WorldWideScience

Sample records for repeated studies show

  1. Induced pluripotent stem cells from patients with Huntington's disease show CAG-repeat-expansion-associated phenotypes.

    Science.gov (United States)

    2012-08-03

    Huntington's disease (HD) is an inherited neurodegenerative disorder caused by an expanded stretch of CAG trinucleotide repeats that results in neuronal dysfunction and death. Here, The HD Consortium reports the generation and characterization of 14 induced pluripotent stem cell (iPSC) lines from HD patients and controls. Microarray profiling revealed CAG-repeat-expansion-associated gene expression patterns that distinguish patient lines from controls, and early onset versus late onset HD. Differentiated HD neural cells showed disease-associated changes in electrophysiology, metabolism, cell adhesion, and ultimately cell death for lines with both medium and longer CAG repeat expansions. The longer repeat lines were however the most vulnerable to cellular stressors and BDNF withdrawal, as assessed using a range of assays across consortium laboratories. The HD iPSC collection represents a unique and well-characterized resource to elucidate disease mechanisms in HD and provides a human stem cell platform for screening new candidate therapeutics.

  2. Repeat length variation in the dopamine D4 receptor gene shows no evidence of association with schizophrenia

    Energy Technology Data Exchange (ETDEWEB)

    Daniels, J.; Williams, J.; Asherson, P. [Univ. of Wales College of Medicine, Cardiff (United Kingdom)] [and others

    1994-09-15

    The D4 receptor has been shown to exist in several allelic forms reflecting variation in the number of 48 base-pair sequence repeats in the putative cytoplasmic loop. We report a comparison of repeat length variation between schizophrenic patients and controls. Our sample of 106 unrelated schizophrenic cases and 119 controls showed no significant differences in allele or genotype distribution between patients and controls. In particular, we were unable to support the previous observation of an excess of 4-repeat homozygotes in patients. 16 refs., 2 tabs.

  3. Corticosterone stress response shows long-term repeatability and links to personality in free-living Nazca boobies.

    Science.gov (United States)

    Grace, Jacquelyn K; Anderson, David J

    2014-11-01

    The concept of "coping styles", or consistently different responses to stressors, is of broad interest in behavioral ecology and biomedicine. Two critical predictions of this concept are individual consistency of neurophysiological and behavioral responses (relative to population variability) and a negative relationship between aggression/proactivity and hypothalamic-pituitary-adrenal axis reactivity. Recent studies failed to provide strong support for these predictions, especially outside of strictly controlled conditions, and long-term measures to test the first prediction are rare. Here, we demonstrate individual repeatability across 2-3years of maximum circulating corticosterone concentration [CORT] and area under the [CORT] response curve (AUCI) during a standard capture-restraint test in wild, free-living adult Nazca boobies (Sula granti). We also show that the stress response predicts the personality traits aggression and anxiety in these birds (measured in the wild); however, the strength of these results was weak. Maximum [CORT] and AUCI showed higher repeatability between years than baseline [CORT]. After controlling breeding status, sex, mass, date sampled, and their interactions, baseline [CORT] was most closely related to personality traits, followed by AUCI, and then maximum [CORT]. The direction of these relationships depended on whether the testing context was social or non-social. [CORT] parameters had little to no relationship with cross-context plasticity in personality traits. Our results generally affirm two critical predictions of coping styles, but match the emerging trend that these relationships are weak in the wild, and may depend on testing context.

  4. Do monkey F5 mirror neurons show changes in firing rate during repeated observation of natural actions?

    Science.gov (United States)

    Kilner, J M; Kraskov, A; Lemon, R N

    2014-03-01

    Mirror neurons were first discovered in area F5 of macaque monkeys. In humans, noninvasive studies have demonstrated an increased blood oxygen level-dependent (BOLD) signal in homologous motor areas during action observation. One approach to demonstrating that this indicates the existence of mirror neurons in humans has been to employ functional (f)MRI adaptation to test whether the same population of neurons is active during both observation and execution conditions. Although a number of human studies have reported fMRI adaptation in these areas, a recent study has shown that macaque mirror neurons do not attenuate their firing rate with two repetitions. Here we investigated whether mirror neurons modulate their firing rate when monkeys observed the same repeated natural action multiple times. We recorded from 67 mirror neurons in area F5 of two macaque monkeys while they observed an experimenter perform a reach-to-grasp action on a small food reward using a precision grip. Although no changes were detectable for the first two repetitions, we show that both the firing rate and the latency at which mirror neurons discharged during observation were subtly modulated by the repetition of the observed action over 7-10 trials. Significant adaption was mostly found in the period immediately before the grasp was performed. We also found that the local field potential activity in F5 (beta-frequency range, 16-23 Hz), which is attenuated during action observation, also showed systematic changes with repeated observation. These LFP changes occurred well in advance of the mirror neuron adaptation. We conclude that macaque mirror neurons can show intra-modal adaptation, but whether this is related to fMRI adaptation of the BOLD signal requires further investigation.

  5. STD studies show spermicides protect against Chlamydia.

    Science.gov (United States)

    1986-01-01

    Evidence which suggests that spermicides provide protection against sexually transmitted diseases (STDs) is accumulating. Laboratory tests have repeatedly demonstrated that spermicides are capable of killing the bacteria responsible for several types of STDs, as well as the virus responsible for acquired immunodeficiency syndrome. Recently, studies conducted in Bangkok, Thailand and in New York City suggest that these protective effects are not confined to the laboratory but that they also occur among women who use spermicides in the real world. In the New York City study, Family Health International (FHI), using data collected by Planned Parenthood of New York City, compared STD prevalence rates for women using different contraceptive methods. Women who used spermicides, in comparison with women who used oral contraceptives (OCs), were 20% less likely to have contracted a STD, 30% less likely to have gonorrhea, and 60% less likely to have chlamydia. In the Thai study, conducted jointly by the FHI and the Ministry of Health, women at high risk of STDs were allocated either to a group which was instructed to use a vaginal sponge impregnated with nonoxynol-9 during intercourse or to a control group which received no vaginal contraceptives. All the women were either sterilized or using OCs, IUDs, or injectable contraceptives. Preliminary results suggest that the women who used the vaginal sponges were significantly less likely to contract chlamydia than the control group. In regard to the incidence of gonorrhea, no differences between the 2 groups was detected. In the Thai study methodological problems forced the researchers to redesign the study. In accordance with the new design, the women in the 2 groups will be crossed over after 6 weeks. This will allow the researchers to examine the effect of using or not using a vaginal spermicide on specific individuals. The findings of the 2 studies have special relevance given the increasing prevalence of STDs in many

  6. Study Shows How Zika Attacks Infant Brain

    Science.gov (United States)

    ... gov/news/fullstory_162514.html Study Shows How Zika Attacks Infant Brain Virus can copy itself thousands ... New research paints a chilling portrait of how Zika ravages the infant brain. Scientists from the U.S. ...

  7. The repeat domain of the type III effector protein PthA shows a TPR-like structure and undergoes conformational changes upon DNA interaction.

    Science.gov (United States)

    Murakami, Mário Tyago; Sforça, Mauricio Luis; Neves, Jorge Luiz; Paiva, Joice Helena; Domingues, Mariane Noronha; Pereira, André Luiz Araujo; Zeri, Ana Carolina de Mattos; Benedetti, Celso Eduardo

    2010-12-01

    Many plant pathogenic bacteria rely on effector proteins to suppress defense and manipulate host cell mechanisms to cause disease. The effector protein PthA modulates the host transcriptome to promote citrus canker. PthA possesses unusual protein architecture with an internal region encompassing variable numbers of near-identical tandem repeats of 34 amino acids termed the repeat domain. This domain mediates protein-protein and protein-DNA interactions, and two polymorphic residues in each repeat unit determine DNA specificity. To gain insights into how the repeat domain promotes protein-protein and protein-DNA contacts, we have solved the structure of a peptide corresponding to 1.5 units of the PthA repeat domain by nuclear magnetic resonance (NMR) and carried out small-angle X-ray scattering (SAXS) and spectroscopic studies on the entire 15.5-repeat domain of PthA2 (RD2). Consistent with secondary structure predictions and circular dichroism data, the NMR structure of the 1.5-repeat peptide reveals three α-helices connected by two turns that fold into a tetratricopeptide repeat (TPR)-like domain. The NMR structure corroborates the theoretical TPR superhelix predicted for RD2, which is also in agreement with the elongated shape of RD2 determined by SAXS. Furthermore, RD2 undergoes conformational changes in a pH-dependent manner and upon DNA interaction, and shows sequence similarities to pentatricopeptide repeat (PPR), a nucleic acid-binding motif structurally related to TPR. The results point to a model in which the RD2 structure changes its compactness as it embraces the DNA with the polymorphic diresidues facing the interior of the superhelix oriented toward the nucleotide bases.

  8. Studies of an expanded trinucleotide repeat in transgenic mice

    Energy Technology Data Exchange (ETDEWEB)

    Bingham, P.; Wang, S.; Merry, D. [Univ. of Pennsylvania, Philadelphia, PA (United States)

    1994-09-01

    Spinal and bulbar muscular atrophy (SBMA) is a progressive motor neuron disease caused by expansion of a trinucleotide repeat in the androgen receptor gene (AR{sup exp}). AR{sup exp} repeats expand further or contract in approximately 25% of transmissions. Analogous {open_quotes}dynamic mutations{close_quotes} have been reported in other expanded trinucleotide repeat disorders. We have been developing a mouse model of this disease using a transgenic approach. Expression of the SBMA AR was documented in transgenic mice with an inducible promoter. No phenotypic effects of transgene expression were observed. We have extended our previous results on stability of the expanded trinucleotide repeat in transgenic mice in two lines carrying AR{sup exp}. Tail DNA was amplified by PCR using primers spanning the repeat on 60 AR{sup exp} transgenic mice from four different transgenic lines. Migration of the PCR product through an acrylamide gel showed no change of the 45 CAG repeat length in any progeny. Similarly, PCR products from 23 normal repeat transgenics showed no change from the repeat length of the original construct. Unlike the disease allele in humans, the expanded repeat AR cDNA in transgenic mice showed no change in repeat length with transmission. The relative stability of CAG repeats seen in the transgenic mice may indicate either differences in the fidelity of replicative enzymes, or differences in error identification and repair between mice and humans. Integration site or structural properties of the transgene itself might also play a role.

  9. Methane Seeps in the Gulf of Mexico: repeat acoustic surveying shows highly temporally and spatially variable venting

    Science.gov (United States)

    Beaumont, B. C.; Raineault, N.

    2016-02-01

    Scientists have recognized that natural seeps account for a large amount of methane emissions. Despite their widespread occurrence in areas like the Gulf of Mexico, little is known about the temporal variability and site-scale spatial variability of venting over time. We used repeat acoustic surveys to compare multiple days of seep activity and determine the changes in the locus of methane emission and plume height. The Sleeping Dragon site was surveyed with an EM302 multibeam sonar on three consecutive days in 2014 and 4 days within one week in 2015. The data revealed three distinctive plume regions. The locus of venting varied by 10-60 meters at each site. The plume that exhibited the least spatial variability in venting, was also the most temporally variable. This seep was present in one-third of survey dates in 2014 and three quarters of survey dates in 2015, showing high day-to-day variability. The plume height was very consistent for this plume, whereas the other plumes were more consistent temporally, but varied in maximum plume height detection by 25-85 m. The single locus of emission at the site that had high day-to-day variability may be due to a single conduit for methane release, which is sometimes closed off by carbonate or clathrate hydrate formation. In addition to day-to-day temporal variability, the locus of emission at one site was observed to shift from a point-source in 2014 to a diffuse source in 2015 at a nearby location. ROV observations showed that one of the seep sites that closed off temporarily, experienced an explosive breakthrough of gas, releasing confined methane and blowing out rock. The mechanism that causes on/off behavior of certain plumes, combined with the spatial variability of the locus of methane release shown in this study may point to carbonate or hydrate formation in the seep plumbing system and should be further investigated.

  10. Plasmodium falciparum field isolates from areas of repeated emergence of drug resistant malaria show no evidence of hypermutator phenotype.

    Science.gov (United States)

    Brown, Tyler S; Jacob, Christopher G; Silva, Joana C; Takala-Harrison, Shannon; Djimdé, Abdoulaye; Dondorp, Arjen M; Fukuda, Mark; Noedl, Harald; Nyunt, Myaing Myaing; Kyaw, Myat Phone; Mayxay, Mayfong; Hien, Tran Tinh; Plowe, Christopher V; Cummings, Michael P

    2015-03-01

    Multiple transcontinental waves of drug resistance in Plasmodium falciparum have originated in Southeast Asia before spreading westward, first into the rest of Asia and then to sub-Saharan Africa. In vitro studies have suggested that hypermutator P. falciparum parasites may exist in Southeast Asia and that an increased rate of acquisition of new mutations in these parasites may explain the repeated emergence of drug resistance in Southeast Asia. This study is the first to test the hypermutator hypothesis using field isolates. Using genome-wide SNP data from human P. falciparum infections in Southeast Asia and West Africa and a test for relative rate differences we found no evidence of increased relative substitution rates in P. falciparum isolates from Southeast Asia. Instead, we found significantly increased substitution rates in Mali and Bangladesh populations relative to those in populations from Southeast Asia. Additionally we found no association between increased relative substitution rates and parasite clearance following treatment with artemisinin derivatives.

  11. The SIDER2 elements, interspersed repeated sequences that populate the Leishmania genomes, constitute subfamilies showing chromosomal proximity relationship

    Directory of Open Access Journals (Sweden)

    Thomas M Carmen

    2008-06-01

    Full Text Available Abstract Background Protozoan parasites of the genus Leishmania are causative agents of a diverse spectrum of human diseases collectively known as leishmaniasis. These eukaryotic pathogens that diverged early from the main eukaryotic lineage possess a number of unusual genomic, molecular and biochemical features. The completion of the genome projects for three Leishmania species has generated invaluable information enabling a direct analysis of genome structure and organization. Results By using DNA macroarrays, made with Leishmania infantum genomic clones and hybridized with total DNA from the parasite, we identified a clone containing a repeated sequence. An analysis of the recently completed genome sequence of L. infantum, using this repeated sequence as bait, led to the identification of a new class of repeated elements that are interspersed along the different L. infantum chromosomes. These elements turned out to be homologues of SIDER2 sequences, which were recently identified in the Leishmania major genome; thus, we adopted this nomenclature for the Leishmania elements described herein. Since SIDER2 elements are very heterogeneous in sequence, their precise identification is rather laborious. We have characterized 54 LiSIDER2 elements in chromosome 32 and 27 ones in chromosome 20. The mean size for these elements is 550 bp and their sequence is G+C rich (mean value of 66.5%. On the basis of sequence similarity, these elements can be grouped in subfamilies that show a remarkable relationship of proximity, i.e. SIDER2s of a given subfamily locate close in a chromosomal region without intercalating elements. For comparative purposes, we have identified the SIDER2 elements existing in L. major and Leishmania braziliensis chromosomes 32. While SIDER2 elements are highly conserved both in number and location between L. infantum and L. major, no such conservation exists when comparing with SIDER2s in L. braziliensis chromosome 32. Conclusion

  12. Analysis of repeated outcome measures from longitudinal studies

    Institute of Scientific and Technical Information of China (English)

    Yuanjia WANG; Naihua DUAN

    2011-01-01

    @@ In many clinical studies repeated measurements of an outcome are collected over time.For example,in an 8-week study of treatment for obsessive compulsive disorder,the severity of the disorder may be measured weekly using the Yale-Brown-Obsessive-Compulsive-Disorder-Scale (YBOCS).For each study participant who completes the study,there will be nine repeated measures of YBOCS (a baseline assessment plus eight assessments during the course of treatment).Such a study in which participants are followed and measured repeatedly over time is called a longitudinal study and the resulting data are called longitudinal data.

  13. Novel Luminex Assay for Telomere Repeat Mass Does Not Show Well Position Effects Like qPCR.

    Directory of Open Access Journals (Sweden)

    Muhammad G Kibriya

    Full Text Available Telomere length is a potential biomarker of aging and risk for age-related diseases. For measurement of relative telomere repeat mass (TRM, qPCR is typically used primarily due to its low cost and low DNA input. But the position of the sample on a plate often impacts the qPCR-based TRM measurement. Recently we developed a novel, probe-based Luminex assay for TRM that requires ~50ng DNA and involves no DNA amplification. Here we report, for the first time, a comparison among TRM measurements obtained from (a two singleplex qPCR assays (using two different primer sets, (b a multiplex qPCR assay, and (c our novel Luminex assay. Our comparison is focused on characterizing the effects of sample positioning on TRM measurement. For qPCR, DNA samples from two individuals (K and F were placed in 48 wells of a 96-well plate. For each singleplex qPCR assay, we used two plates (one for Telomere and one for Reference gene. For the multiplex qPCR and the Luminex assay, the telomere and the reference genes were assayed from the same well. The coefficient of variation (CV of the TRM for Luminex (7.2 to 8.4% was consistently lower than singleplex qPCR (11.4 to 14.9% and multiplex qPCR (19.7 to 24.3%. In all three qPCR assays the DNA samples in the left- and right-most columns showed significantly lower TRM than the samples towards the center, which was not the case for the Luminex assay (p = 0.83. For singleplex qPCR, 30.5% of the variation in TL was explained by column-to-column variation and 0.82 to 27.9% was explained by sample-to-sample variation. In contrast, only 5.8% of the variation in TRM for the Luminex assay was explained by column-to column variation and 50.4% was explained by sample-to-sample variation. Our novel Luminex assay for TRM had good precision and did not show the well position effects of the sample that were seen in all three of the qPCR assays that were tested.

  14. Cytogenetic studies in couples experiencing repeated pregnancy losses.

    Science.gov (United States)

    De Braekeleer, M; Dao, T N

    1990-07-01

    A computerized database generated from the literature on cytogenetic studies in couples experiencing repeated pregnancy losses has been set up at the University of Quebec at Chicoutimi. At the present time, it contains data on 22,199 couples (44,398 individuals). The statistical analyses showed a relationship between the distribution of the chromosome abnormalities and the number of abortions. An uneven distribution of the chromosomal structural rearrangements according to the sex of the carrier was found (P less than 0.05). Overall, 4.7% of the couples ascertained for two or more spontaneous abortions included one carrier. It also appeared that only translocations (both reciprocal and Robertsonian) and inversions were associated with a higher risk of pregnancy wastage. Therefore, genetic counselling should be offered to these couples and investigations performed on their extended families.

  15. The canine prostate cancer cell line CHP-1 shows over-expression of the co-chaperone small glutamine-rich tetratricopeptide repeat-containing protein α.

    Science.gov (United States)

    Azakami, D; Nakahira, R; Kato, Y; Michishita, M; Kobayashi, M; Onozawa, E; Bonkobara, M; Kobayashi, M; Takahashi, K; Watanabe, M; Ishioka, K; Sako, T; Ochiai, K; Omi, T

    2017-06-01

    Although androgen therapy resistance and poor clinical outcomes are seen in most canine prostate cancer cases, there are only a few tools for analysing canine prostate cancer by using a cell biological approach. Therefore, to evaluate androgen-independent neoplastic cell growth, a new canine prostate cancer cell line (CHP-1) was established in this study. CHP-1 over-expressed the co-chaperone small glutamine-rich tetratricopeptide repeat-containing protein α (SGTA), which is over-expressed in human androgen-independent prostate cancer. The CHP-1 xenograft also showed SGTA over-expression. Although CHP-1 shows poor androgen receptor (AR) signalling upon dihydrotestosterone stimulation, forced expression of AR enabled evaluation of AR signalling. Taken together, these results suggest that CHP-1 will be a useful model for investigating the pathogenesis of androgen-dependent and androgen-independent canine prostate cancer. © 2016 John Wiley & Sons Ltd.

  16. On The Repeater Control to Achieve Goods Any Show Effect%Repeater控件实现商品的任何展示效果的研究

    Institute of Scientific and Technical Information of China (English)

    王得燕; 肖颖

    2011-01-01

    DataGrid、DataList和Repeater三个控件是ASP.NET的重要数据控件,通过数据源的设置。均可以用来显示数据,被大量用于WEB网页的设计过程中。文章对三个控件的异同做了研究,对看起来份量最轻但其实性能最好的Repeater控件进行深入研究,给出实现各种商品展示效果的程序设计方法。%Data Grid, Data List and Repeater are three important controls for ASP. NET data controls. By setting the data source, they can be used to display data and WEB pages design process. This article made some comparison on the similarities and differences between the three controls, and studied the Repeater control deeply and gave programs that achieve Any Show Effect of goods.

  17. [A case of bronchial foreign body due to citrus fruit seed aspiration showing multiple pulmonary infiltration repeatedly].

    Science.gov (United States)

    Morimatsu, Yoshitaka; Aoki, Yuka; Mizoguchi, Yusuke; Kitasato, Hirohiko; Aizawa, Hisamichi

    2005-12-01

    We report a case of a bronchial foreign body in a 76-year-old citrus fruit farmer. The patient was detected patchy infiltration (ground-glass attenuation) of the right upper lung field on the chest X-ray on Dec. 26th, 2003. The shadow tended to disappear after treatment with antibiotics. The same shadow was detected again 10 months later and the patient underwent a bronchoscopic examination. A foreign body was found lodged in the center of the right upper bronchus, associated with bronchial stenosis due to mucosal edema. The abnormal shadow disappeared after the foreign body, which we decided was a citrus fruit seed, was removed. From the time course of the present illness and a retrospective evaluation of previous chest X-rays, the patient had aspirated the foreign body 18 months prior to his admission for bronchoscopy. We should be careful of the possibility of foreign bodies even when the elderly do not present a history of foreign body aspiration. It is important to consider the possibility of a bronchial foreign body in patients with repeated pneumonia, and to perform bronchoscopy aggressively.

  18. Successive failure, repeat entrepreneurship and no learning: A case study

    Directory of Open Access Journals (Sweden)

    Marius Pretorius

    2011-02-01

    Full Text Available Orientation: Current theories of repeat entrepreneurship provide little explanation for the effect of failure as a ‘trigger’ for creating successive ventures or learning from repeated failures. Research purpose: This study attempts to establish the role of previous failures on the ventures that follow them and to determine the process of learning from successive failures.Motivation for the study: Successive failures offer potentially valuable insights into the relationship between failures on the ventures that follow and the process of learning from failure.Research design, approach and method: The researchers investigated a single case study of one entrepreneur’s successive failures over 20 years.Main findings: Although the causes varied, all the failures had fundamental similarities. This suggested that the entrepreneur had not learnt from them. The previous failures did not trigger the subsequent ventures. Instead, they played a role in causing the failures. Learning from failure does not happen immediately but requires deliberate reflection. Deliberate reflection is a prerequisite for learning from failure as the entrepreneur repeated similar mistakes time after time until he reflected on each failure.Practical/managerial implications: It confirms that failure is a part of entrepreneurial endeavours. However, learning from it requires deliberate reflection. Failure does not ‘trigger’ the next venture and educators should note this.Contribution/value-add: Knowing the effect of failure on consecutive ventures may help us to understand the development of prototypes (mental frameworks and expand the theory about entrepreneurial prototype categories.

  19. Repeating tests: different roles in research studies and clinical medicine.

    Science.gov (United States)

    Monach, Paul A

    2012-10-01

    Researchers often decide whether to average multiple results in order to produce more precise data, and clinicians often decide whether to repeat a laboratory test in order to confirm its validity or to follow a trend. Some of the major sources of variation in laboratory tests (analytical imprecision, within-subject biological variation and between-subject variation) and the effects of averaging multiple results from the same sample or from the same person over time are discussed quantitatively in this article. This analysis leads to the surprising conclusion that the strategy of averaging multiple results is only necessary and effective in a limited range of research studies. In clinical practice, it may be important to repeat a test in order to eliminate the possibility of a rare type of error that has nothing to do analytical imprecision or within-subject variation, and for this reason, paradoxically, it may be most important to repeat tests with the highest sensitivity and/or specificity (i.e., ones that are critical for clinical decision-making).

  20. PET functional volume delineation: a robustness and repeatability study

    Energy Technology Data Exchange (ETDEWEB)

    Hatt, Mathieu [CHU Morvan, INSERM, U650, LaTIM, Brest (France); CHU MORVAN, LaTIM, INSERM U650, Brest (France); Cheze-le Rest, Catherine [CHU Morvan, INSERM, U650, LaTIM, Brest (France); CHU, Academic Department of Nuclear Medicine, Brest (France); Albarghach, Nidal; Pradier, Olivier [CHU Morvan, INSERM, U650, LaTIM, Brest (France); CHU, Institute of Oncology, Brest (France); Visvikis, Dimitris [CHU Morvan, INSERM, U650, LaTIM, Brest (France)

    2011-04-15

    Current state-of-the-art algorithms for functional uptake volume segmentation in PET imaging consist of threshold-based approaches, whose parameters often require specific optimization for a given scanner and associated reconstruction algorithms. Different advanced image segmentation approaches previously proposed and extensively validated, such as among others fuzzy C-means (FCM) clustering, or fuzzy locally adaptive bayesian (FLAB) algorithm have the potential to improve the robustness of functional uptake volume measurements. The objective of this study was to investigate robustness and repeatability with respect to various scanner models, reconstruction algorithms and acquisition conditions. Robustness was evaluated using a series of IEC phantom acquisitions carried out on different PET/CT scanners (Philips Gemini and Gemini Time-of-Flight, Siemens Biograph and GE Discovery LS) with their associated reconstruction algorithms (RAMLA, TF MLEM, OSEM). A range of acquisition parameters (contrast, duration) and reconstruction parameters (voxel size) were considered for each scanner model, and the repeatability of each method was evaluated on simulated and clinical tumours and compared to manual delineation. For all the scanner models, acquisition parameters and reconstruction algorithms considered, the FLAB algorithm demonstrated higher robustness in delineation of the spheres with low mean errors (10%) and variability (5%), with respect to threshold-based methodologies and FCM. The repeatability provided by all segmentation algorithms considered was very high with a negligible variability of <5% in comparison to that associated with manual delineation (5-35%). The use of advanced image segmentation algorithms may not only allow high accuracy as previously demonstrated, but also provide a robust and repeatable tool to aid physicians as an initial guess in determining functional volumes in PET. (orig.)

  1. New species of Ehrlichia isolated from Rhipicephalus (Boophilus microplus shows an ortholog of the E. canis major immunogenic glycoprotein gp36 with a new sequence of tandem repeats

    Directory of Open Access Journals (Sweden)

    Cruz Alejandro Cabezas

    2012-12-01

    Full Text Available Abstract Background Ehrlichia species are the etiological agents of emerging and life-threatening tick-borne human zoonoses that inflict serious and fatal infections in companion animals and livestock. The aim of this paper was to phylogeneticaly characterise a new species of Ehrlichia isolated from Rhipicephalus (Boophilus microplus from Minas Gerais, Brazil. Methods The agent was isolated from the hemolymph of Rhipicephalus (B. microplus engorged females that had been collected from naturally infested cattle in a farm in the state of Minas Gerais, Brazil. This agent was then established and cultured in IDE8 tick cells. The molecular and phylogenetic analysis was based on 16S rRNA, groEL, dsb, gltA and gp36 genes. We used the maximum likelihood method to construct the phylogenetic trees. Results The phylogenetic trees based on 16S rRNA, groEL, dsb and gltA showed that the Ehrlichia spp isolated in this study falls in a clade separated from any previously reported Ehrlichia spp. The molecular analysis of the ortholog of gp36, the major immunoreactive glycoproteins in E. canis and ortholog of the E. chaffeensis gp47, showed a unique tandem repeat of 9 amino acids (VPAASGDAQ when compared with those reported for E. canis, E. chaffeensis and the related mucin-like protein in E. ruminantium. Conclusions Based on the molecular and phylogenetic analysis of the 16S rRNA, groEL, dsb and gltA genes we concluded that this tick-derived microorganism isolated in Brazil is a new species, named E. mineirensis (UFMG-EV, with predicted novel antigenic properties in the gp36 ortholog glycoprotein. Further studies on this new Ehrlichia spp should address questions about its transmissibility by ticks and its pathogenicity for mammalian hosts.

  2. Repeat film analysis and its implications for quality assurance in dental radiology: An institutional case study

    Directory of Open Access Journals (Sweden)

    Shruthi Acharya

    2015-01-01

    Full Text Available Context: The goal of any radiologist is to produce the highest quality diagnostic radiographs, while keeping patient exposure as low as reasonably achievable (ALARA. Aims: The aim of this study was to describe the reasons for radiograph rejections through a repeat film analysis in an Indian dental school. Settings and Design: An observational study conducted in the Department of Oral Medicine and Radiology, Manipal College of Dental Sciences, Manipal. Materials and Methods: During a 6-month study period, a total of 9,495 intra-oral radiographs and 2339 extraoral radiographs taken in the Radiology Department were subjected to repeat film analysis. Statistical Analysis Used: SPSS Version 16. Descriptive analysis used. Results: The results showed that the repeat rates were 7.1% and 5.86% for intraoral and extraoral radiographs, respectively. Among the causes for errors reported, positioning error (38.7% was the most common, followed by improper angulations (26.1%, and improper film placement (11.2% for intra-oral radiographs. The study found that the maximum frequency of repeats among extraoral radiographs was for panoramic radiographs (49% followed by lateral cephalogram (33%, and paranasal sinus view (14%. It was also observed that repeat rate of intraoral radiographs was highest for internees (44.7%, and undergraduate students (28.2%. Conclusions: The study pointed to a need for more targeted interventions to achieve the goal of keeping patient exposure ALARA in a dental school setting.

  3. Zika May Persist for Months in Newborns, Study Shows

    Science.gov (United States)

    ... page: https://medlineplus.gov/news/fullstory_160594.html Zika May Persist for Months in Newborns, Study Shows ... There's more bad news when it comes to Zika's effect on infants: A case study suggests the ...

  4. A Study on Person Deixis Used in TV Talk Show

    Institute of Scientific and Technical Information of China (English)

    肖晓

    2014-01-01

    Deixis means“pointing” via language. There are many scholars who study person deixis in different discourses. However, few of them have analyzed person deixis used in TV talk show, which is more popular in our daily life. TV talk show is an important face-to-face conversation in which the participants use some person deixis to reach certain goal. This thesis studies the person deixis used in TV talk show especial y three types of unconventional usage of person deixis in the TV talk show discourse.

  5. Mice repeatedly exposed to Group-A β-Haemolytic Streptococcus show perseverative behaviors, impaired sensorimotor gating, and immune activation in rostral diencephalon.

    Science.gov (United States)

    Macrì, Simone; Ceci, Chiara; Onori, Martina Proietti; Invernizzi, Roberto William; Bartolini, Erika; Altabella, Luisa; Canese, Rossella; Imperi, Monica; Orefici, Graziella; Creti, Roberta; Margarit, Immaculada; Magliozzi, Roberta; Laviola, Giovanni

    2015-08-25

    Repeated exposure to Group-A β-Haemolytic Streptococcus (GAS) may constitute a vulnerability factor in the onset and course of pediatric motor disturbances. GAS infections/colonization can stimulate the production of antibodies, which may cross the blood brain barrier, target selected brain areas (e.g. basal ganglia), and exacerbate motor alterations. Here, we exposed developing SJL male mice to four injections with a GAS homogenate and evaluated the following domains: motor coordination; general locomotion; repetitive behaviors; perseverative responses; and sensorimotor gating (pre-pulse inhibition, PPI). To demonstrate that behavioral changes were associated with immune-mediated brain alterations, we analyzed, in selected brain areas, the presence of infiltrates and microglial activation (immunohistochemistry), monoamines (HPLC), and brain metabolites (in vivo Magnetic Resonance Spectroscopy). GAS-exposed mice showed increased repetitive and perseverative behaviors, impaired PPI, and reduced concentrations of serotonin in prefrontal cortex, a brain area linked to the behavioral domains investigated, wherein they also showed remarkable elevations in lactate. Active inflammatory processes were substantiated by the observation of infiltrates and microglial activation in the white matter of the anterior diencephalon. These data support the hypothesis that repeated GAS exposure may elicit inflammatory responses in brain areas involved in motor control and perseverative behavior, and result in phenotypic abnormalities.

  6. Study of simple sequence repeat (SSR) polymorphism for biotic ...

    African Journals Online (AJOL)

    home

    2013-10-02

    Oct 2, 2013 ... back cross breeding; SSRs, simple sequence repeats; PIC, polymorphism ..... PIC values were reported in barley wheat and rice (Gu et ... doubled-haploid rice population. Theor. ... Grover A, Aishwarya V, Sharma PC (2007).

  7. NMR shows hydrophobic interactions replace glycine packing in the triple helix at a natural break in the (Gly-X-Y)n repeat.

    Science.gov (United States)

    Li, Yingjie; Brodsky, Barbara; Baum, Jean

    2007-08-03

    Little is known about the structural consequences of the more than 20 breaks in the (Gly-X-Y)(n) repeating sequence found in the long triple helix domain of basement membrane type IV collagen. NMR triple resonance studies of doubly labeled residues within a set of collagen model peptides provide distance and dihedral angle restraints that allow determination of model structures of both a standard triple helix and of a triple helix with a break in solution. Although the standard triple helix cannot continue when Gly is not every third residue, the NMR data support rod-like molecules that have standard triple-helical structures on both sides of a well defined and highly localized perturbation. The GAAVM break region may be described as a "pseudo triple helix," because it preserves the standard one-residue stagger of the triple helix but introduces hydrophobic interactions at the position normally occupied by the much smaller and hydrogen-bonded Gly residue of the repeating (Gly-X-Y)(n) sequence. This structure provides a rationale for the consensus presence of hydrophobic residues in breaks of similar length and defines a novel variant of a triple helix that could be involved in recognition.

  8. Exposing Students to Repeat Photography: Increasing Cultural Understanding on a Short-Term Study Abroad

    Science.gov (United States)

    Lemmons, Kelly K.; Brannstrom, Christian; Hurd, Danielle

    2014-01-01

    Traditionally, repeat photography has been used to analyze land cover change. This paper describes how repeat photography may be used as a tool to enhance the short-term study abroad experience by facilitating cultural interaction and understanding. We present evidence from two cases and suggest a five-step repeat photography method for educators…

  9. Exposing Students to Repeat Photography: Increasing Cultural Understanding on a Short-Term Study Abroad

    Science.gov (United States)

    Lemmons, Kelly K.; Brannstrom, Christian; Hurd, Danielle

    2014-01-01

    Traditionally, repeat photography has been used to analyze land cover change. This paper describes how repeat photography may be used as a tool to enhance the short-term study abroad experience by facilitating cultural interaction and understanding. We present evidence from two cases and suggest a five-step repeat photography method for educators…

  10. Single and repeated elective abortions in Japan: a psychosocial study.

    Science.gov (United States)

    Kitamura, T; Toda, M A; Shima, S; Sugawara, M

    1998-09-01

    Despite its social, legal and medical importance, termination of pregnancy (TOP) (induced abortion) has rarely been the focus of psychosocial research. Of a total of 1329 women who consecutively attended the antenatal clinic of a general hospital in Japan, 635 were expecting their first baby. Of these 635 women, 103 (16.2%) had experienced TOP once previously (first aborters), while 47 (7.4%) had experienced TOP two or more times (repeated aborters). Discriminant function analysis was performed using psychosocial variables found to be significantly associated with either first abortion or repeated abortion in bivariate analyses. This revealed that both first and repeated aborters could be predicted by smoking habits and an unwanted current pregnancy while the repeated aborters appear to differ from first aborters in having a longer pre-marital dating period, non-arranged marriages, smoking habits, early maternal loss experience or a low level of maternal care during childhood. These findings suggest that both the frequency of abortion and its repetition have psychosocial origins.

  11. Acute and repeated dose toxicity studies of different β-cyclodextrin-based nanosponge formulations.

    Science.gov (United States)

    Shende, Pravin; Kulkarni, Yogesh A; Gaud, R S; Deshmukh, Kiran; Cavalli, Roberta; Trotta, Francesco; Caldera, Fabrizio

    2015-05-01

    Nanosponges (NS) show promising results in different fields such as medicine, agriculture, water purification, fire engineering and so on. The present study was designed to evaluate toxicity of different NS formulations (namely, S1-S6) synthesized with different cross-linking agents such as carbonyl diimidazole, pyromellitic dianhydride and hexamethylene diisocynate; and preparation methods in experimental animals. Acute and repeated dose toxicity studies of formulations were carried out as per OECD guidelines 423 and 407, respectively. For acute toxicity study, formulations were administered to female rats at doses of 300 and 2000 mg/kg orally. The general behaviour of the rats was continuously monitored for 1 h after dosing, periodically during the first 24 h and daily thereafter for a total of 14 days. On day 14, animals were fasted overnight, weighed, and sacrificed. After sacrification, animals were subjected to necropsy. For repeated dose toxicity study, rats of either sex were orally administered with formulations at the dose of 300 mg/kg per day for a period of 28 days. The maximally tolerated dose of all formulations was found to be 2000 mg/kg. Repeated administration of formulations for 28 days did not show any significant changes in haematological and biochemical parameters in experimental animals. These results indicate that the formulations are safe, when tested in experimental animals.

  12. Quantum repeated games revisited

    CERN Document Server

    Frackiewicz, Piotr

    2011-01-01

    We present a scheme for playing quantum repeated 2x2 games based on the Marinatto and Weber's approach to quantum games. As a potential application, we study twice repeated Prisoner's Dilemma game. We show that results not available in classical game can be obtained when the game is played in the quantum way. Before we present our idea, we comment on the previous scheme of playing quantum repeated games.

  13. Reactor pulse repeatability studies at the annular core research reactor

    Energy Technology Data Exchange (ETDEWEB)

    DePriest, K.R. [Applied Nuclear Technologies, Sandia National Laboratories, Mail Stop 1146, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States); Trinh, T.Q. [Nuclear Facility Operations, Sandia National Laboratories, Mail Stop 0614, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States); Luker, S. M. [Applied Nuclear Technologies, Sandia National Laboratories, Mail Stop 1146, Post Office Box 5800, Albuquerque, NM 87185-1146 (United States)

    2011-07-01

    The Annular Core Research Reactor (ACRR) at Sandia National Laboratories is a water-moderated pool-type reactor designed for testing many types of objects in the pulse and steady-state mode of operations. Personnel at Sandia began working to improve the repeatability of pulse operations for experimenters in the facility. The ACRR has a unique UO{sub 2}-BeO fuel that makes the task of producing repeatable pulses difficult with the current operating procedure. The ACRR produces a significant quantity of photoneutrons through the {sup 9}Be({gamma}, n){sup 8}Be reaction in the fuel elements. The photoneutrons are the result of the gammas produced during fission and in fission product decay, so their production is very much dependent on the reactor power history and changes throughout the day/week of experiments in the facility. Because the photoneutrons interfere with the delayed-critical measurements required for accurate pulse reactivity prediction, a new operating procedure was created. The photoneutron effects at delayed critical are minimized when using the modified procedure. In addition, the pulse element removal time is standardized for all pulse operations with the modified procedure, and this produces less variation in reactivity removal times. (authors)

  14. Prolonged repeated acupuncture stimulation induces habituation effects in pain-related brain areas: an FMRI study.

    Science.gov (United States)

    Li, Chuanfu; Yang, Jun; Park, Kyungmo; Wu, Hongli; Hu, Sheng; Zhang, Wei; Bu, Junjie; Xu, Chunsheng; Qiu, Bensheng; Zhang, Xiaochu

    2014-01-01

    Most previous studies of brain responses to acupuncture were designed to investigate the acupuncture instant effect while the cumulative effect that should be more important in clinical practice has seldom been discussed. In this study, the neural basis of the acupuncture cumulative effect was analyzed. For this experiment, forty healthy volunteers were recruited, in which more than 40 minutes of repeated acupuncture stimulation was implemented at acupoint Zhusanli (ST36). Three runs of acupuncture fMRI datasets were acquired, with each run consisting of two blocks of acupuncture stimulation. Besides general linear model (GLM) analysis, the cumulative effects of acupuncture were analyzed with analysis of covariance (ANCOVA) to find the association between the brain response and the cumulative duration of acupuncture stimulation in each stimulation block. The experimental results showed that the brain response in the initial stage was the strongest although the brain response to acupuncture was time-variant. In particular, the brain areas that were activated in the first block and the brain areas that demonstrated cumulative effects in the course of repeated acupuncture stimulation overlapped in the pain-related areas, including the bilateral middle cingulate cortex, the bilateral paracentral lobule, the SII, and the right thalamus. Furthermore, the cumulative effects demonstrated bimodal characteristics, i.e. the brain response was positive at the beginning, and became negative at the end. It was suggested that the cumulative effect of repeated acupuncture stimulation was consistent with the characteristic of habituation effects. This finding may explain the neurophysiologic mechanism underlying acupuncture analgesia.

  15. Association between CAG repeat polymorphisms and the risk of prostate cancer: a meta-analysis by race, study design and the number of (CAG)n repeat polymorphisms.

    Science.gov (United States)

    Sun, Jun-Hyun; Lee, Sang-Ah

    2013-11-01

    Although a number of studies have been conducted on the association between prostate cancer and CAG repeat polymorphisms of the androgen receptor gene, this association remains elusive and controversial. In this meta-analysis, we aimed to evaluate the effects of (CAG)n repeat genetic polymorphisms on the incidence of prostate cancer, particularly as regards race, study design and the number of (CAG)n repeats. To collect articles published on the association between CAG repeats and prostate cancer, publications were identified from the National Center for Biotechnology Information (NCBI) database of epidemiological studies published up to October 2011; our identification of publications was not limited by a language barrier. The following search keywords were used: prostate cancer risk, CAG repeat polymorphism, androgen receptor gene and human. Stata version 10 was used for the meta-analysis and the publication bias was measured through the Begg's test and Egger's test. This meta-analysis included 47 studies with 13,346 cases and 15,172 control or non-cases and consisted of 31 reports based on Caucasians, ten on Asians, one on Hispanics and four on combined ethnic groups. The carriers of a shorter CAG repeat sequence had an increased risk of prostate cancer (OR 1.21, 95% CI 1.10-1.34 for all subjects; OR 1.21, 95% CI 1.10-1.34 for prospective studies; OR 1.32, 95% CI 1.15-1.51 for retrospective studies) regardless of the exact length of the CAG repeat, compared with carriers of a longer repeat sequence. In terms of race, the risk of carrying a shorter CAG repeat sequence was 1.10- and 1.83-fold higher than that of a longer repeat sequence in Caucasians and Asians, respectively. For the specific number of CAG repeat polymorphisms, carriers of repeats were observed to have a higher risk of prostate cancer (OR 1.16, 95% CI 1.04-1.29) compared with carriers with ≥ 22 CAG repeat polymorphisms, particularly for Asians (OR 2.06, 95% CI 1.00-4.24). This meta

  16. A study on the trinucleotide repeat associated with Huntington`s disease in the Chinese

    Energy Technology Data Exchange (ETDEWEB)

    Bing-wen Soong; Jih-tsuu Wang [Neurological Institute, Taipei (Taiwan, Province of China)

    1994-09-01

    Analysis of the polymorphic (CAG)n repeat in the hungingtin gene in the chinese confirmed the presence of an expanded repeat on all Huntington`s disease chromosomes. Measurement of the specific CAG repeat sequence in 34 HD chromosomes from 15 unrelated families and 190 control chromosomes from the Chinese population showed a range from 9 to 29 repeats in normal subjects and 40 to 58 in affected subjects. The size distributions of normal and affected alleles did not overlap. A clear correlation bewteen early onset of symptoms and very high repeat number was seen, but the spread of the age-at-onset in the major repeat range producing characteristic HD it too wide to be of diagnostic value. There was also variability in the transmitted repeat size for both sexes in the HD size range. Maternal HD alleles showed a moderate instability with a preponderance of size decrease, while paternal HD alleles had a tendency to increase in repeat size on transmission, the degree of which appeared proportional to the initial size.

  17. Using Bayesian analysis in repeated preclinical in vivo studies for a more effective use of animals.

    Science.gov (United States)

    Walley, Rosalind; Sherington, John; Rastrick, Joe; Detrait, Eric; Hanon, Etienne; Watt, Gillian

    2016-05-01

    Whilst innovative Bayesian approaches are increasingly used in clinical studies, in the preclinical area Bayesian methods appear to be rarely used in the reporting of pharmacology data. This is particularly surprising in the context of regularly repeated in vivo studies where there is a considerable amount of data from historical control groups, which has potential value. This paper describes our experience with introducing Bayesian analysis for such studies using a Bayesian meta-analytic predictive approach. This leads naturally either to an informative prior for a control group as part of a full Bayesian analysis of the next study or using a predictive distribution to replace a control group entirely. We use quality control charts to illustrate study-to-study variation to the scientists and describe informative priors in terms of their approximate effective numbers of animals. We describe two case studies of animal models: the lipopolysaccharide-induced cytokine release model used in inflammation and the novel object recognition model used to screen cognitive enhancers, both of which show the advantage of a Bayesian approach over the standard frequentist analysis. We conclude that using Bayesian methods in stable repeated in vivo studies can result in a more effective use of animals, either by reducing the total number of animals used or by increasing the precision of key treatment differences. This will lead to clearer results and supports the "3Rs initiative" to Refine, Reduce and Replace animals in research. Copyright © 2016 John Wiley & Sons, Ltd.

  18. The role of exposure history on HIV acquisition: insights from repeated low-dose challenge studies.

    Directory of Open Access Journals (Sweden)

    Roland R Regoes

    Full Text Available To assess the efficacy of HIV vaccine candidates or preventive treatment, many research groups have started to challenge monkeys repeatedly with low doses of the virus. Such challenge data provide a unique opportunity to assess the importance of exposure history for the acquisition of the infection. I developed stochastic models to analyze previously published challenge data. In the mathematical models, I allowed for variation of the animals' susceptibility to infection across challenge repeats, or across animals. In none of the studies I analyzed, I found evidence for an immunizing effect of non-infecting challenges, and in most studies, there is no evidence for variation in the susceptibilities to the challenges across animals. A notable exception was a challenge experiment by Letvin et al. Sci Translat Med (2011 conducted with the strain SIVsmE660. The challenge data of this experiment showed significant susceptibility variation from animal-to-animal, which is consistent with previously established genetic differences between the involved animals. For the studies which did not show significant immunizing effects and susceptibility differences, I conducted a power analysis and could thus exclude a very strong immunization effect for some of the studies. These findings validate the assumption that non-infecting challenges do not immunize an animal - an assumption that is central in the argument that repeated low-dose challenge experiments increase the statistical power of preclinical HIV vaccine trials. They are also relevant for our understanding of the role of exposure history for HIV acquisition and forecasting the epidemiological spread of HIV.

  19. Repeat colonoscopy after a colonoscopy with a negative result in Ontario: a population-based cohort study.

    Science.gov (United States)

    Hol, Lieke; Sutradhar, Rinku; Gu, Sumei; Baxter, Nancy N; Rabeneck, Linda; Tinmouth, Jill M; Paszat, Lawrence F

    2015-01-01

    Data suggest the overuse of repeat colonoscopies, especially in patients at low risk for colorectal cancer. Our objective was to evaluate the time to repeat colonoscopies in low-risk patients aged 50-79 years old and the associated patient- and endoscopist-related factors. All patients aged 50-79 years of age who underwent a complete outpatient colonoscopy with a negative result between 2000 and 2007 were identified from the Ontario Health Insurance Plan database. A colonoscopy performed within 5.5 years of follow-up after the index colonoscopy was considered an early repeat colonoscopy. Patient, endoscopist and endoscopy setting characteristics were recorded and their association with an early repeat colonoscopy was determined using an extended Cox proportional hazards regression model. The cohort consisted of 546 467 patients: 55.4% of the patients were female with a mean age of 61.1 years (95% confidence interval [CI] 61.1-61.2). The cumulative percentage of early repeat colonoscopy after 5.5 years was 33.7%. The rate decreased significantly between 2000 and 2007 (hazard ratio [HR] 0.35, 95% CI 0.34-0.36). General surgeons were associated with a higher risk of early repeat colonoscopy than gastroenterologists (HR 1.27, 95% CI 1.25-1.28). Endoscopists practising in a nonhospital setting were more likely to perform an early repeat colonoscopy (HR 1.26, 95% CI 1.22-1.30) than endoscopists at a hospital. This study showed that there was overuse of early repeat colonoscopy in more than 30% of patients who were at low risk for colorectal cancer. The risk decreased significantly between 2000 and 2007 but was still greater than 20% in 2007. Our findings can be used to develop targeted educational interventions among subgroups of endoscopists with a higher rate of early repeat colonoscopy.

  20. Mice repeatedly exposed to Group-A β-Haemolytic Streptococcus show perseverative behaviors, impaired sensorimotor gating, and immune activation in rostral diencephalon

    OpenAIRE

    Simone Macrì; Chiara Ceci; Martina Proietti Onori; Roberto William Invernizzi; Erika Bartolini; Luisa Altabella; Rossella Canese; Monica Imperi; Graziella Orefici; Roberta Creti; Immaculada Margarit; Roberta Magliozzi; Giovanni Laviola

    2015-01-01

    Repeated exposure to Group-A β-Haemolytic Streptococcus (GAS) may constitute a vulnerability factor in the onset and course of pediatric motor disturbances. GAS infections/colonization can stimulate the production of antibodies, which may cross the blood brain barrier, target selected brain areas (e.g. basal ganglia), and exacerbate motor alterations. Here, we exposed developing SJL male mice to four injections with a GAS homogenate and evaluated the following domains: motor coordination; gen...

  1. Ghana Fiasco Shows Risks of Faculty-Led Study Trips

    Science.gov (United States)

    Fischer, Karin

    2007-01-01

    This article illustrates the importance of preparation for professors who take students overseas. A University of Washington study-abroad program in Ghana that was cut short last summer after the medical evacuation of half of its participants highlights the potential hazards associated with programs led by individual faculty members who may lack…

  2. Studies of the CAG repeat in the Machado-Joseph disease gene in Taiwan.

    Science.gov (United States)

    Hsieh, M; Tsai, H F; Lu, T M; Yang, C Y; Wu, H M; Li, S Y

    1997-08-01

    Machado-Joseph disease (MJD) is an autosomal dominant spinocerebellar degeneration characterized by cerebellar ataxia and pyramidal signs associated in varying degrees with a dystonic-rigid extrapyramidal syndrome or peripheral amyotrophy. Unstable CAG trinucleotide repeat expansion in the MJD gene on the long arm of chromosome 14 has been identified as the pathological mutation for MJD. While investigating the distribution of CAG repeat lengths of the MJD gene in Taiwan's population, we have identified 18 MJD-affected patients and 12 at-risk individuals in seven families. In addition, we have analyzed the range of CAG repeat lengths in 96 control individuals. The CAG repeat number ranged from 13 to 44 in the controls and 72-85 in the affected and at-risk individuals. Our results indicated that the CAG repeat number was inversely correlated with the age of onset. The differences in CAG repeat length between parent and child and between siblings are greater with paternal transmission than maternal transmission. Our data show a tendency towards the phenomenon of anticipation in the MJD families but do not support unidirectional expansion of CAG repeats during transmission. We also demonstrated that PCR amplification of the CAG repeats in the MJD gene from villous DNA was possible and might prove useful as a diagnostic tool for affected families in the future.

  3. Analysing Repeat Visitation on Country Level with Passive Mobile Positioning Method: an Estonian Case Study

    Directory of Open Access Journals (Sweden)

    Andres Kuusik

    2013-01-01

    Full Text Available The purpose of this paper is to investigate the capabilities and limits of the passive mobile positioning (PMP method in studying loyalty of tourists on the macro level. The repeat visitors were identified using database of call activities of roaming phones in Estonia since 25.04.2005 till 31.01.2009. For this purpose was developed model which selected repeat visits on the basis of time interval. The findings of the study revealed that it is possible to observe the duration, density, seasonality and dynamics of repeat visitations. In addition the local destinations and events most loved by repeat visitors and the trajectory they are using could be also identified. Another important finding revealed that repeat visitors stay longer in destination than first time visitors. The results presented in this paper could be used by Estonian Ministry of Economic Affairs and Communications and by Enterprise Estonia developing the Estonian tourism policy

  4. What gastric cancer proteomic studies show about gastric carcinogenesis?

    Science.gov (United States)

    Leal, Mariana Ferreira; Wisnieski, Fernanda; de Oliveira Gigek, Carolina; do Santos, Leonardo Caires; Calcagno, Danielle Queiroz; Burbano, Rommel Rodriguez; Smith, Marilia Cardoso

    2016-08-01

    Gastric cancer is a complex, heterogeneous, and multistep disease. Over the past decades, several studies have aimed to determine the molecular factors that lead to gastric cancer development and progression. After completing the human genome sequencing, proteomic technologies have presented rapid progress. Differently from the relative static state of genome, the cell proteome is dynamic and changes in pathologic conditions. Proteomic approaches have been used to determine proteome profiles and identify differentially expressed proteins between groups of samples, such as neoplastic and nonneoplastic samples or between samples of different cancer subtypes or stages. Therefore, proteomic technologies are a useful tool toward improving the knowledge of gastric cancer molecular pathogenesis and the understanding of tumor heterogeneity. This review aimed to summarize the proteins or protein families that are frequently identified by using high-throughput screening methods and which thus may have a key role in gastric carcinogenesis. The increased knowledge of gastric carcinogenesis will clearly help in the development of new anticancer treatments. Although the studies are still in their infancy, the reviewed proteins may be useful for gastric cancer diagnosis, prognosis, and patient management.

  5. Two novel DXZ4-associated long noncoding RNAs show developmental changes in expression coincident with heterochromatin formation at the human (Homo sapiens) macrosatellite repeat.

    Science.gov (United States)

    Figueroa, Debbie M; Darrow, Emily M; Chadwick, Brian P

    2015-12-01

    On the male X and female active X chromosome (Xa), the macrosatellite repeat (MSR) DXZ4 is packaged into constitutive heterochromatin characterized by CpG methylation and histone H3 tri-methylated at lysine-9 (H3K9me3). In contrast, DXZ4 on the female inactive X chromosome (Xi), is packaged into euchromatin, is bound by the architectural protein CCCTC-binding factor, and mediates Xi-specific long-range cis contact with similarly packaged tandem repeats on the Xi. In cancer, male DXZ4 can inappropriately revert to a Xi-like state and other MSRs have been reported to adopt alternate chromatin configurations in response to disease. Given this plasticity, we sought to identify factors that might control heterochromatin at DXZ4. In human embryonic stem cells, we found low levels of 5-hydroxymethylcytosine at DXZ4 and that this mark is lost upon differentiation as H3K9me3 is acquired. We identified two previously undescribed DXZ4 associated noncoding transcripts (DANT1 and DANT2) that are transcribed toward DXZ4 from promoters flanking the array. Each generates transcript isoforms that traverse the MSR. However, upon differentiation, enhancer of Zeste-2 silences DANT1, and DANT2 transcription terminates prior to entering DXZ4. These data support a model wherein DANT1 and/or DANT2 may function to regulate constitutive heterochromatin formation at this MSR.

  6. Two novel DXZ4-associated long noncoding RNAs show developmental changes in expression coincident with heterochromatin formation at the human (Homo sapiens) macrosatellite repeat

    Science.gov (United States)

    Figueroa, Debbie M.; Darrow, Emily M.; Chadwick, Brian P.

    2015-01-01

    On the male X and female active X chromosome (Xa), the macrosatellite repeat (MSR) DXZ4 is packaged into constitutive heterochromatin characterized by CpG methylation and histone H3 tri-methylated at lysine-9 (H3K9me3). In contrast, DXZ4 on the female inactive X chromosome (Xi), is packaged into euchromatin, is bound by the architectural protein CCCTC-binding factor, and mediates Xi-specific long-range cis contact with similarly packaged tandem repeats on the Xi. In cancer, male DXZ4 can inappropriately revert to a Xi-like state and other MSRs have been reported to adopt alternate chromatin configurations in response to disease. Given this plasticity, we sought to identify factors that might control heterochromatin at DXZ4. In human embryonic stem cells, we found low levels of 5-hydroxymethylcytosine at DXZ4, and that this mark is lost upon differentiation as H3K9me3 is acquired. We identified two previously undescribed DXZ4 associated non-coding transcripts (DANT1 and DANT2) that are transcribed towards DXZ4 from promoters flanking the array. Each generates transcript isoforms that traverse the MSR. However, upon differentiation, Enhancer of Zeste-2 silences DANT1, and DANT2 transcription terminates prior to entering DXZ4. These data support a model wherein DANT1 and/or DANT2 may function to regulate constitutive heterochromatin formation at this MSR. PMID:26188586

  7. Essays on diffusion and repeat sales of consumer durables : a study of the consumer electronics market

    OpenAIRE

    Kaya, Maria

    2008-01-01

    Although repeat purchases dominate overall sales of consumer durables, diffusion of innovations research has paid them far less attention than new product adoptions. A large survey of 8,077 households allowed a detailed investigation of the differences between households in terms of their repeat purchase behavior of durables. Asymmetric effects were investigated using competing hazard models and showed that consumer innovativeness has a strong impact on discretionary replacements. A modified ...

  8. Association study of the trinucleotide repeat polymorphism within SMARCA2 and schizophrenia

    Directory of Open Access Journals (Sweden)

    Danics Zoltan

    2006-06-01

    Full Text Available Abstract Background Brahma (BRM is a key component of the multisubunit SWI/SNF complex, a complex which uses the energy of ATP hydrolysis to remodel chromatin. BRM contains an N-terminal polyglutamine domain, encoded by a polymorphic trinucleotide (CAA/CAG repeat, the only known polymorphism in the coding region of the gene (SMARCA2. We have examined the association of this polymorphism with schizophrenia in a family-based and case/control study. SMARCA2 was chosen as a candidate gene because of its specific role in developmental pathways, its high expression level in the brain and some evidence of its association with schizophrenia spectrum disorder from genome-wide linkage analysis. Results Family-based analysis with 281 complete and incomplete triads showed that there is no significant preferential transmission of any of the alleles to the affected offspring. Also, in the case/control analysis, similar allele and genotype distributions were observed between affected cases (n = 289 and unaffected controls (n = 273 in each of three Caucasian populations studied: French Canadian, Tunisian and other Caucasians of European origin. Conclusion Results from our family-based and case-control association study suggest that there is no association between the trinucleotide repeat polymorphism within SMARCA2 and schizophrenia.

  9. Investigation of the toxicity of some organophosphorus pesticides in a repeated dose study in rats.

    Science.gov (United States)

    Baconi, Daniela Luiza; Bârcă, Maria; Manda, Gina; Ciobanu, Anne Marie; Bălălău, C

    2013-01-01

    The study aimed to the investigation of the toxicity of organophosphorus pesticides malathion (MLT) and diazinon (DZN) in Wistar rats in a repeated dose study for 35 days. MLT and DZN in corn oil vehicle were oral administered. Body and organs weights, plasma and brain cholinesterase activities, serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) activities, histopathological changes in liver and kidney, and some parameters of the immune function, such as leukocyte formula, spleen weight and cellularity, spleen lymphocytes proliferation in response to concanavalin A (Con A) were investigated; the potential oxidative stress (malondialdehyde in plasma and brain, and blood catalase activity) was also evaluated. No clinical toxicity signs attributed to pesticides were noted; no significant changes in the organ weights have been found. Body weight tends slightly to increase, predominantly in DZN treated rats. The results suggest that plasma cholinesterase is more susceptible than brain cholinesterase to the inhibitory effect of DZN and MLT. Other serum biochemical parameters showed no significant difference. DZN produced a marked increase of the number of spleen lymphocytes without a significant gain of the relative spleen weight. The both pesticides produced an increase of the number of mononuclear cells÷weight spleen. The splenic lymphocyte proliferation has not been influenced by MLT or DZN treatment. Histopathological observations identified some changes (vasodilatation, microvacuoles, and granular dystrophy) in the liver, with MLT, inducing macrovacuolar steatosis. The study indicates that repeated exposure, at subclinical doses, to organophosphorus MLT and DZN causes some biochemical, histopathological and immune alterations in rats.

  10. Prolonged repeated acupuncture stimulation induces habituation effects in pain-related brain areas: an FMRI study.

    Directory of Open Access Journals (Sweden)

    Chuanfu Li

    Full Text Available Most previous studies of brain responses to acupuncture were designed to investigate the acupuncture instant effect while the cumulative effect that should be more important in clinical practice has seldom been discussed. In this study, the neural basis of the acupuncture cumulative effect was analyzed. For this experiment, forty healthy volunteers were recruited, in which more than 40 minutes of repeated acupuncture stimulation was implemented at acupoint Zhusanli (ST36. Three runs of acupuncture fMRI datasets were acquired, with each run consisting of two blocks of acupuncture stimulation. Besides general linear model (GLM analysis, the cumulative effects of acupuncture were analyzed with analysis of covariance (ANCOVA to find the association between the brain response and the cumulative duration of acupuncture stimulation in each stimulation block. The experimental results showed that the brain response in the initial stage was the strongest although the brain response to acupuncture was time-variant. In particular, the brain areas that were activated in the first block and the brain areas that demonstrated cumulative effects in the course of repeated acupuncture stimulation overlapped in the pain-related areas, including the bilateral middle cingulate cortex, the bilateral paracentral lobule, the SII, and the right thalamus. Furthermore, the cumulative effects demonstrated bimodal characteristics, i.e. the brain response was positive at the beginning, and became negative at the end. It was suggested that the cumulative effect of repeated acupuncture stimulation was consistent with the characteristic of habituation effects. This finding may explain the neurophysiologic mechanism underlying acupuncture analgesia.

  11. A nationwide, population-based, long-term follow-up study of repeated self-harm in Taiwan

    Directory of Open Access Journals (Sweden)

    Chung Chi-Hsiang

    2012-09-01

    Full Text Available Abstract Background Previous follow-up studies of repeated self-harm show that the cumulative risk of repeated self-harm within one year is 5.7%–15%, with females at greatest risk. However, relatively few studies have focused on the Far East. The objective of this study was to calculate the cumulative risk of repeated self-harm over different lengths of follow-up time (3 months, 6 months, and 1–8 years, to determine factors influencing repeated self-harm and to explore the interaction between gender and self-harm methods. Methods We used self-harm patient who hospitalized due to first-time self-harm between 2000 and 2007 from 1,230 hospitals in Taiwan. Hospitalization for repeated self-harm among members of this cohort was tracked after 3 months, 6 months, and 1–8 years. Tracking continued until December 31, 2008. We analyzed the cumulative risk and risk factors of repeated self-harm by using negative binomial regression. Results Of the 39,875 individual study samples, 3,388 individuals (8.50% were found to have repeatedly self-harmed. The cumulative risk of repeated self-harm within three months was 7.19% and within one year was 8%. Within 8 years, it was 8.70%. Females were more likely to repeatedly self-harm than males (RR = 1.21, 95% CI = 1.15–1.76. The main method of self-harm was solid or liquid substances (RR = 1.88, 95% CI = 1.23–2.04 or cutting or piercing (RR = 1.36, 95% CI = 1.02–1.82, and in patients with psychiatric disorders were more likely to self-harm (RR = 1.61, 95% CI = 1.48–1.75. Conclusions The key time for intervention for repeated self-harm is within three months. Appropriate prevention programs should be developed based on gender differences.

  12. Neural Correlates of Empathy with Pain Show Habituation Effects. An fMRI Study.

    Directory of Open Access Journals (Sweden)

    Mira A Preis

    Full Text Available Neuroimaging studies have demonstrated that the actual experience of pain and the perception of another person in pain share common neural substrates, including the bilateral anterior insular cortex and the anterior midcingulate cortex. As many fMRI studies include the exposure of participants to repeated, similar stimuli, we examined whether empathic neural responses were affected by habituation and whether the participants' prior pain experience influenced these habituation effects.In 128 trials (four runs, 62 participants (31 women, 23.0 ± 4.2 years were shown pictures of hands exposed to painful pressure (pain pictures and unexposed (neutral pictures. After each trial, the participants rated the pain of the model. Prior to the experiment, participants were either exposed to the same pain stimulus (pain exposure group or not (touch exposure group. In order to assess possible habituation effects, linear changes in the strength of the BOLD response to the pain pictures (relative to the neutral pictures and in the ratings of the model's pain were evaluated across the four runs.Although the ratings of the model's pain remained constant over time, we found neural habituation in the bilateral anterior/midinsular cortex, the posterior midcingulate extending to dorsal posterior cingulate cortex, the supplementary motor area, the cerebellum, the right inferior parietal lobule, and the left superior frontal gyrus, stretching to the pregenual anterior cingulate cortex. The participant's prior pain experience did neither affect their ratings of the model's pain nor their maintenance of BOLD activity in areas associated with empathy. Interestingly, participants with high trait personal distress and fantasy tended to show less habituation in the anterior insula.Neural structures showed a decrease of the BOLD signal, indicating habituation over the course of 45 minutes. This can be interpreted as a neuronal mechanism responding to the repeated exposure to

  13. Responsiveness of 5-HT2C receptors in repeatedly diazepam-injected rats: a behavioral and neurochemical study.

    Science.gov (United States)

    Khan, Asma; Haleem, Darakhshan J

    2008-01-01

    The role of 5-hydroxytryptamine (serotonin; 5-HT)2C receptors in anxiety and the anxiolytic effects of drugs is well documented. In view of the withdrawal anxiety associated with repeated diazepam intake, the present study concerns the efficacy of 5-HT2C receptors in rats treated with diazepam. Results show that diazepam injections at a dose of 2 mg/kg daily for two weeks increased weekly food intake and growth rate. Anxiolytic effects of the drug monitored in a light/dark activity box were not significant after single administration. One week and two weeks of administration elicited anxiolytic effects, which were smaller after two weeks of administration as compared to one week, suggesting the development of tolerance to the anxiolytic profile of diazepam. Moreover, three days' withdrawal from repeated administration elicited anxiogenic behavior in the light/dark activity box. The behavioral and neurochemical effects of 1-(m-chlorophenyl)piperazine (m-CPP) (3 mg/kg), a 5-HT2C agonist, were monitored following withdrawal (three days) from two weeks of diazepam administration. Results showed that hypophagic as well as anxiogenic-like effects of m-CPP were not different from repeated saline or repeated diazepam-injected animals. Administration of m-CPP increased 5-HT metabolism in repeated saline as well as repeated diazepam-injected animals. However, m-CPP-induced increases in 5-HT metabolism were greater in repeated diazepam-injected animals. Results are discussed in the context of the role of 5-HT2C receptors in the precipitation of withdrawal anxiety.

  14. Study of four week repeated dose toxic test of Sweet Bee Venom in Beagle Dogs

    Directory of Open Access Journals (Sweden)

    Jae-Seuk Park

    2010-12-01

    Full Text Available Objectives: This study was performed to analyse four week repeated dose toxicity of Sweet Bee Venom(Sweet BV extracted from the bee venom in Beagle dogs. Methods: All experiments were conducted under the regulations of Good Laboratory Practice (GLP at Biotoxtech Company, a non-clinical study authorized institution. Male and female Beagle dogs of 5-6 months old were chosen for the pilot study of four week repeated dose toxicity of Sweet BV which was administered at the level of 0.56㎎/㎏ body weight which is eighty times higher than the clinical application dosage as the high dosage, followed by 0.28 and 0.14㎎/㎏ as midium and low dosage, respectively. Equal amount of excipient(normal saline to the Sweet BV experiment groups was administered as the control group every day for four weeks. Results: 1. No mortality was witnessed in all of the experiment groups. 2. All experiment groups were appealed pain sense in the treating time compared to the control group, and hyperemia and movement disorder were observed around the area of administration in all experiment groups, and higher occurrence in the higher dosage treatment. 3. For weight measurement, Neither male nor female groups showed significant changes. 4. In the urine analysis, CBC and biochemistry didn't show any significant changes in the experiment groups compared with control group. 5. For weight measurement of organs, experiment groups didn't show any significant changes compared with control group. 6. To verify abnormalities of organs and tissues, thigh muscle which treated with Sweet BV, cerebrum, liver, lung, kidney, and spinal cords were removed and conducted histologocal observation with H-E staining. In the histologocal observation of thigh muscle, cell infiltration, inflammatory, degeneration, necrosis of muscle fiber, and fibrosis were found in both thigh tissue. And the changes were depend on the dose of Sweet BV. But another organs were not detected in any abnormalities. 7

  15. Reduction and technical simplification of testing protocol for walking based on repeatability analyses: An Interreg IVa pilot study

    Directory of Open Access Journals (Sweden)

    Nejc Sarabon

    2010-12-01

    Full Text Available The aim of this study was to define the most appropriate gait measurement protocols to be used in our future studies in the Mobility in Ageing project. A group of young healthy volunteers took part in the study. Each subject carried out a 10-metre walking test at five different speeds (preferred, very slow, very fast, slow, and fast. Each walking speed was repeated three times, making a total of 15 trials which were carried out in a random order. Each trial was simultaneously analysed by three observers using three different technical approaches: a stop watch, photo cells and electronic kinematic dress. In analysing the repeatability of the trials, the results showed that of the five self-selected walking speeds, three of them (preferred, very fast, and very slow had a significantly higher repeatability of the average walking velocity, step length and cadence than the other two speeds. Additionally, the data showed that one of the three technical methods for gait assessment has better metric characteristics than the other two. In conclusion, based on repeatability, technical and organizational simplification, this study helped us to successfully define a simple and reliable walking test to be used in the main study of the project.

  16. Thermal stability of chicken brain {alpha}-spectrin repeat 17: a spectroscopic study

    Energy Technology Data Exchange (ETDEWEB)

    Brenner, Annette K. [University of Bergen, Department of Chemistry (Norway); Kieffer, Bruno [Ecole Superieure de Biotechnologie de Strasbourg, IGBMC Biomolecular NMR Group, CNRS UMR 7104 (France); Trave, Gilles [Ecole Superieure de Biotechnologie de Strasbourg, Equipe Oncoproteines, IREBS, UMR 7242 (France); Froystein, Nils Age [University of Bergen, Department of Chemistry (Norway); Raae, Arnt J., E-mail: arnt.raae@mbi.uib.no [University of Bergen, Department of Molecular Biology (Norway)

    2012-06-15

    Spectrin is a rod-like multi-modular protein that is mainly composed of triple-helical repeats. These repeats show very similar 3D-structures but variable conformational and thermodynamical stabilities, which may be of great importance for the flexibility and dynamic behaviour of spectrin in the cell. For instance, repeat 17 (R17) of the chicken brain spectrin {alpha}-chain is four times less stable than neighbouring repeat 16 (R16) in terms of Increment G. The structure of spectrin repeats has mainly been investigated by X-ray crystallography, but the structures of a few repeats, e.g. R16, have also been determined by NMR spectroscopy. Here, we undertook a detailed characterization of the neighbouring R17 by NMR spectroscopy. We assigned most backbone resonances and observed NOE restraints, relaxation values and coupling constants that all indicated that the fold of R17 is highly similar to that of R16, in agreement with previous X-ray analysis of a tandem repeat of the two domains. However, {sup 15}N heteronuclear NMR spectra measured at different temperatures revealed particular features of the R17 domain that might contribute to its lower stability. Conformational exchange appeared to alter the linker connecting R17 to R16 as well as the BC-loop in close proximity. In addition, heat-induced splitting was observed for backbone resonances of a few spatially related residues including V99 of helix C, which in R16 is replaced by the larger hydrophobic tryptophan residue that is relatively conserved among other spectrin repeats. These data support the view that the substitution of tryptophan by valine at this position may contribute to the lower stability of R17.

  17. Computational study of the human dystrophin repeats: interaction properties and molecular dynamics.

    Science.gov (United States)

    Legrand, Baptiste; Giudice, Emmanuel; Nicolas, Aurélie; Delalande, Olivier; Le Rumeur, Elisabeth

    2011-01-01

    Dystrophin is a large protein involved in the rare genetic disease Duchenne muscular dystrophy (DMD). It functions as a mechanical linker between the cytoskeleton and the sarcolemma, and is able to resist shear stresses during muscle activity. In all, 75% of the dystrophin molecule consists of a large central rod domain made up of 24 repeat units that share high structural homology with spectrin-like repeats. However, in the absence of any high-resolution structure of these repeats, the molecular basis of dystrophin central domain's functions has not yet been deciphered. In this context, we have performed a computational study of the whole dystrophin central rod domain based on the rational homology modeling of successive and overlapping tandem repeats and the analysis of their surface properties. Each tandem repeat has very specific surface properties that make it unique. However, the repeats share enough electrostatic-surface similarities to be grouped into four separate clusters. Molecular dynamics simulations of four representative tandem repeats reveal specific flexibility or bending properties depending on the repeat sequence. We thus suggest that the dystrophin central rod domain is constituted of seven biologically relevant sub-domains. Our results provide evidence for the role of the dystrophin central rod domain as a scaffold platform with a wide range of surface features and biophysical properties allowing it to interact with its various known partners such as proteins and membrane lipids. This new integrative view is strongly supported by the previous experimental works that investigated the isolated domains and the observed heterogeneity of the severity of dystrophin related pathologies, especially Becker muscular dystrophy.

  18. Computational study of the human dystrophin repeats: interaction properties and molecular dynamics.

    Directory of Open Access Journals (Sweden)

    Baptiste Legrand

    Full Text Available Dystrophin is a large protein involved in the rare genetic disease Duchenne muscular dystrophy (DMD. It functions as a mechanical linker between the cytoskeleton and the sarcolemma, and is able to resist shear stresses during muscle activity. In all, 75% of the dystrophin molecule consists of a large central rod domain made up of 24 repeat units that share high structural homology with spectrin-like repeats. However, in the absence of any high-resolution structure of these repeats, the molecular basis of dystrophin central domain's functions has not yet been deciphered. In this context, we have performed a computational study of the whole dystrophin central rod domain based on the rational homology modeling of successive and overlapping tandem repeats and the analysis of their surface properties. Each tandem repeat has very specific surface properties that make it unique. However, the repeats share enough electrostatic-surface similarities to be grouped into four separate clusters. Molecular dynamics simulations of four representative tandem repeats reveal specific flexibility or bending properties depending on the repeat sequence. We thus suggest that the dystrophin central rod domain is constituted of seven biologically relevant sub-domains. Our results provide evidence for the role of the dystrophin central rod domain as a scaffold platform with a wide range of surface features and biophysical properties allowing it to interact with its various known partners such as proteins and membrane lipids. This new integrative view is strongly supported by the previous experimental works that investigated the isolated domains and the observed heterogeneity of the severity of dystrophin related pathologies, especially Becker muscular dystrophy.

  19. Repeat endocarditis: analysis of risk factors based on the International Collaboration on Endocarditis - Prospective Cohort Study.

