vectors, were applied to derive iPSCs from human fibroblasts. The reprogramming efficiency of the methods based on episomal and Sendai virus vectors was higher than that of the retroviral vector-based approach. All human iPSC clones derived with the different methods showed the typical features of pluripotent stem cells, including the expression of alkaline phosphatase and stemness maker genes, and could give rise to the three germ layer derivatives upon embryoid bodies assay. Microarray analysis confirmed the presence of typical stem cell gene expression profiles in all iPSC clones and did not identify any significant difference among reprogramming methods. In conclusion, the use of different reprogramming methods is equivalent and does not affect gene expression profile of the derived human iPSCs.

  13. Reprogramming Methods Do Not Affect Gene Expression Profile of Human Induced Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Marta Trevisan

    2017-01-01

    Full Text Available Induced pluripotent stem cells (iPSCs are pluripotent cells derived from adult somatic cells. After the pioneering work by Yamanaka, who first generated iPSCs by retroviral transduction of four reprogramming factors, several alternative methods to obtain iPSCs have been developed in order to increase the yield and safety of the process. However, the question remains open on whether the different reprogramming methods can influence the pluripotency features of the derived lines. In this study, three different strategies, based on retroviral vectors, episomal vectors, and Sendai virus vectors, were applied to derive iPSCs from human fibroblasts. The reprogramming efficiency of the methods based on episomal and Sendai virus vectors was higher than that of the retroviral vector-based approach. All human iPSC clones derived with the different methods showed the typical features of pluripotent stem cells, including the expression of alkaline phosphatase and stemness maker genes, and could give rise to the three germ layer derivatives upon embryoid bodies assay. Microarray analysis confirmed the presence of typical stem cell gene expression profiles in all iPSC clones and did not identify any significant difference among reprogramming methods. In conclusion, the use of different reprogramming methods is equivalent and does not affect gene expression profile of the derived human iPSCs.

  14. Locating disease genes using Bayesian variable selection with the Haseman-Elston method

    Directory of Open Access Journals (Sweden)

    He Qimei

    2003-12-01

    Full Text Available Abstract Background We applied stochastic search variable selection (SSVS, a Bayesian model selection method, to the simulated data of Genetic Analysis Workshop 13. We used SSVS with the revisited Haseman-Elston method to find the markers linked to the loci determining change in cholesterol over time. To study gene-gene interaction (epistasis and gene-environment interaction, we adopted prior structures, which incorporate the relationship among the predictors. This allows SSVS to search in the model space more efficiently and avoid the less likely models. Results In applying SSVS, instead of looking at the posterior distribution of each of the candidate models, which is sensitive to the setting of the prior, we ranked the candidate variables (markers according to their marginal posterior probability, which was shown to be more robust to the prior. Compared with traditional methods that consider one marker at a time, our method considers all markers simultaneously and obtains more favorable results. Conclusions We showed that SSVS is a powerful method for identifying linked markers using the Haseman-Elston method, even for weak effects. SSVS is very effective because it does a smart search over the entire model space.

  15. A Fast Multiple-Kernel Method With Applications to Detect Gene-Environment Interaction.

    Science.gov (United States)

    Marceau, Rachel; Lu, Wenbin; Holloway, Shannon; Sale, Michèle M; Worrall, Bradford B; Williams, Stephen R; Hsu, Fang-Chi; Tzeng, Jung-Ying

    2015-09-01

    Kernel machine (KM) models are a powerful tool for exploring associations between sets of genetic variants and complex traits. Although most KM methods use a single kernel function to assess the marginal effect of a variable set, KM analyses involving multiple kernels have become increasingly popular. Multikernel analysis allows researchers to study more complex problems, such as assessing gene-gene or gene-environment interactions, incorporating variance-component based methods for population substructure into rare-variant association testing, and assessing the conditional effects of a variable set adjusting for other variable sets. The KM framework is robust, powerful, and provides efficient dimension reduction for multifactor analyses, but requires the estimation of high dimensional nuisance parameters. Traditional estimation techniques, including regularization and the "expectation-maximization (EM)" algorithm, have a large computational cost and are not scalable to large sample sizes needed for rare variant analysis. Therefore, under the context of gene-environment interaction, we propose a computationally efficient and statistically rigorous "fastKM" algorithm for multikernel analysis that is based on a low-rank approximation to the nuisance effect kernel matrices. Our algorithm is applicable to various trait types (e.g., continuous, binary, and survival traits) and can be implemented using any existing single-kernel analysis software. Through extensive simulation studies, we show that our algorithm has similar performance to an EM-based KM approach for quantitative traits while running much faster. We also apply our method to the Vitamin Intervention for Stroke Prevention (VISP) clinical trial, examining gene-by-vitamin effects on recurrent stroke risk and gene-by-age effects on change in homocysteine level. © 2015 WILEY PERIODICALS, INC.

  16. Exploration of new perspectives and limitations in Agrobacterium mediated gene transfer technology. Progress report, [June 1, 1992-- May 31, 1994

    Energy Technology Data Exchange (ETDEWEB)

    Marton, L.

    1994-12-31

    This report describes progress aimed at constructing gene-transfer technology for Nicotiana plumbaginifolia. Most actual effort as described herein has so far been directed at exploring new perspectives and limitations in Agrobacterium mediated gene transfer. Accomplishments are described using a core homologous gene targeting vector.

  17. Analyzing Plasmodium falciparum erythrocyte membrane protein 1 gene expression by a next generation sequencing based method

    DEFF Research Database (Denmark)

    Jespersen, Jakob S.; Petersen, Bent; Seguin-Orlando, Andaine

    2013-01-01

    at identifying PfEMP1 features associated with high virulence. Here we present the first effective method for sequence analysis of var genes expressed in field samples: a sequential PCR and next generation sequencing based technique applied on expressed var sequence tags and subsequently on long range PCR......, encoded by ~60 highly variable 'var' genes per haploid genome. PfEMP1 is exported to the surface of infected erythrocytes and is thought to be fundamental to immune evasion by adhesion to host and parasite factors. The highly variable nature has constituted a roadblock in var expression studies aimed...

  18. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  19. An Intelligent Method of Product Scheme Design Based on Product Gene

    Directory of Open Access Journals (Sweden)

    Qing Song Ai

    2013-01-01

    Full Text Available Nowadays, in order to have some featured products, many customers tend to buy customized products instead of buying common ones in supermarket. The manufacturing enterprises, with the purpose of improving their competitiveness, are focusing on providing customized products with high quality and low cost as well. At present, how to produce customized products rapidly and cheaply has been the key challenge to manufacturing enterprises. In this paper, an intelligent modeling approach applied to supporting the modeling of customized products is proposed, which may improve the efficiency during the product design process. Specifically, the product gene (PG method, which is an analogy of biological evolution in engineering area, is employed to model products in a new way. Based on product gene, we focus on the intelligent modeling method to generate product schemes rapidly and automatically. The process of our research includes three steps: (1 develop a product gene model for customized products; (2 find the obtainment and storage method for product gene; and (3 propose a specific genetic algorithm used for calculating the solution of customized product and generating new product schemes. Finally, a case study is applied to test the usefulness of our study.

  20. A metabolomics-based method for studying the effect of yfcC gene in Escherichia coli on metabolism.

    Science.gov (United States)

    Wang, Xiyue; Xie, Yuping; Gao, Peng; Zhang, Sufang; Tan, Haidong; Yang, Fengxu; Lian, Rongwei; Tian, Jing; Xu, Guowang

    2014-04-15

    Metabolomics is a potent tool to assist in identifying the function of unknown genes through analysis of metabolite changes in the context of varied genetic backgrounds. However, the availability of a universal unbiased profiling analysis is still a big challenge. In this study, we report an optimized metabolic profiling method based on gas chromatography-mass spectrometry for Escherichia coli. It was found that physiological saline at -80°C could ensure satisfied metabolic quenching with less metabolite leakage. A solution of methanol/water (21:79, v/v) was proved to be efficient for intracellular metabolite extraction. This method was applied to investigate the metabolome difference among wild-type E. coli, its yfcC deletion, and overexpression mutants. Statistical and bioinformatic analysis of the metabolic profiling data indicated that the expression of yfcC potentially affected the metabolism of glyoxylate shunt. This finding was further validated by real-time quantitative polymerase chain reactions showing that expression of aceA and aceB, the key genes in glyoxylate shunt, was upregulated by yfcC. This study exemplifies the robustness of the proposed metabolic profiling analysis strategy and its potential roles in investigating unknown gene functions in view of metabolome difference. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Social assessment methods recommendation report: Draft: Revision 1

    International Nuclear Information System (INIS)

    1986-05-01

    This report recommends an approach to the Salt Repository Project Office (SRPO) for assessing the social impacts of a high-level nuclear waste repository. The report establishes several criteria for selecting an approach and then describes and evaluates existing social assessment approaches against the selection criteria. Based upon these evaluations a recommendation is made. The proposed modifications include suggestions to strengthen the approach by including elements of other methods. Suggestions for the development of community surveys and local leader interviews are also made. 64 refs., 4 figs., 14 tabs

  2. INTERIM REPORT IMPROVED METHODS FOR INCORPORATING RISK IN DECISION MAKING

    Energy Technology Data Exchange (ETDEWEB)

    Clausen, M. J.; Fraley, D. W.; Denning, R. S.

    1980-08-01

    This paper reports observations and preliminary investigations in the first phase of a research program covering methodologies for making safety-related decisions. The objective has been to gain insight into NRC perceptions of the value of formal decision methods, their possible applications, and how risk is, or may be, incorporated in decision making. The perception of formal decision making techniques, held by various decision makers, and what may be done to improve them, were explored through interviews with NRC staff. An initial survey of decision making methods, an assessment of the applicability of formal methods vis-a-vis the available information, and a review of methods of incorporating risk and uncertainty have also been conducted.

  3. THORs Power Method for Hydrokinetic Devices - Final Report

    Energy Technology Data Exchange (ETDEWEB)

    J. Turner Hunt; Joel Rumker

    2012-08-08

    Ocean current energy represents a vast untapped source of renewable energy that exists on the outer continental shelf areas of the 5 major continents. Ocean currents are unidirectional in nature and are perpetuated by thermal and salinity sea gradients, as well as coriolis forces imparted from the earth's rotation. This report details THORs Power Method, a breakthrough power control method that can provide dramatic increases to the capacity factor over and above existing marine hydrokinetic (MHK) devices employed in the extraction of energy from ocean currents. THORs Power Method represents a constant speed, variable depth operational method that continually locates the ocean current turbine at a depth at which the rated power of the generator is routinely achieved. Variable depth operation is achieved by using various vertical force effectors, including ballast tanks for variable weight, a hydrodynamic wing for variable lift or down force and drag flaps for variable vehicle drag forces.

  4. Analysis of the robustness of network-based disease-gene prioritization methods reveals redundancy in the human interactome and functional diversity of disease-genes.

    Directory of Open Access Journals (Sweden)

    Emre Guney

    Full Text Available Complex biological systems usually pose a trade-off between robustness and fragility where a small number of perturbations can substantially disrupt the system. Although biological systems are robust against changes in many external and internal conditions, even a single mutation can perturb the system substantially, giving rise to a pathophenotype. Recent advances in identifying and analyzing the sequential variations beneath human disorders help to comprehend a systemic view of the mechanisms underlying various disease phenotypes. Network-based disease-gene prioritization methods rank the relevance of genes in a disease under the hypothesis that genes whose proteins interact with each other tend to exhibit similar phenotypes. In this study, we have tested the robustness of several network-based disease-gene prioritization methods with respect to the perturbations of the system using various disease phenotypes from the Online Mendelian Inheritance in Man database. These perturbations have been introduced either in the protein-protein interaction network or in the set of known disease-gene associations. As the network-based disease-gene prioritization methods are based on the connectivity between known disease-gene associations, we have further used these methods to categorize the pathophenotypes with respect to the recoverability of hidden disease-genes. Our results have suggested that, in general, disease-genes are connected through multiple paths in the human interactome. Moreover, even when these paths are disturbed, network-based prioritization can reveal hidden disease-gene associations in some pathophenotypes such as breast cancer, cardiomyopathy, diabetes, leukemia, parkinson disease and obesity to a greater extend compared to the rest of the pathophenotypes tested in this study. Gene Ontology (GO analysis highlighted the role of functional diversity for such diseases.

  5. Splicing defect in FKBP10 gene causes autosomal recessive osteogenesis imperfecta disease: a case report.

    Science.gov (United States)

    Maghami, Fatemeh; Tabei, Seyed Mohammad Bagher; Moravej, Hossein; Dastsooz, Hassan; Modarresi, Farzaneh; Silawi, Mohammad; Faghihi, Mohammad Ali

    2018-05-25

    Osteogenesis imperfecta (OI) is a group of connective tissue disorder caused by mutations of genes involved in the production of collagen and its supporting proteins. Although the majority of reported OI variants are in COL1A1 and COL1A2 genes, recent reports have shown problems in other non-collagenous genes involved in the post translational modifications, folding and transport, transcription and proliferation of osteoblasts, bone mineralization, and cell signaling. Up to now, 17 types of OI have been reported in which types I to IV are the most frequent cases with autosomal dominant pattern of inheritance. Here we report an 8- year- old boy with OI who has had multiple fractures since birth and now he is wheelchair-dependent. To identify genetic cause of OI in our patient, whole exome sequencing (WES) was carried out and it revealed a novel deleterious homozygote splice acceptor site mutation (c.1257-2A > G, IVS7-2A > G) in FKBP10 gene in the patient. Then, the identified mutation was confirmed using Sanger sequencing in the proband as homozygous and in his parents as heterozygous, indicating its autosomal recessive pattern of inheritance. In addition, we performed RT-PCR on RNA transcripts originated from skin fibroblast of the proband to analyze the functional effect of the mutation on splicing pattern of FKBP10 gene and it showed skipping of the exon 8 of this gene. Moreover, Real-Time PCR was carried out to quantify the expression level of FKBP10 in the proband and his family members in which it revealed nearly the full decrease in the level of FKBP10 expression in the proband and around 75% decrease in its level in the carriers of the mutation, strongly suggesting the pathogenicity of the mutation. Our study identified, for the first time, a private pathogenic splice site mutation in FKBP10 gene and further prove the involvement of this gene in the rare cases of autosomal recessive OI type XI with distinguished clinical manifestations.

  6. Methods for determining radionuclide retardation factors: status report

    International Nuclear Information System (INIS)

    Relyea, J.F.; Serne, R.J.; Rai, D.

    1980-04-01

    This report identifies a number of mechanisms that retard radionuclide migration, and describes the static and dynamic methods that are used to study such retardation phenomena. Both static and dynamic methods are needed for reliable safety assessments of underground nuclear-waste repositories. This report also evaluates the extent to which the two methods may be used to diagnose radionuclide migration through various types of geologic media, among them unconsolidated, crushed, intact, and fractured rocks. Adsorption is one mechanism that can control radionuclide concentrations in solution and therefore impede radionuclide migration. Other mechanisms that control a solution's radionuclide concentration and radionuclide migration are precipitation of hydroxides and oxides, oxidation-reduction reactions, and the formation of minerals that might include the radionuclide as a structural element. The retardation mechanisms mentioned above are controlled by such factors as surface area, cation exchange capacity, solution pH, chemical composition of the rock and of the solution, oxidation-reduction potential, and radionuclide concentration. Rocks and ground waters used in determining retardation factors should represent the expected equilibrium conditions in the geologic system under investigation. Static test methods can be used to rapidly screen the effects of the factors mentioned above. Dynamic (or column) testing, is needed to assess the effects of hydrodynamics and the interaction of hydrodynamics with the other important parameters. This paper proposes both a standard method for conducting batch Kd determinations, and a standard format for organizing and reporting data. Dynamic testing methods are not presently developed to the point that a standard methodology can be proposed. Normal procedures are outlined for column experimentation and the data that are needed to analyze a column experiment are identified

  7. SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

    Directory of Open Access Journals (Sweden)

    Mehmet AYBEKE

    2015-12-01

    Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

  8. A family with hereditary hemochromatosis carrying HFE gene splice site mutation: a case report

    Directory of Open Access Journals (Sweden)

    NING Huibin

    2017-01-01

    Full Text Available ObjectiveTo investigate a new type of HFE gene mutation in a family with hereditary hemochromatosis (HH. MethodsThe analysis of HFE gene was performed for one patient with a confirmed diagnosis of HH and five relatives. Blood genomic DNA was extracted and PCR multiplication was performed for the exon and intron splice sequences of related HFE, HJV, HAMP, transferrin receptor 2 (TfR2, and SLC40A1 genes. After agarose gel electrophoresis and purification, bi-directional direct sequencing was performed to detect mutation sites. ResultsThe proband had abnormal liver function and increases in serum iron, total iron binding capacity, serum ferritin, and transferrin saturation, as well as T→C homozygous mutation in the fourth base of intron 2 in the intervening sequence of the exon EXON2 of HFE gene (IVs 2+4T→C, C/C homozygous, splicing, abnormal. There were no abnormalities in HJV, HAMP, TfR2, and SLC40A1 genes. The proband′s son had the same homozygous mutation, three relatives had heterozygous mutations, and one relative had no abnormal mutations. ConclusionGene detection plays an important role in the diagnosis of hemochromatosis, and IVs 2+4T→C mutation may be a new pathogenic mutation for HH in China.

  9. Pathogenic classification of LPL gene variants reported to be associated with LPL deficiency

    DEFF Research Database (Denmark)

    Rodrigues, Rute; Artieda, Marta; Tejedor, Diego

    2016-01-01

    into the deleterious effect of the mutations is clinically essential. METHODS: We used gene sequencing followed by in-vivo/in-vitro and in-silico tools for classification. We classified 125 rare LPL mutations in 33 subjects thought to have LPL deficiency and in 314 subjects selected for very SHTG. RESULTS: Of the 33...

  10. AST: an automated sequence-sampling method for improving the taxonomic diversity of gene phylogenetic trees.

    Science.gov (United States)

    Zhou, Chan; Mao, Fenglou; Yin, Yanbin; Huang, Jinling; Gogarten, Johann Peter; Xu, Ying

    2014-01-01

    A challenge in phylogenetic inference of gene trees is how to properly sample a large pool of homologous sequences to derive a good representative subset of sequences. Such a need arises in various applications, e.g. when (1) accuracy-oriented phylogenetic reconstruction methods may not be able to deal with a large pool of sequences due to their high demand in computing resources; (2) applications analyzing a collection of gene trees may prefer to use trees with fewer operational taxonomic units (OTUs), for instance for the detection of horizontal gene transfer events by identifying phylogenetic conflicts; and (3) the pool of available sequences is biased towards extensively studied species. In the past, the creation of subsamples often relied on manual selection. Here we present an Automated sequence-Sampling method for improving the Taxonomic diversity of gene phylogenetic trees, AST, to obtain representative sequences that maximize the taxonomic diversity of the sampled sequences. To demonstrate the effectiveness of AST, we have tested it to solve four problems, namely, inference of the evolutionary histories of the small ribosomal subunit protein S5 of E. coli, 16 S ribosomal RNAs and glycosyl-transferase gene family 8, and a study of ancient horizontal gene transfers from bacteria to plants. Our results show that the resolution of our computational results is almost as good as that of manual inference by domain experts, hence making the tool generally useful to phylogenetic studies by non-phylogeny specialists. The program is available at http://csbl.bmb.uga.edu/~zhouchan/AST.php.

  11. Rapid isolation of gene homologs across taxa: Efficient identification and isolation of gene orthologs from non-model organism genomes, a technical report

    Directory of Open Access Journals (Sweden)

    Heffer Alison

    2011-03-01

    Full Text Available Abstract Background Tremendous progress has been made in the field of evo-devo through comparisons of related genes from diverse taxa. While the vast number of species in nature precludes a complete analysis of the molecular evolution of even one single gene family, this would not be necessary to understand fundamental mechanisms underlying gene evolution if experiments could be designed to systematically sample representative points along the path of established phylogenies to trace changes in regulatory and coding gene sequence. This isolation of homologous genes from phylogenetically diverse, representative species can be challenging, especially if the gene is under weak selective pressure and evolving rapidly. Results Here we present an approach - Rapid Isolation of Gene Homologs across Taxa (RIGHT - to efficiently isolate specific members of gene families. RIGHT is based upon modification and a combination of degenerate polymerase chain reaction (PCR and gene-specific amplified fragment length polymorphism (AFLP. It allows targeted isolation of specific gene family members from any organism, only requiring genomic DNA. We describe this approach and how we used it to isolate members of several different gene families from diverse arthropods spanning millions of years of evolution. Conclusions RIGHT facilitates systematic isolation of one gene from large gene families. It allows for efficient gene isolation without whole genome sequencing, RNA extraction, or culturing of non-model organisms. RIGHT will be a generally useful method for isolation of orthologs from both distant and closely related species, increasing sample size and facilitating the tracking of molecular evolution of gene families and regulatory networks across the tree of life.

  12. Endogenous Locus Reporter Assays.

    Science.gov (United States)

    Liu, Yaping; Hermes, Jeffrey; Li, Jing; Tudor, Matthew

    2018-01-01

    Reporter gene assays are widely used in high-throughput screening (HTS) to identify compounds that modulate gene expression. Traditionally a reporter gene assay is built by cloning an endogenous promoter sequence or synthetic response elements in the regulatory region of a reporter gene to monitor transcriptional activity of a specific biological process (exogenous reporter assay). In contrast, an endogenous locus reporter has a reporter gene inserted in the endogenous gene locus that allows the reporter gene to be expressed under the control of the same regulatory elements as the endogenous gene, thus more accurately reflecting the changes seen in the regulation of the actual gene. In this chapter, we introduce some of the considerations behind building a reporter gene assay for high-throughput compound screening and describe the methods we have utilized to establish 1536-well format endogenous locus reporter and exogenous reporter assays for the screening of compounds that modulate Myc pathway activity.

  13. Genetic components for radiosensitivity. Gene expression in radiosensitive monocygotic twins. Final report

    International Nuclear Information System (INIS)

    Dikomey, Ekkehard

    2012-01-01

    The underlying hypothesis of this project was that the variation of individual radiosensitivity is determined by the different expression of single gens. This concept was tested using 60 monozygotic twin pairs, followed by an evaluation with 80 prostate cancer patients. Radiosensitivity was assessed for both G0- as well as G2-phase using chromosomal assays. G0- radiosensitivity is determined by lethal chromosomal aberrations and reflects the individual amount of cell killing, while G2-sensitivity is determined by chromatid breaks and is taken as an indicator of individual cancer risk. For both populations, G0- and G2-radiosensitivity are characterized by substantial variation with a CV of 11 and 14% or 27 and 21%, respectively. While the mean G0-sensitivity is the same for both populations, there is a slight difference for G2. The slightly higher value of G2-sensitivity found for prostate cancer patients might result from the higher age of this group. For both populations gene expression profiles were determined using the Affymetrix chip HG-U133+2.0. Overall gene expression was characterized by a huge variation covering more than four decades. However, for single genes, expression showed little variation with CV generally ranging only between 2 and 8%. Analysis of data using several different methods revealed that variation of both G0- as well as G2-radiosensitivity cannot be ascribed to the different expression of single genes. For twins, random forests can be used to identify 8 to 10 genes than are relevant either for G0- or G2-radiosensitivity. However, these genes cannot be confirmed by an evaluation with 80 prostate cancer patients. This finding clearly demonstrates that the hypothesis, due to which variation of individual radiosensitivity is caused by different expression of single genes, has to be rejected. It appears more likely that this parameter is determined by complex interactions of several genes in functional networks. (orig.)

  14. A comparison of digital gene expression profiling and methyl DNA immunoprecipitation as methods for gene discovery in honeybee (Apis mellifera behavioural genomic analyses.

    Directory of Open Access Journals (Sweden)

    Cui Guan

    Full Text Available The honey bee has a well-organized system of division of labour among workers. Workers typically progress through a series of discrete behavioural castes as they age, and this has become an important case study for exploring how dynamic changes in gene expression can influence behaviour. Here we applied both digital gene expression analysis and methyl DNA immunoprecipitation analysis to nurse, forager and reverted nurse bees (nurses that have returned to the nursing state after a period spent foraging from the same colony in order to compare the outcomes of these different forms of genomic analysis. A total of 874 and 710 significantly differentially expressed genes were identified in forager/nurse and reverted nurse/forager comparisons respectively. Of these, 229 genes exhibited reversed directions of gene expression differences between the forager/nurse and reverted nurse/forager comparisons. Using methyl-DNA immunoprecipitation combined with high-throughput sequencing (MeDIP-seq we identified 366 and 442 significantly differentially methylated genes in forager/nurse and reverted nurse/forager comparisons respectively. Of these, 165 genes were identified as differentially methylated in both comparisons. However, very few genes were identified as both differentially expressed and differentially methylated in our comparisons of nurses and foragers. These findings confirm that changes in both gene expression and DNA methylation are involved in the nurse and forager behavioural castes, but the different analytical methods reveal quite distinct sets of candidate genes.

  15. A simple protocol for preparation of a liposomal vesicle with encapsulated plasmid DNA that mediate high accumulation and reporter gene activity in tumor tissue

    DEFF Research Database (Denmark)

    Gjetting, Torben; Andresen, Thomas Lars; Christensen, Camilla Laulund

    2011-01-01

    The systemic delivery of gene therapeutics by non-viral methods has proven difficult. Transfection systems that are performing well in vitro have been reported to have disadvantageous properties such as rapid clearance and short circulation time often resulting in poor transfection efficiency whe...

  16. A simple protocol for preparation of a liposomal vesicle with encapsulated plasmid DNA that mediate high accumulation and reporter gene activity in tumor tissue

    DEFF Research Database (Denmark)

    Gjetting, Torben; Andresen, Thomas Lars; Christensen, Camilla Laulund

    2011-01-01

    The systemic delivery of gene therapeutics by non-viral methods has proven dif¿cult. Transfection systems that are performing well in vitro have been reported to have disadvantageous properties such as rapid clearance and short circulation time often resulting in poor transfection ef¿ciency when ...

  17. A novel mutation in the SH3BP2 gene causes cherubism: case report

    Directory of Open Access Journals (Sweden)

    Yu Shi-Feng

    2006-12-01

    Full Text Available Abstract Background Cherubism is a rare hereditary multi-cystic disease of the jaws, characterized by its typical appearance in early childhood, and stabilization and remission after puberty. It is genetically transmitted in an autosomal dominant fashion and the gene coding for SH3-binding protein 2 (SH3BP2 may be involved. Case presentation We investigated a family consisting of 21 members with 3 female affected individuals with cherubism from Northern China. Of these 21 family members, 17 were recruited for the genetic analysis. We conducted the direct sequence analysis of the SH3BP2 gene among these 17 family members. A disease-causing mutation was identified in exon 9 of the gene. It was an A1517G base change, which leads to a D419G amino acid substitution. Conclusion To our knowledge, the A1517G mutation has not been reported previously in cherubism. This finding is novel.

  18. Case report of novel CACNA1A gene mutation causing episodic ataxia type 2

    Directory of Open Access Journals (Sweden)

    David Alan Isaacs

    2017-05-01

    Full Text Available Background: Episodic ataxia type 2 (OMIM 108500 is an autosomal dominant channelopathy characterized by paroxysms of ataxia, vertigo, nausea, and other neurologic symptoms. More than 50 mutations of the CACNA1A gene have been discovered in families with episodic ataxia type 2, although 30%–50% of all patients with typical episodic ataxia type 2 phenotype have no detectable mutation of the CACNA1A gene. Case: A 46-year-old Caucasian man, with a long history of bouts of imbalance, vertigo, and nausea, presented to our hospital with 2 weeks of ataxia and headache. Subsequent evaluation revealed a novel mutation in the CACNA1A gene: c.1364 G > A Arg455Gln. Acetazolamide was initiated with symptomatic improvement. Conclusion: This case report expands the list of known CACNA1A mutations associated with episodic ataxia type 2.

  19. Use of reporter-gene based bacteria to quantify phenanthrene biodegradation and toxicity in soil

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Doyun [Department of Civil and Environmental Engineering, Seoul National University, Gwanakno 599, Seoul 151-742 (Korea, Republic of); Moon, Hee Sun [School of Earth and Environmental Science, Seoul National University, Gwanakno 599, Seoul 151-742 (Korea, Republic of); Lin, Chu-Ching; Barkay, Tamar [Department of Biochemistry and Microbiology, Rutgers University, 76 Lipman Drive, New Brunswick, NJ 08901 (United States); Nam, Kyoungphile, E-mail: kpnam@snu.ac.k [Department of Civil and Environmental Engineering, Seoul National University, Gwanakno 599, Seoul 151-742 (Korea, Republic of)

    2011-02-15

    A phenanthrene-degrading bacterium, Sphingomonas paucimobilis EPA505 was used to construct two fluorescence-based reporter strains. Strain D harboring gfp gene was constructed to generate green fluorescence when the strain started to biodegrade phenanthrene. Strain S possessing gef gene was designed to die once phenanthrene biodegradation was initiated and thus to lose green fluorescence when visualized by a live/dead cell staining. Confocal laser scanning microscopic observation followed by image analysis demonstrates that the fluorescence intensity generated by strain D increased and the intensity by strain S decreased linearly at the phenanthrene concentration of up to 200 mg/L. Such quantitative increase and decrease of fluorescence intensity in strain D (i.e., from 1 to 11.90 {+-} 0.72) and strain S (from 1 to 0.40 {+-} 0.07) were also evident in the presence of Ottawa sand spiked with the phenanthrene up to 1000 mg/kg. The potential use of the reporter strains in quantitatively determining biodegradable or toxic phenanthrene was discussed. - Research highlights: A novel reporter bacterial strain has been developed. The bacterium can quantitatively determine the change in fluorescence intensity. The intensity can represent the bioavailable phenanthrene in solid matrix. - A cell-killing gene harboring reporter bacterium shows phenanthrene toxicity.

  20. Final Report: Symposium on Adaptive Methods for Partial Differential Equations

    Energy Technology Data Exchange (ETDEWEB)

    Pernice, M.; Johnson, C.R.; Smith, P.J.; Fogelson, A.

    1998-12-10

    OAK-B135 Final Report: Symposium on Adaptive Methods for Partial Differential Equations. Complex physical phenomena often include features that span a wide range of spatial and temporal scales. Accurate simulation of such phenomena can be difficult to obtain, and computations that are under-resolved can even exhibit spurious features. While it is possible to resolve small scale features by increasing the number of grid points, global grid refinement can quickly lead to problems that are intractable, even on the largest available computing facilities. These constraints are particularly severe for three dimensional problems that involve complex physics. One way to achieve the needed resolution is to refine the computational mesh locally, in only those regions where enhanced resolution is required. Adaptive solution methods concentrate computational effort in regions where it is most needed. These methods have been successfully applied to a wide variety of problems in computational science and engineering. Adaptive methods can be difficult to implement, prompting the development of tools and environments to facilitate their use. To ensure that the results of their efforts are useful, algorithm and tool developers must maintain close communication with application specialists. Conversely it remains difficult for application specialists who are unfamiliar with the methods to evaluate the trade-offs between the benefits of enhanced local resolution and the effort needed to implement an adaptive solution method.

  1. Phytoalexin detoxification genes and gene products: Implication for the evolution of host specific traits for pathogenicity. Final report

    International Nuclear Information System (INIS)

    VanEtten, H.

    1997-01-01

    The overall objectives of this research were to determine which differences among PDA genes were associated with different levels of virulence on pea and to clone and characterize a MAK gene. The authors also proposed to characterize the pisatin detoxifying system in pea pathogens in addition to N. haematococca to assess whether pathogens of a common host had evolved similar pathogenicity genes

  2. Phytoalexin detoxification genes and gene products: Implication for the evolution of host specific traits for pathogenicity. Final report

    Energy Technology Data Exchange (ETDEWEB)

    VanEtten, H.

    1997-06-01

    The overall objectives of this research were to determine which differences among PDA genes were associated with different levels of virulence on pea and to clone and characterize a MAK gene. The authors also proposed to characterize the pisatin detoxifying system in pea pathogens in addition to N. haematococca to assess whether pathogens of a common host had evolved similar pathogenicity genes.

  3. Identifying essential genes in bacterial metabolic networks with machine learning methods

    Science.gov (United States)

    2010-01-01

    Background Identifying essential genes in bacteria supports to identify potential drug targets and an understanding of minimal requirements for a synthetic cell. However, experimentally assaying the essentiality of their coding genes is resource intensive and not feasible for all bacterial organisms, in particular if they are infective. Results We developed a machine learning technique to identify essential genes using the experimental data of genome-wide knock-out screens from one bacterial organism to infer essential genes of another related bacterial organism. We used a broad variety of topological features, sequence characteristics and co-expression properties potentially associated with essentiality, such as flux deviations, centrality, codon frequencies of the sequences, co-regulation and phyletic retention. An organism-wise cross-validation on bacterial species yielded reliable results with good accuracies (area under the receiver-operator-curve of 75% - 81%). Finally, it was applied to drug target predictions for Salmonella typhimurium. We compared our predictions to the viability of experimental knock-outs of S. typhimurium and identified 35 enzymes, which are highly relevant to be considered as potential drug targets. Specifically, we detected promising drug targets in the non-mevalonate pathway. Conclusions Using elaborated features characterizing network topology, sequence information and microarray data enables to predict essential genes from a bacterial reference organism to a related query organism without any knowledge about the essentiality of genes of the query organism. In general, such a method is beneficial for inferring drug targets when experimental data about genome-wide knockout screens is not available for the investigated organism. PMID:20438628

  4. Robust variable selection method for nonparametric differential equation models with application to nonlinear dynamic gene regulatory network analysis.

