Human reporter genes: potential use in clinical studies

International Nuclear Information System (INIS)

Serganova, Inna; Ponomarev, Vladimir; Blasberg, Ronald

2007-01-01

The clinical application of positron-emission-tomography-based reporter gene imaging will expand over the next several years. The translation of reporter gene imaging technology into clinical applications is the focus of this review, with emphasis on the development and use of human reporter genes. Human reporter genes will play an increasingly more important role in this development, and it is likely that one or more reporter systems (human gene and complimentary radiopharmaceutical) will take leading roles. Three classes of human reporter genes are discussed and compared: receptors, transporters and enzymes. Examples of highly expressed cell membrane receptors include specific membrane somatostatin receptors (hSSTrs). The transporter group includes the sodium iodide symporter (hNIS) and the norepinephrine transporter (hNET). The endogenous enzyme classification includes human mitochondrial thymidine kinase 2 (hTK2). In addition, we also discuss the nonhuman dopamine 2 receptor and two viral reporter genes, the wild-type herpes simplex virus 1 thymidine kinase (HSV1-tk) gene and the HSV1-tk mutant (HSV1-sr39tk). Initial applications of reporter gene imaging in patients will be developed within two different clinical disciplines: (a) gene therapy and (b) adoptive cell-based therapies. These studies will benefit from the availability of efficient human reporter systems that can provide critical monitoring information for adenoviral-based, retroviral-based and lenteviral-based gene therapies, oncolytic bacterial and viral therapies, and adoptive cell-based therapies. Translational applications of noninvasive in vivo reporter gene imaging are likely to include: (a) quantitative monitoring of gene therapy vectors for targeting and transduction efficacy in clinical protocols by imaging the location, extent and duration of transgene expression; (b) monitoring of cell trafficking, targeting, replication and activation in adoptive T-cell and stem/progenitor cell therapies

Assays for noninvasive imaging of reporter gene expression

International Nuclear Information System (INIS)

Gambhir, S.S.; Barrio, J.R.; Herschman, H.R.; Phelps, M.E.

1999-01-01

Repeated, noninvasive imaging of reporter gene expression is emerging as a valuable tool for monitoring the expression of genes in animals and humans. Monitoring of organ/cell transplantation in living animals and humans, and the assessment of environmental, behavioral, and pharmacologic modulation of gene expression in transgenic animals should soon be possible. The earliest clinical application is likely to be monitoring human gene therapy in tumors transduced with the herpes simplex virus type 1 thymidine kinase (HSV1-tk) suicide gene. Several candidate assays for imaging reporter gene expression have been studied, utilizing cytosine deaminase (CD), HSV1-tk, and dopamine 2 receptor (D2R) as reporter genes. For the HSV1-tk reporter gene, both uracil nucleoside derivatives (e.g., 5-iodo-2'-fluoro-2'-deoxy-1-β-D-arabinofuranosyl-5-iodouracil [FIAU] labeled with 124 I, 131 I ) and acycloguanosine derivatives {e.g., 8-[ 18 F]fluoro-9-[[2-hydroxy-1-(hydroxymethyl)ethoxy]methyl]guanine (8-[ 18 F]-fluoroganciclovir) ([ 18 F]FGCV), 9-[(3-[ 18 F]fluoro-1-hydroxy-2-propoxy)methyl]guanine ([ 18 F]FHPG)} have been investigated as reporter probes. For the D2R reporter gene, a derivative of spiperone {3-(2'-[ 18 F]-Fluoroethyl)spiperone ([ 18 F]FESP)} has been used with positron emission tomography (PET) imaging. In this review, the principles and specific assays for imaging reporter gene expression are presented and discussed. Specific examples utilizing adenoviral-mediated delivery of a reporter gene as well as tumors expressing reporter genes are discussed

Research progress in machine learning methods for gene-gene interaction detection.

Science.gov (United States)

Peng, Zhe-Ye; Tang, Zi-Jun; Xie, Min-Zhu

2018-03-20

Complex diseases are results of gene-gene and gene-environment interactions. However, the detection of high-dimensional gene-gene interactions is computationally challenging. In the last two decades, machine-learning approaches have been developed to detect gene-gene interactions with some successes. In this review, we summarize the progress in research on machine learning methods, as applied to gene-gene interaction detection. It systematically examines the principles and limitations of the current machine learning methods used in genome wide association studies (GWAS) to detect gene-gene interactions, such as neural networks (NN), random forest (RF), support vector machines (SVM) and multifactor dimensionality reduction (MDR), and provides some insights on the future research directions in the field.

Effect of the absolute statistic on gene-sampling gene-set analysis methods.

Science.gov (United States)

Nam, Dougu

2017-06-01

Gene-set enrichment analysis and its modified versions have commonly been used for identifying altered functions or pathways in disease from microarray data. In particular, the simple gene-sampling gene-set analysis methods have been heavily used for datasets with only a few sample replicates. The biggest problem with this approach is the highly inflated false-positive rate. In this paper, the effect of absolute gene statistic on gene-sampling gene-set analysis methods is systematically investigated. Thus far, the absolute gene statistic has merely been regarded as a supplementary method for capturing the bidirectional changes in each gene set. Here, it is shown that incorporating the absolute gene statistic in gene-sampling gene-set analysis substantially reduces the false-positive rate and improves the overall discriminatory ability. Its effect was investigated by power, false-positive rate, and receiver operating curve for a number of simulated and real datasets. The performances of gene-set analysis methods in one-tailed (genome-wide association study) and two-tailed (gene expression data) tests were also compared and discussed.

Advances in study of molecular imaging reporte gene systems

International Nuclear Information System (INIS)

Wu Tao; An Rui

2010-01-01

The use of molecular imaging reporter gene systems has allowed gene therapy to move from the laboratory to the clinical application, which provides methodology to monitor the expression of therapeutic gene noninvasively and achieve quantitative outcome in vivo. Recently, the radionuclide reporter gene still is the focus many studies, but MRI and optical reporter gene have gradually played a important part in reporter gene systems. On the basis of combination of multi-subject, for example applied chemistry and molecular biology, more and more new modified reporter genes and molecular probes have spread out. This paper mainly introduces the advantages and disadvantages of reporter gene system and development trends. (authors)

Repetitive Imaging of Reporter Gene Expression in the Lung

Directory of Open Access Journals (Sweden)

Jean-Christophe Richard

2003-10-01

Full Text Available Positron emission tomographic imaging is emerging as a powerful technology to monitor reporter transgene expression in the lungs and other organs. However, little information is available about its usefulness for studying gene expression over time. Therefore, we infected 20 rats with a replication-deficient adenovirus containing a fusion gene encoding for a mutant Herpes simplex virus type-1 thymidine kinase and an enhanced green fluorescent protein. Five additional rats were infected with a control virus. Pulmonary gene transfer was performed via intratracheal administration of vector using a surfactant-based method. Imaging was performed 4–6 hr, and 4, 7, and 10 days after gene transfer, using 9-(4-[18F]-fluoro-3-hydroxymethylbutylguanine, an imaging substrate for the mutant kinase. Lung tracer uptake assessed with imaging was moderately but significantly increased 4–6 hr after gene transfer, was maximal after 4 days, and was no longer detectable by 10 days. The temporal pattern of transgene expression measured ex vivo with in vitro assays of thymidine kinase activity and green fluorescent protein was similar to imaging. In conclusion, positron emission tomography is a reliable new tool to evaluate the onset and duration of reporter gene expression noninvasively in the lungs of intact animals.

Investigation progress of PET reporter gene imaging

International Nuclear Information System (INIS)

Chen Yumei; Huang Gang

2006-01-01

Molecular imaging for gene therapy and gene expression has been more and more attractive, while the use of gene therapy has been widely investigated and intense research have allowed it to the clinical setting in the last two-decade years. In vivo imaging with positron emission tomography (PET) by combination of appropriate PET reporter gene and PET reporter probe could provide qualitative and quantitative information for gene therapy. PET imaging could also obtain some valuable parameters not available by other techniques. This technology is useful to understand the process and development of gene therapy and how to apply it into clinical practice in the future. (authors)

A review for detecting gene-gene interactions using machine learning methods in genetic epidemiology.

Science.gov (United States)

Koo, Ching Lee; Liew, Mei Jing; Mohamad, Mohd Saberi; Salleh, Abdul Hakim Mohamed

2013-01-01

Recently, the greatest statistical computational challenge in genetic epidemiology is to identify and characterize the genes that interact with other genes and environment factors that bring the effect on complex multifactorial disease. These gene-gene interactions are also denoted as epitasis in which this phenomenon cannot be solved by traditional statistical method due to the high dimensionality of the data and the occurrence of multiple polymorphism. Hence, there are several machine learning methods to solve such problems by identifying such susceptibility gene which are neural networks (NNs), support vector machine (SVM), and random forests (RFs) in such common and multifactorial disease. This paper gives an overview on machine learning methods, describing the methodology of each machine learning methods and its application in detecting gene-gene and gene-environment interactions. Lastly, this paper discussed each machine learning method and presents the strengths and weaknesses of each machine learning method in detecting gene-gene interactions in complex human disease.

A Review for Detecting Gene-Gene Interactions Using Machine Learning Methods in Genetic Epidemiology

Directory of Open Access Journals (Sweden)

Ching Lee Koo

2013-01-01

Full Text Available Recently, the greatest statistical computational challenge in genetic epidemiology is to identify and characterize the genes that interact with other genes and environment factors that bring the effect on complex multifactorial disease. These gene-gene interactions are also denoted as epitasis in which this phenomenon cannot be solved by traditional statistical method due to the high dimensionality of the data and the occurrence of multiple polymorphism. Hence, there are several machine learning methods to solve such problems by identifying such susceptibility gene which are neural networks (NNs, support vector machine (SVM, and random forests (RFs in such common and multifactorial disease. This paper gives an overview on machine learning methods, describing the methodology of each machine learning methods and its application in detecting gene-gene and gene-environment interactions. Lastly, this paper discussed each machine learning method and presents the strengths and weaknesses of each machine learning method in detecting gene-gene interactions in complex human disease.

Environmental Application of Reporter-Genes Based Biosensors for Chemical Contamination Screening

Directory of Open Access Journals (Sweden)

Matejczyk Marzena

2014-12-01

Full Text Available The paper presents results of research concerning possibilities of applications of reporter-genes based microorganisms, including the selective presentation of defects and advantages of different new scientific achievements of methodical solutions in genetic system constructions of biosensing elements for environmental research. The most robust and popular genetic fusion and new trends in reporter genes technology – such as LacZ (β-galactosidase, xylE (catechol 2,3-dioxygenase, gfp (green fluorescent proteins and its mutated forms, lux (prokaryotic luciferase, luc (eukaryotic luciferase, phoA (alkaline phosphatase, gusA and gurA (β-glucuronidase, antibiotics and heavy metals resistance are described. Reporter-genes based biosensors with use of genetically modified bacteria and yeast successfully work for genotoxicity, bioavailability and oxidative stress assessment for detection and monitoring of toxic compounds in drinking water and different environmental samples, surface water, soil, sediments.

Multiplex cDNA quantification method that facilitates the standardization of gene expression data

Science.gov (United States)

Gotoh, Osamu; Murakami, Yasufumi; Suyama, Akira

2011-01-01

Microarray-based gene expression measurement is one of the major methods for transcriptome analysis. However, current microarray data are substantially affected by microarray platforms and RNA references because of the microarray method can provide merely the relative amounts of gene expression levels. Therefore, valid comparisons of the microarray data require standardized platforms, internal and/or external controls and complicated normalizations. These requirements impose limitations on the extensive comparison of gene expression data. Here, we report an effective approach to removing the unfavorable limitations by measuring the absolute amounts of gene expression levels on common DNA microarrays. We have developed a multiplex cDNA quantification method called GEP-DEAN (Gene expression profiling by DCN-encoding-based analysis). The method was validated by using chemically synthesized DNA strands of known quantities and cDNA samples prepared from mouse liver, demonstrating that the absolute amounts of cDNA strands were successfully measured with a sensitivity of 18 zmol in a highly multiplexed manner in 7 h. PMID:21415008

Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data.

Science.gov (United States)

Kannan, Soumya; Sams, Thomas; Maury, Jérôme; Workman, Christopher T

2018-03-16

Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system of ordinary differential equations for estimating dynamic promoter activity for promoters that change their activity in response to the environment that is robust to noise and changes in growth rate. Our approach, inference of dynamic promoter activity (PromAct), improves on existing methods by more accurately inferring known promoter activity profiles. This method is also capable of estimating the correct scale of promoter activity and can be applied to quantitative data sets to estimate quantitative rates.

The development and application of a multiple gene co-silencing system using endogenous URA3 as a reporter gene in Ganoderma lucidum.

Directory of Open Access Journals (Sweden)

Dashuai Mu

Full Text Available Ganoderma lucidum is one of the most important medicinal mushrooms; however, molecular genetics research on this species has been limited due to a lack of reliable reverse genetic tools. In this study, the endogenous orotidine 5'-monophosphate decarboxylase gene (URA3 was cloned as a silencing reporter, and four gene-silencing methods using hairpin, sense, antisense, and dual promoter constructs, were introduced into G. lucidum through a simple electroporation procedure. A comparison and evaluation of silencing efficiency demonstrated that all of the four methods differentially suppressed the expression of URA3. Our data unequivocally indicate that the dual promoter silencing vector yields the highest rate of URA3 silencing compared with other vectors (up to 81.9%. To highlight the advantages of the dual promoter system, we constructed a co-silencing system based on the dual promoter method and succeeded in co-silencing URA3 and laccase in G. lucidum. The reduction of the mRNA levels of the two genes were correlated. Thus, the screening efficiency for RNAi knockdown of multiple genes may be improved by the co-silencing of an endogenous reporter gene. The molecular tools developed in this study should facilitate the isolation of genes and the characterization of the functions of multiple genes in this pharmaceutically important species, and these tools should be highly useful for the study of other basidiomycetes.

Link-based quantitative methods to identify differentially coexpressed genes and gene Pairs

Directory of Open Access Journals (Sweden)

Ye Zhi-Qiang

2011-08-01

Full Text Available Abstract Background Differential coexpression analysis (DCEA is increasingly used for investigating the global transcriptional mechanisms underlying phenotypic changes. Current DCEA methods mostly adopt a gene connectivity-based strategy to estimate differential coexpression, which is characterized by comparing the numbers of gene neighbors in different coexpression networks. Although it simplifies the calculation, this strategy mixes up the identities of different coexpression neighbors of a gene, and fails to differentiate significant differential coexpression changes from those trivial ones. Especially, the correlation-reversal is easily missed although it probably indicates remarkable biological significance. Results We developed two link-based quantitative methods, DCp and DCe, to identify differentially coexpressed genes and gene pairs (links. Bearing the uniqueness of exploiting the quantitative coexpression change of each gene pair in the coexpression networks, both methods proved to be superior to currently popular methods in simulation studies. Re-mining of a publicly available type 2 diabetes (T2D expression dataset from the perspective of differential coexpression analysis led to additional discoveries than those from differential expression analysis. Conclusions This work pointed out the critical weakness of current popular DCEA methods, and proposed two link-based DCEA algorithms that will make contribution to the development of DCEA and help extend it to a broader spectrum.

HMM-Based Gene Annotation Methods

Energy Technology Data Exchange (ETDEWEB)

Haussler, David; Hughey, Richard; Karplus, Keven

1999-09-20

Development of new statistical methods and computational tools to identify genes in human genomic DNA, and to provide clues to their functions by identifying features such as transcription factor binding sites, tissue, specific expression and splicing patterns, and remove homologies at the protein level with genes of known function.

Combining gene prediction methods to improve metagenomic gene annotation

Directory of Open Access Journals (Sweden)

Rosen Gail L

2011-01-01

Full Text Available Abstract Background Traditional gene annotation methods rely on characteristics that may not be available in short reads generated from next generation technology, resulting in suboptimal performance for metagenomic (environmental samples. Therefore, in recent years, new programs have been developed that optimize performance on short reads. In this work, we benchmark three metagenomic gene prediction programs and combine their predictions to improve metagenomic read gene annotation. Results We not only analyze the programs' performance at different read-lengths like similar studies, but also separate different types of reads, including intra- and intergenic regions, for analysis. The main deficiencies are in the algorithms' ability to predict non-coding regions and gene edges, resulting in more false-positives and false-negatives than desired. In fact, the specificities of the algorithms are notably worse than the sensitivities. By combining the programs' predictions, we show significant improvement in specificity at minimal cost to sensitivity, resulting in 4% improvement in accuracy for 100 bp reads with ~1% improvement in accuracy for 200 bp reads and above. To correctly annotate the start and stop of the genes, we find that a consensus of all the predictors performs best for shorter read lengths while a unanimous agreement is better for longer read lengths, boosting annotation accuracy by 1-8%. We also demonstrate use of the classifier combinations on a real dataset. Conclusions To optimize the performance for both prediction and annotation accuracies, we conclude that the consensus of all methods (or a majority vote is the best for reads 400 bp and shorter, while using the intersection of GeneMark and Orphelia predictions is the best for reads 500 bp and longer. We demonstrate that most methods predict over 80% coding (including partially coding reads on a real human gut sample sequenced by Illumina technology.

Detection of anabolic androgenic steroid abuse in doping control using mammalian reporter gene bioassays.

Science.gov (United States)

Houtman, Corine J; Sterk, Saskia S; van de Heijning, Monique P M; Brouwer, Abraham; Stephany, Rainer W; van der Burg, Bart; Sonneveld, Edwin

2009-04-01

Anabolic androgenic steroids (AAS) are a class of steroid hormones related to the male hormone testosterone. They are frequently detected as drugs in sport doping control. Being similar to or derived from natural male hormones, AAS share the activation of the androgen receptor (AR) as common mechanism of action. The mammalian androgen responsive reporter gene assay (AR CALUX bioassay), measuring compounds interacting with the AR can be used for the analysis of AAS without the necessity of knowing their chemical structure beforehand, whereas current chemical-analytical approaches may have difficulty in detecting compounds with unknown structures, such as designer steroids. This study demonstrated that AAS prohibited in sports and potential designer AAS can be detected with this AR reporter gene assay, but that also additional steroid activities of AAS could be found using additional mammalian bioassays for other types of steroid hormones. Mixtures of AAS were found to behave additively in the AR reporter gene assay showing that it is possible to use this method for complex mixtures as are found in doping control samples, including mixtures that are a result of multi drug use. To test if mammalian reporter gene assays could be used for the detection of AAS in urine samples, background steroidal activities were measured. AAS-spiked urine samples, mimicking doping positive samples, showed significantly higher androgenic activities than unspiked samples. GC-MS analysis of endogenous androgens and AR reporter gene assay analysis of urine samples showed how a combined chemical-analytical and bioassay approach can be used to identify samples containing AAS. The results indicate that the AR reporter gene assay, in addition to chemical-analytical methods, can be a valuable tool for the analysis of AAS for doping control purposes.

Ultrahigh-dimensional variable selection method for whole-genome gene-gene interaction analysis

Directory of Open Access Journals (Sweden)

Ueki Masao

2012-05-01

Full Text Available Abstract Background Genome-wide gene-gene interaction analysis using single nucleotide polymorphisms (SNPs is an attractive way for identification of genetic components that confers susceptibility of human complex diseases. Individual hypothesis testing for SNP-SNP pairs as in common genome-wide association study (GWAS however involves difficulty in setting overall p-value due to complicated correlation structure, namely, the multiple testing problem that causes unacceptable false negative results. A large number of SNP-SNP pairs than sample size, so-called the large p small n problem, precludes simultaneous analysis using multiple regression. The method that overcomes above issues is thus needed. Results We adopt an up-to-date method for ultrahigh-dimensional variable selection termed the sure independence screening (SIS for appropriate handling of numerous number of SNP-SNP interactions by including them as predictor variables in logistic regression. We propose ranking strategy using promising dummy coding methods and following variable selection procedure in the SIS method suitably modified for gene-gene interaction analysis. We also implemented the procedures in a software program, EPISIS, using the cost-effective GPGPU (General-purpose computing on graphics processing units technology. EPISIS can complete exhaustive search for SNP-SNP interactions in standard GWAS dataset within several hours. The proposed method works successfully in simulation experiments and in application to real WTCCC (Wellcome Trust Case–control Consortium data. Conclusions Based on the machine-learning principle, the proposed method gives powerful and flexible genome-wide search for various patterns of gene-gene interaction.

Investigation of the molecular relationship between breast cancer and obesity by candidate gene prioritization methods

Directory of Open Access Journals (Sweden)

Saba Garshasbi

2015-10-01

Full Text Available Background: Cancer and obesity are two major public health concerns. More than 12 million cases of cancer are reported annually. Many reports confirmed obesity as a risk factor for cancer. The molecular relationship between obesity and breast cancer has not been clear yet. The purpose of this study was to investigate priorities of effective genes in the molecular relationship between obesity and breast cancer. Methods: In this study, computer simulation method was used for prioritizing the genes that involved in the molecular links between obesity and breast cancer in laboratory of systems biology and bioinformatics (LBB, Tehran University, Tehran, Iran, from March to July 2014. In this study, ENDEAVOUR software was used for prioritizing the genes and integrating multiple data sources was used for data analysis. Training genes were selected from effective genes in obesity and/or breast cancer. Two groups of candidate genes were selected. The first group was included the existential genes in 5 common region chromosomes (between obesity and breast cancer and the second group was included the results of genes microarray data analysis of research Creighton, et al (In 2012 on patients with breast cancer. The microarray data were analyzed with GER2 software (R online software on GEO website. Finally, both training and candidate genes were entered in ENDEAVOUR software package. Results: The candidate genes were prioritized to four style and five genes in ten of the first priorities were repeated twice. In other word, the outcome of prioritizing of 72 genes (Product of microarray data analysis and genes of 5 common chromosome regions (Between obesity and breast cancer showed, 5 genes (TNFRSF10B, F2, IGFALS, NTRK3 and HSP90B1 were the priorities in the molecular connection between obesity and breast cancer. Conclusion: There are some common genes between breast cancer and obesity. So, molecular relationship is confirmed. In this study the possible effect

A two-cassette reporter system for assessing target gene translation and target gene product inclusion body formation

DEFF Research Database (Denmark)

2016-01-01

The present invention relates to a dual cassette reporter system capable of assessing target gene translation and target gene product folding. The present invention further relates to vectors and host cells comprising the dual cassette reporter system. In addition the invention relates to the use...... of the dual cassette reporter system for assessing target gene translation and target gene product folding....

PET/CT imaging of human somatostatin receptor 2 (hsstr2) as reporter gene for gene therapy

International Nuclear Information System (INIS)

Hofmann, M.; Gazdhar, A.; Weitzel, T.; Schmid, R.; Krause, T.

2006-01-01

Localized information on region-selective gene expression in small animals is widely obtained by use of reporter genes inducing light emission. Using these reporter genes for imaging deep inside the human body fluorescent probes are hindered by attenuation, scattering and possible fluorescence quenching. This can be overcome by use of radio-peptide receptors as reporter genes. Therefore, the feasibility of the somatostatin receptor 2 expression vector system for expression imaging was checked against a control vector containing luciferase gene. For in vivo transduction of vector DNA into the rat forelimb muscles the in vivo electroporation technique was chosen because of its high regio-selectivity. The gene expression was imaged by high-sensitive CCD camera (luciferase activity) and by PET/CT using a Ga-68-DOTATOC as radio peptide probe. The relative sstr2 expression was enhanced by gene transduction at maximum to a factor of 15. The PET/CT images could be fully quantified. The above demonstrated feasibility of radio-peptide PET/CT reporter gene imaging may serve in the future as a tool for full quantitative understanding of regional gene expression, especially in large animals and humans

PET/CT imaging of human somatostatin receptor 2 (hsstr2) as reporter gene for gene therapy

Energy Technology Data Exchange (ETDEWEB)

Hofmann, M. [Molecular Imaging and Therapy Group (MIT-Bern), Clinic of Nuclear Medicine, Inselspital, Medical School Bern (Switzerland)]. E-mail: Michael.Hofmann@insel.ch; Gazdhar, A. [Division of Pulmonary Medicine, University Hospital Bern (Switzerland); Weitzel, T. [Molecular Imaging and Therapy Group (MIT-Bern), Clinic of Nuclear Medicine, Inselspital, Medical School Bern (Switzerland); Schmid, R. [Division of Thoracic Surgery, University Hospital Bern (Switzerland); Krause, T. [Molecular Imaging and Therapy Group (MIT-Bern), Clinic of Nuclear Medicine, Inselspital, Medical School Bern (Switzerland)

2006-12-20

Localized information on region-selective gene expression in small animals is widely obtained by use of reporter genes inducing light emission. Using these reporter genes for imaging deep inside the human body fluorescent probes are hindered by attenuation, scattering and possible fluorescence quenching. This can be overcome by use of radio-peptide receptors as reporter genes. Therefore, the feasibility of the somatostatin receptor 2 expression vector system for expression imaging was checked against a control vector containing luciferase gene. For in vivo transduction of vector DNA into the rat forelimb muscles the in vivo electroporation technique was chosen because of its high regio-selectivity. The gene expression was imaged by high-sensitive CCD camera (luciferase activity) and by PET/CT using a Ga-68-DOTATOC as radio peptide probe. The relative sstr2 expression was enhanced by gene transduction at maximum to a factor of 15. The PET/CT images could be fully quantified. The above demonstrated feasibility of radio-peptide PET/CT reporter gene imaging may serve in the future as a tool for full quantitative understanding of regional gene expression, especially in large animals and human000.

Biological Education of IVFRU and FIAU for HSV1-TK Reporter Gene Monitoring

Energy Technology Data Exchange (ETDEWEB)

Hong, Su Hee; Kim, Eun Jung; Lee, Eun Ah; Lee, Jong Chan; Choi, Tae Hyun; Lee, Kyo Chul; An, Gwang Il; Cheon, Gi Jeong [Korea Institute of Radiological and Medical Sciences, Seoul (Korea, Republic of)

2006-07-01

The Herpes Simplex Virus Type1-thymidine kinase (HSV1-TK) system is a useful gene therapy monitoring method. HSV1-TK is one of the most widely used effector gene systems used for imaging gene expression, in association with its use as a reporter gene. It has resulted the development of a number of radiolabeled HSV1-TK substrates for the non-invasive detection of HSV1-TK expression. In non-invasive imaging of the HSV1-TK system, many nucleoside derivatives have been developed as prodrugs for tumor proliferation imaging or as anti-viral drugs. Prodrug activation or sucide gene therapy has been shown to be successful in potentiating the therapeutic index by sensitizing genetically modified tumor cells to various prodrugs or enhancing the action of commonly used chemotherapeutic agents. The most studied prodrug activation approaches involve transfection of tumors with HSV1-TK gene. (Z)-5-(2-iodovinyl)-2'-fluoro- 2'-deoxyuridine (IVFRU) possesses a 2'-fluoro substituent in the ribose configuration, is considered to protect IVFRU from enzyme mediated degradation in vivo. It is obviously potential substrates for HSV1-TK imaging. 2'-Fiuoro-2'-deoxy-1-{beta}-D-arabinofuranosyl- 5-iodo-uridine (FIAU), an anticancer drug widely used in clinical practice, is an analogue of thymidine. In a series of studies using adenovirus vector for gene transfer described the appropriate combination of exogenously introduced HSV1-TK as a 'marker/reporter gene' and radiolabelled FIAU as a 'marker substrate/reporter probe' for monitoring gene therapy and gene expression.

Biological Education of IVFRU and FIAU for HSV1-TK Reporter Gene Monitoring

International Nuclear Information System (INIS)

Hong, Su Hee; Kim, Eun Jung; Lee, Eun Ah; Lee, Jong Chan; Choi, Tae Hyun; Lee, Kyo Chul; An, Gwang Il; Cheon, Gi Jeong

2006-01-01

The Herpes Simplex Virus Type1-thymidine kinase (HSV1-TK) system is a useful gene therapy monitoring method. HSV1-TK is one of the most widely used effector gene systems used for imaging gene expression, in association with its use as a reporter gene. It has resulted the development of a number of radiolabeled HSV1-TK substrates for the non-invasive detection of HSV1-TK expression. In non-invasive imaging of the HSV1-TK system, many nucleoside derivatives have been developed as prodrugs for tumor proliferation imaging or as anti-viral drugs. Prodrug activation or sucide gene therapy has been shown to be successful in potentiating the therapeutic index by sensitizing genetically modified tumor cells to various prodrugs or enhancing the action of commonly used chemotherapeutic agents. The most studied prodrug activation approaches involve transfection of tumors with HSV1-TK gene. (Z)-5-(2-iodovinyl)-2'-fluoro- 2'-deoxyuridine (IVFRU) possesses a 2'-fluoro substituent in the ribose configuration, is considered to protect IVFRU from enzyme mediated degradation in vivo. It is obviously potential substrates for HSV1-TK imaging. 2'-Fiuoro-2'-deoxy-1-β-D-arabinofuranosyl- 5-iodo-uridine (FIAU), an anticancer drug widely used in clinical practice, is an analogue of thymidine. In a series of studies using adenovirus vector for gene transfer described the appropriate combination of exogenously introduced HSV1-TK as a 'marker/reporter gene' and radiolabelled FIAU as a 'marker substrate/reporter probe' for monitoring gene therapy and gene expression

LEGO: a novel method for gene set over-representation analysis by incorporating network-based gene weights.

Science.gov (United States)

Dong, Xinran; Hao, Yun; Wang, Xiao; Tian, Weidong

2016-01-11

Pathway or gene set over-representation analysis (ORA) has become a routine task in functional genomics studies. However, currently widely used ORA tools employ statistical methods such as Fisher's exact test that reduce a pathway into a list of genes, ignoring the constitutive functional non-equivalent roles of genes and the complex gene-gene interactions. Here, we develop a novel method named LEGO (functional Link Enrichment of Gene Ontology or gene sets) that takes into consideration these two types of information by incorporating network-based gene weights in ORA analysis. In three benchmarks, LEGO achieves better performance than Fisher and three other network-based methods. To further evaluate LEGO's usefulness, we compare LEGO with five gene expression-based and three pathway topology-based methods using a benchmark of 34 disease gene expression datasets compiled by a recent publication, and show that LEGO is among the top-ranked methods in terms of both sensitivity and prioritization for detecting target KEGG pathways. In addition, we develop a cluster-and-filter approach to reduce the redundancy among the enriched gene sets, making the results more interpretable to biologists. Finally, we apply LEGO to two lists of autism genes, and identify relevant gene sets to autism that could not be found by Fisher.

Confocal quantification of cis-regulatory reporter gene expression in living sea urchin.

Science.gov (United States)

Damle, Sagar; Hanser, Bridget; Davidson, Eric H; Fraser, Scott E

2006-11-15

Quantification of GFP reporter gene expression at single cell level in living sea urchin embryos can now be accomplished by a new method of confocal laser scanning microscopy (CLSM). Eggs injected with a tissue-specific GFP reporter DNA construct were grown to gastrula stage and their fluorescence recorded as a series of contiguous Z-section slices that spanned the entire embryo. To measure the depth-dependent signal decay seen in the successive slices of an image stack, the eggs were coinjected with a freely diffusible internal fluorescent standard, rhodamine dextran. The measured rhodamine fluorescence was used to generate a computational correction for the depth-dependent loss of GFP fluorescence per slice. The intensity of GFP fluorescence was converted to the number of GFP molecules using a conversion constant derived from CLSM imaging of eggs injected with a measured quantity of GFP protein. The outcome is a validated method for accurately counting GFP molecules in given cells in reporter gene transfer experiments, as we demonstrate by use of an expression construct expressed exclusively in skeletogenic cells.

Reliable gene expression analysis by reverse transcription-quantitative PCR: reporting and minimizing the uncertainty in data accuracy.

Science.gov (United States)

Remans, Tony; Keunen, Els; Bex, Geert Jan; Smeets, Karen; Vangronsveld, Jaco; Cuypers, Ann

2014-10-01

Reverse transcription-quantitative PCR (RT-qPCR) has been widely adopted to measure differences in mRNA levels; however, biological and technical variation strongly affects the accuracy of the reported differences. RT-qPCR specialists have warned that, unless researchers minimize this variability, they may report inaccurate differences and draw incorrect biological conclusions. The Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines describe procedures for conducting and reporting RT-qPCR experiments. The MIQE guidelines enable others to judge the reliability of reported results; however, a recent literature survey found low adherence to these guidelines. Additionally, even experiments that use appropriate procedures remain subject to individual variation that statistical methods cannot correct. For example, since ideal reference genes do not exist, the widely used method of normalizing RT-qPCR data to reference genes generates background noise that affects the accuracy of measured changes in mRNA levels. However, current RT-qPCR data reporting styles ignore this source of variation. In this commentary, we direct researchers to appropriate procedures, outline a method to present the remaining uncertainty in data accuracy, and propose an intuitive way to select reference genes to minimize uncertainty. Reporting the uncertainty in data accuracy also serves for quality assessment, enabling researchers and peer reviewers to confidently evaluate the reliability of gene expression data. © 2014 American Society of Plant Biologists. All rights reserved.

Methods for monitoring multiple gene expression

Energy Technology Data Exchange (ETDEWEB)

Berka, Randy [Davis, CA; Bachkirova, Elena [Davis, CA; Rey, Michael [Davis, CA

2012-05-01

The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

Methods for monitoring multiple gene expression

Energy Technology Data Exchange (ETDEWEB)

Berka, Randy; Bachkirova, Elena; Rey, Michael

2013-10-01

The present invention relates to methods for monitoring differential expression of a plurality of genes in a first filamentous fungal cell relative to expression of the same genes in one or more second filamentous fungal cells using microarrays containing Trichoderma reesei ESTs or SSH clones, or a combination thereof. The present invention also relates to computer readable media and substrates containing such array features for monitoring expression of a plurality of genes in filamentous fungal cells.

Recombinant carcinoembryonic antigen as a reporter gene for molecular imaging

International Nuclear Information System (INIS)

Kenanova, Vania; Barat, Bhaswati; Olafsen, Tove; Chatziioannou, Arion; Herschman, Harvey R.; Wu, Anna M.; Braun, Jonathan

2009-01-01

Reporter genes can provide a way of noninvasively assessing gene activity in vivo. However, current reporter gene strategies may be limited by the immunogenicity of foreign reporter proteins, endogenous expression, or unwanted biological activity. We have developed a reporter gene based on carcinoembryonic antigen (CEA), a human protein with limited normal tissue expression. To construct a CEA reporter gene for PET, a CEA minigene (N-A3) was fused to the extracellular and transmembrane domains of the human FcγRIIb receptor. The NA3-FcγRIIb recombinant gene, driven by a CMV promoter, was transfected in Jurkat (human T cell leukemia) cells. Expression was analyzed by flow cytometry, immunohistochemistry (IHC), and microPET imaging. Flow cytometry identified Jurkat clones stably expressing NA3-FcγRIIb at low, medium, and high levels. High and medium NA3-FcγRIIb expression could also be detected by Western blot. Reporter gene positive and negative Jurkat cells were used to establish xenografts in athymic mice. IHC showed staining of the tumor with high reporter gene expression; medium and low N-A3 expression was not detected. MicroPET imaging, using an anti-CEA 124 I-labeled single-chain Fv-Fc antibody fragment, demonstrated that only high N-A3 expression could be detected. Specific accumulation of activity was visualized at the N-A3 positive tumor as early as 4 h. MicroPET image quantitation showed tumor activity of 1.8 ± 0.2, 15.2 ± 1.3, and 4.6 ± 1.2 percent injected dose per gram (%ID/g) at 4, 20, and 48 h, respectively. Biodistribution at 48 h demonstrated tumor uptake of 4.8 ± 0.8%ID/g. The CEA N-A3 minigene has the potential to be used as a reporter gene for imaging cells in vivo. (orig.)

Ratiometric Gas Reporting: A Nondisruptive Approach To Monitor Gene Expression in Soils.

Science.gov (United States)

Cheng, Hsiao-Ying; Masiello, Caroline A; Del Valle, Ilenne; Gao, Xiaodong; Bennett, George N; Silberg, Jonathan J

2018-03-16

Fluorescent proteins are ubiquitous tools that are used to monitor the dynamic functions of natural and synthetic genetic circuits. However, these visual reporters can only be used in transparent settings, a limitation that complicates nondisruptive measurements of gene expression within many matrices, such as soils and sediments. We describe a new ratiometric gas reporting method for nondisruptively monitoring gene expression within hard-to-image environmental matrices. With this approach, C 2 H 4 is continuously synthesized by ethylene forming enzyme to provide information on viable cell number, and CH 3 Br is conditionally synthesized by placing a methyl halide transferase gene under the control of a conditional promoter. We show that ratiometric gas reporting enables the creation of Escherichia coli biosensors that report on acylhomoserine lactone (AHL) autoinducers used for quorum sensing by Gram-negative bacteria. Using these biosensors, we find that an agricultural soil decreases the bioavailable concentration of a long-chain AHL up to 100-fold. We also demonstrate that these biosensors can be used in soil to nondisruptively monitor AHLs synthesized by Rhizobium leguminosarum and degraded by Bacillus thuringiensis. Finally, we show that this new reporting approach can be used in Shewanella oneidensis, a bacterium that lives in sediments.

In vivo characterization of a reporter gene system for imaging hypoxia-induced gene expression.

Science.gov (United States)

Carlin, Sean; Pugachev, Andrei; Sun, Xiaorong; Burke, Sean; Claus, Filip; O'Donoghue, Joseph; Ling, C Clifton; Humm, John L

2009-10-01

To characterize a tumor model containing a hypoxia-inducible reporter gene and to demonstrate utility by comparison of reporter gene expression to the uptake and distribution of the hypoxia tracer (18)F-fluoromisonidazole ((18)F-FMISO). Three tumors derived from the rat prostate cancer cell line R3327-AT were grown in each of two rats as follows: (1) parental R3327-AT, (2) positive control R3327-AT/PC in which the HSV1-tkeGFP fusion reporter gene was expressed constitutively, (3) R3327-AT/HRE in which the reporter gene was placed under the control of a hypoxia-inducible factor-responsive promoter sequence (HRE). Animals were coadministered a hypoxia-specific marker (pimonidazole) and the reporter gene probe (124)I-2'-fluoro-2'-deoxy-1-beta-d-arabinofuranosyl-5-iodouracil ((124)I-FIAU) 3 h prior to sacrifice. Statistical analysis of the spatial association between (124)I-FIAU uptake and pimonidazole fluorescent staining intensity was then performed on a pixel-by-pixel basis. Utility of this system was demonstrated by assessment of reporter gene expression versus the exogenous hypoxia probe (18)F-FMISO. Two rats, each bearing a single R3327-AT/HRE tumor, were injected with (124)I-FIAU (3 h before sacrifice) and (18)F-FMISO (2 h before sacrifice). Statistical analysis of the spatial association between (18)F-FMISO and (124)I-FIAU on a pixel-by-pixel basis was performed. Correlation coefficients between (124)I-FIAU uptake and pimonidazole staining intensity were: 0.11 in R3327-AT tumors, -0.66 in R3327-AT/PC and 0.76 in R3327-AT/HRE, confirming that only in the R3327-AT/HRE tumor was HSV1-tkeGFP gene expression associated with hypoxia. Correlation coefficients between (18)F-FMISO and (124)I-FIAU uptakes in R3327-AT/HRE tumors were r=0.56, demonstrating good spatial correspondence between the two tracers. We have confirmed hypoxia-specific expression of the HSV1-tkeGFP fusion gene in the R3327-AT/HRE tumor model and demonstrated the utility of this model for the

A copula method for modeling directional dependence of genes

Directory of Open Access Journals (Sweden)

Park Changyi

2008-05-01

Full Text Available Abstract Background Genes interact with each other as basic building blocks of life, forming a complicated network. The relationship between groups of genes with different functions can be represented as gene networks. With the deposition of huge microarray data sets in public domains, study on gene networking is now possible. In recent years, there has been an increasing interest in the reconstruction of gene networks from gene expression data. Recent work includes linear models, Boolean network models, and Bayesian networks. Among them, Bayesian networks seem to be the most effective in constructing gene networks. A major problem with the Bayesian network approach is the excessive computational time. This problem is due to the interactive feature of the method that requires large search space. Since fitting a model by using the copulas does not require iterations, elicitation of the priors, and complicated calculations of posterior distributions, the need for reference to extensive search spaces can be eliminated leading to manageable computational affords. Bayesian network approach produces a discretely expression of conditional probabilities. Discreteness of the characteristics is not required in the copula approach which involves use of uniform representation of the continuous random variables. Our method is able to overcome the limitation of Bayesian network method for gene-gene interaction, i.e. information loss due to binary transformation. Results We analyzed the gene interactions for two gene data sets (one group is eight histone genes and the other group is 19 genes which include DNA polymerases, DNA helicase, type B cyclin genes, DNA primases, radiation sensitive genes, repaire related genes, replication protein A encoding gene, DNA replication initiation factor, securin gene, nucleosome assembly factor, and a subunit of the cohesin complex by adopting a measure of directional dependence based on a copula function. We have compared

The progress of PET based reporter gene imaging

International Nuclear Information System (INIS)

Zhao Wei; Zhang Xiuli

2005-01-01

More than two decades of intense research have allowed gene therapy to move from the laboratory to the clinical setting, where its use for the treatment of human pathologies has been considerably increased in the last years. However, many crucial questions remain to be solved in this challenging field. In vivo imaging with positron emission tomography (PET) by combination of the appropriate PET reporter gene and PET reporter probe could provide invaluable qualitative and quantitative information to answer multiple unsolved questions about gene therapy. PET imaging could be used to define parameters not available by other techniques that are of substantial interest not only for the proper understanding of the gene therapy process, but also for its future development and clinical application in humans. (authors)

Advances of reporter gene imaging monitoring stem cell therapy

International Nuclear Information System (INIS)

Pei Zhijun; Zhang Yongxue

2010-01-01

Stem cell transplantation in the treatment of various tissue damage or degenerative diseases are research hotspots both at home and abroad. However, ignorance of the homing, differentiation and functional expression of the stem cell in vivo influence the further development of stem cell therapy. As an important component of molecular imaging technology, reporter gene imaging dynamically monitors the change of stem cell in vivo via monitoring the expression of transfected reporter gene. This paper briefly describes the latest research progress and the future development trend of the monitoring of reporter gene imaging in stem cell therapy in vivo. (authors)

A Novel ‘Gene Insertion/Marker Out’ (GIMO) Method for Transgene Expression and Gene Complementation in Rodent Malaria Parasites

Science.gov (United States)

Sajid, Mohammed; Chevalley-Maurel, Séverine; Ramesar, Jai; Klop, Onny; Franke-Fayard, Blandine M. D.; Janse, Chris J.; Khan, Shahid M.

2011-01-01

Research on the biology of malaria parasites has greatly benefited from the application of reverse genetic technologies, in particular through the analysis of gene deletion mutants and studies on transgenic parasites that express heterologous or mutated proteins. However, transfection in Plasmodium is limited by the paucity of drug-selectable markers that hampers subsequent genetic modification of the same mutant. We report the development of a novel ‘gene insertion/marker out’ (GIMO) method for two rodent malaria parasites, which uses negative selection to rapidly generate transgenic mutants ready for subsequent modifications. We have created reference mother lines for both P. berghei ANKA and P. yoelii 17XNL that serve as recipient parasites for GIMO-transfection. Compared to existing protocols GIMO-transfection greatly simplifies and speeds up the generation of mutants expressing heterologous proteins, free of drug-resistance genes, and requires far fewer laboratory animals. In addition we demonstrate that GIMO-transfection is also a simple and fast method for genetic complementation of mutants with a gene deletion or mutation. The implementation of GIMO-transfection procedures should greatly enhance Plasmodium reverse-genetic research. PMID:22216235

Comparative study on gene set and pathway topology-based enrichment methods.

Science.gov (United States)

Bayerlová, Michaela; Jung, Klaus; Kramer, Frank; Klemm, Florian; Bleckmann, Annalen; Beißbarth, Tim

2015-10-22

Enrichment analysis is a popular approach to identify pathways or sets of genes which are significantly enriched in the context of differentially expressed genes. The traditional gene set enrichment approach considers a pathway as a simple gene list disregarding any knowledge of gene or protein interactions. In contrast, the new group of so called pathway topology-based methods integrates the topological structure of a pathway into the analysis. We comparatively investigated gene set and pathway topology-based enrichment approaches, considering three gene set and four topological methods. These methods were compared in two extensive simulation studies and on a benchmark of 36 real datasets, providing the same pathway input data for all methods. In the benchmark data analysis both types of methods showed a comparable ability to detect enriched pathways. The first simulation study was conducted with KEGG pathways, which showed considerable gene overlaps between each other. In this study with original KEGG pathways, none of the topology-based methods outperformed the gene set approach. Therefore, a second simulation study was performed on non-overlapping pathways created by unique gene IDs. Here, methods accounting for pathway topology reached higher accuracy than the gene set methods, however their sensitivity was lower. We conducted one of the first comprehensive comparative works on evaluating gene set against pathway topology-based enrichment methods. The topological methods showed better performance in the simulation scenarios with non-overlapping pathways, however, they were not conclusively better in the other scenarios. This suggests that simple gene set approach might be sufficient to detect an enriched pathway under realistic circumstances. Nevertheless, more extensive studies and further benchmark data are needed to systematically evaluate these methods and to assess what gain and cost pathway topology information introduces into enrichment analysis. Both

A new electrospray method for targeted gene delivery.

Science.gov (United States)

Boehringer, Stephan; Ruzgys, Paulius; Tamò, Luca; Šatkauskas, Saulius; Geiser, Thomas; Gazdhar, Amiq; Hradetzky, David

2018-03-05

A challenge for gene therapy is absence of safe and efficient local delivery of therapeutic genetic material. An efficient and reproducible physical method of electrospray for localized and targeted gene delivery is presented. Electrospray works on the principle of coulombs repulsion, under influence of electric field the liquid carrying genetic material is dispersed into micro droplets and is accelerated towards the targeted tissue, acting as a counter electrode. The accelerated droplets penetrate the targeted cells thus facilitating the transfer of genetic material into the cell. The work described here presents the principle of electrospray for gene delivery, the basic instrument design, and the various optimized parameters to enhance gene transfer in vitro. We estimate a transfection efficiency of up to 60% was achieved. We describe an efficient gene transfer method and a potential electrospray-mediated gene transfer mechanism.

Stem Cell Gene Therapy for Fanconi Anemia: Report from the 1st International Fanconi Anemia Gene Therapy Working Group Meeting

Science.gov (United States)

Tolar, Jakub; Adair, Jennifer E; Antoniou, Michael; Bartholomae, Cynthia C; Becker, Pamela S; Blazar, Bruce R; Bueren, Juan; Carroll, Thomas; Cavazzana-Calvo, Marina; Clapp, D Wade; Dalgleish, Robert; Galy, Anne; Gaspar, H Bobby; Hanenberg, Helmut; Von Kalle, Christof; Kiem, Hans-Peter; Lindeman, Dirk; Naldini, Luigi; Navarro, Susana; Renella, Raffaele; Rio, Paula; Sevilla, Julián; Schmidt, Manfred; Verhoeyen, Els; Wagner, John E; Williams, David A; Thrasher, Adrian J

2011-01-01

Survival rates after allogeneic hematopoietic cell transplantation (HCT) for Fanconi anemia (FA) have increased dramatically since 2000. However, the use of autologous stem cell gene therapy, whereby the patient's own blood stem cells are modified to express the wild-type gene product, could potentially avoid the early and late complications of allogeneic HCT. Over the last decades, gene therapy has experienced a high degree of optimism interrupted by periods of diminished expectation. Optimism stems from recent examples of successful gene correction in several congenital immunodeficiencies, whereas diminished expectations come from the realization that gene therapy will not be free of side effects. The goal of the 1st International Fanconi Anemia Gene Therapy Working Group Meeting was to determine the optimal strategy for moving stem cell gene therapy into clinical trials for individuals with FA. To this end, key investigators examined vector design, transduction method, criteria for large-scale clinical-grade vector manufacture, hematopoietic cell preparation, and eligibility criteria for FA patients most likely to benefit. The report summarizes the roadmap for the development of gene therapy for FA. PMID:21540837

Cloning-free regulated monitoring of reporter and gene expression

Directory of Open Access Journals (Sweden)

Demirkaya Omer

2009-03-01

Full Text Available Abstract Background The majority of the promoters, their regulatory elements, and their variations in the human genome remain unknown. Reporter gene technology for transcriptional activity is a widely used tool for the study of promoter structure, gene regulation, and signaling pathways. Construction of transcriptional reporter vectors, including use of cis-acting sequences, requires cloning and time-demanding manipulations, particularly with introduced mutations. Results In this report, we describe a cloning-free strategy to generate transcriptionally-controllable linear reporter constructs. This approach was applied in common transcriptional models of inflammatory response and the interferon system. In addition, it was used to delineate minimal transcriptional activity of selected ribosomal protein promoters. The approach was tested for conversion of genes into TetO-inducible/repressible expression cassettes. Conclusion The simple introduction and tuning of any transcriptional control in the linear DNA product renders promoter activation and regulated gene studies simple and versatile.

Development and evaluation of an efficient heterologous gene knock-in reporter system in Lactococcus lactis.