    Science.gov (United States)

    Alagna, L; Park, L P; Nicholson, B P; Keiger, A J; Strahilevitz, J; Morris, A; Wray, D; Gordon, D; Delahaye, F; Edathodu, J; Miró, J M; Fernández-Hidalgo, N; Nacinovich, F M; Shahid, R; Woods, C W; Joyce, M J; Sexton, D J; Chu, V H

    2014-06-01

    Repeat episodes of infective endocarditis (IE) can occur in patients who survive an initial episode. We analysed risk factors and 1-year mortality of patients with repeat IE. We considered 1874 patients enrolled in the International Collaboration on Endocarditis - Prospective Cohort Study between January 2000 and December 2006 (ICE-PCS) who had definite native or prosthetic valve IE and 1-year follow-up. Multivariable analysis was used to determine risk factors for repeat IE and 1-year mortality. Of 1874 patients, 1783 (95.2%) had single-episode IE and 91 (4.8%) had repeat IE: 74/91 (81%) with new infection and 17/91 (19%) with presumed relapse. On bivariate analysis, repeat IE was associated with haemodialysis (p 0.002), HIV (p 0.009), injection drug use (IDU) (p < 0.001), Staphylococcus aureus IE (p 0.003), healthcare acquisition (p 0.006) and previous IE before ICE enrolment (p 0.001). On adjusted analysis, independent risk factors were haemodialysis (OR, 2.5; 95% CI, 1.2-5.3), IDU (OR, 2.9; 95% CI, 1.6-5.4), previous IE (OR, 2.8; 95% CI, 1.5-5.1) and living in the North American region (OR, 1.9; 95% CI, 1.1-3.4). Patients with repeat IE had higher 1-year mortality than those with single-episode IE (p 0.003). Repeat IE is associated with IDU, previous IE and haemodialysis. Clinicians should be aware of these risk factors in order to recognize patients who are at risk of repeat IE.

  20. A study of allelic polymorphism of four short tandem repeats in the population of northwestern Russia

    Energy Technology Data Exchange (ETDEWEB)

    Aseev, M.V.; Skakun, V.N.; Baranov, V.S. [Ott Institute of Obstetrics and Gynecology, St. Petersburg (Russian Federation)

    1995-06-01

    Characteristics of the allelic polymorphisms of the trimeric AGC repeat of the androgen receptor gene (Xq11-12), exon 1 (AR); the tetrameric ATCT repeat of the von Willebrand factor gene (12p12), intron 40 (vWF); the AGAT repeat of the hypoxanthine phosphoribosyltransferase gene (Xq26) (HPRT); and the AGAT repeat of anonymous DNA sequences of the short arm of chromosome X (STRX1) were studied in 160 DNA samples from unrelated inhabitants of northwestern Russia using the method of polymerase chain reaction. Seventeen, ten, eight, and nine alleles were revealed electrophoretically for short tandem repeats of AR, vWF, HPRT, and STRX1, respectively. The heterozygosity indices for these repeats were 0.80, 0.70, 0.54, and 0.58, respectively. The values for AR and vWF correlated with those expected according to the Hardy-Weinberg equilibrium, whereas the values for HPRT and STRX1 differed significantly from those theoretically expected. The individualization potentials were 0.045, 0.135, 0.095, and 0.061 for the short tandem repeats of AR, vWF, HPRT, and STRX1, respectively. The distribution of genotypes for the set of these four loci in the population studied was determined. The possibilities of using the studied polymorphic marker systems in molecular diagnosis of the corresponding monogenic diseases - spinal and bulbar muscle atrophy (AR), Lesch-Nyhan disease (HPRT), and von Willebrand disease (vWF) - as well as in population human genetics, testing of personal identity, and molecular approaches to the estimation of mutagenic activity are discussed. 17 refs., 2 figs., 6 tabs.

  1. Anterior segment biometry: a study and review of resolution and repeatability data.

    Science.gov (United States)

    Reinstein, Dan Z; Gobbe, Marine; Archer, Timothy J

    2012-07-01

    To obtain comparable resolution and repeatability data for a selection of anterior segment imaging devices. A standard letter of request was sent in May 2008 to each device manufacturer requesting resolution and repeatability data for its device to be provided according to specific definitions and protocol; if this was not already published in the peer-reviewed domain, compliant raw data were required. Where applicable, repeatability data were reported for corneal vertex corneal thickness; epithelial and flap thickness; minimum corneal thickness; corneal, epithelial and flap thickness mapping for the central 6-mm diameter; minimum residual stromal thickness; angle-to-angle diameter; sulcus-to-sulcus diameter; and anterior chamber depth. To summarize published repeatability data, a complete review of the peer-reviewed literature waas performed. Nine of the 13 manufacturers contacted agreed to take part and provided the data requested: Pentacam HD (Oculus Optikgeräte GmbH), Galilei (Ziemer), Visante OCT (Carl Zeiss Meditec), SL-OCT (Haag-Streit), RTVue (Optovue), Artemis (ArcScan), Vumax (Sonomed), HiScan (Opticon), and Eye Cubed (Ellex/Innovative). Only one (Carl Zeiss Meditec) of 9 manufacturers was able to provide the data directly upon request, without performing a prospective study. Five of the 9 manufacturers were able to provide a complete set of repeatability data for all parameters measurable with their device; the remaining 4 manufacturers admitted that repeatability of some parameters was unknown. Both literature and manufacturers' data on file were lacking and required the study to be performed. This report provides an imperfect, but most comprehensive to date, resolution and repeatability data review of biometric devices intended for surgical planning. Copyright 2012, SLACK Incorporated.

  2. Assessing the repeatability of terrestrial laser scanning for monitoring gully topography: A case study from Aratula, Queensland, Australia

    Science.gov (United States)

    Goodwin, Nicholas Robert; Armston, John; Stiller, Isaac; Muir, Jasmine

    2016-06-01

    Terrestrial laser scanning (TLS) technology is a powerful tool for quantifying gully morphology and monitoring change over time. This is due to the high sampling density, sub-centimetre positional accuracies (x, y, z), flexibility of survey configurations and ability to link multiple TLS scans together. However, to ensure correct interpretation of results, research is needed to test the repeatability of TLS derived products to quantify the accuracy and separate 'false' from 'true' geomorphic change. In this study, we use the RIEGL VZ400 scanner to test the repeatability of TLS datasets for mapping gully morphology. We then quantify change following a rainfall event of approximately 100 mm. Our study site, located in south-east Queensland, Australia was chosen to be challenging from a repeatability perspective with high topographic variability. The TLS data capture involved three sets of linked scans: one survey pre-rainfall, to be compared to two surveys post-rainfall acquired on consecutive days. Change is considered negligible in the two post-rainfall scans to test survey repeatability. To verify TLS accuracy, an independent dataset of gully extent and spot heights were acquired using traditional total station techniques. Results confirm that the TLS datasets can be registered multi-temporally at sub-centimetre levels of accuracy in three dimensions. Total station and TLS elevation samples showed strong agreement with a mean error and standard deviation (SD) of residuals equal to 0.052 and 0.047 m, respectively (n = 889). Significantly, our repeatability tests found that return type and pulse deviation influence the accuracy and repeatability of DEMs in gully environments. Analysis of consecutive day datasets showed that DEMs derived from first return data recorded 40% higher SD of residual error than DEMs using multiple return data. A significant empirical relationship between pulse deviation and the variance of residuals for repeat DEMs is also shown (r2 = 0

  3. Receptionist input to quality and safety in repeat prescribing in UK general practice: ethnographic case study.

    Science.gov (United States)

    Swinglehurst, Deborah; Greenhalgh, Trisha; Russell, Jill; Myall, Michelle

    2011-11-03

    To describe, explore, and compare organisational routines for repeat prescribing in general practice to identify contributors and barriers to safety and quality. Ethnographic case study. Four urban UK general practices with diverse organisational characteristics using electronic patient records that supported semi-automation of repeat prescribing. 395 hours of ethnographic observation of staff (25 doctors, 16 nurses, 4 healthcare assistants, 6 managers, and 56 reception or administrative staff), and 28 documents and other artefacts relating to repeat prescribing locally and nationally. Potential threats to patient safety and characteristics of good practice. Observation of how doctors, receptionists, and other administrative staff contributed to, and collaborated on, the repeat prescribing routine. Analysis included mapping prescribing routines, building a rich description of organisational practices, and drawing these together through narrative synthesis. This was informed by a sociological model of how organisational routines shape and are shaped by information and communications technologies. Results Repeat prescribing was a complex, technology-supported social practice requiring collaboration between clinical and administrative staff, with important implications for patient safety. More than half of requests for repeat prescriptions were classed as "exceptions" by receptionists (most commonly because the drug, dose, or timing differed from what was on the electronic repeat list). They managed these exceptions by making situated judgments that enabled them (sometimes but not always) to bridge the gap between the idealised assumptions about tasks, roles, and interactions that were built into the electronic patient record and formal protocols, and the actual repeat prescribing routine as it played out in practice. This work was creative and demanded both explicit and tacit knowledge. Clinicians were often unaware of this input and it did not feature in policy

  4. Planned Repeat Cesarean Section at Term and Adverse Childhood Health Outcomes: A Record-Linkage Study.

    Directory of Open Access Journals (Sweden)

    Mairead Black

    2016-03-01

    Full Text Available Global cesarean section (CS rates range from 1% to 52%, with a previous CS being the commonest indication. Labour following a previous CS carries risk of scar rupture, with potential for offspring hypoxic brain injury, leading to high rates of repeat elective CS. However, the effect of delivery by CS on long-term outcomes in children is unclear. Increasing evidence suggests that in avoiding exposure to maternal bowel flora during labour or vaginal birth, offspring delivered by CS may be adversely affected in terms of energy uptake from the gut and immune development, increasing obesity and asthma risks, respectively. This study aimed to address the evidence gap on long-term childhood outcomes following repeat CS by comparing adverse childhood health outcomes after (1 planned repeat CS and (2 unscheduled repeat CS with those that follow vaginal birth after CS (VBAC.A data-linkage cohort study was performed. All second-born, term, singleton offspring delivered between 1 January 1993 and 31 December 2007 in Scotland, UK, to women with a history of CS (n = 40,145 were followed up until 31 January 2015. Outcomes assessed included obesity at age 5 y, hospitalisation with asthma, learning disability, cerebral palsy, and death. Cox regression and binary logistic regression were used as appropriate to compare outcomes following planned repeat CS (n = 17,919 and unscheduled repeat CS (n = 8,847 with those following VBAC (n = 13,379. Risk of hospitalisation with asthma was greater following both unscheduled repeat CS (3.7% versus 3.3%, adjusted hazard ratio [HR] 1.18, 95% CI 1.05-1.33 and planned repeat CS (3.6% versus 3.3%, adjusted HR 1.24, 95% CI 1.09-1.42 compared with VBAC. Learning disability and death were more common following unscheduled repeat CS compared with VBAC (3.7% versus 2.3%, adjusted odds ratio 1.64, 95% CI 1.17-2.29, and 0.5% versus 0.4%, adjusted HR 1.50, 95% CI 1.00-2.25, respectively. Risk of obesity at age 5 y and risk of cerebral

  5. Strengths and limitations of using repeat-dose toxicity studies to predict effects on fertility.

    Science.gov (United States)

    Dent, M P

    2007-08-01

    The upcoming European chemicals legislation REACH (Registration, Evaluation, and Authorisation of Chemicals) will require the risk assessment of many thousands of chemicals. It is therefore necessary to develop intelligent testing strategies to ensure that chemicals of concern are identified whilst minimising the testing of chemicals using animals. Xenobiotics may perturb the reproductive cycle, and for this reason several reproductive studies are recommended under REACH. One of the endpoints assessed in this battery of tests is mating performance and fertility. Animal tests that address this endpoint use a relatively large number of animals and are also costly in terms of resource, time, and money. If it can be shown that data from non-reproductive studies such as in-vitro or repeat-dose toxicity tests are capable of generating reliable alerts for effects on fertility then some animal testing may be avoided. Available rat sub-chronic and fertility data for 44 chemicals that have been classified by the European Union as toxic to fertility were therefore analysed for concordance of effects. Because it was considered appropriate to read across data for some chemicals these data sets were considered relevant for 73 of the 102 chemicals currently classified as toxic to reproduction (fertility) under this system. For all but 5 of these chemicals it was considered that a well-performed sub-chronic toxicity study would have detected pathology in the male, and in some cases, the female reproductive tract. Three showed evidence of direct interaction with oestrogen or androgen receptors (linuron, nonylphenol, and fenarimol). The remaining chemicals (quinomethionate and azafenidin) act by modes of action that do not require direct interaction with steroid receptors. However, both these materials caused in-utero deaths in pre-natal developmental toxicity studies, and the relatively low NOAELs and the nature of the hazard identified in the sub-chronic tests provides an alert

  6. Longitudinal study of repeated sprint performance in youth soccer players of contrasting skeletal maturity status

    NARCIS (Netherlands)

    Valente-dos-Santos, Joao; Coelho-e-Silva, Manuel J.; Severino, Vitor; Duarte, Joao; Martins, Raul S.; Figueiredo, Antonio J.; Seabra, Andre T.; Philippaerts, Renaat M.; Cumming, Sean P.; Elferink-Gemser, Marije; Malina, Robert M.

    The purpose of the study was to evaluate the developmental changes in performance in a repeated-sprint ability (RSA) test in young soccer players of contrasting maturity status. A total of 83 regional level Portuguese youth soccer players, aged 11-13 years at baseline was assessed annually. Stature,

  7. Longitudinal study of repeated sprint performance in youth soccer players of contrasting maturity status

    NARCIS (Netherlands)

    V. Duarte; A. Seabra; A. Figueiredo; S. Cumming; R. Martins; R. Philippaerts; M. Coelho e Silva; J. Valente dos Santos; V. Severino; Marije Elferink-Gemser

    2012-01-01

    The purpose of the study was to evaluate the developmental changes in performance in a repeated-sprint ability (RSA) test in young soccer players of contrasting maturity status. A total of 83 regional level Portuguese youth soccer players, aged 11- 13 years at baseline was assessed annually.

  8. 40 CFR 799.9305 - TSCA Repeated dose 28-day oral toxicity study in rodents.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 31 2010-07-01 2010-07-01 true TSCA Repeated dose 28-day oral toxicity study in rodents. 799.9305 Section 799.9305 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... strains of young healthy adult animals should be employed. The females should be nulliparous and...

  9. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study

    Directory of Open Access Journals (Sweden)

    Yan-Min Ma

    2014-06-01

    Full Text Available This study aimed to investigate the correlations among androgen receptor (AR CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years were enrolled. The individuals were grouped as CAG short (CAG S if they harbored repeat length of ≤20 or as CAG long (CAG L if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified physicians; CAG repeat polymorphism was determined by the polymerase chain reaction (PCR method; and the serum levels of the sex hormones were detected by radioimmunoassay. Student's t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T level was positively associated with the AR CAG repeat length (P = 0.01; whereas, no significant correlation of T or AR CAG repeat polymorphism with the penile length was found (P = 0.593. Interestingly, an inverse association was observed between serum prolactin (PRL levels and penile length by linear regression analyses (β= −0.024, P = 0.039, 95% confidence interval (CI: −0.047, 0. Collectively, this study provides the first evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  10. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study.

    Science.gov (United States)

    Ma, Yan-Min; Wu, Kai-Jie; Ning, Liang; Zeng, Jin; Kou, Bo; Xie, Hong-Jun; Ma, Zhen-Kun; Wang, Xin-Yang; Gong, Yong-Guang; He, Da-Lin

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAG S ) if they harbored repeat length of ≤ 20 or as CAG long (CAG L ) if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified physicians; CAG repeat polymorphism was determined by the polymerase chain reaction (PCR) method; and the serum levels of the sex hormones were detected by radioimmunoassay. Student's t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T) level was positively associated with the AR CAG repeat length (P = 0.01); whereas, no significant correlation of T or AR CAG repeat polymorphism with the penile length was found (P = 0.593). Interestingly, an inverse association was observed between serum prolactin (PRL) levels and penile length by linear regression analyses (β= -0.024, P = 0.039, 95% confidence interval (CI): -0.047, 0). Collectively, this study provides the first evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  11. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China:a cross-sectional study

    Institute of Scientific and Technical Information of China (English)

    YanMin Ma; DaLin He; KaiJie Wu; Liang Ning; Jin Zeng; Bo Kou; HongJun Xie; ZhenKun Ma; XinYang Wang; YongGuang Gong

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and iffty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAGS) if they harbored repeat length of≤20 or as CAG long (CAGL) if their CAG repeat length was>20. Body height/weight, penile length and other parameters were examined and recorded by the speciifed physicians;CAG repeat polymorphism was determined by the polymerase chain reaction (PCR) method;and the serum levels of the sex hormones were detected by radioimmunoassay. Student’s t-test or linear regression analysis was used to assess the associations among AR CAG repeat polymorphism, sex hormones and penile length. This investigation showed that the serum total testosterone (T) level was positively associated with the AR CAG repeat length (P= 0.01); whereas, no signiifcant correlation of T or AR CAG repeat polymorphism with the penile length was found (P= 0.593). Interestingly, an inverse association was observed between serum prolactin (PRL) levels and penile length by linear regression analyses (b=-0.024, P= 0.039, 95%conifdence interval (CI):-0.047, 0). Collectively, this study provides the ifrst evidence that serum PRL, but not T or AR CAG repeat polymorphism, is correlated with penile length in the Han adult population from northwestern China.

  12. Repeated exposure of acidic beverages on esthetic restorative materials: An in-vitro surface microhardness study.

    Science.gov (United States)

    Xavier, Arun M; Sunny, Steffy M; Rai, Kavita; Hegde, Amitha M

    2016-07-01

    A manifold increase in the consumption of aerated beverages has witnessed a twin increase in tooth wear and raised demand for esthetic restorative materials. This study aimed to evaluate the surface microhardness changes of esthetic restorative materials following treatment with aerated beverages in an in-vitro situation. The initial surface microhardness of the restorative materials GC Fuji II LC, GC Fuji IX, Nano Glass ionomer, Resin and Nano composite was recorded. These materials were studied under 3 groups that included those exposed to the acidic beverages daily, weekly once in a month and those that had no exposures at all. The final surface microhardness of the materials was recorded following experimentation and was subjected to statistical comparisons. The restorative materials were compared for their surface microhardness changes following respective treatments using the T-test and One-way ANOVA analysis. Inter-comparisons between the groups showed statistical significance (pmaterials revealed surface microhardness loss; the maximum reduction noticed with the Nano glass ionomer cement tested (pmaterials markedly reduced upon repeated exposures with acidic beverages; the product with phosphoric acid producing the maximum surface microhardness loss. Restorative materials, acidic beverages, surface microhardness, resin composites, glass ionomers.

  13. Origin and fate of repeats in bacteria.

    Science.gov (United States)

    Achaz, G; Rocha, E P C; Netter, P; Coissac, E

    2002-07-01

    We investigated 53 complete bacterial chromosomes for intrachromosomal repeats. In previous studies on eukaryote chromosomes, we proposed a model for the dynamics of repeats based on the continuous genesis of tandem repeats, followed by an active process of high deletion rate, counteracted by rearrangement events that may prevent the repeats from being deleted. The present study of long repeats in the genomes of Bacteria and Archaea suggests that our model of interspersed repeats dynamics may apply to them. Thus the duplication process might be a consequence of very ancient mechanisms shared by all three domains. Moreover, we show that there is a strong negative correlation between nucleotide composition bias and the repeat density of genomes. We hypothesise that in highly biased genomes, non-duplicated small repeats arise more frequently by random effects and are used as primers for duplication mechanisms, leading to a higher density of large repeats.

  14. Optimal selection of individuals for repeated covariate measurements in follow-up studies.

    Science.gov (United States)

    Reinikainen, Jaakko; Karvanen, Juha; Tolonen, Hanna

    2016-12-01

    Repeated covariate measurements bring important information on the time-varying risk factors in long epidemiological follow-up studies. However, due to budget limitations, it may be possible to carry out the repeated measurements only for a subset of the cohort. We study cost-efficient alternatives for the simple random sampling in the selection of the individuals to be remeasured. The proposed selection criteria are based on forms of the D-optimality. The selection methods are compared with the simulation studies and illustrated with the data from the East-West study carried out in Finland from 1959 to 1999. The results indicate that cost savings can be achieved if the selection is focused on the individuals with high expected risk of the event and, on the other hand, on those with extreme covariate values in the previous measurements. © The Author(s) 2014.

  15. Brexpiprazole Alters Monoaminergic Systems following Repeated Administration: an in Vivo Electrophysiological Study

    OpenAIRE

    Oosterhof, Chris A.; Mansari, Mostafa El; Bundgaard, Christoffer; Blier, Pierre

    2015-01-01

    Background: Brexpiprazole was recently approved as adjunctive therapy for depression and treatment of schizophrenia in adults. To complement results from a previous study in which its acute effects were characterized, the present study assessed the effect of repeated brexpiprazole administration on monoaminergic systems. Methods: Brexpiprazole (1mg/kg, subcutaneous) or vehicle was administered once daily for 2 and 14 days. Single-unit electrophysiological recordings from noradrenaline neurons...

  16. Comparative Genomic Hybridization Selection of Blastocysts for Repeated Implantation Failure Treatment: A Pilot Study

    Science.gov (United States)

    Greco, Ermanno; Bono, Sara; Ruberti, Alessandra; Lobascio, Anna Maria; Greco, Pierfrancesco; Biricik, Anil; Spizzichino, Letizia; Greco, Alessia; Tesarik, Jan; Minasi, Maria Giulia; Fiorentino, Francesco

    2014-01-01

    The aim of this study is to determine if the use of preimplantation genetic screening (PGS) by array comparative genomic hybridization (array CGH) and transfer of a single euploid blastocyst in patients with repeated implantation failure (RIF) can improve clinical results. Three patient groups are compared: 43 couples with RIF for whom embryos were selected by array CGH (group RIF-PGS), 33 couples with the same history for whom array CGH was not performed (group RIF NO PGS), and 45 good prognosis infertile couples with array CGH selected embryos (group NO RIF PGS). A single euploid blastocyst was transferred in groups RIF-PGS and NO RIF PGS. Array CGH was not performed in group RIF NO PGS in which 1-2 blastocysts were transferred. One monoembryonic sac with heartbeat was found in 28 patients of group RIF PGS and 31 patients of group NO RIF PGS showing similar clinical pregnancy and implantation rates (68.3% and 70.5%, resp.). In contrast, an embryonic sac with heartbeat was only detected in 7 (21.2%) patients of group RIF NO PGS. In conclusion, PGS by array CGH with single euploid blastocyst transfer appears to be a successful strategy for patients with multiple failed IVF attempts. PMID:24779011

  17. Study on the homocysteine metabolism of patients with unexplained repeated spontaneous abortion

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    Objective:To study the metabolism abnormality of homocysteine(Hcy) in unexplained repeated spontaneous abortion(URSA).Methods:The level of Hcy in sera was measured with hyperpressure liquid chromatography(HPLC);Folic acid and vitamin B12 were detected by radioimmune assay;anticardiolipin antibody (ACA) was detected by ELISA.Results:(1)The level of serum Hcy in URSA group was significantly higher than that in control group,showing a statistical significant difference(P<0.01).The level of Hcy was correlated with ages,but not correlated with areas,numbers of miscarriage,gestation age,primary or secondary abortions.(2)The levels of folic acid and vitamin B12 in URSA group were significantly lower than those in control group.The levels of serum folic acid and vitamin B12 were not correlated with age,area,numbers of miscarriage and abortion periods.(3)ACA positive rate in URSA was significantly higher than that in control group.The level of Hcy in ACA(+) group was significantly higher than that in ACA(-) group among URSA patients.Conclusions:Hyperhomocysteinemia,low folic acid state,and ACA were all the independent risk factors for URSA.Lacking of folic acid and vitamin B12 is one of the important causes of hyperhomocysteinemia.ACA and hyperhomocysteinemia may have synergistic action in the occurrence of URSA.

  18. Evaluation of statistical tools used in short-term repeated dose administration toxicity studies with rodents.

    Science.gov (United States)

    Kobayashi, Katsumi; Pillai, K Sadasivan; Sakuratani, Yuki; Abe, Takemaru; Kamata, Eiichi; Hayashi, Makoto

    2008-02-01

    In order to know the different statistical tools used to analyze the data obtained from twenty-eight-day repeated dose oral toxicity studies with rodents and the impact of these statistical tools on interpretation of data obtained from the studies, study reports of 122 numbers of twenty-eight-day repeated dose oral toxicity studies conducted in rats were examined. It was found that both complex and easy routes of decision trees were followed for the analysis of the quantitative data. These tools include Scheffe's test, non-parametric type Dunnett's and Scheffe's tests with very low power. Few studies used the non-parametric Dunnett type test and Mann-Whitney's U test. Though Chi-square and Fisher's tests are widely used for analysis of qualitative data, their sensitivity to detect a treatment-related effect is questionable. Mann-Whitney's U test has better sensitivity to analyze qualitative data than the chi-square and Fisher's tests. We propose Dunnett's test for analysis of quantitative data obtained from twenty-eight-day repeated dose oral toxicity tests and for qualitative data, Mann-Whitney's U test. For both tests, one-sided test with p=0.05 may be applied.

  19. Repeated vertebral augmentation for new vertebral compression fractures of postvertebral augmentation patients: a nationwide cohort study

    Directory of Open Access Journals (Sweden)

    Liang CL

    2015-03-01

    Full Text Available Cheng-Loong Liang,1 Hao-Kwan Wang,1 Fei-Kai Syu,2 Kuo-Wei Wang,1 Kang Lu,1 Po-Chou Liliang1 1Department of Neurosurgery, E-Da Hospital, I-Shou University, Kaohsiung City, Taiwan; 2Department of Pharmacy, China Medical University Hospital, Taichung City, Taiwan Purpose: Postvertebral augmentation vertebral compression fractures are common; repeated vertebral augmentation is usually performed for prompt pain relief. This study aimed to evaluate the incidence and risk factors of repeat vertebral augmentation.Methods: We performed a retrospective, nationwide, population-based longitudinal observation study, using the National Health Insurance Research Database (NHIRD of Taiwan. All patients who received vertebral augmentation for vertebral compression fractures were evaluated. The collected data included patient characteristics (demographics, comorbidities, and medication exposure and repeat vertebral augmentation. Kaplan–Meier and stratified Cox proportional hazard regressions were performed for analyses.Results: The overall incidence of repeat vertebral augmentation was 11.3% during the follow-up until 2010. Patients with the following characteristics were at greater risk for repeat vertebral augmentation: female sex (AOR=1.24; 95% confidence interval [CI]: 1.10–2.36, advanced age (AOR=1.60; 95% CI: 1.32–2.08, diabetes mellitus (AOR=4.31; 95% CI: 4.05–5.88, cerebrovascular disease (AOR=4.09; 95% CI: 3.44–5.76, dementia (AOR=1.97; 95% CI: 1.69–2.33, blindness or low vision (AOR=3.72; 95% CI: 2.32–3.95, hypertension (AOR=2.58; 95% CI: 2.35–3.47, and hyperlipidemia (AOR=2.09; 95% CI: 1.67–2.22. Patients taking calcium/ vitamin D (AOR=2.98; 95% CI: 1.83–3.93, bisphosphonates (AOR=2.11; 95% CI: 1.26–2.61, or calcitonin (AOR=4.59; 95% CI: 3.40–5.77 were less likely to undergo repeat vertebral augmentation; however, those taking steroids (AOR=7.28; 95% CI: 6.32–8.08, acetaminophen (AOR=3.54; 95% CI: 2.75–4.83, or nonsteroidal

  20. Identification and characterization of simple sequence repeats (SSRs) for population studies of Puccinia novopanici.

    Science.gov (United States)

    Orquera-Tornakian, Gabriela K; Garrido, Patricia; Kronmiller, Brent; Hunger, Robert; Tyler, Brett M; Garzon, Carla D; Marek, Stephen M

    2017-08-01

    Switchgrass (Panicum virgatum L.) can be severely affected by rust disease. Recently switchgrass rust caused by P. emaculata (now confirmed to be Puccinia novopanici) has received most of the attention by the research community because this pathogen is responsible for reducing the biomass production and biofuel feedstock quality of switchgrass. Microsatellite markers found in the literature were either not informative (no allele frequency) or showed few polymorphisms in the target populations, therefore additional markers are needed for future studies of the genetic variation and population structure of P. novopanici. This study reports the development and characterization of novel simple sequence repeat (SSR) markers from a Puccinia emaculata s.l. microsatellite-enriched library and expressed sequence tags (ESTs). Microsatellites were evaluated for polymorphisms on P. emaculata s.l. urediniospores collected in Iowa (IA), Mississippi (MS), Oklahoma (OK), South Dakota (SD) and Virginia (VA). Puccinia novopanici single spore whole genome amplifications were used as templates to validate the SSR reactions protocol and to assess a preliminary population genetics statistics of the pathogen. Eighteen microsatellite markers were polymorphic (average PIC=0.72) on individual urediniospores, with an average of 8.3 alleles per locus (range 3 to 17). Of the 49 SSRs loci initially identified in P. emaculata s.l., 18 were transferable to P. striiformis f. sp. tritici, 23 to P. triticina, 20 to P. sorghi and 31 to P. andropogonis. Thus, these markers could be useful for DNA fingerprinting and population structure analysis for population genetics, epidemiology and ecological studies of P. novopanici and potentially other related Puccinia species. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Expansion of protein domain repeats.

    Directory of Open Access Journals (Sweden)

    Asa K Björklund

    2006-08-01

    Full Text Available Many proteins, especially in eukaryotes, contain tandem repeats of several domains from the same family. These repeats have a variety of binding properties and are involved in protein-protein interactions as well as binding to other ligands such as DNA and RNA. The rapid expansion of protein domain repeats is assumed to have evolved through internal tandem duplications. However, the exact mechanisms behind these tandem duplications are not well-understood. Here, we have studied the evolution, function, protein structure, gene structure, and phylogenetic distribution of domain repeats. For this purpose we have assigned Pfam-A domain families to 24 proteomes with more sensitive domain assignments in the repeat regions. These assignments confirmed previous findings that eukaryotes, and in particular vertebrates, contain a much higher fraction of proteins with repeats compared with prokaryotes. The internal sequence similarity in each protein revealed that the domain repeats are often expanded through duplications of several domains at a time, while the duplication of one domain is less common. Many of the repeats appear to have been duplicated in the middle of the repeat region. This is in strong contrast to the evolution of other proteins that mainly works through additions of single domains at either terminus. Further, we found that some domain families show distinct duplication patterns, e.g., nebulin domains have mainly been expanded with a unit of seven domains at a time, while duplications of other domain families involve varying numbers of domains. Finally, no common mechanism for the expansion of all repeats could be detected. We found that the duplication patterns show no dependence on the size of the domains. Further, repeat expansion in some families can possibly be explained by shuffling of exons. However, exon shuffling could not have created all repeats.

  2. Chromosomal abnormalities in couples with repeated fetal loss: An Indian retrospective study

    Directory of Open Access Journals (Sweden)

    Frenny J Sheth

    2013-01-01

    Full Text Available Background: Recurrent pregnancy loss is a common occurrence and a matter of concern for couples planning the pregnancy. Chromosomal abnormalities, mainly balanced rearrangements, are common in couples with repeated miscarriages. Purpose: The purpose of this study is to evaluate the contribution of chromosomal anomalies causing repeated spontaneous miscarriages and provide detailed characterization of a few structurally altered chromosomes. Materials and Methods: A retrospective cytogenetic study was carried out on 4859 individuals having a history of recurrent miscarriages. The cases were analyzed using G-banding and fluorescence in situ hybridization wherever necessary. Results: Chromosomal rearrangements were found in 170 individuals (3.5%. Translocations were seen in 72 (42.35% cases. Of these, reciprocal translocations constituted 42 (24.70% cases while Robertsonian translocations were detected in 30 (17.64% cases. 7 (4.11% cases were mosaic, 8 (4.70% had small supernumerary marker chromosomes and 1 (0.6% had an interstitial microdeletion. Nearly, 78 (1.61% cases with heteromorphic variants were seen of which inversion of Y chromosome (57.70% and chromosome 9 pericentromeric variants (32.05% were predominantly involved. Conclusions: Chromosomal analysis is an important etiological investigation in couples with repeated miscarriages. Characterization of variants/marker chromosome enable calculation of a more precise recurrent risk in a subsequent pregnancy thereby facilitating genetic counseling and deciding further reproductive options.

  3. On the Applicability of Elastic Network Models for the Study of RNA CUG Trinucleotide Repeat Overexpansion.

    Directory of Open Access Journals (Sweden)

    Àlex L González

    Full Text Available Non-coding RNAs play a pivotal role in a number of diseases promoting an aberrant sequestration of nuclear RNA-binding proteins. In the particular case of myotonic dystrophy type 1 (DM1, a multisystemic autosomal dominant disease, the formation of large non-coding CUG repeats set up long-tract hairpins able to bind muscleblind-like proteins (MBNL, which trigger the deregulation of several splicing events such as cardiac troponin T (cTNT and insulin receptor's, among others. Evidence suggests that conformational changes in RNA are determinant for the recognition and binding of splicing proteins, molecular modeling simulations can attempt to shed light on the structural diversity of CUG repeats and to understand their pathogenic mechanisms. Molecular dynamics (MD are widely used to obtain accurate results at atomistic level, despite being very time consuming, and they contrast with fast but simplified coarse-grained methods such as Elastic Network Model (ENM. In this paper, we assess the application of ENM (traditionally applied on proteins for studying the conformational space of CUG repeats and compare it to conventional and accelerated MD conformational sampling. Overall, the results provided here reveal that ANM can provide useful insights into dynamic rCUG structures at a global level, and that their dynamics depend on both backbone and nucleobase fluctuations. On the other hand, ANM fail to describe local U-U dynamics of the rCUG system, which require more computationally expensive methods such as MD. Given that several limitations are inherent to both methods, we discuss here the usefulness of the current theoretical approaches for studying highly dynamic RNA systems such as CUG trinucleotide repeat overexpansions.

  4. Discovery, Characterization, and Functional Study of a Novel MEF2D CAG Repeat in Duck (Anas platyrhynchos).

    Science.gov (United States)

    Wang, Yushi; Wang, Jiwen; Liu, Hehe; Zhang, Rongping; Zhang, Tao; Gan, Xiang; Huang, Huilan; Chen, Da; Li, Liang

    2016-08-01

    Myocyte enhancer transcription factor 2D (MEF2D) is an important transcription factor for promoting the growth and development of muscle. CAG repeats have been found in the coding sequence (CDS) of avian MEF2D; however, their functions remain unknown and require further investigation. Here, we examined the characteristics and functional role of MEF2D CAG repeat in duck. The full-length CDS of duck MEF2D was cloned for the first time, and a novel CAG repeat was identified and located in exon 9. Sequence analysis indicated that the protein domains of duck MEF2D are highly conserved relative to other vertebrates, whereas MEF2D CAG repeats with variable repeat numbers are specific to avian species. Furthermore, sequencing has revealed polymorphisms in MEF2D CAG repeat at both DNA and mRNA levels. Four MEF2D CAG repeat genotypes and 10 MEF2D cDNA variants with different CAG repeat numbers were detected in two duck populations. A t-test showed that the expanded CAG repeat generated significantly longer transcription products (p analysis demonstrated positive correlations between the expansion of the CAG repeat and five muscle-related traits. By using protein structure prediction, we suggested that the polymorphisms of the CAG repeat affect protein structures within protein domains. Taken together, these findings reveal that duck MEF2D CAG repeat is a potential functional element with polymorphisms and may cause differences in MEF2D function between duck and other vertebrate species.

  5. Study of Optimal Perimetric Testing in Children (OPTIC: Feasibility, Reliability and Repeatability of Perimetry in Children.

    Directory of Open Access Journals (Sweden)

    Dipesh E Patel

    Full Text Available To investigate feasibility, reliability and repeatability of perimetry in children.A prospective, observational study recruiting 154 children aged 5-15 years, without an ophthalmic condition that affects the visual field (controls, identified consecutively between May 2012 and November 2013 from hospital eye clinics. Perimetry was undertaken in a single sitting, with standardised protocols, in a randomised order using the Humphrey static (SITA 24-2 FAST, Goldmann and Octopus kinetic perimeters. Data collected included test duration, subjective experience and test quality (incorporating examiner ratings on comprehension of instructions, fatigue, response to visual and auditory stimuli, concentration and co-operation to assess feasibility and reliability. Testing was repeated within 6 months to assess repeatability.Overall feasibility was very high (Goldmann=96.1%, Octopus=89% and Humphrey=100% completed the tests. Examiner rated reliability was 'good' in 125 (81.2% children for Goldmann, 100 (64.9% for Octopus and 98 (63.6% for Humphrey perimetry. Goldmann perimetry was the most reliable method in children under 9 years of age. Reliability improved with increasing age (multinomial logistic regression (Goldmann, Octopus and Humphrey, p<0.001. No significant differences were found for any of the three test strategies when examining initial and follow-up data outputs (Bland-Altman plots, n=43, suggesting good test repeatability, although the sample size may preclude detection of a small learning effect.Feasibility and reliability of formal perimetry in children improves with age. By the age of 9 years, all the strategies used here were highly feasible and reliable. Clinical assessment of the visual field is achievable in children as young as 5 years, and should be considered where visual field loss is suspected. Since Goldmann perimetry is the most effective strategy in children aged 5-8 years and this perimeter is no longer available, further

  6. Spa Goers' Repeated Visits for Health and Wellness and the Influential Factors: An Exploratory Study of the UK Spa Goers.

    Science.gov (United States)

    Choi, Myungsuk; Poade, Donna; Sohn, Minsung; Choi, Mankyu

    2016-01-01

    Dissemination of spa services across the globe and its market saturation drive demand for differentiated communication methods. This study aims to explore the influential factors on spa goers' repeated visits and their practical applications in the health and wellness spa industry. The identified factors were used as the measurement variables to examine the relation with spa goers' repeated visits. The proposed concept was tested by a mixed method combining a self-administered questionnaire and semistructured interview with 54 survey participants and 6 interviewees. It was meaningful to use a sample of the UK spa goers from the southwest region since global spa trends stem from the EU spas, and the United Kingdom is one of the market leaders. The data were analyzed using frequency, percentage, multiple logistic regression analysis, and coding process. The survey findings demonstrated that the most significant influential factor on the repeated spa visits is a memorable experience of which showed 13.7 times higher probability than the reference up-to-date facility. The details of memorable experiences were discovered throughout the interviews that include the rediscovery of self, feeling of connectedness, recharge for positive emotions, self-reward through escapism, and experience of noncommercialized local products and attractions. Therefore, using experiential marketing methods can be effective spa service marketing.

  7. Implementation of repeat HIV testing during pregnancy in Kenya: a qualitative study.

    Science.gov (United States)

    Rogers, Anna Joy; Weke, Elly; Kwena, Zachary; Bukusi, Elizabeth A; Oyaro, Patrick; Cohen, Craig R; Turan, Janet M

    2016-07-11

    Repeat HIV testing in late pregnancy has the potential to decrease rates of mother-to-child transmission of HIV by identifying mothers who seroconvert after having tested negative for HIV in early pregnancy. Despite being national policy in Kenya, the available data suggest that implementation rates are low. We conducted 20 in-depth semi-structured interviews with healthcare providers and managers to explore barriers and enablers to implementation of repeat HIV testing guidelines for pregnant women. Participants were from the Nyanza region of Kenya and were purposively selected to provide variation in socio-demographics and job characteristics. Interview transcripts were coded and analyzed in Dedoose software using a thematic analysis approach. Four themes were identified a priori using Ferlie and Shortell's Framework for Change and additional themes were allowed to emerge from the data. Participants identified barriers and enablers at the client, provider, facility, and health system levels. Key barriers at the client level from the perspective of providers included late initial presentation to antenatal care and low proportions of women completing the recommended four antenatal visits. Barriers to offering repeat HIV testing for providers included heavy workloads, time limitations, and failing to remember to check for retest eligibility. At the facility level, inconsistent volume of clients and lack of space required for confidential HIV retesting were cited as barriers. Finally, at the health system level, there were challenges relating to the HIV test kit supply chain and the design of nationally standardized antenatal patient registers. Enablers to improving the implementation of repeat HIV testing included client dissemination of the benefits of antenatal care through word-of-mouth, provider cooperation and task shifting, and it was suggested that use of an electronic health record system could provide automatic reminders for retest eligibility. This study

  8. Factors associated with repeated outbreak of anthrax in Bangladesh: qualitative and quantitative study

    Directory of Open Access Journals (Sweden)

    Jayedul Hassan

    2015-06-01

    Full Text Available Anthrax, caused by Bacillus anthracis is an acute, febrile disease of warm blooded animals including humans. Social norms and poverty in addition to climatic factors such as soil conditions, seasons of year, ambient temperature and rainfall influence the persistence of the B. anthracis and anthrax outbreaks. The present study was designed to reveal the factors influencing the repeated outbreak of anthrax in Bangladesh. Considering the previous outbreaks of anthrax, Sirajganj, Bogra, Kushtia, Tangail and Mymensingh districts of Bangladesh were selected for this study. To elucidate the factors, qualitative data relating to the animal management, knowledge and behavior of the people; and quantitative data relating to soil conditions, ambient temperature and rainfall were acquired, and analyzed critically. Based on the outbreak histories, a year was divided into two seasons, anthrax prone season (May-November and anthrax dry season (December-April. Anthrax spores could be isolated from 11.67% (n=14/120 of the soil samples collected from the study areas. The present study revealed that poor knowledge, lack of awareness, improper carcass disposal, inadequate vaccination, high Ca content and moisture in the soil along with high ambient temperature and rainfall during the anthrax prone season were the possible influencing factors of repeated outbreaks of anthrax in the study areas. Intensive propaganda to create public awareness of anthrax together with proper vaccination may reduce anthrax outbreaks in Bangladesh.

  9. Corneal epithelial toxicity of antiglaucoma formulations: in vitro study of repeated applications

    Directory of Open Access Journals (Sweden)

    Meloni M

    2012-09-01

    Full Text Available Marisa Meloni,1 Giampiero Cattaneo,2 Barbara De Servi11VitroScreen In Vitro Research Laboratories, 2Thea Farma, Milan, ItalyBackground: By using a biologically relevant and sensitive three-dimensional model of human corneal epithelium and multiple endpoint analysis, assessment of the potential for eye irritation and long-term compatibility of four registered ophthalmological preparations, ie, Timolabak®, Timoptol®, Nyogel®, and Timogel®, was performed. This approach enables classification of the potential for irritation, discriminating between mildly irritant and non-irritant ocular substances.Methods: The exposure protocol included two time periods, ie, 24 hours (acute application and 72 hours (repeated applications twice daily. This approach allows assessment of not only the acute reaction but also possible recovery, as well as mimicking the potential cumulative effects associated with long-term application. Using benzalkonium chloride (BAK 0.01% as a positive control, the following parameters were quantified: cellular viability by MTT test, histological analysis by hematoxylin and eosin staining, passive release of interleukin-1a by enzyme-linked immunosorbent assay, and OCLN gene expression by quantitative real-time polymerase chain reaction.Results: Cell viability was reduced to under the 50% cutoff value after acute exposure (24 hours to BAK 0.01%, and after repeated application (72 hours of Timoptol and Nyogel. Histological analysis after acute exposure showed signs of superficial damage with all formulations, and severe changes after repeated applications of Timoptol, BAK 0.01%, and Nyogel. Timolabak and Timogel did not significantly alter the morphology of the human corneal epithelial cells after the different exposure times. Interleukin-1α release was greater than that for the negative control (>20 pg/mL and the positive control (BAK 0.01%, Nyogel, and Timoptol treatments and not different after treatment with Timolabak and

  10. Accuracy and repeatability of an inertial measurement unit system for field-based occupational studies.

    Science.gov (United States)

    Schall, Mark C; Fethke, Nathan B; Chen, Howard; Oyama, Sakiko; Douphrate, David I

    2016-04-01

    The accuracy and repeatability of an inertial measurement unit (IMU) system for directly measuring trunk angular displacement and upper arm elevation were evaluated over eight hours (i) in comparison to a gold standard, optical motion capture (OMC) system in a laboratory setting, and (ii) during a field-based assessment of dairy parlour work. Sample-to-sample root mean square differences between the IMU and OMC system ranged from 4.1° to 6.6° for the trunk and 7.2°-12.1° for the upper arm depending on the processing method. Estimates of mean angular displacement and angular displacement variation (difference between the 90th and 10th percentiles of angular displacement) were observed to change IMU system may serve as an acceptable instrument for directly measuring trunk and upper arm postures in field-based occupational exposure assessment studies with long sampling durations. Practitioner Summary: Few studies have evaluated inertial measurement unit (IMU) systems in the field or over long sampling durations. Results of this study indicate that the IMU system evaluated has reasonably good accuracy and repeatability for use in a field setting over a long sampling duration.

  11. Repeated-Doses Toxicity Study of the Essential Oil of Hyptis martiusii Benth. (Lamiaceae in Swiss Mice

    Directory of Open Access Journals (Sweden)

    Germana Freire Rocha Caldas

    2013-01-01

    Full Text Available Hyptis martiusii Benth. (Lamiaceae is found in abundance in Northeastern Brazil where it is used in traditional medicine to treat gastric disorders. Since there are no studies reporting the toxicity and safety profile of this species, we investigated repeated-doses toxicity of the essential oil of Hyptis martiusii (EOHM. Swiss mice of both sexes were orally treated with EOHM (100 and 500 mg/kg for 30 days, and biochemical, hematological, and morphological parameters were determined. No toxicity signs or deaths were recorded during the treatment with EOHM. The body weight gain was not affected, but there was an occasional variation in water and food consumption among mice of both sexes treated with both doses. The hematological and biochemical profiles did not show significant differences except for a decrease in the MCV and an increase in albumin, but these variations are within the limits described for the species. The microscopic analysis showed changes in liver, kidneys, lungs, and spleen; however, these changes do not have clinical relevance since they varied among the groups, including the control group. The results indicate that the treatment of repeated-doses with the essential oil of Hyptis martiusii showed low toxicity in mice.

  12. Potential Role of the Last Half Repeat in TAL Effectors Revealed by a Molecular Simulation Study

    Directory of Open Access Journals (Sweden)

    Hua Wan

    2016-01-01

    Full Text Available TAL effectors (TALEs contain a modular DNA-binding domain that is composed of tandem repeats. In all naturally occurring TALEs, the end of tandem repeats is invariantly a truncated half repeat. To investigate the potential role of the last half repeat in TALEs, we performed comparative molecular dynamics simulations for the crystal structure of DNA-bound TALE AvrBs3 lacking the last half repeat and its modeled structure having the last half repeat. The structural stability analysis indicates that the modeled system is more stable than the nonmodeled system. Based on the principle component analysis, it is found that the AvrBs3 increases its structural compactness in the presence of the last half repeat. The comparison of DNA groove parameters of the two systems implies that the last half repeat also causes the change of DNA major groove binding efficiency. The following calculation of hydrogen bond reveals that, by stabilizing the phosphate binding with DNA at the C-terminus, the last half repeat helps to adopt a compact conformation at the protein-DNA interface. It further mediates more contacts between TAL repeats and DNA nucleotide bases. Finally, we suggest that the last half repeat is required for the high-efficient recognition of DNA by TALE.

  13. Potential Role of the Last Half Repeat in TAL Effectors Revealed by a Molecular Simulation Study

    Science.gov (United States)

    Wan, Hua; Chang, Shan; Hu, Jian-ping; Tian, Xu-hong

    2016-01-01

    TAL effectors (TALEs) contain a modular DNA-binding domain that is composed of tandem repeats. In all naturally occurring TALEs, the end of tandem repeats is invariantly a truncated half repeat. To investigate the potential role of the last half repeat in TALEs, we performed comparative molecular dynamics simulations for the crystal structure of DNA-bound TALE AvrBs3 lacking the last half repeat and its modeled structure having the last half repeat. The structural stability analysis indicates that the modeled system is more stable than the nonmodeled system. Based on the principle component analysis, it is found that the AvrBs3 increases its structural compactness in the presence of the last half repeat. The comparison of DNA groove parameters of the two systems implies that the last half repeat also causes the change of DNA major groove binding efficiency. The following calculation of hydrogen bond reveals that, by stabilizing the phosphate binding with DNA at the C-terminus, the last half repeat helps to adopt a compact conformation at the protein-DNA interface. It further mediates more contacts between TAL repeats and DNA nucleotide bases. Finally, we suggest that the last half repeat is required for the high-efficient recognition of DNA by TALE. PMID:27803930

  14. Does repeated reading predict reading development over time? A study of children from Grade 3 to 4.

    Science.gov (United States)

    Gellert, Anna S

    2014-08-01

    The purpose of this study was to investigate whether immediate gains in reading fluency achieved during repeated reading of text can predict long-term reading development over and above traditional predictors of reading development. Eighty-one Grade 3 children read texts three times consecutively and were instructed either to read as quickly as possible (speed-focused repeated reading), or to retell the text afterwards (meaning-focused repeated reading). Measures of text reading fluency, sentence reading fluency, and text comprehension were administered to the children in Grades 3 and 4 to assess their reading development over time. The results indicate that children's immediate response to repeated reading can contribute to the prediction of their development of reading fluency over time. Even after controlling for individual differences in general cognitive ability, word reading fluency, rapid automatized naming, and vocabulary, the experimental measure with meaning-focused repeated reading remained a significant predictor.

  15. 5-Day repeated inhalation and 28-day post-exposure study of graphene.

    Science.gov (United States)

    Shin, Jae Hoon; Han, Sung Gu; Kim, Jin Kwon; Kim, Boo Wook; Hwang, Joo Hwan; Lee, Jong Seong; Lee, Ji Hyun; Baek, Jin Ee; Kim, Tae Gyu; Kim, Keun Soo; Lee, Heon Sang; Song, Nam Woong; Ahn, Kangho; Yu, Il Je

    2015-01-01

    Graphene has recently been attracting increasing attention due to its unique electronic and chemical properties and many potential applications in such fields as semiconductors, energy storage, flexible electronics, biosensors and medical imaging. However, the toxicity of graphene in the case of human exposure has not yet been clarified. Thus, a 5-day repeated inhalation toxicity study of graphene was conducted using a nose-only inhalation system for male Sprague-Dawley rats. A total of three groups (20 rats per group) were compared: (1) control (ambient air), (2) low concentration (0.68 ± 0.14 mg/m(3) graphene) and (3) high concentration (3.86 ± 0.94 mg/m(3) graphene). The rats were exposed to graphene for 6 h/day for 5 days, followed by recovery for 1, 3, 7 or 28 days. The bioaccumulation and macrophage ingestion of the graphene were evaluated in the rat lungs. The exposure to graphene did not change the body weights or organ weights of the rats after the 5-day exposure and during the recovery period. No statistically significant difference was observed in the levels of lactate dehydrogenase, protein and albumin between the exposed and control groups. However, graphene ingestion by alveolar macrophages was observed in the exposed groups. Therefore, these results suggest that the 5-day repeated exposure to graphene only had a minimal toxic effect at the concentrations and time points used in this study.

  16. Validation of a track repeating algorithm for intensity modulated proton therapy: clinical cases study

    Science.gov (United States)

    Yepes, Pablo P.; Eley, John G.; Liu, Amy; Mirkovic, Dragan; Randeniya, Sharmalee; Titt, Uwe; Mohan, Radhe

    2016-04-01

    Monte Carlo (MC) methods are acknowledged as the most accurate technique to calculate dose distributions. However, due its lengthy calculation times, they are difficult to utilize in the clinic or for large retrospective studies. Track-repeating algorithms, based on MC-generated particle track data in water, accelerate dose calculations substantially, while essentially preserving the accuracy of MC. In this study, we present the validation of an efficient dose calculation algorithm for intensity modulated proton therapy, the fast dose calculator (FDC), based on a track-repeating technique. We validated the FDC algorithm for 23 patients, which included 7 brain, 6 head-and-neck, 5 lung, 1 spine, 1 pelvis and 3 prostate cases. For validation, we compared FDC-generated dose distributions with those from a full-fledged Monte Carlo based on GEANT4 (G4). We compared dose-volume-histograms, 3D-gamma-indices and analyzed a series of dosimetric indices. More than 99% of the voxels in the voxelized phantoms describing the patients have a gamma-index smaller than unity for the 2%/2 mm criteria. In addition the difference relative to the prescribed dose between the dosimetric indices calculated with FDC and G4 is less than 1%. FDC reduces the calculation times from 5 ms per proton to around 5 μs.

  17. Repeat Colonoscopy within 6 Months after Initial Outpatient Colonoscopy in Ontario: A Population-Based Cross-Sectional Study

    Directory of Open Access Journals (Sweden)

    Lawrence Paszat

    2017-01-01

    Full Text Available Background. The goal of this study is to examine utilization of early repeat colonoscopy ≤ 6 months after an index procedure. Methods. We identified persons having repeat colonoscopy ≤ 6 months following outpatient colonoscopy without prior colonoscopy ≤ 5 years or prior diagnosis of colorectal cancer (CRC. We modeled repeat colonoscopy using a generalized estimating equation with an exchangeable correlation structure to account for clustering of patients by endoscopist. Results. The population included 334,663 persons, 7,892 (2.36% of whom had an early repeat colonoscopy within 6 months. Overall, endoscopist prior year colonoscopy volume was inversely related to repeat ≤ 6 months. Repeat colonoscopy ≤ 6 months varied by the clinical setting of the index colonoscopy (adjusted OR = 1.41 (95% CI 1.29–1.55 at nonhospital facilities compared to teaching or community hospitals. Among those who had polypectomy or biopsy, the adjusted OR for early repeat ≤ 6 months was elevated among those whose index colonoscopy was at a nonhospital facility (OR 1.44, 95% CI 1.30–1.60, compared to those at a teaching hospital or community hospital. Conclusions. Repeat colonoscopy ≤ 6 months after an index procedure is associated with the clinical setting of the index colonoscopy.

  18. Seroepidemiological studies indicate frequent and repeated exposure to Campylobacter spp. during childhood.

    Science.gov (United States)

    Ang, C W; Teunis, P F M; Herbrink, P; Keijser, J; Van Duynhoven, Y H T P; Visser, C E; Van Pelt, W

    2011-09-01

    The annual number of episodes of clinical gastroenteritis caused by Campylobacter spp. in The Netherlands is estimated to be 75 000, i.e. once per 200 person life-years. This number is based on extrapolation of culture results from population-based studies. The number of culture-confirmed cases of Campylobacter infection peaks in the first 3 years of life and again between the ages of 20 and 25 years. The seroepidemiology of Campylobacter describes the relationship between age and exposure to Campylobacter and reflects both symptomatic and asymptomatic infections. Using a validated ELISA system, antibodies to Campylobacter were measured in an age-stratified sample (n=456) of the PIENTER serum collection of the Dutch general population. The seroprevalence of Campylobacter IgG antibodies increased with age, reaching almost 100% at age 20 years. Antibody levels steadily increased with age until young adulthood, suggesting repeated exposure to Campylobacter. In conclusion, seroepidemiological data demonstrated repeated exposures to Campylobacter throughout life, most of which do not lead to clinical symptoms. From young adulthood, >95% of the population in The Netherlands had serological evidence for exposure to Campylobacter.

  19. Effects of repeated walking in a perturbing environment: a 4-day locomotor learning study.

    Science.gov (United States)

    Blanchette, Andreanne; Moffet, Helene; Roy, Jean-Sébastien; Bouyer, Laurent J

    2012-07-01

    Previous studies have shown that when subjects repeatedly walk in a perturbing environment, initial movement error becomes smaller, suggesting that retention of the adapted locomotor program occurred (learning). It has been proposed that the newly learned locomotor program may be stored separately from the baseline program. However, how locomotor performance evolves with repeated sessions of walking with the perturbation is not yet known. To address this question, 10 healthy subjects walked on a treadmill on 4 consecutive days. Each day, locomotor performance was measured using kinematics and surface electromyography (EMGs), before, during, and after exposure to a perturbation, produced by an elastic tubing that pulled the foot forward and up during swing, inducing a foot velocity error in the first strides. Initial movement error decreased significantly between days 1 and 2 and then remained stable. Associated changes in medial hamstring EMG activity stabilized only on day 3, however. Aftereffects were present after perturbation removal, suggesting that daily adaptation involved central command recalibration of the baseline program. Aftereffects gradually decreased across days but were still visible on day 4. Separation between the newly learned and baseline programs may take longer than suggested by the daily improvement in initial performance in the perturbing environment or may never be complete. These results therefore suggest that reaching optimal performance in a perturbing environment should not be used as the main indicator of a completed learning process, as central reorganization of the motor commands continues days after initial performance has stabilized.

  20. Whole blood DNA aberrant methylation in pancreatic adenocarcinoma shows association with the course of the disease: a pilot study.

    Directory of Open Access Journals (Sweden)

    Albertas Dauksa

    Full Text Available Pancreatic tumors are usually diagnosed at an advanced stage in the progression of the disease, thus reducing the survival chances of the patients. Non-invasive early detection would greatly enhance therapy and survival rates. Toward this aim, we investigated in a pilot study the power of methylation changes in whole blood as predictive markers for the detection of pancreatic tumors. We investigated methylation levels at selected CpG sites in the CpG rich regions at the promoter regions of p16, RARbeta, TNFRSF10C, APC, ACIN1, DAPK1, 3OST2, BCL2 and CD44 in the blood of 30 pancreatic tumor patients and in the blood of 49 matching controls. In addition, we studied LINE-1 and Alu repeats using degenerate amplification approach as a surrogate marker for genome-wide methylation. The site-specific methylation measurements at selected CpG sites were done by the SIRPH method. Our results show that in the patient's blood, tumor suppressor genes were slightly but significantly higher methylated at several CpG sites, while repeats were slightly less methylated compared to control blood. This was found to be significantly associated with higher risk for pancreatic ductal adenocarcinoma. Additionally, high methylation levels at TNFRSCF10C were associated with positive perineural spread of tumor cells, while higher methylation levels of TNFRSF10C and ACIN1 were significantly associated with shorter survival. This pilot study shows that methylation changes in blood could provide a promising method for early detection of pancreatic tumors. However, larger studies must be carried out to explore the clinical usefulness of a whole blood methylation based test for non-invasive early detection of pancreatic tumors.

  1. Prolonged Repeated Acupuncture Stimulation Induces Habituation Effects in Pain-Related Brain Areas: An fMRI Study

    Science.gov (United States)

    Li, Chuanfu; Yang, Jun; Park, Kyungmo; Wu, Hongli; Hu, Sheng; Zhang, Wei; Bu, Junjie; Xu, Chunsheng; Qiu, Bensheng; Zhang, Xiaochu

    2014-01-01

    Most previous studies of brain responses to acupuncture were designed to investigate the acupuncture instant effect while the cumulative effect that should be more important in clinical practice has seldom been discussed. In this study, the neural basis of the acupuncture cumulative effect was analyzed. For this experiment, forty healthy volunteers were recruited, in which more than 40 minutes of repeated acupuncture stimulation was implemented at acupoint Zhusanli (ST36). Three runs of acupuncture fMRI datasets were acquired, with each run consisting of two blocks of acupuncture stimulation. Besides general linear model (GLM) analysis, the cumulative effects of acupuncture were analyzed with analysis of covariance (ANCOVA) to find the association between the brain response and the cumulative duration of acupuncture stimulation in each stimulation block. The experimental results showed that the brain response in the initial stage was the strongest although the brain response to acupuncture was time-variant. In particular, the brain areas that were activated in the first block and the brain areas that demonstrated cumulative effects in the course of repeated acupuncture stimulation overlapped in the pain-related areas, including the bilateral middle cingulate cortex, the bilateral paracentral lobule, the SII, and the right thalamus. Furthermore, the cumulative effects demonstrated bimodal characteristics, i.e. the brain response was positive at the beginning, and became negative at the end. It was suggested that the cumulative effect of repeated acupuncture stimulation was consistent with the characteristic of habituation effects. This finding may explain the neurophysiologic mechanism underlying acupuncture analgesia. PMID:24821143

  2. Reducing impaired driving through the identification of Repeat Target Vehicles: A case study.

    Science.gov (United States)

    Stewart, James

    2012-02-01

    One of the most persistent groups of impaired drivers that are seemingly unaffected by social pressure, moral appeals, and the fear of arrest is that of the repeat impaired driver. This smaller group accounts for a disproportionate number of all impaired driving trips, often with high blood alcohol contents. New approaches are needed to identify and deal with the repeat impaired driver. We propose a method based on the discovery that almost 10% of all impaired driving calls for service involve repeat vehicles. Using the number of times a vehicle appears in our data, the average time to repeat, and the personality characteristics of the repeat impaired driver, we are able to create a comprehensive and predictive description of a Repeat Target Vehicle (RTV). Our method provides an opportunity to explore new and innovative crime reduction strategies that were never before possible. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. A study on ten short tandem repeat systems: African immigrant and Spanish population data.

    Science.gov (United States)

    Gamero, J J; Romero, J L; Gonzalez, J L; Arufe, M I; Cuesta, M I; Corte-Real, F; Carvalho, M; Anjos, M J; Vieira, D N; Vide, M C

    2000-06-05

    This work presents the results obtained from a genetic-population study for the D1S1656 system in the population of Southwest Spain (Huelva, Cádiz and Sevilla), Spaniards of Caucasian origin from North Africa (Ceuta), as well as in the black Central West African and Moroccan immigrant populations in Spain. The results of a study of the autochtonous population of the Canary Islands (n=138), and immigrant Central West African populations in Spain (n=132), obtained for nine short tandem repeat (STR) loci (D3S1358, VWA, FGA, D8S1179, D21S11, D18S51, D5S818, D13S317, D7S820), as well as the amelogenin locus, all contained in Profiler Plus (Perkin-Elmer) PCR amplification kits, are also presented. Except for the FGA and VWA data on immigrant Central West African populations in Spain, no deviations from the Hardy-Weinberg equilibrium were detected.

  4. A Prospective Study of Psychiatric Comorbidity and Recidivism Among Repeat DUI Offenders

    OpenAIRE

    Nelson, Sarah E.; Belkin, Katerina; LaPlante, Debi A.; Bosworth, Leslie; Shaffer, Howard J.

    2015-01-01

    Psychiatric comorbidity has emerged as a key element distinguishing DUI offenders from others, and, in some cases, distinguishing repeat offenders from first-time offenders. This paper utilizes a prospective design to determine whether the comorbid disorders identified among repeat DUI offenders can predict recidivism. Seven hundred forty-three repeat DUI offenders were recruited from a two-week inpatient treatment program at which they received a standardized mental health assessment and fol...

  5. Bayesian latent variable models for hierarchical clustered count outcomes with repeated measures in microbiome studies.

    Science.gov (United States)

    Xu, Lizhen; Paterson, Andrew D; Xu, Wei

    2017-04-01

    Motivated by the multivariate nature of microbiome data with hierarchical taxonomic clusters, counts that are often skewed and zero inflated, and repeated measures, we propose a Bayesian latent variable methodology to jointly model multiple operational taxonomic units within a single taxonomic cluster. This novel method can incorporate both negative binomial and zero-inflated negative binomial responses, and can account for serial and familial correlations. We develop a Markov chain Monte Carlo algorithm that is built on a data augmentation scheme using Pólya-Gamma random variables. Hierarchical centering and parameter expansion techniques are also used to improve the convergence of the Markov chain. We evaluate the performance of our proposed method through extensive simulations. We also apply our method to a human microbiome study.

  6. [Repeat induced abortion: A multicenter study on medical abortions in France in 2014].

    Science.gov (United States)

    Opatowski, M; Bardy, F; David, P; Dunbavand, A; Saurel-Cubizolles, M-J

    2017-01-01

    To describe the social characteristics of women seeking a medical abortion, and the conditions of that abortion, according to whether they had one or more previous induced abortions. An observational study was carried out in 11 French units in 2013-2014, among women 18 years or older. A self-administered questionnaire on the abortion context and social situation was given to them, as well as a diary to record the pain level for each of five days following the mifepristone intake. The sample included 453 women. Among the respondents, 22% had had one previous abortion and 8% had had two or more. Women having had a previous voluntary abortion were more often isolated and in a poorer social situation than women having their first abortion. Better support for contraception after abortion could reduce the number of repeated abortions. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  7. A Review on the Study of "Repeating Earthquakes" by Cross-correlation of Seismic Waveforms~%A Review on the Study of "Repeating Earthquakes" by Cross-correlation of Seismic Waveforms~

    Institute of Scientific and Technical Information of China (English)

    Li Yutong; Jiang Changsheng

    2012-01-01

    "Repeating earthquakes", identified by cross-correlation of seismic waveforms, are found to be much more abundant in the nature than conventionally expected. In recent years, with the development of digital seismic networks, waveform cross correlation and "repeating earthquakes" have caused much attention to the measuring the variation of crustal medium properties and estimation of location accuracy and fault slip rate at depth or earthquake recurrence intervals. Moreover, as a useful tool, the "repeating earthquake" approach has also been used in the assessment of the accuracy of seismic phase picking, hypocenter location, fault structure and physics of earthquake sources, as well as the study of earthquake prediction. In this paper, we summarized the latest research and applications of "repeating earthquakes".

  8. Causal inference in longitudinal comparative effectiveness studies with repeated measures of a continuous intermediate variable.

    Science.gov (United States)

    Wang, Chen-Pin; Jo, Booil; Brown, C Hendricks

    2014-09-10

    We propose a principal stratification approach to assess causal effects in nonrandomized longitudinal comparative effectiveness studies with a binary endpoint outcome and repeated measures of a continuous intermediate variable. Our method is an extension of the principal stratification approach originally proposed for the longitudinal randomized study "Prevention of Suicide in Primary Care Elderly: Collaborative Trial" to assess the treatment effect on the continuous Hamilton depression score adjusting for the heterogeneity of repeatedly measured binary compliance status. Our motivation for this work comes from a comparison of the effect of two glucose-lowering medications on a clinical cohort of patients with type 2 diabetes. Here, we consider a causal inference problem assessing how well the two medications work relative to one another on two binary endpoint outcomes: cardiovascular disease-related hospitalization and all-cause mortality. Clinically, these glucose-lowering medications can have differential effects on the intermediate outcome, glucose level over time. Ultimately, we want to compare medication effects on the endpoint outcomes among individuals in the same glucose trajectory stratum while accounting for the heterogeneity in baseline covariates (i.e., to obtain 'principal effects' on the endpoint outcomes). The proposed method involves a three-step model estimation procedure. Step 1 identifies principal strata associated with the intermediate variable using hybrid growth mixture modeling analyses. Step 2 obtains the stratum membership using the pseudoclass technique and derives propensity scores for treatment assignment. Step 3 obtains the stratum-specific treatment effect on the endpoint outcome weighted by inverse propensity probabilities derived from Step 2.

  9. Gun Shows and Gun Violence: Fatally Flawed Study Yields Misleading Results

    Science.gov (United States)

    Hemenway, David; Webster, Daniel; Pierce, Glenn; Braga, Anthony A.

    2010-01-01

    A widely publicized but unpublished study of the relationship between gun shows and gun violence is being cited in debates about the regulation of gun shows and gun commerce. We believe the study is fatally flawed. A working paper entitled “The Effect of Gun Shows on Gun-Related Deaths: Evidence from California and Texas” outlined this study, which found no association between gun shows and gun-related deaths. We believe the study reflects a limited understanding of gun shows and gun markets and is not statistically powered to detect even an implausibly large effect of gun shows on gun violence. In addition, the research contains serious ascertainment and classification errors, produces results that are sensitive to minor specification changes in key variables and in some cases have no face validity, and is contradicted by 1 of its own authors’ prior research. The study should not be used as evidence in formulating gun policy. PMID:20724672

  10. Gun shows and gun violence: fatally flawed study yields misleading results.

    Science.gov (United States)

    Wintemute, Garen J; Hemenway, David; Webster, Daniel; Pierce, Glenn; Braga, Anthony A

    2010-10-01

    A widely publicized but unpublished study of the relationship between gun shows and gun violence is being cited in debates about the regulation of gun shows and gun commerce. We believe the study is fatally flawed. A working paper entitled "The Effect of Gun Shows on Gun-Related Deaths: Evidence from California and Texas" outlined this study, which found no association between gun shows and gun-related deaths. We believe the study reflects a limited understanding of gun shows and gun markets and is not statistically powered to detect even an implausibly large effect of gun shows on gun violence. In addition, the research contains serious ascertainment and classification errors, produces results that are sensitive to minor specification changes in key variables and in some cases have no face validity, and is contradicted by 1 of its own authors' prior research. The study should not be used as evidence in formulating gun policy.

  11. The PICTURE study: diagnostic accuracy of multiparametric MRI in men requiring a repeat prostate biopsy.

    Science.gov (United States)

    Simmons, Lucy A M; Kanthabalan, Abi; Arya, Manit; Briggs, Tim; Barratt, Dean; Charman, Susan C; Freeman, Alex; Gelister, James; Hawkes, David; Hu, Yipeng; Jameson, Charles; McCartan, Neil; Moore, Caroline M; Punwani, Shonit; Ramachandran, Navin; van der Meulen, Jan; Emberton, Mark; Ahmed, Hashim U

    2017-04-25

    Transrectal prostate biopsy has limited diagnostic accuracy. Prostate Imaging Compared to Transperineal Ultrasound-guided biopsy for significant prostate cancer Risk Evaluation (PICTURE) was a paired-cohort confirmatory study designed to assess diagnostic accuracy of multiparametric magnetic resonance imaging (mpMRI) in men requiring a repeat biopsy. All underwent 3 T mpMRI and transperineal template prostate mapping biopsies (TTPM biopsies). Multiparametric MRI was reported using Likert scores and radiologists were blinded to initial biopsies. Men were blinded to mpMRI results. Clinically significant prostate cancer was defined as Gleason ⩾4+3 and/or cancer core length ⩾6 mm. Two hundred and forty-nine had both tests with mean (s.d.) age was 62 (7) years, median (IQR) PSA 6.8 ng ml (4.98-9.50), median (IQR) number of previous biopsies 1 (1-2) and mean (s.d.) gland size 37 ml (15.5). On TTPM biopsies, 103 (41%) had clinically significant prostate cancer. Two hundred and fourteen (86%) had a positive prostate mpMRI using Likert score ⩾3; sensitivity was 97.1% (95% confidence interval (CI): 92-99), specificity 21.9% (15.5-29.5), negative predictive value (NPV) 91.4% (76.9-98.1) and positive predictive value (PPV) 46.7% (35.2-47.8). One hundred and twenty-nine (51.8%) had a positive mpMRI using Likert score ⩾4; sensitivity was 80.6% (71.6-87.7), specificity 68.5% (60.3-75.9), NPV 83.3% (75.4-89.5) and PPV 64.3% (55.4-72.6). In men advised to have a repeat prostate biopsy, prostate mpMRI could be used to safely avoid a repeat biopsy with high sensitivity for clinically significant cancers. However, such a strategy can miss some significant cancers and overdiagnose insignificant cancers depending on the mpMRI score threshold used to define which men should be biopsied.

  12. SU-E-J-263: Repeatability of SUV and Texture Parameters in Serial PET Studies

    Energy Technology Data Exchange (ETDEWEB)

    Schwartz, J; Humm, J; Nehmeh, S; Schoder, H [Memorial Sloan-Kettering Cancer Center, New York, NY (United States)

    2015-06-15

    Purpose: Standardized uptake values (SUV) are standard quantitative PET measures of FDG tumor uptake used,and are used as a tool to monitor response to therapy. Textural analysis is emerging as a new tool for assessing intratumoral heterogeneity which may allow better tissue characterization and improved prediction of response and survival rate.Understanding what variations may be expected in these parameters is key in order to make decisions based on how the change throughout the course of treatment. The aim of this study was to assess repeatability in SUV measures and texture parameters,and establish criteria that differentiate changes associated with treatment rather than statistical variability. Methods: Eighty patients,167 random lesions total,were scanned in a GE Discovery STE PET/CT Scanner. One field-of-view was chosen centered on the largest lesion observed in a clinical whole-body FDG PET.Immediately following,a gated 9 min scan was acquired in list mode,without changing the patient’s position between any scans. Data was replayed into 3 time bins,3 min each,in order to insure equivalent noise characteristics in each replicate.Data was reconstructed into 128×128×47 square matrices.One VOI was drawn over each lesion for each patient and used to segment all 3 replicates. The mean.max and peak SUV were calculated for each VOI and replicate. First-order textural features were also calculated (skewness and kurtosis). Repeatability was calculated as the average standard deviation over the mean for the 3 repeated measurements for each lesion. Results: The average percent error in the SUV max,peak and mean were 3.4%(0– 12.9%),1.9% (0–7.5%),2.8% (0–12.2%),respectively.For skewness and kurtosis they were 10.9% and 17.8%. Conclusion: We have shown that there is a large variation in %error in SUV measures across patients. SUVpeak is the least variable and kurtosis and skewness parameters are less reliable thatn SUVs.Higher order textures are be.

  13. Prognostic usefulness of repeated echocardiographic evaluation after acute myocardial infarction. TRACE Study Group. TRAndolapril Cardiac Evaluation

    DEFF Research Database (Denmark)

    Korup, E; Køber, L; Torp-Pedersen, C;

    1999-01-01

    The prognostic value of repeated echocardiographic measurement of left ventricular function after acute myocardial infarction was evaluated. We found that repeated measurements of wall motion index in survivors of acute myocardial infarction, with no reinfarction, provide important prognostic inf...... information about death and worsening of heart failure....

  14. Uncontrolled variables in frying studies: differences in repeatability between thermoxidation and frying experiments

    Directory of Open Access Journals (Sweden)

    Dobarganes, Carmen

    2007-09-01

    Full Text Available Palm oil, soybean oil and partially hydrogenated soybean oil were used to define the repeatability of oil degradation under thermoxidation in the absence of food and during the frying of potatoes. Total polar compounds and their constituent polymeric triglycerides, oxidized monomeric triglycerides and diglycerides were analyzed. The oils were thermoxidized under standard conditions in a Rancimat apparatus at 180 °C for 25 hours. Discontinuous frying experiments were carried out in triplicate in three apparently identical domestic fryers. Five batches of potatoes were fried per day in each fryer. Oils were heated at 180 °C in periods of 5 h per day during 5 consecutive days so that the total heating period was 25 h. Repeatability was high in the thermoxidation assays and rather low in the frying experiments. Significant differences between the oils were found in the thermoxidation experiments, while no significant differences were found in the frying assays due to large standard deviations. The participation of variables related to the fryer performance which are difficult to control, was deduced. Among them, differences in the heating/cooling cycles at high temperature might be important. The contribution of fryer performance to the decreased repeatability was confirmed in further frying experiments with palm oil. Results showed that repeatability for the same fryer was higher than that obtained when different fryers were considered.Se estudia la repetibilidad de los resultados obtenidos en el calentamiento de los aceites y grasas a temperatura elevada utilizando aceite de palma, aceite de soja y aceite de soja parcialmente hidrogenado. Partiendo de la repetibilidad de las determinaciones analíticas utilizadas para la evaluación de la degradación de los aceites y grasas a elevada temperatura, el análisis de compuestos polares y de su distribución en polímeros de triglicéridos, triglicéridos monómeros oxidados y diglicéridos, se

  15. A Prospective Study of Psychiatric Comorbidity and Recidivism Among Repeat DUI Offenders.

    Science.gov (United States)

    Nelson, Sarah E; Belkin, Katerina; LaPlante, Debi A; Bosworth, Leslie; Shaffer, Howard J

    2015-04-13

    Psychiatric comorbidity has emerged as a key element distinguishing DUI offenders from others, and, in some cases, distinguishing repeat offenders from first-time offenders. This paper utilizes a prospective design to determine whether the comorbid disorders identified among repeat DUI offenders can predict recidivism. Seven hundred forty-three repeat DUI offenders were recruited from a two-week inpatient treatment program at which they received a standardized mental health assessment and followed across five years post-treatment to track DUI offense, motor vehicle-related offenses, and general criminal offenses. Psychiatric comorbidity, though it did not predict DUI recidivism specifically, predicted criminal re-offense more generally. In addition, there was a specific relationship between lifetime attention deficit disorder and repeated motor vehicle-related offenses. These findings suggest that for many repeat offenders, DUI is one outlet in a constellation of criminal behavior, and that psychiatric comorbidity increases vulnerability for criminal re-offense.