    Science.gov (United States)

    Lu, Tao

    2016-01-01

    The gene regulation network (GRN) evaluates the interactions between genes and look for models to describe the gene expression behavior. These models have many applications; for instance, by characterizing the gene expression mechanisms that cause certain disorders, it would be possible to target those genes to block the progress of the disease. Many biological processes are driven by nonlinear dynamic GRN. In this article, we propose a nonparametric differential equation (ODE) to model the nonlinear dynamic GRN. Specially, we address following questions simultaneously: (i) extract information from noisy time course gene expression data; (ii) model the nonlinear ODE through a nonparametric smoothing function; (iii) identify the important regulatory gene(s) through a group smoothly clipped absolute deviation (SCAD) approach; (iv) test the robustness of the model against possible shortening of experimental duration. We illustrate the usefulness of the model and associated statistical methods through a simulation and a real application examples.

  5. An Efficient Method for Identifying Gene Fusions by Targeted RNA Sequencing from Fresh Frozen and FFPE Samples.

    Directory of Open Access Journals (Sweden)

    Jonathan A Scolnick

    Full Text Available Fusion genes are known to be key drivers of tumor growth in several types of cancer. Traditionally, detecting fusion genes has been a difficult task based on fluorescent in situ hybridization to detect chromosomal abnormalities. More recently, RNA sequencing has enabled an increased pace of fusion gene identification. However, RNA-Seq is inefficient for the identification of fusion genes due to the high number of sequencing reads needed to detect the small number of fusion transcripts present in cells of interest. Here we describe a method, Single Primer Enrichment Technology (SPET, for targeted RNA sequencing that is customizable to any target genes, is simple to use, and efficiently detects gene fusions. Using SPET to target 5701 exons of 401 known cancer fusion genes for sequencing, we were able to identify known and previously unreported gene fusions from both fresh-frozen and formalin-fixed paraffin-embedded (FFPE tissue RNA in both normal tissue and cancer cells.

  6. HER2 gene amplification in patients with prostate cancer: Evaluating a CISH-based method.

    Science.gov (United States)

    Sharifi, Nazanin; Salmaninejad, Arash; Ferdosi, Samira; Bajestani, Abolfazl Nesaei; Khaleghiyan, Malihe; Estiar, Mehrdad Asghari; Jamali, Mansour; Nowroozi, Mohammad Reza; Shakoori, Abbas

    2016-12-01

    Prostate cancer (PCa) is one of the most widespread malignancies in the world. The role of the human epidermal growth factor receptor 2 (HER2) in the pathogenesis and progression of human PCa remains poorly understood. In contradiction with breast cancer, studies on HER2 overexpression and gene amplification in PCa have produced varying results, although the HER2 oncogene has been implicated in the biology of numerous tumor types, and serves as a prognostic marker and therapeutic target in breast cancer. Technical challenges are considered the main reasons for data discrepancies. Amplification of the HER2 gene has previously been reported in PCa, in which it was associated with tumor progression. The present study aimed to evaluate the prevalence and clinical significance of HER2 amplification in PCa. A total of 32 biopsy samples obtained from human prostate adenocarcinomas were evaluated by chromogenic in situ hybridization (CISH) to determine the frequency of patients with HER2 gene amplifications. High copy numbers of HER2 were detected in 19 of the prostate tumors analyzed. The results of the present study suggested that, in patients without amplification of HER2, high levels of prostate-specific antigen or a high Gleason score were not significantly correlated with a high pathologic stage. Furthermore, amplification levels of the HER2 gene were directly associated with pathologic stage in patients with PCa. Therefore, the potential use of HER2 as a prognostic factor or therapeutic target for PCa warrants further study.

  7. Reporter gene assay for the quantification of the activity and neutralizing antibody response to TNFα antagonists

    DEFF Research Database (Denmark)

    Lallemand, Christophe; Kavrochorianou, Nadia; Steenholdt, Casper

    2011-01-01

    A cell-based assay has been developed for the quantification of the activity of TNFα antagonists based on human erythroleukemic K562 cells transfected with a NFκB regulated firefly luciferase reporter-gene construct. Both drug activity and anti-drug neutralizing antibodies can be quantified...... with a high degree of precision within 2h, and without interference from cytokines and other factors known to activate NFκB. The assay cells also contain the Renilla luciferase reporter gene under the control of a constitutive promoter that allows TNFα-induced firefly luciferase activity to be normalized...... relative to Renilla luciferase expression. Thus, results are independent of cell number or differences in cell viability, resulting in intra and inter assay coefficients of variation of 10% or less. Normalization of results relative to the expression of an internal standard also provides a means...

  8. Late onset bipolar disorder and frontotemporal dementia with mutation in progranulin gene: a case report.

    Science.gov (United States)

    Rubino, Elisa; Vacca, Alessandro; Gallone, Salvatore; Govone, Flora; Zucca, Milena; Gai, Annalisa; Ferrero, Patrizia; Fenoglio, Pierpaola; Giordana, Maria Teresa; Rainero, Innocenzo

    2017-11-01

    Bipolar disorder is a chronic psychiatric illness characterised by fluctuation in mood state, with a relapsing and remitting course. Frontotemporal dementia (FTD) is a clinically and genetically heterogeneous syndrome, with the most frequent phenotype being behavioural variant frontotemporal dementia (bvFTD). Here, we report the case of an Italian male presenting with late-onset bipolar disorder that developed into bvFTD over time, carrying a mutation in the GRN gene. Interestingly, the patient carried the c.1639 C > T variant in the GRN gene, resulting in a R547C substitution. Our case report further corroborates the notion that, in addition to FTD, progranulin may be involved in the neurobiology of bipolar disorder type 1, and suggests to screen patients with late-onset bipolar disorder for GRN mutations.

  9. Genetic Bee Colony (GBC) algorithm: A new gene selection method for microarray cancer classification.

    Science.gov (United States)

    Alshamlan, Hala M; Badr, Ghada H; Alohali, Yousef A

    2015-06-01

    Naturally inspired evolutionary algorithms prove effectiveness when used for solving feature selection and classification problems. Artificial Bee Colony (ABC) is a relatively new swarm intelligence method. In this paper, we propose a new hybrid gene selection method, namely Genetic Bee Colony (GBC) algorithm. The proposed algorithm combines the used of a Genetic Algorithm (GA) along with Artificial Bee Colony (ABC) algorithm. The goal is to integrate the advantages of both algorithms. The proposed algorithm is applied to a microarray gene expression profile in order to select the most predictive and informative genes for cancer classification. In order to test the accuracy performance of the proposed algorithm, extensive experiments were conducted. Three binary microarray datasets are use, which include: colon, leukemia, and lung. In addition, another three multi-class microarray datasets are used, which are: SRBCT, lymphoma, and leukemia. Results of the GBC algorithm are compared with our recently proposed technique: mRMR when combined with the Artificial Bee Colony algorithm (mRMR-ABC). We also compared the combination of mRMR with GA (mRMR-GA) and Particle Swarm Optimization (mRMR-PSO) algorithms. In addition, we compared the GBC algorithm with other related algorithms that have been recently published in the literature, using all benchmark datasets. The GBC algorithm shows superior performance as it achieved the highest classification accuracy along with the lowest average number of selected genes. This proves that the GBC algorithm is a promising approach for solving the gene selection problem in both binary and multi-class cancer classification. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Inference of time-delayed gene regulatory networks based on dynamic Bayesian network hybrid learning method.

    Science.gov (United States)

    Yu, Bin; Xu, Jia-Meng; Li, Shan; Chen, Cheng; Chen, Rui-Xin; Wang, Lei; Zhang, Yan; Wang, Ming-Hui

    2017-10-06

    Gene regulatory networks (GRNs) research reveals complex life phenomena from the perspective of gene interaction, which is an important research field in systems biology. Traditional Bayesian networks have a high computational complexity, and the network structure scoring model has a single feature. Information-based approaches cannot identify the direction of regulation. In order to make up for the shortcomings of the above methods, this paper presents a novel hybrid learning method (DBNCS) based on dynamic Bayesian network (DBN) to construct the multiple time-delayed GRNs for the first time, combining the comprehensive score (CS) with the DBN model. DBNCS algorithm first uses CMI2NI (conditional mutual inclusive information-based network inference) algorithm for network structure profiles learning, namely the construction of search space. Then the redundant regulations are removed by using the recursive optimization algorithm (RO), thereby reduce the false positive rate. Secondly, the network structure profiles are decomposed into a set of cliques without loss, which can significantly reduce the computational complexity. Finally, DBN model is used to identify the direction of gene regulation within the cliques and search for the optimal network structure. The performance of DBNCS algorithm is evaluated by the benchmark GRN datasets from DREAM challenge as well as the SOS DNA repair network in Escherichia coli , and compared with other state-of-the-art methods. The experimental results show the rationality of the algorithm design and the outstanding performance of the GRNs.

  11. A flood-based information flow analysis and network minimization method for gene regulatory networks.

    Science.gov (United States)

    Pavlogiannis, Andreas; Mozhayskiy, Vadim; Tagkopoulos, Ilias

    2013-04-24

    Biological networks tend to have high interconnectivity, complex topologies and multiple types of interactions. This renders difficult the identification of sub-networks that are involved in condition- specific responses. In addition, we generally lack scalable methods that can reveal the information flow in gene regulatory and biochemical pathways. Doing so will help us to identify key participants and paths under specific environmental and cellular context. This paper introduces the theory of network flooding, which aims to address the problem of network minimization and regulatory information flow in gene regulatory networks. Given a regulatory biological network, a set of source (input) nodes and optionally a set of sink (output) nodes, our task is to find (a) the minimal sub-network that encodes the regulatory program involving all input and output nodes and (b) the information flow from the source to the sink nodes of the network. Here, we describe a novel, scalable, network traversal algorithm and we assess its potential to achieve significant network size reduction in both synthetic and E. coli networks. Scalability and sensitivity analysis show that the proposed method scales well with the size of the network, and is robust to noise and missing data. The method of network flooding proves to be a useful, practical approach towards information flow analysis in gene regulatory networks. Further extension of the proposed theory has the potential to lead in a unifying framework for the simultaneous network minimization and information flow analysis across various "omics" levels.

  12. A novel mutual information-based Boolean network inference method from time-series gene expression data.

    Directory of Open Access Journals (Sweden)

    Shohag Barman

    Full Text Available Inferring a gene regulatory network from time-series gene expression data in systems biology is a challenging problem. Many methods have been suggested, most of which have a scalability limitation due to the combinatorial cost of searching a regulatory set of genes. In addition, they have focused on the accurate inference of a network structure only. Therefore, there is a pressing need to develop a network inference method to search regulatory genes efficiently and to predict the network dynamics accurately.In this study, we employed a Boolean network model with a restricted update rule scheme to capture coarse-grained dynamics, and propose a novel mutual information-based Boolean network inference (MIBNI method. Given time-series gene expression data as an input, the method first identifies a set of initial regulatory genes using mutual information-based feature selection, and then improves the dynamics prediction accuracy by iteratively swapping a pair of genes between sets of the selected regulatory genes and the other genes. Through extensive simulations with artificial datasets, MIBNI showed consistently better performance than six well-known existing methods, REVEAL, Best-Fit, RelNet, CST, CLR, and BIBN in terms of both structural and dynamics prediction accuracy. We further tested the proposed method with two real gene expression datasets for an Escherichia coli gene regulatory network and a fission yeast cell cycle network, and also observed better results using MIBNI compared to the six other methods.Taken together, MIBNI is a promising tool for predicting both the structure and the dynamics of a gene regulatory network.

  13. Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

    Science.gov (United States)

    Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

    2012-08-15

    Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Species identification in meat products: A new screening method based on high resolution melting analysis of cyt b gene.

    Science.gov (United States)

    Lopez-Oceja, A; Nuñez, C; Baeta, M; Gamarra, D; de Pancorbo, M M

    2017-12-15

    Meat adulteration by substitution with lower value products and/or mislabeling involves economic, health, quality and socio-religious issues. Therefore, identification and traceability of meat species has become an important subject to detect possible fraudulent practices. In the present study the development of a high resolution melt (HRM) screening method for the identification of eight common meat species is reported. Samples from Bos taurus, Ovis aries, Sus scrofa domestica, Equus caballus, Oryctolagus cuniculus, Gallus gallus domesticus, Meleagris gallopavo and Coturnix coturnix were analyzed through the amplification of a 148 bp fragment from the cyt b gene with a universal primer pair in HRM analyses. Melting profiles from each species, as well as from several DNA mixtures of these species and blind samples, allowed a successful species differentiation. The results demonstrated that the HRM method here proposed is a fast, reliable, and low-cost screening technique. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Scoping reviews: time for clarity in definition, methods, and reporting.

    Science.gov (United States)

    Colquhoun, Heather L; Levac, Danielle; O'Brien, Kelly K; Straus, Sharon; Tricco, Andrea C; Perrier, Laure; Kastner, Monika; Moher, David

    2014-12-01

    The scoping review has become increasingly popular as a form of knowledge synthesis. However, a lack of consensus on scoping review terminology, definition, methodology, and reporting limits the potential of this form of synthesis. In this article, we propose recommendations to further advance the field of scoping review methodology. We summarize current understanding of scoping review publication rates, terms, definitions, and methods. We propose three recommendations for clarity in term, definition and methodology. We recommend adopting the terms "scoping review" or "scoping study" and the use of a proposed definition. Until such time as further guidance is developed, we recommend the use of the methodological steps outlined in the Arksey and O'Malley framework and further enhanced by Levac et al. The development of reporting guidance for the conduct and reporting of scoping reviews is underway. Consistency in the proposed domains and methodologies of scoping reviews, along with the development of reporting guidance, will facilitate methodological advancement, reduce confusion, facilitate collaboration and improve knowledge translation of scoping review findings. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Malignant melanoma arising from a perianal fistula and harbouring a BRAF gene mutation: a case report

    International Nuclear Information System (INIS)

    Martinez-Cadenas, Conrado; Lozoya, Rafael; Boldó, Enrique; Bosch, Nuria; Peñas, Lucas; Flores-Couce, Esther; Ochoa, Enrique; Munárriz, Javier; Aracil, Juan P; Tajahuerce, Marcos; Royo, Ramón

    2011-01-01

    Melanoma of the anal region is a very uncommon disease, accounting for only 0.2-0.3% of all melanoma cases. Mutations of the BRAF gene are usually absent in melanomas occurring in this region as well as in other sun-protected regions. The development of a tumour in a longstanding perianal fistula is also extremely rare. More frequent is the case of a tumour presenting as a fistula, that is, the fistula being a consequence of the cancerous process, although we have found only two cases of fistula-generating melanomas reported in the literature. Here we report the case of a 38-year-old male who presented with a perianal fistula of four years of evolution. Histopathological examination of the fistulous tract confirmed the presence of malignant melanoma. Due to the small size and the central location of the melanoma inside the fistulous tract, we believe the melanoma reported here developed in the epithelium of the fistula once the latter was already formed. Resected sentinel lymph nodes were negative and the patient, after going through a wide local excision, remains disease-free nine years after diagnosis. DNA obtained from melanoma tissue was analysed by automated direct sequencing and the V600E (T1799A) mutation was detected in exon 15 of the BRAF gene. Since fistulae experience persistent inflammation, the fact that this melanoma harbours a BRAF mutation strengthens the view that oxidative stress caused by inflammatory processes plays an important role in the genesis of BRAF gene mutations

  17. Analysis of genes involved in sex determination of fishes by phenol-emulsion method

    Energy Technology Data Exchange (ETDEWEB)

    Nakayama, Ichiro; Nagoya, Hiroyuki; Okamoto, Hiroyuki; Araki, Kazuo [National Research Inst. of Aquaculture, Mie (Japan)

    1998-02-01

    With an aim to clarify the mechanism of sex determination common to vertebrates, the genes presumed to mediate the sex determination were analyzed through cDNA subtraction by phenol-emulsion method. A total RNA was extracted from male juvenile Amago, a kind of oncorhynchus and cDNA was synthesized using mRNA fractionated by oligo-dT column. The male-specific genes expressed in the stage of sex determination was isolated through incorporation to PVC-derived vector. Thus obtained genes were confirmed to be male-specific by Southern hybridization. The results of the screening for the subtracted products indicate that neither of the male-specific clones detected in this study was novel. Previous studies on sex discrimination based on mitochondrial DNA suggested that Sakuramasu and Amago belong in the same species, Oncorhynchus masou masou and the present results show that DNA sequence for male-derived GH pseudo-gene is partially different between the two fishes. (M.N.)

  18. Inhibition of Reporter Genes by Small Interfering RNAs in Cell Culture and Living Fish

    DEFF Research Database (Denmark)

    Larashati, Sekar; Schyth, Brian Dall; Lorenzen, Niels

    2011-01-01

    be used to observe the knock down effect by siRNAs designed to target these reporters. One aim of this project is to verify the specific knock down effect of siRNAs in cell culture and in living fish and to establish easy-read out models for testing the effect especially in vivo. Cell culture from human...... coinjection and the assay is important in order to detect knock down by siRNA. Our experiment reveal in vivo knock down at 72 hours post injection of reporter gene and siRNA, but further dose-response experiments are required to confirm specifity....

  19. Live-cell Imaging of Pol II Promoter Activity to Monitor Gene expression with RNA IMAGEtag reporters

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Ilchung [Ames Laboratory; Ray, Judhajeet [Ames Laboratory; Gupta, Vinayak [Iowa State University; Ilgu, Muslum [Ames Laboratory; Beasley, Jonathan [Iowa State University; Bendickson, Lee [Ames Laboratory; Mehanovic, Samir [Molecular Express; Kraus, George A. [Iowa State University; Nilsen-Hamilton, Marit [Ames Laboratory

    2014-04-20

    We describe a ribonucleic acid (RNA) reporter system for live-cell imaging of gene expression to detect changes in polymerase II activity on individual promoters in individual cells. The reporters use strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags) that can be expressed from a promoter of choice. For imaging, the cells are incubated with their ligands that are separately conjugated with one of the FRET pair, Cy3 and Cy5. The IMAGEtags were expressed in yeast from the GAL1, ADH1 or ACT1 promoters. Transcription from all three promoters was imaged in live cells and transcriptional increases from the GAL1 promoter were observed with time after adding galactose. Expression of the IMAGEtags did not affect cell proliferation or endogenous gene expression. Advantages of this method are that no foreign proteins are produced in the cells that could be toxic or otherwise influence the cellular response as they accumulate, the IMAGEtags are short lived and oxygen is not required to generate their signals. The IMAGEtag RNA reporter system provides a means of tracking changes in transcriptional activity in live cells and in real time.

  20. Methods for interpreting lists of affected genes obtained in a DNA microarray experiment

    Directory of Open Access Journals (Sweden)

    Hedegaard Jakob

    2009-07-01

    Full Text Available Abstract Background The aim of this paper was to describe and compare the methods used and the results obtained by the participants in a joint EADGENE (European Animal Disease Genomic Network of Excellence and SABRE (Cutting Edge Genomics for Sustainable Animal Breeding workshop focusing on post analysis of microarray data. The participating groups were provided with identical lists of microarray probes, including test statistics for three different contrasts, and the normalised log-ratios for each array, to be used as the starting point for interpreting the affected probes. The data originated from a microarray experiment conducted to study the host reactions in broilers occurring shortly after a secondary challenge with either a homologous or heterologous species of Eimeria. Results Several conceptually different analytical approaches, using both commercial and public available software, were applied by the participating groups. The following tools were used: Ingenuity Pathway Analysis, MAPPFinder, LIMMA, GOstats, GOEAST, GOTM, Globaltest, TopGO, ArrayUnlock, Pathway Studio, GIST and AnnotationDbi. The main focus of the approaches was to utilise the relation between probes/genes and their gene ontology and pathways to interpret the affected probes/genes. The lack of a well-annotated chicken genome did though limit the possibilities to fully explore the tools. The main results from these analyses showed that the biological interpretation is highly dependent on the statistical method used but that some common biological conclusions could be reached. Conclusion It is highly recommended to test different analytical methods on the same data set and compare the results to obtain a reliable biological interpretation of the affected genes in a DNA microarray experiment.

  1. Development of library preparation method able to correct gene expression levels in rice anther and isolate a trace expression gene mediated in cold-resistance

    International Nuclear Information System (INIS)

    Yamaguchi, Tomoya; Koike, Setsuo

    2000-01-01

    When cDNA library is prepared by a previously developed method, genes of which expression level is high are apt to be cloned at a high frequency, whereas genes of which expression level are low, are difficult to be cloned. A low-expression gene has been cloned at very low frequency. Therefore, the gene encoding the key enzyme that is involved in growth disturbance of rice pollen has not been identified. In this study, development of a library preparing method able to correct the expression level was attempted using highly sensitive detection method with radioisotope and some genes related to cold-resistance of rice were isolated. Double strand DNAs were synthesized using mRNA extract from rice anthers and annealed following heat-denaturation. It has been known that single strand DNA molecules abundantly existing in DNA solution can easily aggregate to form double strand DNA, but single stranded DNA molecules poor in the solution are apt to still remain as single strand after annealing. Thus, the amount of single strand DNA would be balanced in the solution between abundant DNA and poor DNA species. The authors succeeded to prepare a gene library including low and high expression genes at similar proportions. Moreover, spin trap method that allows RI labeling of DNA bound to latex particle, was developed to detect with high sensitivity, especially for genes that are expressed at low level. The present method could be used for recovery, detection and quantitative analysis of radiolabeled single strand DNA. Thus, it was demonstrated that the stage from tetrad sperm to small sperm might be easily affected by cold stress. The present results suggest that the expressions of β-1 and β-3 glucanase, which are involved in the release of small sperms following meiosis in the pollen formation, might be easily affected by cold stress. (M.N.)

  2. Development of library preparation method able to correct gene expression levels in rice anther and isolate a trace expression gene mediated in cold-resistance

    Energy Technology Data Exchange (ETDEWEB)

    Yamaguchi, Tomoya; Koike, Setsuo [Tohoku National Agricultural Experiment Station, Morioka (Japan)

    2000-02-01

    When cDNA library is prepared by a previously developed method, genes of which expression level is high are apt to be cloned at a high frequency, whereas genes of which expression level are low, are difficult to be cloned. A low-expression gene has been cloned at very low frequency. Therefore, the gene encoding the key enzyme that is involved in growth disturbance of rice pollen has not been identified. In this study, development of a library preparing method able to correct the expression level was attempted using highly sensitive detection method with radioisotope and some genes related to cold-resistance of rice were isolated. Double strand DNAs were synthesized using mRNA extract from rice anthers and annealed following heat-denaturation. It has been known that single strand DNA molecules abundantly existing in DNA solution can easily aggregate to form double strand DNA, but single stranded DNA molecules poor in the solution are apt to still remain as single strand after annealing. Thus, the amount of single strand DNA would be balanced in the solution between abundant DNA and poor DNA species. The authors succeeded to prepare a gene library including low and high expression genes at similar proportions. Moreover, spin trap method that allows RI labeling of DNA bound to latex particle, was developed to detect with high sensitivity, especially for genes that are expressed at low level. The present method could be used for recovery, detection and quantitative analysis of radiolabeled single strand DNA. Thus, it was demonstrated that the stage from tetrad sperm to small sperm might be easily affected by cold stress. The present results suggest that the expressions of {beta}-1 and {beta}-3 glucanase, which are involved in the release of small sperms following meiosis in the pollen formation, might be easily affected by cold stress. (M.N.)

  3. Comparative study of cellular kinetics of reporter probe [{sup 131}I]FIAU in neonatal cardiac myocytes after transfer of HSV1-tk reporter gene with two vectors

    Energy Technology Data Exchange (ETDEWEB)

    Lan Xiaoli [Department of Nuclear Medicine, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Hubei Province Key Laboratory of Molecular Imaging, Wuhan 430022 (China)], E-mail: lxl730724@hotmail.com; Yin Xiaohua; Wang Ruihua; Liu Ying [Department of Nuclear Medicine, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Hubei Province Key Laboratory of Molecular Imaging, Wuhan 430022 (China); Zhang Yongxue [Department of Nuclear Medicine, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China) and Hubei Province Key Laboratory of Molecular Imaging, Wuhan 430022 (China)], E-mail: zhyx1229@163.com

    2009-02-15

    Aim: Reporter gene imaging is a promising approach for noninvasive monitoring of cardiac gene therapy. In this study, HSV1-tk (herpes simplex virus type 1 thymidine kinase) and FIAU (2'-fluoro-2'-deoxy-1-{beta}-D-arabinofuranosyl-5-iodouracil) were used as the reporter gene and probe, respectively. Cellular uptakes of radiolabeled FIAU of neonatal rat cardiac myocytes transferred with HSV1-tk were compared between two vectors, adenovirus and liposome. The aims of this study were to choose the better vector and to provide a theoretical basis for good nuclide images. Methods: Neonatal cardiac myocytes were obtained from rat heart by single collagenase digestion. HSV1-tk inserted into adenovirus vector (recombinant adenovirus type 5, Ad5-tk) and plasmid (pDC316-tk) coated with Lipofectamine 2000 (pDC316-tk/lipoplex) were developed; thus, HSV1-tk could be transferred into neonatal cardiac myocytes. FAU (2'-fluoro-2'-deoxy-1-{beta}-D-arabinofuranosyluracil) was labeled with {sup 131}I, and the product was assessed after purification with reversed-phase Sep-Pak C-18 column. The uptake rates of [{sup 131}I]FIAU in the transferred cardiac myocytes at different times (0.5, 1, 2, 3, 4 and 5 h) were detected. Furthermore, mRNA expression and protein expression of HSV1-tk were detected by semiquantitative reverse-transcriptase polymerase chain reaction and immunocytochemistry. Results: FAU could be labeled with {sup 131}I, and the labeling efficiency and radiochemical purity rates were 53.82{+-}2.05% and 94.85{+-}1.76%, respectively. Time-dependent increase of the accumulation of [{sup 131}I]FIAU was observed in both the Ad5-tk group and the pDC316/lipoplex group, and the highest uptake rate occurred at 5 h, with peak values of 12.55{+-}0.37% and 2.09{+-}0.34%, respectively. Greater uptakes of [{sup 131}I]FIAU in Ad5-tk-infected cells compared with pDC316/lipoplex-transfected ones occurred at all the time points (t=12.978-38.253, P<.01). The exogenous gene

  4. Bacterial host and reporter gene optimization for genetically encoded whole cell biosensors.

    Science.gov (United States)

    Brutesco, Catherine; Prévéral, Sandra; Escoffier, Camille; Descamps, Elodie C T; Prudent, Elsa; Cayron, Julien; Dumas, Louis; Ricquebourg, Manon; Adryanczyk-Perrier, Géraldine; de Groot, Arjan; Garcia, Daniel; Rodrigue, Agnès; Pignol, David; Ginet, Nicolas

    2017-01-01

    Whole-cell biosensors based on reporter genes allow detection of toxic metals in water with high selectivity and sensitivity under laboratory conditions; nevertheless, their transfer to a commercial inline water analyzer requires specific adaptation and optimization to field conditions as well as economical considerations. We focused here on both the influence of the bacterial host and the choice of the reporter gene by following the responses of global toxicity biosensors based on constitutive bacterial promoters as well as arsenite biosensors based on the arsenite-inducible P ars promoter. We observed important variations of the bioluminescence emission levels in five different Escherichia coli strains harboring two different lux-based biosensors, suggesting that the best host strain has to be empirically selected for each new biosensor under construction. We also investigated the bioluminescence reporter gene system transferred into Deinococcus deserti, an environmental, desiccation- and radiation-tolerant bacterium that would reduce the manufacturing costs of bacterial biosensors for commercial water analyzers and open the field of biodetection in radioactive environments. We thus successfully obtained a cell survival biosensor and a metal biosensor able to detect a concentration as low as 100 nM of arsenite in D. deserti. We demonstrated that the arsenite biosensor resisted desiccation and remained functional after 7 days stored in air-dried D. deserti cells. We also report here the use of a new near-infrared (NIR) fluorescent reporter candidate, a bacteriophytochrome from the magnetotactic bacterium Magnetospirillum magneticum AMB-1, which showed a NIR fluorescent signal that remained optimal despite increasing sample turbidity, while in similar conditions, a drastic loss of the lux-based biosensors signal was observed.

  5. Reporter gene expression in fish following cutaneous infection with pantropic retroviral vectors.

    Science.gov (United States)

    Paul, T A; Burns, J C; Shike, H; Getchell, R; Bowser, P R; Whitlock, K E; Casey, J W

    2001-06-01

    A central issue in gene delivery systems is choosing promoters that will direct defined and sustainable levels of gene expression. Pantropic retroviral vectors provide a means to insert genes into either somatic or germline cells. In this study, we focused on somatic cell infection by evaluating the activity of 3 promoters inserted by vectors into fish cell lines and fish skin using pantropic retroviruses. In bluegill and zebrafish cell lines, the highest levels of luciferase expression were observed from the 5' murine leukemia virus long terminal repeat of the retroviral vector. The Rous sarcoma virus long terminal repeat and cytomegalovirus early promoter, as internal promoters, generated lower levels of luciferase. Luciferase reporter vectors infected zebrafish skin, as measured by the presence of viral DNA, and expressed luciferase. We infected developing walleye dermal sarcomas with retroviral vectors to provide an environment with enhanced cell proliferation, a condition necessary for integration of the provirus into the host genome. We demonstrated a 4-fold to 7-fold increase in luciferase gene expression in tumor tissue over infections in normal walleye skin.

  6. The first report of the vanC1 gene in Enterococcus faecium isolated from a human clinical specimen

    Directory of Open Access Journals (Sweden)

    Mingyue Sun

    2014-09-01

    Full Text Available The vanC1 gene, which is chromosomally located, confers resistance to vancomycin and serves as a species marker for Enterococcus gallinarum. Enterococcus faecium TJ4031 was isolated from a blood culture and harbours the vanC1gene. Polymerase chain reaction (PCR assays were performed to detect vanXYc and vanTc genes. Only the vanXYc gene was found in the E. faecium TJ4031 isolate. The minimum inhibitory concentrations of vancomycin and teicoplanin were 2 µg/mL and 1 µg/mL, respectively. Real-time reverse transcription-PCR results revealed that the vanC1and vanXYc genes were not expressed. Pulsed-field gel electrophoresis and southern hybridisation results showed that the vanC1 gene was encoded in the chromosome. E. faecalis isolated from animals has been reported to harbour vanC1gene. However, this study is the first to report the presence of the vanC1gene in E. faecium of human origin. Additionally, our research showed the vanC1gene cannot serve as a species-specific gene of E. gallinarum and that it is able to be transferred between bacteria. Although the resistance marker is not expressed in the strain, our results showed that E. faecium could acquire the vanC1gene from different species.

  7. Dissecting miRNA gene repression on single cell level with an advanced fluorescent reporter system

    Science.gov (United States)

    Lemus-Diaz, Nicolas; Böker, Kai O.; Rodriguez-Polo, Ignacio; Mitter, Michael; Preis, Jasmin; Arlt, Maximilian; Gruber, Jens

    2017-01-01

    Despite major advances on miRNA profiling and target predictions, functional readouts for endogenous miRNAs are limited and frequently lead to contradicting conclusions. Numerous approaches including functional high-throughput and miRISC complex evaluations suggest that the functional miRNAome differs from the predictions based on quantitative sRNA profiling. To resolve the apparent contradiction of expression versus function, we generated and applied a fluorescence reporter gene assay enabling single cell analysis. This approach integrates and adapts a mathematical model for miRNA-driven gene repression. This model predicts three distinct miRNA-groups with unique repression activities (low, mid and high) governed not just by expression levels but also by miRNA/target-binding capability. Here, we demonstrate the feasibility of the system by applying controlled concentrations of synthetic siRNAs and in parallel, altering target-binding capability on corresponding reporter-constructs. Furthermore, we compared miRNA-profiles with the modeled predictions of 29 individual candidates. We demonstrate that expression levels only partially reflect the miRNA function, fitting to the model-projected groups of different activities. Furthermore, we demonstrate that subcellular localization of miRNAs impacts functionality. Our results imply that miRNA profiling alone cannot define their repression activity. The gene regulatory function is a dynamic and complex process beyond a minimalistic conception of “highly expressed equals high repression”. PMID:28338079

  8. Objective Method for Selecting Outdoor Reporting Conditions for Photovoltaic Performance

    International Nuclear Information System (INIS)

    Maish, A.