Science.gov (United States)

Lu, Yifei; Yan, Hongxiang; Deng, Jiezhong; Huang, Zhigang; Jin, Xurui; Yu, Yanlan; Hu, Qiwen; Hu, Fuquan; Wang, Jing

2017-09-18

Lactococcus lactis is a food grade probiotics and widely used to express heterologous proteins. Generally, target genes are knocked into the L. lactis genome through double-crossover recombination to express heterologous proteins stably. However, creating marker-less heterologous genes knocked-in clones is laborious. In this study, an efficient heterologous gene knock-in reporter system was developed in L. lactis NZ9000. Our knock-in reporter system consists of a temperature-sensitive plasmid pJW and a recombinant L. lactis strain named NZB. The pJW contains homologous arms, and was constructed to knock-in heterologous genes at a fixed locus of NZ9000 genome. lacZ (β-galactosidase) gene was knocked into the chromosome of NZ9000 as a counter-selective marker through the plasmid pJW to generate NZB. The engineered NZB strain formed blue colonies on X-Gal plate. The desired double-crossover mutants formed white colonies distinctive from the predominantly blue colonies (parental and plasmid-integrated clones) when the embedded lacZ was replaced with the target heterologous genes carried by pJW in NZB. By using the system, the heterologous gene knocked-in clones are screened by colony phenotype change rather than by checking colonies individually. Our new knock-in reporter system provides an efficient method to create heterologous genes knocked-in clones.

GxGrare: gene-gene interaction analysis method for rare variants from high-throughput sequencing data.

Science.gov (United States)

Kwon, Minseok; Leem, Sangseob; Yoon, Joon; Park, Taesung

2018-03-19

With the rapid advancement of array-based genotyping techniques, genome-wide association studies (GWAS) have successfully identified common genetic variants associated with common complex diseases. However, it has been shown that only a small proportion of the genetic etiology of complex diseases could be explained by the genetic factors identified from GWAS. This missing heritability could possibly be explained by gene-gene interaction (epistasis) and rare variants. There has been an exponential growth of gene-gene interaction analysis for common variants in terms of methodological developments and practical applications. Also, the recent advancement of high-throughput sequencing technologies makes it possible to conduct rare variant analysis. However, little progress has been made in gene-gene interaction analysis for rare variants. Here, we propose GxGrare which is a new gene-gene interaction method for the rare variants in the framework of the multifactor dimensionality reduction (MDR) analysis. The proposed method consists of three steps; 1) collapsing the rare variants, 2) MDR analysis for the collapsed rare variants, and 3) detect top candidate interaction pairs. GxGrare can be used for the detection of not only gene-gene interactions, but also interactions within a single gene. The proposed method is illustrated with 1080 whole exome sequencing data of the Korean population in order to identify causal gene-gene interaction for rare variants for type 2 diabetes. The proposed GxGrare performs well for gene-gene interaction detection with collapsing of rare variants. GxGrare is available at http://bibs.snu.ac.kr/software/gxgrare which contains simulation data and documentation. Supported operating systems include Linux and OS X.

Developmentally regulated expression of reporter gene in adult ...

Indian Academy of Sciences (India)

pression of reporter gene in adult brain specific GAL4 enhancer traps of. Drosophila ... genes based on their expression pattern, thus enabling us to overcome the ... order association and storage centres of olfactory learning and memory, and ...

Biclustering methods: biological relevance and application in gene expression analysis.

Directory of Open Access Journals (Sweden)

Ali Oghabian

Full Text Available DNA microarray technologies are used extensively to profile the expression levels of thousands of genes under various conditions, yielding extremely large data-matrices. Thus, analyzing this information and extracting biologically relevant knowledge becomes a considerable challenge. A classical approach for tackling this challenge is to use clustering (also known as one-way clustering methods where genes (or respectively samples are grouped together based on the similarity of their expression profiles across the set of all samples (or respectively genes. An alternative approach is to develop biclustering methods to identify local patterns in the data. These methods extract subgroups of genes that are co-expressed across only a subset of samples and may feature important biological or medical implications. In this study we evaluate 13 biclustering and 2 clustering (k-means and hierarchical methods. We use several approaches to compare their performance on two real gene expression data sets. For this purpose we apply four evaluation measures in our analysis: (1 we examine how well the considered (biclustering methods differentiate various sample types; (2 we evaluate how well the groups of genes discovered by the (biclustering methods are annotated with similar Gene Ontology categories; (3 we evaluate the capability of the methods to differentiate genes that are known to be specific to the particular sample types we study and (4 we compare the running time of the algorithms. In the end, we conclude that as long as the samples are well defined and annotated, the contamination of the samples is limited, and the samples are well replicated, biclustering methods such as Plaid and SAMBA are useful for discovering relevant subsets of genes and samples.

GSMA: Gene Set Matrix Analysis, An Automated Method for Rapid Hypothesis Testing of Gene Expression Data

Directory of Open Access Journals (Sweden)

Chris Cheadle

2007-01-01

Full Text Available Background: Microarray technology has become highly valuable for identifying complex global changes in gene expression patterns. The assignment of functional information to these complex patterns remains a challenging task in effectively interpreting data and correlating results from across experiments, projects and laboratories. Methods which allow the rapid and robust evaluation of multiple functional hypotheses increase the power of individual researchers to data mine gene expression data more efficiently.Results: We have developed (gene set matrix analysis GSMA as a useful method for the rapid testing of group-wise up- or downregulation of gene expression simultaneously for multiple lists of genes (gene sets against entire distributions of gene expression changes (datasets for single or multiple experiments. The utility of GSMA lies in its flexibility to rapidly poll gene sets related by known biological function or as designated solely by the end-user against large numbers of datasets simultaneously.Conclusions: GSMA provides a simple and straightforward method for hypothesis testing in which genes are tested by groups across multiple datasets for patterns of expression enrichment.

An extensive analysis of disease-gene associations using network integration and fast kernel-based gene prioritization methods

Science.gov (United States)

Valentini, Giorgio; Paccanaro, Alberto; Caniza, Horacio; Romero, Alfonso E.; Re, Matteo

2014-01-01

Objective In the context of “network medicine”, gene prioritization methods represent one of the main tools to discover candidate disease genes by exploiting the large amount of data covering different types of functional relationships between genes. Several works proposed to integrate multiple sources of data to improve disease gene prioritization, but to our knowledge no systematic studies focused on the quantitative evaluation of the impact of network integration on gene prioritization. In this paper, we aim at providing an extensive analysis of gene-disease associations not limited to genetic disorders, and a systematic comparison of different network integration methods for gene prioritization. Materials and methods We collected nine different functional networks representing different functional relationships between genes, and we combined them through both unweighted and weighted network integration methods. We then prioritized genes with respect to each of the considered 708 medical subject headings (MeSH) diseases by applying classical guilt-by-association, random walk and random walk with restart algorithms, and the recently proposed kernelized score functions. Results The results obtained with classical random walk algorithms and the best single network achieved an average area under the curve (AUC) across the 708 MeSH diseases of about 0.82, while kernelized score functions and network integration boosted the average AUC to about 0.89. Weighted integration, by exploiting the different “informativeness” embedded in different functional networks, outperforms unweighted integration at 0.01 significance level, according to the Wilcoxon signed rank sum test. For each MeSH disease we provide the top-ranked unannotated candidate genes, available for further bio-medical investigation. Conclusions Network integration is necessary to boost the performances of gene prioritization methods. Moreover the methods based on kernelized score functions can further

Two-Way Gene Interaction From Microarray Data Based on Correlation Methods.

Science.gov (United States)

Alavi Majd, Hamid; Talebi, Atefeh; Gilany, Kambiz; Khayyer, Nasibeh

2016-06-01

Gene networks have generated a massive explosion in the development of high-throughput techniques for monitoring various aspects of gene activity. Networks offer a natural way to model interactions between genes, and extracting gene network information from high-throughput genomic data is an important and difficult task. The purpose of this study is to construct a two-way gene network based on parametric and nonparametric correlation coefficients. The first step in constructing a Gene Co-expression Network is to score all pairs of gene vectors. The second step is to select a score threshold and connect all gene pairs whose scores exceed this value. In the foundation-application study, we constructed two-way gene networks using nonparametric methods, such as Spearman's rank correlation coefficient and Blomqvist's measure, and compared them with Pearson's correlation coefficient. We surveyed six genes of venous thrombosis disease, made a matrix entry representing the score for the corresponding gene pair, and obtained two-way interactions using Pearson's correlation, Spearman's rank correlation, and Blomqvist's coefficient. Finally, these methods were compared with Cytoscape, based on BIND, and Gene Ontology, based on molecular function visual methods; R software version 3.2 and Bioconductor were used to perform these methods. Based on the Pearson and Spearman correlations, the results were the same and were confirmed by Cytoscape and GO visual methods; however, Blomqvist's coefficient was not confirmed by visual methods. Some results of the correlation coefficients are not the same with visualization. The reason may be due to the small number of data.

State of the Art of Fuzzy Methods for Gene Regulatory Networks Inference

Directory of Open Access Journals (Sweden)

Tuqyah Abdullah Al Qazlan

2015-01-01

Full Text Available To address one of the most challenging issues at the cellular level, this paper surveys the fuzzy methods used in gene regulatory networks (GRNs inference. GRNs represent causal relationships between genes that have a direct influence, trough protein production, on the life and the development of living organisms and provide a useful contribution to the understanding of the cellular functions as well as the mechanisms of diseases. Fuzzy systems are based on handling imprecise knowledge, such as biological information. They provide viable computational tools for inferring GRNs from gene expression data, thus contributing to the discovery of gene interactions responsible for specific diseases and/or ad hoc correcting therapies. Increasing computational power and high throughput technologies have provided powerful means to manage these challenging digital ecosystems at different levels from cell to society globally. The main aim of this paper is to report, present, and discuss the main contributions of this multidisciplinary field in a coherent and structured framework.

Clustering based gene expression feature selection method: A computational approach to enrich the classifier efficiency of differentially expressed genes

KAUST Repository

Abusamra, Heba

2016-07-20

The native nature of high dimension low sample size of gene expression data make the classification task more challenging. Therefore, feature (gene) selection become an apparent need. Selecting a meaningful and relevant genes for classifier not only decrease the computational time and cost, but also improve the classification performance. Among different approaches of feature selection methods, however most of them suffer from several problems such as lack of robustness, validation issues etc. Here, we present a new feature selection technique that takes advantage of clustering both samples and genes. Materials and methods We used leukemia gene expression dataset [1]. The effectiveness of the selected features were evaluated by four different classification methods; support vector machines, k-nearest neighbor, random forest, and linear discriminate analysis. The method evaluate the importance and relevance of each gene cluster by summing the expression level for each gene belongs to this cluster. The gene cluster consider important, if it satisfies conditions depend on thresholds and percentage otherwise eliminated. Results Initial analysis identified 7120 differentially expressed genes of leukemia (Fig. 15a), after applying our feature selection methodology we end up with specific 1117 genes discriminating two classes of leukemia (Fig. 15b). Further applying the same method with more stringent higher positive and lower negative threshold condition, number reduced to 58 genes have be tested to evaluate the effectiveness of the method (Fig. 15c). The results of the four classification methods are summarized in Table 11. Conclusions The feature selection method gave good results with minimum classification error. Our heat-map result shows distinct pattern of refines genes discriminating between two classes of leukemia.

Visualization of ecdysteroid activity using a reporter gene in the crustacean, Daphnia.

Science.gov (United States)

Asada, Miki; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime

2014-02-01

Ecdysone is a hormone known to play a pivotal role in crustaceans and insects. In order to evaluate the ecdysone activities in the environment and within the organism, we have developed a biomonitoring Daphnia strain by introducing a reporter gene. In this study, the ecdysone response element was inserted in the upstream region of a reporter gene, and the DNA construct was injected into Daphnia eggs. The expression of the reporter gene was detected during the early embryonic development stage. In addition, when the eggs expressing the reporter gene were exposed to ecdysone, there was enhanced expression of the reporter gene at detectable levels, while the presence of an antagonist led to its downregulation. These results suggested that this system could be potentially developed for monitoring ecdysone activities in media. Copyright © 2013 Elsevier Ltd. All rights reserved.

[Gene method for inconsistent hydrological frequency calculation. 2: Diagnosis system of hydrological genes and method of hydrological moment genes with inconsistent characters].

Science.gov (United States)

Xie, Ping; Zhao, Jiang Yan; Wu, Zi Yi; Sang, Yan Fang; Chen, Jie; Li, Bin Bin; Gu, Hai Ting

2018-04-01

The analysis of inconsistent hydrological series is one of the major problems that should be solved for engineering hydrological calculation in changing environment. In this study, the diffe-rences of non-consistency and non-stationarity were analyzed from the perspective of composition of hydrological series. The inconsistent hydrological phenomena were generalized into hydrological processes with inheritance, variability and evolution characteristics or regulations. Furthermore, the hydrological genes were identified following the theory of biological genes, while their inheritance bases and variability bases were determined based on composition of hydrological series under diffe-rent time scales. To identify and test the components of hydrological genes, we constructed a diagnosis system of hydrological genes. With the P-3 distribution as an example, we described the process of construction and expression of the moment genes to illustrate the inheritance, variability and evolution principles of hydrological genes. With the annual minimum 1-month runoff series of Yunjinghong station in Lancangjiang River basin as an example, we verified the feasibility and practicability of hydrological gene theory for the calculation of inconsistent hydrological frequency. The results showed that the method could be used to reveal the evolution of inconsistent hydrological series. Therefore, it provided a new research pathway for engineering hydrological calculation in changing environment and an essential reference for the assessment of water security.

Development of functional genomic tools in trematodes: RNA interference and luciferase reporter gene activity in Fasciola hepatica.

Directory of Open Access Journals (Sweden)

Gabriel Rinaldi

2008-07-01

Full Text Available The growing availability of sequence information from diverse parasites through genomic and transcriptomic projects offer new opportunities for the identification of key mediators in the parasite-host interaction. Functional genomics approaches and methods for the manipulation of genes are essential tools for deciphering the roles of genes and to identify new intervention targets in parasites. Exciting advances in functional genomics for parasitic helminths are starting to occur, with transgene expression and RNA interference (RNAi reported in several species of nematodes, but the area is still in its infancy in flatworms, with reports in just three species. While advancing in model organisms, there is a need to rapidly extend these technologies to other parasites responsible for several chronic diseases of humans and cattle. In order to extend these approaches to less well studied parasitic worms, we developed a test method for the presence of a viable RNAi pathway by silencing the exogenous reporter gene, firefly luciferase (fLUC. We established the method in the human blood fluke Schistosoma mansoni and then confirmed its utility in the liver fluke Fasciola hepatica. We transformed newly excysted juveniles of F. hepatica by electroporation with mRNA of fLUC and three hours later were able to detect luciferase enzyme activity, concentrated mainly in the digestive ceca. Subsequently, we tested the presence of an active RNAi pathway in F. hepatica by knocking down the exogenous luciferase activity by introduction into the transformed parasites of double-stranded RNA (dsRNA specific for fLUC. In addition, we tested the RNAi pathway targeting an endogenous F. hepatica gene encoding leucine aminopeptidase (FhLAP, and observed a significant reduction in specific mRNA levels. In summary, these studies demonstrated the utility of RNAi targeting reporter fLUC as a reporter gene assay to establish the presence of an intact RNAi pathway in helminth

Gene set analysis: limitations in popular existing methods and proposed improvements.

Science.gov (United States)

Mishra, Pashupati; Törönen, Petri; Leino, Yrjö; Holm, Liisa

2014-10-01

Gene set analysis is the analysis of a set of genes that collectively contribute to a biological process. Most popular gene set analysis methods are based on empirical P-value that requires large number of permutations. Despite numerous gene set analysis methods developed in the past decade, the most popular methods still suffer from serious limitations. We present a gene set analysis method (mGSZ) based on Gene Set Z-scoring function (GSZ) and asymptotic P-values. Asymptotic P-value calculation requires fewer permutations, and thus speeds up the gene set analysis process. We compare the GSZ-scoring function with seven popular gene set scoring functions and show that GSZ stands out as the best scoring function. In addition, we show improved performance of the GSA method when the max-mean statistics is replaced by the GSZ scoring function. We demonstrate the importance of both gene and sample permutations by showing the consequences in the absence of one or the other. A comparison of asymptotic and empirical methods of P-value estimation demonstrates a clear advantage of asymptotic P-value over empirical P-value. We show that mGSZ outperforms the state-of-the-art methods based on two different evaluations. We compared mGSZ results with permutation and rotation tests and show that rotation does not improve our asymptotic P-values. We also propose well-known asymptotic distribution models for three of the compared methods. mGSZ is available as R package from cran.r-project.org. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Molecular Imaging of Human Embryonic Stem Cells Stably Expressing Human PET Reporter Genes After Zinc Finger Nuclease-Mediated Genome Editing.

Science.gov (United States)

Wolfs, Esther; Holvoet, Bryan; Ordovas, Laura; Breuls, Natacha; Helsen, Nicky; Schönberger, Matthias; Raitano, Susanna; Struys, Tom; Vanbilloen, Bert; Casteels, Cindy; Sampaolesi, Maurilio; Van Laere, Koen; Lambrichts, Ivo; Verfaillie, Catherine M; Deroose, Christophe M

2017-10-01

Molecular imaging is indispensable for determining the fate and persistence of engrafted stem cells. Standard strategies for transgene induction involve the use of viral vectors prone to silencing and insertional mutagenesis or the use of nonhuman genes. Methods: We used zinc finger nucleases to induce stable expression of human imaging reporter genes into the safe-harbor locus adeno-associated virus integration site 1 in human embryonic stem cells. Plasmids were generated carrying reporter genes for fluorescence, bioluminescence imaging, and human PET reporter genes. Results: In vitro assays confirmed their functionality, and embryonic stem cells retained differentiation capacity. Teratoma formation assays were performed, and tumors were imaged over time with PET and bioluminescence imaging. Conclusion: This study demonstrates the application of genome editing for targeted integration of human imaging reporter genes in human embryonic stem cells for long-term molecular imaging. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.

A comparative study of three different gene expression analysis methods.

Science.gov (United States)

Choe, Jae Young; Han, Hyung Soo; Lee, Seon Duk; Lee, Hanna; Lee, Dong Eun; Ahn, Jae Yun; Ryoo, Hyun Wook; Seo, Kang Suk; Kim, Jong Kun

2017-12-04

TNF-α regulates immune cells and acts as an endogenous pyrogen. Reverse transcription polymerase chain reaction (RT-PCR) is one of the most commonly used methods for gene expression analysis. Among the alternatives to PCR, loop-mediated isothermal amplification (LAMP) shows good potential in terms of specificity and sensitivity. However, few studies have compared RT-PCR and LAMP for human gene expression analysis. Therefore, in the present study, we compared one-step RT-PCR, two-step RT-LAMP and one-step RT-LAMP for human gene expression analysis. We compared three gene expression analysis methods using the human TNF-α gene as a biomarker from peripheral blood cells. Total RNA from the three selected febrile patients were subjected to the three different methods of gene expression analysis. In the comparison of three gene expression analysis methods, the detection limit of both one-step RT-PCR and one-step RT-LAMP were the same, while that of two-step RT-LAMP was inferior. One-step RT-LAMP takes less time, and the experimental result is easy to determine. One-step RT-LAMP is a potentially useful and complementary tool that is fast and reasonably sensitive. In addition, one-step RT-LAMP could be useful in environments lacking specialized equipment or expertise.

Advances in study of perpes simplex virus type 1-thymidine kinase reporter gene imaging

International Nuclear Information System (INIS)

Liu Ying; Lan Xiaoli; Zhang Yongxue

2007-01-01

Radionuclide reporter gene imaging is an effect way to provide qualitative and quantitative information for gene therapy. There are three systems of reporter gene including kinase reporter gene. perpes simplex virus type 1-thymidine kinase (HSV1-tk) has perfect physical and chemical characteristic which is suit for imaging as reporter gene. It has been widely investigated and intensively researched. Two substrates of HSV1-tk are purine nucleosite derivant and acyclovir derivant, which can also be used as reporter probes of HSV1-tk. (authors)

An extensive analysis of disease-gene associations using network integration and fast kernel-based gene prioritization methods.

Science.gov (United States)

Valentini, Giorgio; Paccanaro, Alberto; Caniza, Horacio; Romero, Alfonso E; Re, Matteo

2014-06-01

In the context of "network medicine", gene prioritization methods represent one of the main tools to discover candidate disease genes by exploiting the large amount of data covering different types of functional relationships between genes. Several works proposed to integrate multiple sources of data to improve disease gene prioritization, but to our knowledge no systematic studies focused on the quantitative evaluation of the impact of network integration on gene prioritization. In this paper, we aim at providing an extensive analysis of gene-disease associations not limited to genetic disorders, and a systematic comparison of different network integration methods for gene prioritization. We collected nine different functional networks representing different functional relationships between genes, and we combined them through both unweighted and weighted network integration methods. We then prioritized genes with respect to each of the considered 708 medical subject headings (MeSH) diseases by applying classical guilt-by-association, random walk and random walk with restart algorithms, and the recently proposed kernelized score functions. The results obtained with classical random walk algorithms and the best single network achieved an average area under the curve (AUC) across the 708 MeSH diseases of about 0.82, while kernelized score functions and network integration boosted the average AUC to about 0.89. Weighted integration, by exploiting the different "informativeness" embedded in different functional networks, outperforms unweighted integration at 0.01 significance level, according to the Wilcoxon signed rank sum test. For each MeSH disease we provide the top-ranked unannotated candidate genes, available for further bio-medical investigation. Network integration is necessary to boost the performances of gene prioritization methods. Moreover the methods based on kernelized score functions can further enhance disease gene ranking results, by adopting both

An Efficient Ensemble Learning Method for Gene Microarray Classification

Directory of Open Access Journals (Sweden)

Alireza Osareh

2013-01-01

Full Text Available The gene microarray analysis and classification have demonstrated an effective way for the effective diagnosis of diseases and cancers. However, it has been also revealed that the basic classification techniques have intrinsic drawbacks in achieving accurate gene classification and cancer diagnosis. On the other hand, classifier ensembles have received increasing attention in various applications. Here, we address the gene classification issue using RotBoost ensemble methodology. This method is a combination of Rotation Forest and AdaBoost techniques which in turn preserve both desirable features of an ensemble architecture, that is, accuracy and diversity. To select a concise subset of informative genes, 5 different feature selection algorithms are considered. To assess the efficiency of the RotBoost, other nonensemble/ensemble techniques including Decision Trees, Support Vector Machines, Rotation Forest, AdaBoost, and Bagging are also deployed. Experimental results have revealed that the combination of the fast correlation-based feature selection method with ICA-based RotBoost ensemble is highly effective for gene classification. In fact, the proposed method can create ensemble classifiers which outperform not only the classifiers produced by the conventional machine learning but also the classifiers generated by two widely used conventional ensemble learning methods, that is, Bagging and AdaBoost.

AGROBEST: an efficient Agrobacterium-mediated transient expression method for versatile gene function analyses in Arabidopsis seedlings

Science.gov (United States)

2014-01-01

Background Transient gene expression via Agrobacterium-mediated DNA transfer offers a simple and fast method to analyze transgene functions. Although Arabidopsis is the most-studied model plant with powerful genetic and genomic resources, achieving highly efficient and consistent transient expression for gene function analysis in Arabidopsis remains challenging. Results We developed a highly efficient and robust Agrobacterium-mediated transient expression system, named AGROBEST (Agrobacterium-mediated enhanced seedling transformation), which achieves versatile analysis of diverse gene functions in intact Arabidopsis seedlings. Using β-glucuronidase (GUS) as a reporter for Agrobacterium-mediated transformation assay, we show that the use of a specific disarmed Agrobacterium strain with vir gene pre-induction resulted in homogenous GUS staining in cotyledons of young Arabidopsis seedlings. Optimization with AB salts in plant culture medium buffered with acidic pH 5.5 during Agrobacterium infection greatly enhanced the transient expression levels, which were significantly higher than with two existing methods. Importantly, the optimized method conferred 100% infected seedlings with highly increased transient expression in shoots and also transformation events in roots of ~70% infected seedlings in both the immune receptor mutant efr-1 and wild-type Col-0 seedlings. Finally, we demonstrated the versatile applicability of the method for examining transcription factor action and circadian reporter-gene regulation as well as protein subcellular localization and protein–protein interactions in physiological contexts. Conclusions AGROBEST is a simple, fast, reliable, and robust transient expression system enabling high transient expression and transformation efficiency in Arabidopsis seedlings. Demonstration of the proof-of-concept experiments elevates the transient expression technology to the level of functional studies in Arabidopsis seedlings in addition to previous

Alpha-fetoprotein-targeted reporter gene expression imaging in hepatocellular carcinoma.

Science.gov (United States)

Kim, Kwang Il; Chung, Hye Kyung; Park, Ju Hui; Lee, Yong Jin; Kang, Joo Hyun

2016-07-21

Hepatocellular carcinoma (HCC) is one of the most common cancers in Eastern Asia, and its incidence is increasing globally. Numerous experimental models have been developed to better our understanding of the pathogenic mechanism of HCC and to evaluate novel therapeutic approaches. Molecular imaging is a convenient and up-to-date biomedical tool that enables the visualization, characterization and quantification of biologic processes in a living subject. Molecular imaging based on reporter gene expression, in particular, can elucidate tumor-specific events or processes by acquiring images of a reporter gene's expression driven by tumor-specific enhancers/promoters. In this review, we discuss the advantages and disadvantages of various experimental HCC mouse models and we present in vivo images of tumor-specific reporter gene expression driven by an alpha-fetoprotein (AFP) enhancer/promoter system in a mouse model of HCC. The current mouse models of HCC development are established by xenograft, carcinogen induction and genetic engineering, representing the spectrum of tumor-inducing factors and tumor locations. The imaging analysis approach of reporter genes driven by AFP enhancer/promoter is presented for these different HCC mouse models. Such molecular imaging can provide longitudinal information about carcinogenesis and tumor progression. We expect that clinical application of AFP-targeted reporter gene expression imaging systems will be useful for the detection of AFP-expressing HCC tumors and screening of increased/decreased AFP levels due to disease or drug treatment.

A relative variation-based method to unraveling gene regulatory networks.

Directory of Open Access Journals (Sweden)

Yali Wang

Full Text Available Gene regulatory network (GRN reconstruction is essential in understanding the functioning and pathology of a biological system. Extensive models and algorithms have been developed to unravel a GRN. The DREAM project aims to clarify both advantages and disadvantages of these methods from an application viewpoint. An interesting yet surprising observation is that compared with complicated methods like those based on nonlinear differential equations, etc., methods based on a simple statistics, such as the so-called Z-score, usually perform better. A fundamental problem with the Z-score, however, is that direct and indirect regulations can not be easily distinguished. To overcome this drawback, a relative expression level variation (RELV based GRN inference algorithm is suggested in this paper, which consists of three major steps. Firstly, on the basis of wild type and single gene knockout/knockdown experimental data, the magnitude of RELV of a gene is estimated. Secondly, probability for the existence of a direct regulation from a perturbed gene to a measured gene is estimated, which is further utilized to estimate whether a gene can be regulated by other genes. Finally, the normalized RELVs are modified to make genes with an estimated zero in-degree have smaller RELVs in magnitude than the other genes, which is used afterwards in queuing possibilities of the existence of direct regulations among genes and therefore leads to an estimate on the GRN topology. This method can in principle avoid the so-called cascade errors under certain situations. Computational results with the Size 100 sub-challenges of DREAM3 and DREAM4 show that, compared with the Z-score based method, prediction performances can be substantially improved, especially the AUPR specification. Moreover, it can even outperform the best team of both DREAM3 and DREAM4. Furthermore, the high precision of the obtained most reliable predictions shows that the suggested algorithm may be

Non-invasive imaging using reporter genes altering cellular water permeability

Science.gov (United States)

Mukherjee, Arnab; Wu, Di; Davis, Hunter C.; Shapiro, Mikhail G.

2016-12-01

Non-invasive imaging of gene expression in live, optically opaque animals is important for multiple applications, including monitoring of genetic circuits and tracking of cell-based therapeutics. Magnetic resonance imaging (MRI) could enable such monitoring with high spatiotemporal resolution. However, existing MRI reporter genes based on metalloproteins or chemical exchange probes are limited by their reliance on metals or relatively low sensitivity. Here we introduce a new class of MRI reporters based on the human water channel aquaporin 1. We show that aquaporin overexpression produces contrast in diffusion-weighted MRI by increasing tissue water diffusivity without affecting viability. Low aquaporin levels or mixed populations comprising as few as 10% aquaporin-expressing cells are sufficient to produce MRI contrast. We characterize this new contrast mechanism through experiments and simulations, and demonstrate its utility in vivo by imaging gene expression in tumours. Our results establish an alternative class of sensitive, metal-free reporter genes for non-invasive imaging.

Molecular MR imaging of cancer gene therapy. Ferritin transgene reporter takes the stage

International Nuclear Information System (INIS)

Hasegawa, Sumitaka; Furukawa, Takako; Saga, Tsuneo

2010-01-01

Molecular imaging using magnetic resonance (MR) imaging has been actively investigated and made rapid progress in the past decade. Applied to cancer gene therapy, the technique's high spatial resolution allows evaluation of gene delivery into target tissues. Because noninvasive monitoring of the duration, location, and magnitude of transgene expression in tumor tissues or cells provides useful information for assessing therapeutic efficacy and optimizing protocols, molecular imaging is expected to become a critical step in the success of cancer gene therapy in the near future. We present a brief overview of the current status of molecular MR imaging, especially in vivo reporter gene imaging using ferritin and other reporters, discuss its application to cancer gene therapy, and present our research of MR imaging detection of electroporation-mediated cancer gene therapy using the ferritin reporter gene. (author)

Reporter gene bioassays in environmental analysis.

Science.gov (United States)

Köhler, S; Belkin, S; Schmid, R D

2000-01-01

In parallel to the continuous development of increasingly more sophisticated physical and chemical analytical technologies for the detection of environmental pollutants, there is a progressively more urgent need also for bioassays which report not only on the presence of a chemical but also on its bioavailability and its biological effects. As a partial fulfillment of that need, there has been a rapid development of biosensors based on genetically engineered bacteria. Such microorganisms typically combine a promoter-operator, which acts as the sensing element, with reporter gene(s) coding for easily detectable proteins. These sensors have the ability to detect global parameters such as stress conditions, toxicity or DNA-damaging agents as well as specific organic and inorganic compounds. The systems described in this review, designed to detect different groups of target chemicals, vary greatly in their detection limits, specificity, response times and more. These variations reflect on their potential applicability which, for most of the constructs described, is presently rather limited. Nevertheless, present trends promise that additional improvements will make microbial biosensors an important tool for future environmental analysis.

Detection of biomarkers for Hepatocellular Carcinoma using a hybrid univariate gene selection methods

Directory of Open Access Journals (Sweden)

Abdel Samee Nagwan M

2012-08-01

Full Text Available Abstract Background Discovering new biomarkers has a great role in improving early diagnosis of Hepatocellular carcinoma (HCC. The experimental determination of biomarkers needs a lot of time and money. This motivates this work to use in-silico prediction of biomarkers to reduce the number of experiments required for detecting new ones. This is achieved by extracting the most representative genes in microarrays of HCC. Results In this work, we provide a method for extracting the differential expressed genes, up regulated ones, that can be considered candidate biomarkers in high throughput microarrays of HCC. We examine the power of several gene selection methods (such as Pearson’s correlation coefficient, Cosine coefficient, Euclidean distance, Mutual information and Entropy with different estimators in selecting informative genes. A biological interpretation of the highly ranked genes is done using KEGG (Kyoto Encyclopedia of Genes and Genomes pathways, ENTREZ and DAVID (Database for Annotation, Visualization, and Integrated Discovery databases. The top ten genes selected using Pearson’s correlation coefficient and Cosine coefficient contained six genes that have been implicated in cancer (often multiple cancers genesis in previous studies. A fewer number of genes were obtained by the other methods (4 genes using Mutual information, 3genes using Euclidean distance and only one gene using Entropy. A better result was obtained by the utilization of a hybrid approach based on intersecting the highly ranked genes in the output of all investigated methods. This hybrid combination yielded seven genes (2 genes for HCC and 5 genes in different types of cancer in the top ten genes of the list of intersected genes. Conclusions To strengthen the effectiveness of the univariate selection methods, we propose a hybrid approach by intersecting several of these methods in a cascaded manner. This approach surpasses all of univariate selection methods when

Evaluation of gene association methods for coexpression network construction and biological knowledge discovery.

Directory of Open Access Journals (Sweden)

Sapna Kumari

Full Text Available BACKGROUND: Constructing coexpression networks and performing network analysis using large-scale gene expression data sets is an effective way to uncover new biological knowledge; however, the methods used for gene association in constructing these coexpression networks have not been thoroughly evaluated. Since different methods lead to structurally different coexpression networks and provide different information, selecting the optimal gene association method is critical. METHODS AND RESULTS: In this study, we compared eight gene association methods - Spearman rank correlation, Weighted Rank Correlation, Kendall, Hoeffding's D measure, Theil-Sen, Rank Theil-Sen, Distance Covariance, and Pearson - and focused on their true knowledge discovery rates in associating pathway genes and construction coordination networks of regulatory genes. We also examined the behaviors of different methods to microarray data with different properties, and whether the biological processes affect the efficiency of different methods. CONCLUSIONS: We found that the Spearman, Hoeffding and Kendall methods are effective in identifying coexpressed pathway genes, whereas the Theil-sen, Rank Theil-Sen, Spearman, and Weighted Rank methods perform well in identifying coordinated transcription factors that control the same biological processes and traits. Surprisingly, the widely used Pearson method is generally less efficient, and so is the Distance Covariance method that can find gene pairs of multiple relationships. Some analyses we did clearly show Pearson and Distance Covariance methods have distinct behaviors as compared to all other six methods. The efficiencies of different methods vary with the data properties to some degree and are largely contingent upon the biological processes, which necessitates the pre-analysis to identify the best performing method for gene association and coexpression network construction.

Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data

DEFF Research Database (Denmark)

Kannan, Soumya; Sams, Thomas; Maury, Jérôme

2018-01-01

activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system......Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds......, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter...

Cross-organism learning method to discover new gene functionalities.

Science.gov (United States)

Domeniconi, Giacomo; Masseroli, Marco; Moro, Gianluca; Pinoli, Pietro

2016-04-01

Knowledge of gene and protein functions is paramount for the understanding of physiological and pathological biological processes, as well as in the development of new drugs and therapies. Analyses for biomedical knowledge discovery greatly benefit from the availability of gene and protein functional feature descriptions expressed through controlled terminologies and ontologies, i.e., of gene and protein biomedical controlled annotations. In the last years, several databases of such annotations have become available; yet, these valuable annotations are incomplete, include errors and only some of them represent highly reliable human curated information. Computational techniques able to reliably predict new gene or protein annotations with an associated likelihood value are thus paramount. Here, we propose a novel cross-organisms learning approach to reliably predict new functionalities for the genes of an organism based on the known controlled annotations of the genes of another, evolutionarily related and better studied, organism. We leverage a new representation of the annotation discovery problem and a random perturbation of the available controlled annotations to allow the application of supervised algorithms to predict with good accuracy unknown gene annotations. Taking advantage of the numerous gene annotations available for a well-studied organism, our cross-organisms learning method creates and trains better prediction models, which can then be applied to predict new gene annotations of a target organism. We tested and compared our method with the equivalent single organism approach on different gene annotation datasets of five evolutionarily related organisms (Homo sapiens, Mus musculus, Bos taurus, Gallus gallus and Dictyostelium discoideum). Results show both the usefulness of the perturbation method of available annotations for better prediction model training and a great improvement of the cross-organism models with respect to the single-organism ones

Feasibility of sodium/iodide symporter gene as a new imaging reporter gene: comparison with HSV1-tk

International Nuclear Information System (INIS)

Shin, Jae Hoon; Chung, June-Key; Lee, Yong Jin; Kim, Kwang Il; Kang, Joo Hyun; Jeong, Jae Min; Lee, Dong Soo; Kim, Chul Woo; Lee, Myung Chul

2004-01-01

Positron emission tomography (PET) imaging reporter genes, such as HSV1-tk and D 2 receptor genes, make it possible to visualise gene expression non-invasively and repetitively in vivo. However, these systems require the synthesis of complicated substrates and the availability of expensive PET equipment. Expression of the sodium/iodide symporter (NIS) gene can be easily monitored with radioiodines and technetium-99m using a gamma camera. To evaluate the possibility of using NIS as an imaging reporter gene, we compared its characteristics with those of the conventional HSV1-tk gene. The CM cell line was made by transfecting the HSV1-tk gene into CT-26 (mouse colon carcinoma cell line). The CTN and CMN cell lines were then made by transfecting the NIS gene into CT-26 and CM. We measured the uptake of iodine-125 iodovinyldeoxyuridine ([ 125 I]IVDU) and 125 I to evaluate the expression of the HSV1-tk and NIS genes, respectively. Each cell line was injected into four flank sites in Balb/c mice. The biodistribution study was performed after intravenously injecting [ 125 I]IVDU and 131 I, and 131 I scintigraphy was performed for the evaluation of NIS expression. In vitro studies indicated that CTN and CMN had 40- to 79-fold and 150- to 256-fold higher uptake of 125 I than CT-26 and CM, respectively. Furthermore, CM and CMN showed 57- to 69-fold higher uptake of [ 125 I]IVDU than CT-26 and CTN. NIS gene expression and 125 I accumulation were found to be directly correlated (R 2 =0.923), as were HSV1-tk gene expression and [ 125 I]IVDU accumulation (R 2 =0.956). Calculated signal per unit NIS and HSV1-tk mRNA expression was 23,240±3,755 cpm and 34,039±5,346 cpm, respectively. In vivo study indicated that CTN and CMN had 2.3- and 5.8-fold higher uptake of 131 I than CT-26 and CM, and 1.8- and 3.5-fold higher uptake of [ 125 I]IVDU than CT-26 and CTN. Scintigraphy using 131 I easily visualised CTN and CMN tumours. In conclusion, the NIS gene may be viewed as an imaging

Comparative analysis of clustering methods for gene expression time course data

Directory of Open Access Journals (Sweden)

Ivan G. Costa

2004-01-01

Full Text Available This work performs a data driven comparative study of clustering methods used in the analysis of gene expression time courses (or time series. Five clustering methods found in the literature of gene expression analysis are compared: agglomerative hierarchical clustering, CLICK, dynamical clustering, k-means and self-organizing maps. In order to evaluate the methods, a k-fold cross-validation procedure adapted to unsupervised methods is applied. The accuracy of the results is assessed by the comparison of the partitions obtained in these experiments with gene annotation, such as protein function and series classification.

Gene polymorphisms in association with self-reported stroke in US adults

Directory of Open Access Journals (Sweden)

Amy Z Fan

2010-03-01

Full Text Available Amy Z Fan1, Jing Fang1, Ajay Yesupriya2, Man-huei Chang2, Greta Kilmer1, Meaghan House3, Donald Hayes1, Renée M Ned2, Nicole F Dowling2, Ali H Mokdad1 1National Center for Chronic Disease Prevention and Health Promotion, Centers for Disease Control and Prevention, Atlanta, GA, USA; 2Office of Public Health Genomics, Coordinating Center for Health Promotion, Centers for Disease Control and Prevention, Atlanta, GA, USA; 3School of Public Health, Emory University, Atlanta, GA, USAPurpose: Epidemiologic studies suggest that several gene variants increase the risk of stroke, and population-based studies help provide further evidence. We identified polymorphisms associated with the prevalence of self-reported stroke in US populations using a representative sample.Methods: Our sample comprised US adults in the Third National Health and Nutrition Examination (NHANES III DNA bank. We examined nine candidate gene variants within ACE, F2, F5, ITGA2, MTHFR, and NOS3 for associations with self-reported stroke. We used multivariate regression and Cox proportional hazards models to test the association between these variants and history of stroke.Results: In regression models, the rs4646994 variant of ACE (I/I and I/D genotypes was associated with higher prevalence adjusted prevalence odds ratio [APOR] = 2.66 [1.28, 5.55] and 2.23 [1.30, 3.85], respectively compared with the D/D genotype. The heterozygous genotype of MTHFR rs1801131 (A/C was associated with lower prevalence of stroke (APOR = 0.48 [0.25, 0.92] compared with A/A and C/C genotypes. For rs2070744 of NOS3, both the C/T genotype (APOR = 1.91 [1.12, 3.27] and C/C genotype (APOR = 3.31 [1.66, 6.60] were associated with higher prevalence of stroke compared with the T/T genotype.Conclusion: Our findings suggest an association between the prevalence of self-reported stroke and polymorphisms in ACE, MTHFR, and NOS3 in a population-based sample. Keywords: stroke, gene, polymorphisms, NHANES III, gene

A large-scale benchmark of gene prioritization methods.

Science.gov (United States)

Guala, Dimitri; Sonnhammer, Erik L L

2017-04-21

In order to maximize the use of results from high-throughput experimental studies, e.g. GWAS, for identification and diagnostics of new disease-associated genes, it is important to have properly analyzed and benchmarked gene prioritization tools. While prospective benchmarks are underpowered to provide statistically significant results in their attempt to differentiate the performance of gene prioritization tools, a strategy for retrospective benchmarking has been missing, and new tools usually only provide internal validations. The Gene Ontology(GO) contains genes clustered around annotation terms. This intrinsic property of GO can be utilized in construction of robust benchmarks, objective to the problem domain. We demonstrate how this can be achieved for network-based gene prioritization tools, utilizing the FunCoup network. We use cross-validation and a set of appropriate performance measures to compare state-of-the-art gene prioritization algorithms: three based on network diffusion, NetRank and two implementations of Random Walk with Restart, and MaxLink that utilizes network neighborhood. Our benchmark suite provides a systematic and objective way to compare the multitude of available and future gene prioritization tools, enabling researchers to select the best gene prioritization tool for the task at hand, and helping to guide the development of more accurate methods.

Evolutionary signatures amongst disease genes permit novel methods for gene prioritization and construction of informative gene-based networks.

Directory of Open Access Journals (Sweden)

Nolan Priedigkeit

2015-02-01

Full Text Available Genes involved in the same function tend to have similar evolutionary histories, in that their rates of evolution covary over time. This coevolutionary signature, termed Evolutionary Rate Covariation (ERC, is calculated using only gene sequences from a set of closely related species and has demonstrated potential as a computational tool for inferring functional relationships between genes. To further define applications of ERC, we first established that roughly 55% of genetic diseases posses an ERC signature between their contributing genes. At a false discovery rate of 5% we report 40 such diseases including cancers, developmental disorders and mitochondrial diseases. Given these coevolutionary signatures between disease genes, we then assessed ERC's ability to prioritize known disease genes out of a list of unrelated candidates. We found that in the presence of an ERC signature, the true disease gene is effectively prioritized to the top 6% of candidates on average. We then apply this strategy to a melanoma-associated region on chromosome 1 and identify MCL1 as a potential causative gene. Furthermore, to gain global insight into disease mechanisms, we used ERC to predict molecular connections between 310 nominally distinct diseases. The resulting "disease map" network associates several diseases with related pathogenic mechanisms and unveils many novel relationships between clinically distinct diseases, such as between Hirschsprung's disease and melanoma. Taken together, these results demonstrate the utility of molecular evolution as a gene discovery platform and show that evolutionary signatures can be used to build informative gene-based networks.

A hybrid computational method for the discovery of novel reproduction-related genes.

Science.gov (United States)

Chen, Lei; Chu, Chen; Kong, Xiangyin; Huang, Guohua; Huang, Tao; Cai, Yu-Dong

2015-01-01

Uncovering the molecular mechanisms underlying reproduction is of great importance to infertility treatment and to the generation of healthy offspring. In this study, we discovered novel reproduction-related genes with a hybrid computational method, integrating three different types of method, which offered new clues for further reproduction research. This method was first executed on a weighted graph, constructed based on known protein-protein interactions, to search the shortest paths connecting any two known reproduction-related genes. Genes occurring in these paths were deemed to have a special relationship with reproduction. These newly discovered genes were filtered with a randomization test. Then, the remaining genes were further selected according to their associations with known reproduction-related genes measured by protein-protein interaction score and alignment score obtained by BLAST. The in-depth analysis of the high confidence novel reproduction genes revealed hidden mechanisms of reproduction and provided guidelines for further experimental validations.

Using the 2A Protein Coexpression System: Multicistronic 2A Vectors Expressing Gene(s) of Interest and Reporter Proteins.

Science.gov (United States)

Luke, Garry A; Ryan, Martin D

2018-01-01

To date, a huge range of different proteins-many with cotranslational and posttranslational subcellular localization signals-have been coexpressed together with various reporter proteins in vitro and in vivo using 2A peptides. The pros and cons of 2A co-expression technology are considered below, followed by a simple example of a "how to" protocol to concatenate multiple genes of interest, together with a reporter gene, into a single gene linked via 2As for easy identification or selection of transduced cells.

Multiplex PCR assay for detection of recombinant genes encoding fatty acid desaturases fused with lichenase reporter protein in GM plants.

Science.gov (United States)

Berdichevets, Iryna N; Shimshilashvili, Hristina R; Gerasymenko, Iryna M; Sindarovska, Yana R; Sheludko, Yuriy V; Goldenkova-Pavlova, Irina V

2010-07-01

Thermostable lichenase encoded by licB gene of Clostridium thermocellum can be used as a reporter protein in plant, bacterial, yeast, and mammalian cells. It has important advantages of high sensitivity and specificity in qualitative and quantitative assays. Deletion variants of LicB (e.g., LicBM3) retain its enzymatic activity and thermostability and can be expressed in translational fusion with target proteins without compromising with their properties. Fusion with the lichenase reporter is especially convenient for the heterologous expression of proteins whose analysis is difficult or compromised by host enzyme activities, as it is in case of fatty acid desaturases occurring in all groups of organisms. Recombinant desaturase-lichenase genes can be used for creating genetically modified (GM) plants with improved chill tolerance. Development of an analytical method for detection of fused desaturase-lichenase transgenes is necessary both for production of GM plants and for their certification. Here, we report a multiplex polymerase chain reaction method for detection of desA and desC desaturase genes of cyanobacteria Synechocystis sp. PCC6803 and Synechococcus vulcanus, respectively, fused to licBM3 reporter in GM plants.

The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

Science.gov (United States)

Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

2017-01-01

Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

A general method for identifying major hybrid male sterility genes in Drosophila.

Science.gov (United States)

Zeng, L W; Singh, R S

1995-10-01

The genes responsible for hybrid male sterility in species crosses are usually identified by introgressing chromosome segments, monitored by visible markers, between closely related species by continuous backcrosses. This commonly used method, however, suffers from two problems. First, it relies on the availability of markers to monitor the introgressed regions and so the portion of the genome examined is limited to the marked regions. Secondly, the introgressed regions are usually large and it is impossible to tell if the effects of the introgressed regions are the result of single (or few) major genes or many minor genes (polygenes). Here we introduce a simple and general method for identifying putative major hybrid male sterility genes which is free of these problems. In this method, the actual hybrid male sterility genes (rather than markers), or tightly linked gene complexes with large effects, are selectively introgressed from one species into the background of another species by repeated backcrosses. This is performed by selectively backcrossing heterozygous (for hybrid male sterility gene or genes) females producing fertile and sterile sons in roughly equal proportions to males of either parental species. As no marker gene is required for this procedure, this method can be used with any species pairs that produce unisexual sterility. With the application of this method, a small X chromosome region of Drosophila mauritiana which produces complete hybrid male sterility (aspermic testes) in the background of D. simulans was identified. Recombination analysis reveals that this region contains a second major hybrid male sterility gene linked to the forked locus located at either 62.7 +/- 0.66 map units or at the centromere region of the X chromosome of D. mauritiana.

An ensemble method to predict target genes and pathways in uveal melanoma

Directory of Open Access Journals (Sweden)

Wei Chao

2018-04-01

Full Text Available This work proposes to predict target genes and pathways for uveal melanoma (UM based on an ensemble method and pathway analyses. Methods: The ensemble method integrated a correlation method (Pearson correlation coefficient, PCC, a causal inference method (IDA and a regression method (Lasso utilizing the Borda count election method. Subsequently, to validate the performance of PIL method, comparisons between confirmed database and predicted miRNA targets were performed. Ultimately, pathway enrichment analysis was conducted on target genes in top 1000 miRNA-mRNA interactions to identify target pathways for UM patients. Results: Thirty eight of the predicted interactions were matched with the confirmed interactions, indicating that the ensemble method was a suitable and feasible approach to predict miRNA targets. We obtained 50 seed miRNA-mRNA interactions of UM patients and extracted target genes from these interactions, such as ASPG, BSDC1 and C4BP. The 601 target genes in top 1,000 miRNA-mRNA interactions were enriched in 12 target pathways, of which Phototransduction was the most significant one. Conclusion: The target genes and pathways might provide a new way to reveal the molecular mechanism of UM and give hand for target treatments and preventions of this malignant tumor.

Gene cluster statistics with gene families.

Science.gov (United States)

Raghupathy, Narayanan; Durand, Dannie

2009-05-01

analysis in genomes of various sizes and illustrate the utility of our methods by applying them to gene clusters recently reported in the literature. Mathematical code to compute cluster probabilities using our methods is available as supplementary material.

[Myocardial single photon emission tomography imaging of reporter gene expression in rabbits].