  16. Effect of repeated sterilization cycles on the physical properties of scaling instruments: a scanning electron microscopy study.

    Science.gov (United States)

    Porto, Alessandra Nogueira; Borges, Álvaro Henrique; Semenoff-Segundo, Alex; Raslan, Suzane A; Pedro, Fábio Luis Miranda; Jorge, Antônio Olavo Cardoso; Bandeca, Matheus Coelho

    2015-05-01

    Repeated sterilizations cycles cause undesirable alterations in the material properties of the instruments, such as corrosion, alterations in the hardness of the metal and the loss of the cutting sharpness of the instrument. This research examined the effect of repeated dry heat sterilization and autoclaves cycles on carbon steel (CS) and stainless steel (SS) curettes during the scaling and root planning. A total of 77 Gracey curettes were used in this study. Of these, 35 were SS and 42 were CS curettes submitted in different process: Dry heat, autoclave, inhibition of corrosion and autoclave, scaling, root planning and dry heat, scaling, root planning, inhibition of corrosion and autoclave. The inhibition of corrosion used on the carbon curettes (prior to sterilization in the autoclave) was sodium nitrite at 2%. The curettes received 10 consecutive cycles of sterilization and after that the cutting edges were examined in the electronic microscope, at 60 and 100 magnification times. The images were evaluated by three independent examiners, who compared the photographs of each group with the control group. The surface corrosion products and a deterioration of the edges were observed and the results showed that the SS curettes suffered little alteration with sterilization, scaling, root planning whereas the CS curettes were visibly affected by sterilization in the autoclave, but when the inhibition of corrosion was used prior to the sterilization, the oxidation was considerably reduced.

  17. Structural and serological studies on the O-antigen show that Citrobacter youngae PCM1505 must be classified to a new Citrobacter O-serogroup.

    Science.gov (United States)

    Katzenellenbogen, Ewa; Kocharova, Nina A; Górska-Frączek, Sabina; Gamian, Andrzej; Shashkov, Alexander S; Knirel, Yuriy A

    2012-10-01

    The O-polysaccharide obtained by mild acid hydrolysis of the lipopolysaccharide of Citrobacter youngae PCM1505 was studied by sugar and methylation analyses along with 1D and 2D (1)H and (13)C NMR spectroscopies. The following structure of the tetrasaccharide repeating unit of the polysaccharide was established: [Formula: see text]. Structural and serological data obtained earlier and in this work show that the strain studied is a candidate to a new Citrobacter O-serogroup.

  18. Non-target effects of repeated chlorothalonil application on soil nitrogen cycling: The key functional gene study.

    Science.gov (United States)

    Zhang, Manyun; Xu, Zhihong; Teng, Ying; Christie, Peter; Wang, Jun; Ren, Wenjie; Luo, Yongming; Li, Zhengao

    2016-02-01

    The widespread and increasing application of chlorothalonil (CTN) raises concerns about its non-target impacts, but little information is available on the effect of CTN on the key functional genes related to soil nitrogen (N) cycling, especially in the case of repeated applications. In the present study, a microcosm incubation was conducted to determine CTN residues and the impacts on the abundances of key functional genes related to N cycling after repeated CTN applications. The results demonstrated that repeated CTN applications at the recommended application rate and five times the recommended rate led to the accumulation of CTN residue in soil at concentrations of 5.59 and 78.79 mg kg(-1), respectively, by the end of incubation. Real time PCR (RT-PCR) revealed that repeated CTN applications had negative effects on the chiA and aprA gene abundances. There were significantly negative correlations between CTN residues and abundances of AOA and AOB genes. In addition, the abundances of key functional genes involved in soil denitrification were declined by repeated CTN applications with the sole exception of the nosZ gene. This study suggests that repeated CTN applications could lead to the accumulation of CTN residue and generate somewhat inconsistent and erratic effects on the abundances of key functional genes related to soil N cycling.

  19. Impact of repeated measures and sample selection on genome-wide association studies of fasting glucose

    Science.gov (United States)

    Rasmussen-Torvik, Laura J.; Alonso, Alvaro; Li, Man; Kao, Wen; Köttgen, Anna; Yan, Yuer; Couper, David; Boerwinkle, Eric; Bielinski, Suzette J.; Pankow, James S.

    2010-01-01

    Although GWAS have been performed in longitudinal studies, most used only a single trait measure. GWAS of fasting glucose have generally included only normoglycemic individuals. We examined the impact of both repeated measures and sample selection on GWAS in ARIC, a study which obtained four longitudinal measures of fasting glucose and included both individuals with and without prevalent diabetes. The sample included Caucasians and the Affymetrix 6.0 chip was used for genotyping. Sample sizes for GWAS analyses ranged from 8372 (first study visit) to 5782 (average fasting glucose). Candidate SNP analyses with SNPs identified through fasting glucose or diabetes GWAS were conducted in 9133 individuals, including 761 with prevalent diabetes. For a constant sample size, smaller p-values were obtained for the average measure of fasting glucose compared to values at any single visit, and two additional significant GWAS signals were detected. For four candidate SNPs (rs780094, rs10830963, rs7903146, and rs4607517), the strength of association between genotype and glucose was significantly (p-interaction fasting glucose candidate SNPs (rs780094, rs10830963, rs560887, rs4607517, rs13266634) the association with measured fasting glucose was more significant in the smaller sample without prevalent diabetes than in the larger combined sample of those with and without diabetes. This analysis demonstrates the potential utility of averaging trait values in GWAS studies and explores the advantage of using only individuals without prevalent diabetes in GWAS of fasting glucose. PMID:20839289

  20. CAG repeat polymorphisms in the androgen receptor and breast cancer risk in women: a meta-analysis of 17 studies.

    Science.gov (United States)

    Mao, Qixing; Qiu, Mantang; Dong, Gaochao; Xia, Wenjie; Zhang, Shuai; Xu, Youtao; Wang, Jie; Rong, Yin; Xu, Lin; Jiang, Feng

    2015-01-01

    The association between polymorphic CAG repeats in the androgen receptor gene in women and breast cancer susceptibility has been studied extensively. However, the conclusions regarding this relationship remain conflicting. The purpose of this meta-analysis was to identify whether androgen receptor CAG repeat lengths were related to breast cancer susceptibility. The MEDLINE, PubMed, and EMBASE databases were searched through to December 2014 to identify eligible studies. Data and study quality were rigorously assessed by two investigators according to the Newcastle-Ottawa Quality Assessment Scale. The publication bias was assessed by the Begg's test. Seventeen eligible studies were included in this meta-analysis. The overall analysis suggested no association between CAG polymorphisms and breast cancer risk (odds ratio [OR] 1.031, 95% confidence interval [CI] 0.855-1.245). However, in the subgroup analysis, we observed that long CAG repeats significantly increased the risk of breast cancer in the Caucasian population (OR 1.447, 95% CI 1.089-1.992). Additionally, the risk was significantly increased in Caucasian women carrying two alleles with CAG repeats ≥22 units compared with those with two shorter alleles (OR 1.315, 95% CI 1.014-1.707). These findings suggest that long CAG repeats increase the risk of breast cancer in Caucasian women. However, larger scale case-control studies are needed to validate our results.

  1. Intimate partner violence and repeat induced abortion in Italy: A cross sectional study.

    Science.gov (United States)

    Citernesi, Angela; Dubini, Valeria; Uglietti, Anna; Ricci, Elena; Cipriani, Sonia; Parazzini, Fabio

    2015-01-01

    To investigate the impact of intimate partner violence (IPV) on the risk of repeat induced abortion (RIA), we compared IPV history among women with and without previous induced abortion (IA). All consecutive women aged 18 years or more requiring IA in 12 Italian abortion clinics were eligible for inclusion in the study. They were asked to fill in an anonymous, self-developed questionnaire assessing sociodemographic data and their history of different types of violence and related risk factors. The analysis included 1030 women, 624 (60.6%) of whom reported a previous IA. Past or current IPV was reported by 19.3%: 7.0% reported sexual violence, 11.3% physical abuse and 12.1% psychological abuse. Past or current IPV was reported by 22.3% of women with RIA and 14.8% of those undergoing their first IA (adjusted odds ratio 1.57, 95% confidence interval 1.07-2.30; p = 0.02). When we considered sexual, psychological and physical abuse separately, we found that any kind of abuse was more frequent in women with RIA than in women with no previous IA. This study underlines the impact of IPV on the risk of RIA and suggests the need for screening for IPV among women requiring abortion, in order to identify women at risk of RIA and to improve their general and reproductive health.

  2. Repeated open application test with methyldibromo glutaronitrile, a multicentre study within the EECDRG.

    Science.gov (United States)

    Gruvberger, B; Andersen, K E; Brandão, F M; Bruynzeel, D P; Bruze, M; Frosch, P J; Goossens, A; Lahti, A; Maibach, H I; Menné, T; Orton, D; Seidenari, S

    2005-01-01

    Contact allergy to and allergic contact dermatitis from methyldibromo glutaronitrile (MDBGN) have frequently been reported. This study was initiated to help determine the optimal patch test preparation for MDBGN. In 51 patients with a doubtful or a positive patch test reaction to at least 1 of 4 test preparations with MDBGN in petrolatum at 1.0% w/w, 0.5%, 0.3% and 0.1%, a repeated open application test (ROAT) with moisturizers with and without MDBGN at 0.03% w/w was performed on the upper arms for 2 weeks. 18 of the 51 (35.3%) patients developed a positive ROAT. In all patients, there was a positive ROAT only to the moisturizer with MDBGN (P < 0.001). A statistically significant association was also found between the patch test reactivity (PTRL) and the outcome of the ROAT (P < 0.001). If only considering those with a PTRL above 0.3%, thus with negative or doubtful test reactions to 0.1% and 0.3%, there were still statistically significantly more patients with a positive ROAT to the moisturizer with MDBGN than to the moisturizer without MDBGN. The study demonstrates that patch testing with MDBGN at 0.3% and 0.1% will miss clinically relevant patch test reactions to MDBGN.

  3. The Study on the Ferrokinetics and Acquired Immunity in Repeated Hookworm Infections

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Mun Ho; Lee, Pyl Ung [Seoul National University College of Medicine, Seoul (Korea, Republic of)

    1967-09-15

    In order to confirm whether acquired immunity or resistance can be developed by the repeated hookworm infections, the 150 mature actively moving filariform ancylostoma duodenale larvae obtained from the severe hookworm anemia patients were orally given to 8 healthy volunteers in three divided doses, 50 in each, at 5 day interval. Also the hematological changes as well as several ferrokinetics using {sup 59}Fe were done and were compared with 10 controls. The clinical symptoms and signs were checked every day for the first 3 weeks and then twice weekly until the end of the experiment. The appearance of the ova in the stool was examined by the formalin ether method and the ova was counted by the Stoll's method. The following laboratory tests were done:1) Red blood cell count, venous blood hematocrit (micromethod), hemoglobin count (cyanomethemoglobin method) were checked every 5 to 7 day interval. 2) Plasma iron concentration (Barkan's modified method) was determined every 2 to 3 week interval. 3) Radioisotope studies:a) Ferrokinetics: Huff et al and Bothwell's method were applied. Erythropoietic Index (% of normal)= ['Subject's turnover/100 ml whole bloodX100'] over ['Average normal turnover/100 ml whole blood'] b) Quantitative measurement of the gastrointestinal absorption of iron:Radioiron ({sup 59}Fe) balance method was applied. c) Determination of the plasma erythropoietin activity: Fried's method was applied. Following were the results: 1) The serum iron level was lower. The red cell volume was decreased, but with relative increase of plasma volume. 2) The plasma iron disappearance time was accelerated and the plasma iron turnover rate was decreased. The red cell iron turnover rate was markedly increased, while all of the red cell iron concentration, circulating red cell iron, plasma iron pool were decreased. The daily iron pool turnover and red cell renewal rate were increased. 3) The erythropoietic index

  4. Structural Studies of a Four-MBT Repeat Protein MBTD1

    Energy Technology Data Exchange (ETDEWEB)

    Eryilmaz, Jitka; Pan, Patricia; Amaya, Maria F.; Allali-Hassani, Abdellah; Dong, Aiping; Adams-Cioaba, Melanie A.; MacKenzie, Farrell; Vedadi, Masoud; Min, Jinrong; (Toronto); (Toronto)

    2010-08-17

    The Polycomb group (PcG) of proteins is a family of important developmental regulators. The respective members function as large protein complexes involved in establishment and maintenance of transcriptional repression of developmental control genes. MBTD1, Malignant Brain Tumor domain-containing protein 1, is one such PcG protein. MBTD1 contains four MBT repeats. We have determined the crystal structure of MBTD1 (residues 130-566aa covering the 4 MBT repeats) at 2.5 {angstrom} resolution by X-ray crystallography. The crystal structure of MBTD1 reveals its similarity to another four-MBT-repeat protein L3MBTL2, which binds lower methylated lysine histones. Fluorescence polarization experiments confirmed that MBTD1 preferentially binds mono- and di-methyllysine histone peptides, like L3MBTL1 and L3MBTL2. All known MBT-peptide complex structures characterized to date do not exhibit strong histone peptide sequence selectivity, and use a 'cavity insertion recognition mode' to recognize the methylated lysine with the deeply buried methyl-lysine forming extensive interactions with the protein while the peptide residues flanking methyl-lysine forming very few contacts. Nevertheless, our mutagenesis data based on L3MBTL1 suggested that the histone peptides could not bind to MBT repeats in any orientation. The four MBT repeats in MBTD1 exhibits an asymmetric rhomboid architecture. Like other MBT repeat proteins characterized so far, MBTD1 binds mono- or dimethylated lysine histones through one of its four MBT repeats utilizing a semi-aromatic cage.

  5. Resistance repeatability study of ion-beam deposited vanadium oxide thin films

    Science.gov (United States)

    Alvarez, P.; Pearson, D. I. C.; Pochon, S.; Thomas, O.; Cooke, M.; Gunn, R.

    2016-09-01

    Ion Beam Sputter Deposition (IBSD) is a versatile technique particularly suited to applications requiring high quality, high performance layer materials as it allows independent and accurate control of the process parameters. Vanadium oxides, used for example in the fabrication of microbolometers, optical switches or optical storage, exhibit interesting properties such as a high Temperature Coefficient of Resistance (TCR), relatively low 1/f noise and a semiconductormetal phase transition close to room temperature. However, it is very challenging to control the stoichiometry of the deposited film as there are at least 25 different oxidation states of vanadium, few of which display the required electrical characteristics. In the present study, vanadium oxide thin layers were deposited by IBSD using an Oxford Ionfab300+ and analyzed with regard to their electrical properties. The impact of the system parameters on the resistance repeatability, wafer-to-wafer and batch-to-batch, was thoroughly investigated to provide the end user with a clear understanding of the factors affecting film resistivity while ensuring at the same time a steep variation of resistance with temperature, as notably required for uncooled bolometers. These parameters were balanced to also achieve a good deposition rate, throughput and uniformity over large device areas, compatible with the requirements of industrial applications.

  6. Repeated dose (14 days) rat intramuscular toxicology study of Her1 vaccine.

    Science.gov (United States)

    Mancebo, A; Casacó, A; Sánchez, B; González, B; Gómez, D; León, A; Bada, A M; Arteaga, M E; González, Y; González, C; Pupo, M; Fuentes, Dasha

    2012-12-01

    Our goal was to assess the toxicity of two strengths (200 and 400 μg) of HER1 cancer vaccine (Center of Molecular Immunology, Cuba), presented in two different formulations, in Sprague Dawley rats after repeated intramuscular administration (14 days). Four groups (5 animals/sex) were established: Control, Placebo (adjuvant), and two Treated groups receiving a dose representing ten times of human total dose (10×), 28.6 and 57.1 μg/kg. Clinical observations, body weight and rectal temperature were measured during the study. Clinical pathology analysis was performed, besides gross necropsy and histological examination of tissues on animals at the end of the assay. The assay ended with a 100% survival. Injection site damage, with the presence of cysts and granulomas, was observed in adjuvant and vaccine treated groups, with most severe cases predominating at higher strength. Administration of Placebo and Her1 vaccine induced increase in polymorphonuclear cells, with relative lymphopenia conditioned by primary neutrophilia. In summary, results suggest that Her1 immunization was capable of inducing an inflammatory effect at the injection site, leading to systemic alterations, more significant at higher strength (400 μg, 57.1 μg/kg), probably affected by the immunizations' schedule used. The vaccine was shown to be well tolerated without any obvious signs of systemic toxicity, with findings largely attributable to the adjuvant used.

  7. Repeat sleeve gastrectomy compared with primary sleeve gastrectomy: a single-center, matched case study.

    Science.gov (United States)

    Rebibo, Lionel; Fuks, David; Verhaeghe, Pierre; Deguines, Jean-Baptiste; Dhahri, Abdennaceur; Regimbeau, Jean-Marc

    2012-12-01

    Longitudinal sleeve gastrectomy (LSG) has been validated for the treatment of morbid obesity. However, treatment failures can appear several months after SG. Additional malabsorptive surgery is generally recommended in such cases. The objective of the present study was to evaluate the outcomes of repeat SG (re-SG) relative to first-line SG. This was a retrospective study included 15 patients underwent re-SG after failure of first-line SG (i.e. University Hospital, France; Public Practice). These patients were matched (for age, gender, body mass index and comorbidities) 1:2 with 30 patients having undergone first-line SG. The efficacy criteria comprised intra-operative data and postoperative data. The overall study population comprised 45 patients. The re-SG and first-line SG groups did not differ significantly in terms of median age (p = NS). The median BMI was similar in the two groups (43 kg/m(2) vs. 42.3 kg/m(2), p = NS). The two groups were similar in terms of the prevalence of comorbidities. The mean operating time was longer in the re-SG group (116 vs. 86 min; p ≤ 0.01). The postoperative complication rate was twice as high in the re-SG group (p = 0.31). Two patients in the re-SG group developed a gastric fistula (p = 0.25) and one of the latter died. At 12 months, the Excess Weight Loss was 66% (re-SG group) and 77% (first-line SG group) (p = 0.05). Re-SG is feasible but appears to be associated with a greater risk of complications. Nevertheless, re-SG can produce results (in terms of weight loss), equivalent to those obtained after first-line SG.

  8. The silence at trade shows: : A case study at Hannover Messe

    OpenAIRE

    Johansson, Daniel; Bengtsson, Nicklas

    2011-01-01

    This thesis studies the non-verbal communication such as the body language in the context of a trade show. The non-verbal communication is one of the primary conveyors of messages and trade shows are one of the major channels were firms attract new customers. However the combination of trade shows and non-verbal communication is overlooked. The method consists of interviews with visitors and observations of the booths and the visitors. The setting was chosen as the annual Hannover Messe were ...

  9. Single and repeated moderate consumption of native or dealcoholized red wine show different effects on antioxidant parameters in blood and DNA strand breaks in peripheral leukocytes in healthy volunteers: a randomized controlled trial [ISRCTN68505294

    Directory of Open Access Journals (Sweden)

    Spengler Ulrich

    2005-11-01

    Full Text Available Abstract Background Red wine (RW is rich in antioxidant polyphenols that might protect from oxidative stress related diseases, such as cardiovascular disease and cancer. Antioxidant effects after single ingestion of RW or dealcoholized RW (DRW have been observed in several studies, but results after regular consumption are contradictory. Thus, we examined if single or repeated consumption of moderate amounts of RW or DRW exert antioxidant activity in vivo. Methods Total phenolic content and concentration of other antioxidants in plasma/serum, total antioxidant capacity (TEAC in plasma as well as DNA strand breaks in peripheral leukocytes were measured in healthy non-smokers A before, 90 and 360 min after ingestion of one glass of RW, DRW or water; B before and after consumption of one glass of RW or DRW daily for 6 weeks. DNA strand breaks (SB were determined by single cell gel electrophoresis (Comet Assay in untreated cells and after induction of oxidative stress ex vivo with H2O2 (300 μM, 20 min. Results Both RW and DRW transiently increased total phenolic content in plasma after single consumption, but only RW lead to a sustained increase if consumed regularly. Plasma antioxidant capacity was not affected by single or regular consumption of RW or DRW. Effects of RW and DRW on DNA SB were conflicting. DNA strand breaks in untreated cells increased after a single dose of RW and DRW, whereas H2O2 induced SB were reduced after DRW. In contrast, regular RW consumption reduced SB in untreated cells but did not affect H2O2 induced SB. Conclusion The results suggest that consumption of both RW and DRW leads to an accumulation of phenolic compounds in plasma without increasing plasma antioxidant capacity. Red wine and DRW seem to affect the occurrence of DNA strand breaks, but this cannot be referred to antioxidant effects.

  10. Genetic structure of the Azores Islands: a study using 15 autosomal short tandem repeat loci.

    Science.gov (United States)

    Santos, Cristina; Alvarez, Luis; Aluja, Maria Pilar; Bruges-Armas, Jacome; Lima, Manuela

    2009-12-01

    The Azores archipelago (Portugal), located in the Atlantic Ocean, 1,500 km from the European mainland, is formed by nine islands of volcanic origin. The relative position of these islands allows the definition of three geographical groups: Eastern, Central and Western. Previous studies of the Azores using Short Tandem Repeats (STRs) have highlighted differences in the frequencies of several loci, when compared to Mainland Portugal or Madleira Island. Furthermore, linkage disequilibrium (LD), described for Azorean samples has been tentatively explained as reflecting the presence of genetic sub-structuring in the archipelago. To provide information concerning the genetic profile of the Azores Islands and to evaluate the presence of substructuring we have determined the allelic frequencies of 15 autosomal STR loci, using the AmpFlSTR Identifiler Kit, in representative samples from the Azorean Islands. Either considering the Azores as a whole, or analysing by island all the loci were in conformity with Hardy-Weinberg equilibrium. Average gene diversity ranged from 0.7669 in Corvo to 0.7972 in Terceira Island. Allelic independence between loci, tested for the global sample, detected significant LD (after correction for multiple tests) for pairs D21S11/D7S820 and D3S1358/D5S818. The exact test of population differentiation, combining the information of the 15 markers analysed, revealed significant differences between the three groups of islands, and between islands. Inter-island analysis reinforces the previous data that suggested the existence of sub-structuring in the Azores archipelago. Moreover, the data generated by this study can be used in a future forensic genetic database of the Azores after the appropriate enlacement of sample size by island, preventing, in that way, misinterpretations caused by population substructuring and small sample sizes.

  11. Effects of Cold Water Immersion on Muscle Oxygenation During Repeated Bouts of Fatiguing Exercise: A Randomized Controlled Study.

    Science.gov (United States)

    Yeung, Simon S; Ting, Kin Hung; Hon, Maurice; Fung, Natalie Y; Choi, Manfi M; Cheng, Juno C; Yeung, Ella W

    2016-01-01

    Postexercise cold water immersion has been advocated to athletes as a means of accelerating recovery and improving performance. Given the effects of cold water immersion on blood flow, evaluating in vivo changes in tissue oxygenation during cold water immersion may help further our understanding of this recovery modality. This study aimed to investigate the effects of cold water immersion on muscle oxygenation and performance during repeated bouts of fatiguing exercise in a group of healthy young adults. Twenty healthy subjects performed 2 fatiguing bouts of maximal dynamic knee extension and flexion contractions both concentrically on an isokinetic dynamometer with a 10-min recovery period in between. Subjects were randomly assigned to either a cold water immersion (treatment) or passive recovery (control) group. Changes in muscle oxygenation were monitored continuously using near-infrared spectroscopy. Muscle performance was measured with isokinetic dynamometry during each fatiguing bout. Skin temperature, heart rate, blood pressure, and muscle soreness ratings were also assessed. Repeated measures ANOVA analysis was used to evaluate treatment effects. The treatment group had a significantly lower mean heart rate and lower skin temperature compared to the control group (P Cold water immersion attenuated a reduction in tissue oxygenation in the second fatiguing bout by 4% when compared with control. Muscle soreness was rated lower 1 day post-testing (P cold water immersion had no significant effect on muscle performance in subsequent exercise. As the results show that cold water immersion attenuated decreased tissue oxygenation in subsequent exercise performance, the metabolic response to exercise after cold water immersion is worthy of further exploration.

  12. High-Throughput Mycobacterial Interspersed Repetitive-Unit–Variable-Number Tandem-Repeat Genotyping for Mycobacterium tuberculosis Epidemiological Studies

    Science.gov (United States)

    Bidault, Floriane; Mosnier, Amandine; Bablishvili, Nino; Tukvadze, Nestani; Somphavong, Silaphet; Paboriboune, Phimpha; Ocheretina, Oksana; Pape, Jean William; Paranhos-Baccala, Glaucia; Berland, Jean-Luc

    2014-01-01

    The emergence of drug-resistant forms of tuberculosis (TB) represents a major public health concern. Understanding the transmission routes of the disease is a key factor for its control and for the implementation of efficient interventions. Mycobacterial interspersed repetitive-unit–variable-number tandem-repeat (MIRU-VNTR) marker typing is a well-described method for lineage identification and transmission tracking. However, the conventional manual genotyping technique is cumbersome and time-consuming and entails many risks for errors, thus hindering its implementation and dissemination. We describe here a new approach using the QIAxcel system, an automated high-throughput capillary electrophoresis system that also carries out allele calling. This automated method was assessed on 1,824 amplicons from 82 TB isolates and tested with sets of markers of 15 or 24 loci. Overall allele-calling concordance between the methods from 140 to 1,317 bp was 98.9%. DNA concentrations and repeatability and reproducibility performances showed no biases in allele calling. Furthermore, turnaround time using this automated system was reduced by 81% compared to the conventional manual agarose gel method. In sum, this new automated method facilitates MIRU-VNTR genotyping and provides reliable results. Therefore, it is well suited for field genotyping. The implementation of this method will help to achieve accurate and cost-effective epidemiological studies, especially in countries with a high prevalence of TB, where the high number of strains complicates the surveillance of circulating lineages and requires efficient interventions to be carried out in an urgent manner. PMID:25428144

  13. spa Typing and Multilocus Sequence Typing Show Comparable Performance in a Macroepidemiologic Study of Staphylococcus aureus in the United States.

    Science.gov (United States)

    O'Hara, F Patrick; Suaya, Jose A; Ray, G Thomas; Baxter, Roger; Brown, Megan L; Mera, Robertino M; Close, Nicole M; Thomas, Elizabeth; Amrine-Madsen, Heather

    2016-01-01

    A number of molecular typing methods have been developed for characterization of Staphylococcus aureus isolates. The utility of these systems depends on the nature of the investigation for which they are used. We compared two commonly used methods of molecular typing, multilocus sequence typing (MLST) (and its clustering algorithm, Based Upon Related Sequence Type [BURST]) with the staphylococcal protein A (spa) typing (and its clustering algorithm, Based Upon Repeat Pattern [BURP]), to assess the utility of these methods for macroepidemiology and evolutionary studies of S. aureus in the United States. We typed a total of 366 clinical isolates of S. aureus by these methods and evaluated indices of diversity and concordance values. Our results show that, when combined with the BURP clustering algorithm to delineate clonal lineages, spa typing produces results that are highly comparable with those produced by MLST/BURST. Therefore, spa typing is appropriate for use in macroepidemiology and evolutionary studies and, given its lower implementation cost, this method appears to be more efficient. The findings are robust and are consistent across different settings, patient ages, and specimen sources. Our results also support a model in which the methicillin-resistant S. aureus (MRSA) population in the United States comprises two major lineages (USA300 and USA100), which each consist of closely related variants.

  14. spa Typing and Multilocus Sequence Typing Show Comparable Performance in a Macroepidemiologic Study of Staphylococcus aureus in the United States

    Science.gov (United States)

    O'Hara, F. Patrick; Suaya, Jose A.; Ray, G. Thomas; Baxter, Roger; Brown, Megan L.; Mera, Robertino M.; Close, Nicole M.; Thomas, Elizabeth

    2016-01-01

    A number of molecular typing methods have been developed for characterization of Staphylococcus aureus isolates. The utility of these systems depends on the nature of the investigation for which they are used. We compared two commonly used methods of molecular typing, multilocus sequence typing (MLST) (and its clustering algorithm, Based Upon Related Sequence Type [BURST]) with the staphylococcal protein A (spa) typing (and its clustering algorithm, Based Upon Repeat Pattern [BURP]), to assess the utility of these methods for macroepidemiology and evolutionary studies of S. aureus in the United States. We typed a total of 366 clinical isolates of S. aureus by these methods and evaluated indices of diversity and concordance values. Our results show that, when combined with the BURP clustering algorithm to delineate clonal lineages, spa typing produces results that are highly comparable with those produced by MLST/BURST. Therefore, spa typing is appropriate for use in macroepidemiology and evolutionary studies and, given its lower implementation cost, this method appears to be more efficient. The findings are robust and are consistent across different settings, patient ages, and specimen sources. Our results also support a model in which the methicillin-resistant S. aureus (MRSA) population in the United States comprises two major lineages (USA300 and USA100), which each consist of closely related variants. PMID:26669861

  15. LONGITUDINAL STUDY OF REPEATED SPRINT PERFORMANCE IN YOUTH SOCCER PLAYERS OF CONTRASTING SKELETAL MATURITY STATUS

    Directory of Open Access Journals (Sweden)

    João Valente-dos-Santos

    2012-09-01

    Full Text Available The purpose of the study was to evaluate the developmental changes in performance in a repeated-sprint ability (RSA test in young soccer players of contrasting maturity status. A total of 83 regional level Portuguese youth soccer players, aged 11- 13 years at baseline was assessed annually. Stature, body mass, 7x34.2-m sprint protocol (25-s active recovery, 20-m multi-stage continuous shuttle endurance run and counter-movement jump (CMJ without the use of the arms were measured. Fat-free mass (FFM was determined by age and gender- specific formulas. Developmental changes in total sprint time across ages were predicted using multilevel modeling. Corresponding measurements were performed on an independent cross-sectional subsample of 52 youth soccer players 11-17 years to evaluate the predictive model. CA, CA2, maturational status (SA-CA, body size (mass and stature, FFM, aerobic endurance, lower limb explosive strength and annual volume training significantly improved the statistical fit of the RSA multilevel model. In 'late' maturing athletes, the best model for predicting change in RSA was expressed by the following equation: 86.54 - 2.87 x CA + 0.05 x CA2 - 0.25 x FFM + 0.15 x body mass + 0.05 x stature - 0.05 x aerobic endurance - 0.09 x lower limb explosive strength - 0.01 x annual volume training. The best fitting models for players who were 'on time' and 'early' maturing were identical to the best model for late maturing players, less 0.64 seconds and 1.74 seconds, respectively. Multilevel modeling provided performance curves that permitted the prediction of individual RSA performance across adolescent years in regional level soccer players

  16. A 13-week dermal repeat-dose neurotoxicity study of hydrodesulfurized kerosene in rats.

    Science.gov (United States)

    Breglia, Rudolph; Bui, Quang; Burnett, Donald; Koschier, Francis; Lapadula, Elizabeth; Podhasky, Paula; Schreiner, Ceinwen; White, Russell

    2014-01-01

    A 13-week dermal repeat-dose toxicity study was conducted with hydrodesulfurized (HDS) kerosene, a test material that also met the commercial specifications for aviation turbine fuel (jet A). The objectives were to assess the potential for target organ toxicity and neurotoxicity. The HDS kerosene was applied to the shaved backs of Sprague-Dawley CD rats, 12/sex/group, 6 h/d, 5 d/wk in doses of 0 (vehicle control), 165 mg/kg (20% HDS kerosene), 330 mg/kg (40% HDS kerosene), or 495 mg/kg (60% HDS kerosene). Additional rats (12/sex) from the control and the high-dose groups were held without treatment for 4 weeks to assess recovery. Standard parameters of toxicity were investigated during the in-life phase. At necropsy, organs were weighed and selected tissues were processed for microscopic evaluation. Neurobehavioral evaluations included tests of motor activity and functional observations that were conducted pretest, at intervals during the exposure period and after recovery. No test substance-related effects on mortality, clinical observations (except dermal irritation), body weight, or clinical chemistry values were observed. A dose-related increase in skin irritation, confirmed histologically as minimal, was evident at the dosing site. The only statistically significant change considered potentially treatment related was an increase in the neutrophil count in females at 13 weeks. No test article-related effects were observed in the neurobehavioral assessments or gross or microscopic findings in the peripheral or central nervous system tissues in any of the dose groups. Excluding skin irritation, the no observed adverse effect level value for all effects was considered 495 mg/kg/d.

  17. Population genetic study of 10 short tandem repeat loci from 600 domestic dogs in Korea

    Science.gov (United States)

    Moon, Seo Hyun; Jang, Yoon-Jeong

    2016-01-01

    Dogs have long shared close relationships with many humans. Due to the large number of dogs in human populations, they are often involved in crimes. Occasionally, canine biological evidence such as saliva, bloodstains and hairs can be found at crime scenes. Accordingly, canine DNA can be used as forensic evidence. The use of short tandem repeat (STR) loci from biological evidence is valuable for forensic investigations. In Korea, canine STR profiling-related crimes are being successfully analyzed, leading to diverse crimes such as animal cruelty, dog-attacks, murder, robbery, and missing and abandoned dogs being solved. However, the probability of random DNA profile matches cannot be analyzed because of a lack of canine STR data. Therefore, in this study, 10 STR loci were analyzed in 600 dogs in Korea (344 dogs belonging to 30 different purebreds and 256 crossbred dogs) to estimate canine forensic genetic parameters. Among purebred dogs, a separate statistical analysis was conducted for five major subgroups, 97 Maltese, 47 Poodles, 31 Shih Tzus, 32 Yorkshire Terriers, and 25 Pomeranians. Allele frequencies, expected (Hexp) and observed heterozygosity (Hobs), fixation index (F), probability of identity (P(ID)), probability of sibling identity (P(ID)sib) and probability of exclusion (PE) were then calculated. The Hexp values ranged from 0.901 (PEZ12) to 0.634 (FHC2079), while the P(ID)sib values were between 0.481 (FHC2079) and 0.304 (PEZ12) and the P(ID)sib was about 3.35 × 10−5 for the combination of all 10 loci. The results presented herein will strengthen the value of canine DNA to solving dog-related crimes. PMID:26645337

  18. Pilot study: Assessing repeatability of the EcoWalk platform resistive pressure sensors to measure plantar pressure during barefoot standing

    Science.gov (United States)

    Zequera, Martha; Perdomo, Oscar; Wilches, Carlos; Vizcaya, Pedro

    2013-06-01

    Plantar pressure provides useful information to assess the feet's condition. These systems have emerged as popular tools in clinical environment. These systems present errors and no compensation information is presented by the manufacturer, leading to uncertainty in the measurements. Ten healthy subjects, 5 females and 5 males, were recruited. Lateral load distribution, antero-posterior load distribution, average pressure, contact area, and force were recorded. The aims of this study were to assess repeatability of the EcoWalk system and identify the range of pressure values observed in the normal foot. The coefficient of repeatability was less than 4% for all parameters considered.

  19. Prospective study on determinants of repeat attendance and attendance patterns in breast cancer screening using the Theory of Planned Behaviour.

    NARCIS (Netherlands)

    Drossaert, Constance H.C.; Boer, Hendrik; Seydel, E.R.

    2003-01-01

    This prospective study, using the Theory of Planned Behaviour (TPB) as a theoretical framework, was carried out to identify the determinants of repeat attendance and attendance patterns in organised breast screening. A group of 2657 women filled out a baseline questionnaire, approximately 8 weeks

  20. Inter-Simple Sequence Repeat (ISSR Markers to Study Genetic Diversity Among Cotton Cultivars in Associated with Salt Tolerance

    Directory of Open Access Journals (Sweden)

    Ali Akbar ABDI

    2012-11-01

    Full Text Available Developing salt-tolerant crops is very important as a significant proportion of cultivated land is salt-affected. Screening and selection of salt tolerant genotypes of cotton using DNA molecular markers not only introduce tolerant cultivars useful for hybridization and breeding programs but also detect DNA regions involved in mechanism of salinity tolerance. To study this, 28 cotton cultivars, including 8 Iranian cotton varieties were grown in pots under greenhouse condition and three salt treatments were imposed with salt solutions (0, 70 and 140 mM NaCl. Eight agronomic traits including root length, root fresh weight, root dry weight, chlorophyll and fluorescence index, K+ and Na+ contents in shoot (above ground biomass, and K+/Na+ ratio were measured. Cluster analysis of cultivars based on measured agronomic traits, showed �Cindose� and �Ciacra� as the most tolerant cultivars, and �B-557� and �43347� as the most sensitive cultivars of salt damage. A total of 65 polymorphic DNA fragments were generated at 14 inter-simple sequence repeat (ISSR loci. Plants of 28 cultivars of cotton grouped into three clusters based on ISSR markers. Regression analysis of markers in relation with traits data showed that 23, 33 and 30 markers associated with the measured traits in three salt treatments respectively. These markers might help breeders in any marker assisted selection program in order to improving cotton cultivars against salt stress.

  1. Beverage Intake Assessment Questionnaire: Relative Validity and Repeatability in a Spanish Population with Metabolic Syndrome from the PREDIMED-PLUS Study

    Science.gov (United States)

    Ferreira-Pêgo, Cíntia; Nissensohn, Mariela; Kavouras, Stavros A.; Babio, Nancy; Serra-Majem, Lluís; Martín Águila, Adys; Mauromoustakos, Andy; Álvarez Pérez, Jacqueline; Salas-Salvadó, Jordi

    2016-01-01

    We assess the repeatability and relative validity of a Spanish beverage intake questionnaire for assessing water intake from beverages. The present analysis was performed within the framework of the PREDIMED-PLUS trial. The study participants were adults (aged 55–75) with a BMI ≥27 and <40 kg/m2, and at least three components of Metabolic Syndrome (MetS). A trained dietitian completed the questionnaire. Participants provided 24-h urine samples, and the volume and urine osmolality were recorded. The repeatability of the baseline measurement at 6 and 1 year was examined by paired Student’s t-test comparisons. A total of 160 participants were included in the analysis. The Bland–Altman analysis showed relatively good agreement between total daily fluid intake assessed using the fluid-specific questionnaire, and urine osmolality and 24-h volume with parameter estimates of −0.65 and 0.22, respectively (R2 = 0.20; p < 0.001). In the repeatability test, no significant differences were found between neither type of beverage nor total daily fluid intake at 6 months and 1-year assessment, compared to baseline. The proposed fluid-specific assessment questionnaire designed to assess the consumption of water and other beverages in Spanish adult individuals was found to be relatively valid with good repeatability. PMID:27483318

  2. Progress study on the mechanism of CAG repeats dynamic mutation in polyQ disease

    Directory of Open Access Journals (Sweden)

    WANG Chun-rong

    2012-06-01

    Full Text Available Polyglutamine (polyQ disease is a group of neurodegenerative disorders caused by abnormal expansion of CAG repeats within coding regions of certain causative genes, which are translated into a series of abnormally expanded polyQ tracts causing cytotoxicity. So far, nine diseases caused by expanded polyQ tracts have been demonstrated including Huntington's disease (HD, spinobulbar muscular atrophy (SBMA, dentatorubral-pallidoluysian atrophy (DRPLA and several spinocerebellar ataxias subtypes (SCA. In human, long CAG repeats tend to expand during transmissions from parent to offspring, named as dynamic mutation, leading to an earlier age of disease onset and more severe symptoms in subsequent generations. The review presents some novel mechanisms based on dynamic mutation.

  3. PCR bias in amplification of androgen receptor alleles, a trinucleotide repeat marker used in clonality studies.

    OpenAIRE

    Mutter, G L; Boynton, K A

    1995-01-01

    Trinucleotide CAG repeats in the X-linked human androgen receptor gene (HUMARA) have proved a useful means of determining X chromosome haplotypes, and when combined with methylation analysis of nearby cytosine residues permits identification of non-random X inactivation in tumors of women. Co-amplification of two alleles in a heterozygote generates PCR products which differ in the number of CAG units, and thus their melting and secondary structure characteristics. We have shown that under opt...

  4. A genetic and structural study of genome rearrangements mediated by high copy repeat Ty1 elements.

    Directory of Open Access Journals (Sweden)

    Jason E Chan

    2011-05-01

    Full Text Available Ty elements are high copy number, dispersed repeated sequences in the Saccharomyces cerevisiae genome known to mediate gross chromosomal rearrangements (GCRs. Here we found that introduction of Ty912, a previously identified Ty1 element, onto the non-essential terminal region of the left arm of chromosome V led to a 380-fold increase in the rate of accumulating GCRs in a wild-type strain. A survey of 48 different mutations identified those that either increased or decreased the rate of Ty-mediated GCRs and demonstrated that suppression of Ty-mediated GCRs differs from that of both low copy repeat sequence- and single copy sequence-mediated GCRs. The majority of the Ty912-mediated GCRs observed were monocentric nonreciprocal translocations mediated by RAD52-dependent homologous recombination (HR between Ty912 and a Ty element on another chromosome arm. The remaining Ty912-mediated GCRs appeared to involve Ty912-mediated formation of unstable dicentric translocation chromosomes that were resolved by one or more Ty-mediated breakage-fusion-bridge cycles. Overall, the results demonstrate that the Ty912-mediated GCR assay is an excellent model for understanding mechanisms and pathways that suppress genome rearrangements mediated by high copy number repeat sequences, as well as the mechanisms by which such rearrangements occur.

  5. Study of the repeatability of histone genes in the ploidy series of wheat and Aegilops

    Energy Technology Data Exchange (ETDEWEB)

    Vakhitov, V.A.; Kulikov, A.M.

    1986-10-01

    The hDNA content and number of histone genes in the genomes of different wheat and Aegilops species have been determined by molecular hybridization of DNA with /sup 125/I-histone DNA of Drosophila (L-repeat) on nitrocellulose filters. It has been demonstrated that the proportion of hDNA in the total DNA of diploid and polyploid wheat species is (1.3-7.7) x 10/sup -3/% (57-850 genes), and in the ploidy series of Aegilops species (2.0-8.0) x 10/sup -3/% (89-780 genes). The repeatability of the histone genes generally increases at each ploidy level in the species with higher DNA content. At the same time, it has been demonstrated that the DNA content is not the only factor determining repeatability of the histone genes, as some diploid and allopolyploid species have similar number of these genes. It has been concluded that genetic mechanisms are involved in the regulation of the number of histone genes.

  6. Repeatability study of mechanomyography in submaximal isometric contractions using coefficient of variation and intraclass correlation coefficient.

    Science.gov (United States)

    Akataki, K; Mita, K; Itoh, Y

    1999-01-01

    The within-day and between-day repeatability of the mechanomyogram (MMG) was assessed using the coefficient of variation (CV) and the intraclass correlation coefficient (ICC) and was compared with that of the electromyogram (EMG). The MMG and EMG were recorded simultaneously during isometric elbow flexion trials at different submaximal levels of 10% to 90% MVC. The testing session consisting of 9 submaximal trials was repeated 8 times on the same day for estimation of the within-day variation. In order to examine the between-day variation, the same testing session was also performed 8 times over 3 weeks with a 2-day rest interval between each session. The CVs within-day and between-day in both the MMG and EMG did not demonstrate any significant differences relating to the magnitude of force exerted. The CVs combined over all the force levels were approximately 10% within the same day and 25% between days for both the MMG and EMG. These corresponded to the within-day ICC of approximately 0.95 and the between-day ICC of 0.80. The repeatability of the MMG during submaximal isometric contractions of biceps brachii muscles is considered to be similar to that of the more established EMG.

  7. Effects of repeatability measures on results of fMRI sICA: a study on simulated and real resting-state effects.

    Science.gov (United States)

    Remes, Jukka J; Starck, Tuomo; Nikkinen, Juha; Ollila, Esa; Beckmann, Christian F; Tervonen, Osmo; Kiviniemi, Vesa; Silven, Olli

    2011-05-15

    Spatial independent components analysis (sICA) has become a widely applied data-driven method for fMRI data, especially for resting-state studies. These sICA approaches are often based on iterative estimation algorithms and there are concerns about accuracy due to noise. Repeatability measures such as ICASSO, RAICAR and ARABICA have been introduced as remedies but information on their effects on estimates is limited. The contribution of this study was to provide more of such information and test if the repeatability analyses are necessary. We compared FastICA-based ordinary and repeatability approaches concerning mixing vector estimates. Comparisons included original FastICA, FSL4 Melodic FastICA and original and modified ICASSO. The effects of bootstrapping and convergence threshold were evaluated. The results show that there is only moderate improvement due to repeatability measures and only in the bootstrapping case. Bootstrapping attenuated power from time courses of resting-state network related ICs at frequencies higher than 0.1 Hz and made subsets of low frequency oscillations more emphasized IC-wise. The convergence threshold did not have a significant role concerning the accuracy of estimates. The performance results suggest that repeatability measures or strict converge criteria might not be needed in sICA analyses of fMRI data. Consequently, the results in existing sICA fMRI literature are probably valid in this sense. A decreased accuracy of original bootstrapping ICASSO was observed and corrected by using centrotype mixing estimates but the results warrant for thorough evaluations of data-driven methods in general. Also, given the fMRI-specific considerations, further development of sICA methods is strongly encouraged. Copyright © 2010 Elsevier Inc. All rights reserved.

  8. Deployment Repeatability

    Science.gov (United States)

    2016-04-01

    controlled to great precision, but in a Cubesat , there may be no attitude determination at all. Such a Cubesat might treat sun angle and tumbling rates as...could be sensitive to small differences in motor controller timing. In these cases, the analyst might choose to model the entire deployment path, with...knowledge of the material damage model or motor controller timing precision. On the other hand, if many repeated and environmentally representative

  9. Contesting the “Nature” Of Conformity: What Milgram and Zimbardo's Studies Really Show

    Science.gov (United States)

    Haslam, S. Alexander; Reicher, Stephen. D.

    2012-01-01

    Understanding of the psychology of tyranny is dominated by classic studies from the 1960s and 1970s: Milgram's research on obedience to authority and Zimbardo's Stanford Prison Experiment. Supporting popular notions of the banality of evil, this research has been taken to show that people conform passively and unthinkingly to both the instructions and the roles that authorities provide, however malevolent these may be. Recently, though, this consensus has been challenged by empirical work informed by social identity theorizing. This suggests that individuals' willingness to follow authorities is conditional on identification with the authority in question and an associated belief that the authority is right. PMID:23185132

  10. Childhood experiences and repeated suicidal behavior

    DEFF Research Database (Denmark)

    Krarup, Gertrud; Nielsen, Bent; Rask, P

    1991-01-01

    The aim of this study was to elucidate the influence of various events in childhood on suicidal behavior in adult age. For this purpose, 99 patients admitted to the Department of Psychiatry of Odense University Hospital after making a suicide attempt were followed for 5 years, to register repeated...... suicidal behavior. The results showed that three fourths of the patients attempted suicide more than once (62% nonfatal and 14% fatal outcome). The sex distribution was about the same among the first-evers as among the repeaters. Most repeaters were younger people in their twenties and thirties......, and the first-evers on average were past the age of 40. Somewhat unexpectedly, significantly more repeaters than first-evers had grown up with both their parents. However, the results also showed that significantly more repeaters than first-evers had had an unhappy childhood. This indicates...

  11. Variability in prefrontal hemodynamic response during exposure to repeated self-selected music excerpts, a near-infrared spectroscopy study.

    Science.gov (United States)

    Moghimi, Saba; Schudlo, Larissa; Chau, Tom; Guerguerian, Anne-Marie

    2015-01-01

    Music-induced brain activity modulations in areas involved in emotion regulation may be useful in achieving therapeutic outcomes. Clinical applications of music may involve prolonged or repeated exposures to music. However, the variability of the observed brain activity patterns in repeated exposures to music is not well understood. We hypothesized that multiple exposures to the same music would elicit more consistent activity patterns than exposure to different music. In this study, the temporal and spatial variability of cerebral prefrontal hemodynamic response was investigated across multiple exposures to self-selected musical excerpts in 10 healthy adults. The hemodynamic changes were measured using prefrontal cortex near infrared spectroscopy and represented by instantaneous phase values. Based on spatial and temporal characteristics of these observed hemodynamic changes, we defined a consistency index to represent variability across these domains. The consistency index across repeated exposures to the same piece of music was compared to the consistency index corresponding to prefrontal activity from randomly matched non-identical musical excerpts. Consistency indexes were significantly different for identical versus non-identical musical excerpts when comparing a subset of repetitions. When all four exposures were compared, no significant difference was observed between the consistency indexes of randomly matched non-identical musical excerpts and the consistency index corresponding to repetitions of the same musical excerpts. This observation suggests the existence of only partial consistency between repeated exposures to the same musical excerpt, which may stem from the role of the prefrontal cortex in regulating other cognitive and emotional processes.

  12. Laboratory study of fungal bioreceptivity of different fractions of composite flooring tiles showing efflorescence.

    Science.gov (United States)

    Masaphy, Segula; Lavi, Ido; Sultz, Stephan; Zabari, Limor

    2014-06-01

    Fungi can grow in extreme habitats, such as natural stone and mineral building materials, sometimes causing deterioration. Efflorescence-concentrated salt deposits-results from water movement through building material; it can damage masonry materials and other bricks. Fungal isolate KUR1, capable of growth on, and dissolution of stone chips composing terrazzo-type floor tiles, was isolated from such tiles showing fiber-like crystalline efflorescence. The isolate's ribosomal DNA sequences were 100 % identical to those of Nigrospora sphaerica. The ability of KUR1 to colonize and degrade the different stone chips composing the tiles was studied in axenic culture experiments. When exposed to each of the different mineral chip types composed of dolomite, calcite, or calcite-apatite mineral in low-nutrition medium, the fungus showed selective nutrient consumption, and different growth and stone mineral dissolution rates. Micromorphological examination of the fungus-colonized chips by electron microscopy showed the production of a fungal biofilm with thin films around the hyphae on the surface of the examined chips and disintegration of the calcite-apatite fraction. More than 70 % dissolution of the introduced powdered (mineral was obtained within 10 days of incubation for the soft calcite-apatite fraction.

  13. Analysis of allergen immunotherapy studies shows increased clinical efficacy in highly symptomatic patients

    DEFF Research Database (Denmark)

    Howarth, P; Malling, Hans-Jørgen; Molimard, M;

    2011-01-01

    To cite this article: Howarth P, Malling H-J, Molimard M, Devillier P. Analysis of allergen immunotherapy studies shows increased clinical efficacy in highly symptomatic patients. Allergy 2012; 67: 321-327. ABSTRACT: Background:  The assessment of allergen immunotherapy (AIT) efficacy...... in the treatment for seasonal allergic rhinoconjunctivitis (SAR) symptoms is challenging. Allergen immunotherapy differs from symptomatic therapy in that while symptomatic therapy treats patients after symptoms appear and aims to reduce symptoms, AIT is administered before symptoms are present and aims to prevent...... them. Thus, clinical studies of AIT can neither establish baseline symptom levels nor limit the enrolment of patients to those with the most severe symptoms. Allergen immunotherapy treatment effects are therefore diluted by patients with low symptoms for a particular pollen season. The objective...

  14. Repeated hands-and-knees positioning during labour: a randomized pilot study.

    Science.gov (United States)

    Hodnett, Ellen D; Stremler, Robyn; Halpern, Stephen H; Weston, Julie; Windrim, Rory

    2013-01-01

    Background. Caesarean birth rates in North America continue to rise, in the absence of benefit for mothers and babies. One reason may be that hospitalized labouring women spend most of their labours in recumbent or semi-recumbent positions. Although hands-and-knees position has theoretical advantages, efforts to encourage its adoption in practice are severely hampered by the lack of compelling evidence that it is beneficial. Before a definitive, large scale trial, with spontaneous vaginal birth as the primary outcome, could be justified in terms of time, effort, and expense, several feasibility and acceptability questions had to be addressed. We aimed to enrol 60 women in a pilot study to assess feasibility and acceptability of the trial protocol, and to obtain estimates of treatment effects on method of birth and persistent back pain. Methods. We conducted a pilot study at two North American hospitals. In ten months of recruitment, 30 nulliparous women in labour at term were randomly allocated to either usual care (use of any position during labour except hands-and-knees) or to try hands-and-knees for 15 min every hour during labour. Data were collected about compliance, acceptability, persistent back pain, intrapartum interventions, and women's views of their experiences. Results. Although mean length of time from randomization to delivery was over 12 hours, only 9 of the 16 women allocated to repeated hands-and-knees used it more than twice. Two of the 14 in the usual care group used hands-and-knees once. Twenty-seven women had regional analgesia (15 in the hands-and-knees group and 12 in the usual care group). Eleven in the hands-and-knees group and 14 in the usual care group had spontaneous vaginal births. One woman (in the hands-and-knees group) had a vacuum extraction. Four women in the hands-and-knees group and none in the usual care group gave birth by caesarean section. Hourly back pain ratings were highly variable in both groups, covering the full range

  15. Repeated hands-and-knees positioning during labour: a randomized pilot study

    Directory of Open Access Journals (Sweden)

    Ellen D. Hodnett

    2013-02-01

    Full Text Available Background. Caesarean birth rates in North America continue to rise, in the absence of benefit for mothers and babies. One reason may be that hospitalized labouring women spend most of their labours in recumbent or semi-recumbent positions. Although hands-and-knees position has theoretical advantages, efforts to encourage its adoption in practice are severely hampered by the lack of compelling evidence that it is beneficial. Before a definitive, large scale trial, with spontaneous vaginal birth as the primary outcome, could be justified in terms of time, effort, and expense, several feasibility and acceptability questions had to be addressed. We aimed to enrol 60 women in a pilot study to assess feasibility and acceptability of the trial protocol, and to obtain estimates of treatment effects on method of birth and persistent back pain.Methods. We conducted a pilot study at two North American hospitals. In ten months of recruitment, 30 nulliparous women in labour at term were randomly allocated to either usual care (use of any position during labour except hands-and-knees or to try hands-and-knees for 15 min every hour during labour. Data were collected about compliance, acceptability, persistent back pain, intrapartum interventions, and women’s views of their experiences.Results. Although mean length of time from randomization to delivery was over 12 hours, only 9 of the 16 women allocated to repeated hands-and-knees used it more than twice. Two of the 14 in the usual care group used hands-and-knees once. Twenty-seven women had regional analgesia (15 in the hands-and-knees group and 12 in the usual care group. Eleven in the hands-and-knees group and 14 in the usual care group had spontaneous vaginal births. One woman (in the hands-and-knees group had a vacuum extraction. Four women in the hands-and-knees group and none in the usual care group gave birth by caesarean section. Hourly back pain ratings were highly variable in both groups

  16. CAG repeat polymorphisms in the androgen receptor and breast cancer risk in women: a meta-analysis of 17 studies

    Directory of Open Access Journals (Sweden)

    Mao Q

    2015-08-01

    Full Text Available Qixing Mao,1–3,* Mantang Qiu,1–3,* Gaochao Dong,3 Wenjie Xia,1–3 Shuai Zhang,1,3 Youtao Xu,1,3 Jie Wang,3 Yin Rong,1,3 Lin Xu,1,3 Feng Jiang1,3 1Department of Thoracic Surgery, Nanjing Medical University Affiliated Cancer Institute of Jiangsu Province, 2Fourth Clinical College of Nanjing Medical University, 3Jiangsu Key Laboratory of Molecular and Translational Cancer Research, Nanjing, People’s Republic of China *These authors contributed equally to this work Abstract: The association between polymorphic CAG repeats in the androgen receptor gene in women and breast cancer susceptibility has been studied extensively. However, the conclusions regarding this relationship remain conflicting. The purpose of this meta-analysis was to identify whether androgen receptor CAG repeat lengths were related to breast cancer susceptibility. The MEDLINE, PubMed, and EMBASE databases were searched through to December 2014 to identify eligible studies. Data and study quality were rigorously assessed by two investigators according to the Newcastle-Ottawa Quality Assessment Scale. The publication bias was assessed by the Begg’s test. Seventeen eligible studies were included in this meta-analysis. The overall analysis suggested no association between CAG polymorphisms and breast cancer risk (odds ratio [OR] 1.031, 95% confidence interval [CI] 0.855–1.245. However, in the subgroup analysis, we observed that long CAG repeats significantly increased the risk of breast cancer in the Caucasian population (OR 1.447, 95% CI 1.089–1.992. Additionally, the risk was significantly increased in Caucasian women carrying two alleles with CAG repeats ≥22 units compared with those with two shorter alleles (OR 1.315, 95% CI 1.014–1.707. These findings suggest that long CAG repeats increase the risk of breast cancer in Caucasian women. However, larger scale case-control studies are needed to validate our results. Keywords: androgen, CAG repeat polymorphism, women

  17. Preparation of Pt-Tl clusters showing new geometries. X-ray, NMR and luminescence studies.

    Science.gov (United States)

    Belío, Úrsula; Fuertes, Sara; Martín, Antonio

    2014-07-28

    Square planar complexes [Pt(CNC)L] (CNC = C,N,C-2,6-NC5H3(C6H4-2)2; L = tht (tetrahydrothiophene, SC4H8, 1), L = CN(t)Bu (2)) react with TlPF6 in different Pt/Tl molar ratios (3/1 in the case of 1 and 1/1 in the case of 2) yielding the complexes [{Pt(CNC)(tht)}3Tl](PF6) (3) and [Pt(CNC)(CN(t)Bu)Tl](PF6) (4), respectively. The structures of 3 and 4 (X-ray) show the presence of Pt→Tl dative bonds unsupported by any bridging ligands. In complex 3, the only Tl centre is simultaneously bonded to three Pt atoms forming a perfect equilateral triangle with Pt-Tl distances of 2.9088(5) Å, remarkably short. Complex 4 is formed by three "Pt(CNC)(CN(t)Bu)Tl" units, disposed in a triangular fashion, linked together through η(6)-Tl-arene interactions, and showing Pt-Tl bonds with distances of ca. 3.04 Å. The study of these crystal structures would seem to indicate that the difference between the Pt/Tl ratios found in the complexes 3 and 4 is due to the steric requirements of the L ligand bonded to Pt. NMR studies both in solution and in the solid state show that the Pt-Tl bond persists in solutions of 3 and 4. The UV-vis spectra of 3 and 4 in solution display the same profiles as those of 1 and 2, which may suggest a partial dissociation of the Pt-Tl bond in solution. However, by DFT calculations it was proved that in this case the formation of the Pt-Tl dative bond does not produce the expected blue-shift in the UV-vis absorptions. The emissive behaviour of 1-4 in the solid state and in frozen solutions is also studied and included in this work.

  18. Diabetic Foot Prevention: Repeatability of the Loran Platform Plantar Pressure and Load Distribution Measurements in Nondiabetic Subjects during Bipedal Standing—A Pilot Study

    Directory of Open Access Journals (Sweden)

    Martha Zequera

    2011-01-01

    Full Text Available This study was designed to assess the repeatability of the Loran Platform and evaluate the variability of plantar pressure and postural balance, during barefoot standing in nondiabetic subjects, for future diabetic foot clinical evaluation. Measurements were taken for eight nondiabetic subjects (4 females, 4 males, aged 47±7.2 years who had no musculoskeletal symptoms. Five variables were measured with the platform in the barefoot standing position. Ten measurements were taken using two different techniques for feet and posture positioning, during three sessions, once a week. For most measurements, no significant effect over time was found with Student's t-test (P<.000125. The ANOVA test of statistical significance confirmed that measurement differences between subjects showed higher variations than measurements taken from the same subject (P<.001. The measurements taken by the Loran Platform system were found to be repeatable.

  19. Confocal Raman imaging study showing macrophage mediated biodegradation of graphene in vivo.

    Science.gov (United States)

    Girish, Chundayil Madathil; Sasidharan, Abhilash; Gowd, G Siddaramana; Nair, Shantikumar; Koyakutty, Manzoor

    2013-11-01

    This study is focused on the crucial issue of biodegradability of graphene under in vivo conditions. Characteristic Raman signatures of graphene are used to three dimensionally (3D) image its localization in lung, liver, kidney and spleen of mouse and identified gradual development of structural disorder, happening over a period of 3 months, as indicated by the formation of defect-related D'band, line broadening of D and G bands, increase in ID /IG ratio and overall intensity reduction. Prior to injection, the carboxyl functionalized graphene of lateral size ∼200 nm is well dispersed in aqueous medium, but 24 hours post injection, larger aggregates of size up to 10 μm are detected in various organs. Using Raman cluster imaging method, temporal development of disorder is detected from day 8 onwards, which begins from the edges and grows inwards over a period of 3 months. The biodegradation is found prominent in graphene phagocytosed by tissue-bound macrophages and the gene expression studies of pro-inflammatory cytokines indicated the possibility of phagocytic immune response. In addition, in vitro studies conducted on macrophage cell lines also show development of structural disorder in the engulfed graphene, reiterating the role of macrophages in biodegradation. This is the first report providing clear evidence of in vivo biodegradation of graphene and these results may radically change the perspective on potential biomedical applications of graphene.

  20. Reconfigurable multiport EPON repeater

    Science.gov (United States)

    Oishi, Masayuki; Inohara, Ryo; Agata, Akira; Horiuchi, Yukio

    2009-11-01

    An extended reach EPON repeater is one of the solutions to effectively expand FTTH service areas. In this paper, we propose a reconfigurable multi-port EPON repeater for effective accommodation of multiple ODNs with a single OLT line card. The proposed repeater, which has multi-ports in both OLT and ODN sides, consists of TRs, BTRs with the CDR function and a reconfigurable electrical matrix switch, can accommodate multiple ODNs to a single OLT line card by controlling the connection of the matrix switch. Although conventional EPON repeaters require full OLT line cards to accommodate subscribers from the initial installation stage, the proposed repeater can dramatically reduce the number of required line cards especially when the number of subscribers is less than a half of the maximum registerable users per OLT. Numerical calculation results show that the extended reach EPON system with the proposed EPON repeater can save 17.5% of the initial installation cost compared with a conventional repeater, and can be less expensive than conventional systems up to the maximum subscribers especially when the percentage of ODNs in lightly-populated areas is higher.

  1. Repeat prenatal corticosteroid prior to preterm birth: a systematic review and individual participant data meta-analysis for the PRECISE study group (prenatal repeat corticosteroid international IPD study group: assessing the effects using the best level of evidence - study protocol

    Directory of Open Access Journals (Sweden)

    Crowther Caroline A

    2012-02-01

    Full Text Available Abstract Background The aim of this individual participant data (IPD meta-analysis is to assess whether the effects of repeat prenatal corticosteroid treatment given to women at risk of preterm birth to benefit their babies are modified in a clinically meaningful way by factors related to the women or the trial protocol. Methods/Design The Prenatal Repeat Corticosteroid International IPD Study Group: assessing the effects using the best level of Evidence (PRECISE Group will conduct an IPD meta-analysis. The PRECISE International Collaborative Group was formed in 2010 and data collection commenced in 2011. Eleven trials with up to 5,000 women and 6,000 infants are eligible for the PRECISE IPD meta-analysis. The primary study outcomes for the infants will be serious neonatal outcome (defined by the PRECISE International IPD Study Group as one of death (foetal, neonatal or infant; severe respiratory disease; severe intraventricular haemorrhage (grade 3 and 4; chronic lung disease; necrotising enterocolitis; serious retinopathy of prematurity; and cystic periventricular leukomalacia; use of respiratory support (defined as mechanical ventilation or continuous positive airways pressure or other respiratory support; and birth weight (Z-scores. For the children, the primary study outcomes will be death or any neurological disability (however defined by trialists at childhood follow up and may include developmental delay or intellectual impairment (developmental quotient or intelligence quotient more than one standard deviation below the mean, cerebral palsy (abnormality of tone with motor dysfunction, blindness (for example, corrected visual acuity worse than 6/60 in the better eye or deafness (for example, hearing loss requiring amplification or worse. For the women, the primary outcome will be maternal sepsis (defined as chorioamnionitis; pyrexia after trial entry requiring the use of antibiotics; puerperal sepsis; intrapartum fever requiring the use

  2. Collaborative work on evaluation of ovarian toxicity. 17) Two- or four-week repeated-dose studies and fertility study of sulpiride in female rats.

    Science.gov (United States)

    Ishii, Shun-ichiro; Ube, Masayuki; Okada, Miyoko; Adachi, Tamiko; Sugimoto, Jiro; Inoue, Yoshimi; Uno, Yoshifumi; Mutai, Mamoru

    2009-01-01

    To find the appropriate dosing period to detect ovarian toxicity, sulpiride, a D2 antagonist was orally dosed to female rats at dose levels of 1, 10, and 100 mg/kg/day daily for 2 or 4 weeks in repeated-dose toxicity studies. In addition, sulpiride at the same dose levels was given to female rats daily during the pre-mating period, mating period, and Days 0-7 of gestation to assess its effect on fertility. In ovarian histology in the 2-week study, increases in atretic follicle were seen at 1 mg/kg or more and increases in follicular cysts at 10 mg/kg or more. In the 4-week study, these findings were seen at 1 mg/kg or more, and a decrease in large follicles was seen at 10 mg/kg or more. Increased body weight gain was observed at 10 mg/kg or more in the 2- and 4-week studies. The females in these groups exhibited development of mammary alveolus by sulpiride-induced hyperprolactinemia. In the fertility study, sulpiride-treated females showing persistent diestrus resulted in successful mating, and almost all females got pregnant. However, increased implantation loss was observed at 10 mg/kg or more, which was considered to be caused by the adverse effect of sulpiride on oocyte development. From these results, sulpiride-induced ovarian toxicity was seen at 1 mg/kg or more in the 2- and 4-week repeated-dose toxicity studies, and the observed ovarian changes were considered to be related to adverse effects on female fertility.

  3. Hysteresis of magnetostructural transitions: Repeatable and non-repeatable processes

    Energy Technology Data Exchange (ETDEWEB)

    Provenzano, Virgil [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States); Della Torre, Edward; Bennett, Lawrence H. [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States); ElBidweihy, Hatem, E-mail: Hatem@gwmail.gwu.edu [Department of Electrical and Computer Engineering, The George Washington University, Washington, DC 20052 (United States)

    2014-02-15

    The Gd{sub 5}Ge{sub 2}Si{sub 2} alloy and the off-stoichiometric Ni{sub 50}Mn{sub 35}In{sub 15} Heusler alloy belong to a special class of metallic materials that exhibit first-order magnetostructural transitions near room temperature. The magnetic properties of this class of materials have been extensively studied due to their interesting magnetic behavior and their potential for a number of technological applications such as refrigerants for near-room-temperature magnetic refrigeration. The thermally driven first-order transitions in these materials can be field-induced in the reverse order by applying a strong enough field. The field-induced transitions are typically accompanied by the presence of large magnetic hysteresis, the characteristics of which are a complicated function of temperature, field, and magneto-thermal history. In this study we show that the virgin curve, the major loop, and sequentially measured MH loops are the results of both repeatable and non-repeatable processes, in which the starting magnetostructural state, prior to the cycling of field, plays a major role. Using the Gd{sub 5}Ge{sub 2}Si{sub 2} and Ni{sub 50}Mn{sub 35}In{sub 15} alloys, as model materials, we show that a starting single phase state results in fully repeatable processes and large magnetic hysteresis, whereas a mixed phase starting state results in non-repeatable processes and smaller hysteresis.

  4. Material rhetoric: spreading stones and showing bones in the study of prehistory.

    Science.gov (United States)

    Van Reybrouck, David; de Bont, Raf; Rock, Jan

    2009-06-01

    Since the linguistic turn, the role of rhetoric in the circulation and the popular representation of knowledge has been widely accepted in science studies. This article aims to analyze not a textual form of scientific rhetoric, but the crucial role of materiality in scientific debates. It introduces the concept of material rhetoric to understand the promotional regimes in which material objects play an essential argumentative role. It analyzes the phenomenon by looking at two students of prehistory from nineteenth-century Belgium. In the study of human prehistory and evolution, material data are either fairly abundant stone tools or very scarce fossil bones. These two types of material data stand for two different strategies in material rhetoric. In this article, the first strategy is exemplified by Aimé Rutot, who gathered great masses of eoliths (crudely chipped stones which he believed to be prehistoric tools). The second strategy is typified by the example of Julien Fraipont, who based his scientific career on only two Neanderthal skeletons. Rutot sent his "artifacts" to a very wide audience, while Fraipont showed his skeletons to only a few selected scholars. Unlike Rutot, however, Fraipont was able to monitor his audience's interpretation of the finds by means of personal contacts. What an archaeologist gains in reach, he or she apparently loses in control. In this article we argue that only those scholars who find the right balance between the extremes of reach and control will prove to be successful.

  5. Study of KIC 8561221 observed by Kepler: an early red giant showing depressed dipolar modes

    CERN Document Server

    Garcia, R A; Benomar, O; Aguirre, V Silva; Ballot, J; Davies, G R; Dogan, G; Stello, D; Christensen-Dalsgaard, J; Houdek, G; Lignieres, F; Mathur, S; Takata, M; Ceillier, T; Chaplin, W J; Mathis, S; Mosser, B; Ouazzani, R M; Pinsonneault, M H; Reese, D R; Regulo, C; Salabert, D; Thompson, M J; van Saders, J L; Neiner, C; De Ridder, J

    2013-01-01

    The continuous high-precision photometric observations provided by the CoRoT and Kepler space missions have allowed us to better understand the structure and dynamics of red giants using asteroseismic techniques. A small fraction of these stars shows dipole modes with unexpectedly low amplitudes. The reduction in amplitude is more pronounced for stars with higher frequency of maximum power. In this work we want to characterize KIC 8561221 in order to confirm that it is currently the least evolved star among this peculiar subset and to discuss several hypotheses that could help explain the reduction of the dipole mode amplitudes. We used Kepler short- and long-cadence data combined with spectroscopic observations to infer the stellar structure and dynamics of KIC 8561221. We then discussed different scenarios that could contribute to the reduction of the dipole amplitudes such as a fast rotating interior or the effect of a magnetic field on the properties of the modes. We also performed a detailed study of the...

  6. BRAIN VOLUMES OF THE LAMB, RAT AND BIRD DO NOT SHOW HEMISPHERIC ASYMMETRY: A STEREOLOGICAL STUDY

    Directory of Open Access Journals (Sweden)

    Bünyamin Sahin

    2011-05-01

    Full Text Available It is well known that there are functional differences between right and left brain hemispheres. However, it is not clear whether these functional differences are reflected in morphometric differences. This study was carried out to investigate the right-left asymmetry, and sex and species differences of the brains using the Cavalieri principle for volume estimation. Seventeen lambs, 10 rats and 12 avian brains were used to estimate brain volumes. A transparent point grid was superimposed on the slices of lamb brains directly and the slices of the rat and avian brains were projected onto a screen at 10x magnification. Surface areas of the cut slice faces were estimated by simply counting the points that hit the slices. Mean brain volumes were 37.74 cm3, 598.95 mm3 and 730.38 mm3 and the coefficients of variations were 0.08, 0.05 and 0.05 for lamb, rat and avian brains respectively. The differences between left and right hemispheres did not show statistical significance (P > 0.05. However, the male brain volumes were larger than the females for the lamb and bird (P < 0.05. In light of such findings, it will be necessary to evaluate neuron number of the brain hemispheres to provide more useful data regarding inter-hemispheric brain asymmetry.

  7. Watching a food-related television show and caloric intake. A laboratory study.

    Science.gov (United States)

    Bodenlos, Jamie S; Wormuth, Bernadette M

    2013-02-01

    Television watching has been positively associated with overeating and obesity. How popular food-related television shows affects eating behavior has not been examined. An experimental study was conducted to examine how exposure to a food-related television program affects amount and type of food consumed in adults (N=80). Participants were randomized to watch a cooking or nature television program and were then presented with 800 total calories of chocolate covered candies, cheese curls, and carrots. Food was weighed before and after the ad libitum eating session to determine amount consumed. After controlling for dietary restraint, hunger and food preference, significantly more chocolate covered candies were consumed among individuals who watched the cooking program compared to the nature program. No significant differences between conditions were found for overall caloric intake or for cheese curl or carrot consumption. Findings suggest that watching food-related television programs may affect eating behavior and has implications for obesity prevention and intervention efforts. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Geothermal-retrofit study for the National Orange Show Facilities in San Bernardino, California

    Energy Technology Data Exchange (ETDEWEB)

    1981-11-17

    The cost and feasibility of retrofitting the National Orange Show Facilities to use geothermal heat instead of natural gas for heating are determined. Because of the limited usage of the smaller facilities the study was limited to the conversion of the six major buildings: Domed, Hobby, Citrus, Auditorium, Restaurant and Commercial. A major problem is that most of the buildings are used on a very limited basis. This drastically reduced the amount of savings that could be used to amortize the retrofit cost. Another problem is that the buildings are spread over a large area and so the below grade piping costs were high. Finally, all of the buildings except for the Auditorium have direct gas fired heaters that would require all new terminal heating systems. In order to limit the retrofit cost, the retrofit system was designed to handle less than the peak load. This seemed appropriate because the facility might not even be in operation when a peak load condition occurred. Also, the existing systems could be used to supplement the geothermal system if necessary. The calculated and design peak loads are summarized.

  9. The effect of repeated immersion of gypsum cast in sodium hypochlorite and glutaraldehyde on its physical properties: An in vitro study

    Directory of Open Access Journals (Sweden)

    Rachuri Narendra Kumar

    2012-01-01

    Full Text Available Background: One method used to disinfect a dental cast is immersion in a disinfecting solution. Repeated immersion of a cast in disinfectant may affect its physical properties. Purpose: The purpose of this study was to evaluate the changes in dimensional accuracy and hardness of the dental casts as a result of repeated disinfection in 0.525% sodium hypochlorite and 2% glutaraldehyde solutions. Materials and Methods: Sixty specimens were made of type III dental stone. Twenty specimens were immersed in slurry, a supernatant solution of calcium sulfate in distilled water (control casts, 20 specimens in 0.525% sodium hypochlorite, and 20 specimens in 2% glutaraldehyde solutions for 30 min and air dried for 24 h. This process was repeated for 7 times for testing. Linear dimensional change and hardness were determined according to American National Standards Institute/American Dental Association (ANSI/ADA standards. The data were analyzed using two-way analysis of variance. Results: For specimens prepared with type III stones, treatment was by immersion in slurry (group I - control casts, and by immersion in 0.525% sodium hypochlorite (group II - test group 1 and in 2% glutaraldehyde solution (group III - test group 2. The specimens treated with sodium hypochlorite and glutaraldehyde showed more linear dimensional change compared to the specimens treated in slurry. However, the difference between test casts and control casts was significant. But the difference between the two test groups was not significant. Both the test groups showed decrease in hardness of the specimens compared to that specimens in control group. But the difference between two test groups was not significant in hardness.However,the values remained close to ANSI/ADA standards. Conclusion: The results demonstrated that repeated immersion of type III dental stone specimens in slurry with distilled water, 0.525% sodium hypochlorite and 2% glutaraldehyde, along with drying in air

  10. Personal semantics: Is it distinct from episodic and semantic memory? An electrophysiological study of memory for autobiographical facts and repeated events in honor of Shlomo Bentin.