    1999-01-01

    Outdoor performance of photovoltaic modules and systems depends on prevailing conditions at the time of measurement. Outdoor test conditions must be relevant to device performance and readily attainable. Flat-plate, nonconcentrator PV device performance is reported with respect to fixed conditions referred to as Standard Reporting Conditions (SRC) of 1 kW/m plane of array total irradiance, 25 C device temperature, and a reference spectral distribution at air mass 1.5 under certain atmospheric conditions. We report a method of analyzing historical meteorological and irradiance data to determine the range of outdoor environmental parameters and solar irradiance components that affect solar collector performance when the SRC 1 kW/m total irradiance value occurs outdoors. We used data from the 30 year U.S. National Solar Radiation Data Base (NSRDB) , restricting irradiance conditions to within +/- 25 W/m of 1 kW/m on a solar tracking flat-plate collector. The distributions of environmental parameter values under these conditions are non-Gaussian and site dependent. Therefore the median, as opposed to the mean, of the observed distributions is chosen to represent appropriate outdoor reporting conditions. We found the average medians for the direct beam component (834 W/m), ambient temperature (24.4 C), total column water vapor (1.4 cm), and air mass (1.43) are near commonly used SRC values. Average median wind speed (4.4 m/s) and broadband aerosol optical depth (0.08) were significantly different from commonly used values

  9. Enriching the gene set analysis of genome-wide data by incorporating directionality of gene expression and combining statistical hypotheses and methods

    Science.gov (United States)

    Väremo, Leif; Nielsen, Jens; Nookaew, Intawat

    2013-01-01

    Gene set analysis (GSA) is used to elucidate genome-wide data, in particular transcriptome data. A multitude of methods have been proposed for this step of the analysis, and many of them have been compared and evaluated. Unfortunately, there is no consolidated opinion regarding what methods should be preferred, and the variety of available GSA software and implementations pose a difficulty for the end-user who wants to try out different methods. To address this, we have developed the R package Piano that collects a range of GSA methods into the same system, for the benefit of the end-user. Further on we refine the GSA workflow by using modifications of the gene-level statistics. This enables us to divide the resulting gene set P-values into three classes, describing different aspects of gene expression directionality at gene set level. We use our fully implemented workflow to investigate the impact of the individual components of GSA by using microarray and RNA-seq data. The results show that the evaluated methods are globally similar and the major separation correlates well with our defined directionality classes. As a consequence of this, we suggest to use a consensus scoring approach, based on multiple GSA runs. In combination with the directionality classes, this constitutes a more thorough basis for an enriched biological interpretation. PMID:23444143

  10. Luciferase NanoLuc as a reporter for gene expression and protein levels in Saccharomyces cerevisiae.

    Science.gov (United States)

    Masser, Anna E; Kandasamy, Ganapathi; Kaimal, Jayasankar Mohanakrishnan; Andréasson, Claes

    2016-05-01

    Reporter proteins are essential tools in the study of biological processes and are employed to monitor changes in gene expression and protein levels. Luciferases are reporter proteins that enable rapid and highly sensitive detection with an outstanding dynamic range. Here we evaluated the usefulness of the 19 kDa luciferase NanoLuc (Nluc), derived from the deep sea shrimp Oplophorus gracilirostris, as a reporter protein in yeast. Cassettes with codon-optimized genes expressing yeast Nluc (yNluc) or its destabilized derivative yNlucPEST have been assembled in the context of the dominant drug resistance marker kanMX. The reporter proteins do not impair the growth of yeast cells and exhibit half-lives of 40 and 5 min, respectively. The commercial substrate Nano-Glo® is compatible with detection of yNluc bioluminescence in yeast using standard commercial substrate. © 2016 The Authors. Yeast published by John Wiley & Sons Ltd. © 2016 The Authors. Yeast published by John Wiley & Sons Ltd.

  11. A meta-analysis based method for prioritizing candidate genes involved in a pre-specific function

    Directory of Open Access Journals (Sweden)

    Jingjing Zhai

    2016-12-01

    Full Text Available The identification of genes associated with a given biological function in plants remains a challenge, although network-based gene prioritization algorithms have been developed for Arabidopsis thaliana and many non-model plant species. Nevertheless, these network-based gene prioritization algorithms have encountered several problems; one in particular is that of unsatisfactory prediction accuracy due to limited network coverage, varying link quality, and/or uncertain network connectivity. Thus a model that integrates complementary biological data may be expected to increase the prediction accuracy of gene prioritization. Towards this goal, we developed a novel gene prioritization method named RafSee, to rank candidate genes using a random forest algorithm that integrates sequence, evolutionary, and epigenetic features of plants. Subsequently, we proposed an integrative approach named RAP (Rank Aggregation-based data fusion for gene Prioritization, in which an order statistics-based meta-analysis was used to aggregate the rank of the network-based gene prioritization method and RafSee, for accurately prioritizing candidate genes involved in a pre-specific biological function. Finally, we showcased the utility of RAP by prioritizing 380 flowering-time genes in Arabidopsis. The ‘leave-one-out’ cross-validation experiment showed that RafSee could work as a complement to a current state-of-art network-based gene prioritization system (AraNet v2. Moreover, RAP ranked 53.68% (204/380 flowering-time genes higher than AraNet v2, resulting in an 39.46% improvement in term of the first quartile rank. Further evaluations also showed that RAP was effective in prioritizing genes-related to different abiotic stresses. To enhance the usability of RAP for Arabidopsis and non-model plant species, an R package implementing the method is freely available at http://bioinfo.nwafu.edu.cn/software.

  12. Comparison of neuronal spike exchange methods on a Blue Gene/P supercomputer

    Directory of Open Access Journals (Sweden)

    Michael eHines

    2011-11-01

    Full Text Available The performance of several spike exchange methods using a Blue Gene/P supercomputerhas been tested with 8K to 128K cores using randomly connected networks of up to 32M cells with 1k connections per cell and 4M cells with 10k connections per cell. The spike exchange methods used are the standard Message Passing Interface collective, MPI_Allgather, and several variants of the non-blocking multisend method either implemented via non-blocking MPI_Isend, or exploiting the possibility of very low overhead direct memory access communication available on the Blue Gene/P. In all cases the worst performing method was that using MPI_Isend due to the high overhead of initiating a spike communication. The two best performing methods --- the persistent multisend method using the Record-Replay feature of the Deep Computing Messaging Framework DCMF_Multicast;and a two phase multisend in which a DCMF_Multicast is used to first send to a subset of phase 1 destination cores which then pass it on to their subset of phase 2 destination cores --- had similar performance with very low overhead for the initiation of spike communication. Departure from ideal scaling for the multisend methods is almost completely due to load imbalance caused by the largevariation in number of cells that fire on each processor in the interval between synchronization. Spike exchange time itself is negligible since transmission overlaps with computation and is handled by a direct memory access controller. We conclude that ideal performance scaling will be ultimately limited by imbalance between incoming processor spikes between synchronization intervals. Thus, counterintuitively, maximization of load balance requires that the distribution of cells on processors should not reflect neural net architecture but be randomly distributed so that sets of cells which are burst firing together should be on different processors with their targets on as large a set of processors as possible.

  13. Estimating Fuel Cycle Externalities: Analytical Methods and Issues, Report 2

    Energy Technology Data Exchange (ETDEWEB)

    Barnthouse, L.W.; Cada, G.F.; Cheng, M.-D.; Easterly, C.E.; Kroodsma, R.L.; Lee, R.; Shriner, D.S.; Tolbert, V.R.; Turner, R.S.

    1994-07-01

    of complex issues that also have not been fully addressed. This document contains two types of papers that seek to fill part of this void. Some of the papers describe analytical methods that can be applied to one of the five steps of the damage function approach. The other papers discuss some of the complex issues that arise in trying to estimate externalities. This report, the second in a series of eight reports, is part of a joint study by the U.S. Department of Energy (DOE) and the Commission of the European Communities (EC)* on the externalities of fuel cycles. Most of the papers in this report were originally written as working papers during the initial phases of this study. The papers provide descriptions of the (non-radiological) atmospheric dispersion modeling that the study uses; reviews much of the relevant literature on ecological and health effects, and on the economic valuation of those impacts; contains several papers on some of the more complex and contentious issues in estimating externalities; and describes a method for depicting the quality of scientific information that a study uses. The analytical methods and issues that this report discusses generally pertain to more than one of the fuel cycles, though not necessarily to all of them. The report is divided into six parts, each one focusing on a different subject area.

  14. Fuel Cycle Externalities: Analytical Methods and Issues, Report 2

    International Nuclear Information System (INIS)

    Barnthouse, L.W.; Cada, G.F.; Cheng, M.-D.; Easterly, C.E.; Kroodsma, R.L.; Lee, R.; Shriner, D.S.; Tolbert, V.R.; Turner, R.S.

    1994-01-01

    that also have not been fully addressed. This document contains two types of papers that seek to fill part of this void. Some of the papers describe analytical methods that can be applied to one of the five steps of the damage function approach. The other papers discuss some of the complex issues that arise in trying to estimate externalities. This report, the second in a series of eight reports, is part of a joint study by the U.S. Department of Energy (DOE) and the Commission of the European Communities (EC)* on the externalities of fuel cycles. Most of the papers in this report were originally written as working papers during the initial phases of this study. The papers provide descriptions of the (non-radiological) atmospheric dispersion modeling that the study uses; reviews much of the relevant literature on ecological and health effects, and on the economic valuation of those impacts; contains several papers on some of the more complex and contentious issues in estimating externalities; and describes a method for depicting the quality of scientific information that a study uses. The analytical methods and issues that this report discusses generally pertain to more than one of the fuel cycles, though not necessarily to all of them. The report is divided into six parts, each one focusing on a different subject area

  15. pTRA - A reporter system for monitoring the intracellular dynamics of gene expression.

    Science.gov (United States)

    Wagner, Sabine G; Ziegler, Martin; Löwe, Hannes; Kremling, Andreas; Pflüger-Grau, Katharina

    2018-01-01

    The presence of standardised tools and methods to measure and represent accurately biological parts and functions is a prerequisite for successful metabolic engineering and crucial to understand and predict the behaviour of synthetic genetic circuits. Many synthetic gene networks are based on transcriptional circuits, thus information on transcriptional and translational activity is important for understanding and fine-tuning the synthetic function. To this end, we have developed a toolkit to analyse systematically the transcriptional and translational activity of a specific synthetic part in vivo. It is based on the plasmid pTRA and allows the assignment of specific transcriptional and translational outputs to the gene(s) of interest (GOI) and to compare different genetic setups. By this, the optimal combination of transcriptional strength and translational activity can be identified. The design is tested in a case study using the gene encoding the fluorescent mCherry protein as GOI. We show the intracellular dynamics of mRNA and protein formation and discuss the potential and shortcomings of the pTRA plasmid.

  16. SigEMD: A powerful method for differential gene expression analysis in single-cell RNA sequencing data.

    Science.gov (United States)

    Wang, Tianyu; Nabavi, Sheida

    2018-04-24

    Differential gene expression analysis is one of the significant efforts in single cell RNA sequencing (scRNAseq) analysis to discover the specific changes in expression levels of individual cell types. Since scRNAseq exhibits multimodality, large amounts of zero counts, and sparsity, it is different from the traditional bulk RNA sequencing (RNAseq) data. The new challenges of scRNAseq data promote the development of new methods for identifying differentially expressed (DE) genes. In this study, we proposed a new method, SigEMD, that combines a data imputation approach, a logistic regression model and a nonparametric method based on the Earth Mover's Distance, to precisely and efficiently identify DE genes in scRNAseq data. The regression model and data imputation are used to reduce the impact of large amounts of zero counts, and the nonparametric method is used to improve the sensitivity of detecting DE genes from multimodal scRNAseq data. By additionally employing gene interaction network information to adjust the final states of DE genes, we further reduce the false positives of calling DE genes. We used simulated datasets and real datasets to evaluate the detection accuracy of the proposed method and to compare its performance with those of other differential expression analysis methods. Results indicate that the proposed method has an overall powerful performance in terms of precision in detection, sensitivity, and specificity. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Preclinical evaluation of gene delivery methods for the treatment of loco-regional disease in breast cancer.

    LENUS (Irish Health Repository)

    Rajendran, Simon

    2011-04-01

    Preclinical results with various gene therapy strategies indicate significant potential for new cancer treatments. However, many therapeutics fail at clinical trial, often due to differences in tissue physiology between animal models and humans, and tumor phenotype variation. Clinical data relevant to treatment strategies may be generated prior to clinical trial through experimentation using intact patient tissue ex vivo. We developed a novel tumor slice model culture system that is universally applicable to gene delivery methods, using a realtime luminescence detection method to assess gene delivery. Methods investigated include viruses (adenovirus [Ad] and adeno-associated virus), lipofection, ultrasound (US), electroporation and naked DNA. Viability and tumor populations within the slices were well maintained for seven days, and gene delivery was qualitatively and quantitatively examinable for all vectors. Ad was the most efficient gene delivery vector with transduction efficiency >50%. US proved the optimal non-viral gene delivery method in human tumor slices. The nature of the ex vivo culture system permitted examination of specific elements. Parameters shown to diminish Ad gene delivery included blood, regions of low viability and secondary disease. US gene delivery was significantly reduced by blood and skin, while tissue hyperthermia improved gene delivery. US achieved improved efficacy for secondary disease. The ex vivo model was also suitable for examination of tissue-specific effects on vector expression, with Ad expression mediated by the CXCR4 promoter shown to provide a tumor selective advantage over the ubiquitously active cytomegalovirus promoter. In conclusion, this is the first study incorporating patient tissue models in comparing gene delivery from various vectors, providing knowledge on cell-type specificity and examining the crucial biological factors determining successful gene delivery. The results highlight the importance of in

  18. Preclinical evaluation of gene delivery methods for the treatment of loco-regional disease in breast cancer.

    LENUS (Irish Health Repository)

    Rajendran, Simon

    2012-01-31

    Preclinical results with various gene therapy strategies indicate significant potential for new cancer treatments. However, many therapeutics fail at clinical trial, often due to differences in tissue physiology between animal models and humans, and tumor phenotype variation. Clinical data relevant to treatment strategies may be generated prior to clinical trial through experimentation using intact patient tissue ex vivo. We developed a novel tumor slice model culture system that is universally applicable to gene delivery methods, using a realtime luminescence detection method to assess gene delivery. Methods investigated include viruses (adenovirus [Ad] and adeno-associated virus), lipofection, ultrasound (US), electroporation and naked DNA. Viability and tumor populations within the slices were well maintained for seven days, and gene delivery was qualitatively and quantitatively examinable for all vectors. Ad was the most efficient gene delivery vector with transduction efficiency >50%. US proved the optimal non-viral gene delivery method in human tumor slices. The nature of the ex vivo culture system permitted examination of specific elements. Parameters shown to diminish Ad gene delivery included blood, regions of low viability and secondary disease. US gene delivery was significantly reduced by blood and skin, while tissue hyperthermia improved gene delivery. US achieved improved efficacy for secondary disease. The ex vivo model was also suitable for examination of tissue-specific effects on vector expression, with Ad expression mediated by the CXCR4 promoter shown to provide a tumor selective advantage over the ubiquitously active cytomegalovirus promoter. In conclusion, this is the first study incorporating patient tissue models in comparing gene delivery from various vectors, providing knowledge on cell-type specificity and examining the crucial biological factors determining successful gene delivery. The results highlight the importance of in

  19. Reconstruction of gene regulatory modules from RNA silencing of IFN-α modulators: experimental set-up and inference method.

    Science.gov (United States)

    Grassi, Angela; Di Camillo, Barbara; Ciccarese, Francesco; Agnusdei, Valentina; Zanovello, Paola; Amadori, Alberto; Finesso, Lorenzo; Indraccolo, Stefano; Toffolo, Gianna Maria

    2016-03-12

    Inference of gene regulation from expression data may help to unravel regulatory mechanisms involved in complex diseases or in the action of specific drugs. A challenging task for many researchers working in the field of systems biology is to build up an experiment with a limited budget and produce a dataset suitable to reconstruct putative regulatory modules worth of biological validation. Here, we focus on small-scale gene expression screens and we introduce a novel experimental set-up and a customized method of analysis to make inference on regulatory modules starting from genetic perturbation data, e.g. knockdown and overexpression data. To illustrate the utility of our strategy, it was applied to produce and analyze a dataset of quantitative real-time RT-PCR data, in which interferon-α (IFN-α) transcriptional response in endothelial cells is investigated by RNA silencing of two candidate IFN-α modulators, STAT1 and IFIH1. A putative regulatory module was reconstructed by our method, revealing an intriguing feed-forward loop, in which STAT1 regulates IFIH1 and they both negatively regulate IFNAR1. STAT1 regulation on IFNAR1 was object of experimental validation at the protein level. Detailed description of the experimental set-up and of the analysis procedure is reported, with the intent to be of inspiration for other scientists who want to realize similar experiments to reconstruct gene regulatory modules starting from perturbations of possible regulators. Application of our approach to the study of IFN-α transcriptional response modulators in endothelial cells has led to many interesting novel findings and new biological hypotheses worth of validation.

  20. Development of a rapid method for direct detection of tet(M) genes in soil from Danish farmland

    DEFF Research Database (Denmark)

    Agersø, Yvonne; Sengeløv, Gitte; Jensen, Lars Bogø

    2004-01-01

    . The tet(M) gene was directly detected in 10-80% of the samples from the various farmland soils and could be detected in all samples tested after selective enrichment. To validate the obtained results, the method was applied to garden soil samples where lower prevalence of resistance was found. Result......A method for direct detection of antibiotic resistance genes in soil samples has been developed. The tetracycline resistance gene, tet(M), was used as a model. The method was validated on Danish farmland soil that had repeatedly been treated with pig manure slurry containing resistant bacteria......: A detection limit of 10(2)-10(3) copies of the tet(M) gene per gram of soil (in a Bacillus cereus group bacterium) was achieved. tet(M) gene was detected in soil samples with the highest prevalence on farmland treated with pig manure slurry....

  1. Systems-based biological concordance and predictive reproducibility of gene set discovery methods in cardiovascular disease.

    Science.gov (United States)

    Azuaje, Francisco; Zheng, Huiru; Camargo, Anyela; Wang, Haiying

    2011-08-01

    The discovery of novel disease biomarkers is a crucial challenge for translational bioinformatics. Demonstration of both their classification power and reproducibility across independent datasets are essential requirements to assess their potential clinical relevance. Small datasets and multiplicity of putative biomarker sets may explain lack of predictive reproducibility. Studies based on pathway-driven discovery approaches have suggested that, despite such discrepancies, the resulting putative biomarkers tend to be implicated in common biological processes. Investigations of this problem have been mainly focused on datasets derived from cancer research. We investigated the predictive and functional concordance of five methods for discovering putative biomarkers in four independently-generated datasets from the cardiovascular disease domain. A diversity of biosignatures was identified by the different methods. However, we found strong biological process concordance between them, especially in the case of methods based on gene set analysis. With a few exceptions, we observed lack of classification reproducibility using independent datasets. Partial overlaps between our putative sets of biomarkers and the primary studies exist. Despite the observed limitations, pathway-driven or gene set analysis can predict potentially novel biomarkers and can jointly point to biomedically-relevant underlying molecular mechanisms. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. Methods for implementing revisions to emergency operating procedures. Final report

    International Nuclear Information System (INIS)

    Myers, L.B.; Bell, A.J.

    1984-05-01

    In response to the Three Mile Island (TMI) accident, the US Nuclear Regulatory Commission (NRC) has published the TMI Action Plan. The TMI Action Plan Item I.C.1 called for the upgrading of Emergency Operating Procedures (EOPs) at nuclear power plants. The program developed from this Action Plan item has resulted in utility efforts to: (1) revise EOPs; (2) train personnel in the use of the EOPs; and (3) implement the revised EOPs. The NRC supported the study presented in this report to identify factors which influence the effectiveness of training and implementation of revised EOPs. The NRC's major concern was the possible effects of negative transfer of training. The report includes a summary of existing methods for implementing revisions to procedures based on interviews of plant personnel, a review of the training literature applicable to the effect of previously learned procedures on the learning of and performance with revised procedures (i.e., negative transfer) and recommendations of methods and schedules for implementing revised EOPs. While the study found that the concern over negative transfer of training was not as great as anticipated, several recommendations were made. These include: (1) overtraining of operators to reduce the effect of observed negative transfer; and (2) implementation of the revised EOPs as soon as possible after training to minimize the time operators must rely upon the old EOPs after having been trained on the revised EOPs. The results of the study should be useful both to the utilities and the NRC in the development and review of EOP implementation programs

  3. Development of RNAi method for screening candidate genes to control emerald ash borer, Agrilus planipennis.

    Science.gov (United States)

    Rodrigues, Thais B; Rieske, Lynne K; J Duan, Jian; Mogilicherla, Kanakachari; Palli, Subba R

    2017-08-07

    The ingestion of double-strand RNAs (dsRNA) targeting essential genes in an insect could cause mortality. Based on this principle, a new generation of insect control methods using RNA interference (RNAi) are being developed. In this work, we developed a bioassay for oral delivery of dsRNA to an invasive forest and urban tree pest, the emerald ash borer (EAB, Agrilus planipennis). EAB feeds and develops beneath the bark, killing trees rapidly. This behavior, coupled with the lack of a reliable artificial diet for rearing larvae and adults, make them difficult to study. We found that dsRNA is transported and processed to siRNAs by EAB larvae within 72 h after ingestion. Also, feeding neonate larvae with IAP (inhibitor of apoptosis) or COP (COPI coatomer, β subunit) dsRNA silenced their target genes and caused mortality. Both an increase in the concentration of dsRNA fed and sequential feeding of two different dsRNAs increased mortality. Here we provide evidence for successful RNAi in EAB, and demonstrate the development of a rapid and effective bioassay for oral delivery of dsRNA to screen additional genes.

  4. A New Method for the Evaluation of Vaccine Safety Based on Comprehensive Gene Expression Analysis

    Directory of Open Access Journals (Sweden)

    Haruka Momose

    2010-01-01

    Full Text Available For the past 50 years, quality control and safety tests have been used to evaluate vaccine safety. However, conventional animal safety tests need to be improved in several aspects. For example, the number of test animals used needs to be reduced and the test period shortened. It is, therefore, necessary to develop a new vaccine evaluation system. In this review, we show that gene expression patterns are well correlated to biological responses in vaccinated rats. Our findings and methods using experimental biology and genome science provide an important means of assessment for vaccine toxicity.

  5. ESPRIT: A Method for Defining Soluble Expression Constructs in Poorly Understood Gene Sequences.

    Science.gov (United States)

    Mas, Philippe J; Hart, Darren J

    2017-01-01

    Production of soluble, purifiable domains or multi-domain fragments of proteins is a prerequisite for structural biology and other applications. When target sequences are poorly annotated, or when there are few similar sequences available for alignments, identification of domains can be problematic. A method called expression of soluble proteins by random incremental truncation (ESPRIT) addresses this problem by high-throughput automated screening of tens of thousands of enzymatically truncated gene fragments. Rare soluble constructs are identified by experimental screening, and the boundaries revealed by DNA sequencing.

  6. Transmission electron microscopic method for gene mapping on polytene chromosomes by in situ hybridization

    OpenAIRE

    Wu, Madeline; Davidson, Norman

    1981-01-01

    A transmission electron microscope method for gene mapping by in situ hybridization to Drosophila polytene chromosomes has been developed. As electron-opaque labels, we use colloidal gold spheres having a diameter of 25 nm. The spheres are coated with a layer of protein to which Escherichia coli single-stranded DNA is photochemically crosslinked. Poly(dT) tails are added to the 3' OH ends of these DNA strands, and poly(dA) tails are added to the 3' OH ends of a fragmented cloned Drosophila DN...

  7. WASTE PACKAGE OPERATIONS FY99 CLOSURE METHODS REPORT

    Energy Technology Data Exchange (ETDEWEB)

    M. C. Knapp

    1999-09-23

    The waste package (WP) closure weld development task is part of a larger engineering development program to develop waste package designs. The purpose of the larger waste package engineering development program is to develop nuclear waste package fabrication and closure methods that the Nuclear Regulatory Commission will find acceptable and will license for disposal of spent nuclear fuel (SNF), non-fuel components, and vitrified high-level waste within a Monitored Geologic Repository (MGR). Within the WP closure development program are several major development tasks, which, in turn, are divided into subtasks. The major tasks include: WP fabrication development, WP closure weld development, nondestructive examination (NDE) development, and remote in-service inspection development. The purpose of this report is to present the objectives, technical information, and work scope relating to the WP closure weld development.and NDE tasks and subtasks and to report results of the closure weld and NDE development programs for fiscal year 1999 (FY-99). The objective of the FY-99 WP closure weld development task was to develop requirements for closure weld surface and volumetric NDE performance demonstrations, investigate alternative NDE inspection techniques, and develop specifications for welding, NDE, and handling system integration. In addition, objectives included fabricating several flat plate mock-ups that could be used for NDE development, stress relief peening, corrosion testing, and residual stress testing.

  8. WASTE PACKAGE OPERATIONS FY-99 CLOSURE METHODS REPORT

    International Nuclear Information System (INIS)

    M. C. Knapp

    1999-01-01

    The waste package (WP) closure weld development task is part of a larger engineering development program to develop waste package designs. The purpose of the larger waste package engineering development program is to develop nuclear waste package fabrication and closure methods that the Nuclear Regulatory Commission will find acceptable and will license for disposal of spent nuclear fuel (SNF), non-fuel components, and vitrified high-level waste within a Monitored Geologic Repository (MGR). Within the WP closure development program are several major development tasks, which, in turn, are divided into subtasks. The major tasks include: WP fabrication development, WP closure weld development, nondestructive examination (NDE) development, and remote in-service inspection development. The purpose of this report is to present the objectives, technical information, and work scope relating to the WP closure weld development.and NDE tasks and subtasks and to report results of the closure weld and NDE development programs for fiscal year 1999 (FY-99). The objective of the FY-99 WP closure weld development task was to develop requirements for closure weld surface and volumetric NDE performance demonstrations, investigate alternative NDE inspection techniques, and develop specifications for welding, NDE, and handling system integration. In addition, objectives included fabricating several flat plate mock-ups that could be used for NDE development, stress relief peening, corrosion testing, and residual stress testing

  9. Gene Expression Analysis of Immunostained Endothelial Cells Isolated from Formaldehyde-fixated Paraffin Embedded Tumors Using Laser Capture Microdissection – a Technical Report

    Science.gov (United States)

    Kaneko, Tomoatsu; Okiji, Takashi; Kaneko, Reika; Suda, Hideaki; Nör, Jacques E.

    2009-01-01

    Laser capture microdissection (LCM) allows microscopic procurement of specific cell types from tissue sections that can then be used for gene expression analysis. In conventional LCM, frozen tissues stained with hematoxylin are normally used to the molecular analysis. Recent studies suggested that it is possible to carry out gene expression analysis of formaldehyde-fixated paraffin embedded (FFPE) tissues that were stained with hematoxylin. However, it is still unclear if quantitative gene expression analyses can be performed from LCM cells from FFPE tissues that were subjected to immunostaining to enhance identification of target cells. In this proof-of-principle study, we analyzed by RT-PCR and real time PCR the expression of genes in factor VIII immunostained human endothelial cells that were dissected from FFPE tissues by LCM. We observed that immunostaining should be performed at 4°C to preserve the mRNA from the cells. The expression of Bcl-2 in the endothelial cells was evaluated by RT-PCR and by real time PCR. GAPDH and 18S were used as house keeping genes for RT-PCR and real time PCR, respectively. This report unveils a method for quantitative gene expression analysis in cells that were identified by immunostaining and retrieved by LCM from FFPE tissues. This method is ideally suited for the analysis of relatively rare cell types within a tissue, and should improve on our ability to perform differential diagnosis of pathologies as compared to conventional LCM. PMID:19425073

  10. Consequences of population topology for studying gene flow using link-based landscape genetic methods.

    Science.gov (United States)

    van Strien, Maarten J

    2017-07-01

    Many landscape genetic studies aim to determine the effect of landscape on gene flow between populations. These studies frequently employ link-based methods that relate pairwise measures of historical gene flow to measures of the landscape and the geographical distance between populations. However, apart from landscape and distance, there is a third important factor that can influence historical gene flow, that is, population topology (i.e., the arrangement of populations throughout a landscape). As the population topology is determined in part by the landscape configuration, I argue that it should play a more prominent role in landscape genetics. Making use of existing literature and theoretical examples, I discuss how population topology can influence results in landscape genetic studies and how it can be taken into account to improve the accuracy of these results. In support of my arguments, I have performed a literature review of landscape genetic studies published during the first half of 2015 as well as several computer simulations of gene flow between populations. First, I argue why one should carefully consider which population pairs should be included in link-based analyses. Second, I discuss several ways in which the population topology can be incorporated in response and explanatory variables. Third, I outline why it is important to sample populations in such a way that a good representation of the population topology is obtained. Fourth, I discuss how statistical testing for link-based approaches could be influenced by the population topology. I conclude the article with six recommendations geared toward better incorporating population topology in link-based landscape genetic studies.

  11. Unreduced elbow dislocation treated by Ilizarov method: A case report

    Directory of Open Access Journals (Sweden)

    Jovanović Vesna

    2010-01-01

    Full Text Available Introduction. Unreduced elbow dislocation is every elbow dislocation older than one week. It may be treated non-operatively (with prereduction traction or surgically. The treatment goals are: to reduce pain, to establish joint stability and movements. There are a lot of techniques described in literature, series are relatively small, mostly case reports. Multicentric studies have not been done. That is why there are no precisely defined therapeutic protocols. Every contribution in the field is valuable. Case Outline. A 43-year-old patient was admitted for the treatment of a three-month old unreduced elbow dislocation. Treatment has been done by Ilizarov method, using the reduction mechanism. The reduction process lasted two weeks. The Ilizarov device was removed two months after the operation, then physical therapy was started. Normal anatomical and functional findings were established five months following the operation. Conclusion. The presented method of treatment has been found as very useful, having in mind that it may solve two problems: difficult reduction and redislocation. Reduction may be done without the joint opening, step by step; retention of the reduced joint may be easily done. Physical therapy may be started without Ilizarov device removal, movements of flexion and extension may be improved without any lateral instability. There is no iatrogenic intraarticular damage, so there are no secondary joint degeneration, pains and invalidity.

  12. Malignant melanoma arising from a perianal fistula and harbouring a BRAF gene mutation: a case report

    Directory of Open Access Journals (Sweden)

    Tajahuerce Marcos

    2011-08-01

    Full Text Available Abstract Background Melanoma of the anal region is a very uncommon disease, accounting for only 0.2-0.3% of all melanoma cases. Mutations of the BRAF gene are usually absent in melanomas occurring in this region as well as in other sun-protected regions. The development of a tumour in a longstanding perianal fistula is also extremely rare. More frequent is the case of a tumour presenting as a fistula, that is, the fistula being a consequence of the cancerous process, although we have found only two cases of fistula-generating melanomas reported in the literature. Case Presentation Here we report the case of a 38-year-old male who presented with a perianal fistula of four years of evolution. Histopathological examination of the fistulous tract confirmed the presence of malignant melanoma. Due to the small size and the central location of the melanoma inside the fistulous tract, we believe the melanoma reported here developed in the epithelium of the fistula once the latter was already formed. Resected sentinel lymph nodes were negative and the patient, after going through a wide local excision, remains disease-free nine years after diagnosis. DNA obtained from melanoma tissue was analysed by automated direct sequencing and the V600E (T1799A mutation was detected in exon 15 of the BRAF gene. Conclusion Since fistulae experience persistent inflammation, the fact that this melanoma harbours a BRAF mutation strengthens the view that oxidative stress caused by inflammatory processes plays an important role in the genesis of BRAF gene mutations.

  13. Phylogeny Reconstruction with Alignment-Free Method That Corrects for Horizontal Gene Transfer.

    Directory of Open Access Journals (Sweden)

    Raquel Bromberg

    2016-06-01

    Full Text Available Advances in sequencing have generated a large number of complete genomes. Traditionally, phylogenetic analysis relies on alignments of orthologs, but defining orthologs and separating them from paralogs is a complex task that may not always be suited to the large datasets of the future. An alternative to traditional, alignment-based approaches are whole-genome, alignment-free methods. These methods are scalable and require minimal manual intervention. We developed SlopeTree, a new alignment-free method that estimates evolutionary distances by measuring the decay of exact substring matches as a function of match length. SlopeTree corrects for horizontal gene transfer, for composition variation and low complexity sequences, and for branch-length nonlinearity caused by multiple mutations at the same site. We tested SlopeTree on 495 bacteria, 73 archaea, and 72 strains of Escherichia coli and Shigella. We compared our trees to the NCBI taxonomy, to trees based on concatenated alignments, and to trees produced by other alignment-free methods. The results were consistent with current knowledge about prokaryotic evolution. We assessed differences in tree topology over different methods and settings and found that the majority of bacteria and archaea have a core set of proteins that evolves by descent. In trees built from complete genomes rather than sets of core genes, we observed some grouping by phenotype rather than phylogeny, for instance with a cluster of sulfur-reducing thermophilic bacteria coming together irrespective of their phyla. The source-code for SlopeTree is available at: http://prodata.swmed.edu/download/pub/slopetree_v1/slopetree.tar.gz.