Science.gov (United States)

Liu, Ying; Lan, Xiao-li; Zhang, Liang; Wu, Tao; Jiang, Ri-feng; Zhang, Yong-xue

2009-06-01

To explore the feasibility of single photon emission computed tomography (SPECT) detection of heart reporter gene expression and observed the optimal transfecting titer and imaging time by using herpes simplex virus 1-thymidine kinase (HSV1-tk) as reporter gene and 131I-2'-fluoro-2'-deoxy-1-beta-D-arabinofuranosyl-5-iodouracil (131I-FIAU) as reporter probe in rabbit myocardium. The recombinant Ad-tk carrying HSV1-tk gene and adenovirus (Ad) as vector was constructed and intramyocardially injected to rabbits at various concentrations (1 x 10(9) pfu, 5 x 10(8) pfu, 1 x 10(8) pfu, 5 x 10(7) pfu, 1 x 10(7) pfu). Two days later, rabbits were injected with 600 microCi 131I-FIAU in ear-margin vein and then underwent SPECT myocardium imaging for detection of HSV1-tk expression at 6 h, 24 h, 48 h and 72 h after injection, rabbits with 1 x 10(9) pfu Ad-tk injection were imaged at 96 h and 120 h. Rabbits were sacrificed after imaging and the total myocardial 131I-FIAU accumulation was quantified in percent of injected dose per gram myocardium (% ID/g). The myocardial Ad-tk expression was determined with RT-PCR. Reporter gene was detected by SPECT imaging in the injection site while not detected in the control myocardium and site remote from injection. RT-PCR results also evidenced HSV1-tk express in the injection site. The SPECT target/nontarget ratio was correlated with ex vivo gamma-counting (r2 = 0.933, Ppfu by SPECT imaging. The cardiac SPECT reporter gene imaging with HSV1-tk as reporter gene and 131I-FIAU as reporter probe is feasible.

Impact of ubiquitous inhibitors on the GUS gene reporter system: evidence from the model plants Arabidopsis, tobacco and rice and correction methods for quantitative assays of transgenic and endogenous GUS

Directory of Open Access Journals (Sweden)

Gerola Paolo D

2009-12-01

Full Text Available Abstract Background The β-glucuronidase (GUS gene reporter system is one of the most effective and employed techniques in the study of gene regulation in plant molecular biology. Improving protocols for GUS assays have rendered the original method described by Jefferson amenable to various requirements and conditions, but the serious limitation caused by inhibitors of the enzyme activity in plant tissues has thus far been underestimated. Results We report that inhibitors of GUS activity are ubiquitous in organ tissues of Arabidopsis, tobacco and rice, and significantly bias quantitative assessment of GUS activity in plant transformation experiments. Combined with previous literature reports on non-model species, our findings suggest that inhibitors may be common components of plant cells, with variable affinity towards the E. coli enzyme. The reduced inhibitory capacity towards the plant endogenous GUS discredits the hypothesis of a regulatory role of these compounds in plant cells, and their effect on the bacterial enzyme is better interpreted as a side effect due to their interaction with GUS during the assay. This is likely to have a bearing also on histochemical analyses, leading to inaccurate evaluations of GUS expression. Conclusions In order to achieve reliable results, inhibitor activity should be routinely tested during quantitative GUS assays. Two separate methods to correct the measured activity of the transgenic and endogenous GUS are presented.

Robust gene selection methods using weighting schemes for microarray data analysis.

Science.gov (United States)

Kang, Suyeon; Song, Jongwoo

2017-09-02

A common task in microarray data analysis is to identify informative genes that are differentially expressed between two different states. Owing to the high-dimensional nature of microarray data, identification of significant genes has been essential in analyzing the data. However, the performances of many gene selection techniques are highly dependent on the experimental conditions, such as the presence of measurement error or a limited number of sample replicates. We have proposed new filter-based gene selection techniques, by applying a simple modification to significance analysis of microarrays (SAM). To prove the effectiveness of the proposed method, we considered a series of synthetic datasets with different noise levels and sample sizes along with two real datasets. The following findings were made. First, our proposed methods outperform conventional methods for all simulation set-ups. In particular, our methods are much better when the given data are noisy and sample size is small. They showed relatively robust performance regardless of noise level and sample size, whereas the performance of SAM became significantly worse as the noise level became high or sample size decreased. When sufficient sample replicates were available, SAM and our methods showed similar performance. Finally, our proposed methods are competitive with traditional methods in classification tasks for microarrays. The results of simulation study and real data analysis have demonstrated that our proposed methods are effective for detecting significant genes and classification tasks, especially when the given data are noisy or have few sample replicates. By employing weighting schemes, we can obtain robust and reliable results for microarray data analysis.

Novel method to load multiple genes onto a mammalian artificial chromosome.

Directory of Open Access Journals (Sweden)

Anna Tóth

Full Text Available Mammalian artificial chromosomes are natural chromosome-based vectors that may carry a vast amount of genetic material in terms of both size and number. They are reasonably stable and segregate well in both mitosis and meiosis. A platform artificial chromosome expression system (ACEs was earlier described with multiple loading sites for a modified lambda-integrase enzyme. It has been shown that this ACEs is suitable for high-level industrial protein production and the treatment of a mouse model for a devastating human disorder, Krabbe's disease. ACEs-treated mutant mice carrying a therapeutic gene lived more than four times longer than untreated counterparts. This novel gene therapy method is called combined mammalian artificial chromosome-stem cell therapy. At present, this method suffers from the limitation that a new selection marker gene should be present for each therapeutic gene loaded onto the ACEs. Complex diseases require the cooperative action of several genes for treatment, but only a limited number of selection marker genes are available and there is also a risk of serious side-effects caused by the unwanted expression of these marker genes in mammalian cells, organs and organisms. We describe here a novel method to load multiple genes onto the ACEs by using only two selectable marker genes. These markers may be removed from the ACEs before therapeutic application. This novel technology could revolutionize gene therapeutic applications targeting the treatment of complex disorders and cancers. It could also speed up cell therapy by allowing researchers to engineer a chromosome with a predetermined set of genetic factors to differentiate adult stem cells, embryonic stem cells and induced pluripotent stem (iPS cells into cell types of therapeutic value. It is also a suitable tool for the investigation of complex biochemical pathways in basic science by producing an ACEs with several genes from a signal transduction pathway of interest.

Novel method to load multiple genes onto a mammalian artificial chromosome.

Science.gov (United States)

Tóth, Anna; Fodor, Katalin; Praznovszky, Tünde; Tubak, Vilmos; Udvardy, Andor; Hadlaczky, Gyula; Katona, Robert L

2014-01-01

Mammalian artificial chromosomes are natural chromosome-based vectors that may carry a vast amount of genetic material in terms of both size and number. They are reasonably stable and segregate well in both mitosis and meiosis. A platform artificial chromosome expression system (ACEs) was earlier described with multiple loading sites for a modified lambda-integrase enzyme. It has been shown that this ACEs is suitable for high-level industrial protein production and the treatment of a mouse model for a devastating human disorder, Krabbe's disease. ACEs-treated mutant mice carrying a therapeutic gene lived more than four times longer than untreated counterparts. This novel gene therapy method is called combined mammalian artificial chromosome-stem cell therapy. At present, this method suffers from the limitation that a new selection marker gene should be present for each therapeutic gene loaded onto the ACEs. Complex diseases require the cooperative action of several genes for treatment, but only a limited number of selection marker genes are available and there is also a risk of serious side-effects caused by the unwanted expression of these marker genes in mammalian cells, organs and organisms. We describe here a novel method to load multiple genes onto the ACEs by using only two selectable marker genes. These markers may be removed from the ACEs before therapeutic application. This novel technology could revolutionize gene therapeutic applications targeting the treatment of complex disorders and cancers. It could also speed up cell therapy by allowing researchers to engineer a chromosome with a predetermined set of genetic factors to differentiate adult stem cells, embryonic stem cells and induced pluripotent stem (iPS) cells into cell types of therapeutic value. It is also a suitable tool for the investigation of complex biochemical pathways in basic science by producing an ACEs with several genes from a signal transduction pathway of interest.

A hybrid network-based method for the detection of disease-related genes

Science.gov (United States)

Cui, Ying; Cai, Meng; Dai, Yang; Stanley, H. Eugene

2018-02-01

Detecting disease-related genes is crucial in disease diagnosis and drug design. The accepted view is that neighbors of a disease-causing gene in a molecular network tend to cause the same or similar diseases, and network-based methods have been recently developed to identify novel hereditary disease-genes in available biomedical networks. Despite the steady increase in the discovery of disease-associated genes, there is still a large fraction of disease genes that remains under the tip of the iceberg. In this paper we exploit the topological properties of the protein-protein interaction (PPI) network to detect disease-related genes. We compute, analyze, and compare the topological properties of disease genes with non-disease genes in PPI networks. We also design an improved random forest classifier based on these network topological features, and a cross-validation test confirms that our method performs better than previous similar studies.

A new computational method for the detection of horizontal gene transfer events.

Science.gov (United States)

Tsirigos, Aristotelis; Rigoutsos, Isidore

2005-01-01

In recent years, the increase in the amounts of available genomic data has made it easier to appreciate the extent by which organisms increase their genetic diversity through horizontally transferred genetic material. Such transfers have the potential to give rise to extremely dynamic genomes where a significant proportion of their coding DNA has been contributed by external sources. Because of the impact of these horizontal transfers on the ecological and pathogenic character of the recipient organisms, methods are continuously sought that are able to computationally determine which of the genes of a given genome are products of transfer events. In this paper, we introduce and discuss a novel computational method for identifying horizontal transfers that relies on a gene's nucleotide composition and obviates the need for knowledge of codon boundaries. In addition to being applicable to individual genes, the method can be easily extended to the case of clusters of horizontally transferred genes. With the help of an extensive and carefully designed set of experiments on 123 archaeal and bacterial genomes, we demonstrate that the new method exhibits significant improvement in sensitivity when compared to previously published approaches. In fact, it achieves an average relative improvement across genomes of between 11 and 41% compared to the Codon Adaptation Index method in distinguishing native from foreign genes. Our method's horizontal gene transfer predictions for 123 microbial genomes are available online at http://cbcsrv.watson.ibm.com/HGT/.

Gene Transfection Method Using Atmospheric Pressure Dielectric-Barrier Discharge Plasmas

Science.gov (United States)

Sasaki, Shota; Kanzaki, Makoto; Kaneko, Toshiro

2013-09-01

Gene transfection which is the process of deliberately introducing nucleic acids into cells is expected to play an important role in medical treatment because the process is necessary for gene therapy and creation of induced pluripotent stem (iPS) cells. However, the conventional transfection methods have some problems, so we focus attention on promising transfection methods by atmospheric pressure dielectric-barrier discharge (AP-DBD) plasmas. AP-DBD He plasmas are irradiated to the living cell covered with genes. Preliminarily, we use fluorescent dye YOYO-1 instead of the genes and use LIVE/DEAD Stain for cell viability test, and we analyze the transfection efficiency and cell viability under the various conditions. It is clarified that the transfection efficiency is strongly dependence on the plasma irradiation time and cell viability rates is high rates (>90%) regardless of long plasma irradiation time. These results suggest that ROS (Reactive Oxygen Species) and electric field generated by the plasma affect the gene transfection. In addition to this (the plasma irradiation time) dependency, we now investigate the effect of the plasma irradiation under the various conditions.

Combining random gene fission and rational gene fusion to discover near-infrared fluorescent protein fragments that report on protein-protein interactions.

Science.gov (United States)

Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J

2015-05-15

Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.

LGscore: A method to identify disease-related genes using biological literature and Google data.

Science.gov (United States)

Kim, Jeongwoo; Kim, Hyunjin; Yoon, Youngmi; Park, Sanghyun

2015-04-01

Since the genome project in 1990s, a number of studies associated with genes have been conducted and researchers have confirmed that genes are involved in disease. For this reason, the identification of the relationships between diseases and genes is important in biology. We propose a method called LGscore, which identifies disease-related genes using Google data and literature data. To implement this method, first, we construct a disease-related gene network using text-mining results. We then extract gene-gene interactions based on co-occurrences in abstract data obtained from PubMed, and calculate the weights of edges in the gene network by means of Z-scoring. The weights contain two values: the frequency and the Google search results. The frequency value is extracted from literature data, and the Google search result is obtained using Google. We assign a score to each gene through a network analysis. We assume that genes with a large number of links and numerous Google search results and frequency values are more likely to be involved in disease. For validation, we investigated the top 20 inferred genes for five different diseases using answer sets. The answer sets comprised six databases that contain information on disease-gene relationships. We identified a significant number of disease-related genes as well as candidate genes for Alzheimer's disease, diabetes, colon cancer, lung cancer, and prostate cancer. Our method was up to 40% more accurate than existing methods. Copyright © 2015 Elsevier Inc. All rights reserved.

Physical non-viral gene delivery methods for tissue engineering.

Science.gov (United States)

Mellott, Adam J; Forrest, M Laird; Detamore, Michael S

2013-03-01

The integration of gene therapy into tissue engineering to control differentiation and direct tissue formation is not a new concept; however, successful delivery of nucleic acids into primary cells, progenitor cells, and stem cells has proven exceptionally challenging. Viral vectors are generally highly effective at delivering nucleic acids to a variety of cell populations, both dividing and non-dividing, yet these viral vectors are marred by significant safety concerns. Non-viral vectors are preferred for gene therapy, despite lower transfection efficiencies, and possess many customizable attributes that are desirable for tissue engineering applications. However, there is no single non-viral gene delivery strategy that "fits-all" cell types and tissues. Thus, there is a compelling opportunity to examine different non-viral vectors, especially physical vectors, and compare their relative degrees of success. This review examines the advantages and disadvantages of physical non-viral methods (i.e., microinjection, ballistic gene delivery, electroporation, sonoporation, laser irradiation, magnetofection, and electric field-induced molecular vibration), with particular attention given to electroporation because of its versatility, with further special emphasis on Nucleofection™. In addition, attributes of cellular character that can be used to improve differentiation strategies are examined for tissue engineering applications. Ultimately, electroporation exhibits a high transfection efficiency in many cell types, which is highly desirable for tissue engineering applications, but electroporation and other physical non-viral gene delivery methods are still limited by poor cell viability. Overcoming the challenge of poor cell viability in highly efficient physical non-viral techniques is the key to using gene delivery to enhance tissue engineering applications.

Physical non-viral gene delivery methods for tissue engineering

Science.gov (United States)

Mellott, Adam J.; Forrest, M. Laird; Detamore, Michael S.

2016-01-01

The integration of gene therapy into tissue engineering to control differentiation and direct tissue formation is not a new concept; however, successful delivery of nucleic acids into primary cells, progenitor cells, and stem cells has proven exceptionally challenging. Viral vectors are generally highly effective at delivering nucleic acids to a variety of cell populations, both dividing and non-dividing, yet these viral vectors are marred by significant safety concerns. Non-viral vectors are preferred for gene therapy, despite lower transfection efficiencies, and possess many customizable attributes that are desirable for tissue engineering applications. However, there is no single non-viral gene delivery strategy that “fits-all” cell types and tissues. Thus, there is a compelling opportunity to examine different non-viral vectors, especially physical vectors, and compare their relative degrees of success. This review examines the advantages and disadvantages of physical non-viral methods (i.e., microinjection, ballistic gene delivery, electroporation, sonoporation, laser irradiation, magnetofection, and electric field-induced molecular vibration), with particular attention given to electroporation because of its versatility, with further special emphasis on Nucleofection™. In addition, attributes of cellular character that can be used to improve differentiation strategies are examined for tissue engineering applications. Ultimately, electroporation exhibits a high transfection efficiency in many cell types, which is highly desirable for tissue engineering applications, but electroporation and other physical non-viral gene delivery methods are still limited by poor cell viability. Overcoming the challenge of poor cell viability in highly efficient physical non-viral techniques is the key to using gene delivery to enhance tissue engineering applications. PMID:23099792

Endogenous Locus Reporter Assays.

Science.gov (United States)

Liu, Yaping; Hermes, Jeffrey; Li, Jing; Tudor, Matthew

2018-01-01

Reporter gene assays are widely used in high-throughput screening (HTS) to identify compounds that modulate gene expression. Traditionally a reporter gene assay is built by cloning an endogenous promoter sequence or synthetic response elements in the regulatory region of a reporter gene to monitor transcriptional activity of a specific biological process (exogenous reporter assay). In contrast, an endogenous locus reporter has a reporter gene inserted in the endogenous gene locus that allows the reporter gene to be expressed under the control of the same regulatory elements as the endogenous gene, thus more accurately reflecting the changes seen in the regulation of the actual gene. In this chapter, we introduce some of the considerations behind building a reporter gene assay for high-throughput compound screening and describe the methods we have utilized to establish 1536-well format endogenous locus reporter and exogenous reporter assays for the screening of compounds that modulate Myc pathway activity.

A novel binary T-vector with the GFP reporter gene for promoter characterization.

Directory of Open Access Journals (Sweden)

Shu-Ye Jiang

Full Text Available Several strategies have been developed to clone PCR fragments into desired vectors. However, most of commercially available T-vectors are not binary vectors and cannot be directly used for Agrobacterium-mediated plant genetic transformation. In this study, a novel binary T-vector was constructed by integrating two AhdI restriction sites into the backbone vector pCAMBIA 1300. The T-vector also contains a GFP reporter gene and thus, can be used to analyze promoter activity by monitoring the reporter gene. On the other hand, identification and characterization of various promoters not only benefit the functional annotation of their genes but also provide alternative candidates to be used to drive interesting genes for plant genetic improvement by transgenesis. More than 1,000 putative pollen-specific rice genes have been identified in a genome-wide level. Among them, 67 highly expressed genes were further characterized. One of the pollen-specific genes LOC_Os10g35930 was further surveyed in its expression patterns with more details by quantitative real-time reverse-transcription PCR (qRT-PCR analysis. Finally, its promoter activity was further investigated by analyzing transgenic rice plants carrying the promoter::GFP cassette, which was constructed from the newly developed T-vector. The reporter GFP gene expression in these transgenic plants showed that the promoter was active only in mature but not in germinated pollens.

The Ability of Different Imputation Methods to Preserve the Significant Genes and Pathways in Cancer

Directory of Open Access Journals (Sweden)

Rosa Aghdam

2017-12-01

Full Text Available Deciphering important genes and pathways from incomplete gene expression data could facilitate a better understanding of cancer. Different imputation methods can be applied to estimate the missing values. In our study, we evaluated various imputation methods for their performance in preserving significant genes and pathways. In the first step, 5% genes are considered in random for two types of ignorable and non-ignorable missingness mechanisms with various missing rates. Next, 10 well-known imputation methods were applied to the complete datasets. The significance analysis of microarrays (SAM method was applied to detect the significant genes in rectal and lung cancers to showcase the utility of imputation approaches in preserving significant genes. To determine the impact of different imputation methods on the identification of important genes, the chi-squared test was used to compare the proportions of overlaps between significant genes detected from original data and those detected from the imputed datasets. Additionally, the significant genes are tested for their enrichment in important pathways, using the ConsensusPathDB. Our results showed that almost all the significant genes and pathways of the original dataset can be detected in all imputed datasets, indicating that there is no significant difference in the performance of various imputation methods tested. The source code and selected datasets are available on http://profiles.bs.ipm.ir/softwares/imputation_methods/.

A novel mutual information-based Boolean network inference method from time-series gene expression data.

Directory of Open Access Journals (Sweden)

Shohag Barman

Full Text Available Inferring a gene regulatory network from time-series gene expression data in systems biology is a challenging problem. Many methods have been suggested, most of which have a scalability limitation due to the combinatorial cost of searching a regulatory set of genes. In addition, they have focused on the accurate inference of a network structure only. Therefore, there is a pressing need to develop a network inference method to search regulatory genes efficiently and to predict the network dynamics accurately.In this study, we employed a Boolean network model with a restricted update rule scheme to capture coarse-grained dynamics, and propose a novel mutual information-based Boolean network inference (MIBNI method. Given time-series gene expression data as an input, the method first identifies a set of initial regulatory genes using mutual information-based feature selection, and then improves the dynamics prediction accuracy by iteratively swapping a pair of genes between sets of the selected regulatory genes and the other genes. Through extensive simulations with artificial datasets, MIBNI showed consistently better performance than six well-known existing methods, REVEAL, Best-Fit, RelNet, CST, CLR, and BIBN in terms of both structural and dynamics prediction accuracy. We further tested the proposed method with two real gene expression datasets for an Escherichia coli gene regulatory network and a fission yeast cell cycle network, and also observed better results using MIBNI compared to the six other methods.Taken together, MIBNI is a promising tool for predicting both the structure and the dynamics of a gene regulatory network.

The Integrative Method Based on the Module-Network for Identifying Driver Genes in Cancer Subtypes

Directory of Open Access Journals (Sweden)

Xinguo Lu

2018-01-01

Full Text Available With advances in next-generation sequencing(NGS technologies, a large number of multiple types of high-throughput genomics data are available. A great challenge in exploring cancer progression is to identify the driver genes from the variant genes by analyzing and integrating multi-types genomics data. Breast cancer is known as a heterogeneous disease. The identification of subtype-specific driver genes is critical to guide the diagnosis, assessment of prognosis and treatment of breast cancer. We developed an integrated frame based on gene expression profiles and copy number variation (CNV data to identify breast cancer subtype-specific driver genes. In this frame, we employed statistical machine-learning method to select gene subsets and utilized an module-network analysis method to identify potential candidate driver genes. The final subtype-specific driver genes were acquired by paired-wise comparison in subtypes. To validate specificity of the driver genes, the gene expression data of these genes were applied to classify the patient samples with 10-fold cross validation and the enrichment analysis were also conducted on the identified driver genes. The experimental results show that the proposed integrative method can identify the potential driver genes and the classifier with these genes acquired better performance than with genes identified by other methods.

hNIS-IRES-eGFP Dual Reporter Gene Imaging

Directory of Open Access Journals (Sweden)

Jiantu Che

2005-04-01

Full Text Available The human and rodent sodium iodide symporters (NIS have recently been cloned and are being investigated as potential therapeutic and reporter genes. We have extended this effort by constructing an internal ribosomal entry site (IRES-linked human NIS (hNIS-enhanced green fluorescent protein (eGFP hybrid reporter gene for both nuclear and optical imaging. A self-inactivating retroviral vector, termed pQCNIG, containing hNIS-IRES-eGFP dual reporter gene, driven by a constitutive CMV promoter, was constructed and used to generate RG2-pQCNIG cells and RG2-pQCNIG tumors. 131I-iodide and 99mTcO4-pertechnetate accumulation studies plus fluorescence microscopy and intensity assays were performed in vitro, and gamma camera imaging studies in RG2-pQCNIG and RG2 tumor-bearing athymic rats were performed. RG2-pQCNIG cells expressed high levels of hNIS protein and showed high intensity of eGFP fluorescence compared with RG2 wild-type cells. RG2-pQCNIG cells accumulated Na131I and 99mTcO4– to a 50:1 and a 170:1 tissue/medium ratio at 10 min, compared with 0.8:1.2 tissue/medium ratio in wild-type RG2 cells. A significant correlation between radiotracer accumulation and eGFP fluorescence intensity was demonstrated. RG2-pQCNIG and RG2 tumors were readily differentiated by in vivo gamma camera imaging; radiotracer uptake increased in RG2-pQCNIG but declined in RG2 tumors over the 50-min imaging period. Stomach and thyroid were the major organs of radionuclide accumulation. The IRES-linked hNIS-eGFP dual reporter gene is functional and stable in transduced RG2-pQCNIG cells. Optical and nuclear imaging of tumors produced from these cell lines provides the opportunity to monitor tumor growth and response to therapy. These studies indicate the potential for a wider application of hNIS reporter imaging and translation into patient studies using radioisotopes that are currently available for human use for both SPECT and PET imaging.

Rapid detection of SNP (c.309T>G in the MDM2 gene by the Duplex SmartAmp method.

Directory of Open Access Journals (Sweden)

Yasuaki Enokida

Full Text Available BACKGROUND: Genetic polymorphisms in the human MDM2 gene are suggested to be a tumor susceptibility marker and a prognostic factor for cancer. It has been reported that a single nucleotide polymorphism (SNP c.309T>G in the MDM2 gene attenuates the tumor suppressor activity of p53 and accelerates tumor formation in humans. METHODOLOGY: In this study, to detect the SNP c.309T>G in the MDM2 gene, we have developed a new SNP detection method, named "Duplex SmartAmp," which enabled us to simultaneously detect both 309T and 309G alleles in one tube. To develop this new method, we introduced new primers i.e., nBP and oBPs, as well as two different fluorescent dyes that separately detect those genetic polymorphisms. RESULTS AND CONCLUSIONS: By the Duplex SmartAmp method, the genetic polymorphisms of the MDM2 gene were detected directly from a small amount of genomic DNA or blood samples. We used 96 genomic DNA and 24 blood samples to validate the Duplex SmartAmp by comparison with results of the conventional PCR-RFLP method; consequently, the Duplex SmartAmp results agreed totally with those of the PCR-RFLP method. Thus, the new SNP detection method is considered useful for detecting the SNP c.309T>G in the MDM2 gene so as to judge cancer susceptibility against some cellular stress in the clinical setting, and also to handle a large number of samples and enable rapid clinical diagnosis.

The Local Maximum Clustering Method and Its Application in Microarray Gene Expression Data Analysis

Directory of Open Access Journals (Sweden)

Chen Yidong

2004-01-01

Full Text Available An unsupervised data clustering method, called the local maximum clustering (LMC method, is proposed for identifying clusters in experiment data sets based on research interest. A magnitude property is defined according to research purposes, and data sets are clustered around each local maximum of the magnitude property. By properly defining a magnitude property, this method can overcome many difficulties in microarray data clustering such as reduced projection in similarities, noises, and arbitrary gene distribution. To critically evaluate the performance of this clustering method in comparison with other methods, we designed three model data sets with known cluster distributions and applied the LMC method as well as the hierarchic clustering method, the -mean clustering method, and the self-organized map method to these model data sets. The results show that the LMC method produces the most accurate clustering results. As an example of application, we applied the method to cluster the leukemia samples reported in the microarray study of Golub et al. (1999.

The Ability of Different Imputation Methods to Preserve the Significant Genes and Pathways in Cancer.

Science.gov (United States)

Aghdam, Rosa; Baghfalaki, Taban; Khosravi, Pegah; Saberi Ansari, Elnaz

2017-12-01

Deciphering important genes and pathways from incomplete gene expression data could facilitate a better understanding of cancer. Different imputation methods can be applied to estimate the missing values. In our study, we evaluated various imputation methods for their performance in preserving significant genes and pathways. In the first step, 5% genes are considered in random for two types of ignorable and non-ignorable missingness mechanisms with various missing rates. Next, 10 well-known imputation methods were applied to the complete datasets. The significance analysis of microarrays (SAM) method was applied to detect the significant genes in rectal and lung cancers to showcase the utility of imputation approaches in preserving significant genes. To determine the impact of different imputation methods on the identification of important genes, the chi-squared test was used to compare the proportions of overlaps between significant genes detected from original data and those detected from the imputed datasets. Additionally, the significant genes are tested for their enrichment in important pathways, using the ConsensusPathDB. Our results showed that almost all the significant genes and pathways of the original dataset can be detected in all imputed datasets, indicating that there is no significant difference in the performance of various imputation methods tested. The source code and selected datasets are available on http://profiles.bs.ipm.ir/softwares/imputation_methods/. Copyright © 2017. Production and hosting by Elsevier B.V.

A Comparative Study of Feature Selection and Classification Methods for Gene Expression Data

KAUST Repository

Abusamra, Heba

2013-05-01

Microarray technology has enriched the study of gene expression in such a way that scientists are now able to measure the expression levels of thousands of genes in a single experiment. Microarray gene expression data gained great importance in recent years due to its role in disease diagnoses and prognoses which help to choose the appropriate treatment plan for patients. This technology has shifted a new era in molecular classification, interpreting gene expression data remains a difficult problem and an active research area due to their native nature of “high dimensional low sample size”. Such problems pose great challenges to existing classification methods. Thus, effective feature selection techniques are often needed in this case to aid to correctly classify different tumor types and consequently lead to a better understanding of genetic signatures as well as improve treatment strategies. This thesis aims on a comparative study of state-of-the-art feature selection methods, classification methods, and the combination of them, based on gene expression data. We compared the efficiency of three different classification methods including: support vector machines, k- nearest neighbor and random forest, and eight different feature selection methods, including: information gain, twoing rule, sum minority, max minority, gini index, sum of variances, t- statistics, and one-dimension support vector machine. Five-fold cross validation was used to evaluate the classification performance. Two publicly available gene expression data sets of glioma were used for this study. Different experiments have been applied to compare the performance of the classification methods with and without performing feature selection. Results revealed the important role of feature selection in classifying gene expression data. By performing feature selection, the classification accuracy can be significantly boosted by using a small number of genes. The relationship of features selected in

SPECT imaging of cardiac reporter gene expression in living rabbits

International Nuclear Information System (INIS)

Liu Ying; Lan Xiaoli; Zhang Liang; Wu Tao; Jiang Rifeng; Zhang Yongxue

2009-01-01

This work is to demonstrate feasibility of imaging the expression of herpes simplex virus 1-thymidine kinase (HSVI-tk) reporter gene in rabbits myocardium by using the reporter probe 131 I-2'-fluoro-2'-deoxy-l-β-D-arabinofuranosyl-5-iodouracil ( 131 I-FIAU) and SPECT. Rabbits of the study group received intramyocardial injection of Ad5-tk and control group received aseptic saline injection. Two sets of experiments were performed on the study group. Rabbits of the 1st set were injected with 131 I-FIAU 600 μCi at Day 2 after intramyocardial transfection of Ad5-tk in 1xl0 9 , 5x10 8 , 1x10 8 , 5x10 7 and 1x10 7 pfu, and heart SPECT imaging was done at different hours. Rabbits of the 2nd were transferred various titers of Ad5-tk (1x10 9 , 5x10 8 , 1x10 8 , 5x10 7 , 1x10 7 pfu) to determine the threshold and optimal viral titer needed for detection of gene expression. Two days later, 131 I-FIAU was injected and heart SPECT imaging was performed at 6, 24 and 48 h, before killing them for gamma counting of the hearts. Reverse transcription-polymerase chain reaction (RT-PCR) was used to verify the transferred HSVI-tk gene expression. Semi-quantitative analysis derived of region of interest (ROI) of SPECT images and RT-PCR images was performed and the relationship of SPECT images with ex vivo gamma counting and mRNA level were evaluated. SPECT images conformed 131 I-FIAU accumulation in rabbits injected with Ad5-tk in the anterolateral wall. The optimal images quality was obtained at 24-48 h for different viral titers. The highest radioactivity in the focal myocardium was seen at 6 h, and then declined with time. The threshold was 5x10 7 pfu of virus titer. The result could be set better in 1-5x10 8 pfu by SPECT analysis and gamma counting. ROI-derived semi-quantitative study on SPECT images correlated well with ex vivo gamma counting and mRNA levels from RT-PCR analysis. The HSVI-tk/ 131 I-FIAU reporter gene/reporter probe system is feasible for cardiac SPECT reporter

Early Infantile Leigh-like Gene Defects Have a Poor Prognosis: Report and Review

Directory of Open Access Journals (Sweden)

Majid Alfadhel

2017-10-01

Full Text Available Solute carrier family 19 (thiamine transporter, member 3 ( SCL19A3 gene defect produces an autosomal recessive neurodegenerative disorder associated with different phenotypes and acronyms. One of the common presentations is early infantile lethal Leigh-like syndrome. We report a case of early infantile Leigh-like SLC19A3 gene defects of patients who died at 4 months of age with no response to a high dose of biotin and thiamine. In addition, we report a novel mutation that was not reported previously. Finally, we review the literature regarding early infantile Leigh-like SLC19A3 gene defects and compare the literature with our patient.

Improved methods and resources for paramecium genomics: transcription units, gene annotation and gene expression.

Science.gov (United States)

Arnaiz, Olivier; Van Dijk, Erwin; Bétermier, Mireille; Lhuillier-Akakpo, Maoussi; de Vanssay, Augustin; Duharcourt, Sandra; Sallet, Erika; Gouzy, Jérôme; Sperling, Linda

2017-06-26

The 15 sibling species of the Paramecium aurelia cryptic species complex emerged after a whole genome duplication that occurred tens of millions of years ago. Given extensive knowledge of the genetics and epigenetics of Paramecium acquired over the last century, this species complex offers a uniquely powerful system to investigate the consequences of whole genome duplication in a unicellular eukaryote as well as the genetic and epigenetic mechanisms that drive speciation. High quality Paramecium gene models are important for research using this system. The major aim of the work reported here was to build an improved gene annotation pipeline for the Paramecium lineage. We generated oriented RNA-Seq transcriptome data across the sexual process of autogamy for the model species Paramecium tetraurelia. We determined, for the first time in a ciliate, candidate P. tetraurelia transcription start sites using an adapted Cap-Seq protocol. We developed TrUC, multi-threaded Perl software that in conjunction with TopHat mapping of RNA-Seq data to a reference genome, predicts transcription units for the annotation pipeline. We used EuGene software to combine annotation evidence. The high quality gene structural annotations obtained for P. tetraurelia were used as evidence to improve published annotations for 3 other Paramecium species. The RNA-Seq data were also used for differential gene expression analysis, providing a gene expression atlas that is more sensitive than the previously established microarray resource. We have developed a gene annotation pipeline tailored for the compact genomes and tiny introns of Paramecium species. A novel component of this pipeline, TrUC, predicts transcription units using Cap-Seq and oriented RNA-Seq data. TrUC could prove useful beyond Paramecium, especially in the case of high gene density. Accurate predictions of 3' and 5' UTR will be particularly valuable for studies of gene expression (e.g. nucleosome positioning, identification of cis

Role of PET in gene therapy

International Nuclear Information System (INIS)

Lee, Kyung Han

2002-01-01

In addition to the well-established use of positron emission tomography (PET) in clinical oncology, novel roles for PET are rapidly emerging in the field of gene therapy. Methods for controlled gene delivery to living bodies, made available through advances in molecular biology, are currently being employed in animals for reasearch purposes and in humans to treat diseases such as cancer. Although gene therapy is still in its early developmental stage, it is perceived that many serious illnesses could be treated successfully by the use of therapeutic gene delivery. A major challenge for the widespread use of human gene therapy is to achieve a controlled and effective delivery of foreign genes to target cells and subsequently, adequate levels of expression. As such, the availability of noninvasive imaging methods to accurately assess the location, duration, and level of transgene expression is critical for optimizing gene therapy strategies. Current endeavors to achieve this goal include methods that utilize magnetic resonance imaging, optical imaging, and nuclear imaging techniques. As for PET, reporter systems that utilize gene encoding enzymes that accumulate postion labeled substrates and those transcribing surface receptors that bind specific positron labeled ligands have been successfully developed. More recent advances in this area include improved reporter gene constructs and radiotracers, introduction of potential strategies to monitor endogenous gene expression, and human pilot studies evaluating the distribution and safety of reporter PET tracers. The remarkably rapid progress occuring in gene imaging technology indicates its importance and wide range of application. As such, gene imaging is likely to become a major and exciting new area for future application of PET technology

Role of PET in gene therapy

Energy Technology Data Exchange (ETDEWEB)

Lee, Kyung Han [School of Medicine, Sungkyunkwan Univ., Seoul (Korea, Republic of)

2002-02-01

In addition to the well-established use of positron emission tomography (PET) in clinical oncology, novel roles for PET are rapidly emerging in the field of gene therapy. Methods for controlled gene delivery to living bodies, made available through advances in molecular biology, are currently being employed in animals for reasearch purposes and in humans to treat diseases such as cancer. Although gene therapy is still in its early developmental stage, it is perceived that many serious illnesses could be treated successfully by the use of therapeutic gene delivery. A major challenge for the widespread use of human gene therapy is to achieve a controlled and effective delivery of foreign genes to target cells and subsequently, adequate levels of expression. As such, the availability of noninvasive imaging methods to accurately assess the location, duration, and level of transgene expression is critical for optimizing gene therapy strategies. Current endeavors to achieve this goal include methods that utilize magnetic resonance imaging, optical imaging, and nuclear imaging techniques. As for PET, reporter systems that utilize gene encoding enzymes that accumulate postion labeled substrates and those transcribing surface receptors that bind specific positron labeled ligands have been successfully developed. More recent advances in this area include improved reporter gene constructs and radiotracers, introduction of potential strategies to monitor endogenous gene expression, and human pilot studies evaluating the distribution and safety of reporter PET tracers. The remarkably rapid progress occuring in gene imaging technology indicates its importance and wide range of application. As such, gene imaging is likely to become a major and exciting new area for future application of PET technology.

Comparison of normalization methods for the analysis of metagenomic gene abundance data.

Science.gov (United States)

Pereira, Mariana Buongermino; Wallroth, Mikael; Jonsson, Viktor; Kristiansson, Erik

2018-04-20

In shotgun metagenomics, microbial communities are studied through direct sequencing of DNA without any prior cultivation. By comparing gene abundances estimated from the generated sequencing reads, functional differences between the communities can be identified. However, gene abundance data is affected by high levels of systematic variability, which can greatly reduce the statistical power and introduce false positives. Normalization, which is the process where systematic variability is identified and removed, is therefore a vital part of the data analysis. A wide range of normalization methods for high-dimensional count data has been proposed but their performance on the analysis of shotgun metagenomic data has not been evaluated. Here, we present a systematic evaluation of nine normalization methods for gene abundance data. The methods were evaluated through resampling of three comprehensive datasets, creating a realistic setting that preserved the unique characteristics of metagenomic data. Performance was measured in terms of the methods ability to identify differentially abundant genes (DAGs), correctly calculate unbiased p-values and control the false discovery rate (FDR). Our results showed that the choice of normalization method has a large impact on the end results. When the DAGs were asymmetrically present between the experimental conditions, many normalization methods had a reduced true positive rate (TPR) and a high false positive rate (FPR). The methods trimmed mean of M-values (TMM) and relative log expression (RLE) had the overall highest performance and are therefore recommended for the analysis of gene abundance data. For larger sample sizes, CSS also showed satisfactory performance. This study emphasizes the importance of selecting a suitable normalization methods in the analysis of data from shotgun metagenomics. Our results also demonstrate that improper methods may result in unacceptably high levels of false positives, which in turn may lead

Development of an ELA-DRA gene typing method based on pyrosequencing technology.

Science.gov (United States)

Díaz, S; Echeverría, M G; It, V; Posik, D M; Rogberg-Muñoz, A; Pena, N L; Peral-García, P; Vega-Pla, J L; Giovambattista, G

2008-11-01

The polymorphism of equine lymphocyte antigen (ELA) class II DRA gene had been detected by polymerase chain reaction-single-strand conformational polymorphism (PCR-SSCP) and reference strand-mediated conformation analysis. These methodologies allowed to identify 11 ELA-DRA exon 2 sequences, three of which are widely distributed among domestic horse breeds. Herein, we describe the development of a pyrosequencing-based method applicable to ELA-DRA typing, by screening samples from eight different horse breeds previously typed by PCR-SSCP. This sequence-based method would be useful in high-throughput genotyping of major histocompatibility complex genes in horses and other animal species, making this system interesting as a rapid screening method for animal genotyping of immune-related genes.

Delimiting Coalescence Genes (C-Genes) in Phylogenomic Data Sets.

Science.gov (United States)

Springer, Mark S; Gatesy, John

2018-02-26

coalescence methods have emerged as a popular alternative for inferring species trees with large genomic datasets, because these methods explicitly account for incomplete lineage sorting. However, statistical consistency of summary coalescence methods is not guaranteed unless several model assumptions are true, including the critical assumption that recombination occurs freely among but not within coalescence genes (c-genes), which are the fundamental units of analysis for these methods. Each c-gene has a single branching history, and large sets of these independent gene histories should be the input for genome-scale coalescence estimates of phylogeny. By contrast, numerous studies have reported the results of coalescence analyses in which complete protein-coding sequences are treated as c-genes even though exons for these loci can span more than a megabase of DNA. Empirical estimates of recombination breakpoints suggest that c-genes may be much shorter, especially when large clades with many species are the focus of analysis. Although this idea has been challenged recently in the literature, the inverse relationship between c-gene size and increased taxon sampling in a dataset-the 'recombination ratchet'-is a fundamental property of c-genes. For taxonomic groups characterized by genes with long intron sequences, complete protein-coding sequences are likely not valid c-genes and are inappropriate units of analysis for summary coalescence methods unless they occur in recombination deserts that are devoid of incomplete lineage sorting (ILS). Finally, it has been argued that coalescence methods are robust when the no-recombination within loci assumption is violated, but recombination must matter at some scale because ILS, a by-product of recombination, is the raison d'etre for coalescence methods. That is, extensive recombination is required to yield the large number of independently segregating c-genes used to infer a species tree. If coalescent methods are powerful

An Intelligent Method of Product Scheme Design Based on Product Gene

Directory of Open Access Journals (Sweden)

Qing Song Ai

2013-01-01

Full Text Available Nowadays, in order to have some featured products, many customers tend to buy customized products instead of buying common ones in supermarket. The manufacturing enterprises, with the purpose of improving their competitiveness, are focusing on providing customized products with high quality and low cost as well. At present, how to produce customized products rapidly and cheaply has been the key challenge to manufacturing enterprises. In this paper, an intelligent modeling approach applied to supporting the modeling of customized products is proposed, which may improve the efficiency during the product design process. Specifically, the product gene (PG method, which is an analogy of biological evolution in engineering area, is employed to model products in a new way. Based on product gene, we focus on the intelligent modeling method to generate product schemes rapidly and automatically. The process of our research includes three steps: (1 develop a product gene model for customized products; (2 find the obtainment and storage method for product gene; and (3 propose a specific genetic algorithm used for calculating the solution of customized product and generating new product schemes. Finally, a case study is applied to test the usefulness of our study.

Methods for transient assay of gene function in floral tissues

Directory of Open Access Journals (Sweden)

Pathirana Nilangani N

2007-01-01

Full Text Available Abstract Background There is considerable interest in rapid assays or screening systems for assigning gene function. However, analysis of gene function in the flowers of some species is restricted due to the difficulty of producing stably transformed transgenic plants. As a result, experimental approaches based on transient gene expression assays are frequently used. Biolistics has long been used for transient over-expression of genes of interest, but has not been exploited for gene silencing studies. Agrobacterium-infiltration has also been used, but the focus primarily has been on the transient transformation of leaf tissue. Results Two constructs, one expressing an inverted repeat of the Antirrhinum majus (Antirrhinum chalcone synthase gene (CHS and the other an inverted repeat of the Antirrhinum transcription factor gene Rosea1, were shown to effectively induce CHS and Rosea1 gene silencing, respectively, when introduced biolistically into petal tissue of Antirrhinum flowers developing in vitro. A high-throughput vector expressing the Antirrhinum CHS gene attached to an inverted repeat of the nos terminator was also shown to be effective. Silencing spread systemically to create large zones of petal tissue lacking pigmentation, with transmission of the silenced state spreading both laterally within the affected epidermal cell layer and into lower cell layers, including the epidermis of the other petal surface. Transient Agrobacterium-mediated transformation of petal tissue of tobacco and petunia flowers in situ or detached was also achieved, using expression of the reporter genes GUS and GFP to visualise transgene expression. Conclusion We demonstrate the feasibility of using biolistics-based transient RNAi, and transient transformation of petal tissue via Agrobacterium infiltration to study gene function in petals. We have also produced a vector for high throughput gene silencing studies, incorporating the option of using T-A cloning to

Enriching the gene set analysis of genome-wide data by incorporating directionality of gene expression and combining statistical hypotheses and methods

Science.gov (United States)

Väremo, Leif; Nielsen, Jens; Nookaew, Intawat

2013-01-01

Gene set analysis (GSA) is used to elucidate genome-wide data, in particular transcriptome data. A multitude of methods have been proposed for this step of the analysis, and many of them have been compared and evaluated. Unfortunately, there is no consolidated opinion regarding what methods should be preferred, and the variety of available GSA software and implementations pose a difficulty for the end-user who wants to try out different methods. To address this, we have developed the R package Piano that collects a range of GSA methods into the same system, for the benefit of the end-user. Further on we refine the GSA workflow by using modifications of the gene-level statistics. This enables us to divide the resulting gene set P-values into three classes, describing different aspects of gene expression directionality at gene set level. We use our fully implemented workflow to investigate the impact of the individual components of GSA by using microarray and RNA-seq data. The results show that the evaluated methods are globally similar and the major separation correlates well with our defined directionality classes. As a consequence of this, we suggest to use a consensus scoring approach, based on multiple GSA runs. In combination with the directionality classes, this constitutes a more thorough basis for an enriched biological interpretation. PMID:23444143

Analysis of the robustness of network-based disease-gene prioritization methods reveals redundancy in the human interactome and functional diversity of disease-genes.

Directory of Open Access Journals (Sweden)

Emre Guney

Full Text Available Complex biological systems usually pose a trade-off between robustness and fragility where a small number of perturbations can substantially disrupt the system. Although biological systems are robust against changes in many external and internal conditions, even a single mutation can perturb the system substantially, giving rise to a pathophenotype. Recent advances in identifying and analyzing the sequential variations beneath human disorders help to comprehend a systemic view of the mechanisms underlying various disease phenotypes. Network-based disease-gene prioritization methods rank the relevance of genes in a disease under the hypothesis that genes whose proteins interact with each other tend to exhibit similar phenotypes. In this study, we have tested the robustness of several network-based disease-gene prioritization methods with respect to the perturbations of the system using various disease phenotypes from the Online Mendelian Inheritance in Man database. These perturbations have been introduced either in the protein-protein interaction network or in the set of known disease-gene associations. As the network-based disease-gene prioritization methods are based on the connectivity between known disease-gene associations, we have further used these methods to categorize the pathophenotypes with respect to the recoverability of hidden disease-genes. Our results have suggested that, in general, disease-genes are connected through multiple paths in the human interactome. Moreover, even when these paths are disturbed, network-based prioritization can reveal hidden disease-gene associations in some pathophenotypes such as breast cancer, cardiomyopathy, diabetes, leukemia, parkinson disease and obesity to a greater extend compared to the rest of the pathophenotypes tested in this study. Gene Ontology (GO analysis highlighted the role of functional diversity for such diseases.

Method for Screening Compounds That Influence Virulence Gene Expression in Staphylococcus aureus

DEFF Research Database (Denmark)

Nielsen, A.; Nielsen, Kristian Fog; Frees, D.

2010-01-01

We present a simple assay to examine effects of compounds on virulence gene expression in the human pathogen Staphylococcus aureus. The assay employs transcriptional reporter strains carrying lacZ fused to central virulence genes. Compounds affecting virulence gene expression and activity...... of the agr locus are scored based on color change in the presence of a chromogenic beta-galactosidase substrate. The assay can be used to screen for novel antivirulence compounds from many different sources, such as fungi, as demonstrated here....

Effect of external and internal factors on the expression of reporter genes driven by the N resistance gene promoter.

Science.gov (United States)

Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor

2013-07-01

The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.

Fluorescence recovery allows theimplementation of a fluorescence reporter gene platform applicable for the detection and quantification of horizontal gene transfer in anoxic environments

DEFF Research Database (Denmark)

Pinilla-Redondo, Rafael; Riber, Leise; Sørensen, Søren Johannes

2018-01-01

H limitations, and provide experimental tools that will help broaden its horizon of application to other fields.IMPORTANCEMany anaerobic environments, like the gastrointestinal tract, anaerobic digesters, and the interiors of dense biofilms, have been shown to be hotspots for horizontal gene transfer (HGT......). Despite the increasing wealth of reports warning about the alarming spread of antibiotic resistance determinants, to date, HGT studies mainly rely on cultivation-based methods. Unfortunately, the relevance of these studies is often questionable, as only a minor fraction of bacteria can be cultivated...

Rapid and sensitive reporter gene assays for detection of antiandrogenic and estrogenic effects of environmental chemicals

DEFF Research Database (Denmark)

Vinggaard, Anne; Jørgensen, E.C.B.; Larsen, John Christian

1999-01-01

Reports on increasing incidences in developmental abnormalities of the human male reproductive tract and the recent identifications of environmental chemicals with antiandrogenic activity necessitate the screening of a larger number of compounds in order to get an overview of potential antiandrog......Reports on increasing incidences in developmental abnormalities of the human male reproductive tract and the recent identifications of environmental chemicals with antiandrogenic activity necessitate the screening of a larger number of compounds in order to get an overview of potential...... antiandrogenic chemicals present in our environment. Thus, there is a great need for an effective in vitro screening method for (anti)androgenic chemicals. We have developed a rapid, sensitive, and reproducible reporter gene assay for detection of antiandrogenic chemicals. Chinese Hamster Ovary cells were...... calcium phosphate transfection method, this method has the advantage of being more feasible, as the assay can be scaled down to the microtiter plate format. Furthermore, the transfection reagent is noncytotoxic, allowing its addition together with the test compounds thereby reducing the hands...

A simple and robust method for connecting small-molecule drugs using gene-expression signatures

Directory of Open Access Journals (Sweden)

Gant Timothy W

2008-06-01

Full Text Available Abstract Background Interaction of a drug or chemical with a biological system can result in a gene-expression profile or signature characteristic of the event. Using a suitably robust algorithm these signatures can potentially be used to connect molecules with similar pharmacological or toxicological properties by gene expression profile. Lamb et al first proposed the Connectivity Map [Lamb et al (2006, Science 313, 1929–1935] to make successful connections among small molecules, genes, and diseases using genomic signatures. Results Here we have built on the principles of the Connectivity Map to present a simpler and more robust method for the construction of reference gene-expression profiles and for the connection scoring scheme, which importantly allows the valuation of statistical significance of all the connections observed. We tested the new method with two randomly generated gene signatures and three experimentally derived gene signatures (for HDAC inhibitors, estrogens, and immunosuppressive drugs, respectively. Our testing with this method indicates that it achieves a higher level of specificity and sensitivity and so advances the original method. Conclusion The method presented here not only offers more principled statistical procedures for testing connections, but more importantly it provides effective safeguard against false connections at the same time achieving increased sensitivity. With its robust performance, the method has potential use in the drug development pipeline for the early recognition of pharmacological and toxicological properties in chemicals and new drug candidates, and also more broadly in other 'omics sciences.

Visualisation of chicken macrophages using transgenic reporter genes: insights into the development of the avian macrophage lineage.