    Science.gov (United States)

    Renoult, Louis; Tanguay, Annick; Beaudry, Myriam; Tavakoli, Paniz; Rabipour, Sheida; Campbell, Kenneth; Moscovitch, Morris; Levine, Brian; Davidson, Patrick S R

    2016-03-01

    Declarative memory is thought to consist of two independent systems: episodic and semantic. Episodic memory represents personal and contextually unique events, while semantic memory represents culturally-shared, acontextual factual knowledge. Personal semantics refers to aspects of declarative memory that appear to fall somewhere in between the extremes of episodic and semantic. Examples include autobiographical knowledge and memories of repeated personal events. These two aspects of personal semantics have been studied little and rarely compared to both semantic and episodic memory. We recorded the event-related potentials (ERPs) of 27 healthy participants while they verified the veracity of sentences probing four types of questions: general (i.e., semantic) facts, autobiographical facts, repeated events, and unique (i.e., episodic) events. Behavioral results showed equivalent reaction times in all 4 conditions. True sentences were verified faster than false sentences, except for unique events for which no significant difference was observed. Electrophysiological results showed that the N400 (which is classically associated with retrieval from semantic memory) was maximal for general facts and the LPC (which is classically associated with retrieval from episodic memory) was maximal for unique events. For both ERP components, the two personal semantic conditions (i.e., autobiographical facts and repeated events) systematically differed from semantic memory. In addition, N400 amplitudes also differentiated autobiographical facts from unique events. Autobiographical facts and repeated events did not differ significantly from each other but their corresponding scalp distributions differed from those associated with general facts. Our results suggest that the neural correlates of personal semantics can be distinguished from those of semantic and episodic memory, and may provide clues as to how unique events are transformed to semantic memory.

  11. Use of short tandem repeat sequences to study Mycobacterium leprae in leprosy patients in Malawi and India.

    Directory of Open Access Journals (Sweden)

    Saroj K Young

    2008-04-01

    Full Text Available Inadequate understanding of the transmission of Mycobacterium leprae makes it difficult to predict the impact of leprosy control interventions. Genotypic tests that allow tracking of individual bacterial strains would strengthen epidemiological studies and contribute to our understanding of the disease.Genotyping assays based on variation in the copy number of short tandem repeat sequences were applied to biopsies collected in population-based epidemiological studies of leprosy in northern Malawi, and from members of multi-case households in Hyderabad, India. In the Malawi series, considerable genotypic variability was observed between patients, and also within patients, when isolates were collected at different times or from different tissues. Less within-patient variability was observed when isolates were collected from similar tissues at the same time. Less genotypic variability was noted amongst the closely related Indian patients than in the Malawi series.Lineages of M. leprae undergo changes in their pattern of short tandem repeat sequences over time. Genetic divergence is particularly likely between bacilli inhabiting different (e.g., skin and nerve tissues. Such variability makes short tandem repeat sequences unsuitable as a general tool for population-based strain typing of M. leprae, or for distinguishing relapse from reinfection. Careful use of these markers may provide insights into the development of disease within individuals and for tracking of short transmission chains.

  12. Revisiting the TALE repeat.

    Science.gov (United States)

    Deng, Dong; Yan, Chuangye; Wu, Jianping; Pan, Xiaojing; Yan, Nieng

    2014-04-01

    Transcription activator-like (TAL) effectors specifically bind to double stranded (ds) DNA through a central domain of tandem repeats. Each TAL effector (TALE) repeat comprises 33-35 amino acids and recognizes one specific DNA base through a highly variable residue at a fixed position in the repeat. Structural studies have revealed the molecular basis of DNA recognition by TALE repeats. Examination of the overall structure reveals that the basic building block of TALE protein, namely a helical hairpin, is one-helix shifted from the previously defined TALE motif. Here we wish to suggest a structure-based re-demarcation of the TALE repeat which starts with the residues that bind to the DNA backbone phosphate and concludes with the base-recognition hyper-variable residue. This new numbering system is consistent with the α-solenoid superfamily to which TALE belongs, and reflects the structural integrity of TAL effectors. In addition, it confers integral number of TALE repeats that matches the number of bound DNA bases. We then present fifteen crystal structures of engineered dHax3 variants in complex with target DNA molecules, which elucidate the structural basis for the recognition of bases adenine (A) and guanine (G) by reported or uncharacterized TALE codes. Finally, we analyzed the sequence-structure correlation of the amino acid residues within a TALE repeat. The structural analyses reported here may advance the mechanistic understanding of TALE proteins and facilitate the design of TALEN with improved affinity and specificity.

  13. Repeated Insulin-like Growth Factor 1 (IGF1 treatment in a patient with Rett Syndrome: a single case study

    Directory of Open Access Journals (Sweden)

    Giorgio ePini

    2014-06-01

    Full Text Available Rett syndrome (RTT is a devastating neurodevelopmental disorder that has no cure. Patients show regression of acquired skills, motor and speech impairment, cardio-respiratory distress, microcephaly and stereotyped hand movements. The majority of RTT patients display mutations in the gene that codes for the Methyl-CpG binding protein 2 (MeCP2, which is involved in the development of the central nervous system, especially synaptic and circuit maturation. Thus, agents that promote brain development and synaptic function are good candidates for ameliorating the symptoms of RTT. In particular, Insulin-like growth Factor 1 (IGF1 and its active peptide (1-3IGF1 cross the Blood Brain Barrier, and therefore are ideal treatments for RTT Indeed, both (1-3IGF1 and IGF1 treatment significantly ameliorates RTT symptoms in a mouse model of the disease In a previous study we established that IGF1 is safe and well tolerated on Rett patients. In this open label clinical case study, we assess the safety and tolerability of IGF1 administration in two cycles of the treatment. Before and after each cycle we monitored the clinical and blood parameters, autonomic function and social and cognitive abilities, and we found that IGF1 was well tolerated each time and did not induce any side effect, nor it interfered with the other treatments that the patient was undergoing. We noticed a moderate improvement in the cognitive, social and autonomic abilities of the patient after each cycle but the benefits were not retained between the two cycles, consistent with the preclinical observation that treatments for RTT should be administered through life. We find that repeated IGF1 treatment is safe and well tolerated in Rett patients but observed effects are not retained between cycles. These results have applications to other pathologies considering that IGF1 has been shown to be effective in other disorders of the autism spectrum.

  14. Repeated insulin-like growth factor 1 treatment in a patient with rett syndrome: a single case study.

    Science.gov (United States)

    Pini, Giorgio; Scusa, M Flora; Benincasa, Alberto; Bottiglioni, Ilaria; Congiu, Laura; Vadhatpour, Cyrus; Romanelli, Anna Maria; Gemo, Ilaria; Puccetti, Chetti; McNamara, Rachel; O'Leary, Seán; Corvin, Aiden; Gill, Michael; Tropea, Daniela

    2014-01-01

    Rett syndrome (RTT) is a devastating neurodevelopmental disorder that has no cure. Patients show regression of acquired skills, motor, and speech impairment, cardio-respiratory distress, microcephaly, and stereotyped hand movements. The majority of RTT patients display mutations in the gene that codes for the Methyl-CpG binding protein 2 (MeCP2), which is involved in the development of the central nervous system, especially synaptic and circuit maturation. Thus, agents that promote brain development and synaptic function are good candidates for ameliorating the symptoms of RTT. In particular, insulin-like growth factor 1 (IGF1) and its active peptide (1-3) IGF1 cross the Blood Brain Barrier, and therefore are ideal treatments for RTT Indeed, both (1-3) IGF1 and IGF1 treatment significantly ameliorates RTT symptoms in a mouse model of the disease In a previous study, we established that IGF1 is safe and well tolerated on Rett patients. In this open label clinical case study, we assess the safety and tolerability of IGF1 administration in two cycles of the treatment. Before and after each cycle, we monitored the clinical and blood parameters, autonomic function, and social and cognitive abilities, and we found that IGF1 was well tolerated each time and did not induce any side effect, nor it interfered with the other treatments that the patient was undergoing. We noticed a moderate improvement in the cognitive, social, and autonomic abilities of the patient after each cycle but the benefits were not retained between the two cycles, consistent with the pre-clinical observation that treatments for RTT should be administered through life. We find that repeated IGF1 treatment is safe and well tolerated in Rett patients but observed effects are not retained between cycles. These results have applications to other pathologies considering that IGF1 has been shown to be effective in other disorders of the autism spectrum.

  15. Complement activation in leprosy: a retrospective study shows elevated circulating terminal complement complex in reactional leprosy.

    Science.gov (United States)

    Bahia El Idrissi, N; Hakobyan, S; Ramaglia, V; Geluk, A; Morgan, B Paul; Das, P Kumar; Baas, F

    2016-06-01

    Mycobacterium leprae infection gives rise to the immunologically and histopathologically classified spectrum of leprosy. At present, several tools for the stratification of patients are based on acquired immunity markers. However, the role of innate immunity, particularly the complement system, is largely unexplored. The present retrospective study was undertaken to explore whether the systemic levels of complement activation components and regulators can stratify leprosy patients, particularly in reference to the reactional state of the disease. Serum samples from two cohorts were analysed. The cohort from Bangladesh included multi-bacillary (MB) patients with (n = 12) or without (n = 46) reaction (R) at intake and endemic controls (n = 20). The cohort from Ethiopia included pauci-bacillary (PB) (n = 7) and MB (n = 23) patients without reaction and MB (n = 15) patients with reaction. The results showed that the activation products terminal complement complex (TCC) (P ≤ 0·01), C4d (P ≤ 0·05) and iC3b (P ≤ 0·05) were specifically elevated in Bangladeshi patients with reaction at intake compared to endemic controls. In addition, levels of the regulator clusterin (P ≤ 0·001 without R; P < 0·05 with R) were also elevated in MB patients, irrespective of a reaction. Similar analysis of the Ethiopian cohort confirmed that, irrespective of a reaction, serum TCC levels were increased significantly in patients with reactions compared to patients without reactions (P ≤ 0·05). Our findings suggests that serum TCC levels may prove to be a valuable tool in diagnosing patients at risk of developing reactions. © 2016 British Society for Immunology.

  16. The prodromal phase of leucine-rich repeat kinase 2-associated Parkinson disease: Clinical and imaging Studies.

    Science.gov (United States)

    Pont-Sunyer, Claustre; Tolosa, Eduardo; Caspell-Garcia, Chelsea; Coffey, Christopher; Alcalay, Roy N; Chan, Piu; Duda, John E; Facheris, Maurizio; Fernández-Santiago, Rubén; Marek, Kenneth; Lomeña, Francisco; Marras, Connie; Mondragon, Elisabet; Saunders-Pullman, Rachel; Waro, Bjorg

    2017-05-01

    Asymptomatic, nonmanifesting carriers of leucine-rich repeat kinase 2 mutations are at increased risk of developing PD. Clinical and neuroimaging features may be associated with gene carriage and/or may demarcate individuals at greater risk for phenoconversion to PD. To investigate clinical and dopamine transporter single-photon emission computed tomography imaging characteristics of leucine-rich repeat kinase 2 asymptomatic carriers. A total of 342 carriers' and 259 noncarriers' relatives of G2019S leucine-rich repeat kinase 2/PD patients and 39 carriers' and 31 noncarriers' relatives of R1441G leucine-rich repeat kinase 2/PD patients were evaluated. Motor and nonmotor symptoms were assessed using specific scales and questionnaires. Neuroimaging quantitative data were obtained in 81 carriers and compared with 41 noncarriers. G2019S carriers scored higher in motor scores and had lower radioligand uptake compared to noncarriers, but no differences in nonmotor symptoms scores were observed. R1441G carriers scored higher in motor scores, had lower radioligand uptake, and had higher scores in depression, dysautonomia, and Rapid Eye Movements Sleep Behavior Disorder Screening Questionnaire scores, but had better cognition scores than noncarriers. Among G2019S carriers, a group with "mild motor signs" was identified, and was significantly older, with worse olfaction and lower radioligand uptake. G2019S and R1441G carriers differ from their noncarriers' relatives in higher motor scores and slightly lower radioligand uptake. Nonmotor symptoms were mild, and different nonmotor profiles were observed in G2019S carriers compared to R1441G carriers. A group of G2019S carriers with known prodromal features was identified. Longitudinal studies are required to determine whether such individuals are at short-term risk of developing overt parkinsonism. © 2017 International Parkinson and Movement Disorder Society. © 2017 International Parkinson and Movement Disorder Society.

  17. Variability in prefrontal hemodynamic response during exposure to repeated self-selected music excerpts, a near-infrared spectroscopy study.

    Directory of Open Access Journals (Sweden)

    Saba Moghimi

    Full Text Available Music-induced brain activity modulations in areas involved in emotion regulation may be useful in achieving therapeutic outcomes. Clinical applications of music may involve prolonged or repeated exposures to music. However, the variability of the observed brain activity patterns in repeated exposures to music is not well understood. We hypothesized that multiple exposures to the same music would elicit more consistent activity patterns than exposure to different music. In this study, the temporal and spatial variability of cerebral prefrontal hemodynamic response was investigated across multiple exposures to self-selected musical excerpts in 10 healthy adults. The hemodynamic changes were measured using prefrontal cortex near infrared spectroscopy and represented by instantaneous phase values. Based on spatial and temporal characteristics of these observed hemodynamic changes, we defined a consistency index to represent variability across these domains. The consistency index across repeated exposures to the same piece of music was compared to the consistency index corresponding to prefrontal activity from randomly matched non-identical musical excerpts. Consistency indexes were significantly different for identical versus non-identical musical excerpts when comparing a subset of repetitions. When all four exposures were compared, no significant difference was observed between the consistency indexes of randomly matched non-identical musical excerpts and the consistency index corresponding to repetitions of the same musical excerpts. This observation suggests the existence of only partial consistency between repeated exposures to the same musical excerpt, which may stem from the role of the prefrontal cortex in regulating other cognitive and emotional processes.

  18. Show Time

    Institute of Scientific and Technical Information of China (English)

    2004-01-01

    <正> Story: Show Time!The whole class presents the story"Under the Sea".Everyone is so excited and happy.Both Leo and Kathy show their parentsthe characters of the play."Who’s he?"asks Kathy’s mom."He’s the prince."Kathy replies."Who’s she?"asks Leo’s dad."She’s the queen."Leo replieswith a smile.

  19. Snobbish Show

    Institute of Scientific and Technical Information of China (English)

    YIN PUMIN

    2010-01-01

    @@ The State Administration of Radio,Film and Television (SARFT),China's media watchdog,issued a new set of mles on June 9 that strictly regulate TV match-making shows,which have been sweeping the country's primetime programming. "Improper social and love values such as money worship should not be presented in these shows.Humiliation,verbal attacks and sex-implied vulgar content are not allowed" the new roles said.

  20. Twenty-eight-day repeated inhalation toxicity study of nano-sized lanthanum oxide in male sprague-dawley rats.

    Science.gov (United States)

    Shin, Seo-Ho; Lim, Cheol-Hong; Kim, Yong-Soon; Lee, Yong-Hoon; Kim, Sung-Hwan; Kim, Jong-Choon

    2017-04-01

    Although the use of lanthanum has increased in field of high-tech industry worldwide, potential adverse effects to human health and to the environment are largely unknown. The present study aimed to investigate the potential toxicity of nano-sized lanthanum oxide (La2 O3 ) following repeated inhalation exposure in male Sprague-Dawley rats. Male rats were exposed nose-only to nano-sized La2 O3 for 28 days (5 days/week) at doses of 0, 0.5, 2.5, and 10 mg/m(3) . In the experimental period, we evaluated treatment-related changes including clinical signs, body weight, hematology, serum biochemistry, necropsy findings, organ weight, and histopathology findings. We also analyzed lanthanum distribution in the major organs and in the blood, bronchoalveolar lavage fluids (BALF), and oxidative stress in lung tissues. Lanthanum level was highest in lung tissues and showed a dose-dependent relation. Alveolar proteinosis was observed in all treatment groups and was accompanied by an increase in lung weight; moreover, lung inflammation was observed in the 2.5 mg/m(3) and higher dose groups and was accompanied by an increase in white blood cells. In the BALF, total cell counts including macrophages and neutrophils, lactate dehydrogenase, albumin, nitric oxide, and tumor necrosis factor-alpha increased significantly in all treatment groups. Furthermore, these changes tended to deteriorate in the 10 mg/m(3) group at the end of the recovery period. In the present experimental conditions, we found that the lowest-observed-adverse-effect level of nano-sized La2 O3 was 0.5 mg/m(3) in male rats, and the target organ was the lung. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 1226-1240, 2017. © 2016 Wiley Periodicals, Inc.

  1. PCR bias in amplification of androgen receptor alleles, a trinucleotide repeat marker used in clonality studies.

    Science.gov (United States)

    Mutter, G L; Boynton, K A

    1995-04-25

    Trinucleotide CAG repeats in the X-linked human androgen receptor gene (HUMARA) have proved a useful means of determining X chromosome haplotypes, and when combined with methylation analysis of nearby cytosine residues permits identification of non-random X inactivation in tumors of women. Co-amplification of two alleles in a heterozygote generates PCR products which differ in the number of CAG units, and thus their melting and secondary structure characteristics. We have shown that under optimal conditions amplification efficiency of two HUMARA alleles is near-equivalent, generating PCR products in a ratio proportional to that of the genomic template. In contrast, reduction of template quantity, damage of template by ultraviolet irradiation or addition of monovalent salts (sodium chloride, sodium acetate or ammonium acetate) produces highly variable imbalances of allelic PCR products, with a strong tendency to preferentially amplify lower molecular weight alleles. Variability and biasing was diminished by substitution of 7-deaza-2'-dGTP for dGTP during amplification, an intervention which reduces stability of intramolecular and intermolecular GC base pairing. We conclude that DNA which is scanty, damaged or salt contaminated may display amplification bias of GC-rich PCR targets, potentially confounding accurate interpretation or reproducibility of assays which require co-amplification of alleles.

  2. Analyzing repeated measures semi-continuous data, with application to an alcohol dependence study.

    Science.gov (United States)

    Liu, Lei; Strawderman, Robert L; Johnson, Bankole A; O'Quigley, John M

    2016-02-01

    Two-part random effects models (Olsen and Schafer,(1) Tooze et al.(2)) have been applied to repeated measures of semi-continuous data, characterized by a mixture of a substantial proportion of zero values and a skewed distribution of positive values. In the original formulation of this model, the natural logarithm of the positive values is assumed to follow a normal distribution with a constant variance parameter. In this article, we review and consider three extensions of this model, allowing the positive values to follow (a) a generalized gamma distribution, (b) a log-skew-normal distribution, and (c) a normal distribution after the Box-Cox transformation. We allow for the possibility of heteroscedasticity. Maximum likelihood estimation is shown to be conveniently implemented in SAS Proc NLMIXED. The performance of the methods is compared through applications to daily drinking records in a secondary data analysis from a randomized controlled trial of topiramate for alcohol dependence treatment. We find that all three models provide a significantly better fit than the log-normal model, and there exists strong evidence for heteroscedasticity. We also compare the three models by the likelihood ratio tests for non-nested hypotheses (Vuong(3)). The results suggest that the generalized gamma distribution provides the best fit, though no statistically significant differences are found in pairwise model comparisons.

  3. NMR studies on domain diffusion and alignment in modular GB1 repeats.

    Science.gov (United States)

    Walsh, Joseph D; Meier, Katlyn; Ishima, Rieko; Gronenborn, Angela M

    2010-10-20

    Modular proteins contain individual domains that are often connected by flexible, unstructured linkers. Using a model system based on the GB1 domain, we constructed tandem repeat proteins and investigated the rotational diffusion and long-range angular ordering behavior of individual domains by measuring NMR relaxation parameters and residual dipolar couplings. Although they display almost identical protein-solvent interfaces, each domain exhibits distinct rotational diffusion and alignment properties. The diffusion tensor anisotropy of the N-terminal domain (NTD) is D(‖)/D(⊥) = 1.5-1.6, similar to that of single-GB1 domains (D(‖)/D(⊥) = 1.6-1.7), whereas the value for the C-terminal domain (CTD) is D(‖)/D(⊥) = 2.0-2.2. In addition, the two domains have different rotational correlation times. These effects are observed for linkers of three to 24 residues, irrespective of linker length. The NTD and CTD also differ in their degree of magnetic alignment, even with a flexible linker of 18 residues, exhibiting D(a) values of 7.7 Hz and 9.7 Hz, respectively. Our results suggest that diffusion differences and long-range influences may persist in modular protein systems, even for systems that have highly flexible linkers and exhibit no domain-domain or domain-linker interactions.

  4. Does sequential embryo transfer improve pregnancy rate in patients with repeated implantation failure? A randomized control study

    Directory of Open Access Journals (Sweden)

    Wael A. Ismail Madkour

    2015-12-01

    Full Text Available Background: Repeated failure of in vitro fertilization treatment is frustrating to the patients and their clinicians. Various treatment plans and a change of protocol have been suggested for “low responders”; however, patients who fail treatment repeatedly inspite of good quality embryos pose a special therapeutic challenge. Additional challenge would be imposed on that particular group when the local IVF regulating low does not permit surplus embryo freezing. Objective: To examine whether sequential transfer of embryos on day 3 and on day 5 after ovum pick-up improves IVF/ET success rates in patients with repeated consecutive IVF failures (⩾ 3 trials compared to day 3 alone, with the background that local regulation prohibits embryo freezing. Study design: Randomized controlled study. Women scheduled for IVF/ET with repeated consecutive IVF failures (⩾ 3 trials were randomized to either sequential transfer of embryos on day 3 and on day 5 after ovum pick-up (Group I = 74 or conventional day 3 transfer (Group II = 73 as a control. The primary outcome measures were clinical pregnancy rate and implantation rate. The secondary outcome measures were ongoing pregnancy rate and early pregnancy loss. Results: Baseline and cycle characteristics were comparable in both groups. Clinical pregnancy rate (per embryo transfer was significantly higher in sequential ET group (37. 8% compared to that in day 3 group (21.9% (P value <0.05. Also, implantation rate (per embryos transferred was significantly higher in sequential ET group (17.1% compared to that in control group (10.5% (P value <0.01. Similarly, ongoing pregnancy (per embryo transfer was significantly higher in sequential ET group (33. 8% compared to that in day 3 group (19.2% (P value <0.05. Conclusions: Patients with repeated implantation failures, treatment with the sequential embryo transfer approach had significantly improved pregnancy outcomes compared to regular day 3 transfers

  5. Studying the Effect of a Competitive Game Show in a Learning by Teaching Environment

    Science.gov (United States)

    Matsuda, Noboru; Yarzebinski, Evelyn; Keiser, Victoria; Raizada, Rohan; Stylianides, Gabriel J.; Koedinger, Kenneth R.

    2013-01-01

    In this paper we investigate how competition among tutees in the context of learning by teaching affects tutors' engagement as well as tutor learning. We conducted this investigation by incorporating a competitive Game Show feature into an online learning environment where students learn to solve algebraic equations by teaching a synthetic…

  6. Sauerbraten, Rotkappchen und Goethe: The Quiz Show as an Introduction to German Studies.

    Science.gov (United States)

    White, Diane

    1980-01-01

    Proposes an adaptation of the quiz-show format for classroom use, discussing a set of rules and sample questions designed for beginning and intermediate German students. Presents questions based on German life and culture which are especially selected to encourage participation from students majoring in subjects other than German. (MES)

  7. Sauerbraten, Rotkappchen und Goethe: The Quiz Show as an Introduction to German Studies.

    Science.gov (United States)

    White, Diane

    1980-01-01

    Proposes an adaptation of the quiz-show format for classroom use, discussing a set of rules and sample questions designed for beginning and intermediate German students. Presents questions based on German life and culture which are especially selected to encourage participation from students majoring in subjects other than German. (MES)

  8. EROBATIC SHOW

    Institute of Scientific and Technical Information of China (English)

    2016-01-01

    Visitors look at plane models of the Commercial Aircraft Corp. of China, developer of the count,s first homegrown large passenger jet C919, during the Singapore Airshow on February 16. The biennial event is the largest airshow in Asia and one of the most important aviation and defense shows worldwide. A number of Chinese companies took part in the event during which Okay Airways, the first privately owned aidine in China, signed a deal to acquire 12 Boeing 737 jets.

  9. Retrospective study shows that doxapram therapy avoided the need for endotracheal intubation in most premature neonates

    NARCIS (Netherlands)

    Flint, R.B.; Halbmeijer, N.; Meesters, N.; Rosmalen, J. van; Reiss, I.; Dijk, M.; Simons, S.

    2017-01-01

    AIM: Using doxapram to treat neonates with apnoea of prematurity might avoid the need for endotracheal intubation and invasive ventilation. We studied whether doxapram prevented the need for intubation and identified the predictors of the success. METHODS: This was a retrospective study of preterm

  10. NIH study shows increased risk for two types of myotonic muscular dystrophy

    Science.gov (United States)

    Adults with a form of muscular dystrophy called myotonic muscular dystrophy (MMD) may be at increased risk of developing cancer, according to a study by investigators at the National Cancer Institute (NCI), part of the National Institutes of Health.

  11. Excessive users of violent video games do not show emotional desensitization: an fMRI study.

    Science.gov (United States)

    Szycik, Gregor R; Mohammadi, Bahram; Hake, Maria; Kneer, Jonas; Samii, Amir; Münte, Thomas F; Te Wildt, Bert T

    2016-04-16

    Playing violent video games have been linked to long-term emotional desensitization. We hypothesized that desensitization effects in excessive users of violent video games should lead to decreased brain activations to highly salient emotional pictures in emotional sensitivity brain regions. Twenty-eight male adult subjects showing excessive long-term use of violent video games and age and education matched control participants were examined in two experiments using standardized emotional pictures of positive, negative and neutral valence. No group differences were revealed even at reduced statistical thresholds which speaks against desensitization of emotion sensitive brain regions as a result of excessive use of violent video games.

  12. GSTM1 and APE1 genotypes affect arsenic-induced oxidative stress: a repeated measures study

    Directory of Open Access Journals (Sweden)

    Quamruzzaman Quazi

    2007-12-01

    Full Text Available Abstract Background Chronic arsenic exposure is associated with an increased risk of skin, bladder and lung cancers. Generation of oxidative stress may contribute to arsenic carcinogenesis. Methods To investigate the association between arsenic exposure and oxidative stress, urinary 8-hydroxy-2'-deoxyguanosine (8-OHdG was evaluated in a cohort of 97 women recruited from an arsenic-endemic region of Bangladesh in 2003. Arsenic exposure was measured in urine, toenails, and drinking water. Drinking water and urine samples were collected on three consecutive days. Susceptibility to oxidative stress was evaluated by genotyping relevant polymorphisms in glutathione-s transferase mu (GSTM1, human 8-oxoguanine glycosylase (hOGG1 and apurinic/apyrimidinic endonuclease (APE1 genes using the Taqman method. Data were analyzed using random effects Tobit regression to account for repeated measures and 8-OHdG values below the detection limit. Results A consistent negative effect for APE1 was observed across water, toenail and urinary arsenic models. APE1 148 glu/glu + asp/glu genotype was associated with a decrease in logged 8-OHdG of 0.40 (95%CI -0.73, -0.07 compared to APE1 148 asp/asp. An association between total urinary arsenic and 8-OHdG was observed among women with the GSTM1 null genotype but not in women with GSTM1 positive. Among women with GSTM1 null, a comparison of the second, third, and fourth quartiles of total urinary arsenic to the first quartile resulted in a 0.84 increase (95% CI 0.27, 1.42, a 0.98 increase (95% CI 033, 1.66 and a 0.85 increase (95% CI 0.27, 1.44 in logged 8-OHdG, respectively. No effects between 8-OHdG and toenail arsenic or drinking water arsenic were observed. Conclusion These results suggest the APE1 variant genotype decreases repair of 8-OHdG and that arsenic exposure is associated with oxidative stress in women who lack a functional GSTM1 detoxification enzyme.

  13. [A case-control study of factors associated with repeat teen pregnancy based on a sample from a university maternity hospital].

    Science.gov (United States)

    Silva, Andréa de Albuquerque Arruda; Coutinho, Isabela C; Katz, Leila; Souza, Alex Sandro Rolland

    2013-03-01

    Repeat teen pregnancy is a frequent issue and is considered an aggravating factor for increased maternal and fetal morbidity and social problems. The aim of the study was to identify factors associated with repeat teen pregnancy. A case-control study was conducted in 90 postpartum adolescents with more than one pregnancy (cases) and 90 adult women with a history of only one pregnancy during adolescence (controls). Statistical analysis used hierarchical logistic regression with 5% significance. Early sexual initiation (< 15 years), early age at first pregnancy (< 16 years), not raising the children themselves, and low family income (< one minimum wage) were associated with repeat teenage pregnancy, while partner change was inversely associated. Repeat teen pregnancy was mainly associated with reproductive and socioeconomic factors. Partner change appeared as a protective factor. Measures should be adopted during the postpartum period of teenage mothers in order to avoid repeat pregnancy.

  14. Material Rhetoric: Spreading Stones and Showing Bones in the Study of Prehistory

    NARCIS (Netherlands)

    Van Reybrouck, D.; de Bont, R.; Rock, J.

    2009-01-01

    Since the linguistic turn, the role of rhetoric in the circulation and the popular representation of knowledge has been widely accepted in science studies. This article aims to analyze not a textual form of scientific rhetoric, but the crucial role of materiality in scientific debates. It introduces

  15. Affiliation, joint venture or PSO? Case studies show why provider strategies differ.

    Science.gov (United States)

    1998-03-01

    Joint venture, affiliation or PSO? Here are three case studies of providers who chose different paths under Medicare risk, plus some key questions you'll want to ask of your own provider organization. Learn from these examples so you'll make the best contracting decisions.

  16. Material Rhetoric: Spreading Stones and Showing Bones in the Study of Prehistory

    NARCIS (Netherlands)

    Van Reybrouck, D.; de Bont, R.; Rock, J.

    2009-01-01

    Since the linguistic turn, the role of rhetoric in the circulation and the popular representation of knowledge has been widely accepted in science studies. This article aims to analyze not a textual form of scientific rhetoric, but the crucial role of materiality in scientific debates. It introduces

  17. Show Me the Money! Why Higher Ed Should Help K-12 Do Economic Impact Studies

    Science.gov (United States)

    Alam, Nadia

    2010-01-01

    In education, economic impact studies have been largely the product of higher education institutions. Colleges and universities have recognized that they can cultivate public, political and financial support by effectively demonstrating their high return-on-investment value. For more than a decade, all types of higher education institutions have…

  18. Study of medication-free children with Tourette syndrome do not show imaging abnormalities

    DEFF Research Database (Denmark)

    Jeppesen, Signe Søndergaard; Debes, Nanette Mol; Simonsen, Helle Juhl

    2014-01-01

    BACKGROUND: Imaging studies of patients with Tourette's syndrome (TS) across different cohorts have shown alterations in gray and white matter in areas associated with the cortico-striato-thalamic-cortical (CSTC) pathways; however, no consistent findings have subsequently established a clear indi...

  19. Ecological and toxicological responses in a multistressor scenario: Are monitoring programs showing the stressors or just showing stress? A case study in Brazil.

    Science.gov (United States)

    López-Doval, Julio C; Meirelles, Sergio Tadeu; Cardoso-Silva, Sheila; Moschini-Carlos, Viviane; Pompêo, Marcelo

    2016-01-01

    The Metropolitan Region of São Paulo (MRSP) is located in the Brazilian State of São Paulo and reservoirs in this region are vital for water supply and energy production. Changes in economic, social, and demographic trends produced pollution of water bodies, decreasing water quality for human uses and affecting freshwater populations. The presence of emerging pollutants, classical priority substances, nutrient excess and the interaction with tropical-climate conditions require periodic reviews of water policies and monitoring programs in order to detect and manage these threats in a global change scenario. The objective of this work is to determine whether the monitoring program of the São Paulo's Environmental Agency, is sufficient to explain the toxicological and biological responses observed in organisms in reservoirs of the MRSP, and whether it can identify the possible agents causing these responses. For that, we used publicly available data on water quality compiled by this agency in their routine monitoring program. A general overview of these data and a chemometric approach to analyze the responses of biotic indexes and toxicological bioassays, as a function of the physical and chemical parameters monitored, were performed. Data compiled showed temporal and geographical information gaps on variables measured. Toxicological responses have been observed in the reservoirs of the MRSP, together with a high incidence of impairments of the zooplankton community. This demonstrates the presence of stressors that affect the viability of organisms and populations. The statistical approach showed that the data compiled by the environmental agency are insufficient to identify and explain the factors causing the observed ecotoxicological responses and impairments in the zooplankton community, and are therefore insufficient to identify clear cause-effect relationships. Stressors different from those analyzed could be responsible for the observed responses.

  20. Retrospective study shows that doxapram therapy avoided the need for endotracheal intubation in most premature neonates.

    Science.gov (United States)

    Flint, Robert; Halbmeijer, Nienke; Meesters, Naomi; van Rosmalen, Joost; Reiss, Irwin; van Dijk, Monique; Simons, Sinno

    2017-05-01

    Using doxapram to treat neonates with apnoea of prematurity might avoid the need for endotracheal intubation and invasive ventilation. We studied whether doxapram prevented the need for intubation and identified the predictors of the success. This was a retrospective study of preterm infants born from January 2006 to August 2014 who received oral or intravenous doxapram. Success was defined as no need for endotracheal intubation, due to apnoea, during doxapram therapy. Univariable and multivariable logistic regression analyses identified predictors of success during the first 48 hours of doxapram therapy. Data on 203 patients with a median gestational age of 26.1 (interquartile range 25.1-27.4) weeks were analysed. During the first 48 hours of doxapram therapy, 157 (77%) patients did not need endotracheal intubation and 127 (63%) patients were successfully treated over the entire treatment course. The median postnatal age at the start of doxapram therapy was 20 days (interquartile range 12-30). Postnatal age and a lower fraction of inspired oxygen at the start of doxapram therapy were significant predictors of success (odds ratio 0.964, 95% confidence interval 0.938-0.991, p = 0.001). Oral and intravenous doxapram effectively treated most cases of apnoea in preterm infants, avoiding the need for intubation. ©2017 Foundation Acta Paediatrica. Published by John Wiley & Sons Ltd.

  1. People see what papers show! Psychiatry's stint with print media: A pilot study from Mumbai, India.

    Science.gov (United States)

    Shrivastava, Shivanshu; Kalra, Gurvinder; Ajinkya, Shaunak

    2015-01-01

    Mass media including television, internet, and newspapers influences public views about various issues by means of how it covers an issue. Newspapers have a wider reach and may affect the impact that a news story has on the reader by factors such as placement of the story within the different pages. We did a pilot study to see how two English newspapers from Mumbai, India were covering psychiatry related news stories. The study was done over a period of 3 months. We found a total of 870 psychiatry related news stories in the two newspapers over 3 months with the majority of them being covered in the main body of the newspapers. Sex-related crime stories and/or sexual dysfunction stories received the highest coverage among all the news while treatment and/or recovery related stories received very little coverage. It is crucial that the print media takes more efforts in improving reporting of psychiatry-related stories and help in de-stigmatizing psychiatry as a discipline.

  2. Study of pulmonary functions of the tourist guides in two show caves in Slovenia

    Science.gov (United States)

    Debevec Gerjevic, V.; Jovanovič, P.

    2009-04-01

    Park Škocjan Caves is located in South Eastern part of Slovenia. It was established with aim of conserving and protecting exceptional geomorphological, geological and hydrological outstanding features, rare and endangered plant and animal species, paleontological and archaeological sites, ethnological and architectural characteristics and cultural landscape and for the purpose of ensuring opportunities for suitable development, by the National Assembly of the Republic of Slovenia in 1996. Due to their exceptional significance for cultural and natural heritage, the Škocjan Caves were entered on UNESCO's list of natural and cultural world heritage sites in 1986. Caves have always been special places for people all over the world. There has been a lot of research done in the field of speleology and also in medicine in relation to speleotherapy. There is still one field left partial unexplored and its main issue covers the interaction between special ecosystems as caves and human activities and living. Implementing the Slovene legislation in the field of radiation protection, we are obligated to perform special measurements in the caves and also having our guides and workers in the caves regularly examined according to established procedure. The medical exams are performed at Institution of Occupational Safety, Ljubljana in order to monitor the influence of Radon to the workers in the cave. The issue of epidemiologic research encompass several factors that are not necessarily related to the radon. Park Škocjan Caves established research monitoring projects such as caves microclimate parameters, quality of the water, every day's data from our meteorological station useful tool in public awareness related to pollution and climate change. Last year a special study was started in order to evaluate pulmonary functions of persons who work in the caves and those who work mostly in offices. Two groups of tourist guides from Škocjan Caves and Postojna Cave were included in

  3. No Improved Performance With Repeated-Sprint Training in Hypoxia Versus Normoxia: A Double-Blind and Crossover Study.

    Science.gov (United States)

    Montero, David; Lundby, Carsten

    2017-02-01

    Few recent studies indicate that short-term repeated-sprint (RS) training in hypoxia (RSH) improves RS performance compared with identical training under normoxic conditions (RSN) in endurance-trained subjects. To determine the effects of RSH against RSN on RS performance under normoxic and moderate hypoxic conditions, using a randomized, doubleblind, crossover experimental design. Fifteen endurance-trained male subjects (age 25 ± 4 y) performed 4 wk of RS training (3 sessions/wk) in normobaric hypoxia (RSH, FiO2 = 13.8%) and normoxia (RSN, FiO2 = 20.9%) in a crossover manner. Before and after completion of training, RS tests were performed on a cycle ergometer with no prior exercise (RSNE), after an incremental exercise test (RSIE), and after a time-trial test (RSTT) in normoxia and hypoxia. Peak power outputs at the incremental exercise test and time-trial performance were unaltered by RSH in normoxia and hypoxia. RS performance was generally enhanced by RSH, as well as RSN, but there were no additional effects of RSH over RSN on peak and mean sprint power output and the number of repeated sprints performed in the RSNE, RSIE, and RSTT trials under normoxic and hypoxic conditions. The present double-blind crossover study indicates that RSH does not improve RS performance compared with RSN in normoxic and hypoxic conditions in endurance-trained subjects. Therefore, caution should be exercised when proposing RSH as an advantageous method to improve exercise performance.

  4. A Feasibility Study Showing [(68)Ga]Citrate PET Detects Prostate Cancer.

    Science.gov (United States)

    Behr, Spencer C; Aggarwal, Rahul; Seo, Youngho; Aparici, Carina M; Chang, Emily; Gao, Kenneth T; Tao, Dora H; Small, Eric J; Evans, Michael J

    2016-12-01

    The management of advanced or recurrent prostate cancer is limited in part by the lack of effective imaging agents. Metabolic changes in prostate cancer have previously been exploited for imaging, culminating in the recent US FDA approval of [(11)C]choline for the detection of subclinical recurrent disease after definitive local therapy. Despite this milestone, production of [(11)C]choline requires an on-site cyclotron, limiting the scope of medical centers at which this scan can be offered. In this pilot study, we tested whether prostate cancer could be imaged with positron emission tomography (PET) using [(68)Ga]citrate, a radiotracer that targets iron metabolism but is produced without a cyclotron. Eight patients with castrate-resistant prostate cancer were enrolled in this single-center feasibility study. All patients had evidence of metastatic disease by standard of care imaging [X-ray computed tomography (CT), bone scan, or magnetic resonance imaging (MRI)] prior to PET with [(68)Ga]citrate. Patients were intravenously injected with increasing doses of [(68)Ga]citrate (136.9 to a maximum of 259 MBq). Uptake time was steadily increased from 1 h to approximately 3.5 h for the final 4 patients, and all patients were imaged with a PET/MRI. Qualitative and semi-quantitative (maximum standardized uptake value (SUVmax)) assessment of the metastatic lesions was performed and compared to the standard of care imaging. At 1- and 2-h imaging times post injection, there were no detectable lesions with [(68)Ga]citrate PET. At 3- to 4-h uptake time, there were a total of 71 [(68)Ga]citrate-positive lesions (67 osseous, 1 liver, and 3 lymph node). Of these, 65 lesions were visible on the standard of care imaging (CT and/or bone scan). One PET-avid osseous vertebral body metastasis was not apparent on either CT or bone scan. Twenty-five lesions were not PET-avid but seen on CT and bone scan (17 bone, 6 lymph node, 1 pleural, and 1 liver). The average of the maximum SUVs

  5. Animation shows promise in initiating timely cardiopulmonary resuscitation: results of a pilot study.

    Science.gov (United States)

    Attin, Mina; Winslow, Katheryn; Smith, Tyler

    2014-04-01

    Delayed responses during cardiac arrest are common. Timely interventions during cardiac arrest have a direct impact on patient survival. Integration of technology in nursing education is crucial to enhance teaching effectiveness. The goal of this study was to investigate the effect of animation on nursing students' response time to cardiac arrest, including initiation of timely chest compression. Nursing students were randomized into experimental and control groups prior to practicing in a high-fidelity simulation laboratory. The experimental group was educated, by discussion and animation, about the importance of starting cardiopulmonary resuscitation upon recognizing an unresponsive patient. Afterward, a discussion session allowed students in the experimental group to gain more in-depth knowledge about the most recent changes in the cardiac resuscitation guidelines from the American Heart Association. A linear mixed model was run to investigate differences in time of response between the experimental and control groups while controlling for differences in those with additional degrees, prior code experience, and basic life support certification. The experimental group had a faster response time compared with the control group and initiated timely cardiopulmonary resuscitation upon recognition of deteriorating conditions (P < .0001). The results demonstrated the efficacy of combined teaching modalities for timely cardiopulmonary resuscitation. Providing opportunities for repetitious practice when a patient's condition is deteriorating is crucial for teaching safe practice.

  6. Feasibility Study on the Development of Index that Shows Social and Cultural Acceptance of Nuclear Power

    Energy Technology Data Exchange (ETDEWEB)

    Cho, SeongKyung [Bangmok College of General Education at Myongji Univ., Yongin (Korea, Republic of); Choi, Seungho; Yoon, Hana; Song, Jiyeon [Domo Brodeur, Seoul (Korea, Republic of)

    2015-05-15

    In this context, it is necessary to manage and develop an index that can measure the level of public acceptance by establishing the terms of social/cultural public acceptance of nuclear power in a practical manner and by identifying influential factors of public acceptance. Developing an index itself is not intended to increase the public acceptance of nuclear power. This study intends to contribute to determining energy policy acceptable to the public by estimating the level of potential social conflicts related to nuclear power policies with eligible evaluation criteria on social/cultural acceptance and by reducing relevant social costs. Key conclusions and proposal of this research are as follows. First, the influential factors of acceptance are reliability of nuclear safety, risk perception of nuclear power and beneficial perception of nuclear power. Among them, reliability of nuclear safety appears to have the most influence. In addition, benefit perception of nuclear power at the social level is significantly higher than that at the individual level. However, in relation to risk perception, a gap between experts and the public is found as nuclear industry premises that accident does not occur while the public premises that accident may occur.

  7. Melia azedarach plants show tolerance properties to water shortage treatment: an ecophysiological study.

    Science.gov (United States)

    Dias, Maria Celeste; Azevedo, Carla; Costa, Maria; Pinto, Glória; Santos, Conceição

    2014-02-01

    Candidate species for reforestation of areas prone to drought must combine water stress (WS) tolerance and economic or medicinal interest. Melia azedarach produces high quality timber and has insecticidal and medicinal properties. However, the impact of WS on M. azedarach has not yet been studied. Two-month old M. azedarach plants were exposed to WS during 20 days. After this period, plant's growth, water potential, photosynthetic performance and antioxidant capacity were evaluated. WS did not affect plants' growth, but induced stomatal closure, reduced net CO₂ assimilation rate (A) and the intercellular CO₂ availability in mesophyll (C(i)). WS also reduced the photosynthetic efficiency of PSII but not the pigment levels. WS up-regulated the antioxidant enzymes and stimulated the production of antioxidant metabolites, preventing lipid peroxidation. Therefore, despite some repression of photosynthetic parameters by WS, they did not compromise plant growth, and plants increased their antioxidant capacity. Our data demonstrate that M. azedarach juvenile plants have the potential to acclimate to water shortage conditions, opening new perspectives to the use of this species in reforestation/afforestation programs of drought prone areas. Copyright © 2014. Published by Elsevier Masson SAS.

  8. EUropean prospective cohort study on Enterobacteriaceae showing REsistance to CArbapenems (EURECA): a protocol of a European multicentre observational study

    Science.gov (United States)

    Gutiérrez-Gutiérrez, Belén; Sojo-Dorado, Jesús; Bravo-Ferrer, José; Cuperus, Nienke; de Kraker, Marlieke; Kostyanev, Tomislav; Raka, Lul; Daikos, George; Feifel, Jan; Folgori, Laura; Pascual, Alvaro; Goossens, Herman; O'Brien, Seamus; Bonten, Marc J M; Rodríguez-Baño, Jesús

    2017-01-01

    Introduction The rapid worldwide spread of carbapenem-resistant Enterobacteriaceae (CRE) constitutes a major challenge. The aim of the EUropean prospective cohort study on Enterobacteriaceae showing REsistance to CArbapenems (EURECA), which is part of the Innovative Medicines Initiative Joint Undertaking (IMI JU) funded COMBACTE-CARE project, is to investigate risk factors for and outcome determinants of CRE infections to inform randomised clinical trial designs and to provide a historical cohort that could eventually be used for future comparisons with new drugs targeting CRE. Methods A multicentre (50 sites), multinational (11 European countries), analytical observational project was designed, comprising 3 studies. The aims of study 1 (a prospective cohort study) include characterising the features, clinical management and outcomes of hospitalised patients with intra-abdominal infection, pneumonia, complicated urinary tract infections and bloodstream infections caused by CRE (202 patients in each group). The main outcomes will be 30-day all-cause mortality and clinical response. Study 2 (a nested case–control study) will identify the risk factors for target infections caused by CRE; 248 selected patients from study 1 will be matched with patients with carbapenem-susceptible Enterobacteriaceae (1:1) and with hospitalised patients (1:3) and will provide a historical cohort of patients with CRE infections. Study 3 (a matched cohort study) will follow patients in study 2 in order to assess mortality, length of stay and hospital costs associated with CRE. All patients will be followed for 30 days. Different, up-to-date statistical methods will be applied to come to unbiased estimates for all 3 studies. Ethics and dissemination Before-study sites will be initiated, approval will be sought from appropriate regulatory agencies and local Ethics Committees of Research or Institutional Review Boards (IRBs) to conduct the study in accordance with regulatory requirements

  9. Impact of Inclusion or Exclusion of Repeaters on Test Equating

    Science.gov (United States)

    Puhan, Gautam

    2011-01-01

    This study examined the effect of including or excluding repeaters on the equating process and results. New forms of two tests were equated to their respective old forms using either all examinees or only the first timer examinees in the new form sample. Results showed that for both tests used in this study, including or excluding repeaters in the…

  10. Drosophila melanogaster As a Model Organism to Study RNA Toxicity of Repeat Expansion-Associated Neurodegenerative and Neuromuscular Diseases

    Science.gov (United States)

    Koon, Alex C.; Chan, Ho Yin Edwin

    2017-01-01

    For nearly a century, the fruit fly, Drosophila melanogaster, has proven to be a valuable tool in our understanding of fundamental biological processes, and has empowered our discoveries, particularly in the field of neuroscience. In recent years, Drosophila has emerged as a model organism for human neurodegenerative and neuromuscular disorders. In this review, we highlight a number of recent studies that utilized the Drosophila model to study repeat-expansion associated diseases (READs), such as polyglutamine diseases, fragile X-associated tremor/ataxia syndrome (FXTAS), myotonic dystrophy type 1 (DM1) and type 2 (DM2), and C9ORF72-associated amyotrophic lateral sclerosis/frontotemporal dementia (C9-ALS/FTD). Discoveries regarding the possible mechanisms of RNA toxicity will be focused here. These studies demonstrate Drosophila as an excellent in vivo model system that can reveal novel mechanistic insights into human disorders, providing the foundation for translational research and therapeutic development. PMID:28377694

  11. Preliminary Studies on Differential Expression of Auditory Functional Genes in the Brain After Repeated Blast Exposures

    Science.gov (United States)

    2012-01-01

    Army Medical Research and Materiel Command, Fort Detrick, MD Abstract—The mechanisms of central auditory processing involved in auditory/ vestibular ...trans- ducers in auditory neurons [22–23,45–48]. The frontal cor- tex and midbrain of blast-exposed mice showed significant increase in the expression of...auditory neurons [26]. Other types of molecules involved in calcium regula- tion, such as calreticulin and calmodulin-dependent pro- tein kinase expression

  12. Whole scalp resting state EEG of oscillatory brain activity shows no parametric relationship with psychoacoustic and psychosocial assessment of tinnitus: A repeated measures study.

    Science.gov (United States)

    Pierzycki, Robert H; McNamara, Adam J; Hoare, Derek J; Hall, Deborah A

    2016-01-01

    Tinnitus is a perception of sound that can occur in the absence of an external stimulus. A brief review of electroencephalography (EEG) and magnetoencephalography (MEG) literature demonstrates that there is no clear relationship between tinnitus presence and frequency band power in whole scalp or source oscillatory activity. Yet a preconception persists that such a relationship exists and that resting state EEG could be utilised as an outcome measure for clinical trials of tinnitus interventions, e.g. as a neurophysiological marker of therapeutic benefit. To address this issue, we first examined the test-retest correlation of EEG band power measures in tinnitus patients (n = 42). Second we examined the evidence for a parametric relationship between numerous commonly used tinnitus variables (psychoacoustic and psychosocial) and whole scalp EEG power spectra, directly and after applying factor reduction techniques. Test-retest correlation for both EEG band power measures and tinnitus variables were high. Yet we found no relationship between whole scalp EEG band powers and psychoacoustic or psychosocial variables. We conclude from these data that resting state whole scalp EEG should not be used as a biomarker for tinnitus and that greater caution should be exercised in regard to reporting of findings to avoid confirmation bias. The data was collected during a randomised controlled trial registered at ClinicalTrials.gov (Identifier: NCT01541969).

  13. Tectonomagnetic study in the seismoactive area of Narmada–Son lineament, central India: Preliminary results on repeat field observations

    Indian Academy of Sciences (India)

    S Y Waghmare; S D Pimprikar; P B Gawali; L Carlo; A G Patil

    2009-06-01

    Repeated measurements of the total geomagnetic field on the five profiles have revealed a picture of stress-induced tectonomagnetic effect in the form of secular variation of the total geomagnetic field in the tectonically and seismically active area of Jabalpur and adjoining areas of the Narmada-Son lineament (NSL),central India.For this experiment,a reference base station was established within the study area at Jabalpur.Using proton precession magnetometers with a sensitivity of 0.1 nT, simultaneous measurements of total geomagnetic field were made annually at the base and all field stations.Five cycles of repeated observations have been performed between 2003 and 2007.For data analysis,a difference method has been applied and the residuals have been calculated as secular variations of the total geomagnetic field with values ranging from ± 0.1nT to about > ± 14.6nT/yr over the different stations.The anomalies in secular variation of the total geomagnetic field may be related to anomalous accumulation of tectonic stresses and tensions on the deep fault zones and crustal blocks due to recent geodynamic processes and active geological inhomogeneities in the NSL.

  14. Multi-laboratory validation study of multilocus variable-number tandem repeat analysis (MLVA) for Salmonella enterica serovar Enteritidis, 2015

    Science.gov (United States)

    Peters, Tansy; Bertrand, Sophie; Björkman, Jonas T; Brandal, Lin T; Brown, Derek J; Erdõsi, Tímea; Heck, Max; Ibrahem, Salha; Johansson, Karin; Kornschober, Christian; Kotila, Saara M; Le Hello, Simon; Lienemann, Taru; Mattheus, Wesley; Nielsen, Eva Møller; Ragimbeau, Catherine; Rumore, Jillian; Sabol, Ashley; Torpdahl, Mia; Trees, Eija; Tuohy, Alma; de Pinna, Elizabeth

    2017-01-01

    Multilocus variable-number tandem repeat analysis (MLVA) is a rapid and reproducible typing method that is an important tool for investigation, as well as detection, of national and multinational outbreaks of a range of food-borne pathogens. Salmonella enterica serovar Enteritidis is the most common Salmonella serovar associated with human salmonellosis in the European Union/European Economic Area and North America. Fourteen laboratories from 13 countries in Europe and North America participated in a validation study for MLVA of S. Enteritidis targeting five loci. Following normalisation of fragment sizes using a set of reference strains, a blinded set of 24 strains with known allele sizes was analysed by each participant. The S. Enteritidis 5-loci MLVA protocol was shown to produce internationally comparable results as more than 90% of the participants reported less than 5% discrepant MLVA profiles. All 14 participating laboratories performed well, even those where experience with this typing method was limited. The raw fragment length data were consistent throughout, and the inter-laboratory validation helped to standardise the conversion of raw data to repeat numbers with at least two countries updating their internal procedures. However, differences in assigned MLVA profiles remain between well-established protocols and should be taken into account when exchanging data. PMID:28277220

  15. Effectiveness of repeated photodynamic therapy in the elimination of intracanal Enterococcus faecalis biofilm: an in vitro study.

    Science.gov (United States)

    Prażmo, Ewa Joanna; Godlewska, Renata Alicja; Mielczarek, Agnieszka Beata

    2017-04-01

    The study aimed to investigate the effectiveness of photodynamic therapy in the elimination of intracanal Enterococcus faecalis biofilm and to analyse how a repeated light irradiation, replenishment of oxygen and photosensitiser affect the results of the photodynamic disinfecting protocol. After chemomechanical preparation, 46 single-rooted human teeth were infected with a clinical strain of E. faecalis and incubated for a week in microaerobic conditions. The experimental procedures included groups of single application of photodynamic therapy, two cycles of PDT, irrigation with 5.25% NaOCl solution and negative and positive control. The number of residing bacterial colonies in the root canals was determined based on the CFU/ml method. In the group of preparations irrigated with NaOCl, bacterial colonies were not observed. A single PDT eliminated 45% of the initial CFU/ml. Repeated PDT eradicated 95% of the intracanal bacterial biofilm. Photodynamic therapy has a high potential for the elimination of E. faecalis biofilm. There is a safe therapeutic window where photoinduced disinfection can be used as an adjuvant to conventional endodontic treatment, which remains the most effective.

  16. Broad and narrow personality traits as markers of one-time and repeated suicide attempts: A population-based study

    Directory of Open Access Journals (Sweden)

    Vitaro Frank

    2008-03-01

    Full Text Available Abstract Background Studying personality traits with the potential to differentiate between individuals engaging in suicide attempts of different degrees of severity could help us to understand the processes underlying the link of personality and nonfatal suicidal behaviours and to identify at-risk groups. One approach may be to examine whether narrow, i.e., lower-order personality traits may be more useful than their underlying, broad personality trait dimensions. Methods We investigated qualitative and quantitative differences in broad and narrow personality traits between one-time and repeated suicide attempters in a longitudinal, population-based sample of young French Canadian adults using two multivariate regression models. Results One broad (Compulsivity: OR = 2.0; 95% CI 1.2–3.5 and one narrow personality trait (anxiousness: OR = 1.1; 95% CI 1.01–1.1 differentiated between individuals with histories of repeated and one-time suicide attempts. Affective instability [(OR = 1.1; 95% CI 1.04–1.1] and anxiousness [(OR = .92; 95% CI .88–.95], on the other hand, differentiated between nonattempters and one-time suicide attempters. Conclusion Emotional and cognitive dysregulation and associated behavioural manifestations may be associated with suicide attempts of different severity. While findings associated with narrow traits may be easier to interpret and link to existing sociobiological theories, larger effect sizes associated with broad traits such as Compulsivity may be better suited to objectives with a more clinical focus.

  17. Case study: videogame distraction reduces behavioral distress in a preschool-aged child undergoing repeated burn dressing changes: a single-subject design

    National Research Council Canada - National Science Library

    Sil, Soumitri; Dahlquist, Lynnda M; Burns, Andrew J

    2013-01-01

    This single-subject design study evaluated the feasibility and efficacy of passive and interactive videogame distraction on behavioral distress for a preschool-aged child receiving repeated burn dressing changes...

  18. Prevention of eating disorders among minority youth: a matched-sample repeated measures study.

    Science.gov (United States)

    Cook-Cottone, Catherine; Jones, Lakaii A; Haugli, Sara

    2010-01-01

    The purpose of this study was to examine ethnic differences in primary prevention programs for eating disorders in young girls. In order to address the dearth of research in this area, this study examined the comparative response to an eating disorder prevention program on fifth-grade minority and White females. Pre- and post-test data were collected from 10 groups participating in the prevention program for a total of 50 girls. Minority participants and White participants were then matched based on Body Mass Index (BMI) and socioeconomic status in order to examine ethnic differences in group effectiveness. Findings indicated that minority and White participants were equally responsive to the prevention program.

  19. [The study of interaction between paralogous tandem repeats stellate and suppressor of stellate in the genome of Drosophila melanogaster].

    Science.gov (United States)

    Aravin, A A; Naumova, N M; Tulin, A V; Klenov, M S; Gvozdev, V A

    2000-04-01

    Testis-specific expression of tandemly repeated Stellate genes, located in eu- and heterochromatin regions of the X chromosome of Drosophila melanogaster, is suppressed by homologous Suppressor of Stellate repeats located on the Y chromosome. Using transgenic lines, we have demonstrated that three Su(Ste) copies failed to change the expression of the reporter construction carrying the bacterial beta-galactosidase gene under control of the Stellate gene regulatory sequence. Possible mechanisms of the Su(Ste) repeat suppressor activity are discussed.

  20. Repeated versus wide reading: A randomized control design study examining the impact of fluency interventions on underlying reading behavior.

    Science.gov (United States)

    Ardoin, Scott P; Binder, Katherine S; Foster, Tori E; Zawoyski, Andrea M

    2016-12-01

    Repeated readings (RR) has garnered much attention as an evidence based intervention designed to improve all components of reading fluency (rate, accuracy, prosody, and comprehension). Despite this attention, there is not an abundance of research comparing its effectiveness to other potential interventions. The current study presents the findings from a randomized control trial study involving the assignment of 168second grade students to a RR, wide reading (WR), or business as usual condition. Intervention students were provided with 9-10weeks of intervention with sessions occurring four times per week. Pre- and post-testing were conducted using Woodcock-Johnson III reading achievement measures (Woodcock, McGrew, & Mather, 2001, curriculum-based measurement (CBM) probes, measures of prosody, and measures of students' eye movements when reading. Changes in fluency were also monitored using weekly CBM progress monitoring procedures. Data were collected on the amount of time students spent reading and the number of words read by students during each intervention session. Results indicate substantial gains made by students across conditions, with some measures indicating greater gains by students in the two intervention conditions. Analyses do not indicate that RR was superior to WR. In addition to expanding the RR literature, this study greatly expands research evaluating changes in reading behaviors that occur with improvements in reading fluency. Implications regarding whether schools should provide more opportunities to repeatedly practice the same text (i.e., RR) or practice a wide range of text (i.e., WR) are provided. Copyright © 2016 Society for the Study of School Psychology. Published by Elsevier Ltd. All rights reserved.

  1. The Effect of Image Quality, Repeated Study, and Assessment Method on Anatomy Learning

    Science.gov (United States)

    Fenesi, Barbara; Mackinnon, Chelsea; Cheng, Lucia; Kim, Joseph A.; Wainman, Bruce C.

    2017-01-01

    The use of two-dimensional (2D) images is consistently used to prepare anatomy students for handling real specimen. This study examined whether the quality of 2D images is a critical component in anatomy learning. The visual clarity and consistency of 2D anatomical images was systematically manipulated to produce low-quality and high-quality…

  2. Repeated open application test with methyldibromo glutaronitrile, a multicentre study within the EECDRG

    DEFF Research Database (Denmark)

    Gruvberger, B; Andersen, Klaus Ejner; Brandão, F M

    2005-01-01

    Contact allergy to and allergic contact dermatitis from methyldibromo glutaronitrile (MDBGN) have frequently been reported. This study was initiated to help determine the optimal patch test preparation for MDBGN. In 51 patients with a doubtful or a positive patch test reaction to at least 1 of 4 ...

  3. Mouth opening in patients irradiated for head and neck cancer : A prospective repeated measures study

    NARCIS (Netherlands)

    Kamstra, J. I.; Dijkstra, P. U.; van Leeuwen, M.; Roodenburg, J. L. N.; Langendijk, J. A.

    2015-01-01

    Objectives: Aims of this prospective cohort study were (1) to analyze the course of mouth opening up to 48 months post-radiotherapy (RT), (2) to assess risk factors predicting decrease in mouth opening, and (3) to develop a multivariable prediction model for change in mouth opening in a large sample

  4. Mouth opening in patients irradiated for head and neck cancer : A prospective repeated measures study

    NARCIS (Netherlands)

    Kamstra, J. I.; Dijkstra, P. U.; van Leeuwen, M.; Roodenburg, J. L. N.; Langendijk, J. A.

    Objectives: Aims of this prospective cohort study were (1) to analyze the course of mouth opening up to 48 months post-radiotherapy (RT), (2) to assess risk factors predicting decrease in mouth opening, and (3) to develop a multivariable prediction model for change in mouth opening in a large sample

  5. International Mycoplasma pneumoniae typing study: interpretation of M. pneumoniae multilocus variable-number tandem-repeat analysis

    Directory of Open Access Journals (Sweden)

    V.J. Chalker

    2015-09-01

    Full Text Available Typing of Mycoplasma pneumoniae by multiple-locus variable-number tandem repeat analysis (MLVA is increasingly in use. However, no specific internationally agreed guidance is available. Thirty M. pneumoniae DNA samples including serial dilutions of a type strain were sent to six international laboratories to perform MLVA and results were compared. Good correlation was observed, indicating that this methodology can be robustly performed in multiple sites. However, differences due to interpretation of fragment size, repeat sequence identification and repeat numbering led to inconsistency in the final profiles assigned by laboratories. We propose guidelines for interpreting M. pneumoniae MLVA typing and assigning the number of repeats.

  6. Repeats in transforming acidic coiled-coil (TACC) genes.

    Science.gov (United States)

    Trivedi, Seema

    2013-06-01

    Transforming acidic coiled-coil proteins (TACC1, 2, and 3) are essential proteins associated with the assembly of spindle microtubules and maintenance of bipolarity. Dysregulation of TACCs is associated with tumorigenesis, but studies of microsatellite instability in TACC genes have not been extensive. Microsatellite or simple sequence repeat instability is known to cause many types of cancer. The present in silico analysis of SSRs in human TACC gene sequences shows the presence of mono- to hexa-nucleotide repeats, with the highest densities found for mono- and di-nucleotide repeats. Density of repeats is higher in introns than in exons. Some of the repeats are present in regulatory regions and retained introns. Human TACC genes show conservation of many repeat classes. Microsatellites in TACC genes could be valuable markers for monitoring numerical chromosomal aberrations and or cancer.

  7. Repeated exposure of acidic beverages on esthetic restorative materials: an in-vitro surface microhardness study

    OpenAIRE

    Xavier, Arun M.; Sunny, Steffy M.; Rai, Kavita; Amitha M Hegde

    2016-01-01

    Background A manifold increase in the consumption of aerated beverages has witnessed a twin increase in tooth wear and raised demand for esthetic restorative materials. This study aimed to evaluate the surface microhardness changes of esthetic restorative materials following treatment with aerated beverages in an in-vitro situation. Material and Methods The initial surface microhardness of the restorative materials GC Fuji II LC, GC Fuji IX, Nano Glass ionomer, Resin and Nano composite was re...

  8. URINARY CREATINE AT REST AND AFTER REPEATED SPRINTS IN ATHLETES: A PILOT STUDY

    Directory of Open Access Journals (Sweden)

    I. Bezrati-Benayed

    2014-07-01

    Full Text Available Creatine plays a key role in muscle function and its evaluation is important in athletes. In this study, urinary creatine concentration was measured in order to highlight its possible significance in monitoring sprinters. The study included 51 sprinters and 25 age- and sex-matched untrained subjects as a control group. Body composition was measured and dietary intake estimated. Urine samples were collected before and after standardized physical exercise. Creatine was assessed by gas chromatography mass spectrometry. Basal urinary creatine (UC was significantly lower in sprinters than controls (34±30 vs. 74±3 μmol/mmol creatinine, p<0.05. UC was inversely correlated with body mass (r=-0.34, p<0.01 and lean mass (r=- 0.30, p<0.05, and positively correlated with fat mass (r=0.32, p<0.05. After acute exercise, urinary creatine significantly decreased in both athletes and controls. UC is low in sprinters at rest and further decreases after exercise, most likely due to a high uptake and use of creatine by muscles, as muscle mass and physical activity are supposed to be greater in athletes than untrained subjects. Further studies are needed to test the value of urinary creatine as a non-invasive marker of physical condition and as a parameter for managing Cr supplementation in athletes.

  9. Urinary creatine at rest and after repeated sprints in athletes: a pilot study.

    Science.gov (United States)

    Bezrati-Benayed, I; Nasrallah, F; Feki, M; Chamari, K; Omar, S; Alouane-Trabelsi, L; Ben Mansour, A; Kaabachi, N

    2014-03-01

    Creatine plays a key role in muscle function and its evaluation is important in athletes. In this study, urinary creatine concentration was measured in order to highlight its possible significance in monitoring sprinters. The study included 51 sprinters and 25 age- and sex-matched untrained subjects as a control group. Body composition was measured and dietary intake estimated. Urine samples were collected before and after standardized physical exercise. Creatine was assessed by gas chromatography mass spectrometry. Basal urinary creatine (UC) was significantly lower in sprinters than controls (34±30 vs. 74±3 µmol/mmol creatinine, p sprinters at rest and further decreases after exercise, most likely due to a high uptake and use of creatine by muscles, as muscle mass and physical activity are supposed to be greater in athletes than untrained subjects. Further studies are needed to test the value of urinary creatine as a non-invasive marker of physical condition and as a parameter for managing Cr supplementation in athletes.

  10. Relationships among androgen receptor CAG repeat polymorphism, sex hormones and penile length in Han adult men from China: a cross-sectional study

    OpenAIRE

    Yan-Min Ma; Kai-Jie Wu; Liang Ning; Jin Zeng; Bo Kou; Hong-Jun Xie; Zhen-Kun Ma; Xin-Yang Wang; Yong-Guang Gong; Da-Lin He

    2014-01-01

    This study aimed to investigate the correlations among androgen receptor (AR) CAG repeat polymorphism, sex hormones and penile length in healthy Chinese young adult men. Two hundred and fifty-three healthy men (aged 22.8 ± 3.1 years) were enrolled. The individuals were grouped as CAG short (CAG S ) if they harbored repeat length of ≤20 or as CAG long (CAG L ) if their CAG repeat length was >20. Body height/weight, penile length and other parameters were examined and recorded by the specified ...

  11. The haemotoxicity of azathioprine in repeat dose studies in the female CD-1 mouse.

    Science.gov (United States)

    Molyneux, Gemma; Gibson, Frances M; Chen, Christabelle M; Marway, Harpal K; McKeag, Sean; Mifsud, Charles V J; Pilling, Andrew M; Whayman, Matthew J; Turton, John A

    2008-04-01

    Azathioprine (AZA) is a cytotoxic immunosuppressive drug used in the prevention of rejection in organ transplants and the treatment of auto-immune diseases. However, AZA is haemotoxic causing significant bone marrow depression. The present studies were to characterize the haemotoxicity of AZA in the female CD-1 mouse. In Experiment 1, a dose-ranging study, with AZA gavaged daily for 10 days, clinical evidence of toxicity was evident at 125 mg/kg and above. Experiment 2 was a dose-response study with AZA gavaged daily for 10 days at 40-120 mg/kg. At day 1 after the final dose, AZA induced a dose-related pancytopaenia, reduced femoral marrow cellularity, increases in serum levels of the cytokine fms-like tyrosine kinase 3 ligand, reduction in granulocyte-monocyte colony-forming units and erythroid colonies, and increased bone marrow apoptosis. Histology demonstrated hepatocyte hypertrophy, thymic atrophy, reduced splenic extramedullary haemopoiesis, and reduced cellularity of sternal bone marrow. In Experiment 3, AZA was dosed for 10 days at 100 mg/kg with autopsies at 1, 3, 9, 22, 29, 43 and 57 days postdosing. At 1, 3 and 9 days, haematological parameters reflected changes in Experiment 2. At 22/29 days, many blood parameters were returning towards normal; at 43/57 days, most parameters compared with controls. However, there was some evidence of a persistent (i.e. residual/late-stage) mild reduction in RBC and erythroid progenitor cell counts at day 43/57. We conclude that the CD-1 mouse provides an acceptable model for the haemotoxicity of AZA in man.

  12. Women's risk of repeat abortions is strongly associated with alcohol consumption: a longitudinal analysis of a Russian national panel study, 1994-2009.

    Directory of Open Access Journals (Sweden)

    Katherine Keenan

    Full Text Available Abortion rates in Russia, particularly repeat abortions, are among the highest in the world, and abortion complications make a substantial contribution to the country's high maternal mortality rate. Russia also has a very high rate of hazardous alcohol use. However, the association between alcohol use and abortion in Russia remains unexplored. We investigated the longitudinal predictors of first and repeat abortion, focussing on women's alcohol use as a risk factor. Follow-up data from 2,623 women of reproductive age (16-44 years was extracted from 14 waves of the Russian Longitudinal Monitoring Survey (RLMS, a nationally representative panel study covering the period 1994-2009. We used discrete time hazard models to estimate the probability of having a first and repeat abortion by social, demographic and health characteristics at the preceding study wave. Having a first abortion was associated with demographic factors such as age and parity, whereas repeat abortions were associated with low education and alcohol use. After adjustment for demographic and socioeconomic factors, the risk of having a repeat abortion increased significantly as women's drinking frequency increased (P<0.001, and binge drinking women were significantly more likely to have a repeat abortion than non-drinkers (OR 2.28, 95% CI 1.62-3.20. This association was not accounted for by contraceptive use or a higher risk of pregnancy. Therefore the determinants of first and repeat abortion in Russia between 1994-2009 were different. Women who had repeat abortions were distinguished by their heavier and more frequent alcohol use. The mechanism for the association is not well understood but could be explained by unmeasured personality factors, such as risk taking, or social non-conformity increasing the risk of unplanned pregnancy. Heavy or frequent drinkers constitute a particularly high risk group for repeat abortion, who could be targeted in prevention efforts.

  13. Magnetic Resonance Spectroscopy in Patients with Insomnia: A Repeated Measurement Study.

    Science.gov (United States)

    Spiegelhalder, Kai; Regen, Wolfram; Nissen, Christoph; Feige, Bernd; Baglioni, Chiara; Riemann, Dieter; Hennig, Jürgen; Lange, Thomas

    2016-01-01

    Chronic insomnia is one of the most prevalent central nervous system disorders. It is characterized by increased arousal levels, however, the neurobiological causes and correlates of hyperarousal in insomnia remain to be further determined. In the current study, magnetic resonance spectroscopy was used in the morning and evening in a well-characterized sample of 20 primary insomnia patients (12 females; 8 males; 42.7 ± 13.4 years) and 20 healthy good sleepers (12 females; 8 males; 44.1 ± 10.6 years). The most important inhibitory and excitatory neurotransmitters of the central nervous system, γ-aminobutyric acid (GABA) and glutamate/glutamine (Glx), were assessed in the anterior cingulate cortex (ACC) and dorsolateral prefrontal cortex (DLPFC). The primary hypothesis, a diurnal effect on GABA levels in patients with insomnia, could not be confirmed. Moreover, the current results did not support previous findings of altered GABA levels in individuals with insomnia. Exploratory analyses, however, suggested that GABA levels in the ACC may be positively associated with habitual sleep duration, and, thus, reduced GABA levels may be a trait marker of objective sleep disturbances. Moreover, there was a significant GROUP x MEASUREMENT TIME interaction effect on Glx in the DLPFC with increasing Glx levels across the day in the patients but not in the control group. Therefore, Glx levels may reflect hyperarousal at bedtime in those with insomnia. Future confirmatory studies should include larger sample sizes to investigate brain metabolites in different subgroups of insomnia.

  14. Global sensitivity analysis for repeated measures studies with informative drop-out: A semi-parametric approach.

    Science.gov (United States)

    Scharfstein, Daniel; McDermott, Aidan; Díaz, Iván; Carone, Marco; Lunardon, Nicola; Turkoz, Ibrahim

    2017-05-23

    In practice, both testable and untestable assumptions are generally required to draw inference about the mean outcome measured at the final scheduled visit in a repeated measures study with drop-out. Scharfstein et al. (2014) proposed a sensitivity analysis methodology to determine the robustness of conclusions within a class of untestable assumptions. In their approach, the untestable and testable assumptions were guaranteed to be compatible; their testable assumptions were based on a fully parametric model for the distribution of the observable data. While convenient, these parametric assumptions have proven especially restrictive in empirical research. Here, we relax their distributional assumptions and provide a more flexible, semi-parametric approach. We illustrate our proposal in the context of a randomized trial for evaluating a treatment of schizoaffective disorder. © 2017, The International Biometric Society.

  15. Zinc oxide nanoparticles: a 90-day repeated-dose dermal toxicity study in rats

    Directory of Open Access Journals (Sweden)

    Ryu HJ

    2014-12-01

    Full Text Available Hwa Jung Ryu,1,* Mu Yeb Seo,2,* Sung Kyu Jung,1 Eun Ho Maeng,2 Seung-Young Lee,2 Dong-Hyouk Jang,2 Taek-Jin Lee,2 Ki-Yeon Jo,2 Yu-Ri Kim,3 Kyu-Bong Cho,4 Meyoung-Kon Kim,3 Beom Jun Lee,5 Sang Wook Son1 1Department of Dermatology, Korea University College of Medicine, Seoul, 2Korea Testing and Research Institute, Gyunggido, 3Department of Biochemistry and Molecular Biology, Korea University College of Medicine, Seoul, 4Department of Clinical Laboratory Science, Shinheung College, Uijeongbu, 5College of Veterinary Medicine, Chungbuk National University, Cheongju, Republic of Korea *These authors contributed equally to this work and both should be considered first authors Abstract: Zinc oxide (ZnO works as a long-lasting, broad-spectrum physical sunblock, and can prevent skin cancer, sunburn, and photoaging. Nanosized ZnO particles are used often in sunscreens due to consumer preference over larger sizes, which appear opaque when dermally applied. Although the US Food and Drug Administration approved the use of nanoparticles (NPs in sunscreens in 1999, there are ongoing safety concerns. The aim of this study was to evaluate the subchronic toxicity of ZnO NPs after dermal application according to the Organization for Economic Cooperation and Development Test Guidelines 411 using Good Laboratory Practice. Sprague Dawley rats were randomly divided into eight (one control, one vehicle control, three experimental, and three recovery groups. Different concentrations of ZnO NPs were dermally applied to the rats in the experimental groups for 90 days. Clinical observations as well as weight and food consumption were measured and recorded daily. Hematology and biochemistry parameters were determined. Gross pathologic and histopathologic examinations were performed on selected tissues from all animals. Analyses of tissue were undertaken to determine target organ tissue distribution. There was no increased mortality in the experimental group. Although there

  16. The effect of image quality, repeated study, and assessment method on anatomy learning.

    Science.gov (United States)

    Fenesi, Barbara; Mackinnon, Chelsea; Cheng, Lucia; Kim, Joseph A; Wainman, Bruce C

    2017-06-01

    The use of two-dimensional (2D) images is consistently used to prepare anatomy students for handling real specimen. This study examined whether the quality of 2D images is a critical component in anatomy learning. The visual clarity and consistency of 2D anatomical images was systematically manipulated to produce low-quality and high-quality images of the human hand and human eye. On day 0, participants learned about each anatomical specimen from paper booklets using either low-quality or high-quality images, and then completed a comprehension test using either 2D images or three-dimensional (3D) cadaveric specimens. On day 1, participants relearned each booklet, and on day 2 participants completed a final comprehension test using either 2D images or 3D cadaveric specimens. The effect of image quality on learning varied according to anatomical content, with high-quality images having a greater effect on improving learning of hand anatomy than eye anatomy (high-quality vs. low-quality for hand anatomy P = 0.018; high-quality vs. low-quality for eye anatomy P = 0.247). Also, the benefit of high-quality images on hand anatomy learning was restricted to performance on short-answer (SA) questions immediately after learning (high-quality vs. low-quality on SA questions P = 0.018), but did not apply to performance on multiple-choice (MC) questions (high-quality vs. low-quality on MC questions P = 0.109) or after participants had an additional learning opportunity (24 hours later) with anatomy content (high vs. low on SA questions P = 0.643). This study underscores the limited impact of image quality on anatomy learning, and questions whether investment in enhancing image quality of learning aids significantly promotes knowledge development. Anat Sci Educ 10: 249-261. © 2016 American Association of Anatomists. © 2016 American Association of Anatomists.