  14. Phylogeny Reconstruction with Alignment-Free Method That Corrects for Horizontal Gene Transfer

    Science.gov (United States)

    Grishin, Nick V.; Otwinowski, Zbyszek

    2016-01-01

    Advances in sequencing have generated a large number of complete genomes. Traditionally, phylogenetic analysis relies on alignments of orthologs, but defining orthologs and separating them from paralogs is a complex task that may not always be suited to the large datasets of the future. An alternative to traditional, alignment-based approaches are whole-genome, alignment-free methods. These methods are scalable and require minimal manual intervention. We developed SlopeTree, a new alignment-free method that estimates evolutionary distances by measuring the decay of exact substring matches as a function of match length. SlopeTree corrects for horizontal gene transfer, for composition variation and low complexity sequences, and for branch-length nonlinearity caused by multiple mutations at the same site. We tested SlopeTree on 495 bacteria, 73 archaea, and 72 strains of Escherichia coli and Shigella. We compared our trees to the NCBI taxonomy, to trees based on concatenated alignments, and to trees produced by other alignment-free methods. The results were consistent with current knowledge about prokaryotic evolution. We assessed differences in tree topology over different methods and settings and found that the majority of bacteria and archaea have a core set of proteins that evolves by descent. In trees built from complete genomes rather than sets of core genes, we observed some grouping by phenotype rather than phylogeny, for instance with a cluster of sulfur-reducing thermophilic bacteria coming together irrespective of their phyla. The source-code for SlopeTree is available at: http://prodata.swmed.edu/download/pub/slopetree_v1/slopetree.tar.gz. PMID:27336403

  15. Development of a codon optimization strategy using the efor RED reporter gene as a test case

    Science.gov (United States)

    Yip, Chee-Hoo; Yarkoni, Orr; Ajioka, James; Wan, Kiew-Lian; Nathan, Sheila

    2018-04-01

    Synthetic biology is a platform that enables high-level synthesis of useful products such as pharmaceutically related drugs, bioplastics and green fuels from synthetic DNA constructs. Large-scale expression of these products can be achieved in an industrial compliant host such as Escherichia coli. To maximise the production of recombinant proteins in a heterologous host, the genes of interest are usually codon optimized based on the codon usage of the host. However, the bioinformatics freeware available for standard codon optimization might not be ideal in determining the best sequence for the synthesis of synthetic DNA. Synthesis of incorrect sequences can prove to be a costly error and to avoid this, a codon optimization strategy was developed based on the E. coli codon usage using the efor RED reporter gene as a test case. This strategy replaces codons encoding for serine, leucine, proline and threonine with the most frequently used codons in E. coli. Furthermore, codons encoding for valine and glycine are substituted with the second highly used codons in E. coli. Both the optimized and original efor RED genes were ligated to the pJS209 plasmid backbone using Gibson Assembly and the recombinant DNAs were transformed into E. coli E. cloni 10G strain. The fluorescence intensity per cell density of the optimized sequence was improved by 20% compared to the original sequence. Hence, the developed codon optimization strategy is proposed when designing an optimal sequence for heterologous protein production in E. coli.

  16. Identification of genes in anonymous DNA sequences. Annual performance report, February 1, 1991--January 31, 1992

    Energy Technology Data Exchange (ETDEWEB)

    Fields, C.A.

    1996-06-01

    The objective of this project is the development of practical software to automate the identification of genes in anonymous DNA sequences from the human, and other higher eukaryotic genomes. A software system for automated sequence analysis, gm (gene modeler) has been designed, implemented, tested, and distributed to several dozen laboratories worldwide. A significantly faster, more robust, and more flexible version of this software, gm 2.0 has now been completed, and is being tested by operational use to analyze human cosmid sequence data. A range of efforts to further understand the features of eukaryoyic gene sequences are also underway. This progress report also contains papers coming out of the project including the following: gm: a Tool for Exploratory Analysis of DNA Sequence Data; The Human THE-LTR(O) and MstII Interspersed Repeats are subfamilies of a single widely distruted highly variable repeat family; Information contents and dinucleotide compostions of plant intron sequences vary with evolutionary origin; Splicing signals in Drosophila: intron size, information content, and consensus sequences; Integration of automated sequence analysis into mapping and sequencing projects; Software for the C. elegans genome project.

  17. Capturing the target genes of BldD in Saccharopolyspora erythraea using improved genomic SELEX method.

    Science.gov (United States)

    Wu, Hang; Mao, Yongrong; Chen, Meng; Pan, Hui; Huang, Xunduan; Ren, Min; Wu, Hao; Li, Jiali; Xu, Zhongdong; Yuan, Hualing; Geng, Ming; Weaver, David T; Zhang, Lixin; Zhang, Buchang

    2015-03-01

    BldD (SACE_2077), a key developmental regulator in actinomycetes, is the first identified transcriptional factor in Saccharopolyspora erythraea positively regulating erythromycin production and morphological differentiation. Although the BldD of S. erythraea binds to the promoters of erythromycin biosynthetic genes, the interaction affinities are relatively low, implying the existence of its other target genes in S. erythraea. Through the genomic systematic evolution of ligands by exponential enrichment (SELEX) method that we herein improved, four DNA sequences of S. erythraea A226, corresponding to the promoter regions of SACE_0306 (beta-galactosidase), SACE_0811 (50S ribosomal protein L25), SACE_3410 (fumarylacetoacetate hydrolase), and SACE_6014 (aldehyde dehydrogenase), were captured with all three BldD concentrations of 0.5, 1, and 2 μM, while the previously identified intergenic regions of eryBIV-eryAI and ermE-eryCI plus the promoter region of SACE_7115, the amfC homolog for aerial mycelium formation, could be captured only when the BldD's concentration reached 2 μM. Electrophoretic mobility shift assay (EMSA) analysis indicated that BldD specifically bound to above seven DNA sequences, and quantitative real-time PCR (qRT-PCR) assay showed that the transcriptional levels of the abovementioned target genes decreased when bldD was disrupted in A226. Furthermore, SACE_7115 and SACE_0306 in A226 were individually inactivated, showing that SACE_7115 was predominantly involved in aerial mycelium formation, while SACE_0306 mainly controlled erythromycin production. This study provides valuable information for better understanding of the pleiotropic regulator BldD in S. erythraea, and the improved method may be useful for uncovering regulatory networks of other transcriptional factors.

  18. Visualisation of chicken macrophages using transgenic reporter genes: insights into the development of the avian macrophage lineage.

    Science.gov (United States)

    Balic, Adam; Garcia-Morales, Carla; Vervelde, Lonneke; Gilhooley, Hazel; Sherman, Adrian; Garceau, Valerie; Gutowska, Maria W; Burt, David W; Kaiser, Pete; Hume, David A; Sang, Helen M

    2014-08-01

    We have generated the first transgenic chickens in which reporter genes are expressed in a specific immune cell lineage, based upon control elements of the colony stimulating factor 1 receptor (CSF1R) locus. The Fms intronic regulatory element (FIRE) within CSF1R is shown to be highly conserved in amniotes and absolutely required for myeloid-restricted expression of fluorescent reporter genes. As in mammals, CSF1R-reporter genes were specifically expressed at high levels in cells of the macrophage lineage and at a much lower level in granulocytes. The cell lineage specificity of reporter gene expression was confirmed by demonstration of coincident expression with the endogenous CSF1R protein. In transgenic birds, expression of the reporter gene provided a defined marker for macrophage-lineage cells, identifying the earliest stages in the yolk sac, throughout embryonic development and in all adult tissues. The reporter genes permit detailed and dynamic visualisation of embryonic chicken macrophages. Chicken embryonic macrophages are not recruited to incisional wounds, but are able to recognise and phagocytose microbial antigens. © 2014. Published by The Company of Biologists Ltd.

  19. Specific expression of bioluminescence reporter gene in cardiomyocyte regulated by tissue specific promoter

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen, Vu Hong; Tae, Seong Ho; Le, Nguyen Uyen Chi; Min, Jung Joon [Chonnam National University Medical School, Gwangju (Korea, Republic of)

    2007-07-01

    As the human heart is not capable of regenerating the great numbers of cardiac cells that are lost after myocardial infarction, impaired cardiac function is the inevitable result of ischemic disease. Recently, human embryonic stem cells (hESCs) have gained popularity as a potentially ideal cell candidate for tissue regeneration. In particular, hESCs are capable of cardiac lineage-specific differentiation and confer improvement of cardiac function following transplantation into animal models. Although such data are encouraging, the specific strategy for in vivo and non-invasive detection of differentiated cardiac lineage is still limited. Therefore, in the present study, we established the gene construction in which the optical reporter gene Firefly luciferase was controlled by Myosin Heavy Chain promoter for specific expressing in heart cells. The vector consisting of - MHC promoter and a firefly luciferase coding sequence flanked by full-length bovine growth hormone (BGH) 3'-polyadenylation sequence based on pcDNA3.1- vector backbone. To test the specific transcription of this promoter in g of MHC-Fluc or CMV-Flue (for control) plasmid DNA in myocardial tissue, 20 phosphate-buffered saline was directly injected into mouse myocardium through a midline sternotomy and liver. After 1 week of injection, MHC-Fluc expression was detected from heart region which was observed under cooled CCD camera of in vivo imaging system but not from liver. In control group injected with CMV-Flue, the bioluminescence was detected from all these organs. The expression of Flue under control of Myosin Heavy Chain promoter may become a suitable optical reporter gene for stem cell-derived cardiac lineage differentiation study.

  20. A Haplotype Information Theory Method Reveals Genes of Evolutionary Interest in European vs. Asian Pigs.

    Science.gov (United States)

    Hudson, Nicholas J; Naval-Sánchez, Marina; Porto-Neto, Laercio; Pérez-Enciso, Miguel; Reverter, Antonio

    2018-06-05

    Asian and European wild boars were independently domesticated ca. 10,000 years ago. Since the 17th century, Chinese breeds have been imported to Europe to improve the genetics of European animals by introgression of favourable alleles, resulting in a complex mosaic of haplotypes. To interrogate the structure of these haplotypes further, we have run a new haplotype segregation analysis based on information theory, namely compression efficiency (CE). We applied the approach to sequence data from individuals from each phylogeographic region (n = 23 from Asia and Europe) including a number of major pig breeds. Our genome-wide CE is able to discriminate the breeds in a manner reflecting phylogeography. Furthermore, 24,956 non-overlapping sliding windows (each comprising 1,000 consecutive SNP) were quantified for extent of haplotype sharing within and between Asia and Europe. The genome-wide distribution of extent of haplotype sharing was quite different between groups. Unlike European pigs, Asian pigs haplotype sharing approximates a normal distribution. In line with this, we found the European breeds possessed a number of genomic windows of dramatically higher haplotype sharing than the Asian breeds. Our CE analysis of sliding windows capture some of the genomic regions reported to contain signatures of selection in domestic pigs. Prominent among these regions, we highlight the role of a gene encoding the mitochondrial enzyme LACTB which has been associated with obesity, and the gene encoding MYOG a fundamental transcriptional regulator of myogenesis. The origin of these regions likely reflects either a population bottleneck in European animals, or selective targets on commercial phenotypes reducing allelic diversity in particular genes and/or regulatory regions.

  1. Genealogy-based methods for inference of historical recombination and gene flow and their application in Saccharomyces cerevisiae.

    Science.gov (United States)

    Jenkins, Paul A; Song, Yun S; Brem, Rachel B

    2012-01-01

    Genetic exchange between isolated populations, or introgression between species, serves as a key source of novel genetic material on which natural selection can act. While detecting historical gene flow from DNA sequence data is of much interest, many existing methods can be limited by requirements for deep population genomic sampling. In this paper, we develop a scalable genealogy-based method to detect candidate signatures of gene flow into a given population when the source of the alleles is unknown. Our method does not require sequenced samples from the source population, provided that the alleles have not reached fixation in the sampled recipient population. The method utilizes recent advances in algorithms for the efficient reconstruction of ancestral recombination graphs, which encode genealogical histories of DNA sequence data at each site, and is capable of detecting the signatures of gene flow whose footprints are of length up to single genes. Further, we employ a theoretical framework based on coalescent theory to test for statistical significance of certain recombination patterns consistent with gene flow from divergent sources. Implementing these methods for application to whole-genome sequences of environmental yeast isolates, we illustrate the power of our approach to highlight loci with unusual recombination histories. By developing innovative theory and methods to analyze signatures of gene flow from population sequence data, our work establishes a foundation for the continued study of introgression and its evolutionary relevance.

  2. The application of reporter gene assays for the detection of endocrine disruptors in sport supplements

    Energy Technology Data Exchange (ETDEWEB)

    Plotan, Monika; Elliott, Christopher T. [Institute of Agri-Food and Land Use, School of Biological Sciences, Queen' s University Belfast, Belfast BT95AG, Northern Ireland (United Kingdom); Scippo, Marie Louise [Department of Food Sciences, University of Liege, 4000 Liege (Belgium); Muller, Marc [Molecular Biology and Genetic Engineering GIGA-R, University of Liege, 4000 Liege (Belgium); Antignac, Jean-Philippe [LABERCA, ENVN, USC INRA 2013, BP 50707, 44 307, Nantes (France); Malone, Edward [The State Laboratory, Young' s Cross, Celbridge, Co. Kildare (Ireland); Bovee, Toine F.H. [RIKILT Institute of Food Safety, P.O. Box 230, AE Wageningen 6700 (Netherlands); Mitchell, Samuel [Agri-Food and Biosciences Institute, Belfast BT9 5PX (United Kingdom); Connolly, Lisa, E-mail: l.connolly@qub.ac.uk [Institute of Agri-Food and Land Use, School of Biological Sciences, Queen' s University Belfast, Belfast BT95AG, Northern Ireland (United Kingdom)

    2011-08-26

    The increasing availability and use of sports supplements is of concern as highlighted by a number of studies reporting endocrine disruptor contamination in such products. The health food supplement market, including sport supplements, is growing across the Developed World. Therefore, the need to ensure the quality and safety of sport supplements for the consumer is essential. The development and validation of two reporter gene assays coupled with solid phase sample preparation enabling the detection of estrogenic and androgenic constituents in sport supplements is reported. Both assays were shown to be of high sensitivity with the estrogen and androgen reporter gene assays having an EC{sub 50} of 0.01 ng mL{sup -1} and 0.16 ng mL{sup -1} respectively. The developed assays were applied in a survey of 63 sport supplements samples obtained across the Island of Ireland with an additional seven reference samples previously investigated using LC-MS/MS. Androgen and estrogen bio-activity was found in 71% of the investigated samples. Bio-activity profiling was further broken down into agonists, partial agonists and antagonists. Supplements (13) with the strongest estrogenic bio-activity were chosen for further investigation. LC-MS/MS analysis of these samples determined the presence of phytoestrogens in seven of them. Supplements (38) with androgen bio-activity were also selected for further investigation. Androgen agonist bio-activity was detected in 12 supplements, antagonistic bio-activity was detected in 16 and partial antagonistic bio-activity was detected in 10. A further group of supplements (7) did not present androgenic bio-activity when tested alone but enhanced the androgenic agonist bio-activity of dihydrotestosterone when combined. The developed assays offer advantages in detection of known, unknown and low-level mixtures of endocrine disruptors over existing analytical screening techniques. For the detection and identification of constituent hormonally

  3. The application of reporter gene assays for the detection of endocrine disruptors in sport supplements

    International Nuclear Information System (INIS)

    Plotan, Monika; Elliott, Christopher T.; Scippo, Marie Louise; Muller, Marc; Antignac, Jean-Philippe; Malone, Edward; Bovee, Toine F.H.; Mitchell, Samuel; Connolly, Lisa

    2011-01-01

    The increasing availability and use of sports supplements is of concern as highlighted by a number of studies reporting endocrine disruptor contamination in such products. The health food supplement market, including sport supplements, is growing across the Developed World. Therefore, the need to ensure the quality and safety of sport supplements for the consumer is essential. The development and validation of two reporter gene assays coupled with solid phase sample preparation enabling the detection of estrogenic and androgenic constituents in sport supplements is reported. Both assays were shown to be of high sensitivity with the estrogen and androgen reporter gene assays having an EC 50 of 0.01 ng mL -1 and 0.16 ng mL -1 respectively. The developed assays were applied in a survey of 63 sport supplements samples obtained across the Island of Ireland with an additional seven reference samples previously investigated using LC-MS/MS. Androgen and estrogen bio-activity was found in 71% of the investigated samples. Bio-activity profiling was further broken down into agonists, partial agonists and antagonists. Supplements (13) with the strongest estrogenic bio-activity were chosen for further investigation. LC-MS/MS analysis of these samples determined the presence of phytoestrogens in seven of them. Supplements (38) with androgen bio-activity were also selected for further investigation. Androgen agonist bio-activity was detected in 12 supplements, antagonistic bio-activity was detected in 16 and partial antagonistic bio-activity was detected in 10. A further group of supplements (7) did not present androgenic bio-activity when tested alone but enhanced the androgenic agonist bio-activity of dihydrotestosterone when combined. The developed assays offer advantages in detection of known, unknown and low-level mixtures of endocrine disruptors over existing analytical screening techniques. For the detection and identification of constituent hormonally active compounds the

  4. Biomarker Identification for Prostate Cancer and Lymph Node Metastasis from Microarray Data and Protein Interaction Network Using Gene Prioritization Method

    Directory of Open Access Journals (Sweden)

    Carlos Roberto Arias

    2012-01-01

    Full Text Available Finding a genetic disease-related gene is not a trivial task. Therefore, computational methods are needed to present clues to the biomedical community to explore genes that are more likely to be related to a specific disease as biomarker. We present biomarker identification problem using gene prioritization method called gene prioritization from microarray data based on shortest paths, extended with structural and biological properties and edge flux using voting scheme (GP-MIDAS-VXEF. The method is based on finding relevant interactions on protein interaction networks, then scoring the genes using shortest paths and topological analysis, integrating the results using a voting scheme and a biological boosting. We applied two experiments, one is prostate primary and normal samples and the other is prostate primary tumor with and without lymph nodes metastasis. We used 137 truly prostate cancer genes as benchmark. In the first experiment, GP-MIDAS-VXEF outperforms all the other state-of-the-art methods in the benchmark by retrieving the truest related genes from the candidate set in the top 50 scores found. We applied the same technique to infer the significant biomarkers in prostate cancer with lymph nodes metastasis which is not established well.

  5. A simple screening method for detection of Klinefelter syndrome and other X-chromosome aneuploidies based on copy number of the androgen receptor gene

    DEFF Research Database (Denmark)

    Ottesen, A M; Garn, I D; Aksglaede, L

    2007-01-01

    Due to the high prevalence and variable phenotype of patients with Klinefelter syndrome, there is a need for a robust and rapid screening method allowing early diagnosis. Here, we report on the development and detailed clinical validation of a quantitative real-time PCR (qPCR)-based method...... of the copy number assessment of the androgen receptor (AR) gene, located to Xq11.2-q12. We analysed samples from 50 individuals, including a healthy male and female controls and patients with Klinefelter syndrome (47,XXY; 48,XXXY) (n = 28), mosaicisms (46,XX/47,XXY/48XXYY; 45,X/46,XY) (n = 3), other sex......-gene expression. The XIST-expression based assay was correct in only 29/36 samples (81%). Our findings demonstrated that the AR-qPCR technique is a simple and reliable screening method for diagnosis of patients with Klinefelter syndrome or other chromosomal disorders involving an aberrant number of X-chromosomes....

  6. Feasibility of baculovirus-mediated reporter gene delivery for efficient monitoring of islet transplantation in vivo

    International Nuclear Information System (INIS)

    Liu, Shuai; Pan, Yu; Lv, Jing; Wu, Haifei; Tian, Jingyan; Zhang, Yifan

    2014-01-01

    Objective: The objective of this study was to explore the feasibility of baculovirus vector-mediated sodium iodide symporter (NIS) gene delivery to monitor islet transplantation. Methods: Baculovirus vectors expressing green fluorescent protein (GFP) or NIS (Bac-GFP and Bac-NIS) were established using the Bac-to-Bac baculovirus expression system. The GFP expression of Bac-GFP-infected rat islets was observed in vitro by fluorescence microscopy. Iodine uptake and inhibition of iodine uptake by NaClO 4 in Bac-NIS-infected islets were dynamically monitored in vitro. Bac-GFP- or Bac-NIS-infected islets were implanted into the left axillary cavity of NOD-SCID mice, and fluorescence imaging and 125 I NanoSPECT/CT imaging were subsequently performed in vivo. Results: Bac-GFP efficiently infected rat islets (over 95% infected at MOI = 40), and the expression of GFP lasted approximately two weeks. NaClO 4 could inhibit iodine uptake by Bac-NIS-infected islets. In vivo imaging revealed that the fluorescence intensity of the transplant sites in Bac-GFP-infected groups was significantly higher than in the non-infected group. Grafts could be clearly observed by 125 I NanoSPECT/CT imaging for up to 8 h. Conclusion: Baculovirus vectors are powerful vehicles for studying rat islets in gene delivery. It is feasible to use a baculovirus vector to delivery an NIS gene for non-invasive monitoring transplanted islets in vivo by the expression of the target gene

  7. Organisational reviews - requirements, methods and experience. Progress report 2006

    International Nuclear Information System (INIS)

    Reiman, T.; Oedewald, P.; Wahlstroem, B.; Rollenhagen, C.; Kahlbom, U.

    2007-04-01

    Organisational reviews are important instruments in the continuous quest for improved performance. In the nuclear field there has been an increasing regulatory interest in organisational performance, because incidents and accidents often point to organisational deficiencies as one of the major precursors. Many methods for organisational reviews have been proposed, but they are mostly based on ad hoc approaches to specific problems. The absence of well-established techniques for organisational reviews has already shown to cause discussions and controversies on different levels. The aim of the OrRe project is to collect the experiences from organisational reviews carried out so far and to reflect them in a theoretical model of organisational performance. Furthermore, the project aims to reflect on the criteria for the definition of the scope and content of organisational reviews. Finally, recommendations will be made for guidance for people participating in organisational reviews. This progress report describes regulatory practices in Finland and Sweden together with some case examples of organizational reviews and assessment in both countries. Some issues of concern are raised and an outline for the next year's work is proposed. Issues of concern include the sufficient depth of the assessment, the required competence in assessments, data and criteria problems, definition of the boundaries of the system to be assessed, and the necessary internal support and organisational maturity required for successful assessments. Finally, plans for next year's work are outlined. (au)

  8. Organisational reviews - requirements, methods and experience. Progress report 2006

    Energy Technology Data Exchange (ETDEWEB)

    Reiman, T.; Oedewald, P.; Wahlstroem, B. [VTT, Technical Research Centre of Finland (Finland); Rollenhagen, C.; Kahlbom, U. [Maelardalen University (FI)

    2007-04-15

    Organisational reviews are important instruments in the continuous quest for improved performance. In the nuclear field there has been an increasing regulatory interest in organisational performance, because incidents and accidents often point to organisational deficiencies as one of the major precursors. Many methods for organisational reviews have been proposed, but they are mostly based on ad hoc approaches to specific problems. The absence of well-established techniques for organisational reviews has already shown to cause discussions and controversies on different levels. The aim of the OrRe project is to collect the experiences from organisational reviews carried out so far and to reflect them in a theoretical model of organisational performance. Furthermore, the project aims to reflect on the criteria for the definition of the scope and content of organisational reviews. Finally, recommendations will be made for guidance for people participating in organisational reviews. This progress report describes regulatory practices in Finland and Sweden together with some case examples of organizational reviews and assessment in both countries. Some issues of concern are raised and an outline for the next year's work is proposed. Issues of concern include the sufficient depth of the assessment, the required competence in assessments, data and criteria problems, definition of the boundaries of the system to be assessed, and the necessary internal support and organisational maturity required for successful assessments. Finally, plans for next year's work are outlined. (au)

  9. Rapid detection of SNP (c.309T>G in the MDM2 gene by the Duplex SmartAmp method.

    Directory of Open Access Journals (Sweden)

    Yasuaki Enokida

    Full Text Available BACKGROUND: Genetic polymorphisms in the human MDM2 gene are suggested to be a tumor susceptibility marker and a prognostic factor for cancer. It has been reported that a single nucleotide polymorphism (SNP c.309T>G in the MDM2 gene attenuates the tumor suppressor activity of p53 and accelerates tumor formation in humans. METHODOLOGY: In this study, to detect the SNP c.309T>G in the MDM2 gene, we have developed a new SNP detection method, named "Duplex SmartAmp," which enabled us to simultaneously detect both 309T and 309G alleles in one tube. To develop this new method, we introduced new primers i.e., nBP and oBPs, as well as two different fluorescent dyes that separately detect those genetic polymorphisms. RESULTS AND CONCLUSIONS: By the Duplex SmartAmp method, the genetic polymorphisms of the MDM2 gene were detected directly from a small amount of genomic DNA or blood samples. We used 96 genomic DNA and 24 blood samples to validate the Duplex SmartAmp by comparison with results of the conventional PCR-RFLP method; consequently, the Duplex SmartAmp results agreed totally with those of the PCR-RFLP method. Thus, the new SNP detection method is considered useful for detecting the SNP c.309T>G in the MDM2 gene so as to judge cancer susceptibility against some cellular stress in the clinical setting, and also to handle a large number of samples and enable rapid clinical diagnosis.

  10. A statistical method for predicting splice variants between two groups of samples using GeneChip® expression array data

    Directory of Open Access Journals (Sweden)

    Olson James M

    2006-04-01

    Full Text Available Abstract Background Alternative splicing of pre-messenger RNA results in RNA variants with combinations of selected exons. It is one of the essential biological functions and regulatory components in higher eukaryotic cells. Some of these variants are detectable with the Affymetrix GeneChip® that uses multiple oligonucleotide probes (i.e. probe set, since the target sequences for the multiple probes are adjacent within each gene. Hybridization intensity from a probe correlates with abundance of the corresponding transcript. Although the multiple-probe feature in the current GeneChip® was designed to assess expression values of individual genes, it also measures transcriptional abundance for a sub-region of a gene sequence. This additional capacity motivated us to develop a method to predict alternative splicing, taking advance of extensive repositories of GeneChip® gene expression array data. Results We developed a two-step approach to predict alternative splicing from GeneChip® data. First, we clustered the probes from a probe set into pseudo-exons based on similarity of probe intensities and physical adjacency. A pseudo-exon is defined as a sequence in the gene within which multiple probes have comparable probe intensity values. Second, for each pseudo-exon, we assessed the statistical significance of the difference in probe intensity between two groups of samples. Differentially expressed pseudo-exons are predicted to be alternatively spliced. We applied our method to empirical data generated from GeneChip® Hu6800 arrays, which include 7129 probe sets and twenty probes per probe set. The dataset consists of sixty-nine medulloblastoma (27 metastatic and 42 non-metastatic samples and four cerebellum samples as normal controls. We predicted that 577 genes would be alternatively spliced when we compared normal cerebellum samples to medulloblastomas, and predicted that thirteen genes would be alternatively spliced when we compared metastatic

  11. Germline Transgenic Methods for Tracking Cells and Testing Gene Function during Regeneration in the Axolotl

    Science.gov (United States)

    Khattak, Shahryar; Schuez, Maritta; Richter, Tobias; Knapp, Dunja; Haigo, Saori L.; Sandoval-Guzmán, Tatiana; Hradlikova, Kristyna; Duemmler, Annett; Kerney, Ryan; Tanaka, Elly M.

    2013-01-01

    The salamander is the only tetrapod that regenerates complex body structures throughout life. Deciphering the underlying molecular processes of regeneration is fundamental for regenerative medicine and developmental biology, but the model organism had limited tools for molecular analysis. We describe a comprehensive set of germline transgenic strains in the laboratory-bred salamander Ambystoma mexicanum (axolotl) that open up the cellular and molecular genetic dissection of regeneration. We demonstrate tissue-dependent control of gene expression in nerve, Schwann cells, oligodendrocytes, muscle, epidermis, and cartilage. Furthermore, we demonstrate the use of tamoxifen-induced Cre/loxP-mediated recombination to indelibly mark different cell types. Finally, we inducibly overexpress the cell-cycle inhibitor p16INK4a, which negatively regulates spinal cord regeneration. These tissue-specific germline axolotl lines and tightly inducible Cre drivers and LoxP reporter lines render this classical regeneration model molecularly accessible. PMID:24052945

  12. Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli

    Science.gov (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger

    2015-10-01

    To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work

  13. Nance-Horan syndrome: a contiguous gene syndrome involving deletion of the amelogenin gene? A case report and molecular analysis.

    Science.gov (United States)

    Franco, E; Hodgson, S; Lench, N; Roberts, G J

    1995-03-01

    A case of Nance-Horan syndrome in a male is presented, with some features of the condition in his carrier mother and her mother. It is proposed that Nance-Horan syndrome might be a contiguous gene syndrome mapping to chromosome Xp21.2-p22.3. The proband had congenital cataract microphthalmia and dental abnormalities including screwdriver shaped incisors and evidence of enamel pitting hypoplasia. The region Xp21.2-p22.3 also contains the tooth enamel protein gene, amelogenin (AMGX). Using molecular genetic techniques, we have shown that there is no evidence that the AMGX gene is deleted in this case of the Nance-Horan syndrome.

  14. Report of space experiment project, 'Rad Gene', performed in the International Space Station Kibo

    International Nuclear Information System (INIS)

    Ohnishi, Takeo; Takahashi, Akihisa; Nagamatsu, Aiko

    2010-01-01

    This report summarizes results of the project in the title adopted by Japan Aerospace Exploration Agency (JAXA) (in 2000) aiming to elucidate the biological effect of space environment, and contains 3 major parts of the process of the experiment, and of findings by analysis after flight and in radioadaptive response. The process for the experiment includes training of the experimenter crew (Dr. S. Magnus) in JAXA, preparation of samples (frozen cells with normal and mutated p53 genes derived from human lymphoblast TK6) and their transfer to the Space Shuttle Endeavour STS-126 launched on Nov. 15, 2008 (Japanese time) for cell culturing in Feb., 2009. Analyses after flight back to the Kennedy Space Center on Mar. 29, 2009, done on the ground in Japan thereafter include the physical evaluation, confirmation of DNA damage, and phenotypic expression with DNA- and protein-arrays (genes induced for expression of p53-related phenotypes in those cells which were stored frozen in the space, thawed on the ground and then cultured, genes induced for expressing the phenotypes and p53-related proteins expressed in cells cultured in space). Physically, total absorbed dose and dose equivalent are found to be respectively 43.5 mGy and 71.2 mSv (0.5 mSv/day). Interestingly, the biologically estimated dose by DNA-double strand breaks detected by γH2AX staining, 94.5 mSv (0.7 mSv/day), in living, frozen cells in space, is close to the above physical dose. Expression experiments of p53-related phenotypes have revealed that expression of 750 or more genes in 41,000 genes in the array is changed: enhanced or suppressed by space radiation, micro-gravity and/or their mixed effects in space environment. In 642 protein antibodies in the array, 2 proteins are found enhanced and 8, suppressed whereas heat-shock protein is unchanged. Radioadaptive response is the acquisition of radio-resistance to acute exposure by previous irradiation of small dose (window width 20-100 mSv) in normal p53

  15. The first case report of a large deletion of the BRCA1 gene in Croatia: A case report.

    Science.gov (United States)

    Musani, Vesna; Sušac, Ilona; Ozretić, Petar; Eljuga, Domagoj; Levanat, Sonja

    2017-12-01

    Breast cancer is one of the most common cancers in women, and it is the leading cause of cancer related deaths in Croatia. BRCA1 and BRCA2 gene mutations are the most common cause of hereditary breast cancer. In this report we describe a Croatian patient with no apparent family history of cancer, who developed breast cancer first at 29, and again at 33. Due to the early development of first breast cancer and triple negative status of the second, the attending physician suspected a hereditary aspect. Patient was sent to BRCA1 genetic testing. Subsequently, her mother and sister were sent to check for the mutation found in the patient. BRCA1 exons 4-6 deletion was determined and sequencing confirmed the deletion as NG_005905.2:g.107648_117905del10257. Mother and sister were not affected, but since there were no available family members on the fathers' side, it was not possible to determine if this was a case of de novo mutation. Until now, only in three reports with the similar mutation the exact mutation borders were determined. The mutation in this case was not the same as previously reported and was more than twice in size. All large deletions should be described at the nucleotide level, so that in cases with missing family data it would be possible to deduce if the mutation is already known. If the mutation is already known, it is probably not a de novo event, since it is unlikely that the breakpoints would be exactly the same more than once.

  16. β-Globin gene sequencing of hemoglobin Austin revises the historically reported electrophoretic migration pattern.

    Science.gov (United States)

    Racsa, Lori D; Luu, Hung S; Park, Jason Y; Mitui, Midori; Timmons, Charles F

    2014-06-01

    Hemoglobin (Hb) Austin was defined in 1977, using amino acid sequencing of samples from 3 unrelated Mexican-Americans, as a substitution of serine for arginine at position 40 of the β-globin chain (Arg40Ser). Its electrophoretic migration on both cellulose acetate (pH 8.4) and citrate agar (pH 6.2) was reported between Hb F and Hb A, and this description persists in reference literature. OBJECTIVES.-To review the clinical features and redefine the diagnostic characteristics of Hb Austin. Eight samples from 6 unrelated individuals and 2 siblings, all with Hispanic surnames, were submitted for abnormal Hb identification between June 2010 and September 2011. High-performance liquid chromatography, isoelectric focusing (IEF), citrate agar electrophoresis, and bidirectional DNA sequencing of the entire β-globin gene were performed. DNA sequencing confirmed all 8 individuals to be heterozygous for Hb Austin (Arg40Ser). Retention time on high-performance liquid chromatography and migration on citrate agar electrophoresis were consistent with that identification. Migration on IEF, however, was not between Hb F and Hb A, as predicted from the report of cellulose acetate electrophoresis. By IEF, Hb Austin migrated anodal to ("faster than") Hb A. Hemoglobin Austin (Arg40Ser) appears on IEF as a "fast," anodally migrating, Hb variant, just as would be expected from its amino acid substitution. The cited historic report is, at best, not applicable to IEF and is probably erroneous. Our observation of 8 cases in 16 months suggests that this variant may be relatively common in some Hispanic populations, making its recognition important. Furthermore, gene sequencing is proving itself a powerful and reliable tool for definitive identification of Hb variants.