Science.gov (United States)

Balic, Adam; Garcia-Morales, Carla; Vervelde, Lonneke; Gilhooley, Hazel; Sherman, Adrian; Garceau, Valerie; Gutowska, Maria W; Burt, David W; Kaiser, Pete; Hume, David A; Sang, Helen M

2014-08-01

We have generated the first transgenic chickens in which reporter genes are expressed in a specific immune cell lineage, based upon control elements of the colony stimulating factor 1 receptor (CSF1R) locus. The Fms intronic regulatory element (FIRE) within CSF1R is shown to be highly conserved in amniotes and absolutely required for myeloid-restricted expression of fluorescent reporter genes. As in mammals, CSF1R-reporter genes were specifically expressed at high levels in cells of the macrophage lineage and at a much lower level in granulocytes. The cell lineage specificity of reporter gene expression was confirmed by demonstration of coincident expression with the endogenous CSF1R protein. In transgenic birds, expression of the reporter gene provided a defined marker for macrophage-lineage cells, identifying the earliest stages in the yolk sac, throughout embryonic development and in all adult tissues. The reporter genes permit detailed and dynamic visualisation of embryonic chicken macrophages. Chicken embryonic macrophages are not recruited to incisional wounds, but are able to recognise and phagocytose microbial antigens. © 2014. Published by The Company of Biologists Ltd.

GAL4 enhancer trap strains with reporter gene expression during ...

Indian Academy of Sciences (India)

the development of adult brain in Drosophila melanogaster. C. R. VENKATESH ... vous system (CNS), at different time points during the pupal stage—a critical .... in frontal view, with further reduced reporter gene expression. Orthodenticle and ...

Locating disease genes using Bayesian variable selection with the Haseman-Elston method

Directory of Open Access Journals (Sweden)

He Qimei

2003-12-01

Full Text Available Abstract Background We applied stochastic search variable selection (SSVS, a Bayesian model selection method, to the simulated data of Genetic Analysis Workshop 13. We used SSVS with the revisited Haseman-Elston method to find the markers linked to the loci determining change in cholesterol over time. To study gene-gene interaction (epistasis and gene-environment interaction, we adopted prior structures, which incorporate the relationship among the predictors. This allows SSVS to search in the model space more efficiently and avoid the less likely models. Results In applying SSVS, instead of looking at the posterior distribution of each of the candidate models, which is sensitive to the setting of the prior, we ranked the candidate variables (markers according to their marginal posterior probability, which was shown to be more robust to the prior. Compared with traditional methods that consider one marker at a time, our method considers all markers simultaneously and obtains more favorable results. Conclusions We showed that SSVS is a powerful method for identifying linked markers using the Haseman-Elston method, even for weak effects. SSVS is very effective because it does a smart search over the entire model space.

Network-Based Method for Identifying Co- Regeneration Genes in Bone, Dentin, Nerve and Vessel Tissues.

Science.gov (United States)

Chen, Lei; Pan, Hongying; Zhang, Yu-Hang; Feng, Kaiyan; Kong, XiangYin; Huang, Tao; Cai, Yu-Dong

2017-10-02

Bone and dental diseases are serious public health problems. Most current clinical treatments for these diseases can produce side effects. Regeneration is a promising therapy for bone and dental diseases, yielding natural tissue recovery with few side effects. Because soft tissues inside the bone and dentin are densely populated with nerves and vessels, the study of bone and dentin regeneration should also consider the co-regeneration of nerves and vessels. In this study, a network-based method to identify co-regeneration genes for bone, dentin, nerve and vessel was constructed based on an extensive network of protein-protein interactions. Three procedures were applied in the network-based method. The first procedure, searching, sought the shortest paths connecting regeneration genes of one tissue type with regeneration genes of other tissues, thereby extracting possible co-regeneration genes. The second procedure, testing, employed a permutation test to evaluate whether possible genes were false discoveries; these genes were excluded by the testing procedure. The last procedure, screening, employed two rules, the betweenness ratio rule and interaction score rule, to select the most essential genes. A total of seventeen genes were inferred by the method, which were deemed to contribute to co-regeneration of at least two tissues. All these seventeen genes were extensively discussed to validate the utility of the method.

Live-cell Imaging of Pol II Promoter Activity to Monitor Gene expression with RNA IMAGEtag reporters

Energy Technology Data Exchange (ETDEWEB)

Shin, Ilchung [Ames Laboratory; Ray, Judhajeet [Ames Laboratory; Gupta, Vinayak [Iowa State University; Ilgu, Muslum [Ames Laboratory; Beasley, Jonathan [Iowa State University; Bendickson, Lee [Ames Laboratory; Mehanovic, Samir [Molecular Express; Kraus, George A. [Iowa State University; Nilsen-Hamilton, Marit [Ames Laboratory

2014-04-20

We describe a ribonucleic acid (RNA) reporter system for live-cell imaging of gene expression to detect changes in polymerase II activity on individual promoters in individual cells. The reporters use strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags) that can be expressed from a promoter of choice. For imaging, the cells are incubated with their ligands that are separately conjugated with one of the FRET pair, Cy3 and Cy5. The IMAGEtags were expressed in yeast from the GAL1, ADH1 or ACT1 promoters. Transcription from all three promoters was imaged in live cells and transcriptional increases from the GAL1 promoter were observed with time after adding galactose. Expression of the IMAGEtags did not affect cell proliferation or endogenous gene expression. Advantages of this method are that no foreign proteins are produced in the cells that could be toxic or otherwise influence the cellular response as they accumulate, the IMAGEtags are short lived and oxygen is not required to generate their signals. The IMAGEtag RNA reporter system provides a means of tracking changes in transcriptional activity in live cells and in real time.

A computational method based on the integration of heterogeneous networks for predicting disease-gene associations.

Directory of Open Access Journals (Sweden)

Xingli Guo

Full Text Available The identification of disease-causing genes is a fundamental challenge in human health and of great importance in improving medical care, and provides a better understanding of gene functions. Recent computational approaches based on the interactions among human proteins and disease similarities have shown their power in tackling the issue. In this paper, a novel systematic and global method that integrates two heterogeneous networks for prioritizing candidate disease-causing genes is provided, based on the observation that genes causing the same or similar diseases tend to lie close to one another in a network of protein-protein interactions. In this method, the association score function between a query disease and a candidate gene is defined as the weighted sum of all the association scores between similar diseases and neighbouring genes. Moreover, the topological correlation of these two heterogeneous networks can be incorporated into the definition of the score function, and finally an iterative algorithm is designed for this issue. This method was tested with 10-fold cross-validation on all 1,126 diseases that have at least a known causal gene, and it ranked the correct gene as one of the top ten in 622 of all the 1,428 cases, significantly outperforming a state-of-the-art method called PRINCE. The results brought about by this method were applied to study three multi-factorial disorders: breast cancer, Alzheimer disease and diabetes mellitus type 2, and some suggestions of novel causal genes and candidate disease-causing subnetworks were provided for further investigation.

Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method

Directory of Open Access Journals (Sweden)

Javad Mohammadi

2017-06-01

Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary

The Impact of GFP Reporter Gene Transduction and Expression on Metabolomics of Placental Mesenchymal Stem Cells Determined by UHPLC-Q/TOF-MS

Directory of Open Access Journals (Sweden)

Jinfeng Yang

2017-01-01

Full Text Available Introduction. Green fluorescent protein (GFP is widely used as a reporter gene in regenerative medicine research to label and track stem cells. Here, we examined whether expressing GFP gene may impact the metabolism of human placental mesenchymal stem cells (hPMSCs. Methods. The GFP gene was transduced into hPMSCs using lentiviral-based infection to establish GFP+hPMSCs. A sensitive 13C/12C-dansyl labeling LC-MS method targeting the amine/phenol submetabolome was used for in-depth cell metabolome profiling. Results. A total of 1151 peak pairs or metabolites were detected from 12 LC-MS runs. Principal component analysis and partial least squares discriminant analysis showed poor separation, and the volcano plots demonstrated that most of the metabolites were not significantly changed when hPMSCs were tagged with GFP. Overall, 739 metabolites were positively or putatively identified. Only 11 metabolites showed significant changes. Metabolic pathway analyses indicated that three of the identified metabolites were involved in nine pathways. However, these metabolites are unlikely to have a large impact on the metabolic pathways due to their nonessential roles and limited hits in pathway analysis. Conclusion. This study indicated that the expression of ectopic GFP reporter gene did not significantly alter the metabolomics pathways covered by the amine/phenol submetabolome.

A Comparative Study of Feature Selection and Classification Methods for Gene Expression Data

KAUST Repository

Abusamra, Heba

2013-01-01

Different experiments have been applied to compare the performance of the classification methods with and without performing feature selection. Results revealed the important role of feature selection in classifying gene expression data. By performing feature selection, the classification accuracy can be significantly boosted by using a small number of genes. The relationship of features selected in different feature selection methods is investigated and the most frequent features selected in each fold among all methods for both datasets are evaluated.

A method to identify differential expression profiles of time-course gene data with Fourier transformation.

Science.gov (United States)

Kim, Jaehee; Ogden, Robert Todd; Kim, Haseong

2013-10-18

Time course gene expression experiments are an increasingly popular method for exploring biological processes. Temporal gene expression profiles provide an important characterization of gene function, as biological systems are both developmental and dynamic. With such data it is possible to study gene expression changes over time and thereby to detect differential genes. Much of the early work on analyzing time series expression data relied on methods developed originally for static data and thus there is a need for improved methodology. Since time series expression is a temporal process, its unique features such as autocorrelation between successive points should be incorporated into the analysis. This work aims to identify genes that show different gene expression profiles across time. We propose a statistical procedure to discover gene groups with similar profiles using a nonparametric representation that accounts for the autocorrelation in the data. In particular, we first represent each profile in terms of a Fourier basis, and then we screen out genes that are not differentially expressed based on the Fourier coefficients. Finally, we cluster the remaining gene profiles using a model-based approach in the Fourier domain. We evaluate the screening results in terms of sensitivity, specificity, FDR and FNR, compare with the Gaussian process regression screening in a simulation study and illustrate the results by application to yeast cell-cycle microarray expression data with alpha-factor synchronization.The key elements of the proposed methodology: (i) representation of gene profiles in the Fourier domain; (ii) automatic screening of genes based on the Fourier coefficients and taking into account autocorrelation in the data, while controlling the false discovery rate (FDR); (iii) model-based clustering of the remaining gene profiles. Using this method, we identified a set of cell-cycle-regulated time-course yeast genes. The proposed method is general and can be

Feasibility of dual reporter gene in rat myoblast cell line using human sodium iodide symporter (hNIS) and enhanced green fluorescent protein (EGFP) gene

Energy Technology Data Exchange (ETDEWEB)

Lee, Yong Jin; Lee, You La; Ahn, Sohn Joo; Choi, Chang Ik; Lee, Sang Woo; Ahn, Byeong Cheol; Lee, Jae Tae [School of Medicine, Kyungpook National University, Daegu (Korea, Republic of)

2007-07-01

To develop a non-invasive combined imaging method of gamma camera and optical imaging to assess rat myoblast cell line, H9c2, we constructed retrovirus containing hNIS and EGFP gene, and transfected to rat myoblast cell and monitored hNIS and EGFP expression. Rat myoblast cell line, H9C2, was transfected with hNIS and EGFP gene using retrovirus (H9C2-NG). The expression of hNIS and EGFP gene was determined by RT-PCR and fluorescence microscopy, respectively. The uptake and efflux of I-125 were measured in the transfected and wild type cell lines. Each cell line was injected to 4 flank sites (H9c2: 1X107 or 2X107, H9C2-NG: 1X107 or 2X107) in nude mouse. Scintigraphic image was performed at 3h, 1 day after H9C2 and H9C2-NG cell inoculation. We performed gamma camera and animal PET imaging to evaluate NIS expression. Also, GFP image obtained using optical imaging system. The expression of hNIS and EGFP gene was confirmed by RT-PCR. In iodide uptake, H9C2-NG cells accumulated 274.52.2 pmol/ mg protein at 30 min. But wild type cell line did not uptake iodide. In fluorescent microscopy, H9C2-NG cells were highly fluorescent than that of H9C2 cells. In iodide efflux study, 50% of radioactivity flowed out during the first 10min. Scintigraphy showed increased uptake of Tc-99m in H9c2-NG than in H9C2 for 1 day. Also, H9C2-NG cells showed high signal-to-background fluorescent spots in animal body. In this study, NIS and EGFP reporter gene were successfully transfected by a retrovirus in myoblast cell line, and the transfected cell can be easily visualized in vivo. These results suggest that NIS and EGFP gene has an excellent feasibility as a reporter gene, and it can be used to monitor cell trafficking for monitoring.

Multimodality imaging of reporter gene expression using a novel fusion vector in living cells and animals

Science.gov (United States)

Gambhir, Sanjiv [Portola Valley, CA; Pritha, Ray [Mountain View, CA

2011-06-07

Novel double and triple fusion reporter gene constructs harboring distinct imagable reporter genes are provided, as well as applications for the use of such double and triple fusion constructs in living cells and in living animals using distinct imaging technologies.

Expression of Root Genes in Arabidopsis Seedlings Grown by Standard and Improved Growing Methods.

Science.gov (United States)

Qu, Yanli; Liu, Shuai; Bao, Wenlong; Xue, Xian; Ma, Zhengwen; Yokawa, Ken; Baluška, František; Wan, Yinglang

2017-05-03

Roots of Arabidopsis thaliana seedlings grown in the laboratory using the traditional plant-growing culture system (TPG) were covered to maintain them in darkness. This new method is based on a dark chamber and is named the improved plant-growing method (IPG). We measured the light conditions in dark chambers, and found that the highest light intensity was dramatically reduced deeper in the dark chamber. In the bottom and side parts of dark chambers, roots were almost completely shaded. Using the high-throughput RNA sequencing method on the whole RNA extraction from roots, we compared the global gene expression levels in roots of seedlings from these two conditions and identified 141 differently expressed genes (DEGs) between them. According to the KEGG (Kyoto Encyclopedia of Genes and Genomes) enrichment, the flavone and flavonol biosynthesis and flavonoid biosynthesis pathways were most affected among all annotated pathways. Surprisingly, no genes of known plant photoreceptors were identified as DEGs by this method. Considering that the light intensity was decreased in the IPG system, we collected four sections (1.5 cm for each) of Arabidopsis roots grown in TPG and IPG conditions, and the spatial-related differential gene expression levels of plant photoreceptors and polar auxin transporters, including CRY1 , CRY2 , PHYA , PHYB , PHOT1 , PHOT2 , and UVR8 were analyzed by qRT-PCR. Using these results, we generated a map of the spatial-related expression patterns of these genes under IPG and TPG conditions. The expression levels of light-related genes in roots is highly sensitive to illumination and it provides a background reference for selecting an improved culture method for laboratory-maintained Arabidopsis seedlings.

Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering.

Science.gov (United States)

Kimura, Yukiko; Hisano, Yu; Kawahara, Atsuo; Higashijima, Shin-ichi

2014-10-08

The type II bacterial CRISPR/Cas9 system is rapidly becoming popular for genome-engineering due to its simplicity, flexibility, and high efficiency. Recently, targeted knock-in of a long DNA fragment via homology-independent DNA repair has been achieved in zebrafish using CRISPR/Cas9 system. This raised the possibility that knock-in transgenic zebrafish could be efficiently generated using CRISPR/Cas9. However, how widely this method can be applied for the targeting integration of foreign genes into endogenous genomic loci is unclear. Here, we report efficient generation of knock-in transgenic zebrafish that have cell-type specific Gal4 or reporter gene expression. A donor plasmid containing a heat-shock promoter was co-injected with a short guide RNA (sgRNA) targeted for genome digestion, a sgRNA targeted for donor plasmid digestion, and Cas9 mRNA. We have succeeded in establishing stable knock-in transgenic fish with several different constructs for 4 genetic loci at a frequency being exceeding 25%. Due to its simplicity, design flexibility, and high efficiency, we propose that CRISPR/Cas9-mediated knock-in will become a standard method for the generation transgenic zebrafish.

Introduction of optical reporter gene into cancer and immune cells using lentiviral vector

International Nuclear Information System (INIS)

Min, Jung Joon; Le, Uyenchi N.; Moon, Sung Min; Heo, Young Jun; Song, Ho Chun; Bom, Hee Seung; Kim, Yeon Soo

2004-01-01

For some applications such as gene therapy or reporter gene imaging, a gene has to be introduced into the organism of interest. Adenoviral vectors are capable of transducing both replicating and non-dividing cells. The adenoviral vectors do not integrate their DNA into host DNA, but do lead to an immune response. Lentiviruses belong to the retrovirus family and are capable of infecting both dividing and non-dividing cells. The human immunodeficiency virus (HIV) is an example of a lentavirus. A disabled HIV virus has been developed and could be used for in vivo gene delivery. A portion of the viral genome which encodes for accessory proteins canbe deleted without affecting production of the vector and efficiency of infection. Lentiviral delivery into various rodent tissues shows sustained expression of the transgene of up to six months. Furthermore, there seems to be little or no immune response with these vectors. These lentiviral vectors hold significant promise for in vivo gene delivery. We constructed lentiviral vector encoding firefly luciferase (Fluc) and eGFP. Fluc-eGFP fusion gene was inserted into multiple cloning sites of pLentiM1.3 vector. Reporter gene (Fluc-eGFP) was designed to be driven by murine CMV promoter with enhanced efficacy of transgene expression as compared to human CMV promoter. We transfected pLenti1.3-Fluc into human cervix cancer cell line (HeLa) and murine T lymphocytes. We also constructed adenovirus encoding Fluc and transfected to HeLa and T cells. This LentiM1.3-Fluc was transfected into HeLa cells and murine T lymphocytes in vitro, showing consistent expression of eGFP under the fluorescence microscopy from the 2nd day of transfection. Firefly luciferase reporter gene was not expressed in immune cells when it is mediated by adenovirus. Lentivirus was validated as a useful vector for both immune and cancer cells

Noninvasive imaging of transplanted living functional cells transfected with a reporter estrogen receptor gene

Energy Technology Data Exchange (ETDEWEB)

Takamatsu, Shinji [Biomedical Imaging Research Center, University of Fukui, 23-3 Shimoaizuki, Matsuoka, Yoshida, Fukui 910-1193 (Japan)]. E-mail: shinjit@fmsrsa.fukui-med.ac.jp; Furukawa, Takako [Biomedical Imaging Research Center, University of Fukui, 23-3 Shimoaizuki, Matsuoka, Yoshida, Fukui 910-1193 (Japan); Mori, Tetsuya [Biomedical Imaging Research Center, University of Fukui, 23-3 Shimoaizuki, Matsuoka, Yoshida, Fukui 910-1193 (Japan); Yonekura, Yoshiharu [Biomedical Imaging Research Center, University of Fukui, 23-3 Shimoaizuki, Matsuoka, Yoshida, Fukui 910-1193 (Japan); Fujibayashi, Yasuhisa [Biomedical Imaging Research Center, University of Fukui, 23-3 Shimoaizuki, Matsuoka, Yoshida, Fukui 910-1193 (Japan)

2005-11-01

The transplantation of functional cells such as dopaminergic cells into damaged tissue is now clinically ongoing, but at present the population of surviving cells at the transplantation site mostly cannot be noninvasively examined. To visualize surviving transplanted functional cells using a noninvasive method, we chose the estrogen receptor ligand binding domain (ERL) as a reporter molecule and 16{alpha}-[{sup 18}F]-fluoro-17{beta}-estradiol (FES) for its ligand. We used a mouse embryonic stem (ES) cell line for recipient cells as a model. To obtain ES cells that constitutively or inducibly express ERL, we transfected two types of expression vectors into EB5 parental ES cell line using the lipofection method and obtained about 30 clones for each of the two types of transfectants. Then, to examine the expression level of ERL, we performed Western blotting analysis. Ligand uptake experiments were carried out using [{sup 3}H]-estradiol with or without excessive unlabeled estradiol for control cells and ERL transfectants. Each selected clone was also used for in vivo positron emission tomography (PET) imaging studies involving FES in nude mice transplanted with control cells and ERL transfectants. In some of the clones transfected with the inducible-type ERL gene, protein was expressed much higher than in the controls. However, constitutive-type ERL gene-transfected ES cells showed no protein production in spite of their gene expression activity being considerably high. All clones also expressed equal levels of the Oct-3/4 gene, a marker of pluripotency, in comparison with the parental cells. Also, the specific uptake of [{sup 3}H]-estradiol was over 30 times higher in inducer-treated ERL-expressing ES cells compared to untreated control cells. Finally, by performing dynamic PET imaging, we successfully visualized ERL-expressing teratomas using FES.

Noninvasive imaging of transplanted living functional cells transfected with a reporter estrogen receptor gene

International Nuclear Information System (INIS)

Takamatsu, Shinji; Furukawa, Takako; Mori, Tetsuya; Yonekura, Yoshiharu; Fujibayashi, Yasuhisa

2005-01-01

The transplantation of functional cells such as dopaminergic cells into damaged tissue is now clinically ongoing, but at present the population of surviving cells at the transplantation site mostly cannot be noninvasively examined. To visualize surviving transplanted functional cells using a noninvasive method, we chose the estrogen receptor ligand binding domain (ERL) as a reporter molecule and 16α-[ 18 F]-fluoro-17β-estradiol (FES) for its ligand. We used a mouse embryonic stem (ES) cell line for recipient cells as a model. To obtain ES cells that constitutively or inducibly express ERL, we transfected two types of expression vectors into EB5 parental ES cell line using the lipofection method and obtained about 30 clones for each of the two types of transfectants. Then, to examine the expression level of ERL, we performed Western blotting analysis. Ligand uptake experiments were carried out using [ 3 H]-estradiol with or without excessive unlabeled estradiol for control cells and ERL transfectants. Each selected clone was also used for in vivo positron emission tomography (PET) imaging studies involving FES in nude mice transplanted with control cells and ERL transfectants. In some of the clones transfected with the inducible-type ERL gene, protein was expressed much higher than in the controls. However, constitutive-type ERL gene-transfected ES cells showed no protein production in spite of their gene expression activity being considerably high. All clones also expressed equal levels of the Oct-3/4 gene, a marker of pluripotency, in comparison with the parental cells. Also, the specific uptake of [ 3 H]-estradiol was over 30 times higher in inducer-treated ERL-expressing ES cells compared to untreated control cells. Finally, by performing dynamic PET imaging, we successfully visualized ERL-expressing teratomas using FES

Benchmarking of methods for identification of antimicrobial resistance genes in bacterial whole genome data

DEFF Research Database (Denmark)

Clausen, Philip T. L. C.; Zankari, Ea; Aarestrup, Frank Møller

2016-01-01

to two different methods in current use for identification of antibiotic resistance genes in bacterial WGS data. A novel method, KmerResistance, which examines the co-occurrence of k-mers between the WGS data and a database of resistance genes, was developed. The performance of this method was compared...... with two previously described methods; ResFinder and SRST2, which use an assembly/BLAST method and BWA, respectively, using two datasets with a total of 339 isolates, covering five species, originating from the Oxford University Hospitals NHS Trust and Danish pig farms. The predicted resistance...... was compared with the observed phenotypes for all isolates. To challenge further the sensitivity of the in silico methods, the datasets were also down-sampled to 1% of the reads and reanalysed. The best results were obtained by identification of resistance genes by mapping directly against the raw reads...

SigEMD: A powerful method for differential gene expression analysis in single-cell RNA sequencing data.

Science.gov (United States)

Wang, Tianyu; Nabavi, Sheida

2018-04-24

Differential gene expression analysis is one of the significant efforts in single cell RNA sequencing (scRNAseq) analysis to discover the specific changes in expression levels of individual cell types. Since scRNAseq exhibits multimodality, large amounts of zero counts, and sparsity, it is different from the traditional bulk RNA sequencing (RNAseq) data. The new challenges of scRNAseq data promote the development of new methods for identifying differentially expressed (DE) genes. In this study, we proposed a new method, SigEMD, that combines a data imputation approach, a logistic regression model and a nonparametric method based on the Earth Mover's Distance, to precisely and efficiently identify DE genes in scRNAseq data. The regression model and data imputation are used to reduce the impact of large amounts of zero counts, and the nonparametric method is used to improve the sensitivity of detecting DE genes from multimodal scRNAseq data. By additionally employing gene interaction network information to adjust the final states of DE genes, we further reduce the false positives of calling DE genes. We used simulated datasets and real datasets to evaluate the detection accuracy of the proposed method and to compare its performance with those of other differential expression analysis methods. Results indicate that the proposed method has an overall powerful performance in terms of precision in detection, sensitivity, and specificity. Copyright © 2018 Elsevier Inc. All rights reserved.

A Fast Multiple-Kernel Method With Applications to Detect Gene-Environment Interaction.

Science.gov (United States)

Marceau, Rachel; Lu, Wenbin; Holloway, Shannon; Sale, Michèle M; Worrall, Bradford B; Williams, Stephen R; Hsu, Fang-Chi; Tzeng, Jung-Ying

2015-09-01

Kernel machine (KM) models are a powerful tool for exploring associations between sets of genetic variants and complex traits. Although most KM methods use a single kernel function to assess the marginal effect of a variable set, KM analyses involving multiple kernels have become increasingly popular. Multikernel analysis allows researchers to study more complex problems, such as assessing gene-gene or gene-environment interactions, incorporating variance-component based methods for population substructure into rare-variant association testing, and assessing the conditional effects of a variable set adjusting for other variable sets. The KM framework is robust, powerful, and provides efficient dimension reduction for multifactor analyses, but requires the estimation of high dimensional nuisance parameters. Traditional estimation techniques, including regularization and the "expectation-maximization (EM)" algorithm, have a large computational cost and are not scalable to large sample sizes needed for rare variant analysis. Therefore, under the context of gene-environment interaction, we propose a computationally efficient and statistically rigorous "fastKM" algorithm for multikernel analysis that is based on a low-rank approximation to the nuisance effect kernel matrices. Our algorithm is applicable to various trait types (e.g., continuous, binary, and survival traits) and can be implemented using any existing single-kernel analysis software. Through extensive simulation studies, we show that our algorithm has similar performance to an EM-based KM approach for quantitative traits while running much faster. We also apply our method to the Vitamin Intervention for Stroke Prevention (VISP) clinical trial, examining gene-by-vitamin effects on recurrent stroke risk and gene-by-age effects on change in homocysteine level. © 2015 WILEY PERIODICALS, INC.

Effects of Epigenetic Modulation on Reporter Gene Expression: Implications for Stem Cell Imaging

Science.gov (United States)

Krishnan, Manickam; Park, Jinha M.; Cao, Feng; Wang, Dongxu; Paulmurugan, Ramasay; Tseng, Jeffrey R.; Gonzalgo, Mark L.; Gambhir, Sanjiv S.; Wu, Joseph C.

2013-01-01

Tracking stem cell localization, survival, differentiation, and proliferation following transplantation in living subjects is essential for understanding stem cell biology and physiology. In this study, we investigated the long-term stability of reporter gene expression in an embryonic rat cardiomyoblast cell line and the role of epigenetic modulation on reversing reporter gene silencing. Cells were stably transfected with plasmids carrying cytomegalovirus promoter driving firefly luciferase reporter gene (CMV-Fluc) and passaged repeatedly for 3–8 months. Within the highest expressor clone, the firefly luciferase activity decreased progressively from passage-1 (843±28) to passage-20 (250±10) to passage-40 (44±3) to passage-60 (3±1 RLU/µg) (P<0.05 vs. passage-1). Firefly luciferase activity was maximally rescued by treatment with 5-azacytidine (DNA methyltransferase inhibitor) compared to trichostatin A (histone deacetylase inhibitor) and retinoic acid (transcriptional activator) (P<0.05). Increasing dosages of 5-azacytidine treatment led to higher levels of firefly luciferase mRNA (RT-PCR) and protein (Western blots) and inversely lower levels of methylation in the CMV promoter (DNA nucleotide sequence). These in vitro results were extended to in vivo bioluminescence imaging (BLI) of cell transplant in living animals. Cells treated with 5-azacytidine were monitored for 2 weeks compared to 1 week for untreated cells (P<0.05). These findings should have important implications for reporter gene-based imaging of stem cell transplantation. PMID:16246867

The feasibility of using a baculovirus vector to deliver the sodium-iodide symporter gene as a reporter

Energy Technology Data Exchange (ETDEWEB)

Zhou Xiang; Li Biao; Wang Jun; Yin Hongyan [Department of Nuclear Medicine, Ruijin Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200025 (China); Zhang Yifan [Department of Nuclear Medicine, Ruijin Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai 200025 (China)], E-mail: zhangyifan1992@yahoo.com.cn

2010-04-15

Purpose: To evaluate the efficiency of baculovirus vectors in transducing FTC-133 cells and to examine the feasibility of using baculovirus vectors for the delivery of the sodium-iodide symporter (NIS) gene as a reporter through co-transduction to monitor the expression of the target gene. Method: Two recombinant baculoviruses were constructed to express NIS and green fluorescent protein (GFP) respectively. FTC-133, 8050C, SW1116, A549 cells, were infected with Bac-GFP. The infection efficiency of Bac-GFP and the intensity of fluorescence, in either the presence or absence of sodium butyrate, were monitored by flow cytometry. The iodine uptake by FTC-133 cells infected with Bac-NIS was measured using a {gamma} counter. FTC-133 cells were infected with a mixture of equal amounts of Bac-NIS and Bac-GFP at different setting of multiplicity of infection (MOI). The changes of GFP fluorescence intensity and iodine uptake were monitored 24 h after infection in the coinfected cells. Results: We have successfully constructed recombinant baculoviruses carrying NIS and GFP under the control of the cytomegalovirus IE-1 promoter. We found that transduced efficiency of baculovirus in 8505C, SW1116, A549 cells are low in absence of sodium butyrate. Yet Bac-GFP infects FTC-133 cells at a high efficiency, 77.67%, 85.57% and 93.23% with MOI of 100, 200 and 400, respectively. The fluorescence intensity of the Bac-GFP infected tumor cells correlated positively with the MOI of the virus. Sodium butyrate induction increased both the infection efficiency and the fluorescence intensity, but increase of infection efficiency was insignificant in FTC-133 cells. Reporter gene (GFP) expression in FTC-133 is stable within 7 days after infection. The radioactivity incorporated by the tumor cells infected with Bac-NIS correlated positively with the MOI of Bac-NIS as well. In tumor cells co-infected with Bac-NIS and Bac-GFP, the amount of radioactivity incorporated significantly correlated with

Effect of secretory pathway gene overexpression on secretion of a fluorescent reporter protein in Aspergillus nidulans

DEFF Research Database (Denmark)

Schalén, Martin; Anyaogu, Diana Chinyere; Hoof, Jakob Blæsbjerg

2016-01-01

roles in the process have been identified through transcriptomics. The assignment of function to these genes has been enabled in combination with gene deletion studies. In this work, 14 genes known to play a role in protein secretion in filamentous fungi were overexpressed in Aspergillus nidulans....... The background strain was a fluorescent reporter secreting mRFP. The overall effect of the overexpressions could thus be easily monitored through fluorescence measurements, while the effects on physiology were determined in batch cultivations and surface growth studies. Results: Fourteen protein secretion...... pathway related genes were overexpressed with a tet-ON promoter in the RFP-secreting reporter strain and macromorphology, physiology and protein secretion were monitored when the secretory genes were induced. Overexpression of several of the chosen genes was shown to cause anomalies on growth, micro...

Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

Directory of Open Access Journals (Sweden)

Maria V. Fernández

2018-04-01

Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

Science.gov (United States)

In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

1997-03-01

Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

Autoradiography study and SPECT imaging of reporter gene HSV1-tk expression in heart

Energy Technology Data Exchange (ETDEWEB)

Lan Xiaoli [Department of Nuclear Medicine, Union Hospital, Tongji Medical College of Huazhong University of Science and Technology, Hubei Province Key Laboratory of Molecular Imaging, Wuhan, Hubei Province, 430022 (China)], E-mail: LXL730724@hotmail.com; Liu Ying; He Yong; Wu Tao; Zhang Binqing; Gao Zairong; An Rui [Department of Nuclear Medicine, Union Hospital, Tongji Medical College of Huazhong University of Science and Technology, Hubei Province Key Laboratory of Molecular Imaging, Wuhan, Hubei Province, 430022 (China); Zhang Yongxue [Department of Nuclear Medicine, Union Hospital, Tongji Medical College of Huazhong University of Science and Technology, Hubei Province Key Laboratory of Molecular Imaging, Wuhan, Hubei Province, 430022 (China)], E-mail: zhyx1229@163.com

2010-04-15

Aim: To demonstrate the feasibility and optimal conditions of imaging herpes simplex virus 1-thymidine kinase (HSV1-tk) gene transferred into hearts with {sup 131}I-2'-fluoro-2'-deoxy-1-{beta}-D-arabinofuranosyl-5-iodouracil ({sup 131}I-FIAU) using autoradiography (ARG) and single photon emission computed tomography (SPECT) in animal models. Methods: HSV1-tk inserted into adenovirus vector (Ad5-tk) and adenovirus (Ad5-null) was prepared. Rats or rabbits were divided into a study group receiving intramyocardial injection of Ad5-tk, and a control group receiving Ad-null injection. In the study group of rats, two sets of experiments, time-course study and dose-dependence study, were performed. In time-course experiments, rats were injected with {sup 131}I-FIAU on Days 1, 2, 3, 5 and 7, after transfection of 1x10{sup 8} pfu Ad5-tk, to study the feasibility and suitable time course for reporter gene imaging. In dose-dependence study, various titers of Ad5-tk (5x10{sup 8}, 1x10{sup 8}, 5x10{sup 7} and 1x10{sup 7} pfu) were used to determine the threshold and optimal viral titer needed for detection of gene expression. The gamma counts of hearts were measured. The rat myocardium was analyzed by ARG and reverse transcriptase-polymerase chain reaction (RT-PCR). SPECT whole-body planar imaging and cardiac tomographic imaging were performed in the rabbit models. Results: From the ARG images, rats injected with Ad5-tk showed significant {sup 131}I-FIAU activity in the anterolateral wall compared with background signals seen in the control Ad5-null rats. In time-course study, the highest radioactivity in the focal myocardium could be seen on Day 1, and then progressively declined with time. In dose-dependence study, the level of {sup 131}I-FIAU accumulation in the transfected myocardium declined with the decrease of Ad viral titers. From the ARG analysis and gamma counting, the threshold viral titer was 5x10{sup 7} pfu, and the optimal Ad titer was 1x10{sup 8} pfu

Comparison of multiple gene assembly methods for metabolic engineering

Science.gov (United States)

Chenfeng Lu; Karen Mansoorabadi; Thomas Jeffries

2007-01-01

A universal, rapid DNA assembly method for efficient multigene plasmid construction is important for biological research and for optimizing gene expression in industrial microbes. Three different approaches to achieve this goal were evaluated. These included creating long complementary extensions using a uracil-DNA glycosylase technique, overlap extension polymerase...

A metabolomics-based method for studying the effect of yfcC gene in Escherichia coli on metabolism.

Science.gov (United States)

Wang, Xiyue; Xie, Yuping; Gao, Peng; Zhang, Sufang; Tan, Haidong; Yang, Fengxu; Lian, Rongwei; Tian, Jing; Xu, Guowang

2014-04-15

Metabolomics is a potent tool to assist in identifying the function of unknown genes through analysis of metabolite changes in the context of varied genetic backgrounds. However, the availability of a universal unbiased profiling analysis is still a big challenge. In this study, we report an optimized metabolic profiling method based on gas chromatography-mass spectrometry for Escherichia coli. It was found that physiological saline at -80°C could ensure satisfied metabolic quenching with less metabolite leakage. A solution of methanol/water (21:79, v/v) was proved to be efficient for intracellular metabolite extraction. This method was applied to investigate the metabolome difference among wild-type E. coli, its yfcC deletion, and overexpression mutants. Statistical and bioinformatic analysis of the metabolic profiling data indicated that the expression of yfcC potentially affected the metabolism of glyoxylate shunt. This finding was further validated by real-time quantitative polymerase chain reactions showing that expression of aceA and aceB, the key genes in glyoxylate shunt, was upregulated by yfcC. This study exemplifies the robustness of the proposed metabolic profiling analysis strategy and its potential roles in investigating unknown gene functions in view of metabolome difference. Copyright © 2014 Elsevier Inc. All rights reserved.

Application of biclustering of gene expression data and gene set enrichment analysis methods to identify potentially disease causing nanomaterials

Directory of Open Access Journals (Sweden)

Andrew Williams

2015-12-01

Full Text Available Background: The presence of diverse types of nanomaterials (NMs in commerce is growing at an exponential pace. As a result, human exposure to these materials in the environment is inevitable, necessitating the need for rapid and reliable toxicity testing methods to accurately assess the potential hazards associated with NMs. In this study, we applied biclustering and gene set enrichment analysis methods to derive essential features of altered lung transcriptome following exposure to NMs that are associated with lung-specific diseases. Several datasets from public microarray repositories describing pulmonary diseases in mouse models following exposure to a variety of substances were examined and functionally related biclusters of genes showing similar expression profiles were identified. The identified biclusters were then used to conduct a gene set enrichment analysis on pulmonary gene expression profiles derived from mice exposed to nano-titanium dioxide (nano-TiO2, carbon black (CB or carbon nanotubes (CNTs to determine the disease significance of these data-driven gene sets.Results: Biclusters representing inflammation (chemokine activity, DNA binding, cell cycle, apoptosis, reactive oxygen species (ROS and fibrosis processes were identified. All of the NM studies were significant with respect to the bicluster related to chemokine activity (DAVID; FDR p-value = 0.032. The bicluster related to pulmonary fibrosis was enriched in studies where toxicity induced by CNT and CB studies was investigated, suggesting the potential for these materials to induce lung fibrosis. The pro-fibrogenic potential of CNTs is well established. Although CB has not been shown to induce fibrosis, it induces stronger inflammatory, oxidative stress and DNA damage responses than nano-TiO2 particles.Conclusion: The results of the analysis correctly identified all NMs to be inflammogenic and only CB and CNTs as potentially fibrogenic. In addition to identifying several

A novel method of predicting microRNA-disease associations based on microRNA, disease, gene and environment factor networks.

Science.gov (United States)

Peng, Wei; Lan, Wei; Zhong, Jiancheng; Wang, Jianxin; Pan, Yi

2017-07-15

MicroRNAs have been reported to have close relationship with diseases due to their deregulation of the expression of target mRNAs. Detecting disease-related microRNAs is helpful for disease therapies. With the development of high throughput experimental techniques, a large number of microRNAs have been sequenced. However, it is still a big challenge to identify which microRNAs are related to diseases. Recently, researchers are interesting in combining multiple-biological information to identify the associations between microRNAs and diseases. In this work, we have proposed a novel method to predict the microRNA-disease associations based on four biological properties. They are microRNA, disease, gene and environment factor. Compared with previous methods, our method makes predictions not only by using the prior knowledge of associations among microRNAs, disease, environment factors and genes, but also by using the internal relationship among these biological properties. We constructed four biological networks based on the similarity of microRNAs, diseases, environment factors and genes, respectively. Then random walking was implemented on the four networks unequally. In the walking course, the associations can be inferred from the neighbors in the same networks. Meanwhile the association information can be transferred from one network to another. The results of experiment showed that our method achieved better prediction performance than other existing state-of-the-art methods. Copyright © 2017 Elsevier Inc. All rights reserved.

Development of library preparation method able to correct gene expression levels in rice anther and isolate a trace expression gene mediated in cold-resistance

Energy Technology Data Exchange (ETDEWEB)

Yamaguchi, Tomoya; Koike, Setsuo [Tohoku National Agricultural Experiment Station, Morioka (Japan)

2000-02-01

When cDNA library is prepared by a previously developed method, genes of which expression level is high are apt to be cloned at a high frequency, whereas genes of which expression level are low, are difficult to be cloned. A low-expression gene has been cloned at very low frequency. Therefore, the gene encoding the key enzyme that is involved in growth disturbance of rice pollen has not been identified. In this study, development of a library preparing method able to correct the expression level was attempted using highly sensitive detection method with radioisotope and some genes related to cold-resistance of rice were isolated. Double strand DNAs were synthesized using mRNA extract from rice anthers and annealed following heat-denaturation. It has been known that single strand DNA molecules abundantly existing in DNA solution can easily aggregate to form double strand DNA, but single stranded DNA molecules poor in the solution are apt to still remain as single strand after annealing. Thus, the amount of single strand DNA would be balanced in the solution between abundant DNA and poor DNA species. The authors succeeded to prepare a gene library including low and high expression genes at similar proportions. Moreover, spin trap method that allows RI labeling of DNA bound to latex particle, was developed to detect with high sensitivity, especially for genes that are expressed at low level. The present method could be used for recovery, detection and quantitative analysis of radiolabeled single strand DNA. Thus, it was demonstrated that the stage from tetrad sperm to small sperm might be easily affected by cold stress. The present results suggest that the expressions of {beta}-1 and {beta}-3 glucanase, which are involved in the release of small sperms following meiosis in the pollen formation, might be easily affected by cold stress. (M.N.)

Development of library preparation method able to correct gene expression levels in rice anther and isolate a trace expression gene mediated in cold-resistance

International Nuclear Information System (INIS)

Yamaguchi, Tomoya; Koike, Setsuo

2000-01-01

When cDNA library is prepared by a previously developed method, genes of which expression level is high are apt to be cloned at a high frequency, whereas genes of which expression level are low, are difficult to be cloned. A low-expression gene has been cloned at very low frequency. Therefore, the gene encoding the key enzyme that is involved in growth disturbance of rice pollen has not been identified. In this study, development of a library preparing method able to correct the expression level was attempted using highly sensitive detection method with radioisotope and some genes related to cold-resistance of rice were isolated. Double strand DNAs were synthesized using mRNA extract from rice anthers and annealed following heat-denaturation. It has been known that single strand DNA molecules abundantly existing in DNA solution can easily aggregate to form double strand DNA, but single stranded DNA molecules poor in the solution are apt to still remain as single strand after annealing. Thus, the amount of single strand DNA would be balanced in the solution between abundant DNA and poor DNA species. The authors succeeded to prepare a gene library including low and high expression genes at similar proportions. Moreover, spin trap method that allows RI labeling of DNA bound to latex particle, was developed to detect with high sensitivity, especially for genes that are expressed at low level. The present method could be used for recovery, detection and quantitative analysis of radiolabeled single strand DNA. Thus, it was demonstrated that the stage from tetrad sperm to small sperm might be easily affected by cold stress. The present results suggest that the expressions of β-1 and β-3 glucanase, which are involved in the release of small sperms following meiosis in the pollen formation, might be easily affected by cold stress. (M.N.)

The experimental study of reporter probe 131I-FIAU in neonatal cardiac myocytes after transfer of herpes simplex virus type 1 thymidine kinase reporter gene by different vectors

International Nuclear Information System (INIS)

Yin Xiaohua; Lan Xiaoli; Wang Ruihua; Liu Ying; Zhang Yongxue

2009-01-01

Objective: Reporter gene imaging is a promising approach for noninvasive monitoring of cardiac gene therapy. In the present study, the recombinant plasmid and adenoviral vector carrying reporter gene. herpes simplex virus type 1 thymidine kinase (HSV1-tk), were constructed and transferred into nee-natal cardiac myocytes, and a series of in vitro studies were carried out on the cells transferred to evaluate the uptake of radiolabeled reporter probe and to compare both vectors for cardiac reporter gene imaging. Methods: Neonatal cardiac myocytes were obtained from rat heart by single collagenase digestion. HSVI-tk. chosen as the reporter gene.was inserted into adenovirus vector (Ad5-tk) and plasmid (pDC316-tk), thus it could be transferred into neonatal cardiac myocytes. Recombinant adenovirus containing enhanced green fluorescent protein (Ad5-EGFP) was used as control. Recombinant plasmid was coated with lipofectamine TM 2000 (pDC316-tk/lipoplex). The specific reporter probe of HSV1-tk, 2'-fluoro-2'-deoxy-l-β-D-arabinofuranosyl-uracil (FAU), was labeled with 131 I by solid phase oxidation with lodogen. Product wag purified on a reverse. phase Sep-Pak C18 column and the radiochemical purity wag then assessed. The accumulation of it in the transferred cardiac myocytes wag detected as uptake rate. Furthermore, mRNA expression of HSV1-tk was detected by semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR), while its protein expression wag located by immunocytochemistry. Results: FAU could be labeled with 131 I and the labeling efficiency was (53.82 ±2.05)%. The radiochemical purity was (94.85 ± 1.76)% after purification, and it kept stable in vitro for at least 24h. Time-dependent increase of the ac- cumulation of 131 I-FIAU was observed in both Ad5-tk group and pDC316-tk/lipoplex group. and the highest uptake rate occurred at 5h, with peak values of (12.55 ± 0.37)% and (2.09 ± 0.34)% respectively. However, it also indicated that greater

Volatile Gas Production by Methyl Halide Transferase: An In Situ Reporter Of Microbial Gene Expression In Soil.

Science.gov (United States)

Cheng, Hsiao-Ying; Masiello, Caroline A; Bennett, George N; Silberg, Jonathan J

2016-08-16

Traditional visual reporters of gene expression have only very limited use in soils because their outputs are challenging to detect through the soil matrix. This severely restricts our ability to study time-dependent microbial gene expression in one of the Earth's largest, most complex habitats. Here we describe an approach to report on dynamic gene expression within a microbial population in a soil under natural water levels (at and below water holding capacity) via production of methyl halides using a methyl halide transferase. As a proof-of-concept application, we couple the expression of this gas reporter to the conjugative transfer of a bacterial plasmid in a soil matrix and show that gas released from the matrix displays a strong correlation with the number of transconjugant bacteria that formed. Gas reporting of gene expression will make possible dynamic studies of natural and engineered microbes within many hard-to-image environmental matrices (soils, sediments, sludge, and biomass) at sample scales exceeding those used for traditional visual reporting.

A method for CRISPR/Cas9 mutation of genes in fathead minnow

Science.gov (United States)

Product Description: CRISPR/Cas9 is a system that can be used to disrupt a gene of interest in any animal. It allows us to study each gene’s role by observing changes in the animal when the gene isn’t functional. We worked out a method to use this technology in the f...

A Comparative Study of Feature Selection and Classification Methods for Gene Expression Data of Glioma

KAUST Repository

Abusamra, Heba

2013-11-01

Microarray gene expression data gained great importance in recent years due to its role in disease diagnoses and prognoses which help to choose the appropriate treatment plan for patients. This technology has shifted a new era in molecular classification. Interpreting gene expression data remains a difficult problem and an active research area due to their native nature of “high dimensional low sample size”. Such problems pose great challenges to existing classification methods. Thus, effective feature selection techniques are often needed in this case to aid to correctly classify different tumor types and consequently lead to a better understanding of genetic signatures as well as improve treatment strategies. This paper aims on a comparative study of state-of-the- art feature selection methods, classification methods, and the combination of them, based on gene expression data. We compared the efficiency of three different classification methods including: support vector machines, k-nearest neighbor and random forest, and eight different feature selection methods, including: information gain, twoing rule, sum minority, max minority, gini index, sum of variances, t-statistics, and one-dimension support vector machine. Five-fold cross validation was used to evaluate the classification performance. Two publicly available gene expression data sets of glioma were used in the experiments. Results revealed the important role of feature selection in classifying gene expression data. By performing feature selection, the classification accuracy can be significantly boosted by using a small number of genes. The relationship of features selected in different feature selection methods is investigated and the most frequent features selected in each fold among all methods for both datasets are evaluated.

A Comparative Study of Feature Selection and Classification Methods for Gene Expression Data of Glioma

KAUST Repository

Abusamra, Heba

2013-01-01

Microarray gene expression data gained great importance in recent years due to its role in disease diagnoses and prognoses which help to choose the appropriate treatment plan for patients. This technology has shifted a new era in molecular classification. Interpreting gene expression data remains a difficult problem and an active research area due to their native nature of “high dimensional low sample size”. Such problems pose great challenges to existing classification methods. Thus, effective feature selection techniques are often needed in this case to aid to correctly classify different tumor types and consequently lead to a better understanding of genetic signatures as well as improve treatment strategies. This paper aims on a comparative study of state-of-the- art feature selection methods, classification methods, and the combination of them, based on gene expression data. We compared the efficiency of three different classification methods including: support vector machines, k-nearest neighbor and random forest, and eight different feature selection methods, including: information gain, twoing rule, sum minority, max minority, gini index, sum of variances, t-statistics, and one-dimension support vector machine. Five-fold cross validation was used to evaluate the classification performance. Two publicly available gene expression data sets of glioma were used in the experiments. Results revealed the important role of feature selection in classifying gene expression data. By performing feature selection, the classification accuracy can be significantly boosted by using a small number of genes. The relationship of features selected in different feature selection methods is investigated and the most frequent features selected in each fold among all methods for both datasets are evaluated.

A meta-analysis based method for prioritizing candidate genes involved in a pre-specific function

Directory of Open Access Journals (Sweden)

Jingjing Zhai

2016-12-01

Full Text Available The identification of genes associated with a given biological function in plants remains a challenge, although network-based gene prioritization algorithms have been developed for Arabidopsis thaliana and many non-model plant species. Nevertheless, these network-based gene prioritization algorithms have encountered several problems; one in particular is that of unsatisfactory prediction accuracy due to limited network coverage, varying link quality, and/or uncertain network connectivity. Thus a model that integrates complementary biological data may be expected to increase the prediction accuracy of gene prioritization. Towards this goal, we developed a novel gene prioritization method named RafSee, to rank candidate genes using a random forest algorithm that integrates sequence, evolutionary, and epigenetic features of plants. Subsequently, we proposed an integrative approach named RAP (Rank Aggregation-based data fusion for gene Prioritization, in which an order statistics-based meta-analysis was used to aggregate the rank of the network-based gene prioritization method and RafSee, for accurately prioritizing candidate genes involved in a pre-specific biological function. Finally, we showcased the utility of RAP by prioritizing 380 flowering-time genes in Arabidopsis. The ‘leave-one-out’ cross-validation experiment showed that RafSee could work as a complement to a current state-of-art network-based gene prioritization system (AraNet v2. Moreover, RAP ranked 53.68% (204/380 flowering-time genes higher than AraNet v2, resulting in an 39.46% improvement in term of the first quartile rank. Further evaluations also showed that RAP was effective in prioritizing genes-related to different abiotic stresses. To enhance the usability of RAP for Arabidopsis and non-model plant species, an R package implementing the method is freely available at http://bioinfo.nwafu.edu.cn/software.