  17. Does Repeated Ticking Maintain Tic Behavior? An Experimental Study of Eye Blinking in Healthy Individuals

    Directory of Open Access Journals (Sweden)

    Daniel J. V. Beetsma

    2013-01-01

    Full Text Available Tics in Tourette Syndrome (TS are often preceded by 'premonitory urges': annoying feelings or bodily sensations. We hypothesized that, by reducing annoyance of premonitory urges, tic behaviour may be reinforced. In a 2X2 experimental design in healthy participants, we studied the effects of premonitory urges (operationalized as air puffs on the eye and tic behaviour (deliberate eye blinking after a puff or a sound on changes in subjective evaluation of air puffs, and EMG responses on the m. orbicularis oculi. The experimental group with air puffs+ blinking experienced a decrease in subjective annoyance of the air puff, but habituation of the EMG response was blocked and length of EMG response increased. In the control groups (air puffs without instruction to blink, no air puffs, these effects were absent. When extrapolating to the situation in TS patients, these findings suggest that performance of tics is reinforced by reducing the subjective annoyance of premonitory urges, while simultaneously preventing habituation or even inducing sensitisation of the physiological motor response.

  18. Reported food intake and distribution of body fat: a repeated cross-sectional study

    Directory of Open Access Journals (Sweden)

    Stenlund Hans

    2006-12-01

    Full Text Available Abstract Background Body mass, as well as distribution of body fat, are predictors of both diabetes and cardiovascular disease. In Northern Sweden, despite a marked increase in average body mass, prevalence of diabetes was stagnant and myocardial infarctions decreased. A more favourable distribution of body fat is a possible contributing factor. This study investigates the relative importance of individual food items for time trends in waist circumference (WC and hip circumference (HC on a population level. Methods Independent cross-sectional surveys conducted in 1986, 1990, 1994 and 1999 in the two northernmost counties of Sweden with a common population of 250000. Randomly selected age stratified samples, altogether 2982 men and 3087 women aged 25–64 years. Questionnaires were completed and anthropometric measurements taken. For each food item, associations between frequency of consumption and waist and hip circumferences were estimated. Partial regression coefficients for every level of reported intake were multiplied with differences in proportion of the population reporting the corresponding levels of intake in 1986 and 1999. The sum of these product terms for every food item was the respective estimated impact on mean circumference. Results Time trends in reported food consumption associated with the more favourable gynoid distribution of adipose tissue were increased use of vegetable oil, pasta and 1.5% fat milk. Trends associated with abdominal obesity were increased consumption of beer in men and higher intake of hamburgers and French fried potatoes in women. Conclusion Food trends as markers of time trends in body fat distribution have been identified. The method is a complement to conventional approaches to establish associations between food intake and disease risk on a population level.

  19. Breath acidification in adolescent runners exposed to atmospheric pollution: A prospective, repeated measures observational study

    Directory of Open Access Journals (Sweden)

    Van Sickle David

    2008-03-01

    Full Text Available Abstract Background Vigorous outdoors exercise during an episode of air pollution might cause airway inflammation. The purpose of this study was to examine the effects of vigorous outdoor exercise during peak smog season on breath pH, a biomarker of airway inflammation, in adolescent athletes. Methods We measured breath pH both pre- and post-exercise on ten days during peak smog season in 16 high school athletes engaged in daily long-distance running in a downwind suburb of Atlanta. The association of post-exercise breath pH with ambient ozone and particulate matter concentrations was tested with linear regression. Results We collected 144 pre-exercise and 146 post-exercise breath samples from 16 runners (mean age 14.9 years, 56% male. Median pre-exercise breath pH was 7.58 (interquartile range: 6.90 to 7.86 and did not change significantly after exercise. We observed no significant association between ambient ozone or particulate matter and post-exercise breath pH. However both pre- and post-exercise breath pH were strikingly low in these athletes when compared to a control sample of 14 relatively sedentary healthy adults and to published values of breath pH in healthy subjects. Conclusion Although we did not observe an acute effect of air pollution exposure during exercise on breath pH, breath pH was surprisingly low in this sample of otherwise healthy long-distance runners. We speculate that repetitive vigorous exercise may induce airway acidification.

  20. Toxicity evaluation of zinc aluminium levodopa nanocomposite via oral route in repeated dose study

    Science.gov (United States)

    Kura, Aminu Umar; Cheah, Pike-See; Hussein, Mohd Zobir; Hassan, Zurina; Tengku Azmi, Tengku Ibrahim; Hussein, Nor Fuzina; Fakurazi, Sharida

    2014-05-01

    Nanotechnology, through nanomedicine, allowed drugs to be manipulated into nanoscale sizes for delivery to the different parts of the body, at the same time, retaining the valuable pharmacological properties of the drugs. However, efficient drug delivery and excellent release potential of these delivery systems may be hindered by possible untoward side effects. In this study, the sub-acute toxicity of oral zinc aluminium nanocomposite with and without levodopa was assessed using the Organization for Economic Co-operation and Development guidelines. No sign or symptom of toxicity was observed in orally treated rats with the nanocomposite at 5 and 500 mg/kg concentrations. Body weight gain, feeding, water intake, general survival and organosomatic index were not significantly different between control and treatment groups. Aspartate aminotransferase (AST) in 500 mg/kg levodopa nanocomposite (169 ± 30 U/L), 5 mg/kg levodopa nanocomposite (172 ± 49 U/L), and 500 mg/kg layered double hydroxides (LDH) nanocomposite (175 ± 25 U/L) were notably elevated compared to controls (143 ± 05 U/L); but the difference were not significant ( p > 0.05). However, the differences in aspartate aminotransferase/alanine aminotransferase (AST/ALT) ratio of 500 mg/kg levodopa nanocomposite (0.32 ± 0.12) and 500 mg/kg LDH nanocomposite (0.34 ± 0.12) were statistically significant ( p brain was found to be of similar morphology in both control and experimental groups. The kidneys of 500-mg/kg-treated rats with levodopa nanocomposite and LDH nanocomposite were found to have slight inflammatory changes, notably leukocyte infiltration around the glomeruli. The ultra-structure of the neurons from the substantia nigra of nanocomposite-exposed group was similar to those receiving only normal saline. The observed result has suggested possible liver and renal toxicity in orally administered levodopa intercalated nanocomposite; it is also dose-dependent that needs further assessment.

  1. Understanding how adherence goals promote adherence behaviours: a repeated measure observational study with HIV seropositive patients

    Directory of Open Access Journals (Sweden)

    Jones Gareth

    2012-08-01

    behaviours over and above the effects of the behaviour-specific thinking and ii the relationship between adherence to exercise and to medical treatment is stronger among those with more favourable views about the goal. Results from this study should identify the key contributing factors to inform subsequent adherence research and afford a more streamlined assessment matrix. The project also aims to inform patient care practices. UK Clinical Research Network registration number UKCRN 7842.

  2. A new technique for repeated biopsies of the mammary gland in dairy cows allotted to Latin-square design studies.

    Science.gov (United States)

    de Lima, Luciano S; Martineau, Eric; De Marchi, Francilaine E; Palin, Marie-France; Dos Santos, Geraldo T; Petit, Hélène V

    2016-07-01

    The objective of this study was to develop a technique for carrying out repeated biopsies of the mammary gland of lactating dairy cows that provides enough material to monitor enzyme activities and gene expression in mammary secretory tissue. A total of 16 Holstein cows were subjected to 4 mammary biopsies each at 3-week intervals for a total of 64 biopsies. A 0.75-cm incision was made through the skin and subcutaneous tissue of the mammary gland and a trocar and cannula were inserted using a circular motion. The trocar was withdrawn and a syringe was plugged into the base of the cannula to create a vacuum for sampling mammary tissue. To reduce bleeding, hand pressure was put on the surgery site after biopsy and skin closure and ice was applied for at least 2 h after the biopsy using a cow bra. The entire procedure took an average of 25 min. Two attempts were usually enough to obtain 800 mg of tissue. Visual examination of milk samples 10 d after the biopsy indicated no trace of blood, except in samples from 2 cows. All wounds healed without infection and subcutaneous hematomas resorbed within 7 d. There was no incidence of mastitis throughout the lactation. This technique provides a new tool for biopsy of the mammary gland repeated at short intervals with the main effect being a decrease in milk production. Although secondary complications leading to illness or death are always a risk with any procedure, this biopsy technique was carried out without complications to the health of animals and with no incidence of mastitis during the lactation.

  3. NMR-based metabolomics and breath studies show lipid and protein catabolism during low dose chronic T(1)AM treatment.

    Science.gov (United States)

    Haviland, J A; Reiland, H; Butz, D E; Tonelli, M; Porter, W P; Zucchi, R; Scanlan, T S; Chiellini, G; Assadi-Porter, F M

    2013-12-01

    3-Iodothyronamine (T1 AM), an analog of thyroid hormone, is a recently discovered fast-acting endogenous metabolite. Single high-dose treatments of T1 AM have produced rapid short-term effects, including a reduction of body temperature, bradycardia, and hyperglycemia in mice. The effect of daily low doses of T1 AM (10 mg/kg) for 8 days on weight loss and metabolism in spontaneously overweight mice was monitored. The experiments were repeated twice (n = 4). Nuclear magnetic resonance (NMR) spectroscopy of plasma and real-time analysis of exhaled (13) CO2 in breath by cavity ring down spectroscopy (CRDS) were used to detect T1 AM-induced lipolysis. CRDS detected increased lipolysis in breath shortly after T1 AM administration that was associated with a significant weight loss but independent of food consumption. NMR spectroscopy revealed alterations in key metabolites in serum: valine, glycine, and 3-hydroxybutyrate, suggesting that the subchronic effects of T1 AM include both lipolysis and protein breakdown. After discontinuation of T1 AM treatment, mice regained only 1.8% of the lost weight in the following 2 weeks, indicating lasting effects of T1 AM on weight maintenance. CRDS in combination with NMR and (13) C-metabolic tracing constitute a powerful method of investigation in obesity studies for identifying in vivo biochemical pathway shifts and unanticipated debilitating side effects. Copyright © 2013 The Obesity Society.

  4. All-photonic quantum repeaters

    Science.gov (United States)

    Azuma, Koji; Tamaki, Kiyoshi; Lo, Hoi-Kwong

    2015-01-01

    Quantum communication holds promise for unconditionally secure transmission of secret messages and faithful transfer of unknown quantum states. Photons appear to be the medium of choice for quantum communication. Owing to photon losses, robust quantum communication over long lossy channels requires quantum repeaters. It is widely believed that a necessary and highly demanding requirement for quantum repeaters is the existence of matter quantum memories. Here we show that such a requirement is, in fact, unnecessary by introducing the concept of all-photonic quantum repeaters based on flying qubits. In particular, we present a protocol based on photonic cluster-state machine guns and a loss-tolerant measurement equipped with local high-speed active feedforwards. We show that, with such all-photonic quantum repeaters, the communication efficiency scales polynomially with the channel distance. Our result paves a new route towards quantum repeaters with efficient single-photon sources rather than matter quantum memories. PMID:25873153

  5. Huntington CAG repeat size does not modify onset age in familial Parkinson’s disease: The GenePD Study

    Science.gov (United States)

    McNicoll, Christopher F.; Latourelle, Jeanne C.; MacDonald, Marcy E.; Lew, Mark F.; Suchowersky, Oksana; Klein, Christine; Golbe, Lawrence I.; Mark, Margery H.; Growdon, John H.; Wooten, G. Frederick; Watts, Ray L.; Guttman, Mark; Racette, Brad A.; Perlmutter, Joel S.; Ahmed, Anwar; Shill, Holly A.; Singer, Carlos; Saint-Hilaire, Marie H.; Massood, Tiffany; Huskey, Karen W.; DeStefano, Anita L.; Gillis, Tammy; Mysore, Jayalakshmi; Goldwurm, Stefano; Pezzoli, Gianni; Baker, Kenneth B.; Itin, Ilia; Litvan, Irene; Nicholson, Garth; Corbett, Alastair; Nance, Martha; Drasby, Edward; Isaacson, Stuart; Burn, David J.; Chinnery, Patrick F.; Pramstaller, Peter P.; Al-hinti, Jomana; Moller, Anette T.; Ostergaard, Karen; Sherman, Scott J.; Roxburgh, Richard; Snow, Barry; Slevin, John T.; Cambi, Franca; Gusella, James F.; Myers, Richard H.

    2009-01-01

    The ATP/ADP ratio reflects mitochondrial function and has been reported to be influenced by the size of the Huntington disease gene (HD) repeat. Impaired mitochondrial function has long been implicated in the pathogenesis of Parkinson’s disease (PD) and therefore, we evaluated the relationship of the HD CAG repeat size to PD onset age in a large sample of familial PD cases. PD affected siblings (n=495) with known onset ages from 248 families, were genotyped for the HD CAG repeat. Genotyping failed in 11 cases leaving 484 for analysis, including 35 LRRK2 carriers. All cases had HD CAG repeats (range 15 to 34) below the clinical range for HD, although 5.2 percent of the sample (n=25) had repeats in the intermediate range (the intermediate range lower limit=27; upper limit=35 repeats), suggesting that the prevalence of intermediate allele carriers in the general population is significant. No relation between the HD CAG repeat size and the age at onset for PD was found in this sample of familial PD. PMID:18649400

  6. Repeat spinal anesthesia in cesarean section: A comparison between 10 mg and 12 mg doses of intrathecal hyperbaric (0.05%) bupivacaine repeated after failed spinal anesthesia: A prospective, parallel group study.

    Science.gov (United States)

    Bhar, Debasish; RoyBasunia, Sandip; Das, Anjan; Chhaule, Subinay; Mondal, Sudipta Kumar; Bisai, Subrata; Chattopadhyay, Surajit; Mandal, Subrata Kumar

    2016-01-01

    Spinal anesthesia for cesarean section is not a 100% successful technique. At times, despite straightforward insertion and drug administration, intrathecal anesthesia for cesarean section fails to obtain any sensory or motor block. Very few studies and literature are available regarding repeat administration of spinal anesthesia and its drug dosage, especially after first spinal failure in cesarean section lower segment cesarean section (LSCS) due to fear of the excessive spread of drug. The aim of our study is to compare the outcome between two different doses of 0.5% hyperbaric bupivacaine repeated intrathecally after failed spinal. After taking informed consent and Ethical Committee approval this prospective, randomized single-blinded study was conducted in 100 parturients of American Society of Anesthesiologists I-II who were posted for elective LSCS and had Bromage score 0 and no sensory block even at L4 dermatome after 10 min of first spinal anesthesia; were included in the study. Group A (n = 50) patients received 2.4 ml and Group B (n = 50) patients received 2 ml of 0.5% hyperbaric bupivacaine respectively for administering repeat spinal anesthesia. Heart rate (HR), systolic blood pressure (SBP), diastolic blood pressure (DBP), oxygen saturation, respiratory rate and electrocardiogram were monitored both intra- and post-operatively and complications were recorded. Incidence of high spinal, bradycardia, hypotension, respiratory complications, and nausea vomiting are significantly higher in Group A compared to Group B (P cesarean section with 10 mg of 0.5% hyperbaric bupivacaine provided after first spinal anesthesia, the level of sensory block is below L4 and motor power in Bromage scale is 0.

  7. Remarkable selective constraints on exonic dinucleotide repeats.

    Science.gov (United States)

    Haasl, Ryan J; Payseur, Bret A

    2014-09-01

    Long dinucleotide repeats found in exons present a substantial mutational hazard: mutations at these loci occur often and generate frameshifts. Here, we provide clear and compelling evidence that exonic dinucleotides experience strong selective constraint. In humans, only 18 exonic dinucleotides have repeat lengths greater than six, which contrasts sharply with the genome-wide distribution of dinucleotides. We genotyped each of these dinucleotides in 200 humans from eight 1000 Genomes Project populations and found a near-absence of polymorphism. More remarkably, divergence data demonstrate that repeat lengths have been conserved across the primate phylogeny in spite of what is likely considerable mutational pressure. Coalescent simulations show that even a very low mutation rate at these loci fails to explain the anomalous patterns of polymorphism and divergence. Our data support two related selective constraints on the evolution of exonic dinucleotides: a short-term intolerance for any change to repeat length and a long-term prevention of increases to repeat length. In general, our results implicate purifying selection as the force that eliminates new, deleterious mutants at exonic dinucleotides. We briefly discuss the evolution of the longest exonic dinucleotide in the human genome--a 10 x CA repeat in fibroblast growth factor receptor-like 1 (FGFRL1)--that should possess a considerably greater mutation rate than any other exonic dinucleotide and therefore generate a large number of deleterious variants. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  8. Dynamic combinatorial libraries of artificial repeat proteins.

    Science.gov (United States)

    Eisenberg, Margarita; Shumacher, Inbal; Cohen-Luria, Rivka; Ashkenasy, Gonen

    2013-06-15

    Repeat proteins are found in almost all cellular systems, where they are involved in diverse molecular recognition processes. Recent studies have suggested that de novo designed repeat proteins may serve as universal binders, and might potentially be used as practical alternative to antibodies. We describe here a novel chemical methodology for producing small libraries of repeat proteins, and screening in parallel the ligand binding of library members. The first stage of this research involved the total synthesis of a consensus-based three-repeat tetratricopeptide (TPR) protein (~14 kDa), via sequential attachment of the respective peptides. Despite the effectiveness of the synthesis and ligation steps, this method was found to be too demanding for the production of proteins containing variable number of repeats. Additionally, the analysis of binding of the individual proteins was time consuming. Therefore, we designed and prepared novel dynamic combinatorial libraries (DCLs), and show that their equilibration can facilitate the formation of TPR proteins containing up to eight repeating units. Interestingly, equilibration of the library building blocks in the presence of the biologically relevant ligands, Hsp90 and Hsp70, induced their oligomerization into forming more of the proteins with large recognition surfaces. We suggest that this work presents a novel simple and rapid tool for the simultaneous screening of protein mixtures with variable binding surfaces, and for identifying new binders for ligands of interest.

  9. Risk factors for complications in donors at first and repeat whole blood donation: a cohort study with assessment of the impact on donor return.

    Science.gov (United States)

    Wiersum-Osselton, Johanna C; Marijt-van der Kreek, Tanneke; Brand, Anneke; Veldhuizen, Ingrid; van der Bom, Johanna G; de Kort, Wim

    2014-01-01

    First-time donation is among recognised risk factors for vasovagal reactions to blood donation and reactions are known to reduce donor return. We assessed associations between potential risk factors and vasovagal reactions and needle-related complications in first-time whole blood donation in comparison to repeat donation and analysed the impact of complications on donor return. We performed a cohort study on whole blood donations in The Netherlands from 1/1/2010 to 31/12/2010 using data extracted from the blood service information system. Donation data up to 31/12/2011 were used to ascertain donor return. In 2010 28,786 donors made first whole blood donations and there were 522,958 repeat donations. Vasovagal reactions occurred in 3.9% of first donations by males and 3.5% of first donations by females compared to in 0.2% and 0.6%, respectively, of repeat donations. Associations of vasovagal reactions with other factors including age, body weight, systolic and diastolic blood pressure were similar in first-time and repeat donors. Needle-related complications occurred in 0.2% of male and 0.5% of female first-time donations and in 0.1% and 0.3%, respectively, of repeat donations. Among first-time donors, the return rate within 1 year was 82% following an uncomplicated first donation, but 55% and 61% following vasovagal reactions and needle-related complications, respectively; the corresponding percentages among repeat donors were 86%, 58% and 82%. Among first-time donors, females suffered less than males from vasovagal reactions. Other risk factors had similar associations among first-time and repeat donors. Vasovagal reactions and needle-related complications in both first-time and repeat donors are followed by reduced donor return.

  10. Application of transrectal ultrasound-guided repeat needle biopsy in the diagnosis of prostate cancer in Chinese population: A retrospective study

    Directory of Open Access Journals (Sweden)

    Yi Wang

    2016-01-01

    Full Text Available Background: Transrectal ultrasound-guided repeat needle biopsy (TUGRNB is widely used for diagnosis of prostate cancer (PCa. However, significance of TUGRNB in Chinese population was rarely reported. A retrospective study was conducted to evaluate the significance of TUGRNB applied in prediction of PCa in Chinese population. Materials and Methods: A total of 960 from January 2009 to December 2012 were included. Repeat needle biopsy rate and PCa positive detection rate were evaluated. Relationship between prostate specific antigen (PSA levels and PCa positive rates was analyzed. Results: PCa positive detection rate after initial needle biopsy was 28.4%, which was lower than the rate of repeat needle biopsy (40%. The rate for immediate transurethral resection (TUR, surgery after initial needle biopsy, was 27.1%, however with a low PCa positive detection rate (0.66%. The repeat needle biopsy rate was lower compared with the initial biopsy rate (P 20 ng/ml, PCa positive rate was significantly higher than those with PSA < 20 ng/ml (P < 0.05. Conclusion: PCa positive detection rate following repeat needle biopsy in Chinese population was higher, although the repeated needle biopsy rate was still in a low level. TUGRNB should attract more attention in the diagnosis of PCa.

  11. Patients' perceptions of physicians: a pilot study of the influence of prime-time fictional medical shows.

    Science.gov (United States)

    Stinson, Mary Elizabeth; Heischmidt, Kenneth

    2012-01-01

    Much criticism has fallen onto prime-time crime shows for skewing the perception the public has on crime. Could the same criticism apply to prime-time medical dramas, which tend to be among the most watched television shows today, for skewing patients' expectations? In the past, physicians on prime-time fictional medical shows tended to be depicted in a positive manner. However, today's medical dramas often portray physicians in a less positive context. The results of this study showed that television exposure only negatively affect patients' perceptions of physicians in regards to physical attractiveness and character, but not to physician propriety, power, communication, sociability, extroversion, competence, and composure. In addition, this study showed that prime-time fictional shows affect patient-physician interactions.

  12. Repeat induced abortion - a matter of individual behaviour or societal factors? A cross-sectional study among Swedish women.

    Science.gov (United States)

    Makenzius, Marlene; Tydén, Tanja; Darj, Elisabeth; Larsson, Margareta

    2011-10-01

    Almost 40% of all induced abortions in Sweden are repeat abortions; little is known about the risk factors. To investigate differences between women who had a first-time abortion and those with repeat abortion, and to identify factors associated with repeat abortion. A questionnaire was answered by 798 abortion-seeking women in Sweden during 2009. A regression model was used to assess risk factors for repeat abortions. In the age range 20-49 years, 41% of women had experienced at least one previous abortion. Risk factors for repeat abortion were parity (OR 2.57), lack of emotional support (OR 2.09), unemployment or sick leave (OR 1.65), tobacco use (OR 1.56), and low educational level (OR 1.5). Some women (n = 55) considered economic support and work opportunities could have enabled them to continue the pregnancy. Increased Sex and Relationship Education (SRE), easy access to high-quality contraception and counselling, were suggested (n = 86) as interventions for preventing unintended pregnancies. Even in a country with long established SRE and a public health policy to enhance sexual and reproductive health over a third of women requesting abortion have experienced one previously and the rate is maintained. Some specific factors are identified but, overall, a picture of vulnerability among women seeking repeat abortion stands out that needs to be considered in the prevention of unintended pregnancies.

  13. Decision-to-Delivery Time Intervals in Emergency Caesarean Section Cases: Repeated cross-sectional study from Oman.

    Science.gov (United States)

    Tashfeen, Kaukab; Patel, Malini; Hamdi, Ilham M; Al-Busaidi, Ibrahim H A; Al-Yarubi, Mansour N

    2017-02-01

    In cases of fetal intolerance to labour, meeting the standard decision-to-delivery time interval (DDI) of ≤30 minutes is challenging. This study aimed to assess DDIs in emergency Caesarean section (CS) cases to identify factors causing DDI delays and the impact of a delayed DDI on perinatal outcomes. This repeated cross-sectional study included all emergency CS procedures performed due to acute fetal distress, antepartum haemorrhage or umbilical cord prolapse at the Nizwa Hospital, Nizwa, Oman. Three audit cycles of three months each were conducted between April 2011 and June 2013, including an initial retrospective cycle and two prospective cycles following the implementation of improvement strategies to address factors causing DDI delays. Poor perinatal outcomes were defined as Apgar scores of 60 minutes was significantly associated with poor neonatal outcomes in terms of increased SCBU admissions and low Apgar scores (P <0.001 each). Factors causing DDI delays included obtaining consent for the CS procedure, a lack of operating theatre availability and moving patients to the operating theatre. The identification of factors causing DDI delays may provide opportunities to improve perinatal outcomes.

  14. Decision-to-Delivery Time Intervals in Emergency Caesarean Section Cases; Repeated cross-sectional study from Oman

    Directory of Open Access Journals (Sweden)

    Kaukab Tashfeen

    2017-03-01

    Full Text Available Objectives: In cases of fetal intolerance to labour, meeting the standard decision-to-delivery time interval (DDI of ≤30 minutes is challenging. This study aimed to assess DDIs in emergency Caesarean section (CS cases to identify factors causing DDI delays and the impact of a delayed DDI on perinatal outcomes. Methods: This repeated cross-sectional study included all emergency CS procedures performed due to acute fetal distress, antepartum haemorrhage or umbilical cord prolapse at the Nizwa Hospital, Nizwa, Oman. Three audit cycles of three months each were conducted between April 2011 and June 2013, including an initial retrospective cycle and two prospective cycles following the implementation of improvement strategies to address factors causing DDI delays. Poor perinatal outcomes were defined as Apgar scores of 60 minutes was significantly associated with poor neonatal outcomes in terms of increased SCBU admissions and low Apgar scores (P <0.001 each. Factors causing DDI delays included obtaining consent for the CS procedure, a lack of operating theatre availability and moving patients to the operating theatre. Conclusion: The identification of factors causing DDI delays may provide opportunities to improve perinatal outcomes.

  15. First worldwide proficiency study on variable-number tandem-repeat typing of Mycobacterium tuberculosis complex strains.

    Science.gov (United States)

    de Beer, Jessica L; Kremer, Kristin; Ködmön, Csaba; Supply, Philip; van Soolingen, Dick

    2012-03-01

    Although variable-number tandem-repeat (VNTR) typing has gained recognition as the new standard for the DNA fingerprinting of Mycobacterium tuberculosis complex (MTBC) isolates, external quality control programs have not yet been developed. Therefore, we organized the first multicenter proficiency study on 24-locus VNTR typing. Sets of 30 DNAs of MTBC strains, including 10 duplicate DNA samples, were distributed among 37 participating laboratories in 30 different countries worldwide. Twenty-four laboratories used an in-house-adapted method with fragment sizing by gel electrophoresis or an automated DNA analyzer, nine laboratories used a commercially available kit, and four laboratories used other methods. The intra- and interlaboratory reproducibilities of VNTR typing varied from 0% to 100%, with averages of 72% and 60%, respectively. Twenty of the 37 laboratories failed to amplify particular VNTR loci; if these missing results were ignored, the number of laboratories with 100% interlaboratory reproducibility increased from 1 to 5. The average interlaboratory reproducibility of VNTR typing using a commercial kit was better (88%) than that of in-house-adapted methods using a DNA analyzer (70%) or gel electrophoresis (50%). Eleven laboratories using in-house-adapted manual typing or automated typing scored inter- and intralaboratory reproducibilities of 80% or higher, which suggests that these approaches can be used in a reliable way. In conclusion, this first multicenter study has documented the worldwide quality of VNTR typing of MTBC strains and highlights the importance of international quality control to improve genotyping in the future.

  16. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  17. Nifty Nines and Repeating Decimals

    Science.gov (United States)

    Brown, Scott A.

    2016-01-01

    The traditional technique for converting repeating decimals to common fractions can be found in nearly every algebra textbook that has been published, as well as in many precalculus texts. However, students generally encounter repeating decimal numerals earlier than high school when they study rational numbers in prealgebra classes. Therefore, how…

  18. Repeat-until-success quantum repeaters

    Science.gov (United States)

    Bruschi, David Edward; Barlow, Thomas M.; Razavi, Mohsen; Beige, Almut

    2014-09-01

    We propose a repeat-until-success protocol to improve the performance of probabilistic quantum repeaters. Conventionally, these rely on passive static linear-optics elements and photodetectors to perform Bell-state measurements (BSMs) with a maximum success rate of 50%. This is a strong impediment for entanglement swapping between distant quantum memories. Every time a BSM fails, entanglement needs to be redistributed between the corresponding memories in the repeater link. The key ingredients of our scheme are repeatable BSMs. Under ideal conditions, these turn probabilistic quantum repeaters into deterministic ones. Under realistic conditions, our protocol too might fail. However, using additional threshold detectors now allows us to improve the entanglement generation rate by almost orders of magnitude, at a nominal distance of 1000 km, compared to schemes that rely on conventional BSMs. This improvement is sufficient to make the performance of our scheme comparable to the expected performance of some deterministic quantum repeaters.

  19. Collaborative work on evaluation of ovarian toxicity. 2) Two- or four-week repeated dose studies and fertility study of mifepristone in female rats.

    Science.gov (United States)

    Tamura, Toru; Yokoi, Ryohei; Okuhara, Yuji; Harada, Chiho; Terashima, Yukari; Hayashi, Morimichi; Nagasawa, Tatsuya; Onozato, Tomoya; Kobayashi, Kazuo; Kuroda, Junji; Kusama, Hiroshi

    2009-01-01

    In order to assess ovarian pathological changes and their relationship to changes in female fertility parameters, mifepristone, a progesterone receptor antagonist, was selected as the test article and was administered orally to female rats at dose levels of 0, 0.8, 4, 20 and 100 mg/kg for 2 or 4 weeks in repeated dose-toxicity studies and in a female fertility study at dose levels of 0, 0.8, 4 and 20 mg/kg from > 2 weeks before copulation to postcoital day 7. In the repeated dose toxicity studies, persistent estrus was seen in the vaginal smears, and multiple cysts in the ovaries at necropsy, increases in luteinized cysts and hypertrophy of previously formed corpora lutea were observed in the histopathological examination of ovaries in rats receiving 20 mg/kg or more for 2 or 4 weeks. In female fertility studies, persistent vaginal cornification was also observed at 20 mg/kg and the precoital interval was significantly shortened. All of the animals were completely infertile when dosed with 20 mg/kg during the post-coital period. An increase in pre-implantation losses was observed in the animals treated with 20 mg/kg during the pre-coital phase, while treatment with 4 mg/kg mifepristone during the post-coital phase induced an increase in post-implantation losses. These results suggested that a 2-week administration period would be sufficient to detect the ovarian toxicity of mifepristone in repeated dose toxicity study and the pathological findings in the ovaries would reflect the alterations in female reproductive endpoints in the female fertility study.

  20. Are diagnostic criteria for acute malnutrition affected by hydration status in hospitalized children? A repeated measures study

    Directory of Open Access Journals (Sweden)

    Fegan Gregory

    2011-09-01

    Full Text Available Abstract Introduction Dehydration and malnutrition commonly occur together among ill children in developing countries. Dehydration (change in total body water is known to alter weight. Although muscle tissue has high water content, it is not known whether mid-upper arm circumference (MUAC may be altered by changes in tissue hydration. We aimed to determine whether rehydration alters MUAC, MUAC Z score (MUACz, weight-for-length Z-score (WFLz and classification of nutritional status among hospitalised Kenyan children admitted with signs of dehydration. Study procedure We enrolled children aged from 3 months to 5 years admitted to a rural Kenyan district hospital with clinical signs compatible with dehydration, and without kwashiorkor. Anthropometric measurements were taken at admission and repeated after 48 hours of treatment, which included rehydration by WHO protocols. Changes in weight observed during this period were considered to be due to changes in hydration status. Results Among 325 children (median age 11 months the median weight gain (rehydration after 48 hours was 0.21 kg, (an increase of 2.9% of admission body weight. Each 1% change in weight was associated with a 0.40 mm (95% CI: 0.30 to 0.44 mm, p Conclusion MUAC is less affected by dehydration than WFLz and is therefore more suitable for nutritional assessment of ill children. However, both WFLz and MUAC misclassify SAM among dehydrated children. Nutritional status should be re-evaluated following rehydration, and management adjusted accordingly.

  1. A Study for the Characteristic Changes Under the Repeated Thermal Exposure in the Process of Repairing Aircraft Sandwich Structures

    Science.gov (United States)

    Kim, Yun Hae; Han, Joong Won; Kim, Don Won; Choi, Byung Keun; Murakami, R.

    Delamination can be observed in the sound areas during and/or after a couple times exposure to the elevated curing temperature due to the repeated repair condition. This study was conducted for checking the degree of degradation of properties of the cured parts and delamination between skin prepreg and honeycomb core. Specimens with glass honeycomb sandwich construction and glass/epoxy prepreg were prepared. The specimens were cured 1 to 5 times at 260°F in an autoclave and each additionally exposed 50, 100 and 150 hours in the 260°F oven. Each specimen was tested for tensile strength, compressive strength, flatwise tensile strength and interlaminar shear strength. To monitor the characteristics of the resin itself, the cured resin was tested using DMA and DSC. As a results, the decrease of Tg value were observed in the specific specimen which is exposed over 50 hrs at 260°F. This means the change or degradative of resin properties is also related to the decrease of flatwise tensile properties. Accordingly, minimal exposure on the curing temperature is recommended for parts in order to prevent the delation and maintain the better condition.

  2. Public perception of drinking water safety in South Africa 2002–2009: a repeated cross-sectional study

    Directory of Open Access Journals (Sweden)

    Wright Jim A

    2012-07-01

    Full Text Available Abstract Background In low and middle income countries, public perceptions of drinking water safety are relevant to promotion of household water treatment and to household choices over drinking water sources. However, most studies of this topic have been cross-sectional and not considered temporal variation in drinking water safety perceptions. The objective of this study is to explore trends in perceived drinking water safety in South Africa and its association with disease outbreaks, water supply and household characteristics. Methods This repeated cross-sectional study draws on General Household Surveys from 2002–2009, a series of annual nationally representative surveys of South African households, which include a question about perceived drinking water safety. Trends in responses to this question were examined from 2002–2009 in relation to reported cholera cases. The relationship between perceived drinking water safety and organoleptic qualities of drinking water, supply characteristics, and socio-economic and demographic household characteristics was explored in 2002 and 2008 using hierarchical stepwise logistic regression. Results The results suggest that perceived drinking water safety has remained relatively stable over time in South Africa, once the expansion of improved supplies is controlled for. A large cholera outbreak in 2000–02 had no apparent effect on public perception of drinking water safety in 2002. Perceived drinking water safety is primarily related to water taste, odour, and clarity rather than socio-economic or demographic characteristics. Conclusion This suggests that household perceptions of drinking water safety in South Africa follow similar patterns to those observed in studies in developed countries. The stability over time in public perception of drinking water safety is particularly surprising, given the large cholera outbreak that took place at the start of this period.

  3. Mononucleotide repeats are asymmetrically distributed in fungal genes

    Directory of Open Access Journals (Sweden)

    de Graaff Leo H

    2008-12-01

    Full Text Available Abstract Background Systematic analyses of sequence features have resulted in a better characterisation of the organisation of the genome. A previous study in prokaryotes on the distribution of sequence repeats, which are notoriously variable and can disrupt the reading frame in genes, showed that these motifs are skewed towards gene termini, specifically the 5' end of genes. For eukaryotes no such intragenic analysis has been performed, though this could indicate the pervasiveness of this distribution bias, thereby helping to expose the selective pressures causing it. Results In fungal gene repertoires we find a similar 5' bias of intragenic mononucleotide repeats, most notably for Candida spp., whereas e.g. Coccidioides spp. display no such bias. With increasing repeat length, ever larger discrepancies are observed in genome repertoire fractions containing such repeats, with up to an 80-fold difference in gene fractions at repeat lengths of 10 bp and longer. This species-specific difference in gene fractions containing large repeats could be attributed to variations in intragenic repeat tolerance. Furthermore, long transcripts experience an even more prominent bias towards the gene termini, with possibly a more adaptive role for repeat-containing short transcripts. Conclusion Mononucleotide repeats are intragenically biased in numerous fungal genomes, similar to earlier studies on prokaryotes, indicative of a similar selective pressure in gene organization.

  4. Contributions by the CAG-repeat Polymorphism of the Androgen Receptor Gene and Circulating Androgens to Muscle Size. Odense Androgen Study - A Population-based Study of 20-29 Year-old Danish Men

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian;

    2007-01-01

    Context: The number of CAG-repeats within the CAG-repeat polymorphism of the androgen receptor gene is inversely correlated with the transcriptional activity of the androgen receptor. Objective: To study the effect of the CAG-repeat number and circulating androgens on muscle size, to examine......-repeat number correlated inversely with thigh and axial muscle area and with lower and upper extremity lean body mass. Except for upper extremity lean body mass, these findings remained significant in multivariate analyses controlling for circulating androgens, physical activity, smoking, alcohol intake...

  5. Intermediate CAG repeat expansion in the ATXN2 gene is a unique genetic risk factor for ALS--a systematic review and meta-analysis of observational studies.

    Directory of Open Access Journals (Sweden)

    Ming-Dong Wang

    Full Text Available Amyotrophic lateral sclerosis (ALS is a rare degenerative condition of the motor neurons. Over 10% of ALS cases are linked to monogenic mutations, with the remainder thought to be due to other risk factors, including environmental factors, genetic polymorphisms, and possibly gene-environmental interactions. We examined the association between ALS and an intermediate CAG repeat expansion in the ATXN2 gene using a meta-analytic approach. Observational studies were searched with relevant disease and gene terms from MEDLINE, EMBASE, and PsycINFO from January 2010 through to January 2014. All identified articles were screened using disease terms, gene terms, population information, and CAG repeat information according to PRISMA guidelines. The final list of 17 articles was further evaluated based on the study location, time period, and authors to exclude multiple usage of the same study populations: 13 relevant articles were retained for this study. The range 30-33 CAG repeats in the ATXN2 gene was most strongly associated with ALS. The meta-analysis revealed that the presence of an intermediate CAG repeat (30-33 in the ATXN2 gene was associated with an increased risk of ALS [odds ratio (OR = 4.44, 95%CI: 2.91-6.76] in Caucasian ALS patients. There was no significant difference in the association of this CAG intermediate repeat expansion in the ATXN2 gene between familial ALS cases (OR = 3.59, 1.58-8.17 and sporadic ALS cases (OR = 3.16, 1.88-5.32. These results indicate that the presence of intermediate CAG repeat expansion in the ATXN2 gene is a specific genetic risk factor for ALS, unlike monogenic mutations with an autosomal dominant transmission mode, which cause a more severe phenotype of ALS, with a higher prevalence in familial ALS.

  6. Intermediate CAG repeat expansion in the ATXN2 gene is a unique genetic risk factor for ALS--a systematic review and meta-analysis of observational studies.

    Science.gov (United States)

    Wang, Ming-Dong; Gomes, James; Cashman, Neil R; Little, Julian; Krewski, Daniel

    2014-01-01

    Amyotrophic lateral sclerosis (ALS) is a rare degenerative condition of the motor neurons. Over 10% of ALS cases are linked to monogenic mutations, with the remainder thought to be due to other risk factors, including environmental factors, genetic polymorphisms, and possibly gene-environmental interactions. We examined the association between ALS and an intermediate CAG repeat expansion in the ATXN2 gene using a meta-analytic approach. Observational studies were searched with relevant disease and gene terms from MEDLINE, EMBASE, and PsycINFO from January 2010 through to January 2014. All identified articles were screened using disease terms, gene terms, population information, and CAG repeat information according to PRISMA guidelines. The final list of 17 articles was further evaluated based on the study location, time period, and authors to exclude multiple usage of the same study populations: 13 relevant articles were retained for this study. The range 30-33 CAG repeats in the ATXN2 gene was most strongly associated with ALS. The meta-analysis revealed that the presence of an intermediate CAG repeat (30-33) in the ATXN2 gene was associated with an increased risk of ALS [odds ratio (OR) = 4.44, 95%CI: 2.91-6.76)] in Caucasian ALS patients. There was no significant difference in the association of this CAG intermediate repeat expansion in the ATXN2 gene between familial ALS cases (OR = 3.59, 1.58-8.17) and sporadic ALS cases (OR = 3.16, 1.88-5.32). These results indicate that the presence of intermediate CAG repeat expansion in the ATXN2 gene is a specific genetic risk factor for ALS, unlike monogenic mutations with an autosomal dominant transmission mode, which cause a more severe phenotype of ALS, with a higher prevalence in familial ALS.

  7. A comparative study of the effectiveness of "Star Show" vs. "Participatory Oriented Planetarium" lessons in a middle school Starlab setting

    Science.gov (United States)

    Platco, Nicholas L.., Jr.

    2005-06-01

    The purpose of this study was to compare the effectiveness of "Star Show" and the "Participatory Oriented Planetarium" (POP) instructional programs in a middle school Starlab setting. The Star Show is a planetarium program that relies heavily on an audiovisual/lecture format to impart information, while the POP method of instruction is an inquiry, activity-based approach to teaching astronomy. All Star Show and POP lessons were conducted in a Starlab planetarium. This study examined the effectiveness of the two methods on the attainment of astronomy knowledge, changes in student attitudes toward astronomy, retention of knowledge, and gender differences. A pilot study (N = 69) was conducted at a middle school near King of Prussia, Pennsylvania. The main study (N = 295) was conducted at a middle school near Reading, Pennsylvania. All students were pretested and posttested in both studies. The testing instruments included a 60-question paper-and-pencil content test and a 22-item Likert-style science attitude test. The content test was judged to be valid and reliable by a panel of science educators. The attitude test is a field-tested attitude survey developed by Michael Zeilik. The topics included in the Star Show and POP lessons were seasons, moon phases, eclipses, stars, and constellations. The Star Show programs used in this study are professionally prepared planetarium programs from Jeff Bowen Productions. Several planetarium educators who have been involved with planetarium training workshops throughout the United States developed the POP lessons used in this study. The Star Show was clearly the more effective method for improving student knowledge in both the pilot and main studies. Both methods were equally effective for improving student attitudes toward astronomy. The POP method was the more effective method of instruction when retention of knowledge was examined four weeks after the treatments ended. Gender did not have any significant effect on this study

  8. A review of the reporting and handling of missing data in cohort studies with repeated assessment of exposure measures

    Directory of Open Access Journals (Sweden)

    Karahalios Amalia

    2012-07-01

    Full Text Available Abstract Background Retaining participants in cohort studies with multiple follow-up waves is difficult. Commonly, researchers are faced with the problem of missing data, which may introduce biased results as well as a loss of statistical power and precision. The STROBE guidelines von Elm et al. (Lancet, 370:1453-1457, 2007; Vandenbroucke et al. (PLoS Med, 4:e297, 2007 and the guidelines proposed by Sterne et al. (BMJ, 338:b2393, 2009 recommend that cohort studies report on the amount of missing data, the reasons for non-participation and non-response, and the method used to handle missing data in the analyses. We have conducted a review of publications from cohort studies in order to document the reporting of missing data for exposure measures and to describe the statistical methods used to account for the missing data. Methods A systematic search of English language papers published from January 2000 to December 2009 was carried out in PubMed. Prospective cohort studies with a sample size greater than 1,000 that analysed data using repeated measures of exposure were included. Results Among the 82 papers meeting the inclusion criteria, only 35 (43% reported the amount of missing data according to the suggested guidelines. Sixty-eight papers (83% described how they dealt with missing data in the analysis. Most of the papers excluded participants with missing data and performed a complete-case analysis (n = 54, 66%. Other papers used more sophisticated methods including multiple imputation (n = 5 or fully Bayesian modeling (n = 1. Methods known to produce biased results were also used, for example, Last Observation Carried Forward (n = 7, the missing indicator method (n = 1, and mean value substitution (n = 3. For the remaining 14 papers, the method used to handle missing data in the analysis was not stated. Conclusions This review highlights the inconsistent reporting of missing data in cohort studies and the continuing

  9. A review of the reporting and handling of missing data in cohort studies with repeated assessment of exposure measures.

    Science.gov (United States)

    Karahalios, Amalia; Baglietto, Laura; Carlin, John B; English, Dallas R; Simpson, Julie A

    2012-07-11

    Retaining participants in cohort studies with multiple follow-up waves is difficult. Commonly, researchers are faced with the problem of missing data, which may introduce biased results as well as a loss of statistical power and precision. The STROBE guidelines von Elm et al. (Lancet, 370:1453-1457, 2007); Vandenbroucke et al. (PLoS Med, 4:e297, 2007) and the guidelines proposed by Sterne et al. (BMJ, 338:b2393, 2009) recommend that cohort studies report on the amount of missing data, the reasons for non-participation and non-response, and the method used to handle missing data in the analyses. We have conducted a review of publications from cohort studies in order to document the reporting of missing data for exposure measures and to describe the statistical methods used to account for the missing data. A systematic search of English language papers published from January 2000 to December 2009 was carried out in PubMed. Prospective cohort studies with a sample size greater than 1,000 that analysed data using repeated measures of exposure were included. Among the 82 papers meeting the inclusion criteria, only 35 (43%) reported the amount of missing data according to the suggested guidelines. Sixty-eight papers (83%) described how they dealt with missing data in the analysis. Most of the papers excluded participants with missing data and performed a complete-case analysis (n=54, 66%). Other papers used more sophisticated methods including multiple imputation (n=5) or fully Bayesian modeling (n=1). Methods known to produce biased results were also used, for example, Last Observation Carried Forward (n=7), the missing indicator method (n=1), and mean value substitution (n=3). For the remaining 14 papers, the method used to handle missing data in the analysis was not stated. This review highlights the inconsistent reporting of missing data in cohort studies and the continuing use of inappropriate methods to handle missing data in the analysis. Epidemiological journals

  10. Duct Leakage Repeatability Testing

    Energy Technology Data Exchange (ETDEWEB)

    Walker, Iain [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Sherman, Max [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2014-01-01

    Duct leakage often needs to be measured to demonstrate compliance with requirements or to determine energy or Indoor Air Quality (IAQ) impacts. Testing is often done using standards such as ASTM E1554 (ASTM 2013) or California Title 24 (California Energy Commission 2013 & 2013b), but there are several choices of methods available within the accepted standards. Determining which method to use or not use requires an evaluation of those methods in the context of the particular needs. Three factors that are important considerations are the cost of the measurement, the accuracy of the measurement and the repeatability of the measurement. The purpose of this report is to evaluate the repeatability of the three most significant measurement techniques using data from the literature and recently obtained field data. We will also briefly discuss the first two factors. The main question to be answered by this study is to determine if differences in the repeatability of these tests methods is sufficient to indicate that any of these methods is so poor that it should be excluded from consideration as an allowed procedure in codes and standards.

  11. Development of new genomic microsatellite markers from robusta coffee (Coffea canephora Pierre ex A. Froehner showing broad cross-species transferability and utility in genetic studies

    Directory of Open Access Journals (Sweden)

    Hendre Prasad

    2008-04-01

    Full Text Available Abstract Background Species-specific microsatellite markers are desirable for genetic studies and to harness the potential of MAS-based breeding for genetic improvement. Limited availability of such markers for coffee, one of the most important beverage tree crops, warrants newer efforts to develop additional microsatellite markers that can be effectively deployed in genetic analysis and coffee improvement programs. The present study aimed to develop new coffee-specific SSR markers and validate their utility in analysis of genetic diversity, individualization, linkage mapping, and transferability for use in other related taxa. Results A small-insert partial genomic library of Coffea canephora, was probed for various SSR motifs following conventional approach of Southern hybridisation. Characterization of repeat positive clones revealed a very high abundance of DNRs (1/15 Kb over TNRs (1/406 kb. The relative frequencies of different DNRs were found as AT >> AG > AC, whereas among TNRs, AGC was the most abundant repeat. The SSR positive sequences were used to design 58 primer pairs of which 44 pairs could be validated as single locus markers using a panel of arabica and robusta genotypes. The analysis revealed an average of 3.3 and 3.78 alleles and 0.49 and 0.62 PIC per marker for the tested arabicas and robustas, respectively. It also revealed a high cumulative PI over all the markers using both sib-based (10-6 and 10-12 for arabicas and robustas respectively and unbiased corrected estimates (10-20 and 10-43 for arabicas and robustas respectively. The markers were tested for Hardy-Weinberg equilibrium, linkage dis-equilibrium, and were successfully used to ascertain generic diversity/affinities in the tested germplasm (cultivated as well as species. Nine markers could be mapped on robusta linkage map. Importantly, the markers showed ~92% transferability across related species/genera of coffee. Conclusion The conventional approach of genomic

  12. Development of new genomic microsatellite markers from robusta coffee (Coffea canephora Pierre ex A. Froehner) showing broad cross-species transferability and utility in genetic studies.

    Science.gov (United States)

    Hendre, Prasad Suresh; Phanindranath, Regur; Annapurna, V; Lalremruata, Albert; Aggarwal, Ramesh K

    2008-04-30

    Species-specific microsatellite markers are desirable for genetic studies and to harness the potential of MAS-based breeding for genetic improvement. Limited availability of such markers for coffee, one of the most important beverage tree crops, warrants newer efforts to develop additional microsatellite markers that can be effectively deployed in genetic analysis and coffee improvement programs. The present study aimed to develop new coffee-specific SSR markers and validate their utility in analysis of genetic diversity, individualization, linkage mapping, and transferability for use in other related taxa. A small-insert partial genomic library of Coffea canephora, was probed for various SSR motifs following conventional approach of Southern hybridisation. Characterization of repeat positive clones revealed a very high abundance of DNRs (1/15 Kb) over TNRs (1/406 kb). The relative frequencies of different DNRs were found as AT > AG > AC, whereas among TNRs, AGC was the most abundant repeat. The SSR positive sequences were used to design 58 primer pairs of which 44 pairs could be validated as single locus markers using a panel of arabica and robusta genotypes. The analysis revealed an average of 3.3 and 3.78 alleles and 0.49 and 0.62 PIC per marker for the tested arabicas and robustas, respectively. It also revealed a high cumulative PI over all the markers using both sib-based (10-6 and 10-12 for arabicas and robustas respectively) and unbiased corrected estimates (10-20 and 10-43 for arabicas and robustas respectively). The markers were tested for Hardy-Weinberg equilibrium, linkage dis-equilibrium, and were successfully used to ascertain generic diversity/affinities in the tested germplasm (cultivated as well as species). Nine markers could be mapped on robusta linkage map. Importantly, the markers showed ~92% transferability across related species/genera of coffee. The conventional approach of genomic library was successfully employed although with low

  13. ProtRepeatsDB: a database of amino acid repeats in genomes

    Directory of Open Access Journals (Sweden)

    Chauhan Virander S

    2006-07-01

    Full Text Available Abstract Background Genome wide and cross species comparisons of amino acid repeats is an intriguing problem in biology mainly due to the highly polymorphic nature and diverse functions of amino acid repeats. Innate protein repeats constitute vital functional and structural regions in proteins. Repeats are of great consequence in evolution of proteins, as evident from analysis of repeats in different organisms. In the post genomic era, availability of protein sequences encoded in different genomes provides a unique opportunity to perform large scale comparative studies of amino acid repeats. ProtRepeatsDB http://bioinfo.icgeb.res.in/repeats/ is a relational database of perfect and mismatch repeats, access to which is designed as a resource and collection of tools for detection and cross species comparisons of different types of amino acid repeats. Description ProtRepeatsDB (v1.2 consists of perfect as well as mismatch amino acid repeats in the protein sequences of 141 organisms, the genomes of which are now available. The web interface of ProtRepeatsDB consists of different tools to perform repeat s; based on protein IDs, organism name, repeat sequences, and keywords as in FASTA headers, size, frequency, gene ontology (GO annotation IDs and regular expressions (REGEXP describing repeats. These tools also allow formulation of a variety of simple, complex and logical queries to facilitate mining and large-scale cross-species comparisons of amino acid repeats. In addition to this, the database also contains sequence analysis tools to determine repeats in user input sequences. Conclusion ProtRepeatsDB is a multi-organism database of different types of amino acid repeats present in proteins. It integrates useful tools to perform genome wide queries for rapid screening and identification of amino acid repeats and facilitates comparative and evolutionary studies of the repeats. The database is useful for identification of species or organism specific

  14. [C-11]raclopride-PET studies of the Huntington's disease rate of progression : Relevance of the trinucleotide repeat length

    NARCIS (Netherlands)

    Antonini, A; Leenders, KL; Eidelberg, D

    1998-01-01

    We used [C-11]raclopride and positron emission tomography (PET) to assess the relationship between striatal dopamine D2 receptor binding, trinucleotide repeat number (GAG), and subject age in 10 asymptomatic and 8 symptomatic carriers of the Huntington's disease (HD) mutation. In both preclinical an

  15. Pharmacokinetic evaluation of pamidronate after oral administration: a study on dose proportionality, absolute bioavailability, and effect of repeated administration

    DEFF Research Database (Denmark)

    Hyldstrup, Lars; Flesch, G; Hauffe, S A

    1993-01-01

    30 minutes at constant infusion rate. Repeated peroral doses (75 and 150 mg) were administered to 12 females (aged 51-70 years) for 10 consecutive days. Urinary excretion of pamidronate after peroral and i.v. administration was used for estimation of pamidronate absorption. Renal excretion...

  16. Primary and Repeat Cesarean Deliveries: A Population-based Study in the United States, 1979-2010.

    Science.gov (United States)

    Ananth, Cande V; Friedman, Alexander M; Keyes, Katherine M; Lavery, Jessica A; Hamilton, Ava; Wright, Jason D

    2017-07-01

    Despite the temporal increase in cesarean deliveries, the extent to which maternal age, period, and maternal birth cohorts may have contributed to these trends remains unknown. We performed an analysis of 123 million singleton deliveries in the United States (1979-2010). We estimated rate ratio (RR) with 95% confidence interval (CI) for primary and repeat cesarean deliveries. We examined changes in cesarean rates with weighted Poisson regression models across three time-scales: maternal age, year of delivery, and birth cohort (mother's birth year). The primary cesarean rate increased by 68% (95% confidence interval [CI]: 67%, 69%) between 1979 (11.0%) and 2010 (18.5%). Repeat cesarean deliveries increased by 178% (95% CI: 176, 179) from 5.2% in 1979 to 14.4% in 2010. Cesarean rates increased with advancing age. Compared with 1979, the RR for the period effect in primary and repeat cesarean deliveries increased up to 1990, fell to a nadir at 1993, and began to rise thereafter. A small birth cohort effect was evident, with women born before 1950 at increased risk of primary cesarean; no cohort effect was seen for repeat cesarean deliveries. Adjustment for maternal BMI had a small effect on these findings. Period effects in primary cesarean were explained by a combination of trends in obesity and chronic hypertension, as well as demographic shifts over time. Maternal age and period appear to have important contributions to the temporal increase in the cesarean rates, although the effect of parity on these associations remains undetermined.

  17. A Cross-Sectional Study on the Perceptions and Practices of Teenagers With Inflammatory Bowel Disease About Repeated Stool Sampling

    NARCIS (Netherlands)

    Heida, Anke; Dijkstra, Alie; Dantuma, Sietske K.; van Rheenen, Patrick F.

    2016-01-01

    Purpose: Repeated stool sampling to monitor disease activity is increasingly used in teenagers with inflammatory bowel disease (IBD). Knowledge about their perceptions and practices regarding collection of feces will increase the success rate of this monitoring strategy. Methods: We sent a survey to

  18. New Study Shows Flu Vaccine Reduced Children's Risk of Intensive Care Unit Flu Admission by Three-Fourths

    Science.gov (United States)

    ... Health Image Library (PHIL) New Study Shows Flu Vaccine Reduced Children’s Risk of Intensive Care Unit Flu Admission by ... Media Relations (404) 639-3286 Getting a flu vaccine reduces a child's risk of flu-related intensive care hospitalization by ...

  19. Repeated administration of D-amphetamine induces loss of [I-123]FP-CIT binding to striatal dopamine transporters in rat brain: a validation study

    NARCIS (Netherlands)

    J. Booij; K. de Bruin; W.B. Gunning

    2006-01-01

    In recent years, several PET and SPECT studies have shown loss of striatal dopamine transporter (DAT) binding in arnphetamine (AMPH) users. However, the use of DAT SPECT tracers to detect AMPH-induced changes in DAT binding has not been validated. We therefore examined if repeated administration of

  20. Prospective study on the determinants of repeat attendance and attendance patterns in breast cancer screening using the Theory of Planned Behaviour

    NARCIS (Netherlands)

    Drossaert, C.H.C.; Boer, H.; Seydel, E.R.

    2003-01-01

    This prospective study, using the Theory of Planned Behaviour (TPB) as a theoretical framework, was carried out to identify the determinants of repeat attendance and attendance patterns in organised breast screening. A group of 2657 women filled out a baseline questionnaire, approximately 8 weeks af

  1. Repeated administration of D-amphetamine induces loss of [{sup 123}I]FP-CIT binding to striatal dopamine transporters in rat brain: a validation study

    Energy Technology Data Exchange (ETDEWEB)

    Booij, Jan [Department of Nuclear Medicine, Academic Medical Center, 1105 AZ Amsterdam (Netherlands)]. E-mail: j.booij@amc.uva.nl; Bruin, Kora de [Department of Nuclear Medicine, Academic Medical Center, 1105 AZ Amsterdam (Netherlands); Gunning, W. Boudewijn [Department of Neurology, Epilepsy Centre Kempenhaeghe, 5590 AB Heeze (Netherlands)

    2006-04-15

    In recent years, several PET and SPECT studies have shown loss of striatal dopamine transporter (DAT) binding in amphetamine (AMPH) users. However, the use of DAT SPECT tracers to detect AMPH-induced changes in DAT binding has not been validated. We therefore examined if repeated administration of D-AMPH or methamphetamine (METH) may induce loss of binding to striatal DATs in rats by using an experimental biodistribution study design and a SPECT tracer for the DAT ([{sup 123}I]FP-CIT). Methods: Groups of male rats (n=10 per group) were treated with D-AMPH (10 mg/kg body weight), METH (10 mg/kg body weight), or saline, twice a day for 5 consecutive days. Five days later, [{sup 123}I]FP-CIT was injected intravenously, and 2 h later, the rats were sacrificed and radioactivity was assayed. Results: In D-AMPH but not METH-treated rats, striatal [{sup 123}I]FP-CIT uptake was significantly lower (approximately 17%) than in the control group. Conclusion: These data show that [{sup 123}I]FP-CIT can be used to detect AMPH-induced changes in DAT binding and may validate the use of DAT radiotracers to study AMPH-induced changes in striatal DAT binding in vivo.

  2. Influence of coefficient of variation in determining significant difference of quantitative values obtained from 28-day repeated-dose toxicity studies in rats.

    Science.gov (United States)

    Kobayashi, Katsumi; Sakuratani, Yuki; Abe, Takemaru; Yamazaki, Kazuko; Nishikawa, Satoshi; Yamada, Jun; Hirose, Akihiko; Kamata, Eiichi; Hayashi, Makoto

    2011-01-01

    In order to understand the influence of coefficient of variation (CV) in determining significant difference of quantitative values of 28-day repeated-dose toxicity studies, we examined 59 parameters of 153 studies conducted in accordance with Chemical Substance Control Law in 12 test facilities. Sex difference was observed in 12 parameters and 10 parameters showed large CV in females. The minimum CV was 0.74% for sodium. CV of electrolytes was comparatively small, whereas enzymes had large CV. Large differences in CV were observed for major parameters among 7-8 test facilities. The changes in CV were grossly classified into 11. Our study revealed that a statistical significant difference is usually detected if there is a difference of 7% in mean values between the groups and the groups have a CV of about 7%. A parameter with a CV as high as 30% may be significantly different, if the difference of the mean between the groups is 30%. It would be ideal to use median value to assess the treatment-related effect, rather than mean, when the CV is very high. We recommend using CV of the body weight as a standard to judge the adverse effect level.

  3. A Trans-National Audience Study of a Global Format Genre: Talent Shows in Denmark, Finland, Germany and Great Britain

    DEFF Research Database (Denmark)

    Jensen, Pia Majbritt; Esser, Andrea; Keinonen, Heidi;

    This paper will discuss the methodology and present the preliminary findings of a trans-national, comparative audience study of the musical talent show genre undertaken in Denmark, Finland, Germany and Great Britain in early 2013. Within the international business model of selling and adapting...... television formats, the musical talent show genre has been particularly successful in crossing cultural borders. Formats such as Idols, Got Talent, X Factor and, more recently, Voice have sold to a large variety of countries. As an example, Idols alone has been adapted in over 40 territories, covering all...... programming. A consensus seems to have developed that television formats such as Voice and X Factor to a considerable degree are adapted according to national audiences and, hence, national cultural tastes and mentalities. In our research approach, we recognize that musical talent shows appear to contribute...

  4. Reception of Talent Shows in Denmark: First Results from a Trans-National Audience Study of a Global Format Genre

    DEFF Research Database (Denmark)

    Jensen, Pia Majbritt

    This paper will discuss the methodology and present the preliminary findings of the Danish part of a trans-national, comparative audience study of the musical talent show genre undertaken in Denmark, Finland, Germany and Great Britain in Spring 2013. Within the international business model...... of format adaptation, the musical talent show genre has been particularly successful in crossing cultural borders. Formats such as Idols, X Factor and Voice have sold to a large variety of countries, covering all continents. Such global reach inevitably raises the question of the genre’s audience appeal...... that television formats to a considerable degree are adapted according to national audiences and, hence, national cultural tastes. And in our research approach, we do recognize that musical talent shows appear to contribute to ‘imagining the nation’ (Anderson 1983), often even mentioning the nation in the title...

  5. Reception of Talent Shows in Denmark: First Results from a Trans-National Audience Study of a Global Format Genre

    DEFF Research Database (Denmark)

    Jensen, Pia Majbritt

    of format adaptation, the musical talent show genre has been particularly successful in crossing cultural borders. Formats such as Idols, X Factor and Voice have sold to a large variety of countries, covering all continents. Such global reach inevitably raises the question of the genre’s audience appeal......This paper will discuss the methodology and present the preliminary findings of the Danish part of a trans-national, comparative audience study of the musical talent show genre undertaken in Denmark, Finland, Germany and Great Britain in Spring 2013. Within the international business model...... that television formats to a considerable degree are adapted according to national audiences and, hence, national cultural tastes. And in our research approach, we do recognize that musical talent shows appear to contribute to ‘imagining the nation’ (Anderson 1983), often even mentioning the nation in the title...

  6. A Trans-National Audience Study of a Global Format Genre: Talent Shows in Denmark, Finland, Germany and Great Britain

    DEFF Research Database (Denmark)

    Jensen, Pia Majbritt; Esser, Andrea; Keinonen, Heidi

    television formats, the musical talent show genre has been particularly successful in crossing cultural borders. Formats such as Idols, Got Talent, X Factor and, more recently, Voice have sold to a large variety of countries. As an example, Idols alone has been adapted in over 40 territories, covering all......This paper will discuss the methodology and present the preliminary findings of a trans-national, comparative audience study of the musical talent show genre undertaken in Denmark, Finland, Germany and Great Britain in early 2013. Within the international business model of selling and adapting...... programming. A consensus seems to have developed that television formats such as Voice and X Factor to a considerable degree are adapted according to national audiences and, hence, national cultural tastes and mentalities. In our research approach, we recognize that musical talent shows appear to contribute...

  7. Automatization and familiarity in repeated checking

    NARCIS (Netherlands)

    Dek, Eliane C P; van den Hout, Marcel A.; Giele, Catharina L.; Engelhard, Iris M.

    2014-01-01

    Repeated checking paradoxically increases memory uncertainty. This study investigated the underlying mechanism of this effect. We hypothesized that as a result of repeated checking, familiarity with stimuli increases, and automatization of the checking procedure occurs, which should result in decrea

  8. Reported frequency of physical activity in a large epidemiological study: relationship to specific activities and repeatability over time

    Directory of Open Access Journals (Sweden)

    Reeves Gillian K

    2011-06-01

    Full Text Available Abstract Background How overall physical activity relates to specific activities and how reported activity changes over time may influence interpretation of observed associations between physical activity and health. We examine the relationships between various physical activities self-reported at different times in a large cohort study of middle-aged UK women. Methods At recruitment, Million Women Study participants completed a baseline questionnaire including questions on frequency of strenuous and of any physical activity. About 3 years later 589,896 women also completed a follow-up questionnaire reporting the hours they spent on a range of specific activities. Time spent on each activity was used to estimate the associated excess metabolic equivalent hours (MET-hours and this value was compared across categories of physical activity reported at recruitment. Additionally, 18,655 women completed the baseline questionnaire twice, at intervals of up to 4 years; repeatability over time was assessed using the weighted kappa coefficient (κweighted and absolute percentage agreement. Results The average number of hours per week women reported doing specific activities was 14.0 for housework, 4.5 for walking, 3.0 for gardening, 0.2 for cycling, and 1.4 for all strenuous activity. Time spent and the estimated excess MET-hours associated with each activity increased with increasing frequency of any or strenuous physical activity reported at baseline (tests for trend, P weighted = 0.71 for questionnaires administered less than 6 months apart, and 52% (κweighted = 0.51 for questionnaires more than 2 years apart. Corresponding values for any physical activity were 57% (κweighted = 0.67 and 47% (κweighted = 0.58. Conclusions In this cohort, responses to simple questions on the frequency of any physical activity and of strenuous activity asked at baseline were associated with hours spent on specific activities and the associated estimated excess MET

  9. Repeatability of peripheral aberrations in young emmetropes.

    Science.gov (United States)

    Baskaran, Karthikeyan; Theagarayan, Baskar; Carius, Staffan; Gustafsson, Jörgen

    2010-10-01

    The purpose of this study is to assess the intrasession repeatability of ocular aberration measurements in the peripheral visual field with a commercially available Shack-Hartmann aberrometer (complete ophthalmic analysis system-high definition-vision research). The higher-order off-axis aberrations data in young healthy emmetropic eyes are also reported. The aberrations of the right eye of 18 emmetropes were measured using an aberrometer with an open field of view that allows peripheral measurements. Five repeated measures of ocular aberrations were obtained and assessed in steps of 10° out to ±40° in the horizontal visual field (nasal + and temporal -) and -20° in the inferior visual field. The coefficient of repeatability, coefficient of variation, and the intraclass correlation coefficient were calculated as a measure of intrasession repeatability. In all eccentric angles, the repeatability of the third- and fourth-order aberrations was better than the fifth and sixth order aberrations. The coefficient of variation was coefficient was >0.90 for the third and fourth order but reduced gradually for higher orders. There was no statistical significant difference in variance of total higher-order root mean square between on- and off-axis measurements (p > 0.05). The aberration data in this group of young emmetropes showed that the horizontal coma (C(3)(1)) was most positive at 40° in the temporal field, decreasing linearly toward negative values with increasing off-axis angle into the nasal field, whereas all other higher-order aberrations showed little or no change. The complete ophthalmic analysis system-high definition-vision research provides fast, repeatable, and valid peripheral aberration measurements and can be used efficiently to measure off-axis aberrations in the peripheral visual field.

  10. A pilot study in non-human primates shows no adverse response to intravenous injection of quantum dots

    Science.gov (United States)

    Ye, Ling; Yong, Ken-Tye; Liu, Liwei; Roy, Indrajit; Hu, Rui; Zhu, Jing; Cai, Hongxing; Law, Wing-Cheung; Liu, Jianwei; Wang, Kai; Liu, Jing; Liu, Yaqian; Hu, Yazhuo; Zhang, Xihe; Swihart, Mark T.; Prasad, Paras N.

    2012-07-01

    Quantum dots have been used in biomedical research for imaging, diagnostics and sensing purposes. However, concerns over the cytotoxicity of their heavy metal constituents and conflicting results from in vitro and small animal toxicity studies have limited their translation towards clinical applications. Here, we show in a pilot study that rhesus macaques injected with phospholipid micelle-encapsulated CdSe/CdS/ZnS quantum dots do not exhibit evidence of toxicity. Blood and biochemical markers remained within normal ranges following treatment, and histology of major organs after 90 days showed no abnormalities. Our results show that acute toxicity of these quantum dots in vivo can be minimal. However, chemical analysis revealed that most of the initial dose of cadmium remained in the liver, spleen and kidneys after 90 days. This means that the breakdown and clearance of quantum dots is quite slow, suggesting that longer-term studies will be required to determine the ultimate fate of these heavy metals and the impact of their persistence in primates.

  11. A Preliminary Study of the Effects of Repeated Massage on Hypothalamic–Pituitary–Adrenal and Immune Function in Healthy Individuals: A Study of Mechanisms of Action and Dosage

    Science.gov (United States)

    Schettler, Pamela; Bresee, Catherine

    2012-01-01

    Abstract Objectives This study gathers preliminary data about the biologic effects of repeated Swedish massage therapy compared to a light-touch control condition. Design The study design was a 5-week comparison of repeated Swedish massage and light touch on oxytocin (OT), arginine-vasopressin (AVP), adrenal corticotropin hormone (ACTH), cortisol (CORT), circulating phenotypic lymphocyte markers, and mitogen-stimulated cytokine function. Setting The setting was an outpatient research unit in an academic medical center. Participants The study subjects were medically and psychiatrically healthy young adults. Intervention The study comprised 45 minutes of Swedish massage or light touch, using highly specified and identical protocols, either weekly or twice weekly for 5 weeks. Outcome measures The outcome measures were mean differences between massage and light touch on OT, AVP, ACTH, CORT, lymphocyte markers, and cytokine levels. Results Compared to the touch control condition, weekly Swedish massage stimulated a sustained pattern of increased circulating phenotypic lymphocyte markers and decreased mitogen-stimulated cytokine production, similar to what was previously reported for a single massage session, while having minimal effect on hypothalamic–pituitary–adrenal function. Twice-weekly massage produced a different response pattern with increased OT levels, decreased AVP, and decreased CORT but little effect on circulating lymphocyte phenotypic markers and a slight increase in mitogen-stimulated interferon-γ, tumor necrosis factor-α, interleukin (IL)-1b and IL-2 levels, suggesting increased production of pro-inflammatory cytokines. Conclusions There are sustained cumulative biologic actions for the massage and touch interventions that persist for several days or a week, and these differ profoundly depending on the dosage (frequency) of sessions. Confirmatory studies in larger samples are needed. PMID:22775448

  12. Diurnal variations of plasma homocysteine, total antioxidant status, and biological markers of muscle injury during repeated sprint: effect on performance and muscle fatigue--a pilot study.

    Science.gov (United States)

    Hammouda, Omar; Chtourou, Hamdi; Chahed, Henda; Ferchichi, Salyma; Kallel, Choumous; Miled, Abdelhedi; Chamari, Karim; Souissi, Nizar

    2011-12-01

    The aim of this study was (i) to evaluate whether homocysteine (Hcy), total antioxidant status (TAS), and biological markers of muscle injury would be affected by time of day (TOD) in football players and (ii) to establish a relationship between diurnal variation of these biomarkers and the daytime rhythm of power and muscle fatigue during repeated sprint ability (RSA) exercise. In counterbalanced order, 12 football (soccer) players performed an RSA test (5 x[6 s of maximal cycling sprint + 24 s of rest]) on two different occasions: 07:00-08:30 h and 17:00-18:30 h. Fasting blood samples were collected from a forearm vein before and 3-5 min after each RSA test. Core temperature, rating of perceived exertion, and performances (i.e., Sprint 1, Sprint 2, and power decrease) during the RSA test were significantly higher at 17:00 than 07:00 h (p RSA test. However, biomarkers of antioxidant status' resting levels (i.e., total antioxidant status, uric acid, and total bilirubin) were higher in the morning. This TOD effect was suppressed after exercise for TAS and uric acid. In conclusion, the present study confirms diurnal variation of Hcy, selected biological markers of cellular damage, and antioxidant status in young football players. Also, the higher performances and muscle fatigue showed in the evening during RSA exercise might be due to higher levels of biological markers of muscle injury and lower antioxidant status at this TOD.

  13. Combination of the clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 technique with the piggybac transposon system for mouse in utero electroporation to study cortical development.

    Science.gov (United States)

    Cheng, Man; Jin, Xubin; Mu, Lili; Wang, Fangyu; Li, Wei; Zhong, Xiaoling; Liu, Xuan; Shen, Wenchen; Liu, Ying; Zhou, Yan

    2016-09-01

    In utero electroporation (IUE) is commonly used to study cortical development of cerebrum by downregulating or overexpressing genes of interest in neural progenitor cells (NPCs) of small mammals. However, exogenous plasmids are lost or diluted over time. Furthermore, gene knockdown based on short-hairpin RNAs may exert nonspecific effects that lead to aberrant neuronal migration. Genomic engineering by the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) system has great research and therapeutic potentials. Here we integrate the CRISPR/Cas9 components into the piggyBac (PB) transposon system (the CRISPR/Cas9-PB toolkit) for cortical IUEs. The mouse Sry-related HMG box-2 (Sox2) gene was selected as the target for its application. Most transduced cortical NPCs were depleted of SOX2 protein as early as 3 days post-IUE, whereas expressions of SOX1 and PAX6 remained intact. Furthermore, both the WT Cas9 and the D10A nickase mutant Cas9n showed comparable knockout efficiency. Transduced cortical cells were purified with fluorescence-activated cell sorting, and effective gene editing at the Sox2 loci was confirmed. Thus, application of the CRISPR/Cas9-PB toolkit in IUE is a promising strategy to study gene functions in cortical NPCs and their progeny. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  14. Genotype-Phenotype Study of the Middle Gangetic Plain in India Shows Association of rs2470102 with Skin Pigmentation.