  17. Involvement of the BDNF Gene in Loneliness in Adolescence : A Report of Opposite Gene Effects in Boys and Girls

    NARCIS (Netherlands)

    Verhagen, Maaike; van Roekel, Eeske; Engels, Rutger C. M. E.

    2014-01-01

    Previous research has shown that loneliness has a heritable component and that genes within the serotonin-, dopamine-, and oxytocin systems are related to loneliness in adolescence. In the present study, the relation between the BDNF Val66Met polymorphism and loneliness in adolescent boys and girls

  18. Biolistic transformation of Schistosoma mansoni: Studies with modified reporter-gene constructs containing regulatory regions of protease genes

    Czech Academy of Sciences Publication Activity Database

    Dvořák, Jan; Beckmann, S.; Lim, K.-C.; Engel, J. C.; Grevelding, C. G.; McKerrow, J. H.; Caffrey, C. R.

    2010-01-01

    Roč. 170, č. 1 (2010), s. 37-40 ISSN 0166-6851 Institutional research plan: CEZ:AV0Z60220518 Keywords : Schistosoma * Protease * Transgene * Gene promoter * Biolistics * Electroporation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.875, year: 2010

  19. In silico method for modelling metabolism and gene product expression at genome scale

    Energy Technology Data Exchange (ETDEWEB)

    Lerman, Joshua A.; Hyduke, Daniel R.; Latif, Haythem; Portnoy, Vasiliy A.; Lewis, Nathan E.; Orth, Jeffrey D.; Rutledge, Alexandra C.; Smith, Richard D.; Adkins, Joshua N.; Zengler, Karsten; Palsson, Bernard O.

    2012-07-03

    Transcription and translation use raw materials and energy generated metabolically to create the macromolecular machinery responsible for all cellular functions, including metabolism. A biochemically accurate model of molecular biology and metabolism will facilitate comprehensive and quantitative computations of an organism's molecular constitution as a function of genetic and environmental parameters. Here we formulate a model of metabolism and macromolecular expression. Prototyping it using the simple microorganism Thermotoga maritima, we show our model accurately simulates variations in cellular composition and gene expression. Moreover, through in silico comparative transcriptomics, the model allows the discovery of new regulons and improving the genome and transcription unit annotations. Our method presents a framework for investigating molecular biology and cellular physiology in silico and may allow quantitative interpretation of multi-omics data sets in the context of an integrated biochemical description of an organism.

  20. A method to detect transfected chloramphenicol acetyltransferase gene expression in intact animals

    International Nuclear Information System (INIS)

    Narayanan, R.; Jastreboff, M.M.; Chiu, Chang Fang; Ito, Etsuro; Bertino, J.R.

    1988-01-01

    A rapid procedure is described for assaying chloramphenicol acetyltransferase enzyme activity in intact animals following transfection of the RSV CAT plasmid into mouse bone marrow cells by electroporation. The reconstituted mice were injected with [ 14 C]chloramphenicol and ethyl acetate extracts of 24-h urine samples were analyzed by TLC autoradiography for the excretion of 14 C-labeled metabolites. CAT expression in vivo can be detected by the presence of acetylated 14 C-labeled metabolites in the urine within 1 week after bone marrow transplantation and, under the conditions described, these metabolites can be detected for at least 3 months. CAT expression in intact mice as monitored by the urine assay correlates with the CAT expression in the hematopoietic tissues assayed in vitro. This method offers a quick mode of screening for introduced CAT gene expression in vivo without sacrificing the mice

  1. MR molecular imaging of tumours using ferritin heavy chain reporter gene expression mediated by the hTERT promoter

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Yan [Third Military Medical University, Department of Radiology, XinQiao Hospital, ChongQing (China); The First Affiliated Hospital of ChengDu Medical College, Department of Radiology, ChengDu (China); Gong, Ming-fu; Yang, Hua; Zhang, Song; Wang, Guang-xian; Su, Tong-sheng; Wen, Li; Zhang, Dong [Third Military Medical University, Department of Radiology, XinQiao Hospital, ChongQing (China)

    2016-11-15

    Using the human telomerase reverse transcriptase (hTERT) promoter and the modified ferritin heavy chain (Fth) reporter gene, reporter gene expression for MRI was examined in telomerase positive and negative tumour cells and xenografts. Activity of the reporter gene expression vector Lenti-hTERT-Fth1-3FLAG-Puro was compared to constitutive CMV-driven expression and to the untransfected parental control in five tumour cell lines: A549, SKOV3, 293T, U2OS and HPDLF. In vitro, transfected cells were evaluated for FLAG-tagged protein expression, iron accumulation and transverse relaxation. In vivo, tumours transduced by lentiviral vector injection were imaged using T2*WI. Changes in tumour signal intensity were validated by histology. Only telomerase positive tumour cells expressed FLAG-tagged Fth and displayed an increase in R2* above the parental control, with a corresponding change in T2*WI. In addition, only telomerase positive tumours, transduced by injection of the reporter gene expression construct, exhibited a change in signal intensity on T2*WI. Tumour histology verified the expression of FLAG-tagged Fth and iron accumulation in telomerase positive tissue. Reporter gene expression for MRI, using the Fth reporter and the hTERT promoter, may be a useful strategy for the non-invasive diagnosis of many types of cancer. (orig.)

  2. The Impact of GFP Reporter Gene Transduction and Expression on Metabolomics of Placental Mesenchymal Stem Cells Determined by UHPLC-Q/TOF-MS

    Directory of Open Access Journals (Sweden)

    Jinfeng Yang

    2017-01-01

    Full Text Available Introduction. Green fluorescent protein (GFP is widely used as a reporter gene in regenerative medicine research to label and track stem cells. Here, we examined whether expressing GFP gene may impact the metabolism of human placental mesenchymal stem cells (hPMSCs. Methods. The GFP gene was transduced into hPMSCs using lentiviral-based infection to establish GFP+hPMSCs. A sensitive 13C/12C-dansyl labeling LC-MS method targeting the amine/phenol submetabolome was used for in-depth cell metabolome profiling. Results. A total of 1151 peak pairs or metabolites were detected from 12 LC-MS runs. Principal component analysis and partial least squares discriminant analysis showed poor separation, and the volcano plots demonstrated that most of the metabolites were not significantly changed when hPMSCs were tagged with GFP. Overall, 739 metabolites were positively or putatively identified. Only 11 metabolites showed significant changes. Metabolic pathway analyses indicated that three of the identified metabolites were involved in nine pathways. However, these metabolites are unlikely to have a large impact on the metabolic pathways due to their nonessential roles and limited hits in pathway analysis. Conclusion. This study indicated that the expression of ectopic GFP reporter gene did not significantly alter the metabolomics pathways covered by the amine/phenol submetabolome.

  3. Parameter estimation methods for gene circuit modeling from time-series mRNA data: a comparative study.

    Science.gov (United States)

    Fan, Ming; Kuwahara, Hiroyuki; Wang, Xiaolei; Wang, Suojin; Gao, Xin

    2015-11-01

    Parameter estimation is a challenging computational problem in the reverse engineering of biological systems. Because advances in biotechnology have facilitated wide availability of time-series gene expression data, systematic parameter estimation of gene circuit models from such time-series mRNA data has become an important method for quantitatively dissecting the regulation of gene expression. By focusing on the modeling of gene circuits, we examine here the performance of three types of state-of-the-art parameter estimation methods: population-based methods, online methods and model-decomposition-based methods. Our results show that certain population-based methods are able to generate high-quality parameter solutions. The performance of these methods, however, is heavily dependent on the size of the parameter search space, and their computational requirements substantially increase as the size of the search space increases. In comparison, online methods and model decomposition-based methods are computationally faster alternatives and are less dependent on the size of the search space. Among other things, our results show that a hybrid approach that augments computationally fast methods with local search as a subsequent refinement procedure can substantially increase the quality of their parameter estimates to the level on par with the best solution obtained from the population-based methods while maintaining high computational speed. These suggest that such hybrid methods can be a promising alternative to the more commonly used population-based methods for parameter estimation of gene circuit models when limited prior knowledge about the underlying regulatory mechanisms makes the size of the parameter search space vastly large. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  4. Case report: value of gene expression profiling in the diagnosis of atypical neuroblastoma.

    Science.gov (United States)

    Harttrampf, Anne C; Chen, Qingrong; Jüttner, Eva; Geiger, Julia; Vansant, Gordon; Khan, Javed; Kontny, Udo

    2017-08-17

    Nephroblastoma and neuroblastoma belong to the most common abdominal malignancies in childhood. Similarities in the initial presentation may provide difficulties in distinguishing between these two entities, especially if unusual variations to prevalent patterns of disease manifestation occur. Because of the risk of tumor rupture, European protocols do not require biopsy for diagnosis, which leads to misdiagnosis in some cases. We report on a 4½-year-old girl with a renal tumor displaying radiological and laboratory characteristics supporting the diagnosis of nephroblastoma. Imaging studies showed tumor extension into the inferior vena cava and bilateral lung metastases while urine catecholamines and MIBG-scintigraphy were negative. Preoperative chemotherapy with vincristine, actinomycine D and adriamycin according to the SIOP2001/GPOH protocol for the treatment of nephroblastoma was initiated and followed by surgical tumor resection. Histopathology revealed an undifferentiated tumor with expression of neuronal markers, suggestive of neuroblastoma. MYCN amplification could not be detected. DNA-microarray analysis was performed using Affymetrix genechip human genome U133 plus 2.0 and artificial neural network analysis. Results were confirmed by multiplex RT-PCR. Principal component analysis using 84 genes showed that the patient sample was clearly clustering with neuroblastoma tumors. This was confirmed by hierarchical clustering of the multiplex RT-PCR data. The patient underwent treatment for high-risk neuroblastoma comprising chemotherapy including cisplatin, etoposide, vindesine, dacarbacine, ifosfamide, vincristine, adriamycine and autologous stem cell transplantation followed by maintenance therapy with 13-cis retinoic acid (GPOH NB2004 High Risk Trial Protocol) and is in complete long-term remission. The use of gene expression profiling in an individual patient strongly contributed to clarification in a diagnostic dilemma which finally led to a change of

  5. The Method of Choice for Reporting Comprehensive Income

    Directory of Open Access Journals (Sweden)

    Kendra Huff

    2014-10-01

    Full Text Available Globalization of financial markets and exponential growth of cross-listing of foreign companies on stock exchanges in other countries throughout the world call for a need of a single global accounting language which ensures relevance, completeness, understandability, reliability, timeliness, neutrality, verifiability, consistency, comparability and transparency of financial statements. The International Accounting Standards Board (IASB introduced International Financial Reporting Standards (IFRS. The growing acceptance of IFRSs across the world presents an important challenge and represents a fundamental change in financial reporting. This study contributes to the latest discussions on international financial reporting by reviewing corporate financial statements of Fortune 500 companies to determine how corporations are reporting comprehensive income. We find that companies across the sample are consistent in reporting OCI - they utilize a separate statement for OCI reporting.

  6. A novel method of predicting microRNA-disease associations based on microRNA, disease, gene and environment factor networks.

    Science.gov (United States)

    Peng, Wei; Lan, Wei; Zhong, Jiancheng; Wang, Jianxin; Pan, Yi

    2017-07-15

    MicroRNAs have been reported to have close relationship with diseases due to their deregulation of the expression of target mRNAs. Detecting disease-related microRNAs is helpful for disease therapies. With the development of high throughput experimental techniques, a large number of microRNAs have been sequenced. However, it is still a big challenge to identify which microRNAs are related to diseases. Recently, researchers are interesting in combining multiple-biological information to identify the associations between microRNAs and diseases. In this work, we have proposed a novel method to predict the microRNA-disease associations based on four biological properties. They are microRNA, disease, gene and environment factor. Compared with previous methods, our method makes predictions not only by using the prior knowledge of associations among microRNAs, disease, environment factors and genes, but also by using the internal relationship among these biological properties. We constructed four biological networks based on the similarity of microRNAs, diseases, environment factors and genes, respectively. Then random walking was implemented on the four networks unequally. In the walking course, the associations can be inferred from the neighbors in the same networks. Meanwhile the association information can be transferred from one network to another. The results of experiment showed that our method achieved better prediction performance than other existing state-of-the-art methods. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Writing a Mixed Methods Report in Social Work Research

    Science.gov (United States)

    Bronstein, Laura R.; Kovacs, Pamela J.

    2013-01-01

    This article briefly chronicles the development of mixed methods research and its use in social work. We then move onto a discussion of terms and designs, reasons for (and for not) using mixed methods. Drawing upon exemplars, we address how to write up a mixed methods study when (1) the sample is single; single for one part, with a subset for the…

  8. Gene probes : principles and protocols [Methods in molecular biology, v. 179

    National Research Council Canada - National Science Library

    Rapley, Ralph; Aquino de Muro, Marilena

    2002-01-01

    ... of labeled DNA has allowed genes to be mapped to single chromosomes and in many cases to a single chromosome band, promoting significant advance in human genome mapping. Gene Probes: Principles and Protocols presents the principles for gene probe design, labeling, detection, target format, and hybridization conditions together with detailed protocols, accom...

  9. 77 FR 41336 - Analytical Methods Used in Periodic Reporting

    Science.gov (United States)

    2012-07-13

    ... IOCS Reporting Codes. The Postal Service proposes to make changes to In-Office Cost System activity... comments electronically via the Commission's Filing Online system at http://www.prc.gov . Commenters who... Postal Service proposes to eliminate the separate, shape-based reporting of unit costs within Standard...

  10. Simultaneous amplification of two bacterial genes: more reliable method of Helicobacter pylori detection in microbial rich dental plaque samples.

    Science.gov (United States)

    Chaudhry, Saima; Idrees, Muhammad; Izhar, Mateen; Butt, Arshad Kamal; Khan, Ayyaz Ali

    2011-01-01

    Polymerase Chain reaction (PCR) assay is considered superior to other methods for detection of Helicobacter pylori (H. pylori) in oral cavity; however, it also has limitations when sample under study is microbial rich dental plaque. The type of gene targeted and number of primers used for bacterial detection in dental plaque samples can have a significant effect on the results obtained as there are a number of closely related bacterial species residing in plaque biofilm. Also due to high recombination rate of H. pylori some of the genes might be down regulated or absent. The present study was conducted to determine the frequency of H. pylori colonization of dental plaque by simultaneously amplifying two genes of the bacterium. One hundred dental plaque specimens were collected from dyspeptic patients before their upper gastrointestinal endoscopy and presence of H. pylori was determined through PCR assay using primers targeting two different genes of the bacterium. Eighty-nine of the 100 samples were included in final analysis. With simultaneous amplification of two bacterial genes 51.6% of the dental plaque samples were positive for H. pylori while this prevalence increased to 73% when only one gene amplification was used for bacterial identification. Detection of H. pylori in dental plaque samples is more reliable when two genes of the bacterium are simultaneously amplified as compared to one gene amplification only.

  11. A novel mutation of WFS1 gene in a Chinese patient with Wolfram syndrome: a case report.

    Science.gov (United States)

    Li, Min; Liu, Jia; Yi, Huan; Xu, Li; Zhong, Xiufeng; Peng, Fuhua

    2018-03-17

    Wolfram syndrome (WS), caused by mutations of the Wolfram syndrome 1 (WFS1) gene on chromosome 4p16.1, is an autosomal recessive disorder characterized by diabetes insipidus (DI), neuro-psychiatric disorders, hearing deficit, and urinary tract anomalies. Here we report a 11-year-old Chinese boy who presented with visual loss, was suspected with optic neuritis (ON) or neuromyelitis optica (NMO) and referred to our department for further diagnosis. Finally he was diagnosed with WS because of diabetes mellitus (DM) and optic atrophy (OA). Eight exons and flanking introns of WFS1 gene were analyzed by sequencing. A novel mutation c.1760G > A in WFS1 gene of exon 8 was identified. This report reviews a case of WS associated with a novel mutation, c.1760G > A in WFS1 gene of exon 8, and emphasizes that WS should be taken into account for juveniles with visual loss and diabetes mellitus.

  12. Aberrant DNA methylation of cancer-related genes in giant breast fibroadenoma: a case report

    Directory of Open Access Journals (Sweden)

    Orozco Javier I

    2011-10-01

    Full Text Available Abstract Introduction Giant fibroadenoma is an uncommon variant of benign breast lesions. Aberrant methylation of CpG islands in promoter regions is known to be involved in the silencing of genes (for example, tumor-suppressor genes and appears to be an early event in the etiology of breast carcinogenesis. Only hypermethylation of p16INK4a has been reported in non-giant breast fibroadenoma. In this particular case, there are no previously published data on epigenetic alterations in giant fibroadenomas. Our previous results, based on the analysis of 49 cancer-related CpG islands have confirmed that the aberrant methylation is specific to malignant breast tumors and that it is completely absent in normal breast tissue and breast fibroadenomas. Case presentation A 13-year-old Hispanic girl was referred after she had noted a progressive development of a mass in her left breast. On physical examination, a 10 × 10 cm lump was detected and axillary lymph nodes were not enlarged. After surgical removal the lump was diagnosed as a giant fibroadenoma. Because of the high growth rate of this benign tumor, we decided to analyze the methylation status of 49 CpG islands related to cell growth control. We have identified the methylation of five cancer-related CpG islands in the giant fibroadenoma tissue: ESR1, MGMT, WT-1, BRCA2 and CD44. Conclusion In this case report we show for the first time the methylation analysis of a giant fibroadenoma. The detection of methylation of these five cancer-related regions indicates substantial epigenomic differences with non-giant fibroadenomas. Epigenetic alterations could explain the higher growth rate of this tumor. Our data contribute to the growing knowledge of aberrant methylation in breast diseases. In this particular case, there exist no previous data regarding the role of methylation in giant fibroadenomas, considered by definition as a benign breast lesion.

  13. Development of the 5-HT2CR-Tango System Combined with an EGFP Reporter Gene.

    Science.gov (United States)

    Watanabe, Yoshihisa; Tsujimura, Atsushi; Aoki, Miku; Taguchi, Katsutoshi; Tanaka, Masaki

    2016-02-01

    The serotonin 2C receptor (5-HT2CR) is a G-protein-coupled receptor implicated in emotion, feeding, reward, and cognition. 5-HT2CRs are pharmacological targets for mental disorders and metabolic and reward system abnormalities, as alterations in 5-HT2CR expression, RNA editing, and SNPs are involved in these disturbances. To date, 5-HT2CR activity has mainly been measured by quantifying inositol phosphate production and intracellular Ca(2+) release, but these assays are not suitable for in vivo analysis. Here, we developed a 5-HT2CR-Tango assay system, a novel analysis tool of 5-HT2CR activity based on the G-protein-coupled receptor (GPCR)-arrestin interaction. With desensitization of activated 5-HT2CR by arrestin, this system converts the 5-HT2CR-arrestin interaction into EGFP reporter gene signal via the LexA transcriptional activation system. For validation of our system, we measured activity of two 5-HT2CR RNA-editing isoforms (INI and VGV) in HEK293 cells transfected with EGFP reporter gene. The INI isoform displayed both higher basal- and 5-HT-stimulated activities than the VGV isoform. Moreover, an inhibitory effect of 5-HT2CR antagonist SB242084 was also detected by 5-HT2CR-Tango system. This novel tool is useful for in vitro high-throughput targeted 5-HT2CR drug screening and can be applied to future in vivo brain function studies associated with 5-HT2CRs in transgenic animal models.

  14. Rapid and tunable method to temporally control gene editing based on conditional Cas9 stabilization. | Office of Cancer Genomics

    Science.gov (United States)

    The CRISPR/Cas9 system is a powerful tool for studying gene function. Here, we describe a method that allows temporal control of CRISPR/Cas9 activity based on conditional Cas9 destabilization. We demonstrate that fusing an FKBP12-derived destabilizing domain to Cas9 (DD-Cas9) enables conditional Cas9 expression and temporal control of gene editing in the presence of an FKBP12 synthetic ligand. This system can be easily adapted to co-express, from the same promoter, DD-Cas9 with any other gene of interest without co-modulation of the latter.

  15. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data.

    Science.gov (United States)

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2016-05-01

    Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Quantitative structure-activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro-in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and big data. Environ Health Perspect 124:634-641;

  16. Using Dual Fluorescence Reporting Genes to Establish an In Vivo Imaging Model of Orthotopic Lung Adenocarcinoma in Mice.

    Science.gov (United States)

    Lai, Cheng-Wei; Chen, Hsiao-Ling; Yen, Chih-Ching; Wang, Jiun-Long; Yang, Shang-Hsun; Chen, Chuan-Mu

    2016-12-01

    Lung adenocarcinoma is characterized by a poor prognosis and high mortality worldwide. In this study, we purposed to use the live imaging techniques and a reporter gene that generates highly penetrative near-infrared (NIR) fluorescence to establish a preclinical animal model that allows in vivo monitoring of lung cancer development and provides a non-invasive tool for the research on lung cancer pathogenesis and therapeutic efficacy. A human lung adenocarcinoma cell line (A549), which stably expressed the dual fluorescence reporting gene (pCAG-iRFP-2A-Venus), was used to generate subcutaneous or orthotopic lung cancer in nude mice. Cancer development was evaluated by live imaging via the NIR fluorescent signals from iRFP, and the signals were verified ex vivo by the green fluorescence of Venus from the gross lung. The tumor-bearing mice received miR-16 nucleic acid therapy by intranasal administration to demonstrate therapeutic efficacy in this live imaging system. For the subcutaneous xenografts, the detection of iRFP fluorescent signals revealed delicate changes occurring during tumor growth that are not distinguishable by conventional methods of tumor measurement. For the orthotopic xenografts, the positive correlation between the in vivo iRFP signal from mice chests and the ex vivo green fluorescent signal from gross lung tumors and the results of the suppressed tumorigenesis by miR-16 treatment indicated that lung tumor size can be accurately quantified by the emission of NIR fluorescence. In addition, orthotopic lung tumor localization can be accurately visualized using iRFP fluorescence tomography in vivo, thus revealing the trafficking of lung tumor cells. We introduced a novel dual fluorescence lung cancer model that provides a non-invasive option for preclinical research via the use of NIR fluorescence in live imaging of lung.

  17. Case reports of juvenile GM1 gangliosidosisis type II caused by mutation in GLB1 gene.

    Science.gov (United States)

    Karimzadeh, Parvaneh; Naderi, Samaneh; Modarresi, Farzaneh; Dastsooz, Hassan; Nemati, Hamid; Farokhashtiani, Tayebeh; Shamsian, Bibi Shahin; Inaloo, Soroor; Faghihi, Mohammad Ali

    2017-07-17

    Type II or juvenile GM1-gangliosidosis is an autosomal recessive lysosomal storage disorder, which is clinically distinct from infantile form of the disease by the lack of characteristic cherry-red spot and hepatosplenomegaly. The disease is characterized by slowly progressive neurodegeneration and mild skeletal changes. Due to the later age of onset and uncharacteristic presentation, diagnosis is frequently puzzled with other ataxic and purely neurological disorders. Up to now, 3-4 types of GM1-gangliosidosis have been reported and among them type I is the most common phenotype with the age of onset around 6 months. Various forms of GM1-gangliosidosis are caused by GLB1 gene mutations but severity of the disease and age of onset are directly related to the position and the nature of deleterious mutations. However, due to its unique genetic cause and overlapping clinical features, some researchers believe that GM1 gangliosidosis represents an overlapped disease spectrum instead of four distinct types. Here, we report a less frequent type of autosomal recessive GM1 gangliosidosis with perplexing clinical presentation in three families in the southwest part of Iran, who are unrelated but all from "Lurs" ethnic background. To identify disease-causing mutations, Whole Exome Sequencing (WES) utilizing next generation sequencing was performed. Four patients from three families were investigated with the age of onset around 3 years old. Clinical presentations were ataxia, gate disturbances and dystonia leading to wheelchair-dependent disability, regression of intellectual abilities, and general developmental regression. They all were born in consanguineous families with no previous documented similar disease in their parents. A homozygote missense mutation in GLB1 gene (c. 601 G > A, p.R201C) was found in all patients. Using Sanger sequencing this identified mutation was confirmed in the proband, their parents, grandparents, and extended family members, confirming

  18. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    analysis in genomes of various sizes and illustrate the utility of our methods by applying them to gene clusters recently reported in the literature. Mathematical code to compute cluster probabilities using our methods is available as supplementary material.

  19. Final report on the Copper Mountain conference on multigrid methods

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-10-01

    The Copper Mountain Conference on Multigrid Methods was held on April 6-11, 1997. It took the same format used in the previous Copper Mountain Conferences on Multigrid Method conferences. Over 87 mathematicians from all over the world attended the meeting. 56 half-hour talks on current research topics were presented. Talks with similar content were organized into sessions. Session topics included: fluids; domain decomposition; iterative methods; basics; adaptive methods; non-linear filtering; CFD; applications; transport; algebraic solvers; supercomputing; and student paper winners.

  20. Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR.

    Science.gov (United States)

    Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas

    2013-05-21

    Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.

  1. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

    OpenAIRE

    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A

    1997-01-01

    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, delet...

  2. Optimatization of transient transformation methods to study gene expression in Musa acuminata (AAA group) cultivar Ambon Lumut

    Science.gov (United States)

    Prayuni, Kinasih; Dwivany, Fenny M.

    2015-09-01

    Banana is classified as a climateric fruit, whose ripening is regulated by ethylene. Ethylene is synthesized from ACC (1-aminocyclopropane-1-carboxylic acid) by ACC oxidase enzyme which is encoded by ACO gene. Controling an important gene expression in ethylene biosynthesis pathway has became a target to delay the ripening process. Therefore in the previous study we have designed a MaACO-RNAi construct to control MaACO gene expression. In this research, we study the effectiveness of different transient transformation methods to deliver the construct. Direct injection, with or no vaccum infiltration methods were used to deliver MaACO-RNAi construct. All of the methods succesfully deliver the construct into banana fruits based on RT-PCR result.

  3. Clustering based gene expression feature selection method: A computational approach to enrich the classifier efficiency of differentially expressed genes

    KAUST Repository

    Abusamra, Heba; Bajic, Vladimir B.

    2016-01-01

    decrease the computational time and cost, but also improve the classification performance. Among different approaches of feature selection methods, however most of them suffer from several problems such as lack of robustness, validation issues etc. Here, we

  4. Summary Report for Evaluation of Compost Sample Drying Methods

    National Research Council Canada - National Science Library

    Frye, Russell

    1994-01-01

    The U.S. Army Environmental Center (USAEC), formerly the U.S. Army Toxic and Hazardous Materials Agency, has evaluated composting methods for treatment of explosive-contaminated soils and sediments at Army installations...

  5. GraphTeams: a method for discovering spatial gene clusters in Hi-C sequencing data.

    Science.gov (United States)

    Schulz, Tizian; Stoye, Jens; Doerr, Daniel

    2018-05-08

    Hi-C sequencing offers novel, cost-effective means to study the spatial conformation of chromosomes. We use data obtained from Hi-C experiments to provide new evidence for the existence of spatial gene clusters. These are sets of genes with associated functionality that exhibit close proximity to each other in the spatial conformation of chromosomes across several related species. We present the first gene cluster model capable of handling spatial data. Our model generalizes a popular computational model for gene cluster prediction, called δ-teams, from sequences to graphs. Following previous lines of research, we subsequently extend our model to allow for several vertices being associated with the same label. The model, called δ-teams with families, is particular suitable for our application as it enables handling of gene duplicates. We develop algorithmic solutions for both models. We implemented the algorithm for discovering δ-teams with families and integrated it into a fully automated workflow for discovering gene clusters in Hi-C data, called GraphTeams. We applied it to human and mouse data to find intra- and interchromosomal gene cluster candidates. The results include intrachromosomal clusters that seem to exhibit a closer proximity in space than on their chromosomal DNA sequence. We further discovered interchromosomal gene clusters that contain genes from different chromosomes within the human genome, but are located on a single chromosome in mouse. By identifying δ-teams with families, we provide a flexible model to discover gene cluster candidates in Hi-C data. Our analysis of Hi-C data from human and mouse reveals several known gene clusters (thus validating our approach), but also few sparsely studied or possibly unknown gene cluster candidates that could be the source of further experimental investigations.

  6. A powerful nonparametric method for detecting differentially co-expressed genes: distance correlation screening and edge-count test.

    Science.gov (United States)

    Zhang, Qingyang

    2018-05-16

    Differential co-expression analysis, as a complement of differential expression analysis, offers significant insights into the changes in molecular mechanism of different phenotypes. A prevailing approach to detecting differentially co-expressed genes is to compare Pearson's correlation coefficients in two phenotypes. However, due to the limitations of Pearson's correlation measure, this approach lacks the power to detect nonlinear changes in gene co-expression which is common in gene regulatory networks. In this work, a new nonparametric procedure is proposed to search differentially co-expressed gene pairs in different phenotypes from large-scale data. Our computational pipeline consisted of two main steps, a screening step and a testing step. The screening step is to reduce the search space by filtering out all the independent gene pairs using distance correlation measure. In the testing step, we compare the gene co-expression patterns in different phenotypes by a recently developed edge-count test. Both steps are distribution-free and targeting nonlinear relations. We illustrate the promise of the new approach by analyzing the Cancer Genome Atlas data and the METABRIC data for breast cancer subtypes. Compared with some existing methods, the new method is more powerful in detecting nonlinear type of differential co-expressions. The distance correlation screening can greatly improve computational efficiency, facilitating its application to large data sets.

  7. A Robust and Versatile Method of Combinatorial Chemical Synthesis of Gene Libraries via Hierarchical Assembly of Partially Randomized Modules

    Science.gov (United States)

    Popova, Blagovesta; Schubert, Steffen; Bulla, Ingo; Buchwald, Daniela; Kramer, Wilfried

    2015-01-01

    A major challenge in gene library generation is to guarantee a large functional size and diversity that significantly increases the chances of selecting different functional protein variants. The use of trinucleotides mixtures for controlled randomization results in superior library diversity and offers the ability to specify the type and distribution of the amino acids at each position. Here we describe the generation of a high diversity gene library using tHisF of the hyperthermophile Thermotoga maritima as a scaffold. Combining various rational criteria with contingency, we targeted 26 selected codons of the thisF gene sequence for randomization at a controlled level. We have developed a novel method of creating full-length gene libraries by combinatorial assembly of smaller sub-libraries. Full-length libraries of high diversity can easily be assembled on demand from smaller and much less diverse sub-libraries, which circumvent the notoriously troublesome long-term archivation and repeated proliferation of high diversity ensembles of phages or plasmids. We developed a generally applicable software tool for sequence analysis of mutated gene sequences that provides efficient assistance for analysis of library diversity. Finally, practical utility of the library was demonstrated in principle by assessment of the conformational stability of library members and isolating protein variants with HisF activity from it. Our approach integrates a number of features of nucleic acids synthetic chemistry, biochemistry and molecular genetics to a coherent, flexible and robust method of combinatorial gene synthesis. PMID:26355961

  8. Guidelines for Reporting Quantitative Methods and Results in Primary Research

    Science.gov (United States)

    Norris, John M.; Plonsky, Luke; Ross, Steven J.; Schoonen, Rob

    2015-01-01

    Adequate reporting of quantitative research about language learning involves careful consideration of the logic, rationale, and actions underlying both study designs and the ways in which data are analyzed. These guidelines, commissioned and vetted by the board of directors of "Language Learning," outline the basic expectations for…

  9. 77 FR 56176 - Analytical Methods Used in Periodic Reporting

    Science.gov (United States)

    2012-09-12

    ... informal rulemaking proceeding to consider changes in analytical principles (Proposals Six and Seven) used... (Proposals Six and Seven), September 4, 2012 (Petition). Proposal Six: Use of Foreign Postal Settlement System as Sole Source for Reporting of Inbound International Revenue, Pieces, and Weights. The Postal...