Analyzing gene expression profiles in dilated cardiomyopathy via bioinformatics methods.

Science.gov (United States)

Wang, Liming; Zhu, L; Luan, R; Wang, L; Fu, J; Wang, X; Sui, L

2016-10-10

Dilated cardiomyopathy (DCM) is characterized by ventricular dilatation, and it is a common cause of heart failure and cardiac transplantation. This study aimed to explore potential DCM-related genes and their underlying regulatory mechanism using methods of bioinformatics. The gene expression profiles of GSE3586 were downloaded from Gene Expression Omnibus database, including 15 normal samples and 13 DCM samples. The differentially expressed genes (DEGs) were identified between normal and DCM samples using Limma package in R language. Pathway enrichment analysis of DEGs was then performed. Meanwhile, the potential transcription factors (TFs) and microRNAs (miRNAs) of these DEGs were predicted based on their binding sequences. In addition, DEGs were mapped to the cMap database to find the potential small molecule drugs. A total of 4777 genes were identified as DEGs by comparing gene expression profiles between DCM and control samples. DEGs were significantly enriched in 26 pathways, such as lymphocyte TarBase pathway and androgen receptor signaling pathway. Furthermore, potential TFs (SP1, LEF1, and NFAT) were identified, as well as potential miRNAs (miR-9, miR-200 family, and miR-30 family). Additionally, small molecules like isoflupredone and trihexyphenidyl were found to be potential therapeutic drugs for DCM. The identified DEGs (PRSS12 and FOXG1), potential TFs, as well as potential miRNAs, might be involved in DCM.

Analyzing gene expression profiles in dilated cardiomyopathy via bioinformatics methods

Directory of Open Access Journals (Sweden)

Liming Wang

Full Text Available Dilated cardiomyopathy (DCM is characterized by ventricular dilatation, and it is a common cause of heart failure and cardiac transplantation. This study aimed to explore potential DCM-related genes and their underlying regulatory mechanism using methods of bioinformatics. The gene expression profiles of GSE3586 were downloaded from Gene Expression Omnibus database, including 15 normal samples and 13 DCM samples. The differentially expressed genes (DEGs were identified between normal and DCM samples using Limma package in R language. Pathway enrichment analysis of DEGs was then performed. Meanwhile, the potential transcription factors (TFs and microRNAs (miRNAs of these DEGs were predicted based on their binding sequences. In addition, DEGs were mapped to the cMap database to find the potential small molecule drugs. A total of 4777 genes were identified as DEGs by comparing gene expression profiles between DCM and control samples. DEGs were significantly enriched in 26 pathways, such as lymphocyte TarBase pathway and androgen receptor signaling pathway. Furthermore, potential TFs (SP1, LEF1, and NFAT were identified, as well as potential miRNAs (miR-9, miR-200 family, and miR-30 family. Additionally, small molecules like isoflupredone and trihexyphenidyl were found to be potential therapeutic drugs for DCM. The identified DEGs (PRSS12 and FOXG1, potential TFs, as well as potential miRNAs, might be involved in DCM.

Preclinical evaluation of gene delivery methods for the treatment of loco-regional disease in breast cancer.

LENUS (Irish Health Repository)

Rajendran, Simon

2011-04-01

Preclinical results with various gene therapy strategies indicate significant potential for new cancer treatments. However, many therapeutics fail at clinical trial, often due to differences in tissue physiology between animal models and humans, and tumor phenotype variation. Clinical data relevant to treatment strategies may be generated prior to clinical trial through experimentation using intact patient tissue ex vivo. We developed a novel tumor slice model culture system that is universally applicable to gene delivery methods, using a realtime luminescence detection method to assess gene delivery. Methods investigated include viruses (adenovirus [Ad] and adeno-associated virus), lipofection, ultrasound (US), electroporation and naked DNA. Viability and tumor populations within the slices were well maintained for seven days, and gene delivery was qualitatively and quantitatively examinable for all vectors. Ad was the most efficient gene delivery vector with transduction efficiency >50%. US proved the optimal non-viral gene delivery method in human tumor slices. The nature of the ex vivo culture system permitted examination of specific elements. Parameters shown to diminish Ad gene delivery included blood, regions of low viability and secondary disease. US gene delivery was significantly reduced by blood and skin, while tissue hyperthermia improved gene delivery. US achieved improved efficacy for secondary disease. The ex vivo model was also suitable for examination of tissue-specific effects on vector expression, with Ad expression mediated by the CXCR4 promoter shown to provide a tumor selective advantage over the ubiquitously active cytomegalovirus promoter. In conclusion, this is the first study incorporating patient tissue models in comparing gene delivery from various vectors, providing knowledge on cell-type specificity and examining the crucial biological factors determining successful gene delivery. The results highlight the importance of in

Preclinical evaluation of gene delivery methods for the treatment of loco-regional disease in breast cancer.

LENUS (Irish Health Repository)

Rajendran, Simon

2012-01-31

Preclinical results with various gene therapy strategies indicate significant potential for new cancer treatments. However, many therapeutics fail at clinical trial, often due to differences in tissue physiology between animal models and humans, and tumor phenotype variation. Clinical data relevant to treatment strategies may be generated prior to clinical trial through experimentation using intact patient tissue ex vivo. We developed a novel tumor slice model culture system that is universally applicable to gene delivery methods, using a realtime luminescence detection method to assess gene delivery. Methods investigated include viruses (adenovirus [Ad] and adeno-associated virus), lipofection, ultrasound (US), electroporation and naked DNA. Viability and tumor populations within the slices were well maintained for seven days, and gene delivery was qualitatively and quantitatively examinable for all vectors. Ad was the most efficient gene delivery vector with transduction efficiency >50%. US proved the optimal non-viral gene delivery method in human tumor slices. The nature of the ex vivo culture system permitted examination of specific elements. Parameters shown to diminish Ad gene delivery included blood, regions of low viability and secondary disease. US gene delivery was significantly reduced by blood and skin, while tissue hyperthermia improved gene delivery. US achieved improved efficacy for secondary disease. The ex vivo model was also suitable for examination of tissue-specific effects on vector expression, with Ad expression mediated by the CXCR4 promoter shown to provide a tumor selective advantage over the ubiquitously active cytomegalovirus promoter. In conclusion, this is the first study incorporating patient tissue models in comparing gene delivery from various vectors, providing knowledge on cell-type specificity and examining the crucial biological factors determining successful gene delivery. The results highlight the importance of in

Splicing defect in FKBP10 gene causes autosomal recessive osteogenesis imperfecta disease: a case report.

Science.gov (United States)

Maghami, Fatemeh; Tabei, Seyed Mohammad Bagher; Moravej, Hossein; Dastsooz, Hassan; Modarresi, Farzaneh; Silawi, Mohammad; Faghihi, Mohammad Ali

2018-05-25

Osteogenesis imperfecta (OI) is a group of connective tissue disorder caused by mutations of genes involved in the production of collagen and its supporting proteins. Although the majority of reported OI variants are in COL1A1 and COL1A2 genes, recent reports have shown problems in other non-collagenous genes involved in the post translational modifications, folding and transport, transcription and proliferation of osteoblasts, bone mineralization, and cell signaling. Up to now, 17 types of OI have been reported in which types I to IV are the most frequent cases with autosomal dominant pattern of inheritance. Here we report an 8- year- old boy with OI who has had multiple fractures since birth and now he is wheelchair-dependent. To identify genetic cause of OI in our patient, whole exome sequencing (WES) was carried out and it revealed a novel deleterious homozygote splice acceptor site mutation (c.1257-2A > G, IVS7-2A > G) in FKBP10 gene in the patient. Then, the identified mutation was confirmed using Sanger sequencing in the proband as homozygous and in his parents as heterozygous, indicating its autosomal recessive pattern of inheritance. In addition, we performed RT-PCR on RNA transcripts originated from skin fibroblast of the proband to analyze the functional effect of the mutation on splicing pattern of FKBP10 gene and it showed skipping of the exon 8 of this gene. Moreover, Real-Time PCR was carried out to quantify the expression level of FKBP10 in the proband and his family members in which it revealed nearly the full decrease in the level of FKBP10 expression in the proband and around 75% decrease in its level in the carriers of the mutation, strongly suggesting the pathogenicity of the mutation. Our study identified, for the first time, a private pathogenic splice site mutation in FKBP10 gene and further prove the involvement of this gene in the rare cases of autosomal recessive OI type XI with distinguished clinical manifestations.

An algebra-based method for inferring gene regulatory networks.

Science.gov (United States)

Vera-Licona, Paola; Jarrah, Abdul; Garcia-Puente, Luis David; McGee, John; Laubenbacher, Reinhard

2014-03-26

The inference of gene regulatory networks (GRNs) from experimental observations is at the heart of systems biology. This includes the inference of both the network topology and its dynamics. While there are many algorithms available to infer the network topology from experimental data, less emphasis has been placed on methods that infer network dynamics. Furthermore, since the network inference problem is typically underdetermined, it is essential to have the option of incorporating into the inference process, prior knowledge about the network, along with an effective description of the search space of dynamic models. Finally, it is also important to have an understanding of how a given inference method is affected by experimental and other noise in the data used. This paper contains a novel inference algorithm using the algebraic framework of Boolean polynomial dynamical systems (BPDS), meeting all these requirements. The algorithm takes as input time series data, including those from network perturbations, such as knock-out mutant strains and RNAi experiments. It allows for the incorporation of prior biological knowledge while being robust to significant levels of noise in the data used for inference. It uses an evolutionary algorithm for local optimization with an encoding of the mathematical models as BPDS. The BPDS framework allows an effective representation of the search space for algebraic dynamic models that improves computational performance. The algorithm is validated with both simulated and experimental microarray expression profile data. Robustness to noise is tested using a published mathematical model of the segment polarity gene network in Drosophila melanogaster. Benchmarking of the algorithm is done by comparison with a spectrum of state-of-the-art network inference methods on data from the synthetic IRMA network to demonstrate that our method has good precision and recall for the network reconstruction task, while also predicting several of the

Non-Viral Transfection Methods Optimized for Gene Delivery to a Lung Cancer Cell Line

Science.gov (United States)

Salimzadeh, Loghman; Jaberipour, Mansooreh; Hosseini, Ahmad; Ghaderi, Abbas

2013-01-01

Background Mehr-80 is a newly established adherent human large cell lung cancer cell line that has not been transfected until now. This study aims to define the optimal transfection conditions and effects of some critical elements for enhancing gene delivery to this cell line by utilizing different non-viral transfection Procedures. Methods In the current study, calcium phosphate (CaP), DEAE-dextran, superfect, electroporation and lipofection transfection methods were used to optimize delivery of a plasmid construct that expressed Green Fluorescent Protein (GFP). Transgene expression was detected by fluorescent microscopy and flowcytometry. Toxicities of the methods were estimated by trypan blue staining. In order to evaluate the density of the transfected gene, we used a plasmid construct that expressed the Stromal cell-Derived Factor-1 (SDF-1) gene and measured its expression by real-time PCR. Results Mean levels of GFP-expressing cells 48 hr after transfection were 8.4% (CaP), 8.2% (DEAE-dextran), 4.9% (superfect), 34.1% (electroporation), and 40.1% (lipofection). Lipofection had the highest intense SDF-1 expression of the analyzed methods. Conclusion This study has shown that the lipofection and electroporation methods were more efficient at gene delivery to Mehr-80 cells. The quantity of DNA per transfection, reagent concentration, and incubation time were identified as essential factors for successful transfection in all of the studied methods. PMID:23799175

WellReader: a MATLAB program for the analysis of fluorescence and luminescence reporter gene data.

Science.gov (United States)

Boyer, Frédéric; Besson, Bruno; Baptist, Guillaume; Izard, Jérôme; Pinel, Corinne; Ropers, Delphine; Geiselmann, Johannes; de Jong, Hidde

2010-05-01

Fluorescent and luminescent reporter gene systems in combination with automated microplate readers allow real-time monitoring of gene expression on the population level at high precision and sampling density. This generates large amounts of data for the analysis of which computer tools are missing to date. We have developed WellReader, a MATLAB program for the analysis of fluorescent and luminescent reporter gene data. WellReader allows the user to load the output files of microplate readers, remove outliers, correct for background effects and smooth and fit the data. Moreover, it computes biologically relevant quantities from the measured signals, notably promoter activities and protein concentrations, and compares the resulting expression profiles of different genes under different conditions. WellReader is available under a LGPL licence at http://prabi1.inrialpes.fr/trac/wellreader.

Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

Science.gov (United States)

Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian

2013-01-01

We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

Porcine E. coli: virulence-associated genes, resistance genes and adhesion and probiotic activity tested by a new screening method.

Directory of Open Access Journals (Sweden)

Peter Schierack

Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.

A fast, simple method for screening radiation susceptibility genes by RNA interference

International Nuclear Information System (INIS)

Tsuji, Atsushi B.; Sudo, Hitomi; Sugyo, Aya; Otsuki, Marika; Miyagishi, Makoto; Taira, Kazunari; Imai, Takashi; Harada, Yoshi-nobu

2005-01-01

Radiotherapy can cause unacceptable levels of damage to normal tissues in some cancer patients. To understand the molecular mechanisms underlying radiation-induced physiological responses, and to be able to predict the radiation susceptibility of normal tissues in individual patients, it is important to identify a comprehensive set of genes responsible for radiation susceptibility. We have developed a simple and rapid 96-well screening protocol using cell proliferation assays and RNA interference to identify genes associated with radiation susceptibility. We evaluated the performance of alamarBlue-, BrdU-, and sulforhodamine B-based cell proliferation assays using the 96-well format. Each proliferation assay detected the known radiation susceptibility gene, PRKDC. In a trial screen using 28 shRNA vectors, another known gene, CDKN1A, and one new radiation susceptibility gene, ATP5G3, were identified. Our results indicate that this method may be useful for large-scale screens designed to identify novel radiation susceptibility genes

Comparison of information-theoretic to statistical methods for gene-gene interactions in the presence of genetic heterogeneity

Directory of Open Access Journals (Sweden)

Sucheston Lara

2010-09-01

Full Text Available Abstract Background Multifactorial diseases such as cancer and cardiovascular diseases are caused by the complex interplay between genes and environment. The detection of these interactions remains challenging due to computational limitations. Information theoretic approaches use computationally efficient directed search strategies and thus provide a feasible solution to this problem. However, the power of information theoretic methods for interaction analysis has not been systematically evaluated. In this work, we compare power and Type I error of an information-theoretic approach to existing interaction analysis methods. Methods The k-way interaction information (KWII metric for identifying variable combinations involved in gene-gene interactions (GGI was assessed using several simulated data sets under models of genetic heterogeneity driven by susceptibility increasing loci with varying allele frequency, penetrance values and heritability. The power and proportion of false positives of the KWII was compared to multifactor dimensionality reduction (MDR, restricted partitioning method (RPM and logistic regression. Results The power of the KWII was considerably greater than MDR on all six simulation models examined. For a given disease prevalence at high values of heritability, the power of both RPM and KWII was greater than 95%. For models with low heritability and/or genetic heterogeneity, the power of the KWII was consistently greater than RPM; the improvements in power for the KWII over RPM ranged from 4.7% to 14.2% at for α = 0.001 in the three models at the lowest heritability values examined. KWII performed similar to logistic regression. Conclusions Information theoretic models are flexible and have excellent power to detect GGI under a variety of conditions that characterize complex diseases.

Bacterial host and reporter gene optimization for genetically encoded whole cell biosensors.

Science.gov (United States)

Brutesco, Catherine; Prévéral, Sandra; Escoffier, Camille; Descamps, Elodie C T; Prudent, Elsa; Cayron, Julien; Dumas, Louis; Ricquebourg, Manon; Adryanczyk-Perrier, Géraldine; de Groot, Arjan; Garcia, Daniel; Rodrigue, Agnès; Pignol, David; Ginet, Nicolas

2017-01-01

Whole-cell biosensors based on reporter genes allow detection of toxic metals in water with high selectivity and sensitivity under laboratory conditions; nevertheless, their transfer to a commercial inline water analyzer requires specific adaptation and optimization to field conditions as well as economical considerations. We focused here on both the influence of the bacterial host and the choice of the reporter gene by following the responses of global toxicity biosensors based on constitutive bacterial promoters as well as arsenite biosensors based on the arsenite-inducible P ars promoter. We observed important variations of the bioluminescence emission levels in five different Escherichia coli strains harboring two different lux-based biosensors, suggesting that the best host strain has to be empirically selected for each new biosensor under construction. We also investigated the bioluminescence reporter gene system transferred into Deinococcus deserti, an environmental, desiccation- and radiation-tolerant bacterium that would reduce the manufacturing costs of bacterial biosensors for commercial water analyzers and open the field of biodetection in radioactive environments. We thus successfully obtained a cell survival biosensor and a metal biosensor able to detect a concentration as low as 100 nM of arsenite in D. deserti. We demonstrated that the arsenite biosensor resisted desiccation and remained functional after 7 days stored in air-dried D. deserti cells. We also report here the use of a new near-infrared (NIR) fluorescent reporter candidate, a bacteriophytochrome from the magnetotactic bacterium Magnetospirillum magneticum AMB-1, which showed a NIR fluorescent signal that remained optimal despite increasing sample turbidity, while in similar conditions, a drastic loss of the lux-based biosensors signal was observed.

An efficient parallel stochastic simulation method for analysis of nonviral gene delivery systems

KAUST Repository

Kuwahara, Hiroyuki

2011-01-01

Gene therapy has a great potential to become an effective treatment for a wide variety of diseases. One of the main challenges to make gene therapy practical in clinical settings is the development of efficient and safe mechanisms to deliver foreign DNA molecules into the nucleus of target cells. Several computational and experimental studies have shown that the design process of synthetic gene transfer vectors can be greatly enhanced by computational modeling and simulation. This paper proposes a novel, effective parallelization of the stochastic simulation algorithm (SSA) for pharmacokinetic models that characterize the rate-limiting, multi-step processes of intracellular gene delivery. While efficient parallelizations of the SSA are still an open problem in a general setting, the proposed parallel simulation method is able to substantially accelerate the next reaction selection scheme and the reaction update scheme in the SSA by exploiting and decomposing the structures of stochastic gene delivery models. This, thus, makes computationally intensive analysis such as parameter optimizations and gene dosage control for specific cell types, gene vectors, and transgene expression stability substantially more practical than that could otherwise be with the standard SSA. Here, we translated the nonviral gene delivery model based on mass-action kinetics by Varga et al. [Molecular Therapy, 4(5), 2001] into a more realistic model that captures intracellular fluctuations based on stochastic chemical kinetics, and as a case study we applied our parallel simulation to this stochastic model. Our results show that our simulation method is able to increase the efficiency of statistical analysis by at least 50% in various settings. © 2011 ACM.

Identification of human circadian genes based on time course gene expression profiles by using a deep learning method.

Science.gov (United States)

Cui, Peng; Zhong, Tingyan; Wang, Zhuo; Wang, Tao; Zhao, Hongyu; Liu, Chenglin; Lu, Hui

2018-06-01

Circadian genes express periodically in an approximate 24-h period and the identification and study of these genes can provide deep understanding of the circadian control which plays significant roles in human health. Although many circadian gene identification algorithms have been developed, large numbers of false positives and low coverage are still major problems in this field. In this study we constructed a novel computational framework for circadian gene identification using deep neural networks (DNN) - a deep learning algorithm which can represent the raw form of data patterns without imposing assumptions on the expression distribution. Firstly, we transformed time-course gene expression data into categorical-state data to denote the changing trend of gene expression. Two distinct expression patterns emerged after clustering of the state data for circadian genes from our manually created learning dataset. DNN was then applied to discriminate the aperiodic genes and the two subtypes of periodic genes. In order to assess the performance of DNN, four commonly used machine learning methods including k-nearest neighbors, logistic regression, naïve Bayes, and support vector machines were used for comparison. The results show that the DNN model achieves the best balanced precision and recall. Next, we conducted large scale circadian gene detection using the trained DNN model for the remaining transcription profiles. Comparing with JTK_CYCLE and a study performed by Möller-Levet et al. (doi: https://doi.org/10.1073/pnas.1217154110), we identified 1132 novel periodic genes. Through the functional analysis of these novel circadian genes, we found that the GTPase superfamily exhibits distinct circadian expression patterns and may provide a molecular switch of circadian control of the functioning of the immune system in human blood. Our study provides novel insights into both the circadian gene identification field and the study of complex circadian-driven biological

Comparison of methods for genomic localization of gene trap sequences

Directory of Open Access Journals (Sweden)

Ferrin Thomas E

2006-09-01

Full Text Available Abstract Background Gene knockouts in a model organism such as mouse provide a valuable resource for the study of basic biology and human disease. Determining which gene has been inactivated by an untargeted gene trapping event poses a challenging annotation problem because gene trap sequence tags, which represent sequence near the vector insertion site of a trapped gene, are typically short and often contain unresolved residues. To understand better the localization of these sequences on the mouse genome, we compared stand-alone versions of the alignment programs BLAT, SSAHA, and MegaBLAST. A set of 3,369 sequence tags was aligned to build 34 of the mouse genome using default parameters for each algorithm. Known genome coordinates for the cognate set of full-length genes (1,659 sequences were used to evaluate localization results. Results In general, all three programs performed well in terms of localizing sequences to a general region of the genome, with only relatively subtle errors identified for a small proportion of the sequence tags. However, large differences in performance were noted with regard to correctly identifying exon boundaries. BLAT correctly identified the vast majority of exon boundaries, while SSAHA and MegaBLAST missed the majority of exon boundaries. SSAHA consistently reported the fewest false positives and is the fastest algorithm. MegaBLAST was comparable to BLAT in speed, but was the most susceptible to localizing sequence tags incorrectly to pseudogenes. Conclusion The differences in performance for sequence tags and full-length reference sequences were surprisingly small. Characteristic variations in localization results for each program were noted that affect the localization of sequence at exon boundaries, in particular.

Parameter estimation methods for gene circuit modeling from time-series mRNA data: a comparative study.

Science.gov (United States)

Fan, Ming; Kuwahara, Hiroyuki; Wang, Xiaolei; Wang, Suojin; Gao, Xin

2015-11-01

Parameter estimation is a challenging computational problem in the reverse engineering of biological systems. Because advances in biotechnology have facilitated wide availability of time-series gene expression data, systematic parameter estimation of gene circuit models from such time-series mRNA data has become an important method for quantitatively dissecting the regulation of gene expression. By focusing on the modeling of gene circuits, we examine here the performance of three types of state-of-the-art parameter estimation methods: population-based methods, online methods and model-decomposition-based methods. Our results show that certain population-based methods are able to generate high-quality parameter solutions. The performance of these methods, however, is heavily dependent on the size of the parameter search space, and their computational requirements substantially increase as the size of the search space increases. In comparison, online methods and model decomposition-based methods are computationally faster alternatives and are less dependent on the size of the search space. Among other things, our results show that a hybrid approach that augments computationally fast methods with local search as a subsequent refinement procedure can substantially increase the quality of their parameter estimates to the level on par with the best solution obtained from the population-based methods while maintaining high computational speed. These suggest that such hybrid methods can be a promising alternative to the more commonly used population-based methods for parameter estimation of gene circuit models when limited prior knowledge about the underlying regulatory mechanisms makes the size of the parameter search space vastly large. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

Prediction methods environmental-effect reporting

International Nuclear Information System (INIS)

Jonker, R.J.; Koester, H.W.

1987-12-01

This report provides a survey of prediction methods which can be applied to the calculation of emissions in cuclear-reactor accidents, in the framework of environment-effect reports (dutch m.e.r.) or risk analyses. Also emissions during normal operation are important for m.e.r.. These can be derived from measured emissions of power plants being in operation. Data concerning the latter are reported. The report consists of an introduction into reactor technology, among which a description of some reactor types, the corresponding fuel cycle and dismantling scenarios - a discussion of risk-analyses for nuclear power plants and the physical processes which can play a role during accidents - a discussion of prediction methods to be employed and the expected developments in this area - some background information. (aughor). 145 refs.; 21 figs.; 20 tabs

High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.

Science.gov (United States)

Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert

2018-01-01

Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.

Assessment of a 44 gene classifier for the evaluation of chronic fatigue syndrome from peripheral blood mononuclear cell gene expression.

Directory of Open Access Journals (Sweden)

Daniel Frampton

Full Text Available Chronic fatigue syndrome (CFS is a clinically defined illness estimated to affect millions of people worldwide causing significant morbidity and an annual cost of billions of dollars. Currently there are no laboratory-based diagnostic methods for CFS. However, differences in gene expression profiles between CFS patients and healthy persons have been reported in the literature. Using mRNA relative quantities for 44 previously identified reporter genes taken from a large dataset comprising both CFS patients and healthy volunteers, we derived a gene profile scoring metric to accurately classify CFS and healthy samples. This metric out-performed any of the reporter genes used individually as a classifier of CFS.To determine whether the reporter genes were robust across populations, we applied this metric to classify a separate blind dataset of mRNA relative quantities from a new population of CFS patients and healthy persons with limited success. Although the metric was able to successfully classify roughly two-thirds of both CFS and healthy samples correctly, the level of misclassification was high. We conclude many of the previously identified reporter genes are study-specific and thus cannot be used as a broad CFS diagnostic.

Non-viral transfection methods optimized for gene delivery to a lung cancer cell line.

Science.gov (United States)

Salimzadeh, Loghman; Jaberipour, Mansooreh; Hosseini, Ahmad; Ghaderi, Abbas

2013-04-01

Mehr-80 is a newly established adherent human large cell lung cancer cell line that has not been transfected until now. This study aims to define the optimal transfection conditions and effects of some critical elements for enhancing gene delivery to this cell line by utilizing different non-viral transfection Procedures. In the current study, calcium phosphate (CaP), DEAE-dextran, superfect, electroporation and lipofection transfection methods were used to optimize delivery of a plasmid construct that expressed Green Fluorescent Protein (GFP). Transgene expression was detected by fluorescent microscopy and flowcytometry. Toxicities of the methods were estimated by trypan blue staining. In order to evaluate the density of the transfected gene, we used a plasmid construct that expressed the Stromal cell-Derived Factor-1 (SDF-1) gene and measured its expression by real-time PCR. Mean levels of GFP-expressing cells 48 hr after transfection were 8.4% (CaP), 8.2% (DEAE-dextran), 4.9% (superfect), 34.1% (electroporation), and 40.1% (lipofection). Lipofection had the highest intense SDF-1 expression of the analyzed methods. This study has shown that the lipofection and electroporation methods were more efficient at gene delivery to Mehr-80 cells. The quantity of DNA per transfection, reagent concentration, and incubation time were identified as essential factors for successful transfection in all of the studied methods.

Comparative study of cellular kinetics of reporter probe [{sup 131}I]FIAU in neonatal cardiac myocytes after transfer of HSV1-tk reporter gene with two vectors

Energy Technology Data Exchange (ETDEWEB)

Lan Xiaoli [Department of Nuclear Medicine, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Hubei Province Key Laboratory of Molecular Imaging, Wuhan 430022 (China)], E-mail: lxl730724@hotmail.com; Yin Xiaohua; Wang Ruihua; Liu Ying [Department of Nuclear Medicine, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China); Hubei Province Key Laboratory of Molecular Imaging, Wuhan 430022 (China); Zhang Yongxue [Department of Nuclear Medicine, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022 (China) and Hubei Province Key Laboratory of Molecular Imaging, Wuhan 430022 (China)], E-mail: zhyx1229@163.com

2009-02-15

Aim: Reporter gene imaging is a promising approach for noninvasive monitoring of cardiac gene therapy. In this study, HSV1-tk (herpes simplex virus type 1 thymidine kinase) and FIAU (2'-fluoro-2'-deoxy-1-{beta}-D-arabinofuranosyl-5-iodouracil) were used as the reporter gene and probe, respectively. Cellular uptakes of radiolabeled FIAU of neonatal rat cardiac myocytes transferred with HSV1-tk were compared between two vectors, adenovirus and liposome. The aims of this study were to choose the better vector and to provide a theoretical basis for good nuclide images. Methods: Neonatal cardiac myocytes were obtained from rat heart by single collagenase digestion. HSV1-tk inserted into adenovirus vector (recombinant adenovirus type 5, Ad5-tk) and plasmid (pDC316-tk) coated with Lipofectamine 2000 (pDC316-tk/lipoplex) were developed; thus, HSV1-tk could be transferred into neonatal cardiac myocytes. FAU (2'-fluoro-2'-deoxy-1-{beta}-D-arabinofuranosyluracil) was labeled with {sup 131}I, and the product was assessed after purification with reversed-phase Sep-Pak C-18 column. The uptake rates of [{sup 131}I]FIAU in the transferred cardiac myocytes at different times (0.5, 1, 2, 3, 4 and 5 h) were detected. Furthermore, mRNA expression and protein expression of HSV1-tk were detected by semiquantitative reverse-transcriptase polymerase chain reaction and immunocytochemistry. Results: FAU could be labeled with {sup 131}I, and the labeling efficiency and radiochemical purity rates were 53.82{+-}2.05% and 94.85{+-}1.76%, respectively. Time-dependent increase of the accumulation of [{sup 131}I]FIAU was observed in both the Ad5-tk group and the pDC316/lipoplex group, and the highest uptake rate occurred at 5 h, with peak values of 12.55{+-}0.37% and 2.09{+-}0.34%, respectively. Greater uptakes of [{sup 131}I]FIAU in Ad5-tk-infected cells compared with pDC316/lipoplex-transfected ones occurred at all the time points (t=12.978-38.253, P<.01). The exogenous gene

Methods for simultaneously identifying coherent local clusters with smooth global patterns in gene expression profiles

Directory of Open Access Journals (Sweden)

Lee Yun-Shien

2008-03-01

Full Text Available Abstract Background The hierarchical clustering tree (HCT with a dendrogram 1 and the singular value decomposition (SVD with a dimension-reduced representative map 2 are popular methods for two-way sorting the gene-by-array matrix map employed in gene expression profiling. While HCT dendrograms tend to optimize local coherent clustering patterns, SVD leading eigenvectors usually identify better global grouping and transitional structures. Results This study proposes a flipping mechanism for a conventional agglomerative HCT using a rank-two ellipse (R2E, an improved SVD algorithm for sorting purpose seriation by Chen 3 as an external reference. While HCTs always produce permutations with good local behaviour, the rank-two ellipse seriation gives the best global grouping patterns and smooth transitional trends. The resulting algorithm automatically integrates the desirable properties of each method so that users have access to a clustering and visualization environment for gene expression profiles that preserves coherent local clusters and identifies global grouping trends. Conclusion We demonstrate, through four examples, that the proposed method not only possesses better numerical and statistical properties, it also provides more meaningful biomedical insights than other sorting algorithms. We suggest that sorted proximity matrices for genes and arrays, in addition to the gene-by-array expression matrix, can greatly aid in the search for comprehensive understanding of gene expression structures. Software for the proposed methods can be obtained at http://gap.stat.sinica.edu.tw/Software/GAP.

GO-PCA: An Unsupervised Method to Explore Gene Expression Data Using Prior Knowledge.

Science.gov (United States)

Wagner, Florian

2015-01-01

Genome-wide expression profiling is a widely used approach for characterizing heterogeneous populations of cells, tissues, biopsies, or other biological specimen. The exploratory analysis of such data typically relies on generic unsupervised methods, e.g. principal component analysis (PCA) or hierarchical clustering. However, generic methods fail to exploit prior knowledge about the molecular functions of genes. Here, I introduce GO-PCA, an unsupervised method that combines PCA with nonparametric GO enrichment analysis, in order to systematically search for sets of genes that are both strongly correlated and closely functionally related. These gene sets are then used to automatically generate expression signatures with functional labels, which collectively aim to provide a readily interpretable representation of biologically relevant similarities and differences. The robustness of the results obtained can be assessed by bootstrapping. I first applied GO-PCA to datasets containing diverse hematopoietic cell types from human and mouse, respectively. In both cases, GO-PCA generated a small number of signatures that represented the majority of lineages present, and whose labels reflected their respective biological characteristics. I then applied GO-PCA to human glioblastoma (GBM) data, and recovered signatures associated with four out of five previously defined GBM subtypes. My results demonstrate that GO-PCA is a powerful and versatile exploratory method that reduces an expression matrix containing thousands of genes to a much smaller set of interpretable signatures. In this way, GO-PCA aims to facilitate hypothesis generation, design of further analyses, and functional comparisons across datasets.

Form gene clustering method about pan-ethnic-group products based on emotional semantic

Science.gov (United States)

Chen, Dengkai; Ding, Jingjing; Gao, Minzhuo; Ma, Danping; Liu, Donghui

2016-09-01

The use of pan-ethnic-group products form knowledge primarily depends on a designer's subjective experience without user participation. The majority of studies primarily focus on the detection of the perceptual demands of consumers from the target product category. A pan-ethnic-group products form gene clustering method based on emotional semantic is constructed. Consumers' perceptual images of the pan-ethnic-group products are obtained by means of product form gene extraction and coding and computer aided product form clustering technology. A case of form gene clustering about the typical pan-ethnic-group products is investigated which indicates that the method is feasible. This paper opens up a new direction for the future development of product form design which improves the agility of product design process in the era of Industry 4.0.

A simple protocol for preparation of a liposomal vesicle with encapsulated plasmid DNA that mediate high accumulation and reporter gene activity in tumor tissue

DEFF Research Database (Denmark)

Gjetting, Torben; Andresen, Thomas Lars; Christensen, Camilla Laulund

2011-01-01

The systemic delivery of gene therapeutics by non-viral methods has proven difficult. Transfection systems that are performing well in vitro have been reported to have disadvantageous properties such as rapid clearance and short circulation time often resulting in poor transfection efficiency whe...

Gene tree rooting methods give distributions that mimic the coalescent process.

Science.gov (United States)

Tian, Yuan; Kubatko, Laura S

2014-01-01

Multi-locus phylogenetic inference is commonly carried out via models that incorporate the coalescent process to model the possibility that incomplete lineage sorting leads to incongruence between gene trees and the species tree. An interesting question that arises in this context is whether data "fit" the coalescent model. Previous work (Rosenfeld et al., 2012) has suggested that rooting of gene trees may account for variation in empirical data that has been previously attributed to the coalescent process. We examine this possibility using simulated data. We show that, in the case of four taxa, the distribution of gene trees observed from rooting estimated gene trees with either the molecular clock or with outgroup rooting can be closely matched by the distribution predicted by the coalescent model with specific choices of species tree branch lengths. We apply commonly-used coalescent-based methods of species tree inference to assess their performance in these situations. Copyright © 2013 Elsevier Inc. All rights reserved.

Gene flow analysis method, the D-statistic, is robust in a wide parameter space.

Science.gov (United States)

Zheng, Yichen; Janke, Axel

2018-01-08

We evaluated the sensitivity of the D-statistic, a parsimony-like method widely used to detect gene flow between closely related species. This method has been applied to a variety of taxa with a wide range of divergence times. However, its parameter space and thus its applicability to a wide taxonomic range has not been systematically studied. Divergence time, population size, time of gene flow, distance of outgroup and number of loci were examined in a sensitivity analysis. The sensitivity study shows that the primary determinant of the D-statistic is the relative population size, i.e. the population size scaled by the number of generations since divergence. This is consistent with the fact that the main confounding factor in gene flow detection is incomplete lineage sorting by diluting the signal. The sensitivity of the D-statistic is also affected by the direction of gene flow, size and number of loci. In addition, we examined the ability of the f-statistics, [Formula: see text] and [Formula: see text], to estimate the fraction of a genome affected by gene flow; while these statistics are difficult to implement to practical questions in biology due to lack of knowledge of when the gene flow happened, they can be used to compare datasets with identical or similar demographic background. The D-statistic, as a method to detect gene flow, is robust against a wide range of genetic distances (divergence times) but it is sensitive to population size. The D-statistic should only be applied with critical reservation to taxa where population sizes are large relative to branch lengths in generations.

An Entropy-based gene selection method for cancer classification using microarray data

Directory of Open Access Journals (Sweden)

Krishnan Arun

2005-03-01

Full Text Available Abstract Background Accurate diagnosis of cancer subtypes remains a challenging problem. Building classifiers based on gene expression data is a promising approach; yet the selection of non-redundant but relevant genes is difficult. The selected gene set should be small enough to allow diagnosis even in regular clinical laboratories and ideally identify genes involved in cancer-specific regulatory pathways. Here an entropy-based method is proposed that selects genes related to the different cancer classes while at the same time reducing the redundancy among the genes. Results The present study identifies a subset of features by maximizing the relevance and minimizing the redundancy of the selected genes. A merit called normalized mutual information is employed to measure the relevance and the redundancy of the genes. In order to find a more representative subset of features, an iterative procedure is adopted that incorporates an initial clustering followed by data partitioning and the application of the algorithm to each of the partitions. A leave-one-out approach then selects the most commonly selected genes across all the different runs and the gene selection algorithm is applied again to pare down the list of selected genes until a minimal subset is obtained that gives a satisfactory accuracy of classification. The algorithm was applied to three different data sets and the results obtained were compared to work done by others using the same data sets Conclusion This study presents an entropy-based iterative algorithm for selecting genes from microarray data that are able to classify various cancer sub-types with high accuracy. In addition, the feature set obtained is very compact, that is, the redundancy between genes is reduced to a large extent. This implies that classifiers can be built with a smaller subset of genes.

Gene therapy for ocular diseases.

Science.gov (United States)

Liu, Melissa M; Tuo, Jingsheng; Chan, Chi-Chao

2011-05-01

The eye is an easily accessible, highly compartmentalised and immune-privileged organ that offers unique advantages as a gene therapy target. Significant advancements have been made in understanding the genetic pathogenesis of ocular diseases, and gene replacement and gene silencing have been implicated as potentially efficacious therapies. Recent improvements have been made in the safety and specificity of vector-based ocular gene transfer methods. Proof-of-concept for vector-based gene therapies has also been established in several experimental models of human ocular diseases. After nearly two decades of ocular gene therapy research, preliminary successes are now being reported in phase 1 clinical trials for the treatment of Leber congenital amaurosis. This review describes current developments and future prospects for ocular gene therapy. Novel methods are being developed to enhance the performance and regulation of recombinant adeno-associated virus- and lentivirus-mediated ocular gene transfer. Gene therapy prospects have advanced for a variety of retinal disorders, including retinitis pigmentosa, retinoschisis, Stargardt disease and age-related macular degeneration. Advances have also been made using experimental models for non-retinal diseases, such as uveitis and glaucoma. These methodological advancements are critical for the implementation of additional gene-based therapies for human ocular diseases in the near future.

A Pathway Based Classification Method for Analyzing Gene Expression for Alzheimer's Disease Diagnosis.

Science.gov (United States)

Voyle, Nicola; Keohane, Aoife; Newhouse, Stephen; Lunnon, Katie; Johnston, Caroline; Soininen, Hilkka; Kloszewska, Iwona; Mecocci, Patrizia; Tsolaki, Magda; Vellas, Bruno; Lovestone, Simon; Hodges, Angela; Kiddle, Steven; Dobson, Richard Jb

2016-01-01

Recent studies indicate that gene expression levels in blood may be able to differentiate subjects with Alzheimer's disease (AD) from normal elderly controls and mild cognitively impaired (MCI) subjects. However, there is limited replicability at the single marker level. A pathway-based interpretation of gene expression may prove more robust. This study aimed to investigate whether a case/control classification model built on pathway level data was more robust than a gene level model and may consequently perform better in test data. The study used two batches of gene expression data from the AddNeuroMed (ANM) and Dementia Case Registry (DCR) cohorts. Our study used Illumina Human HT-12 Expression BeadChips to collect gene expression from blood samples. Random forest modeling with recursive feature elimination was used to predict case/control status. Age and APOE ɛ4 status were used as covariates for all analysis. Gene and pathway level models performed similarly to each other and to a model based on demographic information only. Any potential increase in concordance from the novel pathway level approach used here has not lead to a greater predictive ability in these datasets. However, we have only tested one method for creating pathway level scores. Further, we have been able to benchmark pathways against genes in datasets that had been extensively harmonized. Further work should focus on the use of alternative methods for creating pathway level scores, in particular those that incorporate pathway topology, and the use of an endophenotype based approach.

The construction and identification of hypoxia-regulated recombinant plasmid with reporter gene hNIS

International Nuclear Information System (INIS)

Hu Qunchao; Wu Jinchang; Zhou Jundong; Gu Ke

2011-01-01

Objective: To construct pShuttle-5 × HRE-CMV-NIS recombinant plasmid regulated by hypoxia-responsive element, which can possibly by used to detect the expression of hypoxia induced factor-α (HIF-1α) gene under hypoxia condition. Methods: Artificially synthesize the nucleotide sequences of five copies of hypoxia response elements (HREs) were cloned into pGL3-promoter vector to construct pGL3-promoter-5 × HRE vector. Human sodium/iodide symporter (hNIS) gene cDNA was amplified from human genome by RT-PCR, and subcloned into pGL3-promoter-5 × HRE vector then was sequenced. After treated with CoCl 2 as hypoxia mimic, HEK293 cells were transfected with recombinant plasmid with hNIS gene, while cells treated with DMSO as the control. Meanwhile, pcDNA3.1-HIF-1α and recombinant hNIS gene vectors were transfected into HEK293 cells at the ratio of 3 to 1, while co-transfection with pcDNA3.1 and pShuttle-NIS vectors cells were taken as the control. NIS mRNA expression was analyzed by qRT-PCR while function of NIS protein was tested by 99m TcO 4 - -uptake. Results: The sequence data of hNIS gene in recombinant plasmid were in accordance with those reported in the literatures. Compared with control groups, HEK293 cells co-transfected with both pShuttle-5 × HRE-CMV-NIS and HIF-1α gene vectors and CoCl 2 -treated after pShuttle-NIS transfecting presented higher mRNA expressions of NIS and 99m TcO 4 - uptake (P<0.01). Conclusion: HIF-1α can be bound to and activate pShuttle-5 × HRE-CMV-NIS in cells to accumulate radioactive nuclide 99m TcO 4 - and this technique is potential for detection of expression and activity of HIF-1α, the indicator of cell hypoxia. (authors)

Use of reporter-gene based bacteria to quantify phenanthrene biodegradation and toxicity in soil

Energy Technology Data Exchange (ETDEWEB)

Shin, Doyun [Department of Civil and Environmental Engineering, Seoul National University, Gwanakno 599, Seoul 151-742 (Korea, Republic of); Moon, Hee Sun [School of Earth and Environmental Science, Seoul National University, Gwanakno 599, Seoul 151-742 (Korea, Republic of); Lin, Chu-Ching; Barkay, Tamar [Department of Biochemistry and Microbiology, Rutgers University, 76 Lipman Drive, New Brunswick, NJ 08901 (United States); Nam, Kyoungphile, E-mail: kpnam@snu.ac.k [Department of Civil and Environmental Engineering, Seoul National University, Gwanakno 599, Seoul 151-742 (Korea, Republic of)

2011-02-15

A phenanthrene-degrading bacterium, Sphingomonas paucimobilis EPA505 was used to construct two fluorescence-based reporter strains. Strain D harboring gfp gene was constructed to generate green fluorescence when the strain started to biodegrade phenanthrene. Strain S possessing gef gene was designed to die once phenanthrene biodegradation was initiated and thus to lose green fluorescence when visualized by a live/dead cell staining. Confocal laser scanning microscopic observation followed by image analysis demonstrates that the fluorescence intensity generated by strain D increased and the intensity by strain S decreased linearly at the phenanthrene concentration of up to 200 mg/L. Such quantitative increase and decrease of fluorescence intensity in strain D (i.e., from 1 to 11.90 {+-} 0.72) and strain S (from 1 to 0.40 {+-} 0.07) were also evident in the presence of Ottawa sand spiked with the phenanthrene up to 1000 mg/kg. The potential use of the reporter strains in quantitatively determining biodegradable or toxic phenanthrene was discussed. - Research highlights: A novel reporter bacterial strain has been developed. The bacterium can quantitatively determine the change in fluorescence intensity. The intensity can represent the bioavailable phenanthrene in solid matrix. - A cell-killing gene harboring reporter bacterium shows phenanthrene toxicity.

MR molecular imaging of tumours using ferritin heavy chain reporter gene expression mediated by the hTERT promoter

Energy Technology Data Exchange (ETDEWEB)

Yang, Yan [Third Military Medical University, Department of Radiology, XinQiao Hospital, ChongQing (China); The First Affiliated Hospital of ChengDu Medical College, Department of Radiology, ChengDu (China); Gong, Ming-fu; Yang, Hua; Zhang, Song; Wang, Guang-xian; Su, Tong-sheng; Wen, Li; Zhang, Dong [Third Military Medical University, Department of Radiology, XinQiao Hospital, ChongQing (China)

2016-11-15

Using the human telomerase reverse transcriptase (hTERT) promoter and the modified ferritin heavy chain (Fth) reporter gene, reporter gene expression for MRI was examined in telomerase positive and negative tumour cells and xenografts. Activity of the reporter gene expression vector Lenti-hTERT-Fth1-3FLAG-Puro was compared to constitutive CMV-driven expression and to the untransfected parental control in five tumour cell lines: A549, SKOV3, 293T, U2OS and HPDLF. In vitro, transfected cells were evaluated for FLAG-tagged protein expression, iron accumulation and transverse relaxation. In vivo, tumours transduced by lentiviral vector injection were imaged using T2*WI. Changes in tumour signal intensity were validated by histology. Only telomerase positive tumour cells expressed FLAG-tagged Fth and displayed an increase in R2* above the parental control, with a corresponding change in T2*WI. In addition, only telomerase positive tumours, transduced by injection of the reporter gene expression construct, exhibited a change in signal intensity on T2*WI. Tumour histology verified the expression of FLAG-tagged Fth and iron accumulation in telomerase positive tissue. Reporter gene expression for MRI, using the Fth reporter and the hTERT promoter, may be a useful strategy for the non-invasive diagnosis of many types of cancer. (orig.)

GeneNetWeaver: in silico benchmark generation and performance profiling of network inference methods.

Science.gov (United States)

Schaffter, Thomas; Marbach, Daniel; Floreano, Dario

2011-08-15

Over the last decade, numerous methods have been developed for inference of regulatory networks from gene expression data. However, accurate and systematic evaluation of these methods is hampered by the difficulty of constructing adequate benchmarks and the lack of tools for a differentiated analysis of network predictions on such benchmarks. Here, we describe a novel and comprehensive method for in silico benchmark generation and performance profiling of network inference methods available to the community as an open-source software called GeneNetWeaver (GNW). In addition to the generation of detailed dynamical models of gene regulatory networks to be used as benchmarks, GNW provides a network motif analysis that reveals systematic prediction errors, thereby indicating potential ways of improving inference methods. The accuracy of network inference methods is evaluated using standard metrics such as precision-recall and receiver operating characteristic curves. We show how GNW can be used to assess the performance and identify the strengths and weaknesses of six inference methods. Furthermore, we used GNW to provide the international Dialogue for Reverse Engineering Assessments and Methods (DREAM) competition with three network inference challenges (DREAM3, DREAM4 and DREAM5). GNW is available at http://gnw.sourceforge.net along with its Java source code, user manual and supporting data. Supplementary data are available at Bioinformatics online. dario.floreano@epfl.ch.

A systemic gene silencing method suitable for high throughput, reverse genetic analyses of gene function in fern gametophytes

Directory of Open Access Journals (Sweden)

Tanurdzic Milos

2004-04-01

Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.

Development of a rapid method for direct detection of tet(M) genes in soil from Danish farmland

DEFF Research Database (Denmark)

Agersø, Yvonne; Sengeløv, Gitte; Jensen, Lars Bogø

2004-01-01

. The tet(M) gene was directly detected in 10-80% of the samples from the various farmland soils and could be detected in all samples tested after selective enrichment. To validate the obtained results, the method was applied to garden soil samples where lower prevalence of resistance was found. Result......A method for direct detection of antibiotic resistance genes in soil samples has been developed. The tetracycline resistance gene, tet(M), was used as a model. The method was validated on Danish farmland soil that had repeatedly been treated with pig manure slurry containing resistant bacteria......: A detection limit of 10(2)-10(3) copies of the tet(M) gene per gram of soil (in a Bacillus cereus group bacterium) was achieved. tet(M) gene was detected in soil samples with the highest prevalence on farmland treated with pig manure slurry....

A postprocessing method in the HMC framework for predicting gene function based on biological instrumental data

Science.gov (United States)

Feng, Shou; Fu, Ping; Zheng, Wenbin

2018-03-01

Predicting gene function based on biological instrumental data is a complicated and challenging hierarchical multi-label classification (HMC) problem. When using local approach methods to solve this problem, a preliminary results processing method is usually needed. This paper proposed a novel preliminary results processing method called the nodes interaction method. The nodes interaction method revises the preliminary results and guarantees that the predictions are consistent with the hierarchy constraint. This method exploits the label dependency and considers the hierarchical interaction between nodes when making decisions based on the Bayesian network in its first phase. In the second phase, this method further adjusts the results according to the hierarchy constraint. Implementing the nodes interaction method in the HMC framework also enhances the HMC performance for solving the gene function prediction problem based on the Gene Ontology (GO), the hierarchy of which is a directed acyclic graph that is more difficult to tackle. The experimental results validate the promising performance of the proposed method compared to state-of-the-art methods on eight benchmark yeast data sets annotated by the GO.