    Science.gov (United States)

    Mishra, Anshuman; Nizammuddin, Sheikh; Mallick, Chandana Basu; Singh, Sakshi; Prakash, Satya; Siddiqui, Niyamat Ali; Rai, Niraj; Carlus, S Justin; Sudhakar, Digumarthi V S; Tripathi, Vishnu P; Möls, Märt; Kim-Howard, Xana; Dewangan, Hemlata; Mishra, Abhishek; Reddy, Alla G; Roy, Biswajit; Pandey, Krishna; Chaubey, Gyaneshwer; Das, Pradeep; Nath, Swapan K; Singh, Lalji; Thangaraj, Kumarasamy

    2017-03-01

    Our understanding of the genetics of skin pigmentation has been largely skewed towards populations of European ancestry, imparting less attention to South Asian populations, who behold huge pigmentation diversity. Here, we investigate skin pigmentation variation in a cohort of 1,167 individuals in the Middle Gangetic Plain of the Indian subcontinent. Our data confirm the association of rs1426654 with skin pigmentation among South Asians, consistent with previous studies, and also show association for rs2470102 single nucleotide polymorphism. Our haplotype analyses further help us delineate the haplotype distribution across social categories and skin color. Taken together, our findings suggest that the social structure defined by the caste system in India has a profound influence on the skin pigmentation patterns of the subcontinent. In particular, social category and associated single nucleotide polymorphisms explain about 32% and 6.4%, respectively, of the total phenotypic variance. Phylogeography of the associated single nucleotide polymorphisms studied across 52 diverse populations of the Indian subcontinent shows wide presence of the derived alleles, although their frequencies vary across populations. Our results show that both polymorphisms (rs1426654 and rs2470102) play an important role in the skin pigmentation diversity of South Asians.

  15. Association of the D repeat polymorphism in the ASPN gene with developmental dysplasia of the hip: a case-control study in Han Chinese

    Science.gov (United States)

    2011-01-01

    Introduction Developmental dysplasia of the hip (DDH) is a common skeletal disease, which is characterized by abnormal seating of the femoral head in the acetabulum. Genetic factors play a considerable role in the etiology of DDH. Asporin (ASPN) is an ECM protein which can bind to TGF-β1 and sequentially inhibit TGF-β/Smad signaling. A functional aspartic acid (D) repeat polymorphism of ASPN was first described as an osteoarthritis-associated polymorphism. As TGF-β is well known as an important regulator in the development of skeletal components, ASPN may also be involved in the etiology of DDH. Our objective is to evaluate whether the D repeat polymorphism of ASPN is associated with DDH in Han Chinese. Methods The D repeat polymorphism was genotyped in 370 DDH patients and 445 control subjects, and the allelic association of the D repeat was examined. Results From D11 to D18, eight alleles were identified. D13 allele is the most common allele both in control and DDH groups, the frequencies are 67.3% and 58.1% respectively. In the DDH group, a significantly higher frequency of the D14 allele and significantly lower frequency of D13 was observed. The association of D14 and D13 was found in both females and males after stratification by gender. There was no significant difference in any other alleles we examined. Conclusions Our results show an obvious association between the D repeat polymorphism of ASPN and DDH. It indicates that ASPN is an important regulator in the etiology of DDH. PMID:21329514

  16. Correlation of CAG repeat length between the maternal and paternal allele of the Huntingtin gene: evidence for assortative mating

    Directory of Open Access Journals (Sweden)

    Wassink Tom

    2011-10-01

    Full Text Available Abstract Triplet repeats contribute to normal variation in behavioral traits and when expanded, cause brain disorders. While Huntington's Disease is known to be caused by a CAG triplet repeat in the gene Huntingtin, the effect of CAG repeats on brain function below disease threshold has not been studied. The current study shows a significant correlation between the CAG repeat length of the maternal and paternal allele in the Huntingtin gene among healthy subjects, suggesting assortative mating.

  17. TU-AB-BRA-05: Repeatability of [F-18]-NaF PET Imaging Biomarkers for Bone Lesions: A Multicenter Study

    Energy Technology Data Exchange (ETDEWEB)

    Lin, C; Bradshaw, T; Perk, T; Harmon, S; Jeraj, R [University of Wisconsin - Madison, School of Medicine and Public Health, Madison, WI (United States); Liu, G

    2015-06-15

    Purpose: Quantifying the repeatability of imaging biomarkers is critical for assessing therapeutic response. While therapeutic efficacy has been traditionally quantified by SUV metrics, imaging texture features have shown potential for use as quantitative biomarkers. In this study we evaluated the repeatability of quantitative {sup 18}F-NaF PET-derived SUV metrics and texture features in bone lesions from patients in a multicenter study. Methods: Twenty-nine metastatic castrate-resistant prostate cancer patients received whole-body test-retest NaF PET/CT scans from one of three harmonized imaging centers. Bone lesions of volume greater than 1.5 cm{sup 3} were identified and automatically segmented using a SUV>15 threshold. From each lesion, 55 NaF PET-derived texture features (including first-order, co-occurrence, grey-level run-length, neighbor gray-level, and neighbor gray-tone difference matrix) were extracted. The test-retest repeatability of each SUV metric and texture feature was assessed with Bland-Altman analysis. Results: A total of 315 bone lesions were evaluated. Of the traditional SUV metrics, the repeatability coefficient (RC) was 12.6 SUV for SUVmax, 2.5 SUV for SUVmean, and 4.3 cm{sup 3} for volume. Their respective intralesion coefficients of variation (COVs) were 12%, 17%, and 6%. Of the texture features, COV was lowest for entropy (0.03%) and highest for kurtosis (105%). Lesion intraclass correlation coefficient (ICC) was lowest for maximum correlation coefficient (ICC=0.848), and highest for entropy (ICC=0.985). Across imaging centers, repeatability of texture features and SUV varied. For example, across imaging centers, COV for SUVmax ranged between 11–23%. Conclusion: Many NaF PET-derived SUV metrics and texture features for bone lesions demonstrated high repeatability, such as SUVmax, entropy, and volume. Several imaging texture features demonstrated poor repeatability, such as SUVtotal and SUVstd. These results can be used to establish

  18. Comparative systems toxicology analysis of cigarette smoke and aerosol from a candidate modified risk tobacco product in organotypic human gingival epithelial cultures: A 3-day repeated exposure study.

    Science.gov (United States)

    Zanetti, Filippo; Titz, Bjoern; Sewer, Alain; Lo Sasso, Giuseppe; Scotti, Elena; Schlage, Walter K; Mathis, Carole; Leroy, Patrice; Majeed, Shoaib; Torres, Laura Ortega; Keppler, Brian R; Elamin, Ashraf; Trivedi, Keyur; Guedj, Emmanuel; Martin, Florian; Frentzel, Stefan; Ivanov, Nikolai V; Peitsch, Manuel C; Hoeng, Julia

    2017-03-01

    Smoking is one of the major lifestyle-related risk factors for periodontal diseases. Modified risk tobacco products (MRTP) offer a promising alternative in the harm reduction strategy for adult smokers unable to quit. Using a systems toxicology approach, we investigated and compared the exposure effects of a reference cigarette (3R4F) and a heat-not-burn technology-based candidate MRTP, the Tobacco Heating System (THS) 2.2. Human gingival epithelial organotypic cultures were repeatedly exposed (3 days) for 28 min at two matching concentrations of cigarette smoke (CS) or THS2.2 aerosol. Results showed only minor histopathological alterations and minimal cytotoxicity upon THS2.2 aerosol exposure compared to CS (1% for THS2.2 aerosol vs. 30% for CS, at the high concentration). Among the 14 proinflammatory mediators analyzed, only 5 exhibited significant alterations with THS2.2 exposure compared with 11 upon CS exposure. Transcriptomic and metabolomic analysis indicated a general reduction of the impact in THS2.2 aerosol-exposed samples with respect to CS (∼79% lower biological impact for the high THS2.2 aerosol concentration compared to CS, and 13 metabolites significantly perturbed for THS2.2 vs. 181 for CS). This study indicates that exposure to THS2.2 aerosol had a lower impact on the pathophysiology of human gingival organotypic cultures than CS. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. A study of the evolution of inverted-topology repeats from LeuT-fold transporters using AlignMe.

    Science.gov (United States)

    Khafizov, Kamil; Staritzbichler, René; Stamm, Marcus; Forrest, Lucy R

    2010-12-21

    X-ray crystal structures have revealed that numerous secondary transporter proteins originally categorized into different sequence families share similar structures, namely, the LeuT fold. The core of this fold consists of two units of five transmembrane helices, whose conformations have been proposed to exchange to form the two alternate states required for transport. That these two units are related implies that LeuT-like transporters evolved from gene-duplication and fusion events. Thus, the origins of this structural repeat may be relevant to the evolution of transport function. However, the lack of significant sequence similarity requires sensitive sequence search methods for analyzing their evolution. To this end, we developed a software application called AlignMe, which can use various types of input information, such as residue hydrophobicity, to perform pairwise alignments of sequences and/or of hydropathy profiles of (membrane) proteins. We used AlignMe to analyze the evolutionary relationships between repeats of the LeuT fold. In addition, we identified proteins from the so-called DedA family that potentially share a common ancestor with these repeats. DedA domains have been implicated in, e.g., selenite uptake; they are found widely distributed across all kingdoms of life; two or more DedA domains are typically found per genome, and some may adopt dual topologies. These results suggest that DedA proteins existed in ancient organisms and may function as dimers, as required for a would-be ancestor of the LeuT fold. In conclusion, we provide novel insights into the evolution of this important structural motif and thus potentially into the alternating-access mechanism of transport itself.

  20. Repeat-pulse 13CO2 labeling of canola and field pea: implications for soil organic matter studies.

    Science.gov (United States)

    Sangster, Amy; Knight, Diane; Farrell, Richard; Bedard-Haughn, Angela

    2010-10-15

    Both the quantity and quality of plant residues can impact soil properties and processes. Isotopic tracers can be used to trace plant residue decomposition if the tracer is homogeneously distributed throughout the plant. Continuous labeling will homogeneously label plants but is not widely accessible because elaborate equipment is needed. In order to determine if the more accessible repeat-pulse labeling method could be used to trace plant residue decomposition, this labeling procedure was employed using (13)CO(2) to enrich field pea and canola plants in a controlled environment. Plants were exposed weekly to pulses of 33 atom% (13)CO(2) and grown to maturity. The distribution of the label throughout the plant parts (roots, stem, leaves, and pod) and biochemical fractions (ADF and ADL) was determined. The label was not homogeneously distributed throughout the plant; in particular, the pod fractions were less enriched than other fractions indicating the importance of continuing labeling well into plant maturity for pod-producing plants. The ADL fraction was also less enriched than the ADF fraction. Because of the heterogeneity of the label throughout the plant, caution should be applied when using the repeat-pulse method to trace the fate of (13)C-labeled residues in the soil. However, root contributions to below-ground C were successfully determined from the repeat-pulse labeled root material, as was (13)C enrichment of soil within the top 15 cm. Canola contributed more above- and below-ground residue C than field pea; however, canola was also higher in ADF and ADL fractions indicating a more recalcitrant residue.

  1. Evaluation of a repeated dose liver micronucleus assay in rats treated with two genotoxic hepatocarcinogens, dimethylnitrosamine and 2-acetylaminofluorene: the possibility of integrating micronucleus tests with multiple tissues into a repeated dose general toxicity study.

    Science.gov (United States)

    Takashima, Rie; Takasawa, Hironao; Kawasako, Kazufumi; Ohyama, Wakako; Okada, Emiko; Narumi, Kazunori; Fujiishi, Yohei; Wako, Yumi; Yasunaga, Katsuaki; Hattori, Akiko; Kawabata, Masayoshi; Nakadate, Kiyoko; Nakagawa, Munehiro; Hamada, Shuichi

    2015-03-01

    As part of a collaborative study by the Collaborative Study Group for Micronucleus Test (CSGMT) of the Mammalian Mutagenicity Study Group (MMS) in the Japanese Environmental Mutagen Society (JEMS), the present study evaluated the effectiveness of the repeated dose liver micronucleus (RDLMN) assay. Two genotoxic hepatocarcinogens, dimethylnitrosamine (DMN) and 2-acetylaminofluorene (2-AAF), were administered orally to male rats (6 weeks old at the initial dosing) once daily for 14 and 28 days to evaluate the micronucleus (MN) inducibility in the liver. In addition, these chemicals were evaluated for MN inducibility in the bone marrow (BM) and gastrointestinal (GI) tract, i.e. glandular stomach and colon of the same animals used in the RDLMN assay. As a result, both chemicals produced positive results in the liver, although a weak positive response was given by 2-AAF. DMN gave negative results in the tissues other than the liver. 2-AAF produced positive responses in the BM and glandular stomach, and a prominent response was particularly observed in the glandular stomach, which is directly exposed to the test chemicals by gavage. The present results suggest that the RDLMN assay is a useful method for detecting genotoxic hepatocarcinogens, and that it is especially effective for evaluating test chemicals, such as DMN, undetectable by the BM and GI tract MN assay. Moreover, the results in this investigation indicate that the use of multiple tissues in the study integrating the MN tests is more effective than using a single tissue, for detection of the MN induction produced by chemical exposure to rats, and helps to determine the characteristics of the test chemicals.

  2. Soft tissue recurrent ameloblastomas also show some malignant features: A clinicopathological study of a 15-year database

    Science.gov (United States)

    Lin, Zitong; Sun, Guowen; Hu, Qingang; Chen, Fei; Wen, Shanhui

    2015-01-01

    Background To investigate the clinicopathological features of six cases of soft tissue recurrent ameloblastoma and explore the role of increased aggressive biological behavior in the recurrences and treatment of this type of ameloblastomas. Material and Methods In this study, we retrospectively reviewed recurrent ameloblastomas during a 15-year period; six cases were diagnosed as soft tissue recurrent ameloblastoma. The clinical, radiographic, cytological and immunohistochemical records of these six cases were investigated and analyzed. Results All the six soft tissue recurrent ameloblastomas occurred after radical bone resection, and were located in the adjacent soft tissues around the osteotomy regions. In Case 4, the patient developed pulmonary metastasis, extensive skull-base infiltration and cytological malignancy after multiple recurrences and malignant transformation was diagnosed. In the other five cases, although there were no cytological signs are sufficient to justify an ameloblastoma as malignant, some malignant features were observed. In Case 1, the tumor showed moderate atypical hyperplasia and the Ki-67 staining percentage was 40% positive, which are strongly suggestive of potential malignance. In Case 5, the patient developed a second soft tissue recurrence in the parapharyngeal region and later died of tumor-related complications. All the remaining three patients showed cytology atypia of varying degrees and high expression of PCNA or Ki-67, which confirmed active cell proliferation. Conclusions Increased aggressiveness is an important factor of soft tissue recurrence. An intraoperative rapid pathological examination and more radical treatment are suggested for these cases. Key words: Ameloblastoma, soft tissue recurrence, aggressive biological behaviour. PMID:25662548

  3. Ethical Disputes and Public Service Televison. Case Study: Otvoreno Political Talk Show, Broadcasted on 21st of January, 2010

    Directory of Open Access Journals (Sweden)

    Gordana Škaljac Narančić

    2011-12-01

    Full Text Available Ratings of the television programs as well as commercial effects become crucial measures of the media success and journalists’ efficiency neglecting minimal ethical standards. The profit maximisation logic and mere survival in times of the economic crisis also has the impact on preserving the sensitive ethical standards. In this respect, the television, as the most influential medium, especially public television, has the biggest responsibility. Violation of the ethical norms on public television means that it does not fulfil its key role – the role of public service. In important cases of the violation of ethical rules, the lack of clear responses of the regulators is the other side of the problem. The case study in this text shows us how easy it is to turn to the contempt of the professional journalistic standards and, consequently, ethical norms. This leads us to think how difficult is today to remain professional and ethical in times of the tangible commercialism and sensationalism.

  4. Heart rate variability and DNA methylation levels are altered after short-term metal fume exposure among occupational welders: a repeated-measures panel study

    OpenAIRE

    2014-01-01

    Background: In occupational settings, boilermakers are exposed to high levels of metallic fine particulate matter (PM2.5) generated during the welding process. The effect of welding PM2.5 on heart rate variability (HRV) has been described, but the relationship between PM2.5, DNA methylation, and HRV is not known. Methods: In this repeated-measures panel study, we recorded resting HRV and measured DNA methylation levels in transposable elements Alu and long interspersed nuclear element-1 (LINE...

  5. Associations of repeated high alcohol use with unsafe driving behaviors, traffic offenses, and traffic crashes among young drivers: Findings from the New Zealand Drivers Study.

    Science.gov (United States)

    Begg, Dorothy; Brookland, Rebecca; Connor, Jennie

    2017-02-17

    The objective of this study was to describe self-reported high alcohol use at each of the 3 licensing stages of graduated driver licensing and its relationship to drink-driving behaviors, intentional risky driving, aggressive driving, alcohol traffic offenses, non-alcohol traffic offenses, and traffic crashes. The New Zealand Drivers Study (NZDS) is a multistage, prospective cohort study of newly licensed drivers interviewed at all 3 stages of the graduated driver licensing system: learner (baseline), restricted (intermediate), and full license. At each stage, alcohol use was self-reported using the Alcohol Use Disorders Identification Test (AUDIT-C), with high alcohol use defined as a score of ≥4 for males and ≥3 for females. Sociodemographic and personality data were obtained at the baseline interview. Alcohol-related, intentional risky, and aggressive driving behaviors were self-reported following each license stage. Traffic crashes and offenses were identified from police records. Crashes were also self-reported. Twenty-six percent (n = 397) reported no high alcohol use, 22% at one license stage, 30% at 2 stages, and 22% at 3 stages. Poisson regression results (unadjusted and adjusted) showed that the number of stages where high alcohol use was reported was significantly associated with each of the outcomes. For most outcomes, and especially the alcohol-involved outcomes, the relative risk increased with the number of stages of high alcohol use. We found that high alcohol use was common among young newly licensed drivers and those who repeatedly reported high alcohol use were at a significantly higher risk of unsafe driving behaviors. Recently introduced zero blood alcohol concentration (BAC) should help to address this problem, but other strategies are required to target persistent offenders.

  6. Modelling studies on neurodegenerative disease-causing triplet repeat sequences d(GGC/GCC)n and d(CAG/CTG)n

    Indian Academy of Sciences (India)

    Shibasish Chowdhury; Manju Bansal

    2001-12-01

    Model building and molecular mechanics studies have been carried out to examine the potential structures for d(GGC/GCC)5 and d(CAG/CTG)5 that might relate to their biological function and association with triplet repeat expansion diseases. Model building studies suggested that hairpin and quadruplex structures could be formed with these repeat sequences. Molecular mechanics studies have demonstrated that the hairpin and hairpin dimer structures of triplet repeat sequences formed by looping out of the two strands are as favourable as the corresponding B-DNA type hetero duplex structures. Further, at high salt condition, Greek key type quadruplex structures are energetically comparable with hairpin dimer and B-DNA type duplex structures. All tetrads in the quadruplex structures are well stacked and provide favourable stacking energy values. Interestingly, in the energy minimized hairpin dimer and Greek key type quadruplex structures, all the bases even in the non-G tetrads are cyclically hydrogen bonded, even though the A, C and T-tetrads were not hydrogen bonded in the starting structures.

  7. The social well-being of nurses shows a thirst for a holistic support: A qualitative study

    Directory of Open Access Journals (Sweden)

    Naser Mozaffari

    2015-09-01

    Full Text Available Introduction: Social well-being is one of the important aspects of health. In fact, this is a reflection of experience in a social environment, indicating how social challenges are determined. In other words, social well-being is an explanation of people's perception and experience of being in a good situation, satisfaction with the structure, and social interaction. This qualitative study intended to explore nurses’ experience of social well-being. Methods: Qualitative content analysis was used to conduct the study. Through purposive sampling, a total of 18 nurses with various clinical experiences participated in semi-structured interviews. The data were analysed using the five-step, qualitative content analysis introduced by Graneheim and Lundman. Results: The main theme extracted from the data analysis was “thirst for a holistic support” in nurses. It consisted of two subthemes including internal support (family's support, colleague's support, and organizational support and external support (society's support and media's support. Conclusions and discussion: Nurses’ experiences in shaping their social well-being show that nurses need support in order to rebuild their social well-being. It is supported in partnership with the media, the community, health-related organizations, and by nurses and family. This improves job satisfaction, hope, motivation, commitment, and confidence so as to ultimately facilitate improvement of social well-being of nurses.

  8. The social well-being of nurses shows a thirst for a holistic support: A qualitative study.

    Science.gov (United States)

    Mozaffari, Naser; Peyrovi, Hamid; Nayeri, Nahid Dehghan

    2015-01-01

    Social well-being is one of the important aspects of health. In fact, this is a reflection of experience in a social environment, indicating how social challenges are determined. In other words, social well-being is an explanation of people's perception and experience of being in a good situation, satisfaction with the structure, and social interaction. This qualitative study intended to explore nurses' experience of social well-being. Qualitative content analysis was used to conduct the study. Through purposive sampling, a total of 18 nurses with various clinical experiences participated in semi-structured interviews. The data were analysed using the five-step, qualitative content analysis introduced by Graneheim and Lundman. The main theme extracted from the data analysis was "thirst for a holistic support" in nurses. It consisted of two subthemes including internal support (family's support, colleague's support, and organizational support) and external support (society's support and media's support). Nurses' experiences in shaping their social well-being show that nurses need support in order to rebuild their social well-being. It is supported in partnership with the media, the community, health-related organizations, and by nurses and family. This improves job satisfaction, hope, motivation, commitment, and confidence so as to ultimately facilitate improvement of social well-being of nurses.

  9. Cefepime shows good efficacy and no antibiotic resistance in pneumonia caused by Serratia marcescens and Proteus mirabilis - an observational study.

    Science.gov (United States)

    Yayan, Josef; Ghebremedhin, Beniam; Rasche, Kurt

    2016-03-23

    Many antibiotics have no effect on Gram-positive and Gram-negative microbes, which necessitates the prescription of broad-spectrum antimicrobial agents that can lead to increased risk of antibiotic resistance. These pathogens constitute a further threat because they are also resistant to numerous beta-lactam antibiotics, as well as other antibiotic groups. This study retrospectively investigates antimicrobial resistance in hospitalized patients suffering from pneumonia triggered by Gram-negative Serratia marcescens or Proteus mirabilis. The demographic and clinical data analyzed in this study were obtained from the clinical databank of the HELIOS Clinic, Witten/Herdecke University, Wuppertal, Germany, for inpatients presenting with pneumonia triggered by S. marcescens or P. mirabilis from 2004 to 2014. An antibiogram was conducted for the antibiotics utilized as part of the management of patients with pneumonia triggered by these two pathogens. Pneumonia was caused by Gram-negative bacteria in 115 patients during the study period from January 1, 2004, to August 12, 2014. Of these, 43 (37.4 %) hospitalized patients [26 males (60.5 %, 95 % CI 45.9 %-75.1 %) and 17 females (39.5 %, 95 % CI 24.9 %-54.1 %)] with mean age of 66.2 ± 13.4 years had pneumonia triggered by S. marcescens, while 20 (17.4 %) patients [14 males (70 %, 95 % CI 49.9 %-90.1 %) and 6 females (30 %, 95 % CI 9.9 %-50.1 %)] with a mean age of 64.6 ± 12.8 years had pneumonia caused by P. mirabilis. S. marcescens showed an increased antibiotic resistance to ampicillin (100 %), ampicillin-sulbactam (100 %), and cefuroxime (100 %). P. mirabilis had a high resistance to tetracycline (100 %) and ampicillin (55 %). S. marcescens (P resistance to cefepime in these patients with pneumonia. S. marcescens and P. mirabilis were resistant to several commonly used antimicrobial agents, but showed no resistance to cefepime.

  10. Contributions by the CAG-repeat Polymorphism of the Androgen Receptor Gene and Circulating Androgens to Muscle Size. Odense Androgen Study - A Population-based Study of 20-29 Year-old Danish Men

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian

    2007-01-01

    Context: The number of CAG-repeats within the CAG-repeat polymorphism of the androgen receptor gene is inversely correlated with the transcriptional activity of the androgen receptor. Objective: To study the effect of the CAG-repeat number and circulating androgens on muscle size, to examine the ...... muscle size increased exponentially with decreasing androgen levels and was tripled at total testosterone levels...... the CAG-repeat number in relation to body fat mass and circulating androgens, and to identify the best hormonal marker of low muscle size amongst total testosterone, bioavailable testosterone, and dihydrotestosterone. Design, Setting, and Participants: Population-based study of 783 Danish men aged 20...... continuous outcomes (thigh and axial muscle area, lower extremity, upper extremity, and trunk lean body mass, and total body fat mass) and five binary outcomes of low muscle size defined as men with muscle size below the lower 10 percentile of each continuous outcome of muscle size. Results: The CAG...

  11. A multi-centre cohort study shows no association between experienced violence and labour dystocia in nulliparous women at term

    Directory of Open Access Journals (Sweden)

    Dykes Anna-Karin

    2011-02-01

    Full Text Available Abstract Background Although both labour dystocia and domestic violence during pregnancy are associated with adverse maternal and fetal outcome, evidence in support of a possible association between experiences of domestic violence and labour dystocia is sparse. The aim of this study was to investigate whether self-reported history of violence or experienced violence during pregnancy is associated with increased risk of labour dystocia in nulliparous women at term. Methods A population-based multi-centre cohort study. A self-administrated questionnaire collected at 37 weeks of gestation from nine obstetric departments in Denmark. The total cohort comprised 2652 nulliparous women, among whom 985 (37.1% met the protocol criteria for dystocia. Results Among the total cohort, 940 (35.4% women reported experience of violence, and among these, 66 (2.5% women reported exposure to violence during their first pregnancy. Further, 39.5% (n = 26 of those had never been exposed to violence before. Univariate logistic regression analysis showed no association between history of violence or experienced violence during pregnancy and labour dystocia at term, crude OR 0.91, 95% CI (0.77-1.08, OR 0.90, 95% CI (0.54-1.50, respectively. However, violence exposed women consuming alcoholic beverages during late pregnancy had increased odds of labour dystocia, crude OR 1.45, 95% CI (1.07-1.96. Conclusions Our findings indicate that nulliparous women who have a history of violence or experienced violence during pregnancy do not appear to have a higher risk of labour dystocia at term, according to the definition of labour dystocia in this study. Additional research on this topic would be beneficial, including further evaluation of the criteria for labour dystocia.

  12. Clinical and Biomarker Changes in Premanifest Huntington Disease Show Trial Feasibility: A Decade of the PREDICT-HD Study

    Science.gov (United States)

    Paulsen, Jane S.; Long, Jeffrey D.; Johnson, Hans J.; Aylward, Elizabeth H.; Ross, Christopher A.; Williams, Janet K.; Nance, Martha A.; Erwin, Cheryl J.; Westervelt, Holly J.; Harrington, Deborah L.; Bockholt, H. Jeremy; Zhang, Ying; McCusker, Elizabeth A.; Chiu, Edmond M.; Panegyres, Peter K.

    2014-01-01

    There is growing consensus that intervention and treatment of Huntington disease (HD) should occur at the earliest stage possible. Various early-intervention methods for this fatal neurodegenerative disease have been identified, but preventive clinical trials for HD are limited by a lack of knowledge of the natural history of the disease and a dearth of appropriate outcome measures. Objectives of the current study are to document the natural history of premanifest HD progression in the largest cohort ever studied and to develop a battery of imaging and clinical markers of premanifest HD progression that can be used as outcome measures in preventive clinical trials. Neurobiological predictors of Huntington’s disease is a 32-site, international, observational study of premanifest HD, with annual examination of 1013 participants with premanifest HD and 301 gene-expansion negative controls between 2001 and 2012. Findings document 39 variables representing imaging, motor, cognitive, functional, and psychiatric domains, showing different rates of decline between premanifest HD and controls. Required sample size and models of premanifest HD are presented to inform future design of clinical and preclinical research. Preventive clinical trials in premanifest HD with participants who have a medium or high probability of motor onset are calculated to be as resource-effective as those conducted in diagnosed HD and could interrupt disease 7–12 years earlier. Methods and measures for preventive clinical trials in premanifest HD more than a dozen years from motor onset are also feasible. These findings represent the most thorough documentation of a clinical battery for experimental therapeutics in stages of premanifest HD, the time period for which effective intervention may provide the most positive possible outcome for patients and their families affected by this devastating disease. PMID:24795630

  13. Spectroscopic study of Zn{sub 1−x}Co{sub x}O thin films showing intrinsic ferromagnetism

    Energy Technology Data Exchange (ETDEWEB)

    Gautam, S.; Thakur, P. [Advanced Analysis Center, Korea Institute of Science and Technology (KIST), Seoul 136-791 (Korea, Republic of); Bazylewski, P.; Bauer, R. [Department of Physics and Engineering Physics, University of Saskatchewan, Saskatoon, SK, S7N 5E2 Canada (Canada); Singh, A.P.; Kim, J.Y. [Pohang Accelerator Laboratory, Pohang University of Science and Technology, Pohang 790-784 (Korea, Republic of); Subramanian, M.; Jayavel, R. [Crystal Growth Centre, Anna University, Chennai 600 025 (India); Asokan, K. [Inter-University Accelerator Centre, JNU Campus, New Delhi 110 067 (India); Chae, K.H., E-mail: khchae@kist.re.kr [Advanced Analysis Center, Korea Institute of Science and Technology (KIST), Seoul 136-791 (Korea, Republic of); Chang, G.S., E-mail: gapsoo.chang@usask.ca [Department of Physics and Engineering Physics, University of Saskatchewan, Saskatoon, SK, S7N 5E2 Canada (Canada)

    2013-06-15

    Dilute magnetic semiconductors are widely studied due to their potential applications in spin-resolved electronics. We report the direct evidences of intrinsic ferromagnetism in the primarily ferromagnetic ZnO:Co thin films using near-edge X-ray absorption fine structure (NEXAFS) and soft X-ray magnetic circular dichroism (XMCD). The single phase Zn{sub 1−x}Co{sub x}O thin films with nominal compositions (0.00 ≤ x ≤ 0.15) were synthesized by a spray pyrolysis technique, which exhibit room temperature ferromagnetism as revealed by alternating gradient force magnetometer (AGFM) measurements. The spectroscopic measurements indicate that most of Co dopants have substituted for Zn sites in ZnO matrix and they are present in divalent Co{sup 2+} (d{sup 7}) state with tetrahedral symmetry according to the atomic multiplet calculations. The O 1s NEXAFS spectra suggest strong hybridization between O 2p and Co 3d electrons within ZnO matrix. The Co 2p XMCD measurements rule out the magnetism due to the presence of Co clusters, and show that Co–O–Co bonding provides localized magnetic moments leading to ferromagnetism. - Highlights: • We have studied the electronic and magnetic properties of ZnO:Co thin films. • The study uses X-ray absorption and magnetic circular dichroism spectroscopies. • Co dopants substitute for Zn sites in ZnO matrix and are divalent Co{sup 2+}. • Measurements indicate Co clusters are not formed. • Co–O–Co bonding provide localized magnetic moments leading to ferromagnetism.

  14. Clinical and biomarker changes in premanifest Huntington disease show trial feasibility: a decade of the PREDICT-HD study

    Directory of Open Access Journals (Sweden)

    Jane S Paulsen

    2014-04-01

    Full Text Available There is growing consensus that intervention and treatment of Huntington disease (HD should occur at the earliest stage possible. Various early-intervention methods for this fatal neurodegenerative disease have been identified, but preventive clinical trials for HD are limited by a lack of knowledge of the natural history of the disease and a dearth of appropriate outcome measures. Objectives of the current study are to document the natural history of premanifest HD progression in the largest cohort ever studied and to develop a battery of imaging and clinical markers of premanifest HD progression that can be used as outcome measures in preventive clinical trials. PREDICT-HD is a 32-site, international, observational study of premanifest HD, with annual examination of 1013 participants with premanifest HD and 301 gene-expansion negative controls between 2001 and 2012. Findings document 39 variables representing imaging, motor, cognitive, functional, and psychiatric domains, showing different rates of decline between premanifest Huntington disease and controls. Required sample size and models of premanifest HD are presented to inform future design of clinical and preclinical research. Preventive clinical trials in premanifest HD with participants who have a medium or high probability of motor onset are calculated to be as resource-effective as those conducted in diagnosed HD and could interrupt disease seven to twelve years earlier. Methods and measures for preventive clinical trials in premanifest HD more than a dozen years from motor onset are also feasible. These findings represent the most thorough documentation of a clinical battery for experimental therapeutics in stages of premanifest HD, the time period for which effective intervention may provide the most positive possible outcome for patients and their families affected by this devastating disease.

  15. Association of STin2 Variable Number of Tandem Repeat (VNTR) Polymorphism of Serotonin Transporter Gene with Lifelong Premature Ejaculation: A Case-Control Study in Han Chinese Subjects

    Science.gov (United States)

    Huang, Yuanyuan; Zhang, Xiansheng; Gao, Jingjing; Tang, Dongdong; Gao, Pan; Peng, Dangwei; Liang, Chaozhao

    2016-01-01

    Background The STin2 VNTR polymorphism has a variable number of tandem repeats in intron 2 of the serotonin transporter gene. We aimed to explore the relationship between STin2 VNTR polymorphism and lifelong premature ejaculation (LPE). Material/Methods We recruited a total of 115 outpatients who complained of ejaculating prematurely and who were diagnosed as LPE, and 101 controls without PE complaint. Allelic variations of STin2 VNTR were genotyped using PCR-based technology. We evaluated the associations between STin2 VNTR allelic and genotypic frequencies and LPE, as well as the intravaginal ejaculation latency time (IELT) of different STin2 VNTR genotypes among LPE patients. Results The patients and controls did not differ significantly in terms of any characteristic except age. A significantly higher frequency of STin2.12/12 genotype was found among LPE patients versus controls (P=0.026). Frequency of patients carrying at least 1 copy of the 10-repeat allele was significantly lower compared to the control group (28.3% vs. 41.8%, OR=0.55; 95%CI=0.31–0.97, P=0.040). In the LPE group, the mean IELT showed significant difference in STin2.12/12 genotype when compared to those with STin2.12/10 and STin2.10/10 genotypes. The mean IELT in10-repeat allele carriers was 50% longer compared to homozygous carriers of the STin2.12 allele. Conclusions Our results indicate the presence of STin2.10 allele is a protective factor for LPE. Men carrying the higher expression genotype STin2. 12/12 have shorter IELT than 10-repeat allele carriers. PMID:27713390

  16. History repeats itself: genomic divergence in copepods.

    Science.gov (United States)

    Renaut, Sébastien; Dion-Côté, Anne-Marie

    2016-04-01

    Press stop, erase everything from now till some arbitrary time in the past and start recording life as it evolves once again. Would you see the same tape of life playing itself over and over, or would a different story unfold every time? The late Steven Jay Gould called this experiment replaying the tape of life and argued that any replay of the tape would lead evolution down a pathway radically different from the road actually taken (Gould 1989). This thought experiment has puzzled evolutionary biologists for a long time: how repeatable are evolutionary events? And if history does indeed repeat itself, what are the factors that may help us predict the path taken? A powerful means to address these questions at a small evolutionary scale is to study closely related populations that have evolved independently, under similar environmental conditions. This is precisely what Pereira et al. (2016) set out to do using marine copepods Tigriopus californicus, and present their results in this issue of Molecular Ecology. They show that evolution can be repeatable and even partly predictable, at least at the molecular level. As expected from theory, patterns of divergence were shaped by natural selection. At the same time, strong genetic drift due to small population sizes also constrained evolution down a similar evolutionary road, and probably contributed to repeatable patterns of genomic divergence.

  17. A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene.

    Science.gov (United States)

    Leonova, J; Hanson, C

    1999-01-01

    This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.

  18. Experimental and molecular dynamics studies showed that CBP KIX mutation affects the stability of CBP:c-Myb complex.

    Science.gov (United States)

    Odoux, Anne; Jindal, Darren; Tamas, Tamara C; Lim, Benjamin W H; Pollard, Drake; Xu, Wu

    2016-06-01

    The coactivators CBP (CREBBP) and its paralog p300 (EP300), two conserved multi-domain proteins in eukaryotic organisms, regulate gene expression in part by binding DNA-binding transcription factors. It was previously reported that the CBP/p300 KIX domain mutant (Y650A, A654Q, and Y658A) altered both c-Myb-dependent gene activation and repression, and that mice with these three point mutations had reduced numbers of platelets, B cells, T cells, and red blood cells. Here, our transient transfection assays demonstrated that mouse embryonic fibroblast cells containing the same mutations in the KIX domain and without a wild-type allele of either CBP or p300, showed decreased c-Myb-mediated transcription. Dr. Wright's group solved a 3-D structure of the mouse CBP:c-Myb complex using NMR. To take advantage of the experimental structure and function data and improved theoretical calculation methods, we performed MD simulations of CBP KIX, CBP KIX with the mutations, and c-Myb, as well as binding energy analysis for both the wild-type and mutant complexes. The binding between CBP and c-Myb is mainly mediated by a shallow hydrophobic groove in the center where the side-chain of Leu302 of c-Myb plays an essential role and two salt bridges at the two ends. We found that the KIX mutations slightly decreased stability of the CBP:c-Myb complex as demonstrated by higher binding energy calculated using either MM/PBSA or MM/GBSA methods. More specifically, the KIX mutations affected the two salt bridges between CBP and c-Myb (CBP-R646 and c-Myb-E306; CBP-E665 and c-Myb-R294). Our studies also revealed differing dynamics of the hydrogen bonds between CBP-R646 and c-Myb-E306 and between CBP-E665 and c-Myb-R294 caused by the CBP KIX mutations. In the wild-type CBP:c-Myb complex, both of the hydrogen bonds stayed relatively stable. In contrast, in the mutant CBP:c-Myb complex, hydrogen bonds between R646 and E306 showed an increasing trend followed by a decreasing trend, and hydrogen

  19. Structural studies show energy transfer within stabilized phycobilisomes independent of the mode of rod-core assembly.

    Science.gov (United States)

    David, Liron; Prado, Mindy; Arteni, Ana A; Elmlund, Dominika A; Blankenship, Robert E; Adir, Noam

    2014-03-01

    The major light harvesting complex in cyanobacteria and red algae is the phycobilisome (PBS), comprised of hundreds of seemingly similar chromophores, which are protein bound and assembled in a fashion that enables highly efficient uni-directional energy transfer to reaction centers. The PBS is comprised of a core containing 2-5 cylinders surrounded by 6-8 rods, and a number of models have been proposed describing the PBS structure. One of the most critical steps in the functionality of the PBS is energy transfer from the rod substructures to the core substructure. In this study we compare the structural and functional characteristics of high-phosphate stabilized PBS (the standard fashion of stabilization of isolated complexes) with cross-linked PBS in low ionic strength buffer from two cyanobacterial species, Thermosynechococcus vulcanus and Acaryochloris marina. We show that chemical cross-linking preserves efficient energy transfer from the phycocyanin containing rods to the allophycocyanin containing cores with fluorescent emission from the terminal emitters. However, this energy transfer is shown to exist in PBS complexes of different structures as characterized by determination of a 2.4Å structure by X-ray crystallography, single crystal confocal microscopy, mass spectrometry and transmission electron microscopy of negatively stained and cryogenically preserved complexes. We conclude that the PBS has intrinsic structural properties that enable efficient energy transfer from rod substructures to the core substructures without requiring a single unique structure. We discuss the significance of our observations on the functionality of the PBS in vivo.

  20. Mining of simple sequence repeats in the Genome of Gentianaceae

    Directory of Open Access Journals (Sweden)

    R Sathishkumar

    2011-01-01

    Full Text Available Simple sequence repeats (SSRs or short tandem repeats are short repeat motifs that show high level of length polymorphism due to insertion or deletion mutations of one or more repeat types. Here, we present the detection and abundance of microsatellites or SSRs in nucleotide sequences of Gentianaceae family. A total of 545 SSRs were mined in 4698 nucleotide sequences downloaded from the National Center for Biotechnology Information (NCBI. Among the SSR sequences, the frequency of repeat type was about 429 -mono repeats, 99 -di repeats, 15 -tri repeats, and 2 --hexa repeats. Mononucleotide repeats were found to be abundant repeat types, about 78%, followed by dinucleotide repeats (18.16% among the SSR sequences. An attempt was made to design primer pairs for 545 identified SSRs but these were found only for 169 sequences.

  1. Repeated measurement sampling in genetic association analysis with genotyping errors.

    Science.gov (United States)

    Lai, Renzhen; Zhang, Hong; Yang, Yaning

    2007-02-01

    Genotype misclassification occurs frequently in human genetic association studies. When cases and controls are subject to the same misclassification model, Pearson's chi-square test has the correct type I error but may lose power. Most current methods adjusting for genotyping errors assume that the misclassification model is known a priori or can be assessed by a gold standard instrument. But in practical applications, the misclassification probabilities may not be completely known or the gold standard method can be too costly to be available. The repeated measurement design provides an alternative approach for identifying misclassification probabilities. With this design, a proportion of the subjects are measured repeatedly (five or more repeats) for the genotypes when the error model is completely unknown. We investigate the applications of the repeated measurement method in genetic association analysis. Cost-effectiveness study shows that if the phenotyping-to-genotyping cost ratio or the misclassification rates are relatively large, the repeat sampling can gain power over the regular case-control design. We also show that the power gain is not sensitive to the genetic model, genetic relative risk and the population high-risk allele frequency, all of which are typically important ingredients in association studies. An important implication of this result is that whatever the genetic factors are, the repeated measurement method can be applied if the genotyping errors must be accounted for or the phenotyping cost is high.

  2. A comparative evaluation of tray spacer thickness and repeat pour on the accuracy of monophasic polyvinyl siloxane impression material: In vitro study

    Directory of Open Access Journals (Sweden)

    Sandeep Kumar

    2014-01-01

    Full Text Available Purpose: This study was aimed to determine the effect of various tray spacer thickness and subsequent repeated pours on the accuracy and dimensional stability of the impression made from monophasic polyvinyl siloxane material. Materials and Methods: Custom trays with different spacer thickness (2, 4 and 6 mm were used for making an impression of a master model simulating 3 unit fixed partial denture with monophasic polyvinyl siloxane material. These impressions were poured with die stone and repoured. Distance between the reference points were measured and subjected to statistical analysis. Result: Casts obtained from 1 st , 2 nd and 3 rd pour of the impression in 2, 4 and 6 mm spacer thickness tray have similar dimensional accuracy amongst each other and with the master model except in molar diameter and inter-abutment distances of cast obtained from 6 mm spacer thickness tray. Conclusion: The vertical distance of stone dies were decreased, whereas horizontal distance increased as the thickness of impression material is increased. There were statistically non-significant changes occurring among the repeated pours in 2, 4 and 6 mm spacer thickness. Clinical Implication: 2 and 4 mm spacer thickness are acceptable for making an impression for three unit fixed partial denture with monophasic polyvinyl siloxane material and it was not affected by two subsequent (1 st and 2 nd repeated pours.

  3. Vaginal birth after cesarean section (VBAC versus emergency repeat cesarean section at teaching hospitals in India: an ICMR task force study

    Directory of Open Access Journals (Sweden)

    B. S. Dhillon

    2014-06-01

    Results: A total of 155863 deliveries occurred during the study duration, there were 28.1% (n=43824 cesarean section and (10.1% (n=15664 were the number of previous cesarean section. In 84% (n=13151 had repeat cesarean delivery and 2513 (16% delivered vaginally. A trial of labor was planned in 4035 (25.8% women. The success rate of VBAC was 62.3% with 2513 women had successful vaginal delivery and 1522 (37.7% delivered by emergency repeat cesarean section. Major indication of emergency cesarean section was CPD (52.9%, foetal distress (25.8%, severe PIH/eclampsia (5.0%, previous 2 CS (0.7%, APH (1.4% and others (2.7%. In majority, surgical technique was conventional and in 3.7% the Misgav-Ladach technique was used. Scar dehiscence and surgical complications were observed in 5.4% and 4.0% of cases respectively. Blood transfusion was given in 7.0% and post-operative complications were seen in 6.8%. Perinatal and maternal mortality was 18.0/1000 and 257/100000 deliveries respectively. Conclusions: Safety in childbirth for women with prior cesarean is a major public health concern. Repeat caesarean section and planned vaginal birth after cesarean section are both associated with benefits and harms and correct management represents one of the most significant and challenging issues in obstetric practice. [Int J Reprod Contracept Obstet Gynecol 2014; 3(3.000: 592-597

  4. Microbiological Evaluation of Household Drinking Water Treatment in Rural China Shows Benefits of Electric Kettles: A Cross-Sectional Study.

    Directory of Open Access Journals (Sweden)

    Alasdair Cohen

    Full Text Available In rural China ~607 million people drink boiled water, yet little is known about prevailing household water treatment (HWT methods or their effectiveness. Boiling, the most common HWT method globally, is microbiologically effective, but household air pollution (HAP from burning solid fuels causes cardiovascular and respiratory disease, and black carbon emissions exacerbate climate change. Boiled water is also easily re-contaminated. Our study was designed to identify the HWT methods used in rural China and to evaluate their effectiveness.We used a geographically stratified cross-sectional design in rural Guangxi Province to collect survey data from 450 households in the summer of 2013. Household drinking water samples were collected and assayed for Thermotolerant Coliforms (TTC, and physicochemical analyses were conducted for village drinking water sources. In the winter of 2013-2104, we surveyed 120 additional households and used remote sensors to corroborate self-reported boiling data.Our HWT prevalence estimates were: 27.1% boiling with electric kettles, 20.3% boiling with pots, 34.4% purchasing bottled water, and 18.2% drinking untreated water (for these analyses we treated bottled water as a HWT method. Households using electric kettles had the lowest concentrations of TTC (73% lower than households drinking untreated water. Multilevel mixed-effects regression analyses showed that electric kettles were associated with the largest Log10TTC reduction (-0.60, p<0.001, followed by bottled water (-0.45, p<0.001 and pots (-0.44, p<0.01. Compared to households drinking untreated water, electric kettle users also had the lowest risk of having TTC detected in their drinking water (risk ratio, RR = 0.49, 0.34-0.70, p<0.001, followed by bottled water users (RR = 0.70, 0.53-0.93, p<0.05 and households boiling with pots (RR = 0.74, 0.54-1.02, p = 0.06.As far as we are aware, this is the first HWT-focused study in China, and the first to quantify the

  5. Repeated dose 28-days oral toxicity study of Carica papaya L. leaf extract in Sprague Dawley rats.

    Science.gov (United States)

    Afzan, Adlin; Abdullah, Noor Rain; Halim, Siti Zaleha; Rashid, Badrul Amini; Semail, Raja Hazlini Raja; Abdullah, Noordini; Jantan, Ibrahim; Muhammad, Hussin; Ismail, Zakiah

    2012-04-10

    Carica papaya L. leaves have been used in ethnomedicine for the treatment of fevers and cancers. Despite its benefits, very few studies on their potential toxicity have been described. The aim of the present study was to characterize the chemical composition of the leaf extract from 'Sekaki' C. papaya cultivar by UPLC-TripleTOF-ESI-MS and to investigate the sub-acute oral toxicity in Sprague Dawley rats at doses of 0.01, 0.14 and 2 g/kg by examining the general behavior, clinical signs, hematological parameters, serum biochemistry and histopathology changes. A total of twelve compounds consisting of one piperidine alkaloid, two organic acids, six malic acid derivatives, and four flavonol glycosides were characterized or tentatively identified in the C. papaya leaf extract. In the sub-acute study, the C. papaya extract did not cause mortality nor were treatment-related changes in body weight, food intake, water level, and hematological parameters observed between treatment and control groups. Some biochemical parameters such as the total protein, HDL-cholesterol, AST, ALT and ALP were elevated in a non-dose dependent manner. Histopathological examination of all organs including liver did not reveal morphological alteration. Other parameters showed non-significant differences between treatment and control groups. The present results suggest that C. papaya leaf extract at a dose up to fourteen times the levels employed in practical use in traditional medicine in Malaysia could be considered safe as a medicinal agent.

  6. Repeating earthquakes recorded by Liaoning Regional Seismograph Network

    Institute of Scientific and Technical Information of China (English)

    LI Yu-tong; WU Zhong-liang; JIANG Chang-sheng; LI Guang-ping

    2008-01-01

    In the list of 'repeating pairs' or 'doublets' of earthquakes in China identified by Schaff and Richards using tele-seismic waveform cross-correlation, there were 23 repeating pairs located in Liaoning Province. In this study the waveforms of these events were cross-correlated using records from Liaoning Regional Seismograph Network (LRSN), and the 'repeating events' in the sense of regional waveform cross-correlation were obtained. The result was compared with that of Schaff and Richards and was used for the assessment of the seismic phase picking and event location practice of LRSN. The result shows that 'repeating events' in the sense of teleseismic waveform cross-correlation and those in the sense of regional waveform cross-correlation have significant difference, al-though with some overlap. However, the overall assessment of the location accuracy and the phase pick errors of LRSN by using these two sets of 'repeating events', respectively, provides similar results, while 'repeating events' in the sense of regional waveform cross-correlation seem to be better performing in such an assessment. With the assumption that the separation between the 'repeaters' be less than 1 km, the uncertainty in routine earthquake location of LRSN is estimated to be below 5 km, with the average of 2 km. In the observational bulletins of LRSN the time error in phase picking is estimated to be within±Is for 94% Pg readings and for 88% Sg readings.

  7. Positive affective interactions: The role of repeated exposure and copresence

    NARCIS (Netherlands)

    Shahid, S.; Krahmer, E.; Neerincx, M.; Swerts, M.

    2013-01-01

    We describe and evaluate a new interface to induce positive emotions in users: a digital, interactive adaptive mirror. We study whether the induced affect is repeatable after a fixed interval (Study 1) and how copresence influences the emotion induction (Study 2). Results show that participants syst

  8. Ambient particulate air pollution and circulating antioxidant enzymes: A repeated-measure study in healthy adults in Beijing, China.

    Science.gov (United States)

    Wu, Shaowei; Wang, Bin; Yang, Di; Wei, Hongying; Li, Hongyu; Pan, Lu; Huang, Jing; Wang, Xin; Qin, Yu; Zheng, Chanjuan; Shima, Masayuki; Deng, Furong; Guo, Xinbiao

    2016-01-01

    The association of systemic antioxidant activity with ambient air pollution has been unclear. A panel of 40 healthy college students underwent repeated blood collection for 12 occasions under three exposure scenarios before and after relocating from a suburban area to an urban area in Beijing, China in 2010-2011. We measured various air pollutants including fine particles (PM2.5) and determined circulating levels of antioxidant enzymes extracellular superoxide dismutase (EC-SOD) and glutathione peroxidase 1 (GPX1) in the laboratory. An interquartile range increase of 63.4 μg/m(3) at 3-d PM2.5 moving average was associated with a 6.3% (95% CI: 0.6, 12.4) increase in EC-SOD and a 5.5% (95% CI: 1.3, 9.8) increase in GPX1. Several PM2.5 chemical constituents, including negative ions (nitrate and chloride) and metals (e.g., iron and strontium), were consistently associated with increases in EC-SOD and GPX1. Our results support activation of circulating antioxidant enzymes following exposure to particulate air pollution. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. A Study on the Efficiency Improvement of Dye-Sensitized Solar Cell (DSSC) by Repeated Dye Coating.

    Science.gov (United States)

    Seo, Young Ho; Choi, Eun Chang; Hong, Byungyou

    2015-10-01

    Dye-sensitized solar cell (DSSC) is being extensively investigated as the next generation energy source. Despite of the attractive features like simple fabrication process and its economic efficiency, there are some problems such as low efficiency, long fabrication time and low long-term stability. Conventionally, the dye adsorption on TiO2 photo-electrode film needs long time in the solvent with low concentration of dye to get the high efficiency. In this work, the dye coating process was considerably shortened, albeit plenty of dye was used comparing with the conventional way. Our needs were met for the best result in our working environment and the relevant conditions to our work were obtained, which were the coating temperature of 70 °C, the dye concentration of 10 mM and the coating time of 3 min. And this coating process was successively repeated several times to maximize the dye adsorption and to improve the cell efficiency. Therefore, the efficiency increased by 13% in the proper condition.

  10. Entertainment Bias: A Case Study of the Tonight Show and the California Gubernatorial Recall Election in 2003

    OpenAIRE

    Hite, Katherine Blake

    2005-01-01

    This thesis looks at entertainment bias, specifically bias on the Tonight Show with Jay Leno towards Arnold Schwarzenegger during the time leading up to the California recall election in 2003. Entertainment media possess a unique ability to communicate messages to an unguarded audience, which gives them the potential to have more of a political impact than traditional news media. The basic theory is that Jay Leno showed political bias in his monologues towards his friend and gubernatorial c...

  11. Diagnostic accuracy studies of fine-needle aspiration show wide variation in reporting of study population characteristics: implications for external validity.

    Science.gov (United States)

    Schmidt, Robert L; Narra, Krishna K; Witt, Benjamin L; Factor, Rachel E

    2014-01-01

    Study comparisons rest on the assessment of applicability or external validity. Population characteristics are an important component of external validity and, although there has been a heightened awareness of deficiencies in reporting in diagnostic test accuracy (DTA) studies, the reporting of populations in DTA studies has not been investigated. To assess the quality of reporting of population descriptions in DTA studies for fine-needle aspiration cytology (FNAC). Literature survey of common population parameters and usage patterns in FNAC DTA studies. We randomly selected 20 FNAC DTA studies in 4 categories (salivary glands, lung, thyroid, and pancreas) and determined the frequency of parameter usage. Studies showed considerable variability in reporting patterns. On average, studies reported 2 to 4 parameters to describe study populations. Age, sex, and lesion size were most frequently reported. Sixteen percent of studies did not provide any population description. Population parameters were used to describe the sample population more frequently than to describe the selection process (P = .001). There were significant differences in the number of parameters specified by anatomic site (P = .001). Only 21% of studies provided a flow diagram. Thirty-three percent of studies mentioned the target population. Studies show considerable variability in the description of sample populations and the population selection process. Studies often fail to provide flow diagrams or to provide a clear statement of the research problem. There is considerable opportunity for studies to improve both descriptions of sample populations and the process used to select them.

  12. TU-C-12A-05: Repeatability Study of Reduced Field-Of-View Diffusion-Weighted MRI On Human Thyroid Gland

    Energy Technology Data Exchange (ETDEWEB)

    Shukla-Dave, A; Lu, Y; Hatzoglou, V; Stambuk, H; Mazaheri, Y [Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Banerjee, S; Shankaranarayanan, A [GE Healthcare, Menlo Park, California (United States); Deasy, J [Memorial Sloan Kettering Cancer Center, New York, NY (United States)

    2014-06-15

    Purpose: To investigate the repeatability of reduced field-of-view diffusion-weighted imaging (rFOV DWI) in quantifying apparent diffusion coefficients (ADCs) for human thyroid glands in a clinical setting. Methods: Nine healthy human volunteers were enrolled and underwent 3T MRI exams. For each volunteer, 3 longitudinal exams (2 weeks apart) with 2 repetitive sessions within each exam, including rFOV and conventional full field-of-view (fFOV) DWI scans, were performed. In the acquired DWI images, a fixed-size region of interest (ROI; diameter=8mm) was placed on thyroid glands to calculate ADC. ADC was calculated using a monoexponential function with a noise correction scheme. The repeatability of ADC was assessed by using coefficient variation (CV) across sessions or exams, which was defined to be: r = 1-CV, 0 < r < 1, where CV=STD/m, STD is the standard deviation of ADC, and m is the average of ADC across sessions or exams. An experienced radiologist assessed and scored rFOV and fFOV DW images based on image characteristics (1, nondiagnostic; 2, poor; 3, satisfactory; 4, good; and 5, excellent).Analysis of variance (ANOVA) was performed to compare ADC values, CV of ADC, repeatability of ADC across sessions and exams, and radiologic scores between rFOV and fFOV DWI techniques. Results: There was no significant difference in ADC values across sessions and exams either in rFOV or fFOV DWI. The average CVs of both rFOV and fFOV DWI were less than 13%. The repeatability of ADC measurement between rFOV and fFOV DWI was not significantly different. The overall image quality was significantly higher with rFOV DWI than with fFOV DWI. Conclusion: This study suggested that ADCs from both rFOV and fFOV DWI were repeatable, but rFOV DWI had superior imaging quality for human thyroid glands in a clinical setting.

  13. NIH-funded study shows increased prostate cancer risk from vitamin E supplements | Division of Cancer Prevention

    Science.gov (United States)

    Men who took 400 international units (I.U.) of vitamin E daily had more prostate cancers compared to men who took a placebo, according to an updated review of data from the Selenium and Vitamin E Cancer Prevention Trial (SELECT). The findings showed that, per 1,000 men, there were 76 prostate cancers in men who took only vitamin E supplements, vs. |

  14. Violence towards health care workers in a Public Health Care Facility in Italy: a repeated cross-sectional study

    Directory of Open Access Journals (Sweden)

    Magnavita Nicola

    2012-05-01

    Full Text Available Abstract Background Violence at work is one of the major concerns in health care activities. The aim of this study was to identify the prevalence of physical and non-physical violence in a general health care facility in Italy and to assess the relationship between violence and psychosocial factors, thereby providing a basis for appropriate intervention. Methods All health care workers from a public health care facility were invited to complete a questionnaire containing questions on workplace violence. Three questionnaire-based cross-sectional surveys were conducted. The response rate was 75 % in 2005, 71 % in 2007, and 94 % in 2009. The 2009 questionnaire contained the VIF (Violent Incident Form for reporting violent incidents, the DCS (demand/control/support model for job strain, the Colquitt 20 item questionnaire for perceived organizational justice, and the GHQ-12 General Health Questionnaire for the assessment of mental health. Results One out of ten workers reported physical assault, and one out of three exposure to non-physical violence in the workplace in the previous year. Nurses and physicians were the most exposed occupational categories, whereas the psychiatric and emergency departments were the services at greatest risk of violence. Workers exposed to non-physical violence were subject to high job strain, low support, low perceived organizational justice, and high psychological distress. Conclusion Our study shows that health care workers in an Italian local health care facility are exposed to violence. Workplace violence was associated with high demand and psychological disorders, while job control, social support and organizational justice were protective factors.

  15. Between two roles - Experiences of newly trained nurse practitioners in surgical care in Sweden: A qualitative study using repeated interviews.

    Science.gov (United States)

    Jangland, Eva; Yngman Uhlin, Pia; Arakelian, Erebouni

    2016-11-01

    The position of Nurse Practitioner is a new role in Nordic countries. The transition from a registered nurse to the Nurse Practitioner role has been reported to be a personal challenge. This study, guided by the Nordic theoretical model for use in the education of advanced practice nurses, represents a unique opportunity to describe this transition for newly graduated Nurse Practitioners in an interprofessional surgical care team in Sweden. The aim was to explore how the first Nurse Practitioners in surgical care experienced the transition into a new role and what competences they used in the team. Eight new Nurse Practitioners with parallel work in clinical practice were interviewed twice around the time of their graduation. The qualitative analyses show that the participants integrated several central competences, but the focus in this early stage in their new role was on direct clinical praxis, consultation, cooperation, case management, and coaching. Transition from the role of clinical nurse specialist to nurse practitioner was a challenging process in which the positive response from patients was a driving force for the new Nurse Practitioners. The participants felt prepared for and determined to solve the challenging situations they approached working in the interprofessional team.

  16. (1)H NMR-based metabolomics study on repeat dose toxicity of fine particulate matter in rats after intratracheal instillation.

    Science.gov (United States)

    Zhang, Yannan; Hu, Hejing; Shi, Yanfeng; Yang, Xiaozhe; Cao, Lige; Wu, Jing; Asweto, Collins Otieno; Feng, Lin; Duan, Junchao; Sun, Zhiwei

    2017-07-01

    Systemic metabolic effects and toxicity mechanisms of ambient fine particulate matter (PM2.5) remain uncertain. In order to investigate the mechanisms in PM2.5 toxicity, we explored the endogenous metabolic changes and possible influenced metabolic pathways in rats after intratracheal instillation of PM2.5 by using a (1)H nuclear magnetic resonance (NMR)-based metabolomics approach. Liver and kidney histopathology examinations were also performed. Chemical characterization demonstrated that PM2.5 was a complex mixture of elements. Histopathology showed cellular edema in liver and glomerulus atrophy of the PM2.5 treated rats. We systematically analyzed the metabolites changes of serum and urine in rats using (1)H NMR techniques in combination with multivariate statistical analysis. Significantly reduced levels of lactate, alanine, dimethylglycine, creatine, glycine and histidine in serum, together with increased levels of citrate, arginine, hippurate, allantoin and decreased levels of allthreonine, lactate, alanine, acetate, succinate, trimethylamine, formate in urine were observed of PM2.5 treated rats. The mainly affected metabolic pathways by PM2.5 were glycine, serine and threonine metabolism, glyoxylate and dicarboxylate metabolism, citrate cycle (TCA cycle), nitrogen metabolism and methane metabolism. Our study provided important information on assessing the toxicity of PM2.5 and demonstrated that metabolomics approach can be employed as a tool to understand the toxicity mechanism of complicated environmental pollutants. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Identification of two organic bands showing different chemical composition within the skeleton of Porites lutea: a confocal Raman microscopy study

    Science.gov (United States)

    Wall, M.; Nehrke, G.

    2012-07-01

    Confocal Raman microscopy mapping was used to investigate the organic matrix distribution within the skeleton of the coral Porites lutea. Two types of growth lines could be identified: one corresponds to the well-known incremental growth layers, whereas the second type of growth lines showed an elemental composition that differed from the incremental growth layers. The position and shape of the latter growth lines resemble either denticle finger-like structures (most likely traces of former spines) or former skeletal surfaces. We hypothesize that these lines are involved in the three-dimensional arrangement of skeletal elements and represent the outer skeletal surface before another growth cycle of elongation, infilling and thickening of skeletal components continues. We show that high spatial resolution mapping can significantly improve our understanding of skeletal growth patterns in coral skeletons.

  18. Recursive quantum repeater networks

    CERN Document Server

    Van Meter, Rodney; Horsman, Clare

    2011-01-01

    Internet-scale quantum repeater networks will be heterogeneous in physical technology, repeater functionality, and management. The classical control necessary to use the network will therefore face similar issues as Internet data transmission. Many scalability and management problems that arose during the development of the Internet might have been solved in a more uniform fashion, improving flexibility and reducing redundant engineering effort. Quantum repeater network development is currently at the stage where we risk similar duplication when separate systems are combined. We propose a unifying framework that can be used with all existing repeater designs. We introduce the notion of a Quantum Recursive Network Architecture, developed from the emerging classical concept of 'recursive networks', extending recursive mechanisms from a focus on data forwarding to a more general distributed computing request framework. Recursion abstracts independent transit networks as single relay nodes, unifies software layer...

  19. Commonly studied polymorphisms in inflammatory cytokine genes show only minor effects on mortality and related risk factors in nonagenarians

    DEFF Research Database (Denmark)

    Dato, Serena; Krabbe, Karen S; Thinggaard, Mikael;

    2010-01-01

    , in nonagenarian men, the balance of pro- and anti-inflammatory activity at IL18 and IL10 loci is protective against cognitive decline. In conclusion, in this large study with virtually complete follow-up, commonly studied polymorphisms in cytokine genes do not have a major impact on late-life survival...

  20. Effect of repeated intracoronary injection of bone marrow cells in patients with ischaemic heart failure the Danish stem cell study - congestive heart failure trial (DanCell-CHF)

    DEFF Research Database (Denmark)

    Diederichsen, A.C.; Møller, Jacob Eifer; Thayssen, P.;

    2008-01-01

    BACKGROUND: It has been suggested that myocardial regeneration may be achieved by a single intracoronary bone marrow derived stem cell infusion in selected patients with ischaemic heart disease. The effect is uncertain in patients with chronic ischaemic heart failure and it is not known whether...... repeated infusions would have additional positive effects. AIMS: To assess whether two treatments of intracoronary infusion of bone marrow stem cells, administered 4 months apart, could improve left ventricular (LV) systolic function in patients with chronic ischaemic heart failure. METHODS: The study......, NYHA class improved (pstem cell treatment in patients with chronic ischaemic heart failure Udgivelsesdato: 2008/7...

  1. Patients with chronic pain after abdominal surgery show less preoperative endogenous pain inhibition and more postoperative hyperalgesia: a pilot study.

    NARCIS (Netherlands)

    Wilder-Smith, O.H.G.; Schreyer, T.; Scheffer, G.J.; Arendt-Nielsen, L.

    2010-01-01

    Chronic pain is common and undesirable after surgery. Progression from acute to chronic pain involves altered pain processing. The authors studied relationships between presence of chronic pain versus preoperative descending pain control (diffuse noxious inhibitory controls; DNICs) and postoperative

  2. Fixed-flexion knee radiography using a new positioning device produced highly repeatable measurements of joint space width: ELSA-Brasil Musculoskeletal Study (ELSA-Brasil MSK).

    Science.gov (United States)

    Telles, Rosa Weiss; Costa-Silva, Luciana; Machado, Luciana A C; Reis, Rodrigo Citton Padilha Dos; Barreto, Sandhi Maria

    To describe the performance of a non-fluoroscopic fixed-flexion PA radiographic protocol with a new positioning device, developed for the assessment of knee osteoarthritis (OA) in Brazilian Longitudinal Study of Adult Health Musculoskeletal Study (ELSA-Brasil MSK). A test-retest design including 19 adults (38 knee images) was conducted. Feasibility of the radiographic protocol was assessed by image quality parameters and presence of radioanatomic alignment according to intermargin distance (IMD) values. Repeatability was assessed for IMD and joint space width (JSW) measured at three different locations. Approximately 90% of knee images presented excellent quality. Frequencies of nearly perfect radioanatomic alignment (IMD ≤1mm) ranged from 29% to 50%, and satisfactory alignment was found in up to 71% and 76% of the images (IMD ≤1.5mm and ≤1.7mm, respectively). Repeatability analyses yielded the following results: IMD [SD of mean difference=1.08; coefficient of variation (%CV)=54.68%; intraclass correlation coefficient (ICC) (95%CI)=0.59 (0.34-0.77)]; JSW [SD of mean difference=0.34-0.61; %CV=4.48%-9.80%; ICC (95%CI)=0.74 (0.55-0.85)-0.94 (0.87-0.97)]. Adequately reproducible measurements of IMD and JSW were found in 68% and 87% of the images, respectively. Despite the difficulty in achieving consistent radioanatomic alignment between subsequent radiographs in terms of IMD, the protocol produced highly repeatable JSW measurements when these were taken at midpoint and 10mm from the medial extremity of the medial tibial plateau. Therefore, measurements of JSW at these locations can be considered adequate for the assessment of knee OA in ELSA-Brasil MSK. Copyright © 2016. Published by Elsevier Editora Ltda.

  3. Pilot Study to Show the Feasibility of High-Resolution Sagittal Ultrasound Imaging of the Temporomandibular Joint.

    Science.gov (United States)

    Katzberg, Richard W; Conway, William F; Ackerman, Susan J; Gonzales, Theresa S; Kheyfits, Valeriy; Cronan, Michael S

    2017-06-01

    To show the feasibility of acquiring high-resolution sagittal ultrasound (US) images of the temporomandibular joint (TMJ). We used commercially available US probes to assess the TMJ via a transoral soft tissue window to acquire sagittal images. Magnetic resonance imaging and clinical correlation were compared with the US findings by the consensus assessment of 2 of the senior investigators. The sample was composed of 10 TMJs (6 participants) with an age range of 34 to 71 years and a male-female ratio of 3:1. The condyle and subcondylar surface were visible in 10 of 10 joints (100%), the disc in 7 of 10 joints (70%), and the pterygoid muscles in 6 of 10 joints (60%). In the 5 joints with magnetic resonance correlation, disc position and configuration were confirmed in all cases. We show the first sagittal transoral sonograms of the TMJ disc and associated joint components. Copyright © 2016 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

  4. Candidate genes for obesity-susceptibility show enriched association within a large genome-wide association study for BMI

    Science.gov (United States)

    Vimaleswaran, Karani S.; Tachmazidou, Ioanna; Zhao, Jing Hua; Hirschhorn, Joel N.; Dudbridge, Frank; Loos, Ruth J.F.

    2012-01-01

    Before the advent of genome-wide association studies (GWASs), hundreds of candidate genes for obesity-susceptibility had been identified through a variety of approaches. We examined whether those obesity candidate genes are enriched for associations with body mass index (BMI) compared with non-candidate genes by using data from a large-scale GWAS. A thorough literature search identified 547 candidate genes for obesity-susceptibility based on evidence from animal studies, Mendelian syndromes, linkage studies, genetic association studies and expression studies. Genomic regions were defined to include the genes ±10 kb of flanking sequence around candidate and non-candidate genes. We used summary statistics publicly available from the discovery stage of the genome-wide meta-analysis for BMI performed by the genetic investigation of anthropometric traits consortium in 123 564 individuals. Hypergeometric, rank tail-strength and gene-set enrichment analysis tests were used to test for the enrichment of association in candidate compared with non-candidate genes. The hypergeometric test of enrichment was not significant at the 5% P-value quantile (P = 0.35), but was nominally significant at the 25% quantile (P = 0.015). The rank tail-strength and gene-set enrichment tests were nominally significant for the full set of genes and borderline significant for the subset without SNPs at P < 10−7. Taken together, the observed evidence for enrichment suggests that the candidate gene approach retains some value. However, the degree of enrichment is small despite the extensive number of candidate genes and the large sample size. Studies that focus on candidate genes have only slightly increased chances of detecting associations, and are likely to miss many true effects in non-candidate genes, at least for obesity-related traits. PMID:22791748

  5. IN VITRO STUDY OF ENTAMOEBA HISTOLYTICA CAUSATIVE AGENT OF AMOEBIASIS WITH LEMON JUICE AT DIFFERENT CONCENTRATION SHOWED ANTIAMOEBIC PROPERTIES

    Directory of Open Access Journals (Sweden)

    Shrivastava Bhanu

    2011-09-01

    Full Text Available A species of parasite protozoa Entamoeba histolytica causing amoebiasis and amoebic dysentery characteristic include a single nucleus containing a small central karyosome and peripheral chromatin that is finely and regularly beaded. This is a single celled parasitic animal, that infects predominantly humans and other primates. Amoebic infection was first described by Fedor Losch in 1875 in St. Petersburg. In 1890, Sir William Osler reported the first North American case of amoebiasis when he observed amoebae in stool in abscess fluid from physician who previously resided in Panama. So we used the Lemon juice (Citrus at different concentration against Entamoeba histolytica to treat the amoebiasis disease. Entamoeba histolytica shows the variety of growth due to the effect of Lemon juice (Citrus. Lemon juice is ingredient and it has antiamoebic properties against Entamoeba histolytica a causative agent of amoebiasis.

  6. Commonly studied polymorphisms in inflammatory cytokine genes show only minor effects on mortality and related risk factors in nonagenarians.

    Science.gov (United States)

    Dato, Serena; Krabbe, Karen S; Thinggaard, Mikael; Pedersen, Bente K; Christensen, Kaare; Bruunsgaard, Helle; Christiansen, Lene

    2010-03-01

    Systemic low-grade inflammation is consistently associated with functional status, cognitive functioning, multimorbidity, and survival in oldest olds. If inflammation is either a cause or a consequence of age-related pathology, genetic determinants of late-life survival can reside in cytokine genes polymorphisms, regulating inflammatory responses. The aim of this study was to test associations between commonly studied polymorphisms in interleukin (IL)6, IL10, IL15, and IL18, and tumor necrosis factor-alpha genes and late-life survival in a longitudinal cohort of nonagenarians: the Danish 1905 cohort. Additionally, associations were investigated between inflammatory markers and major predictors of mortality as cognitive and functional status. Modest sex-specific associations were found with survival, cognitive functioning, and handgrip strength. Evaluation of combined genotypes indicated that, in nonagenarian men, the balance of pro- and anti-inflammatory activity at IL18 and IL10 loci is protective against cognitive decline. In conclusion, in this large study with virtually complete follow-up, commonly studied polymorphisms in cytokine genes do not have a major impact on late-life survival or associated risk phenotypes.

  7. Preliminary study showing safety/efficacy of nanoss bioactive versus vitoss as bone graft expanders for lumbar noninstrumented fusions

    Directory of Open Access Journals (Sweden)

    Nancy E Epstein

    2015-01-01

    Conclusion: In this preliminary study of patients undergoing multilevel lumbar lamienctomies with posterolateral noninstrumented fusions, results were nearly comparable utilizing Vitoss or NanOss as bone graft expanders. Although the number of NanOss patients was substantially lower, the comparable efficacy and absence of postoperative complications for noninstrumented fusions is promising.

  8. Social Phobia in an Italian region: do Italian studies show lower frequencies than community surveys conducted in other European countries?

    Directory of Open Access Journals (Sweden)

    Dell'Osso Liliana

    2004-10-01

    Full Text Available Abstract Background The lifetime prevalence of Social Phobia (SP in European countries other than Italy has been estimated to range from 3.5% to 16.0%. The aim of this study was to assess the frequency of SP in Sardinia (Italy in order to verify the evidence of a lower frequency of SP in Italy observed in previous studies (from 1.0% to 3.1%. Methods A randomised cross sample of 1040 subjects, living in Cagliari, in rural areas, and in a mining district in Sardinia were interviewed using a Simplified version of the Composite International Diagnostic Interview (CIDIS. Diagnoses were made according to the 10th International Classification of Diseases (ICD-10. Results Lifetime prevalence of SP was 2.2% (males: 1.5%, females: 2.8% whereas 6-month prevalence resulted in 1.5% (males: 0.9%, females: 2.1%. Mean age at onset was 16.2 ± 9.3 years. A statistically significant association was found with Depressive Episode, Dysthymia and Generalized Anxiety Disorder. Conclusions The study is consistent with findings reported in several previous studies of a lower prevalence of SP in Italy. Furthermore, the results confirm the fact that SP, due to its early onset, might constitute an ideal target for early treatment aimed at preventing both the accumulation of social disabilities and impairments caused by anxiety and avoidance behaviour, as well as the onset of more serious, associated complications in later stages of the illness.