  10. Spectral map-analysis: a method to analyze gene expression data

    OpenAIRE

    Bijnens, Luc J.M.; Lewi, Paul J.; Göhlmann, Hinrich W.; Molenberghs, Geert; Wouters, Luc

    2004-01-01

    bioinformatics; biplot; correspondence factor analysis; data mining; data visualization; gene expression data; microarray data; multivariate exploratory data analysis; principal component analysis; Spectral map analysis

  11. A Shortest-Path-Based Method for the Analysis and Prediction of Fruit-Related Genes in Arabidopsis thaliana.

    Science.gov (United States)

    Zhu, Liucun; Zhang, Yu-Hang; Su, Fangchu; Chen, Lei; Huang, Tao; Cai, Yu-Dong

    2016-01-01

    Biologically, fruits are defined as seed-bearing reproductive structures in angiosperms that develop from the ovary. The fertilization, development and maturation of fruits are crucial for plant reproduction and are precisely regulated by intrinsic genetic regulatory factors. In this study, we used Arabidopsis thaliana as a model organism and attempted to identify novel genes related to fruit-associated biological processes. Specifically, using validated genes, we applied a shortest-path-based method to identify several novel genes in a large network constructed using the protein-protein interactions observed in Arabidopsis thaliana. The described analyses indicate that several of the discovered genes are associated with fruit fertilization, development and maturation in Arabidopsis thaliana.

  12. Detection of Chloramphenicol Resistance Genes (cat in Clinical Isolates of Pseudomonas aeruginosa with Polymerase Chain Reaction Method

    Directory of Open Access Journals (Sweden)

    Tiana Milanda

    2014-12-01

    Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.

  13. An in vitro method for screening for the presence of thepat-2 gene in tomatoes (Lycopersicon esculentum Mill.).

    Science.gov (United States)

    Young, T E; Juvik, J A; Sullivan, J G; Skirvin, R M

    1990-01-01

    Under field conditions,pat-2, the gene which conditions parthenocarpy in tomatoes, is recessive. A simple method has been devised for distinguishing the heterozygote from the two homozygotes using tissue culture. Ovaries of plants segregating for thepat-2 gene were excised and cultured on a medium containing 100 ppm gibberellic acid. After three weeks in culture, three distinct ovary sizes could be seen. It was shown, using F 3 progeny tests, that the largest ovaries corresponded to those plants homozygous for thepat-2 gene, the smallest ovaries corresponded to those plants homozygous for the wild type allele, and the intermediate sized ovaries were the heterozygotes. The ability to identify the heterozygote would greatly simplify a backcross breeding program aimed at incorporating thepat-2 gene into commercial cultivars by eliminating the need for an F 3 progeny test to determine the genotype of a plant.

  14. Final Report: Symposium on Adaptive Methods for Partial Differential Equations

    Energy Technology Data Exchange (ETDEWEB)

    Pernice, Michael; Johnson, Christopher R.; Smith, Philip J.; Fogelson, Aaron

    1998-12-08

    Complex physical phenomena often include features that span a wide range of spatial and temporal scales. Accurate simulation of such phenomena can be difficult to obtain, and computations that are under-resolved can even exhibit spurious features. While it is possible to resolve small scale features by increasing the number of grid points, global grid refinement can quickly lead to problems that are intractable, even on the largest available computing facilities. These constraints are particularly severe for three dimensional problems that involve complex physics. One way to achieve the needed resolution is to refine the computational mesh locally, in only those regions where enhanced resolution is required. Adaptive solution methods concentrate computational effort in regions where it is most needed. These methods have been successfully applied to a wide variety of problems in computational science and engineering. Adaptive methods can be difficult to implement, prompting the development of tools and environments to facilitate their use. To ensure that the results of their efforts are useful, algorithm and tool developers must maintain close communication with application specialists. Conversely it remains difficult for application specialists who are unfamiliar with the methods to evaluate the trade-offs between the benefits of enhanced local resolution and the effort needed to implement an adaptive solution method.

  15. Volatile Gas Production by Methyl Halide Transferase: An In Situ Reporter Of Microbial Gene Expression In Soil.

    Science.gov (United States)

    Cheng, Hsiao-Ying; Masiello, Caroline A; Bennett, George N; Silberg, Jonathan J

    2016-08-16

    Traditional visual reporters of gene expression have only very limited use in soils because their outputs are challenging to detect through the soil matrix. This severely restricts our ability to study time-dependent microbial gene expression in one of the Earth's largest, most complex habitats. Here we describe an approach to report on dynamic gene expression within a microbial population in a soil under natural water levels (at and below water holding capacity) via production of methyl halides using a methyl halide transferase. As a proof-of-concept application, we couple the expression of this gas reporter to the conjugative transfer of a bacterial plasmid in a soil matrix and show that gas released from the matrix displays a strong correlation with the number of transconjugant bacteria that formed. Gas reporting of gene expression will make possible dynamic studies of natural and engineered microbes within many hard-to-image environmental matrices (soils, sediments, sludge, and biomass) at sample scales exceeding those used for traditional visual reporting.

  16. An evolutionary conserved region (ECR in the human dopamine receptor D4 gene supports reporter gene expression in primary cultures derived from the rat cortex

    Directory of Open Access Journals (Sweden)

    Haddley Kate

    2011-05-01

    Full Text Available Abstract Background Detecting functional variants contributing to diversity of behaviour is crucial for dissecting genetics of complex behaviours. At a molecular level, characterisation of variation in exons has been studied as they are easily identified in the current genome annotation although the functional consequences are less well understood; however, it has been difficult to prioritise regions of non-coding DNA in which genetic variation could also have significant functional consequences. Comparison of multiple vertebrate genomes has allowed the identification of non-coding evolutionary conserved regions (ECRs, in which the degree of conservation can be comparable with exonic regions suggesting functional significance. Results We identified ECRs at the dopamine receptor D4 gene locus, an important gene for human behaviours. The most conserved non-coding ECR (D4ECR1 supported high reporter gene expression in primary cultures derived from neonate rat frontal cortex. Computer aided analysis of the sequence of the D4ECR1 indicated the potential transcription factors that could modulate its function. D4ECR1 contained multiple consensus sequences for binding the transcription factor Sp1, a factor previously implicated in DRD4 expression. Co-transfection experiments demonstrated that overexpression of Sp1 significantly decreased the activity of the D4ECR1 in vitro. Conclusion Bioinformatic analysis complemented by functional analysis of the DRD4 gene locus has identified a a strong enhancer that functions in neurons and b a transcription factor that may modulate the function of that enhancer.

  17. Blue ghosts: a new method for isolating amber mutants defective in essential genes of Escherichia coli

    DEFF Research Database (Denmark)

    Brown, S; Brickman, E R; Beckwith, J

    1981-01-01

    We describe a technique which permits an easy screening for amber mutants defective in essential genes of Escherichia coli. Using this approach, we have isolated three amber mutants defective in the rho gene. An extension of the technique allows the detection of ochre mutants and transposon inser...

  18. A fast and efficient gene-network reconstruction method from multiple over-expression experiments

    Directory of Open Access Journals (Sweden)

    Thurner Stefan

    2009-08-01

    Full Text Available Abstract Background Reverse engineering of gene regulatory networks presents one of the big challenges in systems biology. Gene regulatory networks are usually inferred from a set of single-gene over-expressions and/or knockout experiments. Functional relationships between genes are retrieved either from the steady state gene expressions or from respective time series. Results We present a novel algorithm for gene network reconstruction on the basis of steady-state gene-chip data from over-expression experiments. The algorithm is based on a straight forward solution of a linear gene-dynamics equation, where experimental data is fed in as a first predictor for the solution. We compare the algorithm's performance with the NIR algorithm, both on the well known E. coli experimental data and on in-silico experiments. Conclusion We show superiority of the proposed algorithm in the number of correctly reconstructed links and discuss computational time and robustness. The proposed algorithm is not limited by combinatorial explosion problems and can be used in principle for large networks.

  19. Structure and function of the human metallothionein gene family: Final technical report

    International Nuclear Information System (INIS)

    Karin, M.

    1986-01-01

    The full nucleotide sequence of two additional human metallothionein (hMT) genes has been determined. These genes, hMT-I/sub B/ and hMT-I/sub F/, are located within the MT-I gene cluster we have described originally. The hMT-I/sub F/ gene is the first hMT-I gene whose amino acid sequence is in complete agreement with the published sequence of the human MT-I proteins. Therefore it is likely to be an active gene encoding a functional protein. However, since we have just completed the sequence analysis, we have not characterized this gene further yet. The hMT-I/sub B/ gene is closely linked to the hMT-I/sub A/ gene, and two pseudogenes, hMT-I/sub C/ and hMT-I/sub D/ separate the two. From its nucleotide sequence hMT-I/sub B/ seems to be an active gene, encoding a functional protein even though it differs in four positions from the published sequence of human MT-I proteins. This gene is expressed in a human hepatoma cell line, HepG2, and its expression is stimulated by Cd ++ . Using gene fusions to the viral thymidine-kinase gene we find that hMT-I/sub B/, like the hMT-I/sub A/ and hMT-II/sub A/ genes, contains a heavy metal responsive promoterregulatory element within its 5' flanking region. We analyzed the level of hMT-I/sub B/ mRNA in a variety of human cell lines by the S1 nuclease technique, and compared it to the expression of the hMT-II/sub A/ gene. While the hMT-II/sub A/ gene was expressed in all of the cell lines analyzed, the hMT-I/sub B/ gene was expressed in liver and kidney derived cell lines cells. This suggest that the expression of the hMT-I/sub B/ gene is controlled in a tissue specific manner. 13 refs

  20. Clinical and genetic characterization of chanarin-dorfman syndrome patients: first report of large deletions in the ABHD5 gene

    Directory of Open Access Journals (Sweden)

    Prati Daniele

    2010-12-01

    Full Text Available Abstract Background Chanarin-Dorfman syndrome (CDS is a rare autosomal recessive disorder characterized by nonbullous congenital ichthyosiform erythroderma (NCIE and an intracellular accumulation of triacylglycerol (TG droplets in most tissues. The clinical phenotype involves multiple organs and systems, including liver, eyes, ears, skeletal muscle and central nervous system (CNS. Mutations in ABHD5/CGI58 gene are associated with CDS. Methods Eight CDS patients belonging to six different families from Mediterranean countries were enrolled for genetic study. Molecular analysis of the ABHD5 gene included the sequencing of the 7 coding exons and of the putative 5' regulatory regions, as well as reverse transcript-polymerase chain reaction analysis and sequencing of normal and aberrant ABHD5 cDNAs. Results Five different mutations were identified, four of which were novel, including two splice-site mutations (c.47+1G>A and c.960+5G>A and two large deletions (c.898_*320del and c.662-1330_773+46del. All the reported mutations are predicted to be pathogenic because they lead to an early stop codon or a frameshift producing a premature termination of translation. While nonsense, missense, frameshift and splice-site mutations have been identified in CDS patients, large genomic deletions have not previously been described. Conclusions These results emphasize the need for an efficient approach for genomic deletion screening to ensure an accurate molecular diagnosis of CDS. Moreover, in spite of intensive molecular screening, no mutations were identified in one patient with a confirmed clinical diagnosis of CDS, appointing to genetic heterogeneity of the syndrome.

  1. Optimizing viral and non-viral gene transfer methods for genetic modification of porcine mesenchymal stem cells

    DEFF Research Database (Denmark)

    Stiehler, Maik; Duch, Mogens; Mygind, Tina

    2006-01-01

    INTRODUCTION: Mesenchymal stem cells (MSCs) provide an excellent source of pluripotent progenitor cells for tissue-engineering applications due to their proliferation capacity and differentiation potential. Genetic modification of MSCs with genes encoding tissue-specific growth factors...... viral and non-viral ex vivo gene delivery systems with respect to gene transfer efficiency, maintenance of transgene expression, and safety issues using primary porcine MSCs as target cells. MATERIALS AND METHODS: MSCs were purified from bone marrow aspirates from the proximal tibiae of four 3-month......-old Danish landrace pigs by Ficoll step gradient separation and polystyrene adherence technique. Vectors expressing enhanced green fluorescent protein (eGFP) and human bone morphogenetic protein-2 (BMP-2) were transferred to the cells by different non-viral methods and by use of recombinant adeno...

  2. Methods of economic analysis applied to fusion research. Final report

    International Nuclear Information System (INIS)

    1983-01-01

    In this and previous efforts ECON has provided economic assessment of a fusion research program. This phase of study focused on two tasks, the first concerned with the economics of fusion in an economy that relies heavily upon synthetic fuels, and the second concerned with the overall economic effects of pursuing soft energy technologies instead of hard technologies. This report is organized in two parts, the first entitled An Economic Analysis of Coproduction of Fusion-Electric Energy and Other Products, and the second entitled Arguments Associated with the Choice of Potential Energy Futures

  3. Cyclin B1 Destruction Box-Mediated Protein Instability: The Enhanced Sensitivity of Fluorescent-Protein-Based Reporter Gene System

    Directory of Open Access Journals (Sweden)

    Chao-Hsun Yang

    2013-01-01

    Full Text Available The periodic expression and destruction of several cyclins are the most important steps for the exact regulation of cell cycle. Cyclins are degraded by the ubiquitin-proteasome system during cell cycle. Besides, a short sequence near the N-terminal of cyclin B called the destruction box (D-box; CDB is also required. Fluorescent-protein-based reporter gene system is insensitive to analysis because of the overly stable fluorescent proteins. Therefore, in this study, we use human CDB fused with both enhanced green fluorescent protein (EGFP at C-terminus and red fluorescent protein (RFP, DsRed at N-terminus in the transfected human melanoma cells to examine the effects of CDB on different fluorescent proteins. Our results indicated that CDB-fused fluorescent protein can be used to examine the slight gene regulations in the reporter gene system and have the potential to be the system for screening of functional compounds in the future.

  4. Manufacturing Methods & Technology Project Execution Report. Second Half CY 1980

    Science.gov (United States)

    1981-03-01

    TO PURSUE DIETHYLENE GLYCOL PROCESS. 5 76 4114 P27 SOLID WASTE SOIL Dl FOSAL TECHNIQUES EYPERIMENTAL WORK AT CRANE IND PROVED THAT NO AIRBORNE TNT OR...DERIVATIVES RELEASED DURING COMPOSTING OPERATION. ALSO NO TOXIC PRODUCTS PRODUCED* FINAL COMFOSTED PRODUCT MAY BE RETURNED TO THE LAND AS A SOIL ...AND CONSIDERABLY MORE EFFICIENT THAN COMPETING METHODS, A NOZZLE OSN AND OPN COND WERE ESTAB WHICH WILL BE USL ) AS THE FIRST TRIAL DURING THE PILOT

  5. Using Experimental Methods to Investigate Discriminatory Tendencies: A Lesson Report

    Directory of Open Access Journals (Sweden)

    Yu-Wen Chen

    2013-08-01

    Full Text Available Using dictator games in experimental analysis, this lesson report demonstrates the process and results of a postgraduate class project in which university students were instructed to scientifically investigate and explore one of German society’s most hotly-contested issues: the level of discriminatory tendencies of non-Muslims towards Muslims. The results of this class project show little or no discriminatory tendencies toward Muslims. Instead, the university students under our investigation tended to act favorably, or at the very least, fairly toward Muslims. We expect that this lesson report can demonstrate how a postgraduate course can be conducted in an innovative way, empowering students to collect primary data and finishing a small scientific project during the span of a semester. Dieser Bericht stellt die Prozesse und Ergebnisse einer experimentellen Studie eines Postgraduierten-Kurses der Universität Greifswald dar. Wir zeigen, wie Studierende das Thema Migration innovativ untersuchen können, indem sie neben theoretischen Lerninhalten an experimentelle Methoden sowie die Primärforschung herangeführt werden. Anhand eines Diktatorspiels wurden die teilnehmenden Studenten angeleitet, ein in der Öffentlichkeit kontrovers debattiertes Thema wissenschaftlich zu untersuchen: Diskriminierende Tendenzen von Nicht-Muslimen gegenüber Muslimen. Die Ergebnisse dieser Studie lassen jedoch nicht auf diskriminierende Tendenzen der Studenten schließen. Stattdessen deuten sie darauf hin, dass sich die Studierenden zumindest fair gegenüber Muslimen verhalten.

  6. Pine Gene Discovery Project - Final Report - 08/31/1997 - 02/28/2001; FINAL

    International Nuclear Information System (INIS)

    Whetten, R. W.; Sederoff, R. R.; Kinlaw, C.; Retzel, E.

    2001-01-01

    Integration of pines into the large scope of plant biology research depends on study of pines in parallel with study of annual plants, and on availability of research materials from pine to plant biologists interested in comparing pine with annual plant systems. The objectives of the Pine Gene Discovery Project were to obtain 10,000 partial DNA sequences of genes expressed in loblolly pine, to determine which of those pine genes were similar to known genes from other organisms, and to make the DNA sequences and isolated pine genes available to plant researchers to stimulate integration of pines into the wider scope of plant biology research. Those objectives have been completed, and the results are available to the public. Requests for pine genes have been received from a number of laboratories that would otherwise not have included pine in their research, indicating that progress is being made toward the goal of integrating pine research into the larger molecular biology research community

  7. Lung cancer gene expression database analysis incorporating prior knowledge with support vector machine-based classification method

    Directory of Open Access Journals (Sweden)

    Huang Desheng

    2009-07-01

    Full Text Available Abstract Background A reliable and precise classification is essential for successful diagnosis and treatment of cancer. Gene expression microarrays have provided the high-throughput platform to discover genomic biomarkers for cancer diagnosis and prognosis. Rational use of the available bioinformation can not only effectively remove or suppress noise in gene chips, but also avoid one-sided results of separate experiment. However, only some studies have been aware of the importance of prior information in cancer classification. Methods Together with the application of support vector machine as the discriminant approach, we proposed one modified method that incorporated prior knowledge into cancer classification based on gene expression data to improve accuracy. A public well-known dataset, Malignant pleural mesothelioma and lung adenocarcinoma gene expression database, was used in this study. Prior knowledge is viewed here as a means of directing the classifier using known lung adenocarcinoma related genes. The procedures were performed by software R 2.80. Results The modified method performed better after incorporating prior knowledge. Accuracy of the modified method improved from 98.86% to 100% in training set and from 98.51% to 99.06% in test set. The standard deviations of the modified method decreased from 0.26% to 0 in training set and from 3.04% to 2.10% in test set. Conclusion The method that incorporates prior knowledge into discriminant analysis could effectively improve the capacity and reduce the impact of noise. This idea may have good future not only in practice but also in methodology.

  8. Downstream reporter gene imaging for signal transduction pathway of dopamine type 2 receptor

    International Nuclear Information System (INIS)

    Le, Uyenchi N.; Min, Jung Joon; Moon, Sung Min; Bom, Hee Seung

    2004-01-01

    The Dopamine 2 receptor (D2R) signal pathway regulates gene expression by phosphorylation of proteins including cAMP reponse element-binding protein (CREB), a transcription factor. In this study, we developed a reporter strategy using the GAL4 fusion CREB to assess the phosphorylation of CREB, one of the targets of the D2R signal transduction pathway. We used three plasmids: GAL4 fusion transactivator (pCMV-CREB), firefly luciferase reporter with GAL4 binding sites (pG5-FLUC), and D2R plasmid (pCMV-D2R). Group 1 293T cells were transiently transfected with pCMV-CREB and pG5-FLUC, and group 2 cells were transfected with all three plasmids. Transfected cells were stimulated with different concentrations of dopamine (0-200 M). For animal studies, group 1 and 2 cells (1x10 6 ) were subcutaneously injected on the left and right thigh of six nude mice, respectively. Dopamine stimiulation was performed with intraperitoneal injection of L-DOPA incombination with carbidopa, a peripheral DOPA decarboxylase inhibitor. Bioluminescence optical imaging studies were performed before and after L-DOPA injection. In cell culture studies, group 1 cells showed strong luciferase activity which implies direct activation of the signaling pathway due to growth factors contained in culture medium. Group 2 cells showed strong luciferase activity and a further increase after administration of dopamine. In animal studies, group 1 and 2 cells showed bioluminescence signal before L-DOPA injection, but signal from group 2 cells significantly increased 12 h after L-DOPA injection. The signal from group 1 cells disappeared thereafter, but group 2 cells continued to show signal until 36 h of L-DOPA injection. This study demonstrates imaging of the D2R signal transduction pathway and should be useful for noninvasive imaging of downstream effects of G-coupled protein pathways

  9. Convergence of spectral methods for nonlinear conservation laws. Final report

    International Nuclear Information System (INIS)

    Tadmor, E.

    1987-08-01

    The convergence of the Fourier method for scalar nonlinear conservation laws which exhibit spontaneous shock discontinuities is discussed. Numerical tests indicate that the convergence may (and in fact in some cases must) fail, with or without post-processing of the numerical solution. Instead, a new kind of spectrally accurate vanishing viscosity is introduced to augment the Fourier approximation of such nonlinear conservation laws. Using compensated compactness arguments, it is shown that this spectral viscosity prevents oscillations, and convergence to the unique entropy solution follows

  10. Polarizing matter and antimatter: A new method. Final report

    International Nuclear Information System (INIS)

    Onel, Y.

    1994-12-01

    Several years ago a self-polarization effect for stored (anti-)protons and ions was investigated theoretically. The effect is based on the well-known Stern-Gerlach effect in gradient fields. The aim of the ongoing measurements at the Indiana University Cyclotron Facility (IUCF) is to verify experimentally the various assumptions on which this effect is based. The final goal is to demonstrate this new polarization effect. The proposed effect could be a powerful tool to produce polarized stored hadron beams both in the low-energy range and at SSC and LHC energies. In this progress report the authors will describe the progress in three parts: (A) experimental work at IUCF Cooler Ring; (B) the extensive computer simulations of the spin stability for the IUCF Cooler Ring; and (C) theoretical studies

  11. Evolution of Self-Reporting Methods for Identifying Discrete Emotions in Science Classrooms

    Science.gov (United States)

    Ritchie, Stephen M.; Hudson, Peter; Bellocchi, Alberto; Henderson, Senka; King, Donna; Tobin, Kenneth

    2016-01-01

    Emotion researchers have grappled with challenging methodological issues in capturing emotions of participants in naturalistic settings such as school or university classrooms. Self-reporting methods have been used frequently, yet these methods are inadequate when used alone. We argue that the self-reporting methods of emotion diaries and…

  12. Development of method quantitative content of dihydroquercetin. Report 1

    Directory of Open Access Journals (Sweden)

    Олександр Юрійович Владимиров

    2016-01-01

    Full Text Available Today is markedly increasing scientific interest in the study of flavonoids in plant objects due to their high biological activity. In this regard, the urgent task of analytical chemistry is in developing available analytical techniques of determination for flavonoids in plant objects.Aim. The aim was to develop specific techniques of quantitative determination for dihydroquercetin and determination of its validation characteristics.Methods. The technique for photocolorimetric quantification of DQW, which was based on the specific reaction of cyanidine chloride formation when added zinc powder to dihydroquercetin solution in an acidic medium has been elaborated.Results. Photocolorimetric technique of determining flavonoids recalculating on DQW has been developed, its basic validation characteristics have been determined. The obtained metrological characteristics of photocolorimetric technique for determining DQW did not exceed admissibility criteria in accordance with the requirements of the State Pharmacopoeia of Ukraine.Conclusions. By the results of statistical analysis of experimental data, it has been stated that the developed technique can be used for quantification of DQW. Metrological data obtained indicate that the method reproduced in conditions of two different laboratories with confidence probability 95 % unit value deviation was 101,85±2,54 %

  13. The experimental study of reporter probe 131I-FIAU in neonatal cardiac myocytes after transfer of herpes simplex virus type 1 thymidine kinase reporter gene by different vectors

    International Nuclear Information System (INIS)

    Yin Xiaohua; Lan Xiaoli; Wang Ruihua; Liu Ying; Zhang Yongxue

    2009-01-01

    Objective: Reporter gene imaging is a promising approach for noninvasive monitoring of cardiac gene therapy. In the present study, the recombinant plasmid and adenoviral vector carrying reporter gene. herpes simplex virus type 1 thymidine kinase (HSV1-tk), were constructed and transferred into nee-natal cardiac myocytes, and a series of in vitro studies were carried out on the cells transferred to evaluate the uptake of radiolabeled reporter probe and to compare both vectors for cardiac reporter gene imaging. Methods: Neonatal cardiac myocytes were obtained from rat heart by single collagenase digestion. HSVI-tk. chosen as the reporter gene.was inserted into adenovirus vector (Ad5-tk) and plasmid (pDC316-tk), thus it could be transferred into neonatal cardiac myocytes. Recombinant adenovirus containing enhanced green fluorescent protein (Ad5-EGFP) was used as control. Recombinant plasmid was coated with lipofectamine TM 2000 (pDC316-tk/lipoplex). The specific reporter probe of HSV1-tk, 2'-fluoro-2'-deoxy-l-β-D-arabinofuranosyl-uracil (FAU), was labeled with 131 I by solid phase oxidation with lodogen. Product wag purified on a reverse. phase Sep-Pak C18 column and the radiochemical purity wag then assessed. The accumulation of it in the transferred cardiac myocytes wag detected as uptake rate. Furthermore, mRNA expression of HSV1-tk was detected by semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR), while its protein expression wag located by immunocytochemistry. Results: FAU could be labeled with 131 I and the labeling efficiency was (53.82 ±2.05)%. The radiochemical purity was (94.85 ± 1.76)% after purification, and it kept stable in vitro for at least 24h. Time-dependent increase of the ac- cumulation of 131 I-FIAU was observed in both Ad5-tk group and pDC316-tk/lipoplex group. and the highest uptake rate occurred at 5h, with peak values of (12.55 ± 0.37)% and (2.09 ± 0.34)% respectively. However, it also indicated that greater

  14. Mixed Methods Analysis of Medical Error Event Reports: A Report from the ASIPS Collaborative

    National Research Council Canada - National Science Library

    Harris, Daniel M; Westfall, John M; Fernald, Douglas H; Duclos, Christine W; West, David R; Niebauer, Linda; Marr, Linda; Quintela, Javan; Main, Deborah S

    2005-01-01

    The Applied Strategies for Improving Patient Safety (ASIPS) collaborative developed an ambulatory primary care patient safety reporting system through an Agency for Healthcare Research and Quality (AHRQ...

  15. Cost comparison between Subterrene and current tunneling methods. Final report

    International Nuclear Information System (INIS)

    Bledsoe, J.D.; Hill, J.E.; Coon, R.F.

    1975-05-01

    A study was made to compare tunnel construction costs between the Subterrene tunneling system and methods currently in use. Three completed tunnels were selected for study cases to represent finished diameters ranging from 3.05 meters (10 feet) to 6.25 meters (20.5 feet). The study cases were normalized by deleting extraneous work and assigning labor, equipment, and materials costs for the Southern California area in 1974. Detailed cost estimates (shown in Appendix A) were then made for the three tunnels for baseline. A conceptual nuclear powered Subterrene tunneling machine (NSTM) was designed. It was assumed that NSTM's were available for each of the three baseline tunnels. Costs were estimated (shown in Appendix B) for the baseline tunnels driven by NSTM

  16. Heterologous expression of mannanase and developing a new Reporter gene system in Lactobacillus casei and Escherichia coli

    DEFF Research Database (Denmark)

    Lin, Jinzhong; Zou, Yexia; Ma, Chengjie

    2015-01-01

    Reporter gene systems are useful for studying bacterial molecular biology, including the regulation of gene expression and the histochemical analysis of protein products. Here, two genes, β-1,4-mannanase (manB) from Bacillus pumilus and β-glucuronidase (gusA) from Escherichia coli K12, were clone....... casei and E.coli....

  17. Gene probes : principles and protocols [Methods in molecular biology, v. 179

    National Research Council Canada - National Science Library

    Rapley, Ralph; Aquino de Muro, Marilena

    2002-01-01

    "Senior scientists Marilena Aquino de Muro and Ralph Rapley have brought together an outstanding collection of time-tested protocols for designing and using genes probes in a wide variety of applications...

  18. An efficient parallel stochastic simulation method for analysis of nonviral gene delivery systems

    KAUST Repository

    Kuwahara, Hiroyuki; Gao, Xin

    2011-01-01

    DNA molecules into the nucleus of target cells. Several computational and experimental studies have shown that the design process of synthetic gene transfer vectors can be greatly enhanced by computational modeling and simulation. This paper proposes a

  19. Gene probes : principles and protocols [Methods in molecular biology, v. 179

    National Research Council Canada - National Science Library

    Rapley, Ralph; Aquino de Muro, Marilena

    2002-01-01

    .... The applications covered range from searching for specific genes in the human chromosome to the detection of microorganisms and their toxins in the environment and in food samples, as well as in the...

  20. EasyClone: method for iterative chromosomal integration of multiple genes in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Jensen, Niels Bjerg; Strucko, Tomas; Kildegaard, Kanchana Rueksomtawin

    2014-01-01

    of multiple genes with an option of recycling selection markers. The vectors combine the advantage of efficient uracil excision reaction-based cloning and Cre-LoxP-mediated marker recycling system. The episomal and integrative vector sets were tested by inserting genes encoding cyan, yellow, and red...... fluorescent proteins into separate vectors and analyzing for co-expression of proteins by flow cytometry. Cells expressing genes encoding for the three fluorescent proteins from three integrations exhibited a much higher level of simultaneous expression than cells producing fluorescent proteins encoded...... on episomal plasmids, where correspondingly 95% and 6% of the cells were within a fluorescence interval of Log10 mean ± 15% for all three colors. We demonstrate that selective markers can be simultaneously removed using Cre-mediated recombination and all the integrated heterologous genes remain...

  1. [Advance in the methods of preimplantation genetic diagnosis for single gene diseases].

    Science.gov (United States)

    Ren, Yixin; Qiao, Jie; Yan, Liying

    2017-06-10

    More than 7000 single gene diseases have been identified and most of them lack effective treatment. As an early form of prenatal diagnosis, preimplantation genetic diagnosis (PGD) is a combination of in vitro fertilization and genetic diagnosis. PGD has been applied in clinics for more than 20 years to avoid the transmission of genetic defects through analysis of embryos at early stages of development. In this paper, a review for the recent advances in PGD for single gene diseases is provided.

  2. Identification of the first large deletion in the CLDN16 gene in a patient with FHHNC and late-onset of chronic kidney disease: case report.

    Science.gov (United States)

    Yamaguti, Paulo Marcio; dos Santos, Pollyanna Almeida Costa; Leal, Bruno Sakamoto; Santana, Viviane Brandão Bandeira de Mello; Mazzeu, Juliana Forte; Acevedo, Ana Carolina; Neves, Francisco de Assis Rocha

    2015-07-02

    Familial hypomagnesemia with hypercalciuria and nephrocalcinosis is a rare autosomal recessive renal disease characterized by tubular disorders at the thick ascending limb of Henle's loop. It is caused by mutations in the tight junction structural proteins claudin-16 or claudin-19, which are encoded by the CLDN16 and CLDN19 genes, respectively. Patients exhibit excessive wasting of calcium and magnesium, nephrocalcinosis, chronic kidney disease, and early progression to end-stage renal failure during infancy. We here report the phenotype and molecular analysis of a female Brazilian patient with a novel large homozygous deletion in the CLDN16 gene. The proband, born from consanguineous parents, presented the first symptoms at age 20. Clinical examination revealed hypocalcemia, hypomagnesemia, nephrocalcinosis, mild myopia, high serum levels of uric acid and intact parathyroid hormone, and moderate chronic kidney disease (stage 3). She and her mother were subjected to CLDN16 and CLDN19 mutational analysis. In addition, the multiplex ligation-dependent probe amplification method was used to confirm a CLDN16 multi-exon deletion. Direct sequencing revealed a normal CLDN19 sequence and suggested a large deletion in the CLDN16 gene. Multiplex ligation-dependent probe amplification showed a homozygous CLDN16 multi-exon deletion (E2_E5del). The patient initiated conventional treatment for familial hypomagnesemia with hypercalciuria and nephrocalcinosis and progressed to end-stage kidney disease after five years. This study provides the first report of a large homozygous deletion in the CLDN16 gene causing familial hypomagnesemia with hypercalciuria and nephrocalcinosis with late onset of the first symptoms. This description expands the phenotypic and genotypic characterization of the disease. The late-onset chronic kidney disease in the presence of a homozygous deletion in the CLDN16 gene reinforces the great variability of genotype-phenotype manifestation in patients with

  3. Fluorescence reporter gene platform applicable for the detection and quantification of horizontal gene transfer in anoxic environments

    DEFF Research Database (Denmark)

    Pinilla Redondo, Rafael

    of the impact the pH has on their fluorescence intensities. Validation of the dual-labelling system for the study of HGT in anoxic milieus. Methods: The time-course fluorescent recovery of mCherry and GFPmut3 in vivo, as well as the effect of the extracellular pH on fluorescence was monitored through flow......Cherry is limited by environmental constraints that affect the correct maturation of their fluorophores, such as oxygen availability and pH levels. Few studies have focused on elucidating their impact, and the sheer amount of distinct protein variants requires each system to be examined in an individual fashion....... The wealth of ecologically and clinically relevant oxygen-deprived micro-habitats in which bacteria thrive, calls for the urgent development of suitable tools that permit their study. Objectives: Development of an aerobic fluorescence recovery method for mCherry and GFPmut3, as well as characterisation...