Correction of gene expression data

DEFF Research Database (Denmark)

Darbani Shirvanehdeh, Behrooz; Stewart, C. Neal, Jr.; Noeparvar, Shahin

2014-01-01

This report investigates for the first time the potential inter-treatment bias source of cell number for gene expression studies. Cell-number bias can affect gene expression analysis when comparing samples with unequal total cellular RNA content or with different RNA extraction efficiencies....... For maximal reliability of analysis, therefore, comparisons should be performed at the cellular level. This could be accomplished using an appropriate correction method that can detect and remove the inter-treatment bias for cell-number. Based on inter-treatment variations of reference genes, we introduce...

Using reporter gene assays to identify cis regulatory differences between humans and chimpanzees.

Science.gov (United States)

Chabot, Adrien; Shrit, Ralla A; Blekhman, Ran; Gilad, Yoav

2007-08-01

Most phenotypic differences between human and chimpanzee are likely to result from differences in gene regulation, rather than changes to protein-coding regions. To date, however, only a handful of human-chimpanzee nucleotide differences leading to changes in gene regulation have been identified. To hone in on differences in regulatory elements between human and chimpanzee, we focused on 10 genes that were previously found to be differentially expressed between the two species. We then designed reporter gene assays for the putative human and chimpanzee promoters of the 10 genes. Of seven promoters that we found to be active in human liver cell lines, human and chimpanzee promoters had significantly different activity in four cases, three of which recapitulated the gene expression difference seen in the microarray experiment. For these three genes, we were therefore able to demonstrate that a change in cis influences expression differences between humans and chimpanzees. Moreover, using site-directed mutagenesis on one construct, the promoter for the DDA3 gene, we were able to identify three nucleotides that together lead to a cis regulatory difference between the species. High-throughput application of this approach can provide a map of regulatory element differences between humans and our close evolutionary relatives.

Genealogy-based methods for inference of historical recombination and gene flow and their application in Saccharomyces cerevisiae.

Science.gov (United States)

Jenkins, Paul A; Song, Yun S; Brem, Rachel B

2012-01-01

Genetic exchange between isolated populations, or introgression between species, serves as a key source of novel genetic material on which natural selection can act. While detecting historical gene flow from DNA sequence data is of much interest, many existing methods can be limited by requirements for deep population genomic sampling. In this paper, we develop a scalable genealogy-based method to detect candidate signatures of gene flow into a given population when the source of the alleles is unknown. Our method does not require sequenced samples from the source population, provided that the alleles have not reached fixation in the sampled recipient population. The method utilizes recent advances in algorithms for the efficient reconstruction of ancestral recombination graphs, which encode genealogical histories of DNA sequence data at each site, and is capable of detecting the signatures of gene flow whose footprints are of length up to single genes. Further, we employ a theoretical framework based on coalescent theory to test for statistical significance of certain recombination patterns consistent with gene flow from divergent sources. Implementing these methods for application to whole-genome sequences of environmental yeast isolates, we illustrate the power of our approach to highlight loci with unusual recombination histories. By developing innovative theory and methods to analyze signatures of gene flow from population sequence data, our work establishes a foundation for the continued study of introgression and its evolutionary relevance.

Reprogramming Methods Do Not Affect Gene Expression Profile of Human Induced Pluripotent Stem Cells.

Science.gov (United States)

Trevisan, Marta; Desole, Giovanna; Costanzi, Giulia; Lavezzo, Enrico; Palù, Giorgio; Barzon, Luisa

2017-01-20

Induced pluripotent stem cells (iPSCs) are pluripotent cells derived from adult somatic cells. After the pioneering work by Yamanaka, who first generated iPSCs by retroviral transduction of four reprogramming factors, several alternative methods to obtain iPSCs have been developed in order to increase the yield and safety of the process. However, the question remains open on whether the different reprogramming methods can influence the pluripotency features of the derived lines. In this study, three different strategies, based on retroviral vectors, episomal vectors, and Sendai virus vectors, were applied to derive iPSCs from human fibroblasts. The reprogramming efficiency of the methods based on episomal and Sendai virus vectors was higher than that of the retroviral vector-based approach. All human iPSC clones derived with the different methods showed the typical features of pluripotent stem cells, including the expression of alkaline phosphatase and stemness maker genes, and could give rise to the three germ layer derivatives upon embryoid bodies assay. Microarray analysis confirmed the presence of typical stem cell gene expression profiles in all iPSC clones and did not identify any significant difference among reprogramming methods. In conclusion, the use of different reprogramming methods is equivalent and does not affect gene expression profile of the derived human iPSCs.

A simple protocol for preparation of a liposomal vesicle with encapsulated plasmid DNA that mediate high accumulation and reporter gene activity in tumor tissue

DEFF Research Database (Denmark)

Gjetting, Torben; Andresen, Thomas Lars; Christensen, Camilla Laulund

2011-01-01

The systemic delivery of gene therapeutics by non-viral methods has proven dif¿cult. Transfection systems that are performing well in vitro have been reported to have disadvantageous properties such as rapid clearance and short circulation time often resulting in poor transfection ef¿ciency when ...

Implementation of plaid model biclustering method on microarray of carcinoma and adenoma tumor gene expression data

Science.gov (United States)

Ardaneswari, Gianinna; Bustamam, Alhadi; Sarwinda, Devvi

2017-10-01

A Tumor is an abnormal growth of cells that serves no purpose. Carcinoma is a tumor that grows from the top of the cell membrane and the organ adenoma is a benign tumor of the gland-like cells or epithelial tissue. In the field of molecular biology, the development of microarray technology is used in the data store of disease genetic expression. For each of microarray gene, an amount of information is stored for each trait or condition. In gene expression data clustering can be done with a bicluster algorithm, thats clustering method which not only the objects to be clustered, but also the properties or condition of the object. This research proposed Plaid Model Biclustering as one of biclustering method. In this study, we discuss the implementation of Plaid Model Biclustering Method on microarray of Carcinoma and Adenoma tumor gene expression data. From the experimental results, we found three biclusters are formed by Carcinoma gene expression data and four biclusters are formed by Adenoma gene expression data.

Gene expression and gene therapy imaging

International Nuclear Information System (INIS)

Rome, Claire; Couillaud, Franck; Moonen, Chrit T.W.

2007-01-01

The fast growing field of molecular imaging has achieved major advances in imaging gene expression, an important element of gene therapy. Gene expression imaging is based on specific probes or contrast agents that allow either direct or indirect spatio-temporal evaluation of gene expression. Direct evaluation is possible with, for example, contrast agents that bind directly to a specific target (e.g., receptor). Indirect evaluation may be achieved by using specific substrate probes for a target enzyme. The use of marker genes, also called reporter genes, is an essential element of MI approaches for gene expression in gene therapy. The marker gene may not have a therapeutic role itself, but by coupling the marker gene to a therapeutic gene, expression of the marker gene reports on the expression of the therapeutic gene. Nuclear medicine and optical approaches are highly sensitive (detection of probes in the picomolar range), whereas MRI and ultrasound imaging are less sensitive and require amplification techniques and/or accumulation of contrast agents in enlarged contrast particles. Recently developed MI techniques are particularly relevant for gene therapy. Amongst these are the possibility to track gene therapy vectors such as stem cells, and the techniques that allow spatiotemporal control of gene expression by non-invasive heating (with MRI guided focused ultrasound) and the use of temperature sensitive promoters. (orig.)

Gene Expression Analysis of Immunostained Endothelial Cells Isolated from Formaldehyde-fixated Paraffin Embedded Tumors Using Laser Capture Microdissection – a Technical Report

Science.gov (United States)

Kaneko, Tomoatsu; Okiji, Takashi; Kaneko, Reika; Suda, Hideaki; Nör, Jacques E.

2009-01-01

Laser capture microdissection (LCM) allows microscopic procurement of specific cell types from tissue sections that can then be used for gene expression analysis. In conventional LCM, frozen tissues stained with hematoxylin are normally used to the molecular analysis. Recent studies suggested that it is possible to carry out gene expression analysis of formaldehyde-fixated paraffin embedded (FFPE) tissues that were stained with hematoxylin. However, it is still unclear if quantitative gene expression analyses can be performed from LCM cells from FFPE tissues that were subjected to immunostaining to enhance identification of target cells. In this proof-of-principle study, we analyzed by RT-PCR and real time PCR the expression of genes in factor VIII immunostained human endothelial cells that were dissected from FFPE tissues by LCM. We observed that immunostaining should be performed at 4°C to preserve the mRNA from the cells. The expression of Bcl-2 in the endothelial cells was evaluated by RT-PCR and by real time PCR. GAPDH and 18S were used as house keeping genes for RT-PCR and real time PCR, respectively. This report unveils a method for quantitative gene expression analysis in cells that were identified by immunostaining and retrieved by LCM from FFPE tissues. This method is ideally suited for the analysis of relatively rare cell types within a tissue, and should improve on our ability to perform differential diagnosis of pathologies as compared to conventional LCM. PMID:19425073

Behavioral science and the study of gene-nutrition and gene-physical activity interactions in obesity research.

Science.gov (United States)

Faith, Myles S

2008-12-01

This report summarizes emerging opportunities for behavioral science to help advance the field of gene-environment and gene-behavior interactions, based on presentations at The National Cancer Institute (NCI) Workshop, "Gene-Nutrition and Gene-Physical Activity Interactions in the Etiology of Obesity." Three opportunities are highlighted: (i) designing potent behavioral "challenges" in experiments, (ii) determining viable behavioral phenotypes for genetics studies, and (iii) identifying specific measures of the environment or environmental exposures. Additional points are underscored, including the need to incorporate novel findings from neuroimaging studies regarding motivation and drive for eating and physical activity. Advances in behavioral science theory and methods can play an important role in advancing understanding of gene-brain-behavior relationships in obesity onset.

Lung cancer gene expression database analysis incorporating prior knowledge with support vector machine-based classification method

Directory of Open Access Journals (Sweden)

Huang Desheng

2009-07-01

Full Text Available Abstract Background A reliable and precise classification is essential for successful diagnosis and treatment of cancer. Gene expression microarrays have provided the high-throughput platform to discover genomic biomarkers for cancer diagnosis and prognosis. Rational use of the available bioinformation can not only effectively remove or suppress noise in gene chips, but also avoid one-sided results of separate experiment. However, only some studies have been aware of the importance of prior information in cancer classification. Methods Together with the application of support vector machine as the discriminant approach, we proposed one modified method that incorporated prior knowledge into cancer classification based on gene expression data to improve accuracy. A public well-known dataset, Malignant pleural mesothelioma and lung adenocarcinoma gene expression database, was used in this study. Prior knowledge is viewed here as a means of directing the classifier using known lung adenocarcinoma related genes. The procedures were performed by software R 2.80. Results The modified method performed better after incorporating prior knowledge. Accuracy of the modified method improved from 98.86% to 100% in training set and from 98.51% to 99.06% in test set. The standard deviations of the modified method decreased from 0.26% to 0 in training set and from 3.04% to 2.10% in test set. Conclusion The method that incorporates prior knowledge into discriminant analysis could effectively improve the capacity and reduce the impact of noise. This idea may have good future not only in practice but also in methodology.

Systematically characterizing and prioritizing chemosensitivity related gene based on Gene Ontology and protein interaction network

Directory of Open Access Journals (Sweden)

Chen Xin

2012-10-01

Full Text Available Abstract Background The identification of genes that predict in vitro cellular chemosensitivity of cancer cells is of great importance. Chemosensitivity related genes (CRGs have been widely utilized to guide clinical and cancer chemotherapy decisions. In addition, CRGs potentially share functional characteristics and network features in protein interaction networks (PPIN. Methods In this study, we proposed a method to identify CRGs based on Gene Ontology (GO and PPIN. Firstly, we documented 150 pairs of drug-CCRG (curated chemosensitivity related gene from 492 published papers. Secondly, we characterized CCRGs from the perspective of GO and PPIN. Thirdly, we prioritized CRGs based on CCRGs’ GO and network characteristics. Lastly, we evaluated the performance of the proposed method. Results We found that CCRG enriched GO terms were most often related to chemosensitivity and exhibited higher similarity scores compared to randomly selected genes. Moreover, CCRGs played key roles in maintaining the connectivity and controlling the information flow of PPINs. We then prioritized CRGs using CCRG enriched GO terms and CCRG network characteristics in order to obtain a database of predicted drug-CRGs that included 53 CRGs, 32 of which have been reported to affect susceptibility to drugs. Our proposed method identifies a greater number of drug-CCRGs, and drug-CCRGs are much more significantly enriched in predicted drug-CRGs, compared to a method based on the correlation of gene expression and drug activity. The mean area under ROC curve (AUC for our method is 65.2%, whereas that for the traditional method is 55.2%. Conclusions Our method not only identifies CRGs with expression patterns strongly correlated with drug activity, but also identifies CRGs in which expression is weakly correlated with drug activity. This study provides the framework for the identification of signatures that predict in vitro cellular chemosensitivity and offers a valuable

Reprogramming Methods Do Not Affect Gene Expression Profile of Human Induced Pluripotent Stem Cells

Directory of Open Access Journals (Sweden)

Marta Trevisan

2017-01-01

Full Text Available Induced pluripotent stem cells (iPSCs are pluripotent cells derived from adult somatic cells. After the pioneering work by Yamanaka, who first generated iPSCs by retroviral transduction of four reprogramming factors, several alternative methods to obtain iPSCs have been developed in order to increase the yield and safety of the process. However, the question remains open on whether the different reprogramming methods can influence the pluripotency features of the derived lines. In this study, three different strategies, based on retroviral vectors, episomal vectors, and Sendai virus vectors, were applied to derive iPSCs from human fibroblasts. The reprogramming efficiency of the methods based on episomal and Sendai virus vectors was higher than that of the retroviral vector-based approach. All human iPSC clones derived with the different methods showed the typical features of pluripotent stem cells, including the expression of alkaline phosphatase and stemness maker genes, and could give rise to the three germ layer derivatives upon embryoid bodies assay. Microarray analysis confirmed the presence of typical stem cell gene expression profiles in all iPSC clones and did not identify any significant difference among reprogramming methods. In conclusion, the use of different reprogramming methods is equivalent and does not affect gene expression profile of the derived human iPSCs.

The first report of prion-related protein gene (PRNT) polymorphisms in goat.

Science.gov (United States)

Kim, Yong-Chan; Jeong, Byung-Hoon

2017-06-01

Prion protein is encoded by the prion protein gene (PRNP). Polymorphisms of several members of the prion gene family have shown association with prion diseases in several species. Recent studies on a novel member of the prion gene family in rams have shown that prion-related protein gene (PRNT) has a linkage with codon 26 of prion-like protein (PRND). In a previous study, codon 26 polymorphism of PRND has shown connection with PRNP haplotype which is strongly associated with scrapie vulnerability. In addition, the genotype of a single nucleotide polymorphism (SNP) at codon 26 of PRND is related to fertilisation capacity. These findings necessitate studies on the SNP of PRNT gene which is connected with PRND. In goat, several polymorphism studies have been performed for PRNP, PRND, and shadow of prion protein gene (SPRN). However, polymorphism on PRNT has not been reported. Hence, the objective of this study was to determine the genotype and allelic distribution of SNPs of PRNT in 238 Korean native goats and compare PRNT DNA sequences between Korean native goats and several ruminant species. A total of five SNPs, including PRNT c.-114G > T, PRNT c.-58A > G in the upstream of PRNT gene, PRNT c.71C > T (p.Ala24Val) and PRNT c.102G > A in the open reading frame (ORF) and c.321C > T in the downstream of PRNT gene, were found in this study. All five SNPs of caprine PRNT gene in Korean native goat are in complete linkage disequilibrium (LD) with a D' value of 1.0. Interestingly, comparative sequence analysis of the PRNT gene revealed five mismatches between DNA sequences of Korean native goats and those of goats deposited in the GenBank. Korean native black goats also showed 5 mismatches in PRNT ORF with cattle. To the best of our knowledge, this is the first genetic research of the PRNT gene in goat.

Reporter gene expression in fish following cutaneous infection with pantropic retroviral vectors.

Science.gov (United States)

Paul, T A; Burns, J C; Shike, H; Getchell, R; Bowser, P R; Whitlock, K E; Casey, J W

2001-06-01

A central issue in gene delivery systems is choosing promoters that will direct defined and sustainable levels of gene expression. Pantropic retroviral vectors provide a means to insert genes into either somatic or germline cells. In this study, we focused on somatic cell infection by evaluating the activity of 3 promoters inserted by vectors into fish cell lines and fish skin using pantropic retroviruses. In bluegill and zebrafish cell lines, the highest levels of luciferase expression were observed from the 5' murine leukemia virus long terminal repeat of the retroviral vector. The Rous sarcoma virus long terminal repeat and cytomegalovirus early promoter, as internal promoters, generated lower levels of luciferase. Luciferase reporter vectors infected zebrafish skin, as measured by the presence of viral DNA, and expressed luciferase. We infected developing walleye dermal sarcomas with retroviral vectors to provide an environment with enhanced cell proliferation, a condition necessary for integration of the provirus into the host genome. We demonstrated a 4-fold to 7-fold increase in luciferase gene expression in tumor tissue over infections in normal walleye skin.

Empirical pillar design methods review report: Final report

International Nuclear Information System (INIS)

1988-02-01

This report summarizes and evaluates empirical pillar design methods that may be of use during the conceptual design of a high-level nuclear waste repository in salt. The methods are discussed according to category (i.e, main, submain, and panel pillars; barrier pillars; and shaft pillars). Of the 21 identified for main, submain, and panel pillars, one method, the Confined Core Method, is evaluated as being most appropriate for conceptual design. Five methods are considered potentially applicable. Of six methods identified for barrier pillars, one method based on the Load Transfer Distance concept is considered most appropriate for design. Based on the evaluation of 25 methods identified for shaft pillars, an approximate sizing criterion is proposed for use in conceptual design. Aspects of pillar performance relating to creep, ground deformation, interaction with roof and floor rock, and response to high temperature environments are not adequately addressed by existing empirical design methods. 152 refs., 22 figs., 14 tabs

Methods for the Isolation of Genes Encoding Novel PHA Metabolism Enzymes from Complex Microbial Communities.

Science.gov (United States)

Cheng, Jiujun; Nordeste, Ricardo; Trainer, Maria A; Charles, Trevor C

2017-01-01

Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bio-plastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti and Pseudomonas putida, allows the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates the functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

Methods for the isolation of genes encoding novel PHB cycle enzymes from complex microbial communities.

Science.gov (United States)

Nordeste, Ricardo F; Trainer, Maria A; Charles, Trevor C

2010-01-01

Development of different PHAs as alternatives to petrochemically derived plastics can be facilitated by mining metagenomic libraries for diverse PHA cycle genes that might be useful for synthesis of bioplastics. The specific phenotypes associated with mutations of the PHA synthesis pathway genes in Sinorhizobium meliloti allows for the use of powerful selection and screening tools to identify complementing novel PHA synthesis genes. Identification of novel genes through their function rather than sequence facilitates finding functional proteins that may otherwise have been excluded through sequence-only screening methodology. We present here methods that we have developed for the isolation of clones expressing novel PHA metabolism genes from metagenomic libraries.

Rapid isolation of gene homologs across taxa: Efficient identification and isolation of gene orthologs from non-model organism genomes, a technical report

Directory of Open Access Journals (Sweden)

Heffer Alison

2011-03-01

Full Text Available Abstract Background Tremendous progress has been made in the field of evo-devo through comparisons of related genes from diverse taxa. While the vast number of species in nature precludes a complete analysis of the molecular evolution of even one single gene family, this would not be necessary to understand fundamental mechanisms underlying gene evolution if experiments could be designed to systematically sample representative points along the path of established phylogenies to trace changes in regulatory and coding gene sequence. This isolation of homologous genes from phylogenetically diverse, representative species can be challenging, especially if the gene is under weak selective pressure and evolving rapidly. Results Here we present an approach - Rapid Isolation of Gene Homologs across Taxa (RIGHT - to efficiently isolate specific members of gene families. RIGHT is based upon modification and a combination of degenerate polymerase chain reaction (PCR and gene-specific amplified fragment length polymorphism (AFLP. It allows targeted isolation of specific gene family members from any organism, only requiring genomic DNA. We describe this approach and how we used it to isolate members of several different gene families from diverse arthropods spanning millions of years of evolution. Conclusions RIGHT facilitates systematic isolation of one gene from large gene families. It allows for efficient gene isolation without whole genome sequencing, RNA extraction, or culturing of non-model organisms. RIGHT will be a generally useful method for isolation of orthologs from both distant and closely related species, increasing sample size and facilitating the tracking of molecular evolution of gene families and regulatory networks across the tree of life.

The first report of the vanC1 gene in Enterococcus faecium isolated from a human clinical specimen

Directory of Open Access Journals (Sweden)

Mingyue Sun

2014-09-01

Full Text Available The vanC1 gene, which is chromosomally located, confers resistance to vancomycin and serves as a species marker for Enterococcus gallinarum. Enterococcus faecium TJ4031 was isolated from a blood culture and harbours the vanC1gene. Polymerase chain reaction (PCR assays were performed to detect vanXYc and vanTc genes. Only the vanXYc gene was found in the E. faecium TJ4031 isolate. The minimum inhibitory concentrations of vancomycin and teicoplanin were 2 µg/mL and 1 µg/mL, respectively. Real-time reverse transcription-PCR results revealed that the vanC1and vanXYc genes were not expressed. Pulsed-field gel electrophoresis and southern hybridisation results showed that the vanC1 gene was encoded in the chromosome. E. faecalis isolated from animals has been reported to harbour vanC1gene. However, this study is the first to report the presence of the vanC1gene in E. faecium of human origin. Additionally, our research showed the vanC1gene cannot serve as a species-specific gene of E. gallinarum and that it is able to be transferred between bacteria. Although the resistance marker is not expressed in the strain, our results showed that E. faecium could acquire the vanC1gene from different species.

Identifying essential genes in bacterial metabolic networks with machine learning methods

Science.gov (United States)

2010-01-01

Background Identifying essential genes in bacteria supports to identify potential drug targets and an understanding of minimal requirements for a synthetic cell. However, experimentally assaying the essentiality of their coding genes is resource intensive and not feasible for all bacterial organisms, in particular if they are infective. Results We developed a machine learning technique to identify essential genes using the experimental data of genome-wide knock-out screens from one bacterial organism to infer essential genes of another related bacterial organism. We used a broad variety of topological features, sequence characteristics and co-expression properties potentially associated with essentiality, such as flux deviations, centrality, codon frequencies of the sequences, co-regulation and phyletic retention. An organism-wise cross-validation on bacterial species yielded reliable results with good accuracies (area under the receiver-operator-curve of 75% - 81%). Finally, it was applied to drug target predictions for Salmonella typhimurium. We compared our predictions to the viability of experimental knock-outs of S. typhimurium and identified 35 enzymes, which are highly relevant to be considered as potential drug targets. Specifically, we detected promising drug targets in the non-mevalonate pathway. Conclusions Using elaborated features characterizing network topology, sequence information and microarray data enables to predict essential genes from a bacterial reference organism to a related query organism without any knowledge about the essentiality of genes of the query organism. In general, such a method is beneficial for inferring drug targets when experimental data about genome-wide knockout screens is not available for the investigated organism. PMID:20438628

Establishment of a hepatocellular carcinoma cell line expressing dual reporter genes: sodium iodide symporter (NIS) and enhanced green fluorescence protein (EGFP)

International Nuclear Information System (INIS)

Kwak, Won Jung; Koo, Bon Chul; Kwon, Mo Sun

2007-01-01

Dual reporter gene imaging has several advantages for more sophisticated molecular imaging studies such as gene therapy monitoring. Herein, we have constructed hepatoma cell line expressing dual reporter genes of sodium iodide symporter (NIS) and enhanced green fluorescence protein (EGFP), and the functionalities of the genes were evaluated in vivo by nuclear and optical imaging. A pRetro-PN vector was constructed after separating NIS gene from pcDNA-NIS. RSV-EGFP-WPRE fragment separated from pLNRGW was cloned into pRetro-PN vector. The final vector expressing dual reporter genes was named pRetro-PNRGW. A human hepatoma (HepG2) cells were transfected by the retrovirus containing NIS and EGFP gene (HepG2-NE). Expression of NIS gene was confirmed by RT-PCR, radioiodine uptake and efflux studies. Expression of EGFP was confirmed by RT-PCR and fluorescence microscope. The HepG2 and HepG2-NE cells were implanted in shoulder and hindlimb of nude mice, then fluorescence image, gamma camera image and I-124 microPET image were undertaken. The HepG2-NE cell was successfully constructed. RT-PCR showed NIS and EGFP mRNA expression. About 50% of cells showed fluorescence. The iodine uptake of NIS-expressed cells was about 9 times higher than control. In efflux study, T 1/2 of HepG2-NE cells was 9 min. HepG2-NE xenograft showed high signal-to-background fluorescent spots and higher iodine-uptake compared to those of HepG2 xenograft. A hepatoma cell line expressing NIS and EGFP dual reporter genes was successfully constructed and could be used as a potential either by therapeutic gene or imaging reporter gene

Using riboswitches to regulate gene expression and define gene function in mycobacteria.

Science.gov (United States)

Van Vlack, Erik R; Seeliger, Jessica C

2015-01-01

Mycobacteria include both environmental species and many pathogenic species such as Mycobacterium tuberculosis, an intracellular pathogen that is the causative agent of tuberculosis in humans. Inducible gene expression is a powerful tool for examining gene function and essentiality, both in in vitro culture and in host cell infections. The theophylline-inducible artificial riboswitch has recently emerged as an alternative to protein repressor-based systems. The riboswitch is translationally regulated and is combined with a mycobacterial promoter that provides transcriptional control. We here provide methods used by our laboratory to characterize the riboswitch response to theophylline in reporter strains, recombinant organisms containing riboswitch-regulated endogenous genes, and in host cell infections. These protocols should facilitate the application of both existing and novel artificial riboswitches to the exploration of gene function in mycobacteria. © 2015 Elsevier Inc. All rights reserved.

A simple screening method for detection of Klinefelter syndrome and other X-chromosome aneuploidies based on copy number of the androgen receptor gene

DEFF Research Database (Denmark)

Ottesen, A M; Garn, I D; Aksglaede, L

2007-01-01

Due to the high prevalence and variable phenotype of patients with Klinefelter syndrome, there is a need for a robust and rapid screening method allowing early diagnosis. Here, we report on the development and detailed clinical validation of a quantitative real-time PCR (qPCR)-based method...... of the copy number assessment of the androgen receptor (AR) gene, located to Xq11.2-q12. We analysed samples from 50 individuals, including a healthy male and female controls and patients with Klinefelter syndrome (47,XXY; 48,XXXY) (n = 28), mosaicisms (46,XX/47,XXY/48XXYY; 45,X/46,XY) (n = 3), other sex......-gene expression. The XIST-expression based assay was correct in only 29/36 samples (81%). Our findings demonstrated that the AR-qPCR technique is a simple and reliable screening method for diagnosis of patients with Klinefelter syndrome or other chromosomal disorders involving an aberrant number of X-chromosomes....

The utility of optical detection system (qPCR) and bioinformatics methods in reference gene expression analysis

Science.gov (United States)

Skarzyńska, Agnieszka; Pawełkowicz, Magdalena; PlÄ der, Wojciech; Przybecki, Zbigniew

2016-09-01

Real-time quantitative polymerase chain reaction is consider as the most reliable method for gene expression studies. However, the expression of target gene could be misinterpreted due to improper normalization. Therefore, the crucial step for analysing of qPCR data is selection of suitable reference genes, which should be validated experimentally. In order to choice the gene with stable expression in the designed experiment, we performed reference gene expression analysis. In this study genes described in the literature and novel genes predicted as control genes, based on the in silico analysis of transcriptome data were used. Analysis with geNorm and NormFinder algorithms allow to create the ranking of candidate genes and indicate the best reference for flower morphogenesis study. According to the results, genes CACS and CYCL were characterised the most stable expression, but the least suitable genes were TUA and EF.

Relaxation rates of gene expression kinetics reveal the feedback signs of autoregulatory gene networks

Science.gov (United States)

Jia, Chen; Qian, Hong; Chen, Min; Zhang, Michael Q.

2018-03-01

The transient response to a stimulus and subsequent recovery to a steady state are the fundamental characteristics of a living organism. Here we study the relaxation kinetics of autoregulatory gene networks based on the chemical master equation model of single-cell stochastic gene expression with nonlinear feedback regulation. We report a novel relation between the rate of relaxation, characterized by the spectral gap of the Markov model, and the feedback sign of the underlying gene circuit. When a network has no feedback, the relaxation rate is exactly the decaying rate of the protein. We further show that positive feedback always slows down the relaxation kinetics while negative feedback always speeds it up. Numerical simulations demonstrate that this relation provides a possible method to infer the feedback topology of autoregulatory gene networks by using time-series data of gene expression.

Imaging gene expression in gene therapy

International Nuclear Information System (INIS)

Wiebe, Leonard I.

1997-01-01

Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on 'suicide gene therapy' of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k + ) has been use for 'suicide' in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k + gene expression where the H S V-1 t k + gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([ 18 F]F H P G; [ 18 F]-A C V), and pyrimidine- ([ 123 / 131 I]I V R F U; [ 124 / 131I ]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [ 123 / 131I ]I V R F U imaging with the H S V-1 t k + reporter gene will be presented

Genes related to xylose fermentation and methods of using same for enhanced biofuel production

Science.gov (United States)

Wohlbach, Dana J.; Gasch, Audrey P.

2014-08-05

The present invention provides isolated gene sequences involved in xylose fermentation and related recombinant yeast which are useful in methods of enhanced biofuel production, particularly ethanol production. Methods of bioengineering recombinant yeast useful for biofuel production are also provided.

Comparative GO: a web application for comparative gene ontology and gene ontology-based gene selection in bacteria.

Directory of Open Access Journals (Sweden)

Mario Fruzangohar

Full Text Available The primary means of classifying new functions for genes and proteins relies on Gene Ontology (GO, which defines genes/proteins using a controlled vocabulary in terms of their Molecular Function, Biological Process and Cellular Component. The challenge is to present this information to researchers to compare and discover patterns in multiple datasets using visually comprehensible and user-friendly statistical reports. Importantly, while there are many GO resources available for eukaryotes, there are none suitable for simultaneous, graphical and statistical comparison between multiple datasets. In addition, none of them supports comprehensive resources for bacteria. By using Streptococcus pneumoniae as a model, we identified and collected GO resources including genes, proteins, taxonomy and GO relationships from NCBI, UniProt and GO organisations. Then, we designed database tables in PostgreSQL database server and developed a Java application to extract data from source files and loaded into database automatically. We developed a PHP web application based on Model-View-Control architecture, used a specific data structure as well as current and novel algorithms to estimate GO graphs parameters. We designed different navigation and visualization methods on the graphs and integrated these into graphical reports. This tool is particularly significant when comparing GO groups between multiple samples (including those of pathogenic bacteria from different sources simultaneously. Comparing GO protein distribution among up- or down-regulated genes from different samples can improve understanding of biological pathways, and mechanism(s of infection. It can also aid in the discovery of genes associated with specific function(s for investigation as a novel vaccine or therapeutic targets.http://turing.ersa.edu.au/BacteriaGO.

Optimatization of transient transformation methods to study gene expression in Musa acuminata (AAA group) cultivar Ambon Lumut

Science.gov (United States)

Prayuni, Kinasih; Dwivany, Fenny M.

2015-09-01

Banana is classified as a climateric fruit, whose ripening is regulated by ethylene. Ethylene is synthesized from ACC (1-aminocyclopropane-1-carboxylic acid) by ACC oxidase enzyme which is encoded by ACO gene. Controling an important gene expression in ethylene biosynthesis pathway has became a target to delay the ripening process. Therefore in the previous study we have designed a MaACO-RNAi construct to control MaACO gene expression. In this research, we study the effectiveness of different transient transformation methods to deliver the construct. Direct injection, with or no vaccum infiltration methods were used to deliver MaACO-RNAi construct. All of the methods succesfully deliver the construct into banana fruits based on RT-PCR result.

Gene-gene, gene-environment, gene-nutrient interactions and single nucleotide polymorphisms of inflammatory cytokines.

Science.gov (United States)

Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif

2015-05-15

Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.

Effect of method of deduplication on estimation of differential gene expression using RNA-seq

Directory of Open Access Journals (Sweden)

Anna V. Klepikova

2017-03-01

Full Text Available Background RNA-seq is a useful tool for analysis of gene expression. However, its robustness is greatly affected by a number of artifacts. One of them is the presence of duplicated reads. Results To infer the influence of different methods of removal of duplicated reads on estimation of gene expression in cancer genomics, we analyzed paired samples of hepatocellular carcinoma (HCC and non-tumor liver tissue. Four protocols of data analysis were applied to each sample: processing without deduplication, deduplication using a method implemented in SAMtools, and deduplication based on one or two molecular indices (MI. We also analyzed the influence of sequencing layout (single read or paired end and read length. We found that deduplication without MI greatly affects estimated expression values; this effect is the most pronounced for highly expressed genes. Conclusion The use of unique molecular identifiers greatly improves accuracy of RNA-seq analysis, especially for highly expressed genes. We developed a set of scripts that enable handling of MI and their incorporation into RNA-seq analysis pipelines. Deduplication without MI affects results of differential gene expression analysis, producing a high proportion of false negative results. The absence of duplicate read removal is biased towards false positives. In those cases where using MI is not possible, we recommend using paired-end sequencing layout.

Candidate gene identification of ovulation-inducing genes by RNA sequencing with an in vivo assay in zebrafish.

Directory of Open Access Journals (Sweden)

Wanlada Klangnurak

Full Text Available We previously reported the microarray-based selection of three ovulation-related genes in zebrafish. We used a different selection method in this study, RNA sequencing analysis. An additional eight up-regulated candidates were found as specifically up-regulated genes in ovulation-induced samples. Changes in gene expression were confirmed by qPCR analysis. Furthermore, up-regulation prior to ovulation during natural spawning was verified in samples from natural pairing. Gene knock-out zebrafish strains of one of the candidates, the starmaker gene (stm, were established by CRISPR genome editing techniques. Unexpectedly, homozygous mutants were fertile and could spawn eggs. However, a high percentage of unfertilized eggs and abnormal embryos were produced from these homozygous females. The results suggest that the stm gene is necessary for fertilization. In this study, we selected additional ovulation-inducing candidate genes, and a novel function of the stm gene was investigated.

Luciferase NanoLuc as a reporter for gene expression and protein levels in Saccharomyces cerevisiae.

Science.gov (United States)

Masser, Anna E; Kandasamy, Ganapathi; Kaimal, Jayasankar Mohanakrishnan; Andréasson, Claes

2016-05-01

Reporter proteins are essential tools in the study of biological processes and are employed to monitor changes in gene expression and protein levels. Luciferases are reporter proteins that enable rapid and highly sensitive detection with an outstanding dynamic range. Here we evaluated the usefulness of the 19 kDa luciferase NanoLuc (Nluc), derived from the deep sea shrimp Oplophorus gracilirostris, as a reporter protein in yeast. Cassettes with codon-optimized genes expressing yeast Nluc (yNluc) or its destabilized derivative yNlucPEST have been assembled in the context of the dominant drug resistance marker kanMX. The reporter proteins do not impair the growth of yeast cells and exhibit half-lives of 40 and 5 min, respectively. The commercial substrate Nano-Glo® is compatible with detection of yNluc bioluminescence in yeast using standard commercial substrate. © 2016 The Authors. Yeast published by John Wiley & Sons Ltd. © 2016 The Authors. Yeast published by John Wiley & Sons Ltd.

The lod score method.

Science.gov (United States)

Rice, J P; Saccone, N L; Corbett, J

2001-01-01

The lod score method originated in a seminal article by Newton Morton in 1955. The method is broadly concerned with issues of power and the posterior probability of linkage, ensuring that a reported linkage has a high probability of being a true linkage. In addition, the method is sequential, so that pedigrees or lod curves may be combined from published reports to pool data for analysis. This approach has been remarkably successful for 50 years in identifying disease genes for Mendelian disorders. After discussing these issues, we consider the situation for complex disorders, where the maximum lod score (MLS) statistic shares some of the advantages of the traditional lod score approach but is limited by unknown power and the lack of sharing of the primary data needed to optimally combine analytic results. We may still learn from the lod score method as we explore new methods in molecular biology and genetic analysis to utilize the complete human DNA sequence and the cataloging of all human genes.

Methods for interpreting lists of affected genes obtained in a DNA microarray experiment

Directory of Open Access Journals (Sweden)

Hedegaard Jakob

2009-07-01

Full Text Available Abstract Background The aim of this paper was to describe and compare the methods used and the results obtained by the participants in a joint EADGENE (European Animal Disease Genomic Network of Excellence and SABRE (Cutting Edge Genomics for Sustainable Animal Breeding workshop focusing on post analysis of microarray data. The participating groups were provided with identical lists of microarray probes, including test statistics for three different contrasts, and the normalised log-ratios for each array, to be used as the starting point for interpreting the affected probes. The data originated from a microarray experiment conducted to study the host reactions in broilers occurring shortly after a secondary challenge with either a homologous or heterologous species of Eimeria. Results Several conceptually different analytical approaches, using both commercial and public available software, were applied by the participating groups. The following tools were used: Ingenuity Pathway Analysis, MAPPFinder, LIMMA, GOstats, GOEAST, GOTM, Globaltest, TopGO, ArrayUnlock, Pathway Studio, GIST and AnnotationDbi. The main focus of the approaches was to utilise the relation between probes/genes and their gene ontology and pathways to interpret the affected probes/genes. The lack of a well-annotated chicken genome did though limit the possibilities to fully explore the tools. The main results from these analyses showed that the biological interpretation is highly dependent on the statistical method used but that some common biological conclusions could be reached. Conclusion It is highly recommended to test different analytical methods on the same data set and compare the results to obtain a reliable biological interpretation of the affected genes in a DNA microarray experiment.

Republished review: Gene therapy for ocular diseases.

Science.gov (United States)

Liu, Melissa M; Tuo, Jingsheng; Chan, Chi-Chao

2011-07-01

The eye is an easily accessible, highly compartmentalised and immune-privileged organ that offers unique advantages as a gene therapy target. Significant advancements have been made in understanding the genetic pathogenesis of ocular diseases, and gene replacement and gene silencing have been implicated as potentially efficacious therapies. Recent improvements have been made in the safety and specificity of vector-based ocular gene transfer methods. Proof-of-concept for vector-based gene therapies has also been established in several experimental models of human ocular diseases. After nearly two decades of ocular gene therapy research, preliminary successes are now being reported in phase 1 clinical trials for the treatment of Leber congenital amaurosis. This review describes current developments and future prospects for ocular gene therapy. Novel methods are being developed to enhance the performance and regulation of recombinant adeno-associated virus- and lentivirus-mediated ocular gene transfer. Gene therapy prospects have advanced for a variety of retinal disorders, including retinitis pigmentosa, retinoschisis, Stargardt disease and age-related macular degeneration. Advances have also been made using experimental models for non-retinal diseases, such as uveitis and glaucoma. These methodological advancements are critical for the implementation of additional gene-based therapies for human ocular diseases in the near future.

Identification and validation of suitable endogenous reference genes for gene expression studies in human peripheral blood

Directory of Open Access Journals (Sweden)

Turner Renee J

2009-08-01

Full Text Available Abstract Background Gene expression studies require appropriate normalization methods. One such method uses stably expressed reference genes. Since suitable reference genes appear to be unique for each tissue, we have identified an optimal set of the most stably expressed genes in human blood that can be used for normalization. Methods Whole-genome Affymetrix Human 2.0 Plus arrays were examined from 526 samples of males and females ages 2 to 78, including control subjects and patients with Tourette syndrome, stroke, migraine, muscular dystrophy, and autism. The top 100 most stably expressed genes with a broad range of expression levels were identified. To validate the best candidate genes, we performed quantitative RT-PCR on a subset of 10 genes (TRAP1, DECR1, FPGS, FARP1, MAPRE2, PEX16, GINS2, CRY2, CSNK1G2 and A4GALT, 4 commonly employed reference genes (GAPDH, ACTB, B2M and HMBS and PPIB, previously reported to be stably expressed in blood. Expression stability and ranking analysis were performed using GeNorm and NormFinder algorithms. Results Reference genes were ranked based on their expression stability and the minimum number of genes needed for nomalization as calculated using GeNorm showed that the fewest, most stably expressed genes needed for acurate normalization in RNA expression studies of human whole blood is a combination of TRAP1, FPGS, DECR1 and PPIB. We confirmed the ranking of the best candidate control genes by using an alternative algorithm (NormFinder. Conclusion The reference genes identified in this study are stably expressed in whole blood of humans of both genders with multiple disease conditions and ages 2 to 78. Importantly, they also have different functions within cells and thus should be expressed independently of each other. These genes should be useful as normalization genes for microarray and RT-PCR whole blood studies of human physiology, metabolism and disease.

Imaging gene expression in gene therapy

Energy Technology Data Exchange (ETDEWEB)

Wiebe, Leonard I. [Alberta Univ., Edmonton (Canada). Noujaim Institute for Pharmaceutical Oncology Research

1997-12-31

Full text. Gene therapy can be used to introduce new genes, or to supplement the function of indigenous genes. At the present time, however, there is non-invasive test to demonstrate efficacy of the gene transfer and expression processes. It has been postulated that scintigraphic imaging can offer unique information on both the site at which the transferred gene is expressed, and the degree of expression, both of which are critical issue for safety and clinical efficacy. Many current studies are based on `suicide gene therapy` of cancer. Cells modified to express these genes commit metabolic suicide in the presence of an enzyme encoded by the transferred gene and a specifically-convertible pro drug. Pro drug metabolism can lead to selective metabolic trapping, required for scintigraphy. Herpes simplex virus type-1 thymidine kinase (H S V-1 t k{sup +}) has been use for `suicide` in vivo tumor gene therapy. It has been proposed that radiolabelled nucleosides can be used as radiopharmaceuticals to detect H S V-1 t k{sup +} gene expression where the H S V-1 t k{sup +} gene serves a reporter or therapeutic function. Animal gene therapy models have been studied using purine-([{sup 18} F]F H P G; [{sup 18} F]-A C V), and pyrimidine- ([{sup 123}/{sup 131} I]I V R F U; [{sup 124}/{sup 131I}]) antiviral nucleosides. Principles of gene therapy and gene therapy imaging will be reviewed and experimental data for [{sup 123}/{sup 131I}]I V R F U imaging with the H S V-1 t k{sup +} reporter gene will be presented

Fast and accurate methods for phylogenomic analyses

Directory of Open Access Journals (Sweden)

Warnow Tandy

2011-10-01

Full Text Available Abstract Background Species phylogenies are not estimated directly, but rather through phylogenetic analyses of different gene datasets. However, true gene trees can differ from the true species tree (and hence from one another due to biological processes such as horizontal gene transfer, incomplete lineage sorting, and gene duplication and loss, so that no single gene tree is a reliable estimate of the species tree. Several methods have been developed to estimate species trees from estimated gene trees, differing according to the specific algorithmic technique used and the biological model used to explain differences between species and gene trees. Relatively little is known about the relative performance of these methods. Results We report on a study evaluating several different methods for estimating species trees from sequence datasets, simulating sequence evolution under a complex model including indels (insertions and deletions, substitutions, and incomplete lineage sorting. The most important finding of our study is that some fast and simple methods are nearly as accurate as the most accurate methods, which employ sophisticated statistical methods and are computationally quite intensive. We also observe that methods that explicitly consider errors in the estimated gene trees produce more accurate trees than methods that assume the estimated gene trees are correct. Conclusions Our study shows that highly accurate estimations of species trees are achievable, even when gene trees differ from each other and from the species tree, and that these estimations can be obtained using fairly simple and computationally tractable methods.

An integrative approach to inferring biologically meaningful gene modules

Directory of Open Access Journals (Sweden)

Wang Kai

2011-07-01

Full Text Available Abstract Background The ability to construct biologically meaningful gene networks and modules is critical for contemporary systems biology. Though recent studies have demonstrated the power of using gene modules to shed light on the functioning of complex biological systems, most modules in these networks have shown little association with meaningful biological function. We have devised a method which directly incorporates gene ontology (GO annotation in construction of gene modules in order to gain better functional association. Results We have devised a method, Semantic Similarity-Integrated approach for Modularization (SSIM that integrates various gene-gene pairwise similarity values, including information obtained from gene expression, protein-protein interactions and GO annotations, in the construction of modules using affinity propagation clustering. We demonstrated the performance of the proposed method using data from two complex biological responses: 1. the osmotic shock response in Saccharomyces cerevisiae, and 2. the prion-induced pathogenic mouse model. In comparison with two previously reported algorithms, modules identified by SSIM showed significantly stronger association with biological functions. Conclusions The incorporation of semantic similarity based on GO annotation with gene expression and protein-protein interaction data can greatly enhance the functional relevance of inferred gene modules. In addition, the SSIM approach can also reveal the hierarchical structure of gene modules to gain a broader functional view of the biological system. Hence, the proposed method can facilitate comprehensive and in-depth analysis of high throughput experimental data at the gene network level.

Novel Random Mutagenesis Method for Directed Evolution.

Science.gov (United States)

Feng, Hong; Wang, Hai-Yan; Zhao, Hong-Yan

2017-01-01

Directed evolution is a powerful strategy for gene mutagenesis, and has been used for protein engineering both in scientific research and in the biotechnology industry. The routine method for directed evolution was developed by Stemmer in 1994 (Stemmer, Proc Natl Acad Sci USA 91, 10747-10751, 1994; Stemmer, Nature 370, 389-391, 1994). Since then, various methods have been introduced, each of which has advantages and limitations depending upon the targeted genes and procedure. In this chapter, a novel alternative directed evolution method which combines mutagenesis PCR with dITP and fragmentation by endonuclease V is described. The kanamycin resistance gene is used as a reporter gene to verify the novel method for directed evolution. This method for directed evolution has been demonstrated to be efficient, reproducible, and easy to manipulate in practice.

Biomarker Identification for Prostate Cancer and Lymph Node Metastasis from Microarray Data and Protein Interaction Network Using Gene Prioritization Method

Directory of Open Access Journals (Sweden)

Carlos Roberto Arias

2012-01-01

Full Text Available Finding a genetic disease-related gene is not a trivial task. Therefore, computational methods are needed to present clues to the biomedical community to explore genes that are more likely to be related to a specific disease as biomarker. We present biomarker identification problem using gene prioritization method called gene prioritization from microarray data based on shortest paths, extended with structural and biological properties and edge flux using voting scheme (GP-MIDAS-VXEF. The method is based on finding relevant interactions on protein interaction networks, then scoring the genes using shortest paths and topological analysis, integrating the results using a voting scheme and a biological boosting. We applied two experiments, one is prostate primary and normal samples and the other is prostate primary tumor with and without lymph nodes metastasis. We used 137 truly prostate cancer genes as benchmark. In the first experiment, GP-MIDAS-VXEF outperforms all the other state-of-the-art methods in the benchmark by retrieving the truest related genes from the candidate set in the top 50 scores found. We applied the same technique to infer the significant biomarkers in prostate cancer with lymph nodes metastasis which is not established well.

COMPANY PERFORMANCE MEASUREMENT AND REPORTING METHODS

Directory of Open Access Journals (Sweden)

Nicu Ioana Elena

2012-12-01

Full Text Available One of the priorities of economic research has been and remains the re-evaluation of the notion of performance and especially exploring and finding some indicators that would reflect as accurately as possible the subtleties of the economic entity. The main purpose of this paper is to highlight the main company performance measurement and reporting methods. Performance is a concept that raises many question marks concerning the most accurate or the best method of reporting the performance at the company level. The research methodology has aimed at studying the Romanian and foreign specialized literature dealing with the analyzed field, studying magazines specialized on company performance measurement. If the financial performance measurement indicators are considered to offer an accurate image of the situation of the company, the modern approach through non-financial indicators offers a new perspective upon performance measurement, which is based on simplicity. In conclusion, after the theoretical study, I have noticed that the methods of performance measurement, reporting and interpretation are various, the opinions regarding the best performance measurement methods are contradictive and the companies prefer resorting to financial indicators that still play a more important role in the consolidation of the company performance measurement than the non-financial indicators do.

A rapid and effective method for screening, sequencing and reporter verification of engineered frameshift mutations in zebrafish

Directory of Open Access Journals (Sweden)

Sergey V. Prykhozhij

2017-06-01

Full Text Available Clustered regularly interspaced palindromic repeats (CRISPR/Cas-based adaptive immunity against pathogens in bacteria has been adapted for genome editing and applied in zebrafish (Danio rerio to generate frameshift mutations in protein-coding genes. Although there are methods to detect, quantify and sequence CRISPR/Cas9-induced mutations, identifying mutations in F1 heterozygous fish remains challenging. Additionally, sequencing a mutation and assuming that it causes a frameshift does not prove causality because of possible alternative translation start sites and potential effects of mutations on splicing. This problem is compounded by the relatively few antibodies available for zebrafish proteins, limiting validation at the protein level. To address these issues, we developed a detailed protocol to screen F1 mutation carriers, and clone and sequence identified mutations. In order to verify that mutations actually cause frameshifts, we created a fluorescent reporter system that can detect frameshift efficiency based on the cloning of wild-type and mutant cDNA fragments and their expression levels. As proof of principle, we applied this strategy to three CRISPR/Cas9-induced mutations in pycr1a, chd7 and hace1 genes. An insertion of seven nucleotides in pycr1a resulted in the first reported observation of exon skipping by CRISPR/Cas9-induced mutations in zebrafish. However, of these three mutant genes, the fluorescent reporter revealed effective frameshifting exclusively in the case of a two-nucleotide deletion in chd7, suggesting activity of alternative translation sites in the other two mutants even though pycr1a exon-skipping deletion is likely to be deleterious. This article provides a protocol for characterizing frameshift mutations in zebrafish, and highlights the importance of checking mutations at the mRNA level and verifying their effects on translation by fluorescent reporters when antibody detection of protein loss is not possible.