  9. Genome-wide meta-analysis of observational studies shows common genetic variants associated with macronutrient intake

    NARCIS (Netherlands)

    T. Tanaka (Toshiko); J.S. Ngwa; F.J.A. van Rooij (Frank); M.C. Zillikens (Carola); M.K. Wojczynski (Mary ); A.C. Frazier-Wood (Alexis); D.K. Houston (Denise); S. Kanoni (Stavroula); R.N. Lemaitre (Rozenn ); J. Luan; V. Mikkilä (Vera); F. Renström (Frida); E. Sonestedt (Emily); J.H. Zhao (Jing); A.Y. Chu (Audrey); L. Qi (Lu); D.I. Chasman (Daniel); M.C. De Oliveira Otto (Marcia); E.J. Dhurandhar (Emily); M.F. Feitosa (Mary Furlan); I. Johansson (Ingegerd); K-T. Khaw (Kay-Tee); K. Lohman (Kurt); A. Manichaikul (Ani); N.M. McKeown (Nicola ); D. Mozaffarian (Dariush); A.B. Singleton (Andrew); K. Stirrups (Kathy); J. Viikari (Jorma); Z. Ye (Zheng); S. Bandinelli (Stefania); I. Barroso (Inês); P. Deloukas (Panagiotis); N.G. Forouhi (Nita); A. Hofman (Albert); Y. Liu (Yongmei); L.-P. Lyytikäinen (Leo-Pekka); K.E. North (Kari); M. Dimitriou (Maria); G. Hallmans (Göran); M. Kähönen (Mika); C. Langenberg (Claudia); J.M. Ordovas (Jose); A.G. Uitterlinden (André); F.B. Hu (Frank); I.-P. Kalafati (Ioanna-Panagiota); O. Raitakari (Olli); O.H. Franco (Oscar); A. Johnson (Anthony); V. Emilsson (Valur); J.A. Schrack (Jennifer); R.D. Semba; D.S. Siscovick (David); D.K. Arnett (Donna); I.B. Borecki (Ingrid); P.W. Franks (Paul); S.B. Kritchevsky (Stephen); R.J.F. Loos (Ruth); M. Orho-Melander (Marju); J.I. Rotter (Jerome); N.J. Wareham (Nick); J.C.M. Witteman (Jacqueline); L. Ferrucci (Luigi); G.V. Dedoussis (George); L.A. Cupples (Adrienne); J.A. Nettleton (Jennifer )

    2013-01-01

    textabstractBackground: Macronutrient intake varies substantially between individuals, and there is evidence that this variation is partly accounted for by genetic variants. Objective: The objective of the study was to identify common genetic variants that are associated with macronutrient intake. D

  10. 大蒜可预防前列腺癌%New Study Shows Garlic May Lower Risk of Prostate Cancer

    Institute of Scientific and Technical Information of China (English)

    Jessica Berman; 阿萌

    2003-01-01

    @@ A diet rich in garlic(大蒜), onions(洋葱), shallots(青葱), leeks(韭葱) and scallions(韭菜) may cut the risk of prostate (前列腺的) cancer. That is according to a new study by researchers at the U.S. National Cancer Institute.

  11. Experimental study on the long-term effect of cadmium in mice fed cadmium-polluted rice with special reference to the effect of repeated reproductive cycles

    Energy Technology Data Exchange (ETDEWEB)

    Watanabe, M.; Shiroishi, K.; Nishino, H.; Shinmura, T.; Murase, H.; Shoji, T.; Naruse, Y.; Kagamimori, S.

    1986-06-01

    Long-term biological effects of cadmium-polluted rice and effect of repeated reproductive cycles on them were examined. Female SLC-B6D2F mice (female C57BL/6, male DBA/2) were fed a rice diet containing 65% unpolished rice for about 2 years from 7 weeks of age. The unpolished rice preparations used were commercially available rice (non-Cd-polluted) and Cd-polluted rice (over 1.0 ppm). Average Cd contents in each diet class were 0.12, 0.48, 1.78, 1.75, and 47.1 ppm (50 ppm Cd as CdCl/sub 2/ added). Some experimental mice were subjected to repeated reproductive cycles (parity group). Hematological, biochemical, and pathological examinations of urine, blood, and tissues, including Cd measurement, were carried out. Results after statistical analysis indicate Cd toxicities such as anemia and disturbances of Ca metabolism. These Cd effects were found to be enhanced by the reproductive cycles. Soft X-ray radiograms showed osteoporosis in the parity groups, especially in the groups with diets of higher Cd content. However, we could not find any sign of disturbance of renal function under our experimental conditions.

  12. The evolution of filamin – A protein domain repeat perspective

    Science.gov (United States)

    Light, Sara; Sagit, Rauan; Ithychanda, Sujay S.; Qin, Jun; Elofsson, Arne

    2013-01-01

    Particularly in higher eukaryotes, some protein domains are found in tandem repeats, performing broad functions often related to cellular organization. For instance, the eukaryotic protein filamin interacts with many proteins and is crucial for the cytoskeleton. The functional properties of long repeat domains are governed by the specific properties of each individual domain as well as by the repeat copy number. To provide better understanding of the evolutionary and functional history of repeating domains, we investigated the mode of evolution of the filamin domain in some detail. Among the domains that are common in long repeat proteins, sushi and spectrin domains evolve primarily through cassette tandem duplications while scavenger and immunoglobulin repeats appear to evolve through clustered tandem duplications. Additionally, immunoglobulin and filamin repeats exhibit a unique pattern where every other domain shows high sequence similarity. This pattern may be the result of tandem duplications, serve to avert aggregation between adjacent domains or it is the result of functional constraints. In filamin, our studies confirm the presence of interspersed integrin binding domains in vertebrates, while invertebrates exhibit more varied patterns, including more clustered integrin binding domains. The most notable case is leech filamin, which contains a 20 repeat expansion and exhibits unique dimerization topology. Clearly, invertebrate filamins are varied and contain examples of similar adjacent integrin-binding domains. Given that invertebrate integrin shows more similarity to the weaker filamin binder, integrin β3, it is possible that the distance between integrin-binding domains is not as crucial for invertebrate filamins as for vertebrates. PMID:22414427

  13. The evolution of filamin-a protein domain repeat perspective.

    Science.gov (United States)

    Light, Sara; Sagit, Rauan; Ithychanda, Sujay S; Qin, Jun; Elofsson, Arne

    2012-09-01

    Particularly in higher eukaryotes, some protein domains are found in tandem repeats, performing broad functions often related to cellular organization. For instance, the eukaryotic protein filamin interacts with many proteins and is crucial for the cytoskeleton. The functional properties of long repeat domains are governed by the specific properties of each individual domain as well as by the repeat copy number. To provide better understanding of the evolutionary and functional history of repeating domains, we investigated the mode of evolution of the filamin domain in some detail. Among the domains that are common in long repeat proteins, sushi and spectrin domains evolve primarily through cassette tandem duplications while scavenger and immunoglobulin repeats appear to evolve through clustered tandem duplications. Additionally, immunoglobulin and filamin repeats exhibit a unique pattern where every other domain shows high sequence similarity. This pattern may be the result of tandem duplications, serve to avert aggregation between adjacent domains or it is the result of functional constraints. In filamin, our studies confirm the presence of interspersed integrin binding domains in vertebrates, while invertebrates exhibit more varied patterns, including more clustered integrin binding domains. The most notable case is leech filamin, which contains a 20 repeat expansion and exhibits unique dimerization topology. Clearly, invertebrate filamins are varied and contain examples of similar adjacent integrin-binding domains. Given that invertebrate integrin shows more similarity to the weaker filamin binder, integrin β3, it is possible that the distance between integrin-binding domains is not as crucial for invertebrate filamins as for vertebrates. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Trends in socioeconomic inequalities in oral health among 15-year-old Danish adolescents during 1995-2013: A nationwide, register-based, repeated cross-sectional study.

    Science.gov (United States)

    Sengupta, Kaushik; Christensen, Lisa Bøge; Mortensen, Laust Hvas; Skovgaard, Lene Theil; Andersen, Ingelise

    2017-10-01

    Scandinavian welfare states, despite having better population oral health than less egalitarian societies, are characterized by ubiquitous social gradients and large relative socioeconomic inequalities in oral health. However, trends in these inequalities among Scandinavian children and adolescents have not been studied in detail. To describe the associations between socioeconomic position (SEP) and oral health in adolescents and to investigate the trends in these associations between 1995 and 2013. Nationwide repeated cross-sectional studies (using individual-level data) were conducted on 15-year-olds in Denmark from 1995, 2003, and 2013 (N=154,750). Dental data were obtained from the national dental register of the Danish Health Authority (Sundhedsstyrelsens Centrale Odontologiske Register [SCOR]) and data on social variables from administrative registers at Statistics Denmark. SEP measures included previous year's parental education (highest attained educational level by either of the parents), income (equivalized household disposable income), and occupational social class (highest recorded occupational class between the parents). Covariates were immigration status, country of origin, number of children and persons in the family, and household type. The outcome was dental caries experience, represented by the decayed, missing, and filled surfaces (DMFS) index. Negative binomial regression models were used to examine the association between DMFS count and each of the explanatory variables separately while accounting for cluster-correlated family data. Furthermore, hierarchical multiple regressions of DMFS on SEP indicators-using the zero-inflated negative binomial (ZINB) distribution as the outcome distribution-were estimated while successively adjusting for the potential effects of the included covariates. Caries prevalence declined from 71% in 1995 to 63% in 2003 and 45% in 2013. Separate assessment of each covariate showed statistically significant graded

  15. The Pathogenic Role of Low Range Repeats in SCA17.

    Directory of Open Access Journals (Sweden)

    Jung Hwan Shin

    Full Text Available SCA17 is an autosomal dominant cerebellar ataxia with expansion of the CAG/CAA trinucleotide repeats in the TATA-binding protein (TBP gene. SCA17 can have various clinical presentations including parkinsonism, ataxia, chorea and dystonia. SCA17 is diagnosed by detecting the expanded CAG repeats in the TBP gene; however, in the literature, pathologic repeat numbers as low as 41 overlap with normal repeat numbers.The subjects in this study included patients with involuntary movement disorders such as cerebellar ataxia, parkinsonism, chorea and dystonia who visited Seoul National University Hospital between Jan. 2006 and Apr. 2014 and were screened for SCA17. Those who were diagnosed with other genetic diseases or nondegenerative diseases were excluded. DNA from healthy subjects who did not have a family history of parkinsonism, ataxia, psychiatric symptoms, chorea or dystonia served as the control. In total, 5242 chromosomes from 2099 patients and 522 normal controls were analyzed.The total number of patients included in the analysis was 2099 (parkinsonism, 1706; ataxia, 345; chorea, 37; and dystonia, 11. In the normal control, up to 44 repeats were found. In the 44 repeat group, there were 7 (0.3% patients and 1 (0.2% normal control. In 43 repeat group, there were 8 (0.4% patients and 2 (0.4% normal controls. In the 42 repeat group, there were 16 (0.8% patients and 3 (0.6% normal controls. In 41 repeat group, there were 48 (2.3% patients and 8 (1.5% normal controls. Considering the overlaps and non-significant differences in allelic frequencies between the patients and the normal controls with low-expansions, we could not determine a definitive cutoff value for the pathologic CAG repeat number of SCA17.Because the statistical analysis between the normal controls and patients with low range expansions failed to show any differences so far, we must consider that clinical cases with low range expansions could be idiopathic movement disorders showing

  16. Oilsands for the USA : while environmental groups ask for a shutdown, new study shows significant resulting economic benefits in America

    Energy Technology Data Exchange (ETDEWEB)

    Cook, D.L.

    2010-02-15

    The United States is beginning to appreciate the value of having massive oil sands resources located in relatively close proximity to their northern border. This article discussed a recent study conducted by the Canadian Energy Research Institute (CERI) to assess the impact of Canada's oil sands development on the economy of the United States. The study forecasted that the demand for oil sands-related goods and services from American companies will continue to increase as the industry expands. The top national-level goods and services impacts will be derived from increases in manufacturing; finance; insurance; real estate; and professional, scientific, and technical services. Accommodation and food services in the United States will also benefit from the growth of the oil sands industry. The United States may not risk pushing ahead with strict carbon-cutting legislation targeting the oil sands when policy-makers consider the potential impacts of Canada selling its resources to China. 1 fig.

  17. A multi-centre cohort study shows no association between experienced violence and labour dystocia in nulliparous women at term

    OpenAIRE

    Dykes Anna-Karin; Dejin-Karlsson Elisabeth; Finnbogadóttir Hafrún

    2011-01-01

    Abstract Background Although both labour dystocia and domestic violence during pregnancy are associated with adverse maternal and fetal outcome, evidence in support of a possible association between experiences of domestic violence and labour dystocia is sparse. The aim of this study was to investigate whether self-reported history of violence or experienced violence during pregnancy is associated with increased risk of labour dystocia in nulliparous women at term. Methods A population-based ...

  18. An investigation of genome-wide studies reported susceptibility loci for ulcerative colitis shows limited replication in north Indians.

    Directory of Open Access Journals (Sweden)

    Garima Juyal

    Full Text Available Genome-Wide Association studies (GWAS of both Crohn's Disease (CD and Ulcerative Colitis (UC have unearthed over 40 risk conferring variants. Recently, a meta-analysis on UC revealed several loci, most of which were either previously associated with UC or CD susceptibility in populations of European origin. In this study, we attempted to replicate these findings in an ethnically distinct north Indian UC cohort. 648 UC cases and 850 controls were genotyped using Infinium Human 660W-quad. Out of 59 meta-analysis index SNPs, six were not in the SNP array used in the study. Of the remaining 53 SNPs, four were found monomorphic. Association (p<0.05 at 25 SNPs was observed, of which 15 were CD specific. Only five SNPs namely rs2395185 (HLA-DRA, rs3024505 (IL10, rs6426833 (RNF186, rs3763313 (BTNL2 and rs2066843 (NOD2 retained significance after Bonferroni correction. These results (i reveal limited replication of Caucasian based meta-analysis results; (ii reiterate overlapping molecular mechanism(s in UC and CD; (iii indicate differences in genetic architecture between populations; and (iv suggest that resources such as HapMap need to be extended to cover diverse ethnic populations. They also suggest a systematic GWAS in this terrain may be insightful for identifying population specific IBD risk conferring loci and thus enable cross-ethnicity fine mapping of disease loci.

  19. Evaluation of the repeated-dose liver micronucleus assay using N-nitrosomorpholine in young adult rats: report on collaborative study by the Collaborative Study Group for the Micronucleus Test (CSGMT)/Japanese Environmental Mutagen Society (JEMS)-Mammalian Mutagenicity Study (MMS) Group.

    Science.gov (United States)

    Hayashi, Aya; Kosaka, Mizuki; Kimura, Aoi; Wako, Yumi; Kawasako, Kazufumi; Hamada, Shuichi

    2015-03-01

    The present study was conducted to evaluate the suitability of a repeated-dose liver micronucleus (LMN) assay in young adult rats as a collaborative study by the Mammalian mutagenicity study (MMS) group. All procedures were performed in accordance with the standard protocols of the MMS Group. Six-week-old male Crl:CD(SD) rats (5 animals/group) received oral doses of the hepatocarcinogen N-nitrosomorpholine (NMOR) at 0 (control), 5, 10, and 30mg/kg/day (10mL/kg) for 14 days. Control animals received vehicle (water). Hepatocytes were collected from the liver 24h after the last dose, and the number of micronucleated hepatocytes (MNHEPs) was determined by microscopy. The number of micronucleated immature erythrocytes (MNIMEs) in the femoral bone marrow was also determined. The liver was examined using histopathologic methods after formalin fixation. The results showed statistically significant and dose-dependent increases in the number of MNHEPs in the liver at doses of 10mg/kg and greater when compared with the vehicle control. However, no significant increase was noted in the number of MNIMEs in the bone marrow at doses of up to 30mg/kg. Histopathology of the liver revealed hypertrophy and single cell necrosis of hepatocytes at doses of 5mg/kg and above. These results showed that the induction of micronuclei by NMOR was detected by the repeated-dose LMN assay, but not by the repeated-dose bone marrow micronucleus assay.

  20. Automated quality checks on repeat prescribing.

    OpenAIRE

    Rogers, Jeremy E; Wroe, Christopher J; Roberts, Angus; Swallow, Angela; Stables, David; Cantrill, Judith A; Rector, Alan L.

    2003-01-01

    BACKGROUND: Good clinical practice in primary care includes periodic review of repeat prescriptions. Markers of prescriptions that may need review have been described, but manually checking all repeat prescriptions against the markers would be impractical. AIM: To investigate the feasibility of computerising the application of repeat prescribing quality checks to electronic patient records in United Kingdom (UK) primary care. DESIGN OF STUDY: Software performance test against benchmark manual...

  1. Violence and TV Shows

    OpenAIRE

    ÖZTÜRK, Yrd. Doç. Dr. Şinasi

    2008-01-01

    This study aims to discuss theories on theviolent effects of TV shows on viewers, especiallyon children. Therefore, this study includes a briefdiscussion of definitions of violence, discussionof violence theories, main results of researcheson televised violence, measuring TV violence,perception of televised violence, individualdifferences and reactions to TV violence,aggressiveness and preferences for TV violence.

  2. Honored Teacher Shows Commitment.

    Science.gov (United States)

    Ratte, Kathy

    1987-01-01

    Part of the acceptance speech of the 1985 National Council for the Social Studies Teacher of the Year, this article describes the censorship experience of this honored social studies teacher. The incident involved the showing of a videotape version of the feature film entitled "The Seduction of Joe Tynan." (JDH)

  3. Honored Teacher Shows Commitment.

    Science.gov (United States)

    Ratte, Kathy

    1987-01-01

    Part of the acceptance speech of the 1985 National Council for the Social Studies Teacher of the Year, this article describes the censorship experience of this honored social studies teacher. The incident involved the showing of a videotape version of the feature film entitled "The Seduction of Joe Tynan." (JDH)

  4. Measurement-based quantum repeaters

    CERN Document Server

    Zwerger, M; Briegel, H J

    2012-01-01

    We introduce measurement-based quantum repeaters, where small-scale measurement-based quantum processors are used to perform entanglement purification and entanglement swapping in a long-range quantum communication protocol. In the scheme, pre-prepared entangled states stored at intermediate repeater stations are coupled with incoming photons by simple Bell-measurements, without the need of performing additional quantum gates or measurements. We show how to construct the required resource states, and how to minimize their size. We analyze the performance of the scheme under noise and imperfections, with focus on small-scale implementations involving entangled states of few qubits. We find measurement-based purification protocols with significantly improved noise thresholds. Furthermore we show that already resource states of small size suffice to significantly increase the maximal communication distance. We also discuss possible advantages of our scheme for different set-ups.

  5. A Birth Cohort Analysis to Study Dog Walking in Adolescence Shows No Relationship with Objectively Measured Physical Activity

    Directory of Open Access Journals (Sweden)

    Carri Westgarth

    2017-05-01

    Full Text Available Physical inactivity during childhood and adolescence is a serious health concern. There are few studies of the activity undertaken by adolescents when walking with the family dog, and the effect of this on objectively measured physical activity levels. Objective measures of physical activity using accelerometers were recorded at age 11–12, 13–14, and 15–16 years in the Avon Longitudinal Study of Parents and Children (ALSPAC (ALSPAC, UK birth cohort during the 2000s. Family pet ownership was collected retrospectively using a questionnaire at age 18 years, for the ages 7, 11, 13, and 15 years. In addition, approximate frequency per week of walks undertaken with dogs were also reported. Multilevel, multivariable modeling was used to investigate the relationship between dog ownership and dog walking status, and physical activity outcomes. There were a total of 4,373 complete data observations for use in 2,055 children. Reported participation in dog walking tended to increase during adolescence, as did dog ownership. The majority of who own dogs reported walking them either 2–6 times/week (range 39–46% or never (range 27–37%. A small minority (7–8% reported walking their dog every day. Most reported never walking any other dog either (94–87%. We found no evidence for an association between dog ownership or reported dog walking, and objectively measured physical activity (counts per minute, P = 0.3, or minutes of moderate-to-vigorous physical activity, P = 0.7 during adolescence. This study provides no evidence to support a relationship between adolescent dog ownership and physical activity, and demonstrates the importance of using objective activity measures and considering dog walking rather than just dog ownership.

  6. Statistical tools for analysing the data obtained from repeated dose toxicity studies with rodents: a comparison of the statistical tools used in Japan with that of used in other countries.

    Science.gov (United States)

    Kobayashi, Katsumi; Pillai, K Sadasivan; Guhatakurta, Soma; Cherian, K M; Ohnishi, Mariko

    2011-01-01

    In the present study, an attempt was made to compare the statistical tools used for analysing the data of repeated dose toxicity studies with rodents conducted in 45 countries, with that of Japan. The study revealed that there was no congruence among the countries in the use of statistical tools for analysing the data obtained from the above studies. For example, to analyse the data obtained from repeated dose toxicity studies with rodents, Scheffé's multiple range and Dunnett type (joint type Dunnett) tests are commonly used in Japan, but in other countries use of these statistical tools is not so common. However, statistical techniques used for testing the above data for homogeneity of variance and inter-group comparisons do not differ much between Japan and other countries. In Japan, the data are generally not tested for normality and the same is true with the most of the countries investigated. In the present investigation, out of 127 studies examined, data of only 6 studies were analysed for both homogeneity of variance and normal distribution. For examining homogeneity of variance, we propose Levene's test, since the commonly used Bartlett's test may show heterogeneity in variance in all the groups, if a slight heterogeneity in variance is seen any one of the groups. We suggest the data may be examined for both homogeneity of variance and normal distribution. For the data of the groups that do not show heterogeneity of variance, to find the significant difference among the groups, we recommend Dunnett's test, and for those show heterogeneity of variance, we recommend Steel's test.

  7. Patients with chronic pain after abdominal surgery show less preoperative endogenous pain inhibition and more postoperative hyperalgesia: a pilot study.

    Science.gov (United States)

    Wilder-Smith, Oliver Hamilton; Schreyer, Tobias; Scheffer, Gert Jan; Arendt-Nielsen, Lars

    2010-06-01

    Chronic pain is common and undesirable after surgery. Progression from acute to chronic pain involves altered pain processing. The authors studied relationships between presence of chronic pain versus preoperative descending pain control (diffuse noxious inhibitory controls; DNICs) and postoperative persistence and spread of skin and deep tissue hyperalgesia (change in electric/pressure pain tolerance thresholds; ePTT/pPTT) up to 6 months postoperatively. In 20 patients undergoing elective major abdominal surgery under standardized anesthesia, we determined ePTT/pPTT (close to [abdomen] and distant from [leg] incision), eDNIC/pDNIC (change in ePTT/pPTT with cold pressor pain task; only preoperatively), and a 100 mm long pain visual analogue scale (VAS) (0 mm = no pain, 100 mm = worst pain imaginable), both at rest and on movement preoperatively, and 1 day and 1, 3, and 6 months postoperatively. Patients reporting chronic pain 6 months postoperatively had more abdominal and leg skin hyperalgesia over the postoperative period. More inhibitory preoperative eDNIC was associated with less late postoperative pain, without affecting skin hyperalgesia. More inhibitory pDNIC was linked to less postoperative leg deep tissue hyperalgesia, without affecting pain VAS. This pilot study for the first time links chronic pain after surgery, poorer preoperative inhibitory pain modulation (DNIC), and greater postoperative degree, persistence, and spread of hyperalgesia. If confirmed, these results support the potential clinical utility of perioperative pain processing testing.

  8. Field Studies Show That In Situ Greenhouse Gas Emission Factors for East African Agriculture Are Less Than IPCC Values

    Science.gov (United States)

    Pelster, D.; Butterbach-Bahl, K.; Rufino, M.; Rosenstock, T. S.; Wanyama, G.

    2015-12-01

    Greenhouse gas (GHG) emissions from African agricultural systems are thought to comprise a large portion of total emissions from the continent, however these estimates have been calculated using emission factors (EF) from other regions due to the lack of field studies in Africa, which results in large uncertainties for these estimates. Field measurements from western Kenya calculating emissions over a year in 59 different sites found that GHG emissions from typical smallholder farms ranged from 2.8 to 15.0 Mg CO2-C ha-1, -6.0 to 2.4 kg CH4-C ha-1 and -0.1 to 1.8 kg N2O-N ha-1, and were not affected by management intensity. The lack of a response in N2O emissions to N fertilization suggests that the EF currently used in national inventories overestimates N2O emissions from typical smallholder agriculture. Another study measuring N2O and CH4 emissions from manure deposited by grazing cattle found that the N2O EF ranged from 0.1 to 0.2%, while the CH4 EF ranged from 0.04 to 0.14 Kg CH4-C per 173 kg animal. These suggest that the current IPCC EF overestimate agricultural soil and manure GHG emissions for Kenya, and likely for much of East Africa.

  9. Repeatability of Harris Corner Detector

    Institute of Scientific and Technical Information of China (English)

    HU Lili

    2003-01-01

    Interest point detectors are commonly employed to reduce the amount of data to be processed. The ideal interest point detector would robustly select those features which are most appropriate or salient for the application and data at hand. This paper shows that interest points are geometrically stable under different transformations.This property makes interest points very successful in the context of image matching. To measure this property quantatively, we introduce a evaluation criterion: repeatability rate.

  10. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    Science.gov (United States)

    Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  11. A COMPARATIVE STUDY SHOWING EFFICACY OF PREEMPTIVE INTRAVENOUS PARACETAMOL IN REDUCING POSTOPERATIVE PAIN AND ANALGESIC REQUIREMENT IN LAPAROSCOPIC CHOLECYSTECTOMY

    Directory of Open Access Journals (Sweden)

    Aftab Ahmad

    2015-07-01

    Full Text Available A double blind, prospective, randomized study was conducted on 60 patients of ASA I and II undergoing laparoscopic cholecystectomy to evaluate the efficacy of pre - emptive IV paracetamol [PCM] in reducing postoperative pain and analgesic requirement. Patien ts were randomly assigned in two groups, group A and group B of which group A received pre - emptive IV PCM 10 minutes before skin incision. It was observed that time to first analgesic required was significantly longer in group A as compared to group B and group A had significantly lower total analgesic consumption and visual analogue scores (VAS as compared to group B. We concluded that pre - emptive use of IV PCM (Paracetamol in laparoscopic cholecystectomy significantly decreases postoperative pain and a nalgesic requirement.

  12. Dithiocarbamate-thiourea hybrids useful as vaginal microbicides also show reverse transcriptase inhibition: design, synthesis, docking and pharmacokinetic studies.

    Science.gov (United States)

    Bala, Veenu; Jangir, Santosh; Mandalapu, Dhanaraju; Gupta, Sonal; Chhonker, Yashpal S; Lal, Nand; Kushwaha, Bhavana; Chandasana, Hardik; Krishna, Shagun; Rawat, Kavita; Maikhuri, Jagdamba P; Bhatta, Rabi S; Siddiqi, Mohammad I; Tripathi, Rajkamal; Gupta, Gopal; Sharma, Vishnu L

    2015-02-15

    Prophylactic prevention is considered as the most promising strategy to tackle STI/HIV. Twenty-five dithiocarbamate-thiourea hybrids (14-38) were synthesized as woman controlled topical vaginal microbicides to counter Trichomonas vaginalis and sperm along with RT inhibition potential. The four promising compounds (18, 26, 28 and 33) were tested for safety through cytotoxic assay against human cervical cell line (HeLa) and compatibility with vaginal flora, Lactobacillus. Docking study of most promising vaginal microbicide (33) revealed that it docked in a position and orientation similar to known reverse transcriptase inhibitor Nevirapine. The preliminary in vivo pharmacokinetics of compound 33 was performed in NZ-rabbits to evaluate systemic toxicity in comparison to Nonoxynol-9.

  13. Randomized, Controlled, Thorough QT/QTc Study Shows Absence of QT Prolongation with Luseogliflozin in Healthy Japanese Subjects.

    Directory of Open Access Journals (Sweden)

    Yuji Kumagai

    Full Text Available Luseogliflozin is a selective sodium glucose co-transporter 2 (SGLT2 inhibitor. To evaluate the cardiac safety of luseogliflozin, a thorough QT/QTc study was conducted in healthy Japanese subjects. The effects of moxifloxacin on QT prolongation in Japanese subjects were also evaluated. In this double-blind, placebo- and open-label positive-controlled, 4-way crossover study, 28 male and 28 female subjects received a single dose of luseogliflozin 5 mg (therapeutic dose, luseogliflozin 20 mg (supratherapeutic dose, placebo, and moxifloxacin 400 mg. Serial triplicate digital 12-lead electrocardiograms (ECGs were recorded before and after dosing, and results were analyzed using the Fridericia correction (QTcF method. Serial blood sampling was performed for pharmacokinetic analyses of luseogliflozin and moxifloxacin to analyze the relationship between QTcF interval and plasma concentration. The upper limits of the two-sided 90% confidence intervals (CIs for baseline and placebo-adjusted QTcF intervals (ΔΔQTcF in the 5 mg and 20 mg luseogliflozin groups were less than 10 ms at all time points. No correlation between plasma luseogliflozin concentrations and ΔΔQTcF was observed. In the moxifloxacin group, the lower limits of the two-sided 90% CIs for ΔΔQTcF were greater than 5 ms at all time points. A positive relationship was observed between plasma moxifloxacin concentration and change in ΔΔQTcF. Luseogliflozin was well tolerated at both dose levels. The majority of adverse events were mild in severity, and no serious or life-threatening adverse events occurred. Neither therapeutic (5 mg nor supratherapeutic (20 mg doses of luseogliflozin affected QT prolongation in healthy Japanese subjects.

  14. Strengthening concept learning by repeated testing.

    Science.gov (United States)

    Wiklund-Hörnqvist, Carola; Jonsson, Bert; Nyberg, Lars

    2014-02-01

    The aim of this study was to examine whether repeated testing with feedback benefits learning compared to rereading of introductory psychology key-concepts in an educational context. The testing effect was examined immediately after practice, after 18 days, and at a five-week delay in a sample of undergraduate students (n = 83). The results revealed that repeated testing with feedback significantly enhanced learning compared to rereading at all delays, demonstrating that repeated retrieval enhances retention compared to repeated encoding in the short- and the long-term. In addition, the effect of repeated testing was beneficial for students irrespectively of working memory capacity. It is argued that teaching methods involving repeated retrieval are important to consider by the educational system.

  15. Clarithromycin and dexamethasone show similar anti-inflammatory effects on distinct phenotypic chronic rhinosinusitis: an explant model study.

    Science.gov (United States)

    Zeng, Ming; Li, Zhi-Yong; Ma, Jin; Cao, Ping-Ping; Wang, Heng; Cui, Yong-Hua; Liu, Zheng

    2015-06-06

    Phenotype of chronic rhinosinusitis (CRS) may be an important determining factor of the efficacy of anti-inflammatory treatments. Although both glucocorticoids and macrolide antibiotics have been recommended for the treatment of CRS, whether they have different anti-inflammatory functions for distinct phenotypic CRS has not been completely understood. The aim of this study is to compare the anti-inflammatory effects of clarithromycin and dexamethasone on sinonasal mucosal explants from different phenotypic CRS ex vivo. Ethmoid mucosal tissues from CRSsNP patients (n = 15), and polyp tissues from eosinophilic (n = 13) and non-eosinophilic (n = 12) CRSwNP patients were cultured in an ex vivo explant model with or without dexamethasone or clarithromycin treatment for 24 h. After culture, the production and/or expression of anti-inflammatory molecules, epithelial-derived cytokines, pro-inflammatory cytokines, T helper (Th)1, Th2 and Th17 cytokines, chemokines, dendritic cell relevant markers, pattern recognition receptors (PRRs), and tissue remodeling factors were detected in tissue explants or culture supernatants by RT-PCR or ELISA, respectively. We found that both clarithromycin and dexamethasone up-regulated the production of anti-inflammatory mediators (Clara cell 10-kDa protein and interleukin (IL)-10), whereas down-regulated the production of Th2 response and eosinophilia promoting molecules (thymic stromal lymphopoietin, IL-25, IL-33, CD80, CD86, OX40 ligand, programmed cell death ligand 1, CCL17, CCL22, CCL11, CCL5, IL-5, IL-13, and eosinophilic cationic protein) and Th1 response and neutrophilia promoting molecules (CXCL8, CXCL5, CXCL10, CXCL9, interferon-γ, and IL-12), from sinonasal mucosa from distinct phenotypic CRS. In contrast, they had no effect on IL-17A production. The expression of PRRs (Toll-like receptors and melanoma differentiation-associated gene 5) was induced, and the production of tissue remodeling factors (transforming growth factor-β1

  16. Mono- and dinuclear manganese(III) complexes showing efficient catechol oxidase activity: syntheses, characterization and spectroscopic studies.

    Science.gov (United States)

    Banu, Kazi Sabnam; Chattopadhyay, Tanmay; Banerjee, Arpita; Mukherjee, Madhuparna; Bhattacharya, Santanu; Patra, Goutam Kumar; Zangrando, Ennio; Das, Debasis

    2009-10-28

    Four side-off compartmental ligands L1-L4 [L1 = N,N'-ethylenebis(3-formyl-5-methyl-salicylaldimine), L2 = N,N'-1-methylethylenebis(3-formyl-5-methylsalicylaldimine), L3 = N,N'-1,1-dimethylethylenebis(3-formyl-5-methylsalicylaldimine) and L4= N,N'-cyclohexenebis(3-formyl-5-methylsalicylaldimine)] having two binding sites, N2O2 and O4, have been chosen to synthesize mononuclear and dinuclear manganese(III) complexes with the aim to study their catecholase activity using 3,5-di-tert-butylcatechol (3,5-DTBC) as substrate in the presence of molecular oxygen. In all cases only mononuclear manganese complexes (1-4) were obtained, with manganese coordination taking place at the N2O2 binding site only, irrespective of the amount of manganese salt used. All these complexes have been characterized by routine physico-chemical techniques. Complex MnL2Cl.4H2O (2) has further been structurally characterized by X-ray single crystal structure analysis. Four dinuclear manganese complexes, 5-8, were obtained after condensing the two pending formyl groups on each ligand (L1-L4) with aniline followed by reaction with MnCl2 to put the second Mn atom onto another N2O2 site. The catalytic activity of all complexes 1-8 has been investigated following the oxidation of 3,5-di-tert-butylcatechol (3,5-DTBC) to 3,5-di-tert-butylbenzoquinone (3,5-DTBQ) with molecular oxygen in two different solvents, methanol and acetonitrile. The study reveals that the catalytic activity is influenced by the solvent and to a significant extent by the backbone of the diamine and the behavior seems to be related mainly to steric rather than electronic factors. Experimental data suggest that a correlation, the lower the E(1/2) value the higher the catalytic activity, can be drawn between E(1/2) and Vmax of the complexes in a particular solvent. The EPR measurements suggest that the catalytic property of the complexes is related to the metal center(s) participation rather than to a radical mechanism.

  17. Delirium superimposed on dementia: a survey of delirium specialists shows a lack of consensus in clinical practice and research studies.

    Science.gov (United States)

    Richardson, Sarah; Teodorczuk, Andrew; Bellelli, Giuseppe; Davis, Daniel H J; Neufeld, Karin J; Kamholz, Barbara A; Trabucchi, Marco; MacLullich, Alasdair M J; Morandi, Alessandro

    2016-05-01

    Despite advances in delirium knowledge and the publication of best practice guidelines, uncertainties exist regarding assessment of Delirium Superimposed on Dementia (DSD). An international survey of delirium specialists was undertaken to evaluate current practice. Invitations to participate in an online survey were distributed by email among members of four international delirium associations with additional publication on their websites. The survey covered the assessment and diagnosis of DSD in clinical practice and research studies. Questions were structured around current practice and attitudes. The 205 responders were mostly confident that they could detect DSD with 60% rating their confidence at 7 or above on a likert scale of 0 (none) to 10 (excellent). Seventy-six percent felt that Dementia with Lewy Bodies (DLB) was the most challenging dementia subtype in which to diagnose DSD. Several scales were used to assess for the presence of DSD including the Confusion Assessment Method (CAM) (54%), DSM-5 criteria (25%) and CAM-ICU (15%). Responders stated that attention (71%), fluctuation in cognitive status (65%), and arousability (41%) were the most clinically useful features to assess when diagnosing DSD. Motor fluctuations were also deemed important but 61% had no specific test to monitor these. The largest survey of DSD practice to date demonstrates that despite good levels of confidence in recognizing DSD, there exists a lack of consensus concerning assessment and diagnosis globally. These findings suggest the need for the development of more research leading to precise diagnostic criteria and comprehensive guidelines regarding the assessment and diagnosis of DSD.

  18. Immunosuppression using the mammalian target of rapamycin (mTOR) inhibitor everolimus: pilot study shows significant cognitive and affective improvement.

    Science.gov (United States)

    Lang, U E; Heger, J; Willbring, M; Domula, M; Matschke, K; Tugtekin, S M

    2009-12-01

    Immunosuppression using calcineurin inhibitors (CNIs) is accompanied by neuropsychiatric side effects, which counteract longevity and quality of life benefits in 10% to 28% of patients. Following the availability of the mammalian target of rapamycin (mTOR) inhibitors, it became possible to replace CNI without increasing the risk of acute graft rejection. mTOR, a member of the phosphatidyl inositol 3' kinase family, is a downstream target of brain-derived neurotrophic factor, which has been implicated in the pathophysiology and treatment of several psychiatric disorders. Preclinical evidence has implicated the mTOR pathway in synaptic plasticity and fear memory consolidation and reconsolidation. In the present study we prospectively evaluated the psychiatric outcomes of CNI-free immunosuppression in adult maintenance heart transplant recipients (n = 9; age: 66.1 +/- 6.1) using the Wechsler Memory Scale-Revised (WMS-R), Symptom Checklist-90-Revised (SCL-90-R), Beck Depression Inventory (BDI), Trail Making Tests A and B, Digit Span (DS), and Hamilton Depression Scale (HAMD). Four weeks after switching to CNI-free immunosuppression using everolimus, BDI (Z = -1.14; P = .048), Trail Making tests A and B (Z = -2.52; P = .012), WMS-R (Z = 2.37; P = .018), and SCL-90-R (Z = -2.37; P = .018) were all significantly improved while DS (Z = -1.18; P = .236) and HAMD (Z = -0.595; P = .552) remained unchanged. This report describes favorable psychiatric outcome variables using everolimus in maintenance heart transplant recipients. CNI-free immunosuppression with everolimus might provide significant improvement in memory, concentration, and overall psychiatric symptoms among heart transplant recipients.

  19. A single qualitative study can show same findings as years of quantitative research: Obstructive sleep apnoea as an example

    Directory of Open Access Journals (Sweden)

    Howard Tandeter

    2016-06-01

    Full Text Available Background Many years of quantitative research led to our present knowledge of the symptoms and associated features (S&AF of the obstructive sleep apnoea (OSA syndrome. Aims 1. To prove that a qualitative research approach may identify symptoms and associated features of OSA in less time/effort than that used in a quantitative approach; 2. To describe the experience of patients with OSA and the effects of the syndrome on their quality of life and that of their spouses and families (issues that quantitative methods fail to recognize. Methods We used a narrative inquiry methodology (qualitative research. The sample was selected using the “snowball sampling technique". The sample included 10 patients with moderate to severe OSA who had good adherence to CPAP and significant clinical improvement after treatment, and 3 of the patient’s spouses. Results The following issues were identified: A long pre-diagnosis phase of OSA (20 years in one of the patients; Characteristic S&AF of the syndrome as experienced by patients and their spouses; The need for increased awareness of both the public and the medical establishment in regards to this disorder; Premature ejaculation (not reported previously and nightmares (non-conclusive in the literature were identified and improved with CPAP therapy. Conclusion With the use of quantitative research methods it took decades to discover things that we found in one simple qualitative study. We therefore urge scientists to use more often these qualitative methods when looking for S&AF of diseases and syndromes.

  20. The Pentapeptide Repeat Proteins

    Energy Technology Data Exchange (ETDEWEB)

    Vetting,M.; Hegde, S.; Fajardo, J.; Fiser, A.; Roderick, S.; Takiff, H.; Blanchard, J.

    2006-01-01

    The Pentapeptide Repeat Protein (PRP) family has over 500 members in the prokaryotic and eukaryotic kingdoms. These proteins are composed of, or contain domains composed of, tandemly repeated amino acid sequences with a consensus sequence of [S, T,A, V][D, N][L, F]-[S, T,R][G]. The biochemical function of the vast majority of PRP family members is unknown. The three-dimensional structure of the first member of the PRP family was determined for the fluoroquinolone resistance protein (MfpA) from Mycobacterium tuberculosis. The structure revealed that the pentapeptide repeats encode the folding of a novel right-handed quadrilateral {beta}-helix. MfpA binds to DNA gyrase and inhibits its activity. The rod-shaped, dimeric protein exhibits remarkable size, shape and electrostatic similarity to DNA.

  1. Can a Repeated Sprint Ability Test Help Clear a Previously Injured Soccer Player for Fully Functional Return to Activity? A Pilot Study.

    Science.gov (United States)

    Padulo, Johnny; Attene, Giuseppe; Ardigò, Luca P; Bragazzi, Nicola L; Maffulli, Nicola; Zagatto, Alessandro M; Dello Iacono, Antonio

    2017-07-01

    To investigate the effects of fatigue induced by a repeated sprint ability (RSA) test on the neuromuscular responses of soccer players with a recent history of lower limb injuries (CH) and a matched control group in good fitness condition (GH). This was a case-control study. Nine CH and 9 GH. Allocation to CH or GH. Each player was assessed for blood lactate concentration and jumping performance [squat jump (SJ) and countermovement jump (CMJ)] before/after RSA. Post-RSA rate of perceived exertion (RPE) was obtained. Receiver operating characteristic analysis was performed to calculate RSA sensitivity and specificity in distinguishing between CH and GH. Intraclass correlation coefficient was used to assess reliability. No baseline differences were found for any variable. ΔSJ before/after RSA was -14 ± 2% and -5 ± 2% in CH and GH, respectively (P Repeated sprint ability is a simple, low-cost field test potentially able to assist in clinical decision making for return to sport.

  2. Repeating the Past

    Science.gov (United States)

    Moore, John W.

    1998-05-01

    As part of the celebration of the Journal 's 75th year, we are scanning each Journal issue from 25, 50, and 74 years ago. Many of the ideas and practices described are so similar to present-day "innovations" that George Santayana's adage (1) "Those who cannot remember the past are condemned to repeat it" comes to mind. But perhaps "condemned" is too strong - sometimes it may be valuable to repeat something that was done long ago. One example comes from the earliest days of the Division of Chemical Education and of the Journal.

  3. Phylogenetic study and molecular identification of 31 Dendrobium species using inter-simple sequence repeat (ISSR) markers

    National Research Council Canada - National Science Library

    Wang, H.-Z; Feng, S.-G; Lu, J.-J; Shi, N.-N; Liu, J.-J

    2009-01-01

    The genetic diversity of the genus Dendrobium is not well known and the phylogenetic relationship of Dendrobium species are mainly determined by studies of the comparative vegetative anatomy and plant systematics...

  4. A Repeating Fast Radio Burst

    CERN Document Server

    Spitler, L G; Hessels, J W T; Bogdanov, S; Brazier, A; Camilo, F; Chatterjee, S; Cordes, J M; Crawford, F; Deneva, J; Ferdman, R D; Freire, P C C; Kaspi, V M; Lazarus, P; Lynch, R; Madsen, E C; McLaughlin, M A; Patel, C; Ransom, S M; Seymour, A; Stairs, I H; Stappers, B W; van Leeuwen, J; Zhu, W W

    2016-01-01

    Fast Radio Bursts are millisecond-duration astronomical radio pulses of unknown physical origin that appear to come from extragalactic distances. Previous follow-up observations have failed to find additional bursts at the same dispersion measures (i.e. integrated column density of free electrons between source and telescope) and sky position as the original detections. The apparent non-repeating nature of the fast radio bursts has led several authors to hypothesise that they originate in cataclysmic astrophysical events. Here we report the detection of ten additional bursts from the direction of FRB121102, using the 305-m Arecibo telescope. These new bursts have dispersion measures and sky positions consistent with the original burst. This unambiguously identifies FRB121102 as repeating and demonstrates that its source survives the energetic events that cause the bursts. Additionally, the bursts from FRB121102 show a wide range of spectral shapes that appear to be predominantly intrinsic to the source and wh...

  5. Second time around: Corticospinal responses following repeated sports-related concussions within the same season. A transcranial magnetic stimulation study

    Directory of Open Access Journals (Sweden)

    Alan J Pearce

    2014-01-01

    Conclusions: This multiple-case study has demonstrated that concussion result in increased intracortical inhibition and reduction in cognitive and motor performance. Further, TMS, in conjunction with tests of cognitive and motor performance, can be useful as a prognostic technique in assessing recovery from acute concussion injury.

  6. Reduction of smoking in Dutch adolescents over the past decade and its health gains : a repeated cross-sectional study

    NARCIS (Netherlands)

    Gielkens-Sijstermans, Cindy M.; Mommers, Monique A.; Hoogenveen, Rudolf T.; Feenstra, Talitha L.; de Vreede, Jacqueline; Bovens, Fons M.; van Schayck, Onno C.

    Background: Smoking is the main preventable lifestyle-related risk factor threatening human health. In this study, time trends in smoking behaviour between 1996 and 2005 among adolescents enrolled in secondary school were assessed. Methods: In 1996, 2001 and 2005, a survey was conducted in the

  7. A repeated-measures study of recreational water exposure, non-point source pollution, and risk of illness

    Science.gov (United States)

    Discharge of stormwater runoff onto beaches is a major cause of beach closings and advisories in the United States. Prospective studies of recreational water quality and health have often been limited to two time points (baseline and follow-up). Little is known about the risk of ...

  8. All-optical repeater.

    Science.gov (United States)

    Silberberg, Y

    1986-06-01

    An all-optical device containing saturable gain, saturable loss, and unsaturable loss is shown to transform weak, distorted optical pulses into uniform standard-shape pulses. The proposed device performs thresholding, amplification, and pulse shaping as required from an optical repeater. It is shown that such a device could be realized by existing semiconductor technology.

  9. Bidirectional Manchester repeater

    Science.gov (United States)

    Ferguson, J.

    1980-01-01

    Bidirectional Manchester repeater is inserted at periodic intervals along single bidirectional twisted pair transmission line to detect, amplify, and transmit bidirectional Manchester 11 code signals. Requiring only 18 TTL 7400 series IC's, some line receivers and drivers, and handful of passive components, circuit is simple and relatively inexpensive to build.

  10. The necessity of repeated assessment of imaging studies contained in medical records in medico-legal opinions

    Directory of Open Access Journals (Sweden)

    Aleksandra Borowska-Solonynko

    2014-12-01

    Full Text Available The paper presents two case reports of living victims, in which imaging studies of the chest conducted at a medical facility were an essential part of the medico-legal opinion. The first case was that of a young male hospitalized due to CT evidence of bilateral rib fractions, who claimed to have been assaulted by police officers. The other case was that of a six week old baby hospitalized due to chest X-ray evidence of right hand side rib fractions. The chest X-ray was performed due to one bruise found on the baby’s forehead and two small bruises on the back, which gave rise to suspicions of child abuse. In both cases, expert witnesses in radiology definitively excluded the presence of any fractures. These cases indicate that a new assessment of imaging studies contained in medical records is needed. Expert opinions based solely on the description of imaging studies may result in grave consequences.

  11. Application of composite estimation in studies of animal population production with two-stage repeated sample designs.

    Science.gov (United States)

    Farver, T B; Holt, D; Lehenbauer, T; Greenley, W M

    1997-05-01

    This paper reports results from two example data sets of a two-stage sampling design where sampling (in panels) both farms and animals within selected farms increases the efficiency of parameter estimation from measurements recorded over time. With such a design, not only are farms replaced from time-to-time but also animals subsampled within retained farms are subject to replacement. Three general categories of parameters estimated for the population (the set of animals belonging to the universe of farms of interest) were (1) the total at each measurement occasion; (2) the difference between means or totals on successive measurement occasions; (3) the total over a sequence of successive measurement periods. Whereas several responses at the farm level were highly correlated over time (rho 1), the corresponding animal responses were less correlated over time (rho 2)-leading to only moderate gains in relative efficiency. Intraclass correlation values were too low in most cases to counteract the overall negative impact of rho 2. In general, sizeable gains in relative efficiency were observed for estimating change-confirming a previous result which showed this to be true provided that rho 1 was high (irrespective of rho 2).

  12. Generosity pays in the presence of direct reciprocity: a comprehensive study of 2 × 2 repeated games.

    Directory of Open Access Journals (Sweden)

    Luis A Martinez-Vaquero

    Full Text Available By applying a technique previously developed to study ecosystem assembly [Capitán et al., Phys. Rev. Lett. 103, 168101 (2009] we study the evolutionary stable strategies of iterated 2 × 2 games. We focus on memory-one strategies, whose probability to play a given action depends on the actions of both players in the previous time step. We find the asymptotically stable populations resulting from all possible invasions of any known stable population. The results of this invasion process are interpreted as transitions between different populations that occur with a certain probability. Thus the whole process can be described as a Markov chain whose states are the different stable populations. With this approach we are able to study the whole space of symmetric 2 × 2 games, characterizing the most probable results of evolution for the different classes of games. Our analysis includes quasi-stationary mixed equilibria that are relevant as very long-lived metastable states and is compared to the predictions of a fixation probability analysis. We confirm earlier results on the success of the Pavlov strategy in a wide range of parameters for the iterated Prisoner's Dilemma, but find that as the temptation to defect grows there are many other possible successful strategies. Other regions of the diagram reflect the equilibria structure of the underlying one-shot game, albeit often some non-expected strategies arise as well. We thus provide a thorough analysis of iterated 2 × 2 games from which we are able to extract some general conclusions. Our most relevant finding is that a great deal of the payoff parameter range can still be understood by focusing on win-stay, lose-shift strategies, and that very ambitious ones, aspiring to obtaining always a high payoff, are never evolutionary stable.

  13. Changes in surgical team performance and safety climate attitudes following expansion of perioperative services: a repeated-measures study.

    Science.gov (United States)

    Gillespie, Brigid M; Harbeck, Emma; Kang, Evelyn; Steel, Catherine; Fairweather, Nicole; Chaboyer, Wendy

    2017-08-10

    Objective The aim of the present study was to describe process changes in surgical team performance and team members' attitudes to safety culture following hospital relocation and expansion of perioperative services.Methods The study was a naturalistic study using structured observations and surveys to assess non-technical skills (NTS; i.e. communication, teamwork, situational awareness, decision making and leadership) in surgery. This interrupted time series design used mixed-linear regression models to examine the effect of phase (before and after hospital relocation) on surgical teams' NTS and their processes that may affect performance. Differences in self-reported teamwork and safety climate attitudes were also examined.Results In all, 186 procedures (100 before and 81 after hospital relocation) were observed across teams working in general, paediatric, orthopaedic and thoracic surgeries. Interobserver agreement ranged from 86% to 95%. An effect of phase was found, indicating that there were significant improvements after relocation in the use of NTS by the teams observed (P=0.020; 95% confidence interval 1.9-4.7).Conclusions The improvements seen in surgical teams' NTS performance and safety culture attitudes may be related to the move to a new state-of-the-art perioperative department.What is known about the topic? Patient safety in surgery relies on optimal team performance, underpinned by effective NTS.What does this paper add? The NTS of surgical teams may be improved through ergonomic innovations that promote teams' shared mental models.What are the implications for practitioners? Effective multidisciplinary teamwork relies on a combination of NTS and ergonomic factors, which inherently contribute to team performance and safety climate attitudes.

  14. Feedback from an image of finger and an actual finger produce similar prismatic after-effect: a repeated measures study

    DEFF Research Database (Denmark)

    Wilms, Inge Linda; Assentoft, Emilie

    2014-01-01

    by seeing their fingertip. In the second condition subjects saw an image of a fingertip. The results indicate that the two conditions are significantly different. The study is an important step in understanding what actually makes a difference in training when trying to convert paper-and-pencil training...... if it is the format rather than the indirectness of the feedback creating this difference. 27 healthy subjects were subjected to a single session of Prism Adaptation Training under two different feedback conditions. In the first feedback condition, subjects were exposed to visual feedback on pointing precision...

  15. Influence of the adaptive iterative dose reduction 3D algorithm on the detectability of low-contrast lesions and radiation dose repeatability in abdominal computed tomography: a phantom study.

    Science.gov (United States)

    Yoon, Jeong Hee; Lee, Jeong Min; Hur, Bo Yun; Baek, Jeehyun; Shim, Hackjoon; Han, Joon Koo; Choi, Byung Ihn

    2015-08-01

    The purpose of the study is to evaluate the influence of the adaptive iterative dose reduction (AIDR 3D) algorithm on the detectability of low-contrast focal liver lesions (FLLs) and the radiation dose repeatability of automatic tube current modulation (ATCM) in abdominal CT scans using anthropomorphic phantoms. Three different sizes of anthropomorphic phantoms, each with 4 low-contrast FLLs, were scanned on a 320-channel CT scanner using the ATCM technique and AIDR 3D, at different radiation doses: full-dose, half-dose, and quarter-dose. Scans were repeated three times and reconstructed with filtered back projection (FBP) and AIDR 3D. Radiation dose repeatability was assessed using the intraclass correlation coefficient (ICC). Image noise, quality, and lesion conspicuity were assessed by four reviewers and the number of invisible FLLs was compared among different radiation doses and reconstruction methods. ICCs of radiation dose among the three CT scans were excellent in all phantoms (0.99). Image noise, quality, and lesion conspicuity in the half-dose group were comparable with full-dose FBP after applying AIDR 3D in all phantoms. In small phantoms, the half-dose group reconstructed with AIDR 3D showed similar sensitivity in visualizing low-contrast FLLs compared to full-dose FBP (P = 0.77-0.84). In medium and large phantoms, AIDR 3D reduced the number of missing low-contrast FLLs [3.1% (9/288), 11.5% (33/288), respectively], compared to FBP [10.4% (30/288), 21.9% (63/288), respectively] in the full-dose group. By applying AIDR 3D, half-dose CT scans may be achievable in small-sized patients without hampering diagnostic performance, while it may improve diagnostic performance in medium- and large-sized patients without increasing the radiation dose.

  16. Long-term facial improvement after repeated BoNT-A injections and mirror biofeedback exercises for chronic facial synkinesis: a case-series study.

    Science.gov (United States)

    Mandrini, Silvia; Comelli, Mario; Dall'angelo, Anna; Togni, Rossella; Cecini, Miriam; Pavese, Chiara; Dalla Toffola, Elena

    2016-12-01

    Only few studies have considered the effects of the combined treatment with onabotulinumtoxinA (BoNT-A) injections and biofeedback (BFB) rehabilitation in the recovery of postparetic facial synkinesis (PPFS). To explore the presence of a persistent improvement in facial function out of the pharmacological effect of BoNT-A in subjects with established PPFS, after repeated sessions of BoNT-A injections combined with an educational facial training program using mirror biofeedback (BFB) exercises. Secondary objective was to investigate the trend of the presumed persistent improvement. Case-series study. Outpatient Clinic of Physical Medicine and Rehabilitation Unit. Twenty-seven patients (22 females; mean age 45±16 years) affected by an established peripheral facial palsy, treated with a minimum of three BoNT-A injections in association with mirror BFB rehabilitation. The interval between consecutive BoNT-A injections was at least five months. At baseline and before every BoNT-A injection+mirror BFB session (when the effect of the previous BoNT-A injection had vanished), patients were assessed with the Italian version of Sunnybrook Facial Grading System (SB). The statistical analysis considered SB composite and partial scores before each treatment session compared to the baseline scores. A significant improvement of the SB composite and partial scores was observed until the fourth session. Considering the "Symmetry of Voluntary Movement" partial score, the main improvement was observed in the muscles of the lower part of the face. In a chronic stage of postparetic facial synkinesis, patients may benefit from a combined therapy with repeated BoNT-A injections and an educational facial training program with mirror BFB exercises, gaining an improvement of the facial function up to the fourth session. This improvement reflects the acquired ability to use facial muscle correctly. It doesn't involve the injected muscles but those trained with mirror biofeedback exercises

  17. Repeated dose studies with pure Epigallocatechin-3-gallate demonstrated dose and route dependant hepatotoxicity with associated dyslipidemia

    Directory of Open Access Journals (Sweden)

    Balaji Ramachandran

    2016-01-01

    Full Text Available EGCG (Epigallocatechin-3-gallate is the major active principle catechin found in green tea. Skepticism regarding the safety of consuming EGCG is gaining attention, despite the fact that it is widely being touted for its potential health benefits, including anti-cancer properties. The lack of scientific data on safe dose levels of pure EGCG is of concern, while EGCG has been commonly studied as a component of GTE (Green tea extract and not as a single active constituent. This study has been carried out to estimate the maximum tolerated non-toxic dose of pure EGCG and to identify the treatment related risk factors. In a fourteen day consecutive treatment, two different administration modalities were compared, offering an improved [i.p (intraperitoneal] and limited [p.o (oral] bioavailability. A trend of dose and route dependant hepatotoxicity was observed particularly with i.p treatment and EGCG increased serum lipid profile in parallel to hepatotoxicity. Fourteen day tolerable dose of EGCG was established as 21.1 mg/kg for i.p and 67.8 mg/kg for p.o. We also observed that, EGCG induced effects by both treatment routes are reversible, subsequent to an observation period for further fourteen days after cessation of treatment. It was demonstrated that the severity of EGCG induced toxicity appears to be a function of dose, route of administration and period of treatment.

  18. Study on critical heat flux in narrow rectangular channel with repeated-rib roughness. 1. Experimental facility and preliminary experiments

    Energy Technology Data Exchange (ETDEWEB)

    Kinoshita, Hidetaka; Terada, Atsuhiko; Kaminaga, Masanori; Hino, Ryutaro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    2001-10-01

    In the design of a spallation target system, the water cooling system, for example a proton beam window and a safety hull, is used with narrow channels, in order to remove high heat flux and prevent lowering of system performance by absorption of neutron. And in narrow channel, heat transfer enhancement using 2-D rib is considered for reduction the cost of cooling component and decrease inventory of water in the cooling system, that is, decrease of the amount of irradiated water. But few studies on CHF with rib have been carried out. Experimental and analytical studies with rib-roughened test section, in 10:1 ratio of pitch to height, are being carried out in order to clarify the CHF in rib-roughened channel. This paper presents the review of previous researches on heat transfer in channel with rib roughness, overview of the test facility and the preliminary experimental and analytical results. As a result, wall friction factors were about 3 times as large as that of smooth channel, and heat transfer coefficients are about 2 times as large as that of smooth channel. The obtained CHF was as same as previous mechanistic model by Sudo. (author)

  19. Repeated head trauma is associated with smaller thalamic volumes and slower processing speed: the Professional Fighters' Brain Health Study.

    Science.gov (United States)

    Bernick, Charles; Banks, Sarah J; Shin, Wanyong; Obuchowski, Nancy; Butler, Sam; Noback, Michael; Phillips, Michael; Lowe, Mark; Jones, Stephen; Modic, Michael

    2015-08-01

    Cumulative head trauma may alter brain structure and function. We explored the relationship between exposure variables, cognition and MRI brain structural measures in a cohort of professional combatants. 224 fighters (131 mixed martial arts fighters and 93 boxers) participating in the Professional Fighters Brain Health Study, a longitudinal cohort study of licensed professional combatants, were recruited, as were 22 controls. Each participant underwent computerised cognitive testing and volumetric brain MRI. Fighting history including years of fighting and fights per year was obtained from self-report and published records. Statistical analyses of the baseline evaluations were applied cross-sectionally to determine the relationship between fight exposure variables and volumes of the hippocampus, amygdala, thalamus, caudate, putamen. Moreover, the relationship between exposure and brain volumes with cognitive function was assessed. Increasing exposure to repetitive head trauma measured by number of professional fights, years of fighting, or a Fight Exposure Score (FES) was associated with lower brain volumes, particularly the thalamus and caudate. In addition, speed of processing decreased with decreased thalamic volumes and with increasing fight exposure. Higher scores on a FES used to reflect exposure to repetitive head trauma were associated with greater likelihood of having cognitive impairment. Greater exposure to repetitive head trauma is associated with lower brain volumes and lower processing speed in active professional fighters. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  20. Fatigue In U12 Soccer-7 Players During Repeated One-Day Tournament Games - A Pilot Study.

    Science.gov (United States)

    Sanchez-Sanchez, Javier; Sanchez, Mario; Hernandez, Daniel; Ramirez-Campillo, Rodrigo; Martínez, Cristian; Nakamura, Fabio Y

    2017-07-12

    The aim of this study was to describe and compare the distances and displacement speeds of U12 Soccer-7 athletes during four tournament Soccer-7 games (TG) played in less than 24-h (experimental condition) with those recorded during two league Soccer-7 games (LG) with 24-h of rest prior to the match (control condition). Ten participants (age = 10.3 ± 0.5 years) were recruited for the study. Main data analyzed during games included distance completed relative to match duration (Drel), maximal velocity and distance completed at different running speeds (including acceleration, deceleration, standing, walking, jogging, medium-intensity running, high-intensity running and sprinting). For data collection during games, athletes wore a GPS unit. Different (p0.05) and during the two LG between 84.2 ± 10.9 m/min and 87.5 ± 9.9 m/min (P>0.05). Moreover, similar Drel was recorded during TG and LG (86.8 m/min and 85.9 m/min, respectively). Compared to LG, during TG maximal velocity was lower (23.0 km/h and 21.3 km/h, respectively; Pgame of the tournament, in the preceding games the distance covered at low speeds (3.1-8.0 km/h) was lower (37.7% and 32.4%, respectively; Pgames with less than 24-h of inter-day rest negatively affects displacement speeds distribution (but not overall relative distances) in U12 Soccer-7 athletes. These results may help to better plan training and competition schedules to youth players.

  1. Effects of ambient air pollution on functional status in patients with chronic congestive heart failure: a repeated-measures study

    Directory of Open Access Journals (Sweden)

    Phillips Russell S

    2007-09-01

    Full Text Available Abstract Background Studies using administrative data report a positive association between ambient air pollution and the risk of hospitalization for congestive heart failure (HF. Circulating levels of B-type natriuretic peptide (BNP are directly associated with cardiac hemodynamics and symptom severity in patients with HF and, therefore, serves as a marker of functional status. We tested the hypothesis that BNP levels would be positively associated with short-term changes in ambient pollution levels among 28 patients with chronic stable HF and impaired systolic function. Methods BNP was measured in whole blood at 0, 6, and 12 weeks. We used linear mixed models to evaluate the association between fine particulate matter (PM2.5, carbon monoxide, sulfur dioxide, nitrogen dioxide, ozone, and black carbon and log(BNP. Lags of 0 to 3 days were considered in separate models. We calculated the intraclass correlation coefficient and within-subject coefficient of variation as measures of reproducibility. Results We found no association between any pollutant and measures of BNP at any lag. For example, a 10 μg/m3 increase in PM2.5 was associated with a 0.8% (95% CI: -16.4, 21.5; p = 0.94 increase in BNP on the same day. The within-subject coefficient of variation was 45% on the natural scale and 9% on the log scale. Conclusion These results suggest that serial BNP measurements are unlikely to be useful in a longitudinal study of air pollution-related acute health effects. The magnitude of expected ambient air pollution health effects appears small in relation to the considerable within-person variability in BNP levels in this population.

  2. Characterization of regional left ventricular function in nonhuman primates using magnetic resonance imaging biomarkers: a test-retest repeatability and inter-subject variability study.

    Directory of Open Access Journals (Sweden)

    Smita Sampath

    Full Text Available Pre-clinical animal models are important to study the fundamental biological and functional mechanisms involved in the longitudinal evolution of heart failure (HF. Particularly, large animal models, like nonhuman primates (NHPs, that possess greater physiological, biochemical, and phylogenetic similarity to humans are gaining interest. To assess the translatability of these models into human diseases, imaging biomarkers play a significant role in non-invasive phenotyping, prediction of downstream remodeling, and evaluation of novel experimental therapeutics. This paper sheds insight into NHP cardiac function through the quantification of magnetic resonance (MR imaging biomarkers that comprehensively characterize the spatiotemporal dynamics of left ventricular (LV systolic pumping and LV diastolic relaxation. MR tagging and phase contrast (PC imaging were used to quantify NHP cardiac strain and flow. Temporal inter-relationships between rotational mechanics, myocardial strain and LV chamber flow are presented, and functional biomarkers are evaluated through test-retest repeatability and inter subject variability analyses. The temporal trends observed in strain and flow was similar to published data in humans. Our results indicate a dominant dimension based pumping during early systole, followed by a torsion dominant pumping action during late systole. Early diastole is characterized by close to 65% of untwist, the remainder of which likely contributes to efficient filling during atrial kick. Our data reveal that moderate to good intra-subject repeatability was observed for peak strain, strain-rates, E/circumferential strain-rate (CSR ratio, E/longitudinal strain-rate (LSR ratio, and deceleration time. The inter-subject variability was high for strain dyssynchrony, diastolic strain-rates, peak torsion and peak untwist rate. We have successfully characterized cardiac function in NHPs using MR imaging. Peak strain, average systolic strain

  3. Filamin repeat segments required for photosensory signalling in Dictyostelium discoideum

    Directory of Open Access Journals (Sweden)

    Ahmed Afsar U

    2007-11-01

    Full Text Available Abstract Background Filamin is an actin binding protein which is ubiquitous in eukaryotes and its basic structure is well conserved – an N-terminal actin binding domain followed by a series of repeated segments which vary in number in different organisms. D. discoideum is a well established model organism for the study of signalling pathways and the actin cytoskeleton and as such makes an excellent organism in which to study filamin. Ddfilamin plays a putative role as a scaffolding protein in a photosensory signalling pathway and this role is thought to be mediated by the unusual repeat segments in the rod domain. Results To study the role of filamin in phototaxis, a filamin null mutant, HG1264, was transformed with constructs each of which expressed wild type filamin or a mutant filamin with a deletion of one of the repeat segments. Transformants expressing the full length filamin to wild type levels completely rescued the phototaxis defect in HG1264, however if filamin was expressed at lower than wild type levels the phototaxis defect was not restored. The transformants lacking any one of the repeat segments 2–6 retained defective phototaxis and thermotaxis phenotypes, whereas transformants expressing filaminΔ1 exhibited a range of partial complementation of the phototaxis phenotype which was related to expression levels. Immunofluorescence microscopy showed that filamin lacking any of the repeat segments still localised to the same actin rich areas as wild type filamin. Ddfilamin interacts with RasD and IP experiments demonstrated that this interaction did not rely upon any single repeat segment or the actin binding domain. Conclusion This paper demonstrates that wild type levels of filamin expression are essential for the formation of functional photosensory signalling complexes and that each of the repeat segments 2–6 are essential for filamins role in phototaxis. By contrast, repeat segment 1 is not essential provided the mutated

  4. Socioeconomic inequalities in smoking in The Netherlands before and during the Global Financial Crisis: a repeated cross-sectional study.

    Science.gov (United States)

    Benson, Fiona E; Kuipers, Mirte A G; Nierkens, Vera; Bruggink, Jan-Willem; Stronks, Karien; Kunst, Anton E

    2015-05-06

    The Global Financial Crisis (GFC) increased levels of financial strain, especially in those of low socioeconomic status (SES). Financial strain can affect smoking behaviour. This study examines socioeconomic inequalities in current smoking and smoking cessation in The Netherlands before and during the Global Financial Crisis (GFC). Participants were 66,960 Dutch adults (≥ 18 years) who took part in the annual national Health Survey (2004-2011). Period was dichotomised: 'pre-' and 'during-GFC'. SES measures used were income, education and neighbourhood deprivation. Outcomes were current smoking rates (smokers/total population) and smoking cessation ratios (former smokers/ever smokers). Multilevel logistic regression models controlled for individual characteristics and tested for interaction between period and SES. In both periods, high SES respondents (in all indicators) had lower current smoking levels and higher cessation ratios than those of middle or low SES. Inequalities in current smoking increased significantly in poorly educated adults of 45-64 years of age (Odds Ratio (OR) low educational level compared with high: 2.00[1.79-2.23] compared to pre-GFC 1.67[1.50-1.86], p for interaction = 0.02). Smoking cessation inequalities by income in 18-30 year olds increased with borderline significance during the GFC (OR low income compared to high income: 0.73[0.58-0.91]) compared to pre-GFC (OR: 0.98[0.80-1.20]), p for interaction = 0.051). Overall, socioeconomic inequalities in current smoking and smoking cessation were unchanged during the GFC. However, current smoking inequalities by education, and smoking cessation inequalities by income, increased in specific age groups. Increased financial strain caused by the crisis may disproportionately affect smoking behaviour in some disadvantaged groups.

  5. Coevolution between simple sequence repeats (SSRs and virus genome size

    Directory of Open Access Journals (Sweden)

    Zhao Xiangyan

    2012-08-01

    Full Text Available Abstract Background Relationship between the level of repetitiveness in genomic sequence and genome size has been investigated by making use of complete prokaryotic and eukaryotic genomes, but relevant studies have been rarely made in virus genomes. Results In this study, a total of 257 viruses were examined, which cover 90% of genera. The results showed that simple sequence repeats (SSRs is strongly, positively and significantly correlated with genome size. Certain repeat class is distributed in a certain range of genome sequence length. Mono-, di- and tri- repeats are widely distributed in all virus genomes, tetra- SSRs as a common component consist in genomes which more than 100 kb in size; in the range of genome  Conclusions We conducted this research standing on the height of the whole virus. We concluded that genome size is an important factor in affecting the occurrence of SSRs; hosts are also responsible for the variances of SSRs content to a certain degree.

  6. Burden of hospital admission and repeat angiography in angina pectoris patients with and without coronary artery disease: a registry-based cohort study.

    Directory of Open Access Journals (Sweden)

    Lasse Jespersen

    Full Text Available AIMS: To evaluate risk of hospitalization due to cardiovascular disease (CVD and repeat coronary angiography (CAG in stable angina pectoris (SAP with no obstructive coronary artery disease (CAD versus obstructive CAD, and asymptomatic reference individuals. METHODS AND RESULTS: We followed 11,223 patients with no prior CVD having a first-time CAG in 1998-2009 due to SAP symptoms and 5,695 asymptomatic reference individuals from the Copenhagen City Heart Study through registry linkage for 7.8 years (median. In recurrent event survival analysis, patients with SAP had 3-4-fold higher risk of hospitalization for CVD irrespective of CAG findings and cardiovascular comorbidity. Multivariable adjusted hazard ratios(95%CI for patients with angiographically normal coronary arteries was 3.0(2.5-3.5, for angiographically diffuse non-obstructive CAD 3.9(3.3-4.6 and for 1-3-vessel disease 3.6-4.1(range(all P<0.001. Mean accumulated hospitalization time was 3.5(3.0-4.0(days/10 years follow-up in reference individuals and 4.5(3.8-5.2/7.0(5.4-8.6/6.7(5.2-8.1/6.1(5.2-7.4/8.6(6.6-10.7 in patients with angiographically normal coronary arteries/angiographically diffuse non-obstructive CAD/1-, 2-, and 3-vessel disease, respectively (all P<0.05, age-adjusted. SAP symptoms predicted repeat CAG with multivariable adjusted hazard ratios for patients with angiographically normal coronary arteries being 2.3(1.9-2.9, for angiographically diffuse non-obstructive CAD 5.5(4.4-6.8 and for obstructive CAD 6.6-9.4(range(all P<0.001. CONCLUSIONS: Patients with SAP symptoms and angiographically normal coronary arteries or angiographically diffuse non-obstructive CAD suffer from considerably greater CVD burdens in terms of hospitalization for CVD and repeat CAG compared with asymptomatic reference individuals even after adjustment for cardiac risk factors and exclusion of cardiovascular comorbidity as cause. Contrary to common perception, excluding obstructive CAD by CAG in such

  7. Facilitating the Development and Evaluation of a Citizen Science Web Site: A Case Study of Repeat Photography and Climate Change in Southwest Alaska's National Parks

    Science.gov (United States)

    Mullen, Karina C.; Newman, Gregory; Thompson, Jessica L.

    2013-01-01

    Interviews with national park visitors across the country revealed that climate change education through place-based, hands-on learning using repeat photographs and technology is appealing to park visitors. This manuscript provides a summary of the development of a repeat photography citizen science Web site for national parks in Southwest Alaska.…

  8. Facilitating the Development and Evaluation of a Citizen Science Web Site: A Case Study of Repeat Photography and Climate Change in Southwest Alaska's National Parks

    Science.gov (United States)

    Mullen, Karina C.; Newman, Gregory; Thompson, Jessica L.

    2013-01-01

    Interviews with national park visitors across the country revealed that climate change education through place-based, hands-on learning using repeat photographs and technology is appealing to park visitors. This manuscript provides a summary of the development of a repeat photography citizen science Web site for national parks in Southwest Alaska.…

  9. Repeatability and Reproducibility of Virtual Subjective Refraction.

    Science.gov (United States)

    Perches, Sara; Collados, M Victoria; Ares, Jorge

    2016-10-01

    To establish the repeatability and reproducibility of a virtual refraction process using simulated retinal images. With simulation software, aberrated images corresponding with each step of the refraction process were calculated following the typical protocol of conventional subjective refraction. Fifty external examiners judged simulated retinal images until the best sphero-cylindrical refraction and the best visual acuity were achieved starting from the aberrometry data of three patients. Data analyses were performed to assess repeatability and reproducibility of the virtual refraction as a function of pupil size and aberrometric profile of different patients. SD values achieved in three components of refraction (M, J0, and J45) are lower than 0.25D in repeatability analysis. Regarding reproducibility, we found SD values lower than 0.25D in the most cases. When the results of virtual refraction with different pupil diameters (4 and 6 mm) were compared, the mean of differences (MoD) obtained were not clinically significant (less than 0.25D). Only one of the aberrometry profiles with high uncorrected astigmatism shows poor results for the M component in reproducibility and pupil size dependence analysis. In all cases, vision achieved was better than 0 logMAR. A comparison between the compensation obtained with virtual and conventional subjective refraction was made as an example of this application, showing good quality retinal images in both processes. The present study shows that virtual refraction has similar levels of precision as conventional subjective refraction. Moreover, virtual refraction has also shown that when high low order astigmatism is present, the refraction result is less precise and highly dependent on pupil size.

  10. An X-Ray Study of Supernova Remnant N49 and Soft Gamma-Ray Repeater 0526-66 in the Large Magellanic Cloud

    CERN Document Server

    Park, Sangwook; Slane, Patrick O; Burrows, David N; Lee, Jae-Joon; Mori, Koji

    2012-01-01

    We report on the results from our deep Chandra observation (120 ks) of the supernova remnant (SNR) N49 and soft Gamma-ray repeater (SGR) 0526-66 in the Large Magellanic Cloud. We firmly establish the detection of an ejecta "bullet" beyond the southwestern boundary of N49. The X-ray spectrum of the bullet is distinguished from that of the main SNR shell, showing significantly enhanced Si and S abundances. We also detect an ejecta feature in the eastern shell, which shows metal overabundances similar to those of the bullet. If N49 was produced by a core-collapse explosion of a massive star, the detected Si-rich ejecta may represent explosive O-burning or incomplete Si-burning products from deep interior of the supernova. On the other hand, the observed Si/S abundance ratio in the ejecta may favor Type Ia origin for N49. We refine the Sedov age of N49, tau_Sed ~ 4800 yr, with the explosion energy E_0 ~ 1.8 x 10^51 erg. Our blackbody (BB) + power law (PL) model for the quiescent X-ray emission from SGR 0526-66 in...

  11. Evaluation of the repeated-dose liver and gastrointestinal tract micronucleus assays with 22 chemicals using young adult rats: summary of the collaborative study by the Collaborative Study Group for the Micronucleus Test (CSGMT)/The Japanese Environmental Mutagen Society (JEMS) - Mammalian Mutagenicity Study Group (MMS).