  4. Method to produce acetyldiacylglycerols (ac-TAGs) by expression of an acetyltransferase gene isolated from Euonymus alatus (burning bush)

    Energy Technology Data Exchange (ETDEWEB)

    Durrett, Timothy; Ohlrogge, John; Pollard, Michael

    2016-05-03

    The present invention relates to novel diacylglycerol acyltransferase genes and proteins, and methods of their use. In particular, the invention describes genes encoding proteins having diacylglycerol acetyltransferase activity, specifically for transferring an acetyl group to a diacylglycerol substrate to form acetyl-Triacylglycerols (ac-TAGS), for example, a 3-acetyl-1,2-diacyl-sn-glycerol. The present invention encompasses both native and recombinant wild-type forms of the transferase, as well as mutants and variant forms. The present invention also relates to methods of using novel diacylglycerol acyltransferase genes and proteins, including their expression in transgenic organisms at commercially viable levels, for increasing production of 3-acetyl-1,2-diacyl-sn-glycerols in plant oils and altering the composition of oils produced by microorganisms, such as yeast, by increasing ac-TAG production. Additionally, oils produced by methods of the present inventions comprising genes and proteins are contemplated for use as biodiesel fuel, in polymer production and as naturally produced food oils with reduced calories.

  5. Logic Learning Machine and standard supervised methods for Hodgkin's lymphoma prognosis using gene expression data and clinical variables.

    Science.gov (United States)

    Parodi, Stefano; Manneschi, Chiara; Verda, Damiano; Ferrari, Enrico; Muselli, Marco

    2018-03-01

    This study evaluates the performance of a set of machine learning techniques in predicting the prognosis of Hodgkin's lymphoma using clinical factors and gene expression data. Analysed samples from 130 Hodgkin's lymphoma patients included a small set of clinical variables and more than 54,000 gene features. Machine learning classifiers included three black-box algorithms ( k-nearest neighbour, Artificial Neural Network, and Support Vector Machine) and two methods based on intelligible rules (Decision Tree and the innovative Logic Learning Machine method). Support Vector Machine clearly outperformed any of the other methods. Among the two rule-based algorithms, Logic Learning Machine performed better and identified a set of simple intelligible rules based on a combination of clinical variables and gene expressions. Decision Tree identified a non-coding gene ( XIST) involved in the early phases of X chromosome inactivation that was overexpressed in females and in non-relapsed patients. XIST expression might be responsible for the better prognosis of female Hodgkin's lymphoma patients.

  6. Complicated distal femoral epiphyseolysis treated by Ilizarov method: Case report

    Directory of Open Access Journals (Sweden)

    Jovanović Vesna

    2010-01-01

    Full Text Available Introduction Injuries of the distal femur are rare in children; however, they are frequently associated with complications. They are almost always physeal, most frequently Salter-Harris type II epiphyseolysis. The treatment of such injuries is similar in all physeal injuries. It is intended to provide growth plate recovery by gentle reduction and stable fixation thus preventing secondary complications, and also to provide decompression of the segment to solve the compartment syndrome and recover the neurovascular structures. Case Outline A seven-year old boy presented with a right knee injury while sleigh riding. He was admitted three weeks following the injury with distal femoral epiphysiolysis associated with peroneal palsy. A day after admission to our Institute the reduction was performed using the Ilizarov device. Physical therapy was started immediately after surgery, as well as walking with weight bearing on the operated leg. Five months after surgery the patient was anatomically and functionally recovered. Conclusion The presented method is recommended in the treatment of such injuries because of several reasons; reposition is simple and complete, there is no need to open the fracture site, fixation is stable, the growth plate is preserved, there is no need for additional external immobilisation, and physical therapy involving walking with weight bearing on the operated leg may be started immediately after surgery. .

  7. Feature genes in metastatic breast cancer identified by MetaDE and SVM classifier methods.

    Science.gov (United States)

    Tuo, Youlin; An, Ning; Zhang, Ming

    2018-03-01

    The aim of the present study was to investigate the feature genes in metastatic breast cancer samples. A total of 5 expression profiles of metastatic breast cancer samples were downloaded from the Gene Expression Omnibus database, which were then analyzed using the MetaQC and MetaDE packages in R language. The feature genes between metastasis and non‑metastasis samples were screened under the threshold of PSVM) classifier training and verification. The accuracy of the SVM classifier was then evaluated using another independent dataset from The Cancer Genome Atlas database. Finally, function and pathway enrichment analyses for genes in the SVM classifier were performed. A total of 541 feature genes were identified between metastatic and non‑metastatic samples. The top 10 genes with the highest betweenness centrality values in the PPI network of feature genes were Nuclear RNA Export Factor 1, cyclin‑dependent kinase 2 (CDK2), myelocytomatosis proto‑oncogene protein (MYC), Cullin 5, SHC Adaptor Protein 1, Clathrin heavy chain, Nucleolin, WD repeat domain 1, proteasome 26S subunit non‑ATPase 2 and telomeric repeat binding factor 2. The cyclin‑dependent kinase inhibitor 1A (CDKN1A), E2F transcription factor 1 (E2F1), and MYC interacted with CDK2. The SVM classifier constructed by the top 30 feature genes was able to distinguish metastatic samples from non‑metastatic samples [correct rate, specificity, positive predictive value and negative predictive value >0.89; sensitivity >0.84; area under the receiver operating characteristic curve (AUROC) >0.96]. The verification of the SVM classifier in an independent dataset (35 metastatic samples and 143 non‑metastatic samples) revealed an accuracy of 94.38% and AUROC of 0.958. Cell cycle associated functions and pathways were the most significant terms of the 30 feature genes. A SVM classifier was constructed to assess the possibility of breast cancer metastasis, which presented high accuracy in several

  8. Brugada syndrome with a novel missense mutation in SCN5A gene: A case report from Bangladesh

    Directory of Open Access Journals (Sweden)

    Md. Zahidus Sayeed

    2014-01-01

    Full Text Available Brugada syndrome is an inherited cardiac arrhythmia that follows autosomal dominant transmission and can cause sudden death. We report a case of Brugada syndrome in a 55-year-old male patient presented with recurrent palpitation, atypical chest pain and presyncope. ECG changes were consistent with type 1 Brugada. Gene analysis revealed a novel missense mutation in SCN5A gene with a genetic variation of D785N and a nucleotide change at 2353G-A. One of his children also had the same mutation. To our knowledge this is the first genetically proved case of Brugada syndrome in Bangladesh.

  9. A rapid and effective method for screening, sequencing and reporter verification of engineered frameshift mutations in zebrafish

    Directory of Open Access Journals (Sweden)

    Sergey V. Prykhozhij

    2017-06-01

    Full Text Available Clustered regularly interspaced palindromic repeats (CRISPR/Cas-based adaptive immunity against pathogens in bacteria has been adapted for genome editing and applied in zebrafish (Danio rerio to generate frameshift mutations in protein-coding genes. Although there are methods to detect, quantify and sequence CRISPR/Cas9-induced mutations, identifying mutations in F1 heterozygous fish remains challenging. Additionally, sequencing a mutation and assuming that it causes a frameshift does not prove causality because of possible alternative translation start sites and potential effects of mutations on splicing. This problem is compounded by the relatively few antibodies available for zebrafish proteins, limiting validation at the protein level. To address these issues, we developed a detailed protocol to screen F1 mutation carriers, and clone and sequence identified mutations. In order to verify that mutations actually cause frameshifts, we created a fluorescent reporter system that can detect frameshift efficiency based on the cloning of wild-type and mutant cDNA fragments and their expression levels. As proof of principle, we applied this strategy to three CRISPR/Cas9-induced mutations in pycr1a, chd7 and hace1 genes. An insertion of seven nucleotides in pycr1a resulted in the first reported observation of exon skipping by CRISPR/Cas9-induced mutations in zebrafish. However, of these three mutant genes, the fluorescent reporter revealed effective frameshifting exclusively in the case of a two-nucleotide deletion in chd7, suggesting activity of alternative translation sites in the other two mutants even though pycr1a exon-skipping deletion is likely to be deleterious. This article provides a protocol for characterizing frameshift mutations in zebrafish, and highlights the importance of checking mutations at the mRNA level and verifying their effects on translation by fluorescent reporters when antibody detection of protein loss is not possible.

  10. Research on stochastic power-flow study methods. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Heydt, G. T. [ed.

    1981-01-01

    A general algorithm to determine the effects of uncertainty in bus load and generation on the output of conventional power flow analysis is presented. The use of statistical moments is presented and developed as a means for representing the stochastic process. Statistical moments are used to describe the uncertainties, and facilitate the calculations of single and multivarlate probability density functions of input and output variables. The transformation of the uncertainty through the power flow equations is made by the expansion of the node equations in a multivariate Taylor series about an expected operating point. The series is truncated after the second order terms. Since the power flow equations are nonlinear, the expected values of output quantities is in general not the solution to the conventional load flow problem using expected values of input quantities. The second order transformation offers a correction vector and allows the consideration of larger uncertainties which have caused significant error in the current linear transformation algorithms. Voltage controlled busses are included with consideration of upper and lower limits. The finite reactive power available at generation sites, and fixed ranges of transformer tap movement may have a significant effect on voltage and line power flow statistics. A method is given which considers limitation constraints in the evaluation of all output quantities. The bus voltages, line power flows, transformer taps, and generator reactive power requirements are described by their statistical moments. Their values are expressed in terms of the probability that they are above or below specified limits, and their expected values given that they do fall outside the limits. Thus the algorithm supplies information about severity of overload as well as probability of occurrence. An example is given for an eleven bus system, evaluating each quantity separately. The results are compared with Monte Carlo simulation.

  11. Discovering genes underlying QTL

    Energy Technology Data Exchange (ETDEWEB)

    Vanavichit, Apichart [Kasetsart University, Kamphaengsaen, Nakorn Pathom (Thailand)

    2002-02-01

    A map-based approach has allowed scientists to discover few genes at a time. In addition, the reproductive barrier between cultivated rice and wild relatives has prevented us from utilizing the germ plasm by a map-based approach. Most genetic traits important to agriculture or human diseases are manifested as observable, quantitative phenotypes called Quantitative Trait Loci (QTL). In many instances, the complexity of the phenotype/genotype interaction and the general lack of clearly identifiable gene products render the direct molecular cloning approach ineffective, thus additional strategies like genome mapping are required to identify the QTL in question. Genome mapping requires no prior knowledge of the gene function, but utilizes statistical methods to identify the most likely gene location. To completely characterize genes of interest, the initially mapped region of a gene location will have to be narrowed down to a size that is suitable for cloning and sequencing. Strategies for gene identification within the critical region have to be applied after the sequencing of a potentially large clone or set of clones that contains this gene(s). Tremendous success of positional cloning has been shown for cloning many genes responsible for human diseases, including cystic fibrosis and muscular dystrophy as well as plant disease resistance genes. Genome and QTL mapping, positional cloning: the pre-genomics era, comparative approaches to gene identification, and positional cloning: the genomics era are discussed in the report. (M. Suetake)

  12. Novel radiosynthesis of PET HSV-tk gene reporter probes [18F]FHPG and [18F]FHBG employing dual Sep-Pak SPE techniques.

    Science.gov (United States)

    Wang, Ji-Quan; Zheng, Qi-Huang; Fei, Xiangshu; Mock, Bruce H; Hutchins, Gary D

    2003-11-17

    Positron emission tomography (PET) herpes simplex virus thymidine kinase (HSV-tk) gene reporter probes 9-[(3-[(18)F]fluoro-1-hydroxy-2-propoxy)methyl]guanine ([(18)F]FHPG) and 9-(4-[(18)F]fluoro-3-hydroxymethylbutyl)guanine ([(18)F]FHBG) were prepared by nucleophilic substitution of the appropriate tosylated precursors with [(18)F]KF/Kryptofix 2.2.2 followed by a quick deprotection reaction and purification with a simplified dual Silica Sep-Pak solid-phase extraction (SPE) method in 15-30% radiochemical yield.

  13. A trans-acting enhancer modulates estrogen-mediated transcription of reporter genes in osteoblasts.

    Science.gov (United States)

    Sasaki-Iwaoka, H; Maruyama, K; Endoh, H; Komori, T; Kato, S; Kawashima, H

    1999-02-01

    The presence of bone-specific estrogen agonists and discovery of the osteoblast-specific transcription factor (TF), Cbfa1, together with the discovery of synergism between a TF Pit-1 and estrogen receptor alpha (ERalpha) on rat prolactin gene, led to investigation of Cbfa1 in the modulation of osteoblast-specific actions of estrogen. Reverse transcribed-polymerase chain reaction demonstrated expression of Cbfa1 in the osteoblastic cell lines, MG63, ROS17/2.8, and MC3T3E1, but not in nonosteoblastic cell lines, MCF7, C3H10T1/2, and HeLa. An ER expression vector and a series of luciferase (Luc) reporter plasmids harboring the Cbfa1 binding site OSE2 (the osteoblast-specific cis element in the osteocalcin promoter) and palindromic estrogen response elements (EREs) were cotransfected into both osteoblastic and nonosteoblastic cells. OSE2 worked as a cis- acting element in osteoblastic cells but not nonosteoblastic cells, whereas EREs were cis- acting in all cell lines. Synergistic transactivation was observed in osteoblastic cells only when both ERE and OSE2 were placed in juxtaposition to the promoter. Forced expression of Cbfa1 in C3H10T1/2 cells also induced synergism. Tamoxifen, a partial agonist/antagonist of estrogen, acted as an osteoblast-specific agonist in cells transfected with a promoter containing ERE and acted synergistically with a promoter containing the ERE-OSE2 enhancer combination. These results support the idea that bone-specific TFs modulate the actions of estrogen in a tissue-specific manner.

  14. Report on emerging technologies for translational bioinformatics: a symposium on gene expression profiling for archival tissues

    Directory of Open Access Journals (Sweden)

    Waldron Levi

    2012-03-01

    Full Text Available Abstract Background With over 20 million formalin-fixed, paraffin-embedded (FFPE tissue samples archived each year in the United States alone, archival tissues remain a vast and under-utilized resource in the genomic study of cancer. Technologies have recently been introduced for whole-transcriptome amplification and microarray analysis of degraded mRNA fragments from FFPE samples, and studies of these platforms have only recently begun to enter the published literature. Results The Emerging Technologies for Translational Bioinformatics symposium on gene expression profiling for archival tissues featured presentations of two large-scale FFPE expression profiling studies (each involving over 1,000 samples, overviews of several smaller studies, and representatives from three leading companies in the field (Illumina, Affymetrix, and NuGEN. The meeting highlighted challenges in the analysis of expression data from archival tissues and strategies being developed to overcome them. In particular, speakers reported higher rates of clinical sample failure (from 10% to 70% than are typical for fresh-frozen tissues, as well as more frequent probe failure for individual samples. The symposium program is available at http://www.hsph.harvard.edu/ffpe. Conclusions Multiple solutions now exist for whole-genome expression profiling of FFPE tissues, including both microarray- and sequencing-based platforms. Several studies have reported their successful application, but substantial challenges and risks still exist. Symposium speakers presented novel methodology for analysis of FFPE expression data and suggestions for improving data recovery and quality assessment in pre-analytical stages. Research presentations emphasized the need for careful study design, including the use of pilot studies, replication, and randomization of samples among batches, as well as careful attention to data quality control. Regardless of any limitations in quantitave transcriptomics for

  15. Study on kinetic degradation in soil and horizontal transfer of bt gene by 35S isotopic tracing method

    International Nuclear Information System (INIS)

    Wang Haiyan; Zhang Yanfei; Ye Qingfu

    2012-01-01

    In this study, 35 S isotopic tracing method was applied to investigate kinetic degradation of bt gene from Bt transgenic rice TT51 in two different soil and possibility of its horizontal transfer into soil bacteria as well. Results showed that, during 30 d of aerobic incubation, it was indicated that 35 S-Bt gene was not horizontally transferred into soil microorganisms. The aerobic soil degradation dynamics significantly followed a first-order dissipation pattern for bt gene. After 30 d of incubation, the amount of bt gene reached 9.32% of applied radioactivity for the fluvio-marine yellow loamy soil and 9.92% for the fluvio-aquatic soil, respectively. The half-lives in two soils were 3.53 d for the former soil and 5. 77 d for the latter soil, which means that bt gene was more easily degradable in the weak acidic soil. The use of 35 S labeling proved to be valuable; it served the purpose of validating the rigorousness of experimental protocols, and provided insights into the soil environmental safety assessment for Bt transgenic rice. (authors)

  16. LDRD Final Report: Adaptive Methods for Laser Plasma Simulation

    International Nuclear Information System (INIS)

    Dorr, M R; Garaizar, F X; Hittinger, J A

    2003-01-01

    The goal of this project was to investigate the utility of parallel adaptive mesh refinement (AMR) in the simulation of laser plasma interaction (LPI). The scope of work included the development of new numerical methods and parallel implementation strategies. The primary deliverables were (1) parallel adaptive algorithms to solve a system of equations combining plasma fluid and light propagation models, (2) a research code implementing these algorithms, and (3) an analysis of the performance of parallel AMR on LPI problems. The project accomplished these objectives. New algorithms were developed for the solution of a system of equations describing LPI. These algorithms were implemented in a new research code named ALPS (Adaptive Laser Plasma Simulator) that was used to test the effectiveness of the AMR algorithms on the Laboratory's large-scale computer platforms. The details of the algorithm and the results of the numerical tests were documented in an article published in the Journal of Computational Physics [2]. A principal conclusion of this investigation is that AMR is most effective for LPI systems that are ''hydrodynamically large'', i.e., problems requiring the simulation of a large plasma volume relative to the volume occupied by the laser light. Since the plasma-only regions require less resolution than the laser light, AMR enables the use of efficient meshes for such problems. In contrast, AMR is less effective for, say, a single highly filamented beam propagating through a phase plate, since the resulting speckle pattern may be too dense to adequately separate scales with a locally refined mesh. Ultimately, the gain to be expected from the use of AMR is highly problem-dependent. One class of problems investigated in this project involved a pair of laser beams crossing in a plasma flow. Under certain conditions, energy can be transferred from one beam to the other via a resonant interaction with an ion acoustic wave in the crossing region. AMR provides an

  17. Final Report of the Project "From the finite element method to the virtual element method"

    Energy Technology Data Exchange (ETDEWEB)

    Manzini, Gianmarco [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Gyrya, Vitaliy [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-12-20

    The Finite Element Method (FEM) is a powerful numerical tool that is being used in a large number of engineering applications. The FEM is constructed on triangular/tetrahedral and quadrilateral/hexahedral meshes. Extending the FEM to general polygonal/polyhedral meshes in straightforward way turns out to be extremely difficult and leads to very complex and computationally expensive schemes. The reason for this failure is that the construction of the basis functions on elements with a very general shape is a non-trivial and complex task. In this project we developed a new family of numerical methods, dubbed the Virtual Element Method (VEM) for the numerical approximation of partial differential equations (PDE) of elliptic type suitable to polygonal and polyhedral unstructured meshes. We successfully formulated, implemented and tested these methods and studied both theoretically and numerically their stability, robustness and accuracy for diffusion problems, convection-reaction-diffusion problems, the Stokes equations and the biharmonic equations.

  18. Mutation analysis of the phenylalanine hydroxylase gene in Azerbaijani population, a report from West Azerbaijan province of Iran

    Directory of Open Access Journals (Sweden)

    Morteza Bagheri

    2015-07-01

    Full Text Available Objective(s:Phenylketonuria (PKU is a genetic inborn error of phenylalanine (Phe metabolism resulting from insufficiency in the hepatic enzyme, phenylalanine hydroxylase (PAH, which leads to elevated levels of Phe in the blood. The present study was carried out for mutation analysis of the PAH gene in West Azerbaijan province of Iran. Materials and Methods:A total of 218 alleles from 40 PKU families were studied using restriction fragment length polymorphism-polymerase chain reaction (RFLP-PCR method. Results:The frequencies of IVS10-11, S67P, R261Q, R252W, IVS11nt-1 g>c, R408Q, and Q232Q mutations were 28(35, 17(21.25, 15(18.75, 3(3.75, 3(3.75, 2(2.5, and 1(1.25, in cases group, and 51(23.4, 31(14.2, 27(12.4, 6(2.75, 6(2.75, 4(1.83, and 2(0.92 in total group, respectively. The mutations of R243Q, 364delG, L333F, 261X, I65T, and R408W were not detected in our samples. Conclusion: It can be concluded that the IVS10-11 mutation has the highest frequency in the tested population. To our knowledge, this report is the first in its own kind and provides better understanding of the genetic heterogeneity, the origin and distributions of PAH mutations in West Azerbaijan province of Iran.

  19. Pitt-Hopkins syndrome: report of a case with a TCF4 gene mutation

    Directory of Open Access Journals (Sweden)

    Orsini Alessandro

    2010-02-01

    Full Text Available Abstract Aims We will discuss the clinical and genetic diagnosis of a child with severe psychomotor delay, who at 3 years of age presented with paroxysms of hyperpnea-apnea and seizures unrelated to breathing anomalies. Methods The child underwent genetic (karyotype, FISH telomeres and neuroradiological (cranial CT and MRI tests, which proved to be normal. He came under our clinical observation at 3 years and 5 months of age. Due to severe psychomotor delay and facial dysmorphisms we completed the genetic investigations based on his clinical feature and analysis of the available literature. Results The presence of severe mental retardation associated with anomalous breathing pattern may suggest the Joubert and Rett syndrome, however these were excluded on the basis of clinical and genetic examination. Angelman syndrome, suspected for facial dysmorphisms and absent language, was also excluded because of the presence of a normal pattern of methylation at SNRPN locus. Another possible diagnosis was the Pitt-Hopkins Syndrome (PHS, characterized by severe mental retardation, breathing anomalies (paroxisms of hyperpnea-apnea, dysmorphisms and sometimes epilepsy. Haploinsufficiency of TCF4 gene located at 18q21.2 region has been recently identified as causative of this syndrome. In our patient the research of TCF4 mutation by the Institute of Human Genetics, University Hospital Erlangen (Germany, showed a de novo mutation. Conclusions The diagnosis of Pitt-Hopkins syndrome, an underdiagnosed cause of mental retardation, was based on clinical and genetic findings. Searching for TCF4 mutations is highly recommended when others overlapping syndromes was excluded. At our knowledge our patient is the first italian case of PHS diagnosed at molecular level.

  20. Fiscal 1999 technical research report. Research and development project on prompt-effect international standards creation (Standardization of gene amplification and analysis methods for genetic screening); 1999 nendo shinki sangyo ikusei sokkogata kokusai hyojunka kaihatsu jigyo seika hokokusho. Idenshi kensayo idenshi zofuku kaiseki hoho no hyojunka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    For the promotion of Japan's proposition for international standardization, PCR (polymerase chain reaction) Comprehensive Research Committee, Technical Promotion Committee, and Japan Bioindustry Association organized a 5-member overseas research team and dispatched the team to Europe and America where they held research interviews at government organizations and business corporations engaged in standardization promotion. The aims were to disclose trends of PCR method standardization and standardization in general in biotechnology. The team visited British Standards Institution, Association Francaise de Normalisation, German Institute for Standardization, Food and Drug Administration of America, American Society for Testing and Materials, PE Biosystem, Bio-Rad Laboratories, and Roche Molecular Systems. The objects of standardization at issue included techniques, tools, devices, and reagents to be used. It is found that in Europe and America there are standardization plans under deliberation for PCR-aided techniques, not for PCR itself, and that some are now approaching completion as national or local standards. It is also learned that in every standardizing organization there is a person responsible for each TC (technical committee) of CEN (Committee European pour Normalisation). (NEDO)

  1. Fiscal 1999 technical research report. Research and development project on prompt-effect international standards creation (Standardization of gene amplification and analysis methods for genetic screening); 1999 nendo shinki sangyo ikusei sokkogata kokusai hyojunka kaihatsu jigyo seika hokokusho. Idenshi kensayo idenshi zofuku kaiseki hoho no hyojunka

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2000-03-01

    For the promotion of Japan's proposition for international standardization, PCR (polymerase chain reaction) Comprehensive Research Committee, Technical Promotion Committee, and Japan Bioindustry Association organized a 5-member overseas research team and dispatched the team to Europe and America where they held research interviews at government organizations and business corporations engaged in standardization promotion. The aims were to disclose trends of PCR method standardization and standardization in general in biotechnology. The team visited British Standards Institution, Association Francaise de Normalisation, German Institute for Standardization, Food and Drug Administration of America, American Society for Testing and Materials, PE Biosystem, Bio-Rad Laboratories, and Roche Molecular Systems. The objects of standardization at issue included techniques, tools, devices, and reagents to be used. It is found that in Europe and America there are standardization plans under deliberation for PCR-aided techniques, not for PCR itself, and that some are now approaching completion as national or local standards. It is also learned that in every standardizing organization there is a person responsible for each TC (technical committee) of CEN (Committee European pour Normalisation). (NEDO)

  2. Evaluation of RNA extraction methods in rice and their application in expression analysis of resistance genes against Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Parisa Azizi

    2017-01-01

    Full Text Available Extraction of RNA of high quality and integrity is essential for gene expression studies and all downstream RNA-based techniques. The leaves of 16 merit Malaysian rice varieties were used to isolate total RNA using five different methods. The quantity, quality and integrity of extracted RNA were confirmed using three different means. The ratios of A260/280 ranged from 2.12 to 2.20. Electrophoresis (1.5% agarose gel was performed, illustrating intact and sharp bands representing the 28S, 18S, 5.8S and 5S ribosomal subunits of RNA, presenting intact RNA. RNA quality was verified using semi-quantitative polymerase chain reaction (sqPCR. The objective of this study was to identify different genes involved in the resistance of rice plants using high-quality RNA extracted 31 h after inoculation of Magnaporthe oryzae pathotype P7.2. The expression levels of eight blast resistance genes, Pikh, Pib, Pita, Pi21, Pi9, Os11gRGA8, OsWRKY22 and OsWRKY45, were evaluated by real-time PCR (RT-PCR. Real-time PCR was performed to identify candidate genes using RNA extracted by the TRIzol method, which showed the highest score compared with other methods in terms of RNA quantity, purity and integrity. In addition, the results of real-time PCR confirmed that the up-regulation of seven blast resistance genes may confer stronger resistance for the MR 276 variety against M. oryzae pathotype P7.2.

  3. Identification of MYCN gene amplification in neuroblastoma using chromogenic in situ hybridization (CISH): an alternative and practical method.

    Science.gov (United States)

    Bhargava, Rohit; Oppenheimer, Orit; Gerald, William; Jhanwar, Suresh C; Chen, Beiyun

    2005-06-01

    Chromogenic in situ hybridization (CISH) is a recently developed technique, which utilizes the general principles of in situ hybridization and a detection system similar to immunohistochemistry. To assess the utility of CISH for analysis of MYCN gene amplification, we compared this assay with established diagnostic assays such as Southern blot analysis (SB) and fluorescent in situ hybridization (FISH). CISH was performed on 67 cases of neuroblastoma using tissue microarray (65 cases) and whole tissue sections (2 cases). Unequivocal, high-level amplification (> or =10 gene copies per tumor nucleus) was identified in 19 of 67 (28.4%) tumors. Two (3%) tumors showed low-level amplification (6-9 gene copies per tumor nucleus). No amplification was seen in 46 of 67 (68.6%) tumors. SB data were available in 44 tumors. Forty-one of the 44 tumors (93%) showed concordant results between CISH and SB. Three tumors showed MYCN amplification by CISH but no amplification by SB, most likely due to dilution effect of nonneoplastic tissue in the test samples. Two of these three tumors also showed MYCN amplification by FISH, and the third tumor was not analyzed by FISH. FISH data were available in total of 30 tumors. All 30 tumors showed concordant results between CISH and FISH for classifying a tumor as MYCN amplified or not amplified. We conclude that CISH is an accurate method for determining MYCN gene amplification, with added advantages that make it a more practically useful method.

  4. The construction and use of versatile binary vectors carrying pyrG auxotrophic marker and fluorescent reporter genes for Agrobacterium-mediated transformation of Aspergillus oryzae.

    Science.gov (United States)

    Nguyen, Khuyen Thi; Ho, Quynh Ngoc; Pham, Thu Ha; Phan, Tuan-Nghia; Tran, Van-Tuan

    2016-12-01

    Aspergillus oryzae is a safe mold widely used in food industry. It is also considered as a microbial cell factory for production of recombinant proteins and enzymes. Currently, genetic manipulation of filamentous fungi is achieved via Agrobacterium tumefaciens-mediated transformation methods usually employing antibiotic resistance markers. These methods are hardly usable for A. oryzae due to its strong resistance to the common antifungal compounds used for fungal transformation. In this study, we have constructed two binary vectors carrying the pyrG gene from A. oryzae as a biochemical marker than an antibiotic resistance marker, and an expression cassette for GFP or DsRed reporter gene under control of the constitutive gpdA promoter from Aspergillus nidulans. All components of these vectors are changeable to generate new versions for specific research purposes. The developed vectors are fully functional for heterologous expression of the GFP and DsRed fluorescent proteins in the uridine/uracil auxotrophic A. oryzae strain. Our study provides a new approach for A. oryzae transformation using pyrG as the selectable auxotrophic marker, A. tumefaciens as the DNA transfer tool and fungal spores as the transformation material. The binary vectors constructed can be used for gene expression studies in this industrially important filamentous fungus.

  5. A quantitative comparison of cell-type-specific microarray gene expression profiling methods in the mouse brain.

    Directory of Open Access Journals (Sweden)

    Benjamin W Okaty

    Full Text Available Expression profiling of restricted neural populations using microarrays can facilitate neuronal classification and provide insight into the molecular bases of cellular phenotypes. Due to the formidable heterogeneity of intermixed cell types that make up the brain, isolating cell types prior to microarray processing poses steep technical challenges that have been met in various ways. These methodological differences have the potential to distort cell-type-specific gene expression profiles insofar as they may insufficiently filter out contaminating mRNAs or induce aberrant cellular responses not normally present in vivo. Thus we have compared the repeatability, susceptibility to contamination from off-target cell-types, and evidence for stress-responsive gene expression of five different purification methods--Laser Capture Microdissection (LCM, Translating Ribosome Affinity Purification (TRAP, Immunopanning (PAN, Fluorescence Activated Cell Sorting (FACS, and manual sorting of fluorescently labeled cells (Manual. We found that all methods obtained comparably high levels of repeatability, however, data from LCM and TRAP showed significantly higher levels of contamination than the other methods. While PAN samples showed higher activation of apoptosis-related, stress-related and immediate early genes, samples from FACS and Manual studies, which also require dissociated cells, did not. Given that TRAP targets actively translated mRNAs, whereas other methods target all transcribed mRNAs, observed differences may also reflect translational regulation.

  6. On the Use of Gene Ontology Annotations to Assess Functional Similarity among Orthologs and Paralogs: A Short Report.

    Directory of Open Access Journals (Sweden)

    Paul D Thomas

    Full Text Available A recent paper (Nehrt et al., PLoS Comput. Biol. 7:e1002073, 2011 has proposed a metric for the "functional similarity" between two genes that uses only the Gene Ontology (GO annotations directly derived from published experimental results. Applying this metric, the authors concluded that paralogous genes within the mouse genome or the human genome are more functionally similar on average than orthologous genes between these genomes, an unexpected result with broad implications if true. We suggest, based on both theoretical and empirical considerations, that this proposed metric should not be interpreted as a functional similarity, and therefore cannot be used to support any conclusions about the "ortholog conjecture" (or, more properly, the "ortholog functional conservation hypothesis". First, we reexamine the case studies presented by Nehrt et al. as examples of orthologs with divergent functions, and come to a very different conclusion: they actually exemplify how GO annotations for orthologous genes provide complementary information about conserved biological functions. We then show that there is a global ascertainment bias in the experiment-based GO annotations for human and mouse genes: particular types of experiments tend to be performed in different model organisms. We conclude that the reported statistical differences in annotations between pairs of orthologous genes do not reflect differences in biological function, but rather complementarity in experimental approaches. Our results underscore two general considerations for researchers proposing novel types of analysis based on the GO: 1 that GO annotations are often incomplete, potentially in a biased manner, and subject to an "open world assumption" (absence of an annotation does not imply absence of a function, and 2 that conclusions drawn from a novel, large-scale GO analysis should whenever possible be supported by careful, in-depth examination of examples, to help ensure the

  7. Pathway Detection from Protein Interaction Networks and Gene Expression Data Using Color-Coding Methods and A* Search Algorithms

    Directory of Open Access Journals (Sweden)

    Cheng-Yu Yeh

    2012-01-01

    Full Text Available With the large availability of protein interaction networks and microarray data supported, to identify the linear paths that have biological significance in search of a potential pathway is a challenge issue. We proposed a color-coding method based on the characteristics of biological network topology and applied heuristic search to speed up color-coding method. In the experiments, we tested our methods by applying to two datasets: yeast and human prostate cancer networks and gene expression data set. The comparisons of our method with other existing methods on known yeast MAPK pathways in terms of precision and recall show that we can find maximum number of the proteins and perform comparably well. On the other hand, our method is more efficient than previous ones and detects the paths of length 10 within 40 seconds using CPU Intel 1.73GHz and 1GB main memory running under windows operating system.