A novel mutation of WFS1 gene in a Chinese patient with Wolfram syndrome: a case report.

Science.gov (United States)

Li, Min; Liu, Jia; Yi, Huan; Xu, Li; Zhong, Xiufeng; Peng, Fuhua

2018-03-17

Wolfram syndrome (WS), caused by mutations of the Wolfram syndrome 1 (WFS1) gene on chromosome 4p16.1, is an autosomal recessive disorder characterized by diabetes insipidus (DI), neuro-psychiatric disorders, hearing deficit, and urinary tract anomalies. Here we report a 11-year-old Chinese boy who presented with visual loss, was suspected with optic neuritis (ON) or neuromyelitis optica (NMO) and referred to our department for further diagnosis. Finally he was diagnosed with WS because of diabetes mellitus (DM) and optic atrophy (OA). Eight exons and flanking introns of WFS1 gene were analyzed by sequencing. A novel mutation c.1760G > A in WFS1 gene of exon 8 was identified. This report reviews a case of WS associated with a novel mutation, c.1760G > A in WFS1 gene of exon 8, and emphasizes that WS should be taken into account for juveniles with visual loss and diabetes mellitus.

Usefulness of intra-arterial embolization method using gelfoam particles in effective gene transduction of adenoviral vector for liver-directed gene therapy: an preliminary animal study in dogs

International Nuclear Information System (INIS)

Lee, Jin Hwa; Park, Byeong Ho; Kim, Chan Sung

2003-01-01

Liver-directed gene therapy is being actively pursued and developed as a method of treating various liver diseases. A number of aspects, including gene intervention, an efficient gene delivery system, and stable transgene expression are key to the success of the chosen strategy, and to overcome problems in these areas, several tactics can be used. In this study, we assess the utility of transarterial embolization using gelfoam particles soaked in an adenovirus vector as a gene-delivery method. Using the angiographic approach, three dogs each weighing 9.5-11kg were superselectively catheterized at the left hepatic artery using a 3-F microcatheter and the coaxial method. Two of the dogs were embolized at the left hepatic artery using 3x2x2-mm and 2x1x1-mm gelfoam particles soaked in 2x10 11 particles/kg of recombinant adv. CMV.LacZ(LacZ-adv). The left hepatic artery of the remaining animal, used as a control, was infused with the same dose of lacZ-adv in the same way as before but without embolization of the left hepatic artery. Three days after embolization or the infusion of LacZ-adv, the dogs were sacrificed prior to harvest of the entire liver for the evaluation of gene transduction. X-gal staining of the liver tissue obtained was positive for hepatocytes, but the pattern and degree of gene transduction differed according to gelfoam particle size. Where this was 3x2x2 mm, gene transduction along the liver hilum varied, but where 2x1x1-mm particles were used, transduction was more even. No pathologic hepatic tissue injury or inflammation was apparent, and control liver tissue was not stained by X-gal. Serum SGOT and SGPT levels were slightly higher one day after the procedure, but had normalized by day 3. Intrahepatic transarterial embolization using gelfoam particles soaked in LacZ-adv appears to be a good method for effective liver-targed gene therapy

Usefulness of intra-arterial embolization method using gelfoam particles in effective gene transduction of adenoviral vector for liver-directed gene therapy: an preliminary animal study in dogs

Energy Technology Data Exchange (ETDEWEB)

Lee, Jin Hwa; Park, Byeong Ho; Kim, Chan Sung [Dong-A University College of Medicine, Pusan (Korea, Republic of)

2003-02-01

Liver-directed gene therapy is being actively pursued and developed as a method of treating various liver diseases. A number of aspects, including gene intervention, an efficient gene delivery system, and stable transgene expression are key to the success of the chosen strategy, and to overcome problems in these areas, several tactics can be used. In this study, we assess the utility of transarterial embolization using gelfoam particles soaked in an adenovirus vector as a gene-delivery method. Using the angiographic approach, three dogs each weighing 9.5-11kg were superselectively catheterized at the left hepatic artery using a 3-F microcatheter and the coaxial method. Two of the dogs were embolized at the left hepatic artery using 3x2x2-mm and 2x1x1-mm gelfoam particles soaked in 2x10{sup 11} particles/kg of recombinant adv. CMV.LacZ(LacZ-adv). The left hepatic artery of the remaining animal, used as a control, was infused with the same dose of lacZ-adv in the same way as before but without embolization of the left hepatic artery. Three days after embolization or the infusion of LacZ-adv, the dogs were sacrificed prior to harvest of the entire liver for the evaluation of gene transduction. X-gal staining of the liver tissue obtained was positive for hepatocytes, but the pattern and degree of gene transduction differed according to gelfoam particle size. Where this was 3x2x2 mm, gene transduction along the liver hilum varied, but where 2x1x1-mm particles were used, transduction was more even. No pathologic hepatic tissue injury or inflammation was apparent, and control liver tissue was not stained by X-gal. Serum SGOT and SGPT levels were slightly higher one day after the procedure, but had normalized by day 3. Intrahepatic transarterial embolization using gelfoam particles soaked in LacZ-adv appears to be a good method for effective liver-targed gene therapy.

Inventory of LCIA selection methods for assessing toxic releases. Methods and typology report part B

DEFF Research Database (Denmark)

Larsen, Henrik Fred; Birkved, Morten; Hauschild, Michael Zwicky

method(s) in Work package 8 (WP8) of the OMNIITOX project. The selection methods and the other CRS methods are described in detail, a set of evaluation criteria are developed and the methods are evaluated against these criteria. This report (Deliverable 11B (D11B)) gives the results from task 7.1d, 7.1e......This report describes an inventory of Life Cycle Impact Assessment (LCIA) selection methods for assessing toxic releases. It consists of an inventory of current selection methods and other Chemical Ranking and Scoring (CRS) methods assessed to be relevant for the development of (a) new selection...... and 7.1f of WP 7 for selection methods. The other part of D11 (D11A) is reported in another report and deals with characterisation methods. A selection method is a method for prioritising chemical emissions to be included in an LCIA characterisation of toxic releases, i.e. calculating indicator scores...

Analysis of genes involved in sex determination of fishes by phenol-emulsion method

Energy Technology Data Exchange (ETDEWEB)

Nakayama, Ichiro; Nagoya, Hiroyuki; Okamoto, Hiroyuki; Araki, Kazuo [National Research Inst. of Aquaculture, Mie (Japan)

1998-02-01

With an aim to clarify the mechanism of sex determination common to vertebrates, the genes presumed to mediate the sex determination were analyzed through cDNA subtraction by phenol-emulsion method. A total RNA was extracted from male juvenile Amago, a kind of oncorhynchus and cDNA was synthesized using mRNA fractionated by oligo-dT column. The male-specific genes expressed in the stage of sex determination was isolated through incorporation to PVC-derived vector. Thus obtained genes were confirmed to be male-specific by Southern hybridization. The results of the screening for the subtracted products indicate that neither of the male-specific clones detected in this study was novel. Previous studies on sex discrimination based on mitochondrial DNA suggested that Sakuramasu and Amago belong in the same species, Oncorhynchus masou masou and the present results show that DNA sequence for male-derived GH pseudo-gene is partially different between the two fishes. (M.N.)

A comparison of digital gene expression profiling and methyl DNA immunoprecipitation as methods for gene discovery in honeybee (Apis mellifera behavioural genomic analyses.

Directory of Open Access Journals (Sweden)

Cui Guan

Full Text Available The honey bee has a well-organized system of division of labour among workers. Workers typically progress through a series of discrete behavioural castes as they age, and this has become an important case study for exploring how dynamic changes in gene expression can influence behaviour. Here we applied both digital gene expression analysis and methyl DNA immunoprecipitation analysis to nurse, forager and reverted nurse bees (nurses that have returned to the nursing state after a period spent foraging from the same colony in order to compare the outcomes of these different forms of genomic analysis. A total of 874 and 710 significantly differentially expressed genes were identified in forager/nurse and reverted nurse/forager comparisons respectively. Of these, 229 genes exhibited reversed directions of gene expression differences between the forager/nurse and reverted nurse/forager comparisons. Using methyl-DNA immunoprecipitation combined with high-throughput sequencing (MeDIP-seq we identified 366 and 442 significantly differentially methylated genes in forager/nurse and reverted nurse/forager comparisons respectively. Of these, 165 genes were identified as differentially methylated in both comparisons. However, very few genes were identified as both differentially expressed and differentially methylated in our comparisons of nurses and foragers. These findings confirm that changes in both gene expression and DNA methylation are involved in the nurse and forager behavioural castes, but the different analytical methods reveal quite distinct sets of candidate genes.

Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

Science.gov (United States)

Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

2012-08-15

Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR.

Science.gov (United States)

Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas

2013-05-21

Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.

Time-Course Gene Set Analysis for Longitudinal Gene Expression Data.

Directory of Open Access Journals (Sweden)

Boris P Hejblum

2015-06-01

Full Text Available Gene set analysis methods, which consider predefined groups of genes in the analysis of genomic data, have been successfully applied for analyzing gene expression data in cross-sectional studies. The time-course gene set analysis (TcGSA introduced here is an extension of gene set analysis to longitudinal data. The proposed method relies on random effects modeling with maximum likelihood estimates. It allows to use all available repeated measurements while dealing with unbalanced data due to missing at random (MAR measurements. TcGSA is a hypothesis driven method that identifies a priori defined gene sets with significant expression variations over time, taking into account the potential heterogeneity of expression within gene sets. When biological conditions are compared, the method indicates if the time patterns of gene sets significantly differ according to these conditions. The interest of the method is illustrated by its application to two real life datasets: an HIV therapeutic vaccine trial (DALIA-1 trial, and data from a recent study on influenza and pneumococcal vaccines. In the DALIA-1 trial TcGSA revealed a significant change in gene expression over time within 69 gene sets during vaccination, while a standard univariate individual gene analysis corrected for multiple testing as well as a standard a Gene Set Enrichment Analysis (GSEA for time series both failed to detect any significant pattern change over time. When applied to the second illustrative data set, TcGSA allowed the identification of 4 gene sets finally found to be linked with the influenza vaccine too although they were found to be associated to the pneumococcal vaccine only in previous analyses. In our simulation study TcGSA exhibits good statistical properties, and an increased power compared to other approaches for analyzing time-course expression patterns of gene sets. The method is made available for the community through an R package.

Reactor kinetics methods development. Final report

International Nuclear Information System (INIS)

Hansen, K.F.; Henry, A.F.

1978-01-01

This report is a qualitative summary of research conducted at MIT from 1967 to 1977 in the area of reactor kinetics methods. The objectives of the research were to find methods of integration of various mathematical models of nuclear reactor transients. From the beginning the work was aimed at numerical integration methods. Specific areas of research, discussed in more detail following, included: integration of multigroup diffusion theory models by finite difference and finite element methods; response matrix and nodal methods; coarse-mesh homogenization; and special treatment of boundary conditions

Learning gene regulatory networks from gene expression data using weighted consensus

KAUST Repository

Fujii, Chisato; Kuwahara, Hiroyuki; Yu, Ge; Guo, Lili; Gao, Xin

2016-01-01

An accurate determination of the network structure of gene regulatory systems from high-throughput gene expression data is an essential yet challenging step in studying how the expression of endogenous genes is controlled through a complex interaction of gene products and DNA. While numerous methods have been proposed to infer the structure of gene regulatory networks, none of them seem to work consistently over different data sets with high accuracy. A recent study to compare gene network inference methods showed that an average-ranking-based consensus method consistently performs well under various settings. Here, we propose a linear programming-based consensus method for the inference of gene regulatory networks. Unlike the average-ranking-based one, which treats the contribution of each individual method equally, our new consensus method assigns a weight to each method based on its credibility. As a case study, we applied the proposed consensus method on synthetic and real microarray data sets, and compared its performance to that of the average-ranking-based consensus and individual inference methods. Our results show that our weighted consensus method achieves superior performance over the unweighted one, suggesting that assigning weights to different individual methods rather than giving them equal weights improves the accuracy. © 2016 Elsevier B.V.

Learning gene regulatory networks from gene expression data using weighted consensus

KAUST Repository

Fujii, Chisato

2016-08-25

An accurate determination of the network structure of gene regulatory systems from high-throughput gene expression data is an essential yet challenging step in studying how the expression of endogenous genes is controlled through a complex interaction of gene products and DNA. While numerous methods have been proposed to infer the structure of gene regulatory networks, none of them seem to work consistently over different data sets with high accuracy. A recent study to compare gene network inference methods showed that an average-ranking-based consensus method consistently performs well under various settings. Here, we propose a linear programming-based consensus method for the inference of gene regulatory networks. Unlike the average-ranking-based one, which treats the contribution of each individual method equally, our new consensus method assigns a weight to each method based on its credibility. As a case study, we applied the proposed consensus method on synthetic and real microarray data sets, and compared its performance to that of the average-ranking-based consensus and individual inference methods. Our results show that our weighted consensus method achieves superior performance over the unweighted one, suggesting that assigning weights to different individual methods rather than giving them equal weights improves the accuracy. © 2016 Elsevier B.V.

Identification and Functional Analysis of Gene Regulatory Sequences Interacting with Colorectal Tumor Suppressors

DEFF Research Database (Denmark)

Dahlgaard, Katja; Troelsen, Jesper

2018-01-01

Several tumor suppressors possess gene regulatory activity. Here, we describe how promoter and promoter/enhancer reporter assays can be used to characterize a colorectal tumor suppressor proteins’ gene regulatory activity of possible target genes. In the first part, a bioinformatic approach...... of the quick and efficient In-Fusion cloning method, and how to carry out transient transfections of Caco-2 colon cancer cells with the produced luciferase reporter plasmids using polyethyleneimine (PEI). A plan describing how to set up and carry out the luciferase expression assay is presented. The luciferase...... to identify relevant gene regulatory regions of potential target genes is presented. In the second part, it is demonstrated how to prepare and carry out the functional assay. We explain how to clone the bioinformatically identified gene regulatory regions into luciferase reporter plasmids by the use...

Exploration of new perspectives and limitations in Agrobacterium mediated gene transfer technology. Progress report, [June 1, 1992-- May 31, 1994

Energy Technology Data Exchange (ETDEWEB)

Marton, L.

1994-12-31

This report describes progress aimed at constructing gene-transfer technology for Nicotiana plumbaginifolia. Most actual effort as described herein has so far been directed at exploring new perspectives and limitations in Agrobacterium mediated gene transfer. Accomplishments are described using a core homologous gene targeting vector.

Discovering genes underlying QTL

Energy Technology Data Exchange (ETDEWEB)

Vanavichit, Apichart [Kasetsart University, Kamphaengsaen, Nakorn Pathom (Thailand)

2002-02-01

A map-based approach has allowed scientists to discover few genes at a time. In addition, the reproductive barrier between cultivated rice and wild relatives has prevented us from utilizing the germ plasm by a map-based approach. Most genetic traits important to agriculture or human diseases are manifested as observable, quantitative phenotypes called Quantitative Trait Loci (QTL). In many instances, the complexity of the phenotype/genotype interaction and the general lack of clearly identifiable gene products render the direct molecular cloning approach ineffective, thus additional strategies like genome mapping are required to identify the QTL in question. Genome mapping requires no prior knowledge of the gene function, but utilizes statistical methods to identify the most likely gene location. To completely characterize genes of interest, the initially mapped region of a gene location will have to be narrowed down to a size that is suitable for cloning and sequencing. Strategies for gene identification within the critical region have to be applied after the sequencing of a potentially large clone or set of clones that contains this gene(s). Tremendous success of positional cloning has been shown for cloning many genes responsible for human diseases, including cystic fibrosis and muscular dystrophy as well as plant disease resistance genes. Genome and QTL mapping, positional cloning: the pre-genomics era, comparative approaches to gene identification, and positional cloning: the genomics era are discussed in the report. (M. Suetake)

Detection of estrogenic activity in sediment-associated compounds using in vitro reporter gene assays

NARCIS (Netherlands)

Legler, J.; Dennekamp, M.; Vethaak, A.D.; Brouwer, A.; Koeman, J.H.; Burg, van der B.; Murk, A.J.

2002-01-01

Sediments may be the ultimate sink for persistent (xeno-) estrogenic compounds released into the aquatic environment. Sediment-associated estrogenic potency was measured with an estrogen receptor-mediated luciferase reporter gene (ER-CALUX) assay and compared with a recombinant yeast screen. The

Genetic Bee Colony (GBC) algorithm: A new gene selection method for microarray cancer classification.

Science.gov (United States)

Alshamlan, Hala M; Badr, Ghada H; Alohali, Yousef A

2015-06-01

Naturally inspired evolutionary algorithms prove effectiveness when used for solving feature selection and classification problems. Artificial Bee Colony (ABC) is a relatively new swarm intelligence method. In this paper, we propose a new hybrid gene selection method, namely Genetic Bee Colony (GBC) algorithm. The proposed algorithm combines the used of a Genetic Algorithm (GA) along with Artificial Bee Colony (ABC) algorithm. The goal is to integrate the advantages of both algorithms. The proposed algorithm is applied to a microarray gene expression profile in order to select the most predictive and informative genes for cancer classification. In order to test the accuracy performance of the proposed algorithm, extensive experiments were conducted. Three binary microarray datasets are use, which include: colon, leukemia, and lung. In addition, another three multi-class microarray datasets are used, which are: SRBCT, lymphoma, and leukemia. Results of the GBC algorithm are compared with our recently proposed technique: mRMR when combined with the Artificial Bee Colony algorithm (mRMR-ABC). We also compared the combination of mRMR with GA (mRMR-GA) and Particle Swarm Optimization (mRMR-PSO) algorithms. In addition, we compared the GBC algorithm with other related algorithms that have been recently published in the literature, using all benchmark datasets. The GBC algorithm shows superior performance as it achieved the highest classification accuracy along with the lowest average number of selected genes. This proves that the GBC algorithm is a promising approach for solving the gene selection problem in both binary and multi-class cancer classification. Copyright © 2015 Elsevier Ltd. All rights reserved.

Method to produce acetyldiacylglycerols (ac-TAGs) by expression of an acetyltransferase gene isolated from Euonymus alatus (burning bush)

Energy Technology Data Exchange (ETDEWEB)

Durrett, Timothy; Ohlrogge, John; Pollard, Michael

2016-05-03

The present invention relates to novel diacylglycerol acyltransferase genes and proteins, and methods of their use. In particular, the invention describes genes encoding proteins having diacylglycerol acetyltransferase activity, specifically for transferring an acetyl group to a diacylglycerol substrate to form acetyl-Triacylglycerols (ac-TAGS), for example, a 3-acetyl-1,2-diacyl-sn-glycerol. The present invention encompasses both native and recombinant wild-type forms of the transferase, as well as mutants and variant forms. The present invention also relates to methods of using novel diacylglycerol acyltransferase genes and proteins, including their expression in transgenic organisms at commercially viable levels, for increasing production of 3-acetyl-1,2-diacyl-sn-glycerols in plant oils and altering the composition of oils produced by microorganisms, such as yeast, by increasing ac-TAG production. Additionally, oils produced by methods of the present inventions comprising genes and proteins are contemplated for use as biodiesel fuel, in polymer production and as naturally produced food oils with reduced calories.

Logic Learning Machine and standard supervised methods for Hodgkin's lymphoma prognosis using gene expression data and clinical variables.

Science.gov (United States)

Parodi, Stefano; Manneschi, Chiara; Verda, Damiano; Ferrari, Enrico; Muselli, Marco

2018-03-01

This study evaluates the performance of a set of machine learning techniques in predicting the prognosis of Hodgkin's lymphoma using clinical factors and gene expression data. Analysed samples from 130 Hodgkin's lymphoma patients included a small set of clinical variables and more than 54,000 gene features. Machine learning classifiers included three black-box algorithms ( k-nearest neighbour, Artificial Neural Network, and Support Vector Machine) and two methods based on intelligible rules (Decision Tree and the innovative Logic Learning Machine method). Support Vector Machine clearly outperformed any of the other methods. Among the two rule-based algorithms, Logic Learning Machine performed better and identified a set of simple intelligible rules based on a combination of clinical variables and gene expressions. Decision Tree identified a non-coding gene ( XIST) involved in the early phases of X chromosome inactivation that was overexpressed in females and in non-relapsed patients. XIST expression might be responsible for the better prognosis of female Hodgkin's lymphoma patients.

AST: an automated sequence-sampling method for improving the taxonomic diversity of gene phylogenetic trees.

Science.gov (United States)

Zhou, Chan; Mao, Fenglou; Yin, Yanbin; Huang, Jinling; Gogarten, Johann Peter; Xu, Ying

2014-01-01

A challenge in phylogenetic inference of gene trees is how to properly sample a large pool of homologous sequences to derive a good representative subset of sequences. Such a need arises in various applications, e.g. when (1) accuracy-oriented phylogenetic reconstruction methods may not be able to deal with a large pool of sequences due to their high demand in computing resources; (2) applications analyzing a collection of gene trees may prefer to use trees with fewer operational taxonomic units (OTUs), for instance for the detection of horizontal gene transfer events by identifying phylogenetic conflicts; and (3) the pool of available sequences is biased towards extensively studied species. In the past, the creation of subsamples often relied on manual selection. Here we present an Automated sequence-Sampling method for improving the Taxonomic diversity of gene phylogenetic trees, AST, to obtain representative sequences that maximize the taxonomic diversity of the sampled sequences. To demonstrate the effectiveness of AST, we have tested it to solve four problems, namely, inference of the evolutionary histories of the small ribosomal subunit protein S5 of E. coli, 16 S ribosomal RNAs and glycosyl-transferase gene family 8, and a study of ancient horizontal gene transfers from bacteria to plants. Our results show that the resolution of our computational results is almost as good as that of manual inference by domain experts, hence making the tool generally useful to phylogenetic studies by non-phylogeny specialists. The program is available at http://csbl.bmb.uga.edu/~zhouchan/AST.php.

Why commercialization of gene therapy stalled; examining the life cycles of gene therapy technologies.

Science.gov (United States)

Ledley, F D; McNamee, L M; Uzdil, V; Morgan, I W

2014-02-01

This report examines the commercialization of gene therapy in the context of innovation theories that posit a relationship between the maturation of a technology through its life cycle and prospects for successful product development. We show that the field of gene therapy has matured steadily since the 1980s, with the congruent accumulation of >35 000 papers, >16 000 US patents, >1800 clinical trials and >$4.3 billion in capital investment in gene therapy companies. Gene therapy technologies comprise a series of dissimilar approaches for gene delivery, each of which has introduced a distinct product architecture. Using bibliometric methods, we quantify the maturation of each technology through a characteristic life cycle S-curve, from a Nascent stage, through a Growing stage of exponential advance, toward an Established stage and projected limit. Capital investment in gene therapy is shown to have occurred predominantly in Nascent stage technologies and to be negatively correlated with maturity. Gene therapy technologies are now achieving the level of maturity that innovation research and biotechnology experience suggest may be requisite for efficient product development. Asynchrony between the maturation of gene therapy technologies and capital investment in development-focused business models may have stalled the commercialization of gene therapy.

Association analysis of the dopamine D{sub 2} receptor gene in Tourette`s syndrome using the haplotype relative risk method

Energy Technology Data Exchange (ETDEWEB)

Noethen, M.M.; Cichon, S.; Propping, P. [Univ. of Bonn (Germany)] [and others

1994-09-15

Comings et al. have recently reported a highly significant association between Tourette`s syndrome (TS) and a restriction fragment length polymorphism (RFLP) of the dopamine D{sub 2} receptor gene (DRD2) locus. The A1 allele of the DRD2 Taq I RFLP was present in 45% of the Tourette patients compared with 25% of controls. We tried to replicate this finding by using the haplotype relative risk (HRR) method for association analysis. This method overcomes a major problem of conventional case-control studies, where undetected ethnic differences between patients and controls may result in a false-positive finding, by using parental alleles not inherited by the proband as control alleles. Sixty-one nuclear families encompassing an affected child and parents were typed for the DRD2 Taq I polymorphism. No significant differences in DRD2 A1 allele frequency were observed between TS probands, sub-populations of probands classified according to tic severity, or parental control alleles. Our data do not support the hypothesis that the DRD2 locus may act as a modifying gene in the expression of the disorder in TS probands. 40 refs., 1 tab.

Optimizing viral and non-viral gene transfer methods for genetic modification of porcine mesenchymal stem cells

DEFF Research Database (Denmark)

Stiehler, Maik; Duch, Mogens; Mygind, Tina

2006-01-01

INTRODUCTION: Mesenchymal stem cells (MSCs) provide an excellent source of pluripotent progenitor cells for tissue-engineering applications due to their proliferation capacity and differentiation potential. Genetic modification of MSCs with genes encoding tissue-specific growth factors...... viral and non-viral ex vivo gene delivery systems with respect to gene transfer efficiency, maintenance of transgene expression, and safety issues using primary porcine MSCs as target cells. MATERIALS AND METHODS: MSCs were purified from bone marrow aspirates from the proximal tibiae of four 3-month......-old Danish landrace pigs by Ficoll step gradient separation and polystyrene adherence technique. Vectors expressing enhanced green fluorescent protein (eGFP) and human bone morphogenetic protein-2 (BMP-2) were transferred to the cells by different non-viral methods and by use of recombinant adeno...

Identification of key genes and molecular mechanisms associated with dedifferentiated liposarcoma based on bioinformatic methods

Directory of Open Access Journals (Sweden)

Yu H

2017-06-01

Full Text Available Hongliang Yu,1 Dong Pei,2 Longyun Chen,2 Xiaoxiang Zhou,2 Haiwen Zhu2 1Department of Radiation Oncology, Jiangsu Cancer Hospital and Jiangsu Institute of Cancer Research, The Affiliated Cancer Hospital of Nanjing Medical University, Nanjing, 2Department of Radiation Oncology, Yancheng Third People’s Hospital, Yancheng, Jiangsu, People’s Republic of China Background: Dedifferentiated liposarcoma (DDLPS is one of the most deadly types of soft tissue sarcoma. To date, there have been few studies dedicated to elucidating the molecular mechanisms behind the disease; therefore, the molecular mechanisms behind this malignancy remain largely unknown.Materials and methods: Microarray profiles of 46 DDLPS samples and nine normal fat controls were extracted from Gene Expression Omnibus (GEO. Quality control for these microarray profiles was performed before analysis. Hierarchical clustering and principal component analysis were used to distinguish the general differences in gene expression between DDLPS samples and the normal fat controls. Differentially expressed genes (DEGs were identified using the Limma package in R. Next, the enriched Gene Ontology (GO terms and Kyoto Encyclopedia of Genes and Genomes (KEGG pathways were obtained using the online tool DAVID (http://david.abcc.ncifcrf.gov/. A protein–protein interaction (PPI network was constructed using the STRING database and Cytoscape software. Furthermore, the hub genes within the PPI network were identified.Results: All 55 microarray profiles were confirmed to be of high quality. The gene expression pattern of DDLPS samples was significantly different from that of normal fat controls. In total, 700 DEGs were identified, and 83 enriched GO terms and three KEGG pathways were obtained. Specifically, within the DEGs of DDLPS samples, several pathways were identified as being significantly enriched, including the PPAR signaling pathway, cell cycle pathway, and pyruvate metabolism pathway

Reconstruction of gene regulatory modules from RNA silencing of IFN-α modulators: experimental set-up and inference method.

Science.gov (United States)

Grassi, Angela; Di Camillo, Barbara; Ciccarese, Francesco; Agnusdei, Valentina; Zanovello, Paola; Amadori, Alberto; Finesso, Lorenzo; Indraccolo, Stefano; Toffolo, Gianna Maria

2016-03-12

Inference of gene regulation from expression data may help to unravel regulatory mechanisms involved in complex diseases or in the action of specific drugs. A challenging task for many researchers working in the field of systems biology is to build up an experiment with a limited budget and produce a dataset suitable to reconstruct putative regulatory modules worth of biological validation. Here, we focus on small-scale gene expression screens and we introduce a novel experimental set-up and a customized method of analysis to make inference on regulatory modules starting from genetic perturbation data, e.g. knockdown and overexpression data. To illustrate the utility of our strategy, it was applied to produce and analyze a dataset of quantitative real-time RT-PCR data, in which interferon-α (IFN-α) transcriptional response in endothelial cells is investigated by RNA silencing of two candidate IFN-α modulators, STAT1 and IFIH1. A putative regulatory module was reconstructed by our method, revealing an intriguing feed-forward loop, in which STAT1 regulates IFIH1 and they both negatively regulate IFNAR1. STAT1 regulation on IFNAR1 was object of experimental validation at the protein level. Detailed description of the experimental set-up and of the analysis procedure is reported, with the intent to be of inspiration for other scientists who want to realize similar experiments to reconstruct gene regulatory modules starting from perturbations of possible regulators. Application of our approach to the study of IFN-α transcriptional response modulators in endothelial cells has led to many interesting novel findings and new biological hypotheses worth of validation.

Deep-tissue reporter-gene imaging with fluorescence and optoacoustic tomography: a performance overview.

Science.gov (United States)

Deliolanis, Nikolaos C; Ale, Angelique; Morscher, Stefan; Burton, Neal C; Schaefer, Karin; Radrich, Karin; Razansky, Daniel; Ntziachristos, Vasilis

2014-10-01

A primary enabling feature of near-infrared fluorescent proteins (FPs) and fluorescent probes is the ability to visualize deeper in tissues than in the visible. The purpose of this work is to find which is the optimal visualization method that can exploit the advantages of this novel class of FPs in full-scale pre-clinical molecular imaging studies. Nude mice were stereotactically implanted with near-infrared FP expressing glioma cells to from brain tumors. The feasibility and performance metrics of FPs were compared between planar epi-illumination and trans-illumination fluorescence imaging, as well as to hybrid Fluorescence Molecular Tomography (FMT) system combined with X-ray CT and Multispectral Optoacoustic (or Photoacoustic) Tomography (MSOT). It is shown that deep-seated glioma brain tumors are possible to visualize both with fluorescence and optoacoustic imaging. Fluorescence imaging is straightforward and has good sensitivity; however, it lacks resolution. FMT-XCT can provide an improved rough resolution of ∼1 mm in deep tissue, while MSOT achieves 0.1 mm resolution in deep tissue and has comparable sensitivity. We show imaging capacity that can shift the visualization paradigm in biological discovery. The results are relevant not only to reporter gene imaging, but stand as cross-platform comparison for all methods imaging near infrared fluorescent contrast agents.

Conditional gene expression in the mouse using a Sleeping Beauty gene-trap transposon

Directory of Open Access Journals (Sweden)

Hackett Perry B

2006-06-01

Full Text Available Abstract Background Insertional mutagenesis techniques with transposable elements have been popular among geneticists studying model organisms from E. coli to Drosophila and, more recently, the mouse. One such element is the Sleeping Beauty (SB transposon that has been shown in several studies to be an effective insertional mutagen in the mouse germline. SB transposon vector studies have employed different functional elements and reporter molecules to disrupt and report the expression of endogenous mouse genes. We sought to generate a transposon system that would be capable of reporting the expression pattern of a mouse gene while allowing for conditional expression of a gene of interest in a tissue- or temporal-specific pattern. Results Here we report the systematic development and testing of a transposon-based gene-trap system incorporating the doxycycline-repressible Tet-Off (tTA system that is capable of activating the expression of genes under control of a Tet response element (TRE promoter. We demonstrate that the gene trap system is fully functional in vitro by introducing the "gene-trap tTA" vector into human cells by transposition and identifying clones that activate expression of a TRE-luciferase transgene in a doxycycline-dependent manner. In transgenic mice, we mobilize gene-trap tTA vectors, discover parameters that can affect germline mobilization rates, and identify candidate gene insertions to demonstrate the in vivo functionality of the vector system. We further demonstrate that the gene-trap can act as a reporter of endogenous gene expression and it can be coupled with bioluminescent imaging to identify genes with tissue-specific expression patterns. Conclusion Akin to the GAL4/UAS system used in the fly, we have made progress developing a tool for mutating and revealing the expression of mouse genes by generating the tTA transactivator in the presence of a secondary TRE-regulated reporter molecule. A vector like the gene

A hybrid approach of gene sets and single genes for the prediction of survival risks with gene expression data.

Science.gov (United States)

Seok, Junhee; Davis, Ronald W; Xiao, Wenzhong

2015-01-01

Accumulated biological knowledge is often encoded as gene sets, collections of genes associated with similar biological functions or pathways. The use of gene sets in the analyses of high-throughput gene expression data has been intensively studied and applied in clinical research. However, the main interest remains in finding modules of biological knowledge, or corresponding gene sets, significantly associated with disease conditions. Risk prediction from censored survival times using gene sets hasn't been well studied. In this work, we propose a hybrid method that uses both single gene and gene set information together to predict patient survival risks from gene expression profiles. In the proposed method, gene sets provide context-level information that is poorly reflected by single genes. Complementarily, single genes help to supplement incomplete information of gene sets due to our imperfect biomedical knowledge. Through the tests over multiple data sets of cancer and trauma injury, the proposed method showed robust and improved performance compared with the conventional approaches with only single genes or gene sets solely. Additionally, we examined the prediction result in the trauma injury data, and showed that the modules of biological knowledge used in the prediction by the proposed method were highly interpretable in biology. A wide range of survival prediction problems in clinical genomics is expected to benefit from the use of biological knowledge.

Late onset bipolar disorder and frontotemporal dementia with mutation in progranulin gene: a case report.

Science.gov (United States)

Rubino, Elisa; Vacca, Alessandro; Gallone, Salvatore; Govone, Flora; Zucca, Milena; Gai, Annalisa; Ferrero, Patrizia; Fenoglio, Pierpaola; Giordana, Maria Teresa; Rainero, Innocenzo

2017-11-01

Bipolar disorder is a chronic psychiatric illness characterised by fluctuation in mood state, with a relapsing and remitting course. Frontotemporal dementia (FTD) is a clinically and genetically heterogeneous syndrome, with the most frequent phenotype being behavioural variant frontotemporal dementia (bvFTD). Here, we report the case of an Italian male presenting with late-onset bipolar disorder that developed into bvFTD over time, carrying a mutation in the GRN gene. Interestingly, the patient carried the c.1639 C > T variant in the GRN gene, resulting in a R547C substitution. Our case report further corroborates the notion that, in addition to FTD, progranulin may be involved in the neurobiology of bipolar disorder type 1, and suggests to screen patients with late-onset bipolar disorder for GRN mutations.

Genetic components for radiosensitivity. Gene expression in radiosensitive monocygotic twins. Final report

International Nuclear Information System (INIS)

Dikomey, Ekkehard

2012-01-01

The underlying hypothesis of this project was that the variation of individual radiosensitivity is determined by the different expression of single gens. This concept was tested using 60 monozygotic twin pairs, followed by an evaluation with 80 prostate cancer patients. Radiosensitivity was assessed for both G0- as well as G2-phase using chromosomal assays. G0- radiosensitivity is determined by lethal chromosomal aberrations and reflects the individual amount of cell killing, while G2-sensitivity is determined by chromatid breaks and is taken as an indicator of individual cancer risk. For both populations, G0- and G2-radiosensitivity are characterized by substantial variation with a CV of 11 and 14% or 27 and 21%, respectively. While the mean G0-sensitivity is the same for both populations, there is a slight difference for G2. The slightly higher value of G2-sensitivity found for prostate cancer patients might result from the higher age of this group. For both populations gene expression profiles were determined using the Affymetrix chip HG-U133+2.0. Overall gene expression was characterized by a huge variation covering more than four decades. However, for single genes, expression showed little variation with CV generally ranging only between 2 and 8%. Analysis of data using several different methods revealed that variation of both G0- as well as G2-radiosensitivity cannot be ascribed to the different expression of single genes. For twins, random forests can be used to identify 8 to 10 genes than are relevant either for G0- or G2-radiosensitivity. However, these genes cannot be confirmed by an evaluation with 80 prostate cancer patients. This finding clearly demonstrates that the hypothesis, due to which variation of individual radiosensitivity is caused by different expression of single genes, has to be rejected. It appears more likely that this parameter is determined by complex interactions of several genes in functional networks. (orig.)

Phylogeny Reconstruction with Alignment-Free Method That Corrects for Horizontal Gene Transfer.

Directory of Open Access Journals (Sweden)

Raquel Bromberg

2016-06-01

Full Text Available Advances in sequencing have generated a large number of complete genomes. Traditionally, phylogenetic analysis relies on alignments of orthologs, but defining orthologs and separating them from paralogs is a complex task that may not always be suited to the large datasets of the future. An alternative to traditional, alignment-based approaches are whole-genome, alignment-free methods. These methods are scalable and require minimal manual intervention. We developed SlopeTree, a new alignment-free method that estimates evolutionary distances by measuring the decay of exact substring matches as a function of match length. SlopeTree corrects for horizontal gene transfer, for composition variation and low complexity sequences, and for branch-length nonlinearity caused by multiple mutations at the same site. We tested SlopeTree on 495 bacteria, 73 archaea, and 72 strains of Escherichia coli and Shigella. We compared our trees to the NCBI taxonomy, to trees based on concatenated alignments, and to trees produced by other alignment-free methods. The results were consistent with current knowledge about prokaryotic evolution. We assessed differences in tree topology over different methods and settings and found that the majority of bacteria and archaea have a core set of proteins that evolves by descent. In trees built from complete genomes rather than sets of core genes, we observed some grouping by phenotype rather than phylogeny, for instance with a cluster of sulfur-reducing thermophilic bacteria coming together irrespective of their phyla. The source-code for SlopeTree is available at: http://prodata.swmed.edu/download/pub/slopetree_v1/slopetree.tar.gz.

Phylogeny Reconstruction with Alignment-Free Method That Corrects for Horizontal Gene Transfer

Science.gov (United States)

Grishin, Nick V.; Otwinowski, Zbyszek

2016-01-01

Advances in sequencing have generated a large number of complete genomes. Traditionally, phylogenetic analysis relies on alignments of orthologs, but defining orthologs and separating them from paralogs is a complex task that may not always be suited to the large datasets of the future. An alternative to traditional, alignment-based approaches are whole-genome, alignment-free methods. These methods are scalable and require minimal manual intervention. We developed SlopeTree, a new alignment-free method that estimates evolutionary distances by measuring the decay of exact substring matches as a function of match length. SlopeTree corrects for horizontal gene transfer, for composition variation and low complexity sequences, and for branch-length nonlinearity caused by multiple mutations at the same site. We tested SlopeTree on 495 bacteria, 73 archaea, and 72 strains of Escherichia coli and Shigella. We compared our trees to the NCBI taxonomy, to trees based on concatenated alignments, and to trees produced by other alignment-free methods. The results were consistent with current knowledge about prokaryotic evolution. We assessed differences in tree topology over different methods and settings and found that the majority of bacteria and archaea have a core set of proteins that evolves by descent. In trees built from complete genomes rather than sets of core genes, we observed some grouping by phenotype rather than phylogeny, for instance with a cluster of sulfur-reducing thermophilic bacteria coming together irrespective of their phyla. The source-code for SlopeTree is available at: http://prodata.swmed.edu/download/pub/slopetree_v1/slopetree.tar.gz. PMID:27336403

[Gene mutation and clinical phenotype analysis of patients with Noonan syndrome and hypertrophic cardiomyopathy].

Science.gov (United States)

Liu, X H; Ding, W W; Han, L; Liu, X R; Xiao, Y Y; Yang, J; Mo, Y

2017-10-02

Objective: To analyze the gene mutations and clinical features of patients with Noonan syndrome and hypertrophic cardiomyopathy. Method: Determined the mutation domain in five cases diagnosed with Noonan syndrome and hypertrophic cardiomyopathy and identified the relationship between the mutant domain and hypertrophic cardiomyopathy by searching relevant articles in pubmed database. Result: Three mutant genes (PTPN11 gene in chromosome 12, RIT1 gene in chromosome 1 and RAF1 gene in chromosome 3) in five cases all had been reported to be related to hypertrophic cardiomyopathy. The reported hypertrophic cardiomyopathy relevant genes MYPN, MYH6 and MYBP3 had also been found in case 1 and 2. Patients with same gene mutation had different clinical manifestations. Both case 4 and 5 had RAF1 mutation (c.770C>T). However, case 4 had special face, low IQ, mild pulmonary artery stenosis, and only mild ventricular hypertrophy. Conclusion: Noonan syndrome is a genetic heterogeneity disease. Our study identified specific gene mutations that could result in Noonan syndrome with hypertrophic cardiomyopathy through molecular biology methods. The results emphasize the importance of gene detection in the management of Noonan syndrome.

State-related alterations of gene expression in bipolar disorder

DEFF Research Database (Denmark)

Munkholm, Klaus; Vinberg, Maj; Berk, Michael

2012-01-01

Munkholm K, Vinberg M, Berk M, Kessing LV. State-related alterations of gene expression in bipolar disorder: a systematic review. Bipolar Disord 2012: 14: 684-696. © 2012 The Authors. Journal compilation © 2012 John Wiley & Sons A/S. Objective:  Alterations in gene expression in bipolar disorder...... have been found in numerous studies. It is unclear whether such alterations are related to specific mood states. As a biphasic disorder, mood state-related alterations in gene expression have the potential to point to markers of disease activity, and trait-related alterations might indicate...... vulnerability pathways. This review therefore evaluated the evidence for whether gene expression in bipolar disorder is state or trait related. Methods:  A systematic review, using the Preferred Reporting Items for Systematic Reviews and Meta-Analysis (PRISMA) guideline for reporting systematic reviews, based...

Species-independent MicroRNA Gene Discovery

KAUST Repository

Kamanu, Timothy K.

2012-12-01

MicroRNA (miRNA) are a class of small endogenous non-coding RNA that are mainly negative transcriptional and post-transcriptional regulators in both plants and animals. Recent studies have shown that miRNA are involved in different types of cancer and other incurable diseases such as autism and Alzheimer’s. Functional miRNAs are excised from hairpin-like sequences that are known as miRNA genes. There are about 21,000 known miRNA genes, most of which have been determined using experimental methods. miRNA genes are classified into different groups (miRNA families). This study reports about 19,000 unknown miRNA genes in nine species whereby approximately 15,300 predictions were computationally validated to contain at least one experimentally verified functional miRNA product. The predictions are based on a novel computational strategy which relies on miRNA family groupings and exploits the physics and geometry of miRNA genes to unveil the hidden palindromic signals and symmetries in miRNA gene sequences. Unlike conventional computational miRNA gene discovery methods, the algorithm developed here is species-independent: it allows prediction at higher accuracy and resolution from arbitrary RNA/DNA sequences in any species and thus enables examination of repeat-prone genomic regions which are thought to be non-informative or ’junk’ sequences. The information non-redundancy of uni-directional RNA sequences compared to information redundancy of bi-directional DNA is demonstrated, a fact that is overlooked by most pattern discovery algorithms. A novel method for computing upstream and downstream miRNA gene boundaries based on mathematical/statistical functions is suggested, as well as cutoffs for annotation of miRNA genes in different miRNA families. Another tool is proposed to allow hypotheses generation and visualization of data matrices, intra- and inter-species chromosomal distribution of miRNA genes or miRNA families. Our results indicate that: miRNA and mi

Case report of novel CACNA1A gene mutation causing episodic ataxia type 2

Directory of Open Access Journals (Sweden)

David Alan Isaacs

2017-05-01

Full Text Available Background: Episodic ataxia type 2 (OMIM 108500 is an autosomal dominant channelopathy characterized by paroxysms of ataxia, vertigo, nausea, and other neurologic symptoms. More than 50 mutations of the CACNA1A gene have been discovered in families with episodic ataxia type 2, although 30%–50% of all patients with typical episodic ataxia type 2 phenotype have no detectable mutation of the CACNA1A gene. Case: A 46-year-old Caucasian man, with a long history of bouts of imbalance, vertigo, and nausea, presented to our hospital with 2 weeks of ataxia and headache. Subsequent evaluation revealed a novel mutation in the CACNA1A gene: c.1364 G > A Arg455Gln. Acetazolamide was initiated with symptomatic improvement. Conclusion: This case report expands the list of known CACNA1A mutations associated with episodic ataxia type 2.

pTRA - A reporter system for monitoring the intracellular dynamics of gene expression.

Science.gov (United States)

Wagner, Sabine G; Ziegler, Martin; Löwe, Hannes; Kremling, Andreas; Pflüger-Grau, Katharina

2018-01-01

The presence of standardised tools and methods to measure and represent accurately biological parts and functions is a prerequisite for successful metabolic engineering and crucial to understand and predict the behaviour of synthetic genetic circuits. Many synthetic gene networks are based on transcriptional circuits, thus information on transcriptional and translational activity is important for understanding and fine-tuning the synthetic function. To this end, we have developed a toolkit to analyse systematically the transcriptional and translational activity of a specific synthetic part in vivo. It is based on the plasmid pTRA and allows the assignment of specific transcriptional and translational outputs to the gene(s) of interest (GOI) and to compare different genetic setups. By this, the optimal combination of transcriptional strength and translational activity can be identified. The design is tested in a case study using the gene encoding the fluorescent mCherry protein as GOI. We show the intracellular dynamics of mRNA and protein formation and discuss the potential and shortcomings of the pTRA plasmid.

Development of a universal RNA beacon for exogenous gene detection.

Science.gov (United States)

Guo, Yuanjian; Lu, Zhongju; Cohen, Ira Stephen; Scarlata, Suzanne

2015-05-01

Stem cell therapy requires a nontoxic and high-throughput method to achieve a pure cell population to prevent teratomas that can occur if even one cell in the implant has not been transformed. A promising method to detect and separate cells expressing a particular gene is RNA beacon technology. However, developing a successful, specific beacon to a particular transfected gene can take months to develop and in some cases is impossible. Here, we report on an off-the-shelf universal beacon that decreases the time and cost of applying beacon technology to select any living cell population transfected with an exogenous gene. ©AlphaMed Press.

SCREENING OF Lr GENES PROVIDING RESISTANCE TO LEAF RUST IN WHEATH USING MULTIPLEX PCR METHOD

Directory of Open Access Journals (Sweden)

Mehmet AYBEKE

2015-12-01

Full Text Available Leaf rust is a fungal disease in wheat that causes significant decrease in yield around the world. In Turkey, several genes, including leaf rust-resistant (Lr Lr9, Lr19, Lr24 and Lr28, have been found to induce disease resistance. To obtain resistant cultivars during the breeding process, screening of these genes in various specimens is crucial. Thus, we aimed in the present study primarily to improve the multiplex polymerase chain reaction (PCR methodology by which four Lr genes could be simultaneously screened in plant samples carrying these genes. Serial PCR experiments were carried out for determination of optimal PCR conditions for each Lr gene and in all studies nursery lines were used. PCR conditions were determined as follows: 35 cycles of 95°C for denaturation (30 s, 58°C for annealing (30 s and 72°C for elongation (60 s, with an initial 94°C denaturation (3 min and a 72°C extension (30 min. The primers used in the PCR runs were as follows: Lr9F: TCCTTTTATTCCGCACGCCGG, Lr9R: CCACACTACCCCAAAGAGACG; Lr19F: CATCCTTGGGGACCTC, Lr19R: CCAGCTCGCATACATCCA; Lr24F: TCTAGTCTGTACATGGGGGC, Lr24R: TGGCACATGAACTCCATACG; Lr28F: CCCGGCATAAGTCTATGGTT, Lr28R: CAATGAATGAGATACGTGAA. We found that the optimum annealing temperature for all four genes was 61°C and extension temperatures were 62°C or 64°C. Finally, using this new PCR method, we successfully screened these genes in specimens carrying only one single Lr gene. Optimal multiplex PCR conditions were; denaturation at 94°C for 1 min, 35 extension cycles [94°C for 30 s, 57–61ºC (ideal 61°C for 30 s, and 64–68°C for 2 min] and final extension at 72°C for 30 min. In addition, we achieved positive results when running the optimised multiplex PCR tests on Lr19, Lr24 and Lr28. Future studies are planned to expand new wide multiplex PCR method to include all other Lr genes.

An Efficient Method for Identifying Gene Fusions by Targeted RNA Sequencing from Fresh Frozen and FFPE Samples.

Directory of Open Access Journals (Sweden)

Jonathan A Scolnick

Full Text Available Fusion genes are known to be key drivers of tumor growth in several types of cancer. Traditionally, detecting fusion genes has been a difficult task based on fluorescent in situ hybridization to detect chromosomal abnormalities. More recently, RNA sequencing has enabled an increased pace of fusion gene identification. However, RNA-Seq is inefficient for the identification of fusion genes due to the high number of sequencing reads needed to detect the small number of fusion transcripts present in cells of interest. Here we describe a method, Single Primer Enrichment Technology (SPET, for targeted RNA sequencing that is customizable to any target genes, is simple to use, and efficiently detects gene fusions. Using SPET to target 5701 exons of 401 known cancer fusion genes for sequencing, we were able to identify known and previously unreported gene fusions from both fresh-frozen and formalin-fixed paraffin-embedded (FFPE tissue RNA in both normal tissue and cancer cells.