    Science.gov (United States)

    Hamada, Shuichi; Ohyama, Wakako; Takashima, Rie; Shimada, Keisuke; Matsumoto, Kazumi; Kawakami, Satoru; Uno, Fuyumi; Sui, Hajime; Shimada, Yasushi; Imamura, Tadashi; Matsumura, Shoji; Sanada, Hisakazu; Inoue, Kenji; Muto, Shigeharu; Ogawa, Izumi; Hayashi, Aya; Takayanagi, Tomomi; Ogiwara, Yosuke; Maeda, Akihisa; Okada, Emiko; Terashima, Yukari; Takasawa, Hironao; Narumi, Kazunori; Wako, Yumi; Kawasako, Kazufumi; Sano, Masaki; Ohashi, Nobuyuki; Morita, Takeshi; Kojima, Hajime; Honma, Masamitsu; Hayashi, Makoto

    2015-03-01

    The repeated-dose liver micronucleus (RDLMN) assay using young adult rats has the potential to detect hepatocarcinogens. We conducted a collaborative study to assess the performance of this assay and to evaluate the possibility of integrating it into general toxicological studies. Twenty-four testing laboratories belonging to the Mammalian Mutagenicity Study Group, a subgroup of the Japanese Environmental Mutagen Society, participated in this trial. Twenty-two model chemicals, including some hepatocarcinogens, were tested in 14- and/or 28-day RDLMN assays. As a result, 14 out of the 16 hepatocarcinogens were positive, including 9 genotoxic hepatocarcinogens, which were reported negative in the bone marrow/peripheral blood micronucleus (MN) assay by a single treatment. These outcomes show the high sensitivity of the RDLMN assay to hepatocarcinogens. Regarding the specificity, 4 out of the 6 non-liver targeted genotoxic carcinogens gave negative responses. This shows the high organ specificity of the RDLMN assay. In addition to the RDLMN assay, we simultaneously conducted gastrointestinal tract MN assays using 6 of the above carcinogens as an optional trial of the collaborative study. The MN assay using the glandular stomach, which is the first contact site of the test chemical when administered by oral gavage, was able to detect chromosomal aberrations with 3 test chemicals including a stomach-targeted carcinogen. The treatment regime was the 14- and/or 28-day repeated-dose, and the regime is sufficiently promising to incorporate these methods into repeated-dose toxicological studies. The outcomes of our collaborative study indicated that the new techniques to detect chromosomal aberrations in vivo in several tissues worked successfully.

  12. Isolation and characterization of human brain genes with (CCA){sub n} trinucleotide repeats

    Energy Technology Data Exchange (ETDEWEB)

    Longshore, J.W.; Finley, W.H.; Descartes, M. [Univ. of Alabama, Birmingham, AL (United States)] [and others

    1994-09-01

    Expansion of trinucleotide repeats has been described as a new form of mutation. To date, only the expansion of (CGG){sub n} and (CAG){sub n} repeats have been associated with disease. Expansion of (CAG){sub n} repeats has been found to cause Huntington`s disease, Kennedy`s disease, myotonic dystrophy, spinocerebellar ataxia type 1, and dentatorubral pallidoluysian atrophy. (CGG){sub n} repeat expansion has been implicated in the fragile X syndrome and FRAXE mental retardation. In an effort to identify other potential repeats as candidates for expansion, a DNA linguistics approach was used to study 10 Mb of human DNA sequences in GenBank. Our study found the (CCA){sub n} repeat and the disease-associated (CGG){sub n} and (CAG){sub n} repeats to be over-represented in the human genome. The (CCA){sub n} repeat also shares other characteristics with (CGG){sub n} and (CAG){sub n}, making it a good candidate for expansion. Trinucleotide repeat numbers in disease-associated genes are normally polymorphic in a population. Therefore, by studying genes for polymorphisms, candidate genes may be identified. Twelve sequences previously deposited in GenBank with at least five tandem copies of (CCA) were studied and no polymorphisms were found. To identify other candidate genes, a human hippocampus cDNA library was screened with a (CCA){sub 8} probe. This approach identified 19 novel expressed sequences having long tandem (CCA){sub n} repeats which are currently under investigation for polymorphisms. Genes with polymorphic repeats may serve as markers for linkage studies or as candidate genes for genetic diseases showing anticipation.

  13. Age, CAG repeat length, and clinical progression in Huntington's disease.

    Science.gov (United States)

    Rosenblatt, Adam; Kumar, Brahma V; Mo, Alisa; Welsh, Claire S; Margolis, Russell L; Ross, Christopher A

    2012-02-01

    The objective of this study was to further explore the effect of CAG repeat length on the rate of clinical progression in patients with Huntington's disease. The dataset included records for 569 subjects followed prospectively at the Baltimore Huntington's Disease Center. Participants were seen for a mean of 7.1 visits, with a mean follow-up of 8.2 years. Subjects were evaluated using the Quantified Neurologic Examination and its Motor Impairment subscale, the Mini-Mental State Examination, and the Huntington's disease Activities of Daily Living Scale. By itself, CAG repeat length showed a statistically significant but small effect on the progression of all clinical measures. Contrary to our previous expectations, controlling for age of onset increased the correlation between CAG repeat length and progression of all variables by 69% to 159%. Graphical models further supported the idea that individuals with smaller triplet expansions experience a more gradual decline. CAG repeat length becomes an important determinant of clinical prognosis when accounting for age of onset. This suggests that the aging process itself influences clinical outcomes in Huntington's disease. Inconsistent results in prior studies examining CAG repeat length and progression may indeed reflect a lack of age adjustment.

  14. 重复荷载作用下钢筋混凝土锚固端黏结性能试验研究%Test study on bonding performance of reinforced concrete anchorage zone under repeated loads

    Institute of Scientific and Technical Information of China (English)

    蒋德稳; 邱洪兴

    2012-01-01

    通过对23个钢筋混凝土试件的静载和重复荷载作用下拔出试验,研究了重复荷载作用下钢筋峰值应变和残余应变、自由端和加载端滑移发展特征,得到了重复荷载作用下黏结应力-滑移滞回曲线变化规律。运用试验测定的钢筋应变,计算了静载和重复荷载作用下锚固端黏结应力分布曲线,总结了重复荷载作用下峰值黏结应力、残余黏结应力变化特征,分析了锚固端黏结应力分布机理。研究结果表明:重复荷载作用后黏结强度并不受重复次数影响;重复荷载作用下,自由端、加载端峰值滑移量和残余滑移量发展均符合疲劳破坏的三阶段特征;当滑移量累积到静载作用下破坏时的峰值滑移量时,发生黏结疲劳破坏;随着重复次数的增加,黏结应力沿锚固长度的分布出现明显的双峰现象,最大黏结应力位于距离加载端和自由端约1/4锚固长度位置处。研究结果可为深入研究混凝土结构疲劳性能提供依据。%23 reinforced concrete Rebar' s peak and residual stress, pull-out specimens were tested under monotonic loading and repeated loading peak slip and residual slip at the loading end and free end were inspected in this test. The bonding stress-slip hysteretic curve was obtained. According to the rebar stress data, the distribution curve in the anchorage was calculated under monotonic loading and repeated loading. Variation characteristics of peak and residual bonding stress under repeated loads were summarized, and bonding stress distribution mechanism was analyzed. Research result shows that bonding strength is not influenced much by repeated loading. The peak slip and residual slip follow the three stage rule of fatigue failure. Bonding fatigue failure occurs when the rebar slippage under repeated loading reaches the maximum slippage under monotonic loading. With the increase of repeating times, the obvious double peak phenomenon was shown in

  15. Detection of dispersed short tandem repeats using reversible jump Markov chain Monte Carlo.

    Science.gov (United States)

    Liang, Tong; Fan, Xiaodan; Li, Qiwei; Li, Shuo-Yen R

    2012-10-01

    Tandem repeats occur frequently in biological sequences. They are important for studying genome evolution and human disease. A number of methods have been designed to detect a single tandem repeat in a sliding window. In this article, we focus on the case that an unknown number of tandem repeat segments of the same pattern are dispersively distributed in a sequence. We construct a probabilistic generative model for the tandem repeats, where the sequence pattern is represented by a motif matrix. A Bayesian approach is adopted to compute this model. Markov chain Monte Carlo (MCMC) algorithms are used to explore the posterior distribution as an effort to infer both the motif matrix of tandem repeats and the location of repeat segments. Reversible jump Markov chain Monte Carlo (RJMCMC) algorithms are used to address the transdimensional model selection problem raised by the variable number of repeat segments. Experiments on both synthetic data and real data show that this new approach is powerful in detecting dispersed short tandem repeats. As far as we know, it is the first work to adopt RJMCMC algorithms in the detection of tandem repeats.

  16. Oxygen uptake during repeated-sprint exercise.

    Science.gov (United States)

    McGawley, Kerry; Bishop, David J

    2015-03-01

    Repeated-sprint ability appears to be influenced by oxidative metabolism, with reductions in fatigue and improved sprint times related to markers of aerobic fitness. The aim of the current study was to measure the oxygen uptake (VO₂) during the first and last sprints during two, 5 × 6-s repeated-sprint bouts. Cross-sectional study. Eight female soccer players performed two, consecutive, 5 × 6-s maximal sprint bouts (B1 and B2) on five separate occasions, in order to identify the minimum time (trec) required to recover total work done (Wtot) in B1. On a sixth occasion, expired air was collected during the first and last sprint of B1 and B2, which were separated by trec. The trec was 10.9 ± 1.1 min. The VO₂ during the first sprint was significantly less than the last sprint in each bout (psprint (measured in kJ) was significantly related to VO₂max in both B1 (r=0.81, p=0.015) and B2 (r=0.93, p=0.001). In addition, the VO₂ attained in the final sprint was not significantly different from VO₂max in B1 (p=0.284) or B2 (p=0.448). The current study shows that the VO₂ increases from the first to the last of 5 × 6-s sprints and that VO₂max may be a limiting factor to performance in latter sprints. Increasing V˙O₂max in team-sport athletes may enable increased aerobic energy delivery, and consequently work done, during a bout of repeated sprints. Copyright © 2014 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

  17. Evaluating post-Katrina recovery in Mississippi using repeat photography.

    Science.gov (United States)

    Burton, Christopher; Mitchell, Jerry T; Cutter, Susan L

    2011-07-01

    Hurricane Katrina of August 2005 had extensive consequences for the state of Mississippi in the United States. Widespread infrastructure and property damage, massive social dislocation, and ecological loss remain among the many challenges faced by communities as they work towards 'normalcy'. This study employs repeat photography to understand differential recovery from Hurricane Katrina in Mississippi. Revealing change with conventional landscape photography, a process known as repeat photography, is common in the natural sciences. Simply stated, repeat photography is the practice of re-photographing the same scene as it appears in an earlier photograph. Photographs were taken at 131 sites every six months over a three-year period. Each photograph was assigned a recovery score and a spatially interpolated recovery surface was generated for each time period. The mapped and graphed results show disparities in the progression of recovery: some communities quickly entered the rebuilding process whereas others have lagged far behind.

  18. Archery performance level and repeatability of event-related EMG.

    Science.gov (United States)

    Soylu, A R; Ertan, H; Korkusuz, F

    2006-12-01

    The purpose of the current study was to compare the repeatability of electromyographic linear envelopes (LE) of archery groups. Surface electromyography (EMG) signals of musculus flexor digitorum superficialis (MFDS) and extensor digitorum (MED) of 23 participants (seven skilled, six beginner archers and ten non-archers) were recorded during archery shooting. Two-second periods (clicker falls at first second) of 12 shots' EMG data were recorded, full-wave rectified and filtered (60 ms moving-average filter) for each participant's drawing arm. Repeatability was investigated by using a statistical criterion, variance ratio (VR). Archers' performances were evaluated in terms of FITA scores. The results showed that FITA scores were significantly correlated to the VRs of MFDS and MED. EMG LEs were more repeatable among archers than non-archers. Therefore, we inferred that VRs of MFDS and MED might be important variables for (a) assessing shooting techniques, (b) evaluation of archers' progress, and (c) selection of talented archers.

  19. Repeated high-intensity exercise in professional rugby union.

    Science.gov (United States)

    Austin, Damien; Gabbett, Tim; Jenkins, David

    2011-07-01

    The aim of the present study was to describe the frequency, duration, and nature of repeated high-intensity exercise in Super 14 rugby union. Time-motion analysis was used during seven competition matches over the 2008 and 2009 Super 14 seasons; five players from each of four positional groups (front row forwards, back row forwards, inside backs, and outside backs) were assessed (20 players in total). A repeated high-intensity exercise bout was considered to involve three or more sprints, and/or tackles and/or scrum/ruck/maul activities within 21 s during the same passage of play. The range of repeated high-intensity exercise bouts for each group in a match was as follows: 11-18 for front row forwards, 11-21 for back row forwards, 13-18 for inside backs, and 2-11 for outside backs. The durations of the most intense repeated high-intensity exercise bouts for each position ranged from 53 s to 165 s and the minimum recovery periods between repeated high-intensity exercise bouts ranged from 25 s for the back row forwards to 64 s for the front row forwards. The present results show that repeated high-intensity exercise bouts vary in duration and activities relative to position but all players in a game will average at least 10 changes in activity in the most demanding bouts and complete at least one tackle and two sprints. The most intense periods of activity are likely to last as long as 120 s and as little as 25 s recovery may separate consecutive repeated high-intensity exercise bouts. The present findings can be used by coaches to prepare their players for the most demanding passages of play likely to be experienced in elite rugby union.

  20. DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats.

    Science.gov (United States)

    de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas

    2015-11-16

    Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats.

  1. Estimation of acute oral toxicity using the No Observed Adverse Effect Level (NOAEL) from the 28 day repeated dose toxicity studies in rats.

    Science.gov (United States)

    Bulgheroni, Anna; Kinsner-Ovaskainen, Agnieszka; Hoffmann, Sebastian; Hartung, Thomas; Prieto, Pilar

    2009-02-01

    Acute systemic toxicity is one of the areas of particular concern due to the 2009 deadline set by the 7th Amendment of the Cosmetics Directive (76/768/EEC), which introduces a testing and marketing ban of cosmetic products with ingredients tested on animals. The scientific community is putting considerable effort into developing and validating non-animal alternatives in this area. However, it is unlikely that validated and regulatory accepted alternative methods and/or strategies will be available in March 2009. Following the initiatives undertaken in the pharmaceutical industry to waive the acute oral toxicity testing before going to clinical studies by using information from other in vivo studies, we proposed an approach to identify non-toxic compounds (LD50>2000mg/kg) using information from 28 days repeated dose toxicity studies. Taking into account the high prevalence of non-toxic substances (87%) in the New Chemicals Database, it was possible to set a NOAEL threshold of 200mg/kg that allowed the correct identification of 63% of non-toxic compounds, while testing of cosmetic ingredients.

  2. Common interruptions in the repeating tripeptide sequence of non-fibrillar collagens: sequence analysis and structural studies on triple-helix peptide models.

    Science.gov (United States)

    Thiagarajan, Geetha; Li, Yingjie; Mohs, Angela; Strafaci, Christopher; Popiel, Magdalena; Baum, Jean; Brodsky, Barbara

    2008-02-22

    Interruptions in the repeating (Gly-X1-X2)(n) amino acid sequence pattern are found in the triple-helix domains of all non-fibrillar collagens, and perturbations to the triple-helix at such sites are likely to play a role in collagen higher-order structure and function. This study defines the sequence features and structural consequences of the most common interruption, where one residue is missing from the tripeptide pattern, Gly-X1-X2-Gly-AA(1)-Gly-X1-X2, designated G1G interruptions. Residues found within G1G interruptions are predominantly hydrophobic (70%), followed by a significant amount of charged residues (16%), and the Gly-X1-X2 triplets flanking the interruption are atypical. Studies on peptide models indicate the degree of destabilization is much greater when Pro is in the interruption, GP, than when hydrophobic residues (GF, GY) are present, and a rigid Gly-Pro-Hyp tripeptide adjacent to the interruption leads to greater destabilization than a flexible Gly-Ala-Ala sequence. Modeling based on NMR data indicates the Phe residue within a GF interruption is located on the outside of the triple helix. The G1G interruptions resemble a previously studied collagen interruption GPOGAAVMGPO, designated G4G-type, in that both are destabilizing, but allow continuation of rod-like triple helices and maintenance of the single residue stagger throughout the imperfection, with a loss of axial register of the superhelix on both sides. Both kinds of interruptions result in a highly localized perturbation in hydrogen bonding and dihedral angles, but the hydrophobic residue of a G4G interruption packs near the central axis of the superhelix, while the hydrophobic residue of a G1G interruption is located on the triple-helix surface. The different structural consequences of G1G and G4G interruptions in the repeating tripeptide sequence pattern suggest a physical basis for their differential susceptibility to matrix metalloproteinases in type X collagen.

  3. Polymorphic GGC repeat differentially regulates human reelin gene expression levels.

    Science.gov (United States)

    Persico, A M; Levitt, P; Pimenta, A F

    2006-10-01

    The human gene encoding Reelin (RELN), a pivotal protein in neurodevelopment, includes a polymorphic GGC repeat in its 5' untranslated region (UTR). CHO cells transfected with constructs encompassing the RELN 5'UTR with 4-to-13 GGC repeats upstream of the luciferase reporter gene show declining luciferase activity with increasing GGC repeat number (P autism.

  4. Evidence of cormorant-induced mortality, disparate migration strategies and repeatable circadian rhythm in the endangered North Sea houting (Coregonus oxyrinchus): A telemetry study mapping the postspawning migration

    DEFF Research Database (Denmark)

    Jensen, Lasse Fast; Rognon, Paul C.B.; Aarestrup, Kim

    2017-01-01

    , possibly indicating constrained navigation through the lakes. The migration into the Wadden Sea correlated with temperature indicating osmoregulatory constraints of sea entry. Unlike most salmonid species, migration occurred both day and night. Moreover, fish exhibited repeatable individual differences...

  5. Simulated Conversations With Virtual Humans to Improve Patient-Provider Communication and Reduce Unnecessary Prescriptions for Antibiotics: A Repeated Measure Pilot Study

    Science.gov (United States)

    2017-01-01

    Background Despite clear evidence that antibiotics do not cure viral infections, the problem of unnecessary prescribing of antibiotics in ambulatory care persists, and in some cases, prescribing patterns have increased. The overuse of antibiotics for treating viral infections has created numerous economic and clinical consequences including increased medical costs due to unnecessary hospitalizations, antibiotic resistance, disruption of gut bacteria, and obesity. Recent research has underscored the importance of collaborative patient-provider communication as a means to reduce the high rates of unnecessary prescriptions for antibiotics. However, most patients and providers do not feel prepared to engage in such challenging conversations. Objectives The aim of this pilot study was to assess the ability of a brief 15-min simulated role-play conversation with virtual humans to serve as a preliminary step to help health care providers and patients practice, and learn how to engage in effective conversations about antibiotics overuse. Methods A total of 69 participants (35 providers and 34 patients) completed the simulation once in one sitting. A pre-post repeated measures design was used to assess changes in patients’ and providers’ self-reported communication behaviors, activation, and preparedness, intention, and confidence to effectively communicate in the patient-provider encounter. Changes in patients’ knowledge and beliefs regarding antibiotic use were also evaluated. Results Patients experienced a short-term positive improvement in beliefs about appropriate antibiotic use for infection (F1,30=14.10, P=.001). Knowledge scores regarding the correct uses of antibiotics improved immediately postsimulation, but decreased at the 1-month follow-up (F1,30=31.16, P.10) Patients with lower levels of activation exhibited positive, short-term benefits in increased intent and confidence to discuss their needs and ask questions in the clinic visit, positive attitudes

  6. Repeatability of Cryogenic Multilayer Insulation

    Science.gov (United States)

    Johnson, W. L.; Vanderlaan, M.; Wood, J. J.; Rhys, N. O.; Guo, W.; Van Sciver, S.; Chato, D. J.

    2017-01-01

    Due to the variety of requirements across aerospace platforms, and one off projects, the repeatability of cryogenic multilayer insulation has never been fully established. The objective of this test program is to provide a more basic understanding of the thermal performance repeatability of MLI systems that are applicable to large scale tanks. There are several different types of repeatability that can be accounted for: these include repeatability between multiple identical blankets, repeatability of installation of the same blanket, and repeatability of a test apparatus. The focus of the work in this report is on the first two types of repeatability. Statistically, repeatability can mean many different things. In simplest form, it refers to the range of performance that a population exhibits and the average of the population. However, as more and more identical components are made (i.e. the population of concern grows), the simple range morphs into a standard deviation from an average performance. Initial repeatability testing on MLI blankets has been completed at Florida State University. Repeatability of five GRC provided coupons with 25 layers was shown to be +/- 8.4 whereas repeatability of repeatedly installing a single coupon was shown to be +/- 8.0. A second group of 10 coupons have been fabricated by Yetispace and tested by Florida State University, through the first 4 tests, the repeatability has been shown to be +/- 16. Based on detailed statistical analysis, the data has been shown to be statistically significant.

  7. Long-term elastic durability of polymer matrix composite materials after repeated steam sterilization.

    Science.gov (United States)

    Chong, Alexander C M; Fischer, Gustav; Dart, Bradley R; Wooley, Paul H

    2015-11-01

    We compared the durability of 3 different selected composite materials that underwent repeated steam sterilization with the durability of traditional metal materials. Composite materials Tepex, CFR-PPS (carbon-fiber-reinforced polyphenylene sulfide), and HTN-53 (Zytel HTN53G50HSLR NC010) were evaluated for durability and water retention after repeated steam sterilization. These composites were compared with stainless steel and aluminum. The structural properties of these materials were measured (short-beam load-to-failure and cyclic compression loading tests) before, during, and after repeated steam sterilization. The relative radiographic density of these materials was also compared. There was no significant difference in the moisture retention of these composite materials before and after repeated sterilization. The composite materials were significantly more radiolucent than the metals. For all the composite materials, load to failure deteriorated after repeated sterilization. The cyclic compression loading tests showed HTN-53 had the poorest performance, with complete failure after 400 cycles of repeated sterilization. CFR-PPS performed slightly better, with 33% failure at final testing. Tepex had no failures at final testing. Although HTN-53 has shown promise in other orthopedic applications, its performance after repeated sterilization was relatively poor. Tepex showed the most potential for durability after repeated sterilization. Further study is needed to identify specific applications for these materials in the orthopedic industry.

  8. The effects of repeated administration of camphor-crataegus berry extract combination on blood pressure and on attentional performance - a randomized, placebo-controlled, double-blind study.

    Science.gov (United States)

    Erfurt, L; Schandry, R; Rubenbauer, S; Braun, U

    2014-09-25

    The present study investigated the effects of repeated administration of Korodin(®), a combination of camphor and crataegus berry extract, on blood pressure and attentional functioning. This study was conducted based on a randomized, placebo-controlled, double-blind design. 54 persons participated (33 female, 21 male) with a mean age of 24.3 years. Blood pressure and body mass index were in the normal range. Participants received 20 drops of either Korodin(®) or a placebo for four times with interjacent time intervals of about 10 min. Blood pressure was measured sphygmomanometrically before and after each administration. Attentional performance was quantified by using two paper-and-pencil tests, the d2 Test of Attention and Digit Symbol Test. Greater increases in blood pressure occurred after the four Korodin(®) administrations in comparison to the four placebo administrations. The performance in two parameters of d2 Test of Attention was consistently superior after the intake of Korodin(®). The excellent tolerability and safety of Korodin(®), even after a total consumption of 80 drops, was confirmed. Copyright © 2014 Elsevier GmbH. All rights reserved.

  9. Determination of the ideal sampling technique to reduce repeated procedures:a comparative study including 393 fine-needle aspirations for thyroid nodules.

    Science.gov (United States)

    Uzunkaya, Fatih; Özden, Ahmet

    2017-02-27

    Fine-needle aspiration biopsy is an established method for the evaluation of thyroid nodules, but it has not been standardized worldwide yet. Adequacy of the aspirations is affected by several factors. The aim of this study is to determine the main factors affecting the adequacy and to suggest a procedural technique expected to reduce repeated procedures. A total of 393 aspiration procedures performed using either 22-gauge or 27-gauge needles were included in the study. The samplings were classified as inadequate or adequate according to the cytopathological reports, and results were compared. The rate of adequate samplings was higher in the 27-gauge group and the difference was statistically significant. Neither the size of nodules nor the number of slides used for smearing affected the adequacy. There was not a statistically significant relation between the needle size and the nodule size or the number of slides in terms of adequacy. Needle size is an important factor that affects the adequacy of samplings. The nodule size and the number of slides do not affect the adequacy. However, bloody and thicker smears are difficult for pathologists to evaluate and result in inadequacy.

  10. Repeatability of clades as a criterion of reliability: a case study for molecular phylogeny of Acanthomorpha (Teleostei) with larger number of taxa.

    Science.gov (United States)

    Chen, Wei-Jen; Bonillo, Céline; Lecointre, Guillaume

    2003-02-01

    Although much progress has been made recently in teleostean phylogeny, relationships among the main lineages of the higher teleosts (Acanthomorpha), containing more than 60% of all fish species, remain poorly defined. This study represents the most extensive taxonomic sampling effort to date to collect new molecular characters for phylogenetic analysis of acanthomorph fishes. We compiled and analyzed three independent data sets, including: (i) mitochondrial ribosomal fragments from 12S and 16s (814bp for 97 taxa); (ii) nuclear ribosomal 28S sequences (847bp for 74 taxa); and (iii) a nuclear protein-coding gene, rhodopsin (759bp for 86 taxa). Detailed analyses were conducted on each data set separately and the principle of taxonomic congruence without consensus trees was used to assess confidence in the results as follows. Repeatability of clades from separate analyses was considered the primary criterion to establish reliability, rather than bootstrap proportions from a single combined (total evidence) data matrix. The new and reliable clades emerging from this study of the acanthomorph radiation were: Gadiformes (cods) with Zeioids (dories); Beloniformes (needlefishes) with Atheriniformes (silversides); blenioids (blennies) with Gobiesocoidei (clingfishes); Channoidei (snakeheads) with Anabantoidei (climbing gouramies); Mastacembeloidei (spiny eels) with Synbranchioidei (swamp-eels); the last two pairs of taxa grouping together, Syngnathoidei (aulostomids, macroramphosids) with Dactylopteridae (flying gurnards); Scombroidei (mackerels) plus Stromatoidei plus Chiasmodontidae; Ammodytidae (sand lances) with Cheimarrhichthyidae (torrentfish); Zoarcoidei (eelpouts) with Cottoidei; Percidae (perches) with Notothenioidei (Antarctic fishes); and a clade grouping Carangidae (jacks), Echeneidae (remoras), Sphyraenidae (barracudas), Menidae (moonfish), Polynemidae (threadfins), Centropomidae (snooks), and Pleuronectiformes (flatfishes).

  11. 26-week repeated oral dose toxicity study of UP446, a combination of defined extracts of Scutellaria baicalensis and Acacia catechu, in beagle dogs.

    Science.gov (United States)

    Yimam, Mesfin; Lee, Young Chul; Jia, Qi

    2016-07-01

    The needs for relatively safe botanical alternatives to relieve symptoms associated to arthritis have continued to grow in parallel with the ageing population. UP446, a standardized bioflavonoid composition from the roots of Scutellaria baicalensis and the heartwoods of Acacia catechu, has been used as over the counter joint care dietary supplements and a prescription medical food. Significant safety data have been documented in rodents and human for this composition. Here we evaluated the potential adverse effects of orally administered UP446 in beagle dogs following a 26-week repeated oral dose toxicity study. UP446 at doses of 250, 500 and 1000 mg/kg/day were administered orally to beagle dogs for 26 weeks. A 4-week recovery group from the high dose (1000 mg/kg) and vehicle treated groups were included. No morbidity or mortality was observed for the duration of the study. No significant differences between groups in body weights, food consumption, ophthalmological examinations, electrocardiograms, urinalysis, hematology, clinical chemistry, organ weights, gross pathology and histopathology were documented. Emesis, loose feces and diarrhea were noted in both genders at the 1000 mg/kg treatment groups. These clinical signs were considered to be reversible as they were not evident in the recovery period. In conclusion, the no-observed-adverse-effect-level (NOAEL) of UP446 was considered to be 500 mg/kg/day both in male and female beagle dogs.

  12. Statistical Properties of repeating FRB 121102

    CERN Document Server

    Wang, F Y

    2016-01-01

    Fast radio bursts (FRBs) are millisecond-duration radio signals possibly occurring at cosmological distances. However the physical model of FRBs is mystery, many models have been proposed. Here we study the frequency distributions of peak flux, fluence, duration and waiting time for repeating FRB 121102. The cumulative distributions of peak flux, fluence and duration show power-law forms. The waiting time distribution also shows power-law distribution, and is consistent with a non-stationary Poisson process. We also use the statistical results to test the proposed models for FRBs. Comparing with the model predications, we find that the theoretical models proposed by Dai et al. (2016) and Katz (2016) are favored. These distributions are consistent with the predications from avalanche models of driven systems.

  13. Cloning, characterization, and properties of seven triplet repeat DNA sequences.

    Science.gov (United States)

    Ohshima, K; Kang, S; Larson, J E; Wells, R D

    1996-07-12

    Several neuromuscular and neurodegenerative diseases are caused by genetically unstable triplet repeat sequences (CTG.CAG, CGG.CCG, or AAG.CTT) in or near the responsible genes. We implemented novel cloning strategies with chemically synthesized oligonucleotides to clone seven of the triplet repeat sequences (GTA.TAC, GAT.ATC, GTT.AAC, CAC.GTG, AGG.CCT, TCG.CGA, and AAG.CTT), and the adjoining paper (Ohshima, K., Kang, S., Larson, J. E., and Wells, R. D.(1996) J. Biol. Chem. 271, 16784-16791) describes studies on TTA.TAA. This approach in conjunction with in vivo expansion studies in Escherichia coli enabled the preparation of at least 81 plasmids containing the repeat sequences with lengths of approximately 16 up to 158 triplets in both orientations with varying extents of polymorphisms. The inserts were characterized by DNA sequencing as well as DNA polymerase pausings, two-dimensional agarose gel electrophoresis, and chemical probe analyses to evaluate the capacity to adopt negative supercoil induced non-B DNA conformations. AAG.CTT and AGG.CCT form intramolecular triplexes, and the other five repeat sequences do not form any previously characterized non-B structures. However, long tracts of TCG.CGA showed strong inhibition of DNA synthesis at specific loci in the repeats as seen in the cases of CTG.CAG and CGG.CCG (Kang, S., Ohshima, K., Shimizu, M., Amirhaeri, S., and Wells, R. D.(1995) J. Biol. Chem. 270, 27014-27021). This work along with other studies (Wells, R. D.(1996) J. Biol. Chem. 271, 2875-2878) on CTG.CAG, CGG.CCG, and TTA.TAA makes available long inserts of all 10 triplet repeat sequences for a variety of physical, molecular biological, genetic, and medical investigations. A model to explain the reduction in mRNA abundance in Friedreich's ataxia based on intermolecular triplex formation is proposed.

  14. The effect of technical replicate (repeats) on Nix Pro Color Sensor™ measurement precision for meat: A case-study on aged beef colour stability.

    Science.gov (United States)

    Holman, Benjamin W B; Collins, Damian; Kilgannon, Ashleigh K; Hopkins, David L

    2017-09-04

    The Nix Pro Colour Sensor™ (NIX) can be potentially used to measure meat colour, but procedural guidelines that assure measurement reproducibility and repeatability (precision) must first be established. Technical replicate number (r) will minimise response variation, measureable as standard error of predicted mean (SEM), and contribute to improved precision. Consequently, we aimed to explore the effects of r on NIX precision when measuring aged beef colour (colorimetrics; L*, a*, b*, hue and chroma values). Each colorimetric SEM declined with increasing r to indicate improved precision and followed a diminishing rate of improvement that allowed us to recommend r=7 for meat colour studies using the NIX. This definition was based on practical limitations and a* variability, as additional r would be required if other colorimetrics or advanced levels of precision are necessary. Beef ageing and display period, holding temperature, loin and sampled portion were also found to contribute to colorimetric variation, but were incorporated within our definition of r. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  15. Multi locus variable-number tandem repeat (MLVA typing tools improved the surveillance of Salmonella enteritidis: a 6 years retrospective study.

    Directory of Open Access Journals (Sweden)

    Sophie Bertrand

    Full Text Available Surveillance of Salmonella enterica subsp. enterica serovar Enteritidis is generally considered to benefit from molecular techniques like multiple-locus variable-number of tandem repeats analysis (MLVA, which allow early detection and confinement of outbreaks. Here, a surveillance study, including phage typing, antimicrobial susceptibility testing and MLVA on 1,535 S. Enteritidis isolates collected between 2007 and 2012, was used to evaluate the added value of MLVA for public health surveillance in Belgium. Phage types PT4, PT8, PT21, PT1, PT6, PT14b, PT28 and PT13 dominate the Belgian S. Enteritidis population. The isolates of S. Enteritidis were most frequently susceptible to all antibiotics tested. 172 different MLVA profiles were detected, of which 9 frequent profiles included 67.2% of the S. Enteritidis population. During a serial passage experiment on selected isolates to investigate the in vitro stability of the 5 MLVA loci, no variations over time were observed indicating that the MLVA profiles were stable. The MLVA profile of isolates originating from different outbreaks in the Democratic Republic of the Congo (DRC between 2010 and 2011 were distinct from any of the MLVA profiles found in Belgian isolates throughout the six year observational period and demonstrates that MLVA improves public health surveillance of S. Enteritidis. However, MLVA should be complemented with other subtyping methods when investigating outbreaks is caused by the most common MLVA profile.

  16. Multi locus variable-number tandem repeat (MLVA) typing tools improved the surveillance of Salmonella enteritidis: a 6 years retrospective study.

    Science.gov (United States)

    Bertrand, Sophie; De Lamine de Bex, Guillaume; Wildemauwe, Christa; Lunguya, Octavie; Phoba, Marie France; Ley, Benedikt; Jacobs, Jan; Vanhoof, Raymond; Mattheus, Wesley

    2015-01-01

    Surveillance of Salmonella enterica subsp. enterica serovar Enteritidis is generally considered to benefit from molecular techniques like multiple-locus variable-number of tandem repeats analysis (MLVA), which allow early detection and confinement of outbreaks. Here, a surveillance study, including phage typing, antimicrobial susceptibility testing and MLVA on 1,535 S. Enteritidis isolates collected between 2007 and 2012, was used to evaluate the added value of MLVA for public health surveillance in Belgium. Phage types PT4, PT8, PT21, PT1, PT6, PT14b, PT28 and PT13 dominate the Belgian S. Enteritidis population. The isolates of S. Enteritidis were most frequently susceptible to all antibiotics tested. 172 different MLVA profiles were detected, of which 9 frequent profiles included 67.2% of the S. Enteritidis population. During a serial passage experiment on selected isolates to investigate the in vitro stability of the 5 MLVA loci, no variations over time were observed indicating that the MLVA profiles were stable. The MLVA profile of isolates originating from different outbreaks in the Democratic Republic of the Congo (DRC) between 2010 and 2011 were distinct from any of the MLVA profiles found in Belgian isolates throughout the six year observational period and demonstrates that MLVA improves public health surveillance of S. Enteritidis. However, MLVA should be complemented with other subtyping methods when investigating outbreaks is caused by the most common MLVA profile.

  17. Second time around:Corticospinal responses following repeated sports-related concussions within the same season. A transcranial magnetic stimulation study

    Institute of Scientific and Technical Information of China (English)

    Alan J Pearce; Daniel T Corp; Charlotte B Davies; Brendan P Major; Jerome J Maller

    2014-01-01

    Objective:To investigate the degree of neurophysiological and cognitive performance changes resulting from repeat concussions sustained in a single season ofAustralianRules football. Methods:Three amateur football players were recruited after sustainingtwo concussions during a single season of playing.Each player was assessed at multiple time points by transcranial magnetic stimulation(TMS) and electromyography, as well as tested for fine motor and cognitive performance after each concussion.Results:In all three cases, concussions resulted in reduction in fine dexterity and visuomotor reaction time, cognitive attention performance and increase in intracortical inhibition fromTMS.No changes in performance orTMS outcomes were found as a result of the order of the concussions.However, changes observed were dependent on the severity of the concussion.Conclusions:This multiple-case study has demonstrated that concussion result in increased intracortical inhibition and reduction in cognitive and motor performance. Further,TMS, in conjunction with tests of cognitive and motor performance, can be useful as a prognostic technique in assessing recovery from acute concussion injury.

  18. Knowledge and skill retention of in-service versus preservice nursing professionals following an informal training program in pediatric cardiopulmonary resuscitation: a repeated-measures quasiexperimental study.

    Science.gov (United States)

    Sankar, Jhuma; Vijayakanthi, Nandini; Sankar, M Jeeva; Dubey, Nandkishore

    2013-01-01

    Our objective was to compare the impact of a training program in pediatric cardiopulmonary resuscitation (CPR) on the knowledge and skills of in-service and preservice nurses at prespecified time points. This repeated-measures quasiexperimental study was conducted in the pediatric emergency and ICU of a tertiary care teaching hospital between January and March 2011. We assessed the baseline knowledge and skills of nursing staff (in-service nurses) and final year undergraduate nursing students (preservice nurses) using a validated questionnaire and a skill checklist, respectively. The participants were then trained on pediatric CPR using standard guidelines. The knowledge and skills were reassessed immediately after training and at 6 weeks after training. A total of 74 participants-28 in-service and 46 preservice professionals-were enrolled. At initial assessment, in-service nurses were found to have insignificant higher mean knowledge scores (6.6 versus 5.8, P = 0.08) while the preservice nurses had significantly higher skill scores (6.5 versus 3.2, P nurses performing better in knowledge test (10.5 versus 9.1, P = 0.01) and the preservice nurses performing better in skill test (9.8 versus 7.4, P skills of in-service and preservice nurses in pediatric CPR improved with training. In comparison to preservice nurses, the in-service nurses seemed to retain knowledge better with time than skills.

  19. Field study of the urinary excretion of ethoxyacetic acid during repeated daily exposure to the ethyl ether of ethylene glycol and the ethyl ether of ethylene glycol acetate.

    Science.gov (United States)

    Veulemans, H; Groeseneken, D; Masschelein, R; Van Vlem, E

    1987-06-01

    The urinary excretion of ethoxyacetic acid (EAA) was studied in a group of five women daily exposed to the ethyl ether of ethylene glycol (EGEE) and the ethyl ether of ethylene glycol acetate (EGEE-Ac) during 5 d of normal production and 7 d after a 12-d production stop. The mean combined exposure concentration of EGEE and EGEE-Ac (expressed in equivalent weight of EGEE) was 14.0 mg/m3 with occasional slight excursions above the current Belgian occupational exposure limit. The daily combined exposure profiles for EGEE and EGEE-Ac were rather constant during the first observation period, but they tended to decrease during the last week. The urinary EAA excretion clearly increased during the work week. Over the weekends the elimination was far from complete, and even after a prolonged nonexposure period of 12 d traces of the metabolite were still detectable. Based on the observations from the first period, a good linear correlation (r = 0.92) was found between the average exposure over 5 d (14.4 mg/m3) and the EAA excretion at the end of the week (105.7 mg/g creatinine). An EAA estimate of 150 +/- 35 mg/g was found to correspond with repeated 5-d full-shift exposures to the respective occupational exposure limit of EGEE (19 mg/m3) or EGEE-Ac (27 mg/m3).

  20. Experimentally Induced Repeated Anhydrobiosis in the Eutardigrade Richtersius coronifer

    Science.gov (United States)

    2016-01-01

    Tardigrades represent one of the main animal groups with anhydrobiotic capacity at any stage of their life cycle. The ability of tardigrades to survive repeated cycles of anhydrobiosis has rarely been studied but is of interest to understand the factors constraining anhydrobiotic survival. The main objective of this study was to investigate the patterns of survival of the eutardigrade Richtersius coronifer under repeated cycles of desiccation, and the potential effect of repeated desiccation on size, shape and number of storage cells. We also analyzed potential change in body size, gut content and frequency of mitotic storage cells. Specimens were kept under non-cultured conditions and desiccated under controlled relative humidity. After each desiccation cycle 10 specimens were selected for analysis of morphometric characteristics and mitosis. The study demonstrates that tardigrades may survive up to 6 repeated desiccations, with declining survival rates with increased number of desiccations. We found a significantly higher proportion of animals that were unable to contract properly into a tun stage during the desiccation process at the 5th and 6th desiccations. Also total number of storage cells declined at the 5th and 6th desiccations, while no effect on storage cell size was observed. The frequency of mitotic storage cells tended to decline with higher number of desiccation cycles. Our study shows that the number of consecutive cycles of anhydrobiosis that R. coronifer may undergo is limited, with increased inability for tun formation and energetic constraints as possible causal factors. PMID:27828978

  1. Is Asp-His-Ser/Thr-Trp tetrad hydrogen-bond network important to WD40-repeat proteins: a statistical and theoretical study.

    Science.gov (United States)

    Wu, Xian-Hui; Zhang, Hui; Wu, Yun-Dong

    2010-04-01

    WD40-repeat proteins are abundant and play important roles in forming protein complexes. The domain usually has seven WD40 repeats, which folds into a seven beta-sheet propeller with each beta-sheet in a four-strand structure. An analysis of 20 available WD40-repeat proteins in Protein Data Bank reveals that each protein has at least one Asp-His-Ser/Thr-Trp (D-H-S/T-W) hydrogen-bonded tetrad, and some proteins have up to six or seven such tetrads. The relative positions of the four residues in the tetrads are also found to be conserved. A sequence alignment analysis of 560 WD40-repeat protein sequences in human reveals very similar features, indicating that such tetrad may be a general feature of WD40-repeat proteins. We carried out density functional theory and found that these tetrads can lead to significant stabilization including hydrogen-bonding cooperativity. The hydrogen bond involving Trp is significant. These results lead us to propose that the tetrads may be critical to the stability and the mechanism of folding of these proteins.

  2. Repeat urine cultures in children with urinary tract infection

    Directory of Open Access Journals (Sweden)

    Risky Vitria Prasetyo

    2012-05-01

    Full Text Available Background Urinary tract infections (UTIs are the second leading cause of infection in children, following respiratory tract infections. Repeat urine cultures after antibiotic treatment are routinely obtained in clinical practice to verify proof of bacteriologic cure. The American Academy of Pediatrics does not recommended repeat cultures, due to increased cost and discomfort to patients. Objective To determine the frequency of positive repeat urine cultures after 3 days of antibiotics in children with UTIs. Methods We conducted a retrospective study on children with UTIs who visited the Division of Pediatric Nephrology, Department of Child Health at Dr. Soetomo Hospital, Surabaya from January 2006 to December 2011. Results of repeat urine cultures were obtained after 3 days of antibiotic treatment. Descriptive statistics were used to analyze the data. Results Of the 779 pediatric UTI cases, repeat urine cultures were performed in 264 (33.9% cases. Of the 264 patients who comprised our study, there were similar numbers of girls and boys (50.4% vs. 49.6%, respectively. The mean age of patients was 43.9 (SD 1.59 months and 35.5% of subjects were aged under 1 year. In the initial urine cultures of our subjects, Escherichia coli was the most common organism found, with 92 cases (34.8%, compared to 58 cases (21.9% of Klebsiella pneumoniae and 29 cases (10.9% of Pseudomonas aeruginosa. Rrepeat urine cultures showed no bacterial growth in 168 cases (63.6%. Conclusion Mostly negative repeat urine cultures will probably obviate the need of this test in daily routine practice. [Paediatr Indones. 2012;52:170-4].

  3. Minimal-invasive magnetic heating of tumors does not alter intra-tumoral nanoparticle accumulation, allowing for repeated therapy sessions: an in vivo study in mice

    Science.gov (United States)

    Kettering, Melanie; Richter, Heike; Wiekhorst, Frank; Bremer-Streck, Sibylle; Trahms, Lutz; Alois Kaiser, Werner; Hilger, Ingrid

    2011-12-01

    Localized magnetic heating treatments (hyperthermia, thermal ablation) using superparamagnetic iron oxide nanoparticles (MNPs) continue to be an active area of cancer research. For generating the appropriate heat to sufficiently target cell destruction, adequate MNP concentrations need to be accumulated into tumors. Furthermore, the knowledge of MNP bio-distribution after application and additionally after heating is significant, firstly because of the possibility of repeated heating treatments if MNPs remain at the target region and secondly to study potential adverse effects dealing with MNP dilution from the target region over time. In this context, little is known about the behavior of MNPs after intra-tumoral application and magnetic heating. Therefore, the present in vivo study on the bio-distribution of intra-tumorally injected MNPs in mice focused on MNP long term monitoring of pre and post therapy over seven days using multi-channel magnetorelaxometry (MRX). Subsequently, single-channel MRX was adopted to study the bio-distribution of MNPs in internal organs and tumors of sacrificed animals. We found no distinct change of total MNP amounts in vivo during long term monitoring. Most of the MNP amounts remained in the tumors; only a few MNPs were detected in liver and spleen and less than 1% of totally injected MNPs were excreted. Apparently, the application of magnetic heating and the induction of apoptosis did not affect MNP accumulation. Our results indicate that MNP mainly remained within the injection side after magnetic heating over a seven-days-observation and therefore not affecting healthy tissue. As a consequence, localized magnetic heating therapy of tumors might be applied periodically for a better therapeutic outcome.

  4. Etiological Role and Repeated Infections of Sapovirus among Children Aged Less than 2 Years in a Cohort Study in a Peri-urban Community of Peru.

    Science.gov (United States)

    Liu, Xiaofang; Jahuira, Helena; Gilman, Robert H; Alva, Alicia; Cabrera, Lilia; Okamoto, Michiko; Xu, Hang; Windle, Henry J; Kelleher, Dermot; Varela, Marco; Verastegui, Manuela; Calderon, Maritza; Sanchez, Gerardo; Sarabia, Vanessa; Ballard, Sarah B; Bern, Caryn; Mayta, Holger; Crabtree, Jean E; Cama, Vitaliano; Saito, Mayuko; Oshitani, Hitoshi

    2016-06-01

    Human sapovirus has been shown to be one of the most important etiologies in pediatric patients with acute diarrhea. However, very limited data are available about the causative roles and epidemiology of sapovirus in community settings. A nested matched case-control study within a birth cohort study of acute diarrhea in a peri-urban community in Peru from 2007 to 2010 was conducted to investigate the attributable fraction (AF) and genetic diversity of sapovirus. By quantitative reverse transcription-real-time PCR (qPCR) sapovirus was detected in 12.4% (37/299) of diarrheal and 5.7% (17/300) of nondiarrheal stools (P = 0.004). The sapovirus AF (7.1%) was higher in the second year (13.2%) than in the first year (1.4%) of life of children. Ten known genotypes and one novel cluster (n = 5) within four genogroups (GI, GII, GIV, and GV) were identified by phylogenetic analysis of a partial VP1 gene. Further sequence analysis of the full VP1 gene revealed a possible novel genotype, tentatively named GII.8. Notably, symptomatic reinfections with different genotypes within the same (n = 3) or different (n = 5) genogroups were observed in eight children. Sapovirus exhibited a high attributable burden for acute gastroenteritis, especially in the second year of life, of children in a Peruvian community. Further large-scale studies are needed to understand better the global burden, genetic diversity, and repeated infections of sapovirus. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  5. A Familial Factor Independent of CAG Repeat Length Influences Age at Onset of Machado-Joseph Disease

    OpenAIRE

    DeStefano, Anita L.; Cupples, L. Adrienne; Maciel, Patricia; Gaspar, Claudia; Radvany, Joao; Dawson, David M.; Sudarsky, Lewis; Corwin, Lee; Coutinho, Paula; MacLeod, Patrick; Sequeiros, Jorge; Rouleau, Guy A.; Farrer, Lindsay A.

    1996-01-01

    Machado-Joseph disease (MJD) is a late-onset, progressive, neurodegenerative disorder caused by the expansion of an unstable trinucleotide (CAG) repeat sequence in a novel gene (MJD1) on chromosome 14. Previous studies showed that age at onset is negatively correlated with the number of CAG repeat units, but only part of the variation in onset age is explained by CAG repeat length. Ages at onset and CAG repeat lengths of 136 MJD patients from 23 kindreds of Portuguese descent were analyzed, t...

  6. Impact of CAG repeat length in the androgen receptor gene on male infertility - a meta-analysis.

    Science.gov (United States)

    Xiao, Feifan; Lan, Aihua; Lin, Zhidi; Song, Jianfei; Zhang, Yuening; Li, Jiatong; Gu, Kailong; Lv, Baihao; Zhao, Dong; Zeng, Siping; Zhang, Ruoheng; Zhao, Wei; Pan, Zhengyan; Deng, Xiaozhen; Yang, Xiaoli

    2016-07-01

    CAG repeats are polymorphic nucleotide repeats present in the androgen receptor gene. Many studies have estimated the association between CAG repeat length and male infertility, but the conclusions are controversial. Previous meta-analyses have come to different conclusions; however, new studies have been published. An updated meta-analysis was conducted. PubMed, CBM, CNKI and Web of Science databases were systematically searched for studies published from 1 January 2000 to 1 October 2015. Case-control studies on the association between CAG repeat length and male infertility using appropriate methodology were included. Forty studies were selected, including 3858 cases and 3161 controls. Results showed statistically significantly longer CAG repeat length among cases compared with controls (SMD = 0.14; 95% CI, 0.02-0.26). Shorter repeat length was associated with a lower risk of male infertility compared with a longer repeat length in the overall analysis (OR = 0.79, 95% CI: 0.66-0.95). Moreover, CAG repeat length was associated with male infertility in Caucasian populations, but not Asian or Egyptian populations. Subgroup analysis revealed no significant difference in German populations, but CAG repeat length was associated with male infertility in China and the USA. There were no significant differences between cases and controls in azoospermia and severe oligozoospermia.

  7. Repeated high-dose (5 × 10(8) TCID50) toxicity study of a third generation smallpox vaccine (IMVAMUNE) in New Zealand white rabbits.

    Science.gov (United States)

    Tree, Julia A; Hall, Graham; Rees, Peter; Vipond, Julia; Funnell, Simon G P; Roberts, Allen D

    2016-07-01

    Concern over the release of variola virus as an agent of bioterrorism remains high and a rapid vaccination regimen is desirable for use in the event of a confirmed release of virus. A single, high-dose (5×10(8) TCID50) of Bavarian Nordic's IMVAMUNE was tested in a Phase-II clinical trial, in humans, as a substitute for the standard (1×10(8) TCID50), using a 2-dose, 28-days apart regimen. Prior to this clinical trial taking place a Good Laboratory Practice, repeated high-dose, toxicology study was performed using IMVAMUNE, in New Zealand white rabbits and the results are reported here. Male and female rabbits were dosed twice, subcutaneously, with 5×10(8) TCID50 of IMVAMUNE (test) or saline (control), 7-days apart. The clinical condition, body-weight, food consumption, haematology, blood chemistry, immunogenicity, organ-weight, and macroscopic and microscopic pathology were investigated. Haematological investigations indicated changes within the white blood cell profile that were attributed to treatment with IMVAMUNE; these comprised slight increases in neutrophil and monocyte numbers, on study days 1-3 and a marginal increase in lymphocyte numbers on day 10. Macroscopic pathology revealed reddening at the sites of administration and thickened skin in IMVAMUNE, treated animals. After the second dose of IMVAMUNE 9/10 rabbits seroconverted, as detected by antibody ELISA on day 10, by day 21, 10/10 rabbits seroconverted. Treatment-related changes were not detected in other parameters. In conclusion, the subcutaneous injection of 2 high-doses of IMVAMUNE, to rabbits, was well tolerated producing only minor changes at the site of administration. Vaccinia-specific antibodies were raised in IMVAMUNE-vaccinated rabbits only.

  8. Analysis of CAG repeats in IT15 gene in Spanish population

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez, A.; Castellvi-Pel, S.; Mila, M. [Hospital Clinic i Provincial de Parcelons (Spain)] [and others

    1994-09-01

    Huntington`s disease (HD) is an autosomal dominant neurodegenerative disorder characterized by involuntary movements, and cognitive and affective changes. HD has a prevalence of 1 in 10,000 individuals in most populations of European origin. The IT15 gene is responsible for HD as it contains a highly polymorphic, unstable (CAG) repeated sequence that is abnormally expanded in HD chromosomes. The IT15 (CAG)n stretch was analyzed in 100 members (50 affected individuals, 40 asymptomatic at risk for HD, and 10 unaffected members) of 50 HD families, and 50 individuals of the general Spanish population. Expansion of the CAG repeat sequence was found in 45 affected members and 14 individuals at risk, with a repeat length of 40 to 85 repeat units. The range of the polymorphic CAG repeat in normal chromosomes was between 11 and 31 repeat units. In the families with several affected members, we found increases of the repeat length in the least generation. Inverse correlation was found between the age of onset and the length of the CAG repeat; the analysis showed also parental male bias. Presymptomatic analysis of HD has been considerably enhanced with the CAG mutation study.

  9. [Comparative analysis of internal repeating segments in proteins of species from the three kingdoms of life].

    Science.gov (United States)

    Chen, Hao; Zhu, Sheng; Chen, Liang-Biao

    2005-03-01

    In 1970's, Ohno proposed that primordial proteins might evolve from periodic amplification of oligopeptides. Internal repeating segments in proteins may play important roles in functional evolution of proteins. In this study,a new method was designed to extract internal repeating segments from proteomes of 8 modern species belong to eukaryota, bacteria and archaea, respectively. The repeating patterns and the frequencies within proteomes of each kingdom were analyzed by matrix plot. Simple repeat segments were found in eukaryotic proteins with high frequencies,but were much lower in bacteria and none in archaea. Further analysis showed that, the biased usage of amino acids in the internal repeating segments was positively related to the frequencies of individual amino acids in the proteome of a given species. The correlation coefficient was up to 0.95 in prokaryota, with the eukaryota to be lower. The high frequency of simple repeat sequences in eukaryotic proteomes, as well as the disparate relationships of amino acid compositions between the internal repeating segments and their haboring eukaryotic proteomes imply that the fast evolution of simple repeat sequences could be one force that generates the high complexity of eukarytic proteomes.

  10. Large-scale studies of the HphI insulin gene variable-number-of-tandem-repeats polymorphism in relation to Type 2 diabetes mellitus and insulin release

    DEFF Research Database (Denmark)

    Hansen, S K; Gjesing, A P; Rasmussen, S K

    2004-01-01

    The class III allele of the variable-number-of-tandem-repeats polymorphism located 5' of the insulin gene (INS-VNTR) has been associated with Type 2 diabetes and altered birthweight. It has also been suggested, although inconsistently, that the class III allele plays a role in glucose-induced ins......The class III allele of the variable-number-of-tandem-repeats polymorphism located 5' of the insulin gene (INS-VNTR) has been associated with Type 2 diabetes and altered birthweight. It has also been suggested, although inconsistently, that the class III allele plays a role in glucose...

  11. Automated genotyping of dinucleotide repeat markers

    Energy Technology Data Exchange (ETDEWEB)

    Perlin, M.W.; Hoffman, E.P. [Carnegie Mellon Univ., Pittsburgh, PA (United States)]|[Univ. of Pittsburgh, PA (United States)

    1994-09-01

    The dinucleotide repeats (i.e., microsatellites) such as CA-repeats are a highly polymorphic, highly abundant class of PCR-amplifiable markers that have greatly streamlined genetic mapping experimentation. It is expected that over 30,000 such markers (including tri- and tetranucleotide repeats) will be characterized for routine use in the next few years. Since only size determination, and not sequencing, is required to determine alleles, in principle, dinucleotide repeat genotyping is easily performed on electrophoretic gels, and can be automated using DNA sequencers. Unfortunately, PCR stuttering with these markers generates not one band for each allele, but a pattern of bands. Since closely spaced alleles must be disambiguated by human scoring, this poses a key obstacle to full automation. We have developed methods that overcome this obstacle. Our model is that the observed data is generated by arithmetic superposition (i.e., convolution) of multiple allele patterns. By quantitatively measuring the size of each component band, and exploiting the unique stutter pattern associated with each marker, closely spaced alleles can be deconvolved; this unambiguously reconstructs the {open_quotes}true{close_quotes} allele bands, with stutter artifact removed. We used this approach in a system for automated diagnosis of (X-linked) Duchenne muscular dystrophy; four multiplexed CA-repeats within the dystrophin gene were assayed on a DNA sequencer. Our method accurately detected small variations in gel migration that shifted the allele size estimate. In 167 nonmutated alleles, 89% (149/167) showed no size variation, 9% (15/167) showed 1 bp variation, and 2% (3/167) showed 2 bp variation. We are currently developing a library of dinucleotide repeat patterns; together with our deconvolution methods, this library will enable fully automated genotyping of dinucleotide repeats from sizing data.

  12. Does it really feel the same? Changes in life satisfaction following repeated life events.

    Science.gov (United States)

    Luhmann, Maike; Eid, Michael

    2009-08-01

    Unemployment, divorce, and marriage are common life events for most people in Western societies. In a longitudinal study, the authors investigated how these life events affect life satisfaction when they occur repeatedly. Data came from the German Socio-Economic Panel, a large-scale representative panel study, and were analyzed using multilevel modeling. Results showed that, in general, life satisfaction decreases with repeated unemployment (sensitization). For repeated divorces, life satisfaction is higher at the second divorce than it had been at the first divorce (adaptation). Finally, life satisfaction is similar at repeated marriages. Neuroticism, extraversion, and gender accounted for interindividual differences in changes in life satisfaction. For instance, the general sensitization pattern associated with repeated unemployment was less pronounced for women. The authors also found main effects of age and the duration of the first event on general differences in life satisfaction. Finally, those with repeated events generally report lower life satisfaction than those with only one occasion of these events, even before the first event actually occurred. Findings show that repeated events can have very different effects on life satisfaction that depend on the nature of the event.

  13. The Great Cometary Show

    Science.gov (United States)

    2007-01-01

    its high spatial and spectral resolution, it was possible to zoom into the very heart of this very massive star. In this innermost region, the observations are dominated by the extremely dense stellar wind that totally obscures the underlying central star. The AMBER observations show that this dense stellar wind is not spherically symmetric, but exhibits a clearly elongated structure. Overall, the AMBER observations confirm that the extremely high mass loss of Eta Carinae's massive central star is non-spherical and much stronger along the poles than in the equatorial plane. This is in agreement with theoretical models that predict such an enhanced polar mass-loss in the case of rapidly rotating stars. ESO PR Photo 06c/07 ESO PR Photo 06c/07 RS Ophiuchi in Outburst Several papers from this special feature focus on the later stages in a star's life. One looks at the binary system Gamma 2 Velorum, which contains the closest example of a star known as a Wolf-Rayet. A single AMBER observation allowed the astronomers to separate the spectra of the two components, offering new insights in the modeling of Wolf-Rayet stars, but made it also possible to measure the separation between the two stars. This led to a new determination of the distance of the system, showing that previous estimates were incorrect. The observations also revealed information on the region where the winds from the two stars collide. The famous binary system RS Ophiuchi, an example of a recurrent nova, was observed just 5 days after it was discovered to be in outburst on 12 February 2006, an event that has been expected for 21 years. AMBER was able to detect the extension of the expanding nova emission. These observations show a complex geometry and kinematics, far from the simple interpretation of a spherical fireball in extension. AMBER has detected a high velocity jet probably perpendicular to the orbital plane of the binary system, and allowed a precise and careful study of the wind and the shockwave

  14. Long-term disability and prognosis in dentatorubral-pallidoluysian atrophy: a correlation with CAG repeat length.

    Science.gov (United States)

    Hasegawa, Arika; Ikeuchi, Takeshi; Koike, Ryoko; Matsubara, Nae; Tsuchiya, Miyuki; Nozaki, Hiroaki; Homma, Atsushi; Idezuka, Jiro; Nishizawa, Masatoyo; Onodera, Osamu

    2010-08-15

    Dentatorubral-pallidoluysian atrophy (DRPLA) is a rare autosomal dominant neurodegenerative disorder caused by CAG repeat expansion. Previous studies demonstrated that the onset of DRPLA is closely associated with CAG repeat length. However, the natural history of DRPLA has not yet been evaluated. We here retrospectively investigated the factors that determine the disease milestones and prognosis in 183 Japanese patients genetically diagnosed with DRPLA. We determined the age at onset, age at which each of the subsequent clinical manifestations appeared, age at becoming wheelchair-bound, and age at death. Kaplan-Meier analysis revealed that the patients with CAG repeats larger than the median length of 65 repeats developed each of the clinical features of DRPLA at a younger age than those with repeats. The patients became wheelchair-bound at a median age of 33 years (n = 61; range, 3-77 years) and died at a median age of 49 years (n = 23; range, 18-80 years). The ages at becoming wheelchair-bound and at death strongly correlated with the expanded CAG repeat length. Moreover, the patients with >or=65 CAG repeats showed a more severe long-term disability and a poorer prognosis. In contrast, the rate of progression after the onset did not correlate with CAG repeat length. The CAG repeat length may have a considerable effect on not only the disease onset but also the disease milestones and prognosis in DRPLA patients. These effects of CAG repeat length may be relevant in designing future clinical therapeutic trials.

  15. AN X-RAY STUDY OF SUPERNOVA REMNANT N49 AND SOFT GAMMA-RAY REPEATER 0526-66 IN THE LARGE MAGELLANIC CLOUD

    Energy Technology Data Exchange (ETDEWEB)

    Park, Sangwook [Department of Physics, University of Texas at Arlington, Box 19059, Arlington, TX 76019 (United States); Hughes, John P. [Department of Physics and Astronomy, Rutgers University, 136 Frelinghuysen Road, Piscataway, NJ 08854-8019 (United States); Slane, Patrick O. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Burrows, David N. [Department of Astronomy and Astrophysics, Pennsylvania State University, 525 Davey Laboratory, University Park, PA 16802 (United States); Lee, Jae-Joon [Korea Astronomy and Space Science Institute, Daejeon 305-348 (Korea, Republic of); Mori, Koji, E-mail: s.park@uta.edu [Department of Applied Physics, University of Miyazaki, 1-1 Gakuen Kibana-dai Nishi, Miyazaki 889-2192 (Japan)

    2012-04-01

    We report on the results from our deep Chandra observation (120 ks) of the supernova remnant (SNR) N49 and soft gamma-ray repeater (SGR) 0526-66 in the Large Magellanic Cloud. We firmly establish the detection of an ejecta 'bullet' beyond the southwestern boundary of N49. The X-ray spectrum of the bullet is distinguished from that of the main SNR shell, showing significantly enhanced Si and S abundances. We also detect an ejecta feature in the eastern shell, which shows metal overabundances similar to those of the bullet. If N49 was produced by a core-collapse explosion of a massive star, the detected Si-rich ejecta may represent explosive O-burning or incomplete Si-burning products from deep interior of the SN. On the other hand, the observed Si/S abundance ratio in the ejecta may favor Type Ia origin for N49. We refine the Sedov age of N49, {tau}{sub Sed} {approx} 4800 yr, with the explosion energy E{sub 0} {approx} 1.8 Multiplication-Sign 10{sup 51} erg. Our blackbody (BB) + power law (PL) model for the quiescent X-ray emission from SGR 0526-66 indicates that the PL photon index ({Gamma} {approx} 2.5) is identical to that of PSR 1E1048.1-5937, the well-known candidate transition object between anomalous X-ray pulsars and SGRs. Alternatively, the two-component BB model implies X-ray emission from a small (R {approx} 1 km) hot spot(s) (kT {approx} 1 keV) in addition to emission from the neutron star's cooler surface (R {approx} 10 km, kT {approx} 0.4 keV). There is a considerable discrepancy in the estimated column toward 0526-66 between BB+PL and BB+BB model fits. Discriminating these spectral models would be crucial to test the long-debated physical association between N49 and 0526-66.

  16. Digital repeat analysis; setup and operation.

    Science.gov (United States)

    Nol, J; Isouard, G; Mirecki, J

    2006-06-01

    Since the emergence of digital imaging, there have been questions about the necessity of continuing reject analysis programs in imaging departments to evaluate performance and quality. As a marketing strategy, most suppliers of digital technology focus on the supremacy of the technology and its ability to reduce the number of repeats, resulting in less radiation doses given to patients and increased productivity in the department. On the other hand, quality assurance radiographers and radiologists believe that repeats are mainly related to positioning skills, and repeat analysis is the main tool to plan training needs to up-skill radiographers. A comparative study between conventional and digital imaging was undertaken to compare outcomes and evaluate the need for reject analysis. However, digital technology still being at its early development stages, setting a credible reject analysis program became the major task of the study. It took the department, with the help of the suppliers of the computed radiography reader and the picture archiving and communication system, over 2 years of software enhancement to build a reliable digital repeat analysis system. The results were supportive of both philosophies; the number of repeats as a result of exposure factors was reduced dramatically; however, the percentage of repeats as a result of positioning skills was slightly on the increase for the simple reason that some rejects in the conventional system qualifying for both exposure and positioning errors were classified as exposure error. The ability of digitally adjusting dark or light images reclassified some of those images as positioning errors.

  17. The Health Show

    OpenAIRE

    Swann, David

    2011-01-01

    Dr David Swann interviewed on The Health Show, Series 1, Episode 5, 2011 for BBC World about the award-winning 21st Century Nursing Bag. BBC World News reaches 241million people every week, available in 296 million homes, 1.8 million hotel rooms and has the highest average viewership on a weekday of any international news channel. The Health Show is a new 26-part series for BBC World News covering the most important news stories from around the world.

  18. Association between secondhand smoke exposure at home and cigarette gifting and sharing in Zhejiang, China: a repeat cross-sectional study.

    Science.gov (United States)

    Xu, Yue; Xu, ShuiYang; Wu, QingQing; Guo, YuJie

    2016-03-03

    The aims of the current study were to assess the prevalence of household cigarette gifting and sharing, and to evaluate the relationship between secondhand smoke (SHS) exposure, and cigarette gifting and sharing, in Zhejiang, China. A repeat cross-sectional design. 10 sites in 5 cities in Zhejiang, China. Two surveys were conducted with adults in Zhejiang, China, in 2010 (N=2112) and 2012 (N=2279), respectively. At both waves, the same questionnaire was used; respondents were asked questions on residence, number of family smokers, indoor smoking rules, household income and cigarette gifting and sharing. The findings revealed that more than half of respondents' families (54.50% in 2010, 52.79% in 2012) reported exposure to SHS. Many families (54.73% in 2010, 47.04% in 2012) shared cigarettes with others, and a minority (14.91% in 2010, 14.17% in 2012) reported their family giving cigarettes as a gift. There was a significant decrease in cigarette sharing from 2010 to 2012, irrespective of household with SHS exposure status; and the cigarette gifting was significantly decreased in household without SHS exposure. Compared to households without SHS exposure, the prevalence of cigarette gifting and sharing in households with SHS exposure was more obvious. Encouraging and promoting a smoke-free household environment is necessary to change public smoking customs in Zhejiang, China. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  19. The impact of the CAG repeat polymorphism of the androgen receptor gene on muscle and adipose tissues in 20-29-year-old Danish men: Odense Androgen Study

    DEFF Research Database (Denmark)

    Nielsen, Torben Leo; Hagen, Claus; Wraae, Kristian

    2010-01-01

    not correlate with any circulating androgen. Conclusions: The CAG repeat polymorphism affects body composition in young men: absolute musclethigh and absolute musclelower trunk increase as CAGn decreases. Expressed relatively, muscle areas and LBM increase, while SAT and FM decrease as CAGn decreases......Background: The number of CAG repeats (CAGn) within the CAG repeat polymorphism of the androgen receptor gene correlates inversely with the transactivation of the receptor. Objective: To examine the impact of CAGn on muscle, fat distribution, and circulating androgen levels. Design, settings...... and participants: Population-based, cross-sectional study of 783 Danish men aged 20–29 years. Methods: Genotyping was performed in 767 men. Areas of thigh and lower trunk muscle (musclethigh and musclelower trunk), subcutaneous adipose tissues (SATthigh and SATlower trunk), and deep adipose tissues (i...

  20. Cognitive and clinical characteristics of patients with amyotrophic lateral sclerosis carrying a C9orf72 repeat expansion: a population-based cohort study.

    LENUS (Irish Health Repository)

    Byrne, Susan

    2012-03-01

    Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disease of upper and lower motor neurons, associated with frontotemporal dementia (FTD) in about 14% of incident cases. We assessed the frequency of the recently identified C9orf72 repeat expansion in familial and apparently sporadic cases of ALS and characterised the cognitive and clinical phenotype of patients with this expansion.

  1. Frequency of the C9orf72 hexanucleotide repeat expansion in patients with amyotrophic lateral sclerosis and frontotemporal dementia: A cross-sectional study

    NARCIS (Netherlands)

    E. Majounie (Elisa); A. Renton (Alan); K. Mok (Kin); E.G.P. Dopper (Elise); A. Waite (Adrian); S. Rollinson (Sara); A. Chiò (Adriano); G. Restagno (Gabriella); N. Nicolaou (Nayia); J. Simón-Sánchez (Javier); J.C. van Swieten (John); Y. Abramzon (Yevgeniya); J. Johnson (Janel); M. Sendtner (Michael); R. Pamphlett (Roger); R. Orrell (Richard); S. Mead (Simon); K.C. Sidle (Katie); H. Houlden (Henry); J.D. Rohrer (Jonathan Daniel); K.E. Morrison (Karen); H. Pall (Hardev); D. Talbot; O. Ansorge (Olaf); D.G. Hernandez (Dena); S. Arepalli (Sampath); M. Sabatelli (Mario); G. Mora (Gabriele); J.C. Corbo (Joseph); F. Giannini (Fabio); A. Calvo (Andrea); E. Englund (Elisabet); G. Borghero (Giuseppe); O.A.M. Floris; A. Remes (Anne); H. Laaksovirta (Hannu); L. McCluskey (Leo); J.Q. Trojanowski (John); V.M. Deerlin (Vivianna); G.D. Schellenberg (Gerard); M.A. Nalls (Michael); V.E. Drory (Vivian E); C.S. Lu (Chin-Song); T.-H. Yeh (Tu-Hsueh); H. Ishiura (Hiroyuki); Y. Takahashi (Yukari); S. Tsuji (Shoji); I. Le Ber (Isabelle); A. Brice; C. Drepper (Carsten); N. Williams (Nigel); J. Kirby (Janine); P.J. Shaw (Pamela); J. Hardy (John); P.J. Tienari (Pentti); P. Heutink (Peter); H. Morris (Huw); S. Pickering-Brown (Stuart); B.J. Traynor (Bryan)

    2012-01-01

    textabstractBackground: We aimed to accurately estimate the frequency of a hexanucleotide repeat expansion in C9orf72 that has been associated with a large proportion of cases of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Methods: We screened 4448 patients diagnosed with

  2. Spinocerebellar ataxia type 7 (SCA7): First report of a systematic neuropathological study of the brain of a patient with a very short expanded CAG-repeat

    NARCIS (Netherlands)

    Rub, U.; Brunt, E.R.; Gierga, K.; Seidel, K.; Schultz, C.; Schols, L.; Auburger, G.; Heinsen, H.; Ippel, P.F.; Glimmerveen, W.F.; Wittebol-Post, D.; Arai, K.; Deller, T.; Rai, D.

    2005-01-01

    Spinocerebellar ataxia type 7 (SCA7) represents a very rare and severe autosomal dominantly inherited cerebellar ataxia (ADCA). It belongs to the group of CAG-repeat or polyglutamine diseases with its underlying molecular genetical defect on chromosome 3p12-p21.1. Here, we performed a systematic stu

  3. Spinocerebellar ataxia type 7 (SCA7) : First report of a systematic neuropathological study of the brain of a patient with a very short expanded CAG-repeat

    NARCIS (Netherlands)

    Rub, U; Brunt, ER; Gierga, K; Seidel, K; Schultz, C; Schols, L; Auburger, G; Heinsen, H; Ippel, PF; Glimmerveen, WF; Wittebol-Post, D; Arai, K; Deller, T; Rai, D

    2005-01-01

    Spinocerebellar ataxia type 7 (SCA7) represents a very rare and severe autosomal dominantly inherited cerebellar ataxia (ADCA). It belongs to the group of CAG-repeat or polyglutamine diseases with its underlying molecular genetical defect on chromosome 3p12-p21.1. Here, we performed a systematic stu

  4. Association of Repeatedly Measured High-Sensitivity-Assayed Troponin I with Cardiovascular Disease Events in a General Population from the MORGAM/BiomarCaRE Study

    DEFF Research Database (Denmark)

    Hughes, Maria F; Ojeda, Francisco; Saarela, Olli;

    2017-01-01

    BACKGROUND: High-sensitivity troponin I (hs-cTnI) concentrations reflect myocardial stress. The role of hs-cTnI in predicting long-term changes in the risk of cardiovascular disease (CVD) in general populations is not clearly defined. METHODS: We investigated whether the change in 3 repeated meas...

  5. Novel Approach to Repeated Arterial Blood Sampling in Small Animal PET : Application in a Test-Retest Study with the Adenosine A1 Receptor Ligand [C-11]MPDX

    NARCIS (Netherlands)

    Sijbesma, Jürgen W A; Zhou, Xiaoyun; Vállez García, David; Houwertjes, Martin C; Doorduin, Janine; Kwizera, Chantal; Maas, Bram; Meerlo, Peter; Dierckx, Rudi A; Slart, Riemer H J A; Elsinga, Philip H; van Waarde, Aren

    2016-01-01

    Small animal positron emission tomography (PET) can be used to detect small changes in neuroreceptor availability. This often requires rapid arterial blood sampling. However, current catheterization procedures do not allow repeated blood sampling. We have developed a procedure which allows arterial

  6. Two-dimensional quantum repeaters

    Science.gov (United States)

    Wallnöfer, J.; Zwerger, M.; Muschik, C.; Sangouard, N.; Dür, W.

    2016-11-01

    The endeavor to develop quantum networks gave rise to a rapidly developing field with far-reaching applications such as secure communication and the realization of distributed computing tasks. This ultimately calls for the creation of flexible multiuser structures that allow for quantum communication between arbitrary pairs of parties in the network and facilitate also multiuser applications. To address this challenge, we propose a two-dimensional quantum repeater architecture to establish long-distance entanglement shared between multiple communication partners in the presence of channel noise and imperfect local control operations. The scheme is based on the creation of self-similar multiqubit entanglement structures at growing scale, where variants of entanglement swapping and multiparty entanglement purification are combined to create high-fidelity entangled states. We show how such networks can be implemented using trapped ions in cavities.

  7. Crowding by a repeating pattern.

    Science.gov (United States)

    Rosen, Sarah; Pelli, Denis G

    2015-01-01

    Theinability to recognize a peripheral target among flankers is called crowding. For a foveal target, crowding can be distinguished from overlap masking by its sparing of detection, linear scaling with eccentricity, and invariance with target size.Crowding depends on the proximity and similarity of the flankers to the target. Flankers that are far from or dissimilar to the target do not crowd it. On a gray page, text whose neighboring letters have different colors, alternately black and white, has enough dissimilarity that it might escape crowding. Since reading speed is normally limited by crowding, escape from crowding should allow faster reading. Yet reading speed is unchanged (Chung & Mansfield, 2009). Why? A recent vernier study found that using alternating-color flankers produces strong crowding (Manassi, Sayim, & Herzog, 2012). Might that effect occur with letters and reading? Critical spacing is the minimum center-to-center target-flanker spacing needed to correctly identify the target. We measure it for a target letter surrounded by several equidistant flanker letters of the same polarity, opposite polarity, or mixed polarity: alternately white and black. We find strong crowding in the alternating condition, even though each flanker letter is beyond its own critical spacing (as measured in a separate condition). Thus a periodic repeating pattern can produce crowding even when the individual elements do not. Further, in all conditions we find that, once a periodic pattern repeats (two cycles), further repetition does not affect critical spacing of the innermost flanker.

  8. Optimizing prostate biopsy for