  8. Gene Expression Profiles for Predicting Metastasis in Breast Cancer: A Cross-Study Comparison of Classification Methods

    Directory of Open Access Journals (Sweden)

    Mark Burton

    2012-01-01

    Full Text Available Machine learning has increasingly been used with microarray gene expression data and for the development of classifiers using a variety of methods. However, method comparisons in cross-study datasets are very scarce. This study compares the performance of seven classification methods and the effect of voting for predicting metastasis outcome in breast cancer patients, in three situations: within the same dataset or across datasets on similar or dissimilar microarray platforms. Combining classification results from seven classifiers into one voting decision performed significantly better during internal validation as well as external validation in similar microarray platforms than the underlying classification methods. When validating between different microarray platforms, random forest, another voting-based method, proved to be the best performing method. We conclude that voting based classifiers provided an advantage with respect to classifying metastasis outcome in breast cancer patients.

  9. Searching for rigour in the reporting of mixed methods population health research: a methodological review.

    Science.gov (United States)

    Brown, K M; Elliott, S J; Leatherdale, S T; Robertson-Wilson, J

    2015-12-01

    The environments in which population health interventions occur shape both their implementation and outcomes. Hence, when evaluating these interventions, we must explore both intervention content and context. Mixed methods (integrating quantitative and qualitative methods) provide this opportunity. However, although criteria exist for establishing rigour in quantitative and qualitative research, there is poor consensus regarding rigour in mixed methods. Using the empirical example of school-based obesity interventions, this methodological review examined how mixed methods have been used and reported, and how rigour has been addressed. Twenty-three peer-reviewed mixed methods studies were identified through a systematic search of five databases and appraised using the guidelines for Good Reporting of a Mixed Methods Study. In general, more detailed description of data collection and analysis, integration, inferences and justifying the use of mixed methods is needed. Additionally, improved reporting of methodological rigour is required. This review calls for increased discussion of practical techniques for establishing rigour in mixed methods research, beyond those for quantitative and qualitative criteria individually. A guide for reporting mixed methods research in population health should be developed to improve the reporting quality of mixed methods studies. Through improved reporting, mixed methods can provide strong evidence to inform policy and practice. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  10. A novel luciferase knock-in reporter system for studying transcriptional regulation of the human Sox2 gene.

    Science.gov (United States)

    Xiao, Dan; Zhang, Weifeng; Li, Yan; Liu, Kuan; Zhao, Junli; Sun, Xiaohong; Shan, Linlin; Mao, Qinwen; Xia, Haibin

    2016-02-10

    Sox2 is an important transcriptional factor that has multiple functions in stem cell maintenance and tumorigenesis. To investigate the transcriptional regulation of the Sox2 gene, a luciferase knock-in reporter system was established in HEK293 cells by placing the luciferase gene in the genome under the control of the Sox2 gene promoter using a transcription activator-like effector nuclease (TALEN)-mediated genome editing technique. PCR and Southern blot results confirmed the site-specific integration of a single copy of the exogenous luciferase gene into the genome. To prove the reliability and sensitivity of this novel luciferase knock-in system, a CRISPR/Cas transcription activation system for the Sox2 gene was constructed and applied to the knock-in system. The results indicated that luciferase activity was directly correlated with the activity of the Sox2 endogenous promoter. This novel system will be a useful tool to study the transcriptional regulation of Sox2, and has great potential in medical and industrial applications. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Comparison of assessment methods for self-reported alcohol consumption in health interview surveys

    DEFF Research Database (Denmark)

    Ekholm, O; Strandberg-Larsen, K; Christensen, K

    2008-01-01

    To select a simple method for assessing alcohol consumption and to compare how different reference periods and response categories influence the self-reported frequency of binge drinking.......To select a simple method for assessing alcohol consumption and to compare how different reference periods and response categories influence the self-reported frequency of binge drinking....

  12. 7 CFR 1781.21 - Borrower accounting methods, management, reporting, and audits.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 12 2010-01-01 2010-01-01 false Borrower accounting methods, management, reporting... DEVELOPMENT (RCD) LOANS AND WATERSHED (WS) LOANS AND ADVANCES § 1781.21 Borrower accounting methods, management, reporting, and audits. These activities will be handled in accordance with the provisions of...

  13. Methods for small RNA preparation for digital gene expression profiling by next-generation sequencing

    NARCIS (Netherlands)

    Linsen, S.E.V.; Cuppen, E.

    2012-01-01

    Digital gene expression (DGE) profiling techniques are playing an eminent role in the detection, localization, and differential expression quantification of many small RNA species, including microRNAs (1-3). Procedures in small RNA library preparation techniques typically include adapter ligation by

  14. Kinds of access: Different methods for report reveal different kinds of metacognitive access

    DEFF Research Database (Denmark)

    Overgaard, Morten; Sandberg, Kristian

    2012-01-01

    that there is not only a theoretical, but also an empirical difference between different methods of reporting. We hypothesize that differences in the sensitivity of different scales may reveal that different types of access are used to issue direct reports about experiences and metacognitive reports about...

  15. Systematic hybrid LOH: a new method to reduce false positives and negatives during screening of yeast gene deletion libraries

    DEFF Research Database (Denmark)

    Alvaro, D.; Sunjevaric, I.; Reid, R. J.

    2006-01-01

    We have developed a new method, systematic hybrid loss of heterozygosity, to facilitate genomic screens utilizing the yeast gene deletion library. Screening is performed using hybrid diploid strains produced through mating the library haploids with strains from a different genetic background......, to minimize the contribution of unpredicted recessive genetic factors present in the individual library strains. We utilize a set of strains where each contains a conditional centromere construct on one of the 16 yeast chromosomes that allows the destabilization and selectable loss of that chromosome. After...... complementation of any spurious recessive mutations in the library strain, facilitating attribution of the observed phenotype to the documented gene deletion and dramatically reducing false positive results commonly obtained in library screens. The systematic hybrid LOH method can be applied to virtually any...

  16. Waste Tank Organic Safety Program: Analytical methods development. Progress report, FY 1994

    International Nuclear Information System (INIS)

    Campbell, J.A.; Clauss, S.A.; Grant, K.E.

    1994-09-01

    The objectives of this task are to develop and document extraction and analysis methods for organics in waste tanks, and to extend these methods to the analysis of actual core samples to support the Waste Tank organic Safety Program. This report documents progress at Pacific Northwest Laboratory (a) during FY 1994 on methods development, the analysis of waste from Tank 241-C-103 (Tank C-103) and T-111, and the transfer of documented, developed analytical methods to personnel in the Analytical Chemistry Laboratory (ACL) and 222-S laboratory. This report is intended as an annual report, not a completed work

  17. Screening of molecular cell targets for carcinogenic heterocyclic aromatic amines by using CALUX® reporter gene assays.

    Science.gov (United States)

    Steinberg, Pablo; Behnisch, Peter A; Besselink, Harrie; Brouwer, Abraham A

    2017-06-01

    Heterocyclic aromatic amines (HCAs) are compounds formed when meat or fish are cooked at high temperatures for a long time or over an open fire. To determine which pathways of toxicity are activated by HCAs, nine out of the ten HCAs known to be carcinogenic in rodents (2-amino-9H-pyrido[2,3-b]indole (AαC), 2-aminodipyrido[1,2-a:3',2-d]imidazole (Glu-P-2), 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), 2-amino-3-methyl-9H-pyrido[2,3-b]indole (MeAαC), 2-amino-3,4-dimethylimidazo[4,5-f]quinoline (MeIQ), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), 3-amino-1,4-dimethyl-5H-pyrido[4,3-b]indole (Trp-P-1), and 3-amino-1-methyl-5H-pyrido[4,3-b]indole (Trp-P-2)) were tested in the estrogen receptor α (ERα), androgen receptor (AR), glucocorticoid receptor (GR), peroxisome proliferator-activated receptor γ2 (PPARγ2), polycyclic aromatic hydrocarbons (PAH), Nrf2, and p53 CALUX® reporter gene assays. Trp-P-1 was the only HCA that led to a positive response in the ERα, PPARγ2, and Nrf2 CALUX® assays. In the PAH CALUX® assay, Trp-P-2, MeAαC, and AαC induced luciferase activity to a greater extent than MeIQ and PhIP. In the p53 CALUX® assay without a coupled metabolic activation, only Trp-P-1 and Trp-P-2 enhanced luciferase expression; when a metabolic activation step was coupled to the p53 CALUX® assay, Trp-P-1, Glu-P-2, MeIQ, MeIQx, and PhIP induced a positive response. No HCA was positive in the AR and GR CALUX® assays. Taken together, the results obtained show that the battery of CALUX® assays performed in the present study can successfully be used to screen for molecular cell targets of carcinogenic compounds such as HCAs.

  18. Study of rNIS as a reporter gene monitoring rBMSC transplanted to rat myocardium

    International Nuclear Information System (INIS)

    Hu Shou; Lan Xiaoli; Cao Wei; Cao Guoxiang; Zhang Guopeng; Zhang Binqing; Wu Tao; Chang Wei; Zhang Yongxue

    2010-01-01

    Objective: To investigate the feasibility of rat sodium/iodide symporter (rNIS) as a reporter gene monitoring rat bone marrow mesenchymal cells (rBMSC) transplanted to rat myocardium in vivo. Methods: Recombinated adenovirus vector was constructed by rNIS/enhanced green fluorescence protein (EGFP) (Ad-rNIS/EGFP). rBMSC transfected by Ad-rNIS/EGFP were studied using fluorescence microscope. Fifteen rats were transplanted with rBMSC and randomly divided into three groups: rNIS group (with rNIS transfection), blocked group (with rNIS transfection) by oral intake of perchloric sodium before planar imaging (GE Millennium MPR SPECT), and control group (without rNIS transfection). All rats underwent 99 Tc m -pertechnetate planar imaging. The biological distribution of 99 Tc m -pertechnetate was studied. The expressions of rNIS gene and protein in myocardium were measured by real time polymerase chain reaction (PCR) and western blot, respectively. The expressions of CD 29 , CD 44 , CD 90 , CD 11 b, CD 34 and CD 45 were measured by immunohistochemistry. Results: rBMSC transfected by Ad-rNIS/EGFP showed EGFP expression under fluorescence microscope. The transplanted rat myocardium could be visualized on 99 Tc m -pertechnetate planar imaging in rNIS group. The relative uptake ratio (R heart /R hmb , RUR) was 6.7 ±0.4. RUR in control group (3.0 ±0.2) was lower than that in rNIS group (t =2.78, P=0.03). The percentage injection dose per gram of tissue (% ID/g) of the transplanted myocardium was 60.2 ± 20.8 in rNIS group, which was higher than that (2.5 ± 0.4) % ID/g of control group ( t = 7.13, P 29 , CD 44 and CD 90 were positive, CD 45 and CD 45 negative CD 11 b mildly positive in the myocardium transplanted with infective rBMSC. Conclusion: rNIS can efficiently monitor rBMSC transplanted to rat myocardium. (authors)

  19. Evaluation of transcriptional activity of the oestrogen receptor with sodium iodide symporter as an imaging reporter gene.

    Science.gov (United States)

    Kang, Joo Hyun; Chung, June-Key; Lee, Yong Jin; Kim, Kwang Il; Jeong, Jae Min; Lee, Dong Soo; Lee, Myung Chul

    2006-10-01

    Oestrogen receptors are ligand-dependent transcription factors whose activity is modulated either by oestrogens or by an alternative signalling pathway. Oestrogen receptors interact via a specific DNA-binding domain, the oestrogen responsive element (ERE), in the promoter region of sensitive genes. This binding leads to an initiation of gene expression and hormonal effects. To determine the transcriptional activity of the oestrogen receptor, we developed a molecular imaging system using sodium iodide symporter (NIS) as a reporter gene. The NIS reporter gene was placed under the control of an artificial ERE derived from pERE-TA-SEAP and named as pERE-NIS. pERE-NIS was transferred to MCF-7, human breast cancer cells, which highly expressed oestrogen receptor-alpha with lipofectamine. Stably expressing cells were generated by selection with G418 for 14 days. After treatment of 17beta-oestradiol and tamoxifen with serial doses, the (125)I uptake was measured for the determination of NIS expression. The inhibition of NIS activity was performed with 50 micromol x l(-1) potassium perchlorate. The MCF7/pERE-NIS treated with 17beta-oestradiol accumulated (125)I up to 70-80% higher than did non-treated cells. NIS expression was increased according to increasing doses of 17beta-oestradiol. MCF7/pERE-NIS treated with tamoxifen also accumulated (125)I up to 50% higher than did non-treated cells. Potassium perchlorate completely inhibited (125)I uptake. When MDA-MB231 cells, the oestrogen receptor-negative breast cancer cells, were transfected with pERE-NIS, (125)I uptake of MDA-MB-231/pERE-NIS did not increase. This pERE-NIS reporter system is sufficiently sensitive for monitoring transcriptional activity of the oestrogen receptor. Therefore, cis-enhancer reporter systems with ERE will be applicable to the development of a novel selective oestrogen receptor modulator with low toxicity and high efficacy.

  20. Characterization of heterologously expressed transporter genes by patch- and voltage-clamp methods: Application to cyclic nucleotide-dependent responses

    KAUST Repository

    Lemtiri-Chlieh, Fouad; Ali, Rashid Ayesha

    2013-01-01

    The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.

  1. Characterization of heterologously expressed transporter genes by patch- and voltage-clamp methods: Application to cyclic nucleotide-dependent responses

    KAUST Repository

    Lemtiri-Chlieh, Fouad

    2013-09-03

    The application of patch- and voltage-clamp methods to study ion transport can be limited by many hurdles: the size of the cells to be patched and/or stabbed, the subcellular localization of the molecule of interest, and its density of expression that could be too low even in their own native environment. Functional expression of genes using recombinant DNA technology not only overcomes those hurdles but also affords additional and elegant investigations such as single-point mutation studies and subunit associations/regulations. In this chapter, we give a step-by-step description of two electrophysiological methods, patch clamp and two-electrode voltage clamp (TEVC), that are routinely used in combination with heterologous gene expression to assist researchers interested in the identification and characterization of ion transporters. We describe how to (1) obtain and maintain the cells suitable for the use with each of the above-mentioned methods (i.e., HEK-293 cells and yeast spheroplasts to use with the patch-clamp methodology and Xenopus laevis oocytes with TEVC), (2) transfect/inject them with the gene of interest, and (3) record ion transport activities. © Springer Science+Business Media New York 2013.

  2. Novel methods for the molecular discrimination of Fasciola spp. on the basis of nuclear protein-coding genes.

    Science.gov (United States)

    Shoriki, Takuya; Ichikawa-Seki, Madoka; Suganuma, Keisuke; Naito, Ikunori; Hayashi, Kei; Nakao, Minoru; Aita, Junya; Mohanta, Uday Kumar; Inoue, Noboru; Murakami, Kenji; Itagaki, Tadashi

    2016-06-01

    Fasciolosis is an economically important disease of livestock caused by Fasciola hepatica, Fasciola gigantica, and aspermic Fasciola flukes. The aspermic Fasciola flukes have been discriminated morphologically from the two other species by the absence of sperm in their seminal vesicles. To date, the molecular discrimination of F. hepatica and F. gigantica has relied on the nucleotide sequences of the internal transcribed spacer 1 (ITS1) region. However, ITS1 genotypes of aspermic Fasciola flukes cannot be clearly differentiated from those of F. hepatica and F. gigantica. Therefore, more precise and robust methods are required to discriminate Fasciola spp. In this study, we developed PCR restriction fragment length polymorphism and multiplex PCR methods to discriminate F. hepatica, F. gigantica, and aspermic Fasciola flukes on the basis of the nuclear protein-coding genes, phosphoenolpyruvate carboxykinase and DNA polymerase delta, which are single locus genes in most eukaryotes. All aspermic Fasciola flukes used in this study had mixed fragment pattern of F. hepatica and F. gigantica for both of these genes, suggesting that the flukes are descended through hybridization between the two species. These molecular methods will facilitate the identification of F. hepatica, F. gigantica, and aspermic Fasciola flukes, and will also prove useful in etiological studies of fasciolosis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  3. Diagnosis of Neisseria gonorrhoeae among pregnant women by culture method and PCR on cppB gene

    Directory of Open Access Journals (Sweden)

    Jalal Mardaneh

    2013-11-01

    Full Text Available Background: Neisseria gonorrhoeae is a human obligate pathogen and the etiological agent of gonorrhea. Health irreparable complications resulting from gonorrhea disease occur mainly in pregnant women and neonates. Aim of this study was diagnosis of Neisseria gonorrhoeae among pregnant women with using culture and molecular method by amplification of cppB gene with PCR. Material and Methods: In this cross-sectional study, two endocervical swab specimens were obtained from 1100 pregnant women who referred to Shiraz Hospitals. Culture on nonselective and selective media and nucleic acid amplification test (NAAT were performed for detection of Neisseria gonorrhoeae cppB gene. Results: All endocervical swabs cultures on selective and nonselective media were negative for Neisseria gonorrhoeae. Among examined endocervical swabs, 13samples (1.18% were positive by nucleic acid amplification of Neisseria gonorrgoeae cppB gene. Conclusion: Negative results of culture and positive results of PCR in this study indicate that however culture is gold standard method for detection of Neisseria gonorrhoeae but due to bacterial autolysis, poor sampling techniques and improper specimen storage and transport, its value decline as compared with Nucleic acid amplification test (NAAT.

  4. Development of real-time PCR method for the detection and the quantification of a new endogenous reference gene in sugar beet "Beta vulgaris L.": GMO application.

    Science.gov (United States)

    Chaouachi, Maher; Alaya, Akram; Ali, Imen Ben Haj; Hafsa, Ahmed Ben; Nabi, Nesrine; Bérard, Aurélie; Romaniuk, Marcel; Skhiri, Fethia; Saïd, Khaled

    2013-01-01

    KEY MESSAGE : Here, we describe a new developed quantitative real-time PCR method for the detection and quantification of a new specific endogenous reference gene used in GMO analysis. The key requirement of this study was the identification of a new reference gene used for the differentiation of the four genomic sections of the sugar beet (Beta vulgaris L.) (Beta, Corrollinae, Nanae and Procumbentes) suitable for quantification of genetically modified sugar beet. A specific qualitative polymerase chain reaction (PCR) assay was designed to detect the sugar beet amplifying a region of the adenylate transporter (ant) gene only from the species of the genomic section I of the genus Beta (cultivated and wild relatives) and showing negative PCR results for 7 species of the 3 other sections, 8 related species and 20 non-sugar beet plants. The sensitivity of the assay was 15 haploid genome copies (HGC). A quantitative real-time polymerase chain reaction (QRT-PCR) assay was also performed, having high linearity (R (2) > 0.994) over sugar beet standard concentrations ranging from 20,000 to 10 HGC of the sugar beet DNA per PCR. The QRT-PCR assay described in this study was specific and more sensitive for sugar beet quantification compared to the validated test previously reported in the European Reference Laboratory. This assay is suitable for GMO quantification in routine analysis from a wide variety of matrices.

  5. Kinds of access: different methods for report reveal different kinds of metacognitive access

    Science.gov (United States)

    Overgaard, Morten; Sandberg, Kristian

    2012-01-01

    In experimental investigations of consciousness, participants are asked to reflect upon their own experiences by issuing reports about them in different ways. For this reason, a participant needs some access to the content of her own conscious experience in order to report. In such experiments, the reports typically consist of some variety of ratings of confidence or direct descriptions of one's own experiences. Whereas different methods of reporting are typically used interchangeably, recent experiments indicate that different results are obtained with different kinds of reporting. We argue that there is not only a theoretical, but also an empirical difference between different methods of reporting. We hypothesize that differences in the sensitivity of different scales may reveal that different types of access are used to issue direct reports about experiences and metacognitive reports about the classification process. PMID:22492747

  6. Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering.

    Science.gov (United States)

    Kimura, Yukiko; Hisano, Yu; Kawahara, Atsuo; Higashijima, Shin-ichi

    2014-10-08

    The type II bacterial CRISPR/Cas9 system is rapidly becoming popular for genome-engineering due to its simplicity, flexibility, and high efficiency. Recently, targeted knock-in of a long DNA fragment via homology-independent DNA repair has been achieved in zebrafish using CRISPR/Cas9 system. This raised the possibility that knock-in transgenic zebrafish could be efficiently generated using CRISPR/Cas9. However, how widely this method can be applied for the targeting integration of foreign genes into endogenous genomic loci is unclear. Here, we report efficient generation of knock-in transgenic zebrafish that have cell-type specific Gal4 or reporter gene expression. A donor plasmid containing a heat-shock promoter was co-injected with a short guide RNA (sgRNA) targeted for genome digestion, a sgRNA targeted for donor plasmid digestion, and Cas9 mRNA. We have succeeded in establishing stable knock-in transgenic fish with several different constructs for 4 genetic loci at a frequency being exceeding 25%. Due to its simplicity, design flexibility, and high efficiency, we propose that CRISPR/Cas9-mediated knock-in will become a standard method for the generation transgenic zebrafish.

  7. A case report of novel mutation in PRF1 gene, which causes familial autosomal recessive hemophagocytic lymphohistiocytosis.

    Science.gov (United States)

    Bordbar, Mohammad Reza; Modarresi, Farzaneh; Farazi Fard, Mohammad Ali; Dastsooz, Hassan; Shakib Azad, Nader; Faghihi, Mohammad Ali

    2017-05-03

    Hemophagocytic Lymphohistiocytosis (HLH) is a life-threatening immunodeficiency and multi-organ disease that affects people of all ages and ethnic groups. Common symptoms and signs of this disease are high fever, hepatosplenomegaly, and cytopenias. Familial form of HLH disease, which is an autosomal recessive hematological disorder is due to disease-causing mutations in several genes essential for NK and T-cell granule-mediated cytotoxic function. For an effective cytotoxic response from cytotoxic T lymphocyte or NK cell encountering an infected cell or tumor cell, different processes are required, including trafficking, docking, priming, membrane fusion, and entry of cytotoxic granules into the target cell leading to apoptosis. Therefore, genes involved in these steps play important roles in the pathogenesis of HLH disease which include PRF1, UNC13D (MUNC13-4), STX11, and STXBP2 (MUNC18-2). Here, we report a novel missense mutation in an 8-year-old boy suffered from hepatosplenomegaly, hepatitis, epilepsy and pancytopenia. The patient was born to a first-cousin parents with no previous documented disease in his parents. To identify mutated gene in the proband, Whole Exome Sequencing (WES) utilizing next generation sequencing was used on an Illumina HiSeq 2000 platform on DNA sample from the patient. Results showed a novel deleterious homozygous missense mutation in PRF1 gene (NM_001083116: exon3: c. 1120 T > G, p.W374G) in the patient and then using Sanger sequencing it was confirmed in the proband and his parents. Since his parents were heterozygous for the identified mutation, autosomal recessive pattern of inheritance was confirmed in the family. Our study identified a rare new pathogenic missense mutation in PRF1 gene in patient with HLH disease and it is the first report of mutation in PRF1 in Iranian patients with this disease.

  8. De novo clustering methods outperform reference-based methods for assigning 16S rRNA gene sequences to operational taxonomic units

    Directory of Open Access Journals (Sweden)

    Sarah L. Westcott

    2015-12-01

    Full Text Available Background. 16S rRNA gene sequences are routinely assigned to operational taxonomic units (OTUs that are then used to analyze complex microbial communities. A number of methods have been employed to carry out the assignment of 16S rRNA gene sequences to OTUs leading to confusion over which method is optimal. A recent study suggested that a clustering method should be selected based on its ability to generate stable OTU assignments that do not change as additional sequences are added to the dataset. In contrast, we contend that the quality of the OTU assignments, the ability of the method to properly represent the distances between the sequences, is more important.Methods. Our analysis implemented six de novo clustering algorithms including the single linkage, complete linkage, average linkage, abundance-based greedy clustering, distance-based greedy clustering, and Swarm and the open and closed-reference methods. Using two previously published datasets we used the Matthew’s Correlation Coefficient (MCC to assess the stability and quality of OTU assignments.Results. The stability of OTU assignments did not reflect the quality of the assignments. Depending on the dataset being analyzed, the average linkage and the distance and abundance-based greedy clustering methods generated OTUs that were more likely to represent the actual distances between sequences than the open and closed-reference methods. We also demonstrated that for the greedy algorithms VSEARCH produced assignments that were comparable to those produced by USEARCH making VSEARCH a viable free and open source alternative to USEARCH. Further interrogation of the reference-based methods indicated that when USEARCH or VSEARCH were used to identify the closest reference, the OTU assignments were sensitive to the order of the reference sequences because the reference sequences can be identical over the region being considered. More troubling was the observation that while both USEARCH and

  9. An improved method for transformation of lettuce by Agrobacterium tumefaciens with a gene that confers freezing resistance

    Directory of Open Access Journals (Sweden)

    Pileggi Marcos

    2001-01-01

    Full Text Available An efficient method for constructing transgenic lettuce cultivars by Agrobacterium tumefaciens was described by Torres et al., 1993. In the present work, an improvement of the above procedure is described and applied to transform the cultivar Grand Rapids with a mutated P5CS gene. The major modifications were concerned with turning more practical the transformation and regeneration protocols. Also we tried to improve transformation steps by increasing injured area in explants and prolonging co-cultivation with Agrobacteria (in larger concentration. A more significant selective pressure was used against non-transformed plants and bacteria. In these work we were concerned to obtain T1 and T2 seeds. The P5CS gene codes for a delta¹-pyrroline-5-carboxylate synthetase, a bifunctional enzyme that catalyzes two steps of proline biosynthesis in plants (Zhang et al., 1995; Peng et al., 1996, while the mutated gene is insensitive to feedback inhibition by proline. The potential benefit of this gene is to confer water stress resistance (drought, salt, cold due to increased intracellular levels of proline that works like an osmoprotectant. In this work could obtain and characterize transgenic lettuce lineages which are resistant to freezing temperature.

  10. First report of a deletion encompassing an entire exon in the homogentisate 1,2-dioxygenase gene causing alkaptonuria.

    Science.gov (United States)

    Zouheir Habbal, Mohammad; Bou-Assi, Tarek; Zhu, Jun; Owen, Renius; Chehab, Farid F

    2014-01-01

    Alkaptonuria is often diagnosed clinically with episodes of dark urine, biochemically by the accumulation of peripheral homogentisic acid and molecularly by the presence of mutations in the homogentisate 1,2-dioxygenase gene (HGD). Alkaptonuria is invariably associated with HGD mutations, which consist of single nucleotide variants and small insertions/deletions. Surprisingly, the presence of deletions beyond a few nucleotides among over 150 reported deleterious mutations has not been described, raising the suspicion that this gene might be protected against the detrimental mechanisms of gene rearrangements. The quest for an HGD mutation in a proband with AKU revealed with a SNP array five large regions of homozygosity (5-16 Mb), one of which includes the HGD gene. A homozygous deletion of 649 bp deletion that encompasses the 72 nucleotides of exon 2 and surrounding DNA sequences in flanking introns of the HGD gene was unveiled in a proband with AKU. The nature of this deletion suggests that this in-frame deletion could generate a protein without exon 2. Thus, we modeled the tertiary structure of the mutant protein structure to determine the effect of exon 2 deletion. While the two β-pleated sheets encoded by exon 2 were missing in the mutant structure, other β-pleated sheets are largely unaffected by the deletion. However, nine novel α-helical coils substituted the eight coils present in the native HGD crystal structure. Thus, this deletion results in a deleterious enzyme, which is consistent with the proband's phenotype. Screening for mutations in the HGD gene, particularly in the Middle East, ought to include this exon 2 deletion in order to determine its frequency and uncover its origin.

  11. First report of a deletion encompassing an entire exon in the homogentisate 1,2-dioxygenase gene causing alkaptonuria.

    Directory of Open Access Journals (Sweden)

    Mohammad Zouheir Habbal

    Full Text Available Alkaptonuria is often diagnosed clinically with episodes of dark urine, biochemically by the accumulation of peripheral homogentisic acid and molecularly by the presence of mutations in the homogentisate 1,2-dioxygenase gene (HGD. Alkaptonuria is invariably associated with HGD mutations, which consist of single nucleotide variants and small insertions/deletions. Surprisingly, the presence of deletions beyond a few nucleotides among over 150 reported deleterious mutations has not been described, raising the suspicion that this gene might be protected against the detrimental mechanisms of gene rearrangements. The quest for an HGD mutation in a proband with AKU revealed with a SNP array five large regions of homozygosity (5-16 Mb, one of which includes the HGD gene. A homozygous deletion of 649 bp deletion that encompasses the 72 nucleotides of exon 2 and surrounding DNA sequences in flanking introns of the HGD gene was unveiled in a proband with AKU. The nature of this deletion suggests that this in-frame deletion could generate a protein without exon 2. Thus, we modeled the tertiary structure of the mutant protein structure to determine the effect of exon 2 deletion. While the two β-pleated sheets encoded by exon 2 were missing in the mutant structure, other β-pleated sheets are largely unaffected by the deletion. However, nine novel α-helical coils substituted the eight coils present in the native HGD crystal structure. Thus, this deletion results in a deleterious enzyme, which is consistent with the proband's phenotype. Screening for mutations in the HGD gene, particularly in the Middle East, ought to include this exon 2 deletion in order to determine its frequency and uncover its origin.

  12. Molecular characterization of a maize regulatory gene. Annual progress report, November 1991--October 1992

    Energy Technology Data Exchange (ETDEWEB)

    Wessler, S.R.

    1994-05-01

    All aspects of this year`s work have converged on the central theme of post-transcriptional control of R gene expression. Unlike transcriptional control, relatively little is known about post-transcriptional regulation, especially in plants. We believe that three levels of post-transcriptional regulation have been identified: control of translation initiation as evidenced by the maize Lc gene; control of nuclear localization as evidenced by the Ds allele r-m9 of maize; and control of nuclear localization through alternative splicing of the rice R homolog.

  13. A next-generation sequencing method for overcoming the multiple gene copy problem in polyploid phylogenetics, applied to Poa grasses

    Directory of Open Access Journals (Sweden)

    Robin Charles

    2011-03-01

    Full Text Available Abstract Background Polyploidy is important from a phylogenetic perspective because of its immense past impact on evolution and its potential future impact on diversification, survival and adaptation, especially in plants. Molecular population genetics studies of polyploid organisms have been difficult because of problems in sequencing multiple-copy nuclear genes using Sanger sequencing. This paper describes a method for sequencing a barcoded mixture of targeted gene regions using next-generation sequencing methods to overcome these problems. Results Using 64 3-bp barcodes, we successfully sequenced three chloroplast and two nuclear gene regions (each of which contained two gene copies with up to two alleles per individual in a total of 60 individuals across 11 species of Australian Poa grasses. This method had high replicability, a low sequencing error rate (after appropriate quality control and a low rate of missing data. Eighty-eight percent of the 320 gene/individual combinations produced sequence reads, and >80% of individuals produced sufficient reads to detect all four possible nuclear alleles of the homeologous nuclear loci with 95% probability. We applied this method to a group of sympatric Australian alpine Poa species, which we discovered to share an allopolyploid ancestor with a group of American Poa species. All markers revealed extensive allele sharing among the Australian species and so we recommend that the current taxonomy be re-examined. We also detected hypermutation in the trnH-psbA marker, suggesting it should not be used as a land plant barcode region. Some markers indicated differentiation between Tasmanian and mainland samples. Significant positive spatial genetic structure was detected at Conclusions Our results demonstrate that 454 sequencing of barcoded amplicon mixtures can be used to reliably sample all alleles of homeologous loci in polyploid species and successfully investigate phylogenetic relationships among

  14. RNA-seq methods for identifying differentially expressed gene in human pancreatic islet cells treated with pro-inflammatory cytokines.

    Science.gov (United States)

    Li, Bo; Bi, Chang Long; Lang, Ning; Li, Yu Ze; Xu, Chao; Zhang, Ying Qi; Zhai, Ai Xia; Cheng, Zhi Feng

    2014-01-01

    Type 1 diabetes is a chronic autoimmune disease in which pancreatic beta cells are killed by the infiltrating immune cells as well as the cytokines released by these cells. Many studies indicate that inflammatory mediators have an essential role in this disease. In the present study, we profiled the transcriptome in human islets of langerhans under control conditions or following exposure to the pro-inflammatory cytokines based on the RNA sequencing dataset downloaded from SRA database. After filtered the low-quality ones, the RNA readers was aligned to human genome hg19 by TopHat and then assembled by Cufflinks. The expression value of each transcript was calculated and consequently differentially expressed genes were screened out. Finally, a total of 63 differentially expressed genes were identified including 60 up-regulated and three down-regulated genes. GBP5 and CXCL9 stood out as the top two most up-regulated genes in cytokines treated samples with the log2 fold change of 12.208 and 10.901, respectively. Meanwhile, PTF1A and REG3G were identified as the top two most down-regulated genes with the log2 fold change of -3.759 and -3.606, respectively. Of note, we also found 262 lncRNAs (long non-coding RNA), 177 of which were inferred as novel lncRNAs. Further in-depth follow-up analysis of the transcriptional regulation reported in this study may shed light on the specific function of these lncRNA.

  15. Efficient methods for targeted mutagenesis in zebrafish using zinc-finger nucleases: data from targeting of nine genes using CompoZr or CoDA ZFNs.

    Directory of Open Access Journals (Sweden)

    Raman Sood

    Full Text Available Recently, it has been shown that targeted mutagenesis using zinc-finger nucleases (ZFNs and transcription activator-like effector nucleases (TALENs can be used to generate knockout zebrafish lines for analysis of their function and/or developing disease models. A number of different