Identification of a novel CLRN1 gene mutation in Usher syndrome type 3: two case reports.

Science.gov (United States)

Yoshimura, Hidekane; Oshikawa, Chie; Nakayama, Jun; Moteki, Hideaki; Usami, Shin-Ichi

2015-05-01

This study examines the CLRN1 gene mutation analysis in Japanese patients who were diagnosed with Usher syndrome type 3 (USH3) on the basis of clinical findings. Genetic analysis using massively parallel DNA sequencing (MPS) was conducted to search for 9 causative USH genes in 2 USH3 patients. We identified the novel pathogenic mutation in the CLRN1 gene in 2 patients. The missense mutation was confirmed by functional prediction software and segregation analysis. Both patients were diagnosed as having USH3 caused by the CLRN1 gene mutation. This is the first report of USH3 with a CLRN1 gene mutation in Asian populations. Validating the presence of clinical findings is imperative for properly differentiating among USH subtypes. In addition, mutation screening using MPS enables the identification of causative mutations in USH. The clinical diagnosis of this phenotypically variable disease can then be confirmed. © The Author(s) 2015.

Novel radiosynthesis of PET HSV-tk gene reporter probes [18F]FHPG and [18F]FHBG employing dual Sep-Pak SPE techniques.

Science.gov (United States)

Wang, Ji-Quan; Zheng, Qi-Huang; Fei, Xiangshu; Mock, Bruce H; Hutchins, Gary D

2003-11-17

Positron emission tomography (PET) herpes simplex virus thymidine kinase (HSV-tk) gene reporter probes 9-[(3-[(18)F]fluoro-1-hydroxy-2-propoxy)methyl]guanine ([(18)F]FHPG) and 9-(4-[(18)F]fluoro-3-hydroxymethylbutyl)guanine ([(18)F]FHBG) were prepared by nucleophilic substitution of the appropriate tosylated precursors with [(18)F]KF/Kryptofix 2.2.2 followed by a quick deprotection reaction and purification with a simplified dual Silica Sep-Pak solid-phase extraction (SPE) method in 15-30% radiochemical yield.

Dual-therapeutic reporter genes fusion for enhanced cancer gene therapy and imaging.

Science.gov (United States)

Sekar, T V; Foygel, K; Willmann, J K; Paulmurugan, R

2013-05-01

Two of the successful gene-directed enzyme prodrug therapies include herpes simplex virus-thymidine kinase (HSV1-TK) enzyme-ganciclovir prodrug and the Escherichia coli nitroreductase (NTR) enzyme-CB1954 prodrug strategies; these enzyme-prodrug combinations produce activated cytotoxic metabolites of the prodrugs capable of tumor cell death by inhibiting DNA synthesis and killing quiescent cells, respectively. Both these strategies also affect significant bystander cell killing of neighboring tumor cells that do not express these enzymes. We have developed a dual-combination gene strategy, where we identified HSV1-TK and NTR fused in a particular orientation can effectively kill tumor cells when the tumor cells are treated with a fusion HSV1-TK-NTR gene- along with a prodrug combination of GCV and CB1954. In order to determine whether the dual-system demonstrate superior therapeutic efficacy than either HSV1-TK or NTR systems alone, we conducted both in vitro and in vivo tumor xenograft studies using triple negative SUM159 breast cancer cells, by evaluating the efficacy of cell death by apoptosis and necrosis upon treatment with the dual HSV1-TK genes-GCV-CB1954 prodrugs system, and compared the efficiency to HSV1-TK-GCV and NTR-CB1954. Our cell-based studies, tumor regression studies in xenograft mice, histological analyses of treated tumors and bystander studies indicate that the dual HSV1-TK-NTR-prodrug system is two times more efficient even with half the doses of both prodrugs than the respective single gene-prodrug system, as evidenced by enhanced apoptosis and necrosis of tumor cells in vitro in culture and xenograft of tumor tissues in animals.

Gene assembly via one-pot chemical ligation of DNA promoted by DNA nanostructures

DEFF Research Database (Denmark)

Manuguerra, Ilenia; Croce, Stefano; El-Sagheer, Afaf H.

2018-01-01

Current gene synthesis methods are driven by enzymatic reactions. Here we report the one-pot synthesis of a chemically-ligated gene from 14 oligonucleotides. The chemical ligation benefits from the highly efficient click chemistry approach templated by DNA nanostructures, and produces modified DNA...

Prioritization of candidate disease genes by combining topological similarity and semantic similarity.

Science.gov (United States)

Liu, Bin; Jin, Min; Zeng, Pan

2015-10-01

The identification of gene-phenotype relationships is very important for the treatment of human diseases. Studies have shown that genes causing the same or similar phenotypes tend to interact with each other in a protein-protein interaction (PPI) network. Thus, many identification methods based on the PPI network model have achieved good results. However, in the PPI network, some interactions between the proteins encoded by candidate gene and the proteins encoded by known disease genes are very weak. Therefore, some studies have combined the PPI network with other genomic information and reported good predictive performances. However, we believe that the results could be further improved. In this paper, we propose a new method that uses the semantic similarity between the candidate gene and known disease genes to set the initial probability vector of a random walk with a restart algorithm in a human PPI network. The effectiveness of our method was demonstrated by leave-one-out cross-validation, and the experimental results indicated that our method outperformed other methods. Additionally, our method can predict new causative genes of multifactor diseases, including Parkinson's disease, breast cancer and obesity. The top predictions were good and consistent with the findings in the literature, which further illustrates the effectiveness of our method. Copyright © 2015 Elsevier Inc. All rights reserved.

A family with hereditary hemochromatosis carrying HFE gene splice site mutation: a case report

Directory of Open Access Journals (Sweden)

NING Huibin

2017-01-01

Full Text Available ObjectiveTo investigate a new type of HFE gene mutation in a family with hereditary hemochromatosis (HH. MethodsThe analysis of HFE gene was performed for one patient with a confirmed diagnosis of HH and five relatives. Blood genomic DNA was extracted and PCR multiplication was performed for the exon and intron splice sequences of related HFE, HJV, HAMP, transferrin receptor 2 (TfR2, and SLC40A1 genes. After agarose gel electrophoresis and purification, bi-directional direct sequencing was performed to detect mutation sites. ResultsThe proband had abnormal liver function and increases in serum iron, total iron binding capacity, serum ferritin, and transferrin saturation, as well as T→C homozygous mutation in the fourth base of intron 2 in the intervening sequence of the exon EXON2 of HFE gene (IVs 2+4T→C, C/C homozygous, splicing, abnormal. There were no abnormalities in HJV, HAMP, TfR2, and SLC40A1 genes. The proband′s son had the same homozygous mutation, three relatives had heterozygous mutations, and one relative had no abnormal mutations. ConclusionGene detection plays an important role in the diagnosis of hemochromatosis, and IVs 2+4T→C mutation may be a new pathogenic mutation for HH in China.

A flood-based information flow analysis and network minimization method for gene regulatory networks.

Science.gov (United States)

Pavlogiannis, Andreas; Mozhayskiy, Vadim; Tagkopoulos, Ilias

2013-04-24

Biological networks tend to have high interconnectivity, complex topologies and multiple types of interactions. This renders difficult the identification of sub-networks that are involved in condition- specific responses. In addition, we generally lack scalable methods that can reveal the information flow in gene regulatory and biochemical pathways. Doing so will help us to identify key participants and paths under specific environmental and cellular context. This paper introduces the theory of network flooding, which aims to address the problem of network minimization and regulatory information flow in gene regulatory networks. Given a regulatory biological network, a set of source (input) nodes and optionally a set of sink (output) nodes, our task is to find (a) the minimal sub-network that encodes the regulatory program involving all input and output nodes and (b) the information flow from the source to the sink nodes of the network. Here, we describe a novel, scalable, network traversal algorithm and we assess its potential to achieve significant network size reduction in both synthetic and E. coli networks. Scalability and sensitivity analysis show that the proposed method scales well with the size of the network, and is robust to noise and missing data. The method of network flooding proves to be a useful, practical approach towards information flow analysis in gene regulatory networks. Further extension of the proposed theory has the potential to lead in a unifying framework for the simultaneous network minimization and information flow analysis across various "omics" levels.

Gene prediction using the Self-Organizing Map: automatic generation of multiple gene models.

Science.gov (United States)

Mahony, Shaun; McInerney, James O; Smith, Terry J; Golden, Aaron

2004-03-05

Many current gene prediction methods use only one model to represent protein-coding regions in a genome, and so are less likely to predict the location of genes that have an atypical sequence composition. It is likely that future improvements in gene finding will involve the development of methods that can adequately deal with intra-genomic compositional variation. This work explores a new approach to gene-prediction, based on the Self-Organizing Map, which has the ability to automatically identify multiple gene models within a genome. The current implementation, named RescueNet, uses relative synonymous codon usage as the indicator of protein-coding potential. While its raw accuracy rate can be less than other methods, RescueNet consistently identifies some genes that other methods do not, and should therefore be of interest to gene-prediction software developers and genome annotation teams alike. RescueNet is recommended for use in conjunction with, or as a complement to, other gene prediction methods.

A powerful nonparametric method for detecting differentially co-expressed genes: distance correlation screening and edge-count test.

Science.gov (United States)

Zhang, Qingyang

2018-05-16

Differential co-expression analysis, as a complement of differential expression analysis, offers significant insights into the changes in molecular mechanism of different phenotypes. A prevailing approach to detecting differentially co-expressed genes is to compare Pearson's correlation coefficients in two phenotypes. However, due to the limitations of Pearson's correlation measure, this approach lacks the power to detect nonlinear changes in gene co-expression which is common in gene regulatory networks. In this work, a new nonparametric procedure is proposed to search differentially co-expressed gene pairs in different phenotypes from large-scale data. Our computational pipeline consisted of two main steps, a screening step and a testing step. The screening step is to reduce the search space by filtering out all the independent gene pairs using distance correlation measure. In the testing step, we compare the gene co-expression patterns in different phenotypes by a recently developed edge-count test. Both steps are distribution-free and targeting nonlinear relations. We illustrate the promise of the new approach by analyzing the Cancer Genome Atlas data and the METABRIC data for breast cancer subtypes. Compared with some existing methods, the new method is more powerful in detecting nonlinear type of differential co-expressions. The distance correlation screening can greatly improve computational efficiency, facilitating its application to large data sets.

Gene Dosage Analysis in a Clinical Environment: Gene-Targeted Microarrays as the Platform-of-Choice

Directory of Open Access Journals (Sweden)

Donald R. Love

2013-03-01

Full Text Available The role of gene deletion and duplication in the aetiology of disease has become increasingly evident over the last decade. In addition to the classical deletion/duplication disorders diagnosed using molecular techniques, such as Duchenne Muscular Dystrophy and Charcot-Marie-Tooth Neuropathy Type 1A, the significance of partial or whole gene deletions in the pathogenesis of a large number single-gene disorders is becoming more apparent. A variety of dosage analysis methods are available to the diagnostic laboratory but the widespread application of many of these techniques is limited by the expense of the kits/reagents and restrictive targeting to a particular gene or portion of a gene. These limitations are particularly important in the context of a small diagnostic laboratory with modest sample throughput. We have developed a gene-targeted, custom-designed comparative genomic hybridisation (CGH array that allows twelve clinical samples to be interrogated simultaneously for exonic deletions/duplications within any gene (or panel of genes on the array. We report here on the use of the array in the analysis of a series of clinical samples processed by our laboratory over a twelve-month period. The array has proven itself to be robust, flexible and highly suited to the diagnostic environment.

Promoter Boundaries for the luxCDABE and betIBA-proXWV Operons in Vibrio harveyi Defined by the Method Rapid Arbitrary PCR Insertion Libraries (RAIL).

Science.gov (United States)

Hustmyer, Christine M; Simpson, Chelsea A; Olney, Stephen G; Rusch, Douglas B; Bochman, Matthew L; van Kessel, Julia C

2018-06-01

Experimental studies of transcriptional regulation in bacteria require the ability to precisely measure changes in gene expression, often accomplished through the use of reporter genes. However, the boundaries of promoter sequences required for transcription are often unknown, thus complicating the construction of reporters and genetic analysis of transcriptional regulation. Here, we analyze reporter libraries to define the promoter boundaries of the luxCDABE bioluminescence operon and the betIBA-proXWV osmotic stress operon in Vibrio harveyi We describe a new method called r apid a rbitrary PCR i nsertion l ibraries (RAIL) that combines the power of arbitrary PCR and isothermal DNA assembly to rapidly clone promoter fragments of various lengths upstream of reporter genes to generate large libraries. To demonstrate the versatility and efficiency of RAIL, we analyzed the promoters driving expression of the luxCDABE and betIBA-proXWV operons and created libraries of DNA fragments from these loci fused to fluorescent reporters. Using flow cytometry sorting and deep sequencing, we identified the DNA regions necessary and sufficient for maximum gene expression for each promoter. These analyses uncovered previously unknown regulatory sequences and validated known transcription factor binding sites. We applied this high-throughput method to gfp , mCherry , and lacZ reporters and multiple promoters in V. harveyi We anticipate that the RAIL method will be easily applicable to other model systems for genetic, molecular, and cell biological applications. IMPORTANCE Gene reporter constructs have long been essential tools for studying gene regulation in bacteria, particularly following the recent advent of fluorescent gene reporters. We developed a new method that enables efficient construction of promoter fusions to reporter genes to study gene regulation. We demonstrate the versatility of this technique in the model bacterium Vibrio harveyi by constructing promoter libraries

Principal Angle Enrichment Analysis (PAEA): Dimensionally Reduced Multivariate Gene Set Enrichment Analysis Tool.

Science.gov (United States)

Clark, Neil R; Szymkiewicz, Maciej; Wang, Zichen; Monteiro, Caroline D; Jones, Matthew R; Ma'ayan, Avi

2015-11-01

Gene set analysis of differential expression, which identifies collectively differentially expressed gene sets, has become an important tool for biology. The power of this approach lies in its reduction of the dimensionality of the statistical problem and its incorporation of biological interpretation by construction. Many approaches to gene set analysis have been proposed, but benchmarking their performance in the setting of real biological data is difficult due to the lack of a gold standard. In a previously published work we proposed a geometrical approach to differential expression which performed highly in benchmarking tests and compared well to the most popular methods of differential gene expression. As reported, this approach has a natural extension to gene set analysis which we call Principal Angle Enrichment Analysis (PAEA). PAEA employs dimensionality reduction and a multivariate approach for gene set enrichment analysis. However, the performance of this method has not been assessed nor its implementation as a web-based tool. Here we describe new benchmarking protocols for gene set analysis methods and find that PAEA performs highly. The PAEA method is implemented as a user-friendly web-based tool, which contains 70 gene set libraries and is freely available to the community.

Computational method for discovery of estrogen responsive genes

DEFF Research Database (Denmark)

Tang, Suisheng; Tan, Sin Lam; Ramadoss, Suresh Kumar

2004-01-01

Estrogen has a profound impact on human physiology and affects numerous genes. The classical estrogen reaction is mediated by its receptors (ERs), which bind to the estrogen response elements (EREs) in target gene's promoter region. Due to tedious and expensive experiments, a limited number of hu...

Heterologous expression of mannanase and developing a new Reporter gene system in Lactobacillus casei and Escherichia coli

DEFF Research Database (Denmark)

Lin, Jinzhong; Zou, Yexia; Ma, Chengjie

2015-01-01

Reporter gene systems are useful for studying bacterial molecular biology, including the regulation of gene expression and the histochemical analysis of protein products. Here, two genes, β-1,4-mannanase (manB) from Bacillus pumilus and β-glucuronidase (gusA) from Escherichia coli K12, were clone....... casei and E.coli....

A statistical method for predicting splice variants between two groups of samples using GeneChip® expression array data

Directory of Open Access Journals (Sweden)

Olson James M

2006-04-01

Full Text Available Abstract Background Alternative splicing of pre-messenger RNA results in RNA variants with combinations of selected exons. It is one of the essential biological functions and regulatory components in higher eukaryotic cells. Some of these variants are detectable with the Affymetrix GeneChip® that uses multiple oligonucleotide probes (i.e. probe set, since the target sequences for the multiple probes are adjacent within each gene. Hybridization intensity from a probe correlates with abundance of the corresponding transcript. Although the multiple-probe feature in the current GeneChip® was designed to assess expression values of individual genes, it also measures transcriptional abundance for a sub-region of a gene sequence. This additional capacity motivated us to develop a method to predict alternative splicing, taking advance of extensive repositories of GeneChip® gene expression array data. Results We developed a two-step approach to predict alternative splicing from GeneChip® data. First, we clustered the probes from a probe set into pseudo-exons based on similarity of probe intensities and physical adjacency. A pseudo-exon is defined as a sequence in the gene within which multiple probes have comparable probe intensity values. Second, for each pseudo-exon, we assessed the statistical significance of the difference in probe intensity between two groups of samples. Differentially expressed pseudo-exons are predicted to be alternatively spliced. We applied our method to empirical data generated from GeneChip® Hu6800 arrays, which include 7129 probe sets and twenty probes per probe set. The dataset consists of sixty-nine medulloblastoma (27 metastatic and 42 non-metastatic samples and four cerebellum samples as normal controls. We predicted that 577 genes would be alternatively spliced when we compared normal cerebellum samples to medulloblastomas, and predicted that thirteen genes would be alternatively spliced when we compared metastatic

Diagnosis of Neisseria gonorrhoeae among pregnant women by culture method and PCR on cppB gene

Directory of Open Access Journals (Sweden)

Jalal Mardaneh

2013-11-01

Full Text Available Background: Neisseria gonorrhoeae is a human obligate pathogen and the etiological agent of gonorrhea. Health irreparable complications resulting from gonorrhea disease occur mainly in pregnant women and neonates. Aim of this study was diagnosis of Neisseria gonorrhoeae among pregnant women with using culture and molecular method by amplification of cppB gene with PCR. Material and Methods: In this cross-sectional study, two endocervical swab specimens were obtained from 1100 pregnant women who referred to Shiraz Hospitals. Culture on nonselective and selective media and nucleic acid amplification test (NAAT were performed for detection of Neisseria gonorrhoeae cppB gene. Results: All endocervical swabs cultures on selective and nonselective media were negative for Neisseria gonorrhoeae. Among examined endocervical swabs, 13samples (1.18% were positive by nucleic acid amplification of Neisseria gonorrgoeae cppB gene. Conclusion: Negative results of culture and positive results of PCR in this study indicate that however culture is gold standard method for detection of Neisseria gonorrhoeae but due to bacterial autolysis, poor sampling techniques and improper specimen storage and transport, its value decline as compared with Nucleic acid amplification test (NAAT.

Gene Electrotransfer to Skin; Review of Existing Literature and Clinical Perspectives

DEFF Research Database (Denmark)

Gothelf, A.; Gehl, Julie

2010-01-01

Gene electrotransfer, which designates the combination of gene transfer and electroporation, is a non-viral means for transfecting genes into cells and tissues. It is a safe and efficient method and reports regarding the use of this technique in a variety of animal models and organs have been...... to now more than 40 papers have been published in which gene electrotransfer was the technique used for gene transfection to skin in vivo. The aim of this review is to summarize which plasmids were injected and the electrical parameters applied. Furthermore an overview of the clinical perspectives...

Evaluation of transcriptional activity of the oestrogen receptor with sodium iodide symporter as an imaging reporter gene.

Science.gov (United States)

Kang, Joo Hyun; Chung, June-Key; Lee, Yong Jin; Kim, Kwang Il; Jeong, Jae Min; Lee, Dong Soo; Lee, Myung Chul

2006-10-01

Oestrogen receptors are ligand-dependent transcription factors whose activity is modulated either by oestrogens or by an alternative signalling pathway. Oestrogen receptors interact via a specific DNA-binding domain, the oestrogen responsive element (ERE), in the promoter region of sensitive genes. This binding leads to an initiation of gene expression and hormonal effects. To determine the transcriptional activity of the oestrogen receptor, we developed a molecular imaging system using sodium iodide symporter (NIS) as a reporter gene. The NIS reporter gene was placed under the control of an artificial ERE derived from pERE-TA-SEAP and named as pERE-NIS. pERE-NIS was transferred to MCF-7, human breast cancer cells, which highly expressed oestrogen receptor-alpha with lipofectamine. Stably expressing cells were generated by selection with G418 for 14 days. After treatment of 17beta-oestradiol and tamoxifen with serial doses, the (125)I uptake was measured for the determination of NIS expression. The inhibition of NIS activity was performed with 50 micromol x l(-1) potassium perchlorate. The MCF7/pERE-NIS treated with 17beta-oestradiol accumulated (125)I up to 70-80% higher than did non-treated cells. NIS expression was increased according to increasing doses of 17beta-oestradiol. MCF7/pERE-NIS treated with tamoxifen also accumulated (125)I up to 50% higher than did non-treated cells. Potassium perchlorate completely inhibited (125)I uptake. When MDA-MB231 cells, the oestrogen receptor-negative breast cancer cells, were transfected with pERE-NIS, (125)I uptake of MDA-MB-231/pERE-NIS did not increase. This pERE-NIS reporter system is sufficiently sensitive for monitoring transcriptional activity of the oestrogen receptor. Therefore, cis-enhancer reporter systems with ERE will be applicable to the development of a novel selective oestrogen receptor modulator with low toxicity and high efficacy.

A Shortest-Path-Based Method for the Analysis and Prediction of Fruit-Related Genes in Arabidopsis thaliana.

Science.gov (United States)

Zhu, Liucun; Zhang, Yu-Hang; Su, Fangchu; Chen, Lei; Huang, Tao; Cai, Yu-Dong

2016-01-01

Biologically, fruits are defined as seed-bearing reproductive structures in angiosperms that develop from the ovary. The fertilization, development and maturation of fruits are crucial for plant reproduction and are precisely regulated by intrinsic genetic regulatory factors. In this study, we used Arabidopsis thaliana as a model organism and attempted to identify novel genes related to fruit-associated biological processes. Specifically, using validated genes, we applied a shortest-path-based method to identify several novel genes in a large network constructed using the protein-protein interactions observed in Arabidopsis thaliana. The described analyses indicate that several of the discovered genes are associated with fruit fertilization, development and maturation in Arabidopsis thaliana.

Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli

Science.gov (United States)

Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger

2015-10-01

To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work

Enhancement of gene expression under hypoxic conditions using fragments of the human vascular endothelial growth factor and the erythropoietin genes

International Nuclear Information System (INIS)

Shibata, Toru; Akiyama, Nobutake; Noda, Makoto; Sasai, Keisuke; Hiraoka, Masahiro

1998-01-01

Purpose: Selective gene expression in response to tumor hypoxia may provide new avenues, not only for radiotherapy and chemotherapy, but also for gene therapy. In this study, we have assessed the extent of hypoxia responsiveness of various DNA constructs by the luciferase assay to help design vectors suitable for cancer therapy. Materials and Methods: Reporter plasmids were constructed with fragments of the human vascular endothelial growth factor (VEGF) and the erythropoietin (Epo) genes encompassing the putative hypoxia-responsive elements (HRE) and the pGL3 promoter vector. Test plasmids and the control pRL-CMV plasmid were cotransfected into tumor cells by the calcium phosphate method. After 6 h hypoxic treatment, the reporter assay was performed. Results: The construct pGL3/VEGF containing the 385 bp fragment of the 5' flanking region in human VEGF gene showed significant increases in luciferase activity in response to hypoxia. The hypoxic/aerobic ratios were about 3-4, and 8-12 for murine and human tumor cells, respectively. Despite the very high degree of conservation among the HREs of mammalian VEGF genes, murine cells showed lower responsiveness than human cells. We next tested the construct pGL3/Epo containing the 150 bp fragment of the 3' flanking region in the Epo gene. Luciferase activity of pGL3/Epo was increased with hypoxia only in human cell lines. The insertion of 5 copies of the 35-bp fragments derived from the VEGF HREs and 32 bp of the E1b minimal promoter resulted in maximal enhancement of hypoxia responsiveness. Conclusions: The constructs with VEGF or Epo fragments containing HRE may be useful for inducing specific gene expression in hypoxic cells. Especially, the application of multiple copies of the HREs and an E1b minimal promoter appears to have the advantage of great improvement in hypoxia responsiveness

Development of a one-step gene knock-out and knock-in method for metabolic engineering of Aureobasidium pullulans.

Science.gov (United States)

Guo, Jian; Wang, Yuanhua; Li, Baozhong; Huang, Siyao; Chen, Yefu; Guo, Xuewu; Xiao, Dongguang

2017-06-10

Aureobasidium pullulans is an increasingly attractive host for bio-production of pullulan, heavy oil, polymalic acid, and a large spectrum of extracellular enzymes. To date, genetic manipulation of A. pullulans mainly relies on time-consuming conventional restriction enzyme digestion and ligation methods. In this study, we present a one-step homologous recombination-based method for rapid genetic manipulation in A. pullulans. Overlaps measuring >40bp length and 10μg DNA segments for homologous recombination provided maximum benefits to transformation of A. pullulans. This optimized method was successfully applied to PKSIII gene (encodes polyketide synthase) knock-out and gltP gene (encodes glycolipid transfer protein) knock-in. After disruption of PKSIII gene, secretion of melanin decreased slightly. The melanin purified from disruptant showed lower reducing capacity compared with that of the parent strain, leading to a decrease in exopolysaccharide production. Knock-in of gltP gene resulted in at least 4.68-fold increase in heavy oil production depending on the carbon source used, indicating that gltP can regulate heavy oil synthesis in A. pullulans. Copyright © 2017 Elsevier B.V. All rights reserved.

Robust variable selection method for nonparametric differential equation models with application to nonlinear dynamic gene regulatory network analysis.

Science.gov (United States)

Lu, Tao

2016-01-01

The gene regulation network (GRN) evaluates the interactions between genes and look for models to describe the gene expression behavior. These models have many applications; for instance, by characterizing the gene expression mechanisms that cause certain disorders, it would be possible to target those genes to block the progress of the disease. Many biological processes are driven by nonlinear dynamic GRN. In this article, we propose a nonparametric differential equation (ODE) to model the nonlinear dynamic GRN. Specially, we address following questions simultaneously: (i) extract information from noisy time course gene expression data; (ii) model the nonlinear ODE through a nonparametric smoothing function; (iii) identify the important regulatory gene(s) through a group smoothly clipped absolute deviation (SCAD) approach; (iv) test the robustness of the model against possible shortening of experimental duration. We illustrate the usefulness of the model and associated statistical methods through a simulation and a real application examples.

Barcoded DNA-tag reporters for multiplex cis-regulatory analysis.

Directory of Open Access Journals (Sweden)

Jongmin Nam

Full Text Available Cis-regulatory DNA sequences causally mediate patterns of gene expression, but efficient experimental analysis of these control systems has remained challenging. Here we develop a new version of "barcoded" DNA-tag reporters, "Nanotags" that permit simultaneous quantitative analysis of up to 130 distinct cis-regulatory modules (CRMs. The activities of these reporters are measured in single experiments by the NanoString RNA counting method and other quantitative procedures. We demonstrate the efficiency of the Nanotag method by simultaneously measuring hourly temporal activities of 126 CRMs from 46 genes in the developing sea urchin embryo, otherwise a virtually impossible task. Nanotags are also used in gene perturbation experiments to reveal cis-regulatory responses of many CRMs at once. Nanotag methodology can be applied to many research areas, ranging from gene regulatory networks to functional and evolutionary genomics.

Constructing an integrated gene similarity network for the identification of disease genes.

Science.gov (United States)

Tian, Zhen; Guo, Maozu; Wang, Chunyu; Xing, LinLin; Wang, Lei; Zhang, Yin

2017-09-20

Discovering novel genes that are involved human diseases is a challenging task in biomedical research. In recent years, several computational approaches have been proposed to prioritize candidate disease genes. Most of these methods are mainly based on protein-protein interaction (PPI) networks. However, since these PPI networks contain false positives and only cover less half of known human genes, their reliability and coverage are very low. Therefore, it is highly necessary to fuse multiple genomic data to construct a credible gene similarity network and then infer disease genes on the whole genomic scale. We proposed a novel method, named RWRB, to infer causal genes of interested diseases. First, we construct five individual gene (protein) similarity networks based on multiple genomic data of human genes. Then, an integrated gene similarity network (IGSN) is reconstructed based on similarity network fusion (SNF) method. Finally, we employee the random walk with restart algorithm on the phenotype-gene bilayer network, which combines phenotype similarity network, IGSN as well as phenotype-gene association network, to prioritize candidate disease genes. We investigate the effectiveness of RWRB through leave-one-out cross-validation methods in inferring phenotype-gene relationships. Results show that RWRB is more accurate than state-of-the-art methods on most evaluation metrics. Further analysis shows that the success of RWRB is benefited from IGSN which has a wider coverage and higher reliability comparing with current PPI networks. Moreover, we conduct a comprehensive case study for Alzheimer's disease and predict some novel disease genes that supported by literature. RWRB is an effective and reliable algorithm in prioritizing candidate disease genes on the genomic scale. Software and supplementary information are available at http://nclab.hit.edu.cn/~tianzhen/RWRB/ .

Core seismic methods verification report

International Nuclear Information System (INIS)

Olsen, B.E.; Shatoff, H.D.; Rakowski, J.E.; Rickard, N.D.; Thompson, R.W.; Tow, D.; Lee, T.H.

1979-12-01

This report presents the description and validation of the analytical methods for calculation of the seismic loads on an HTGR core and the core support structures. Analytical modeling, integration schemes, parameter assignment, parameter sensitivity, and correlation with test data are key topics which have been covered in detail. Much of the text concerns the description and the results of a series of scale model tests performed to obtain data for code correlation. A discussion of scaling laws, model properties, seismic excitation, instrumentation, and data reduction methods is also presented, including a section on the identification and calculation of statistical errors in the test data

Glycoprotein is enough for sindbis virus-derived DNA vector to express heterogenous genes

Directory of Open Access Journals (Sweden)

Fu Juanjuan

2011-07-01

Full Text Available Abstract To investigate the necessity and potential application of structural genes for expressing heterogenous genes from Sindbis virus-derived vector, the DNA-based expression vector pVaXJ was constructed by placing the recombinant genome of sindbis-like virus XJ-160 under the control of the human cytomegalovirus (CMV promoter of the plasmid pVAX1, in which viral structural genes were replaced by a polylinker cassette to allow for insertion of heterologous genes. The defect helper plasmids pVaE or pVaC were developed by cloning the gene of glycoprotein E3E26KE1 or capsid protein of XJ-160 virus into pVAX1, respectively. The report gene cassette pVaXJ-EGFP or pV-Gluc expressing enhanced green fluorescence protein (EGFP or Gaussia luciferase (G.luc were constructed by cloning EGFP or G.luc gene into pVaXJ. EGFP or G.luc was expressed in the BHK-21 cells co-transfected with report gene cassettes and pVaE at levels that were comparable to those produced by report gene cassettes, pVaC and pVaE and were much higher than the levels produced by report gene cassette and pVaC, suggesting that glycoprotein is enough for Sindbis virus-derived DNA vector to express heterogenous genes in host cells. The method of gene expression from Sindbis virus-based DNA vector only co-transfected with envelop E gene increase the conveniency and the utility of alphavirus-based vector systems in general.

A novel mutation in the SH3BP2 gene causes cherubism: case report

Directory of Open Access Journals (Sweden)

Yu Shi-Feng

2006-12-01

Full Text Available Abstract Background Cherubism is a rare hereditary multi-cystic disease of the jaws, characterized by its typical appearance in early childhood, and stabilization and remission after puberty. It is genetically transmitted in an autosomal dominant fashion and the gene coding for SH3-binding protein 2 (SH3BP2 may be involved. Case presentation We investigated a family consisting of 21 members with 3 female affected individuals with cherubism from Northern China. Of these 21 family members, 17 were recruited for the genetic analysis. We conducted the direct sequence analysis of the SH3BP2 gene among these 17 family members. A disease-causing mutation was identified in exon 9 of the gene. It was an A1517G base change, which leads to a D419G amino acid substitution. Conclusion To our knowledge, the A1517G mutation has not been reported previously in cherubism. This finding is novel.

A new type of gene-disruption cassette with a rescue gene for Pichia pastoris.

Science.gov (United States)

Shibui, Tatsuro; Hara, Hiroyoshi

2017-09-01

Pichia pastoris has been used for the production of many recombinant proteins, and many useful mutant strains have been created. However, the efficiency of mutant isolation by gene-targeting is usually low and the procedure is difficult for those inexperienced in yeast genetics. In order to overcome these issues, we developed a new gene-disruption system with a rescue gene using an inducible Cre/mutant-loxP system. With only short homology regions, the gene-disruption cassette of the system replaces its target-gene locus containing a mutation with a compensatory rescue gene. As the cassette contains the AOX1 promoter-driven Cre gene, when targeted strains are grown on media containing methanol, the DNA fragment, i.e., the marker, rescue and Cre genes, between the mutant-loxP sequences in the cassette is excised, leaving only the remaining mutant-loxP sequence in the genome, and consequently a target gene-disrupted mutant can be isolated. The system was initially validated on ADE2 gene disruption, where the disruption can easily be detected by color-change of the colonies. Then, the system was applied for knocking-out URA3 and OCH1 genes, reported to be difficult to accomplish by conventional gene-targeting methods. All three gene-disruption cassettes with their rescue genes replaced their target genes, and the Cre/mutant-loxP system worked well to successfully isolate their knock-out mutants. This study identified a new gene-disruption system that could be used to effectively and strategically knock out genes of interest, especially whose deletion is detrimental to growth, without using special strains, e.g., deficient in nonhomologous end-joining, in P. pastoris. © 2017 American Institute of Chemical Engineers Biotechnol. Prog., 33:1201-1208, 2017. © 2017 American Institute of Chemical Engineers.

Gene therapy prospects--intranasal delivery of therapeutic genes.

Science.gov (United States)

Podolska, Karolina; Stachurska, Anna; Hajdukiewicz, Karolina; Małecki, Maciej

2012-01-01

Gene therapy is recognized to be a novel method for the treatment of various disorders. Gene therapy strategies involve gene manipulation on broad biological processes responsible for the spreading of diseases. Cancer, monogenic diseases, vascular and infectious diseases are the main targets of gene therapy. In order to obtain valuable experimental and clinical results, sufficient gene transfer methods are required. Therapeutic genes can be administered into target tissues via gene carriers commonly defined as vectors. The retroviral, adenoviral and adeno-associated virus based vectors are most frequently used in the clinic. So far, gene preparations may be administered directly into target organs or by intravenous, intramuscular, intratumor or intranasal injections. It is common knowledge that the number of gene therapy clinical trials has rapidly increased. However, some limitations such as transfection efficiency and stable and long-term gene expression are still not resolved. Consequently, great effort is focused on the evaluation of new strategies of gene delivery. There are many expectations associated with intranasal delivery of gene preparations for the treatment of diseases. Intranasal delivery of therapeutic genes is regarded as one of the most promising forms of pulmonary gene therapy research. Gene therapy based on inhalation of gene preparations offers an alternative way for the treatment of patients suffering from such lung diseases as cystic fibrosis, alpha-1-antitrypsin defect, or cancer. Experimental and first clinical trials based on plasmid vectors or recombinant viruses have revealed that gene preparations can effectively deliver therapeutic or marker genes to the cells of the respiratory tract. The noninvasive intranasal delivery of gene preparations or conventional drugs seems to be very encouraging, although basic scientific research still has to continue.

Calculation of evolutionary correlation between individual genes and full-length genome: a method useful for choosing phylogenetic markers for molecular epidemiology.

Directory of Open Access Journals (Sweden)

Shuai Wang

Full Text Available Individual genes or regions are still commonly used to estimate the phylogenetic relationships among viral isolates. The genomic regions that can faithfully provide assessments consistent with those predicted with full-length genome sequences would be preferable to serve as good candidates of the phylogenetic markers for molecular epidemiological studies of many viruses. Here we employed a statistical method to evaluate the evolutionary relationships between individual viral genes and full-length genomes without tree construction as a way to determine which gene can match the genome well in phylogenetic analyses. This method was performed by calculation of linear correlations between the genetic distance matrices of aligned individual gene sequences and aligned genome sequences. We applied this method to the phylogenetic analyses of porcine circovirus 2 (PCV2, measles virus (MV, hepatitis E virus (HEV and Japanese encephalitis virus (JEV. Phylogenetic trees were constructed for comparisons and the possible factors affecting the method accuracy were also discussed in the calculations. The results revealed that this method could produce results consistent with those of previous studies about the proper consensus sequences that could be successfully used as phylogenetic markers. And our results also suggested that these evolutionary correlations could provide useful information for identifying genes that could be used effectively to infer the genetic relationships.

A quantitative comparison of cell-type-specific microarray gene expression profiling methods in the mouse brain.

Directory of Open Access Journals (Sweden)

Benjamin W Okaty

Full Text Available Expression profiling of restricted neural populations using microarrays can facilitate neuronal classification and provide insight into the molecular bases of cellular phenotypes. Due to the formidable heterogeneity of intermixed cell types that make up the brain, isolating cell types prior to microarray processing poses steep technical challenges that have been met in various ways. These methodological differences have the potential to distort cell-type-specific gene expression profiles insofar as they may insufficiently filter out contaminating mRNAs or induce aberrant cellular responses not normally present in vivo. Thus we have compared the repeatability, susceptibility to contamination from off-target cell-types, and evidence for stress-responsive gene expression of five different purification methods--Laser Capture Microdissection (LCM, Translating Ribosome Affinity Purification (TRAP, Immunopanning (PAN, Fluorescence Activated Cell Sorting (FACS, and manual sorting of fluorescently labeled cells (Manual. We found that all methods obtained comparably high levels of repeatability, however, data from LCM and TRAP showed significantly higher levels of contamination than the other methods. While PAN samples showed higher activation of apoptosis-related, stress-related and immediate early genes, samples from FACS and Manual studies, which also require dissociated cells, did not. Given that TRAP targets actively translated mRNAs, whereas other methods target all transcribed mRNAs, observed differences may also reflect translational regulation.

Comparison of neuronal spike exchange methods on a Blue Gene/P supercomputer

Directory of Open Access Journals (Sweden)

Michael eHines

2011-11-01

Full Text Available The performance of several spike exchange methods using a Blue Gene/P supercomputerhas been tested with 8K to 128K cores using randomly connected networks of up to 32M cells with 1k connections per cell and 4M cells with 10k connections per cell. The spike exchange methods used are the standard Message Passing Interface collective, MPI_Allgather, and several variants of the non-blocking multisend method either implemented via non-blocking MPI_Isend, or exploiting the possibility of very low overhead direct memory access communication available on the Blue Gene/P. In all cases the worst performing method was that using MPI_Isend due to the high overhead of initiating a spike communication. The two best performing methods --- the persistent multisend method using the Record-Replay feature of the Deep Computing Messaging Framework DCMF_Multicast;and a two phase multisend in which a DCMF_Multicast is used to first send to a subset of phase 1 destination cores which then pass it on to their subset of phase 2 destination cores --- had similar performance with very low overhead for the initiation of spike communication. Departure from ideal scaling for the multisend methods is almost completely due to load imbalance caused by the largevariation in number of cells that fire on each processor in the interval between synchronization. Spike exchange time itself is negligible since transmission overlaps with computation and is handled by a direct memory access controller. We conclude that ideal performance scaling will be ultimately limited by imbalance between incoming processor spikes between synchronization intervals. Thus, counterintuitively, maximization of load balance requires that the distribution of cells on processors should not reflect neural net architecture but be randomly distributed so that sets of cells which are burst firing together should be on different processors with their targets on as large a set of processors as possible.

The construction and use of versatile binary vectors carrying pyrG auxotrophic marker and fluorescent reporter genes for Agrobacterium-mediated transformation of Aspergillus oryzae.

Science.gov (United States)

Nguyen, Khuyen Thi; Ho, Quynh Ngoc; Pham, Thu Ha; Phan, Tuan-Nghia; Tran, Van-Tuan

2016-12-01

Aspergillus oryzae is a safe mold widely used in food industry. It is also considered as a microbial cell factory for production of recombinant proteins and enzymes. Currently, genetic manipulation of filamentous fungi is achieved via Agrobacterium tumefaciens-mediated transformation methods usually employing antibiotic resistance markers. These methods are hardly usable for A. oryzae due to its strong resistance to the common antifungal compounds used for fungal transformation. In this study, we have constructed two binary vectors carrying the pyrG gene from A. oryzae as a biochemical marker than an antibiotic resistance marker, and an expression cassette for GFP or DsRed reporter gene under control of the constitutive gpdA promoter from Aspergillus nidulans. All components of these vectors are changeable to generate new versions for specific research purposes. The developed vectors are fully functional for heterologous expression of the GFP and DsRed fluorescent proteins in the uridine/uracil auxotrophic A. oryzae strain. Our study provides a new approach for A. oryzae transformation using pyrG as the selectable auxotrophic marker, A. tumefaciens as the DNA transfer tool and fungal spores as the transformation material. The binary vectors constructed can be used for gene expression studies in this industrially important filamentous fungus.

Learning Gene Regulatory Networks Computationally from Gene Expression Data Using Weighted Consensus

KAUST Repository

Fujii, Chisato

2015-04-16

Gene regulatory networks analyze the relationships between genes allowing us to un- derstand the gene regulatory interactions in systems biology. Gene expression data from the microarray experiments is used to obtain the gene regulatory networks. How- ever, the microarray data is discrete, noisy and non-linear which makes learning the networks a challenging problem and existing gene network inference methods do not give consistent results. Current state-of-the-art study uses the average-ranking-based consensus method to combine and average the ranked predictions from individual methods. However each individual method has an equal contribution to the consen- sus prediction. We have developed a linear programming-based consensus approach which uses learned weights from linear programming among individual methods such that the methods have di↵erent weights depending on their performance. Our result reveals that assigning di↵erent weights to individual methods rather than giving them equal weights improves the performance of the consensus. The linear programming- based consensus method is evaluated and it had the best performance on in silico and Saccharomyces cerevisiae networks, and the second best on the Escherichia coli network outperformed by Inferelator Pipeline method which gives inconsistent results across a wide range of microarray data sets.

Clinical Omics Analysis of Colorectal Cancer Incorporating Copy Number Aberrations and Gene Expression Data

Directory of Open Access Journals (Sweden)

Tsuyoshi Yoshida

2010-07-01

expression analysis, together with the clinical information, suggested UGT2B28, LOC440995, CXCL6, SULT1B1, RALBP1, TYMS, RAB12, RNMT, ARHGDIB, S1000A2, ABHD2, OIT3 and ABHD12 as genes that are possibly associated with CRC. Some of these genes have already been reported as being related to CRC. TYMS has been reported as being associated with resistance to the anti-cancer drug 5-fluorouracil, and we observed a copy number increase for this gene. RALBP1, ARHGDIB and S100A2 have been reported as oncogenes, and we observed copy number increases in each. ARHGDIB has been reported as a metastasis-related gene, and our data also showed copy number increases of this gene in cases with metastasis. Conclusion: The combination of CNA analysis and gene expression analysis was a more effective method for finding genes associated with the clinicopathological classification of CRC than either analysis alone. Using this combination of methods, we were able to detect genes that have already been associated with CRC. We also identified additional candidate genes that may be new markers or targets for this form of cancer.

Development of a new fluorescent reporter:operator system: location of AraC regulated genes in Escherichia coli K-12.

Science.gov (United States)

Sellars, Laura E; Bryant, Jack A; Sánchez-Romero, María-Antonia; Sánchez-Morán, Eugenio; Busby, Stephen J W; Lee, David J

2017-08-03

In bacteria, many transcription activator and repressor proteins regulate multiple transcription units that are often distally distributed on the bacterial genome. To investigate the subcellular location of DNA bound proteins in the folded bacterial nucleoid, fluorescent reporters have been developed which can be targeted to specific DNA operator sites. Such Fluorescent Reporter-Operator System (FROS) probes consist of a fluorescent protein fused to a DNA binding protein, which binds to an array of DNA operator sites located within the genome. Here we have developed a new FROS probe using the Escherichia coli MalI transcription factor, fused to mCherry fluorescent protein. We have used this in combination with a LacI repressor::GFP protein based FROS probe to assess the cellular location of commonly regulated transcription units that are distal on the Escherichia coli genome. We developed a new DNA binding fluorescent reporter, consisting of the Escherichia coli MalI protein fused to the mCherry fluorescent protein. This was used in combination with a Lac repressor:green fluorescent protein fusion to examine the spatial positioning and possible co-localisation of target genes, regulated by the Escherichia coli AraC protein. We report that induction of gene expression with arabinose does not result in co-localisation of AraC-regulated transcription units. However, measurable repositioning was observed when gene expression was induced at the AraC-regulated promoter controlling expression of the araFGH genes, located close to the DNA replication terminus on the chromosome. Moreover, in dividing cells, arabinose-induced expression at the araFGH locus enhanced chromosome segregation after replication. Regions of the chromosome regulated by AraC do not colocalise, but transcription events can induce movement of chromosome loci in bacteria and our observations suggest a role for gene expression in chromosome segregation.

Identification of Cell Cycle-Regulated Genes by Convolutional Neural Network.

Science.gov (United States)

Liu, Chenglin; Cui, Peng; Huang, Tao

2017-01-01

The cell cycle-regulated genes express periodically with the cell cycle stages, and the identification and study of these genes can provide a deep understanding of the cell cycle process. Large false positives and low overlaps are big problems in cell cycle-regulated gene detection. Here, a computational framework called DLGene was proposed for cell cycle-regulated gene detection. It is based on the convolutional neural network, a deep learning algorithm representing raw form of data pattern without assumption of their distribution. First, the expression data was transformed to categorical state data to denote the changing state of gene expression, and four different expression patterns were revealed for the reported cell cycle-regulated genes. Then, DLGene was applied to discriminate the non-cell cycle gene and the four subtypes of cell cycle genes. Its performances were compared with six traditional machine learning methods. At last, the biological functions of representative cell cycle genes for each subtype are analyzed. Our method showed better and more balanced performance of sensitivity and specificity comparing to other machine learning algorithms. The cell cycle genes had very different expression pattern with non-cell cycle genes and among the cell-cycle genes, there were four subtypes. Our method not only detects the cell cycle genes, but also describes its expression pattern, such as when its highest expression level is reached and how it changes with time. For each type, we analyzed the biological functions of the representative genes and such results provided novel insight to the cell cycle mechanisms. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Characterization of the human RAB38 and RAB7 genes: exclusion of new major pathological loci for Japanese OCA.

Science.gov (United States)

Suzuki, Tamio; Miyamura, Yoshinori; Inagaki, Katsuhiko; Tomita, Yasushi

2003-08-01

Oculocutaneous albinisms (OCAs) are due to various gene mutations that cause a disruption of melanogenesis in the melanocyte. Four different genes associated with human OCA have been reported, however, not all of OCA patients can be classified according to these four genes. We have sought to find a new major locus for Japanese OCA. Recently two genes, RAB38 and RAB7, were reported to play an important role in melanogenesis in the melanocyte, suggesting that these two genes could be good candidates for new OCA loci. To determine the structures of the human RAB38 and RAB7 genes, and examine if the two genes are new major loci for Japanese OCA. We screened mutations in these genes of 25 Japanese OCA patients who lacked mutations in the OCA1 and OCA2 genes with SSCP/heteroduplexes method. We determined the both genes, and their genomic organizations to design the primers for SSCP/heteroduplexes method. And then we screened mutations, but no mutation was detected. Neither of the genes is a new major locus for Japanese OCA.

Genes2Networks: connecting lists of gene symbols using mammalian protein interactions databases

Directory of Open Access Journals (Sweden)

Ma'ayan Avi

2007-10-01

Full Text Available Abstract Background In recent years, mammalian protein-protein interaction network databases have been developed. The interactions in these databases are either extracted manually from low-throughput experimental biomedical research literature, extracted automatically from literature using techniques such as natural language processing (NLP, generated experimentally using high-throughput methods such as yeast-2-hybrid screens, or interactions are predicted using an assortment of computational approaches. Genes or proteins identified as significantly changing in proteomic experiments, or identified as susceptibility disease genes in genomic studies, can be placed in the context of protein interaction networks in order to assign these genes and proteins to pathways and protein complexes. Results Genes2Networks is a software system that integrates the content of ten mammalian interaction network datasets. Filtering techniques to prune low-confidence interactions were implemented. Genes2Networks is delivered as a web-based service using AJAX. The system can be used to extract relevant subnetworks created from "seed" lists of human Entrez gene symbols. The output includes a dynamic linkable three color web-based network map, with a statistical analysis report that identifies significant intermediate nodes used to connect the seed list. Conclusion Genes2Networks is powerful web-based software that can help experimental biologists to interpret lists of genes and proteins such as those commonly produced through genomic and proteomic experiments, as well as lists of genes and proteins associated with disease processes. This system can be used to find relationships between genes and proteins from seed lists, and predict additional genes or proteins that may play key roles in common pathways or protein complexes.

GSEH: A Novel Approach to Select Prostate Cancer-Associated Genes Using Gene Expression Heterogeneity.

Science.gov (United States)

Kim, Hyunjin; Choi, Sang-Min; Park, Sanghyun

2018-01-01

When a gene shows varying levels of expression among normal people but similar levels in disease patients or shows similar levels of expression among normal people but different levels in disease patients, we can assume that the gene is associated with the disease. By utilizing this gene expression heterogeneity, we can obtain additional information that abets discovery of disease-associated genes. In this study, we used collaborative filtering to calculate the degree of gene expression heterogeneity between classes and then scored the genes on the basis of the degree of gene expression heterogeneity to find "differentially predicted" genes. Through the proposed method, we discovered more prostate cancer-associated genes than 10 comparable methods. The genes prioritized by the proposed method are potentially significant to biological processes of a disease and can provide insight into them.