
Sample records for repeated afm imaging

  1. High accuracy FIONA-AFM hybrid imaging. (United States)

    Fronczek, D N; Quammen, C; Wang, H; Kisker, C; Superfine, R; Taylor, R; Erie, D A; Tessmer, I


    Multi-protein complexes are ubiquitous and play essential roles in many biological mechanisms. Single molecule imaging techniques such as electron microscopy (EM) and atomic force microscopy (AFM) are powerful methods for characterizing the structural properties of multi-protein and multi-protein-DNA complexes. However, a significant limitation to these techniques is the ability to distinguish different proteins from one another. Here, we combine high resolution fluorescence microscopy and AFM (FIONA-AFM) to allow the identification of different proteins in such complexes. Using quantum dots as fiducial markers in addition to fluorescently labeled proteins, we are able to align fluorescence and AFM information to ≥8nm accuracy. This accuracy is sufficient to identify individual fluorescently labeled proteins in most multi-protein complexes. We investigate the limitations of localization precision and accuracy in fluorescence and AFM images separately and their effects on the overall registration accuracy of FIONA-AFM hybrid images. This combination of the two orthogonal techniques (FIONA and AFM) opens a wide spectrum of possible applications to the study of protein interactions, because AFM can yield high resolution (5-10nm) information about the conformational properties of multi-protein complexes and the fluorescence can indicate spatial relationships of the proteins in the complexes.

  2. Reconstruction Algorithms in Undersampled AFM Imaging

    DEFF Research Database (Denmark)

    Arildsen, Thomas; Oxvig, Christian Schou; Pedersen, Patrick Steffen


    This paper provides a study of spatial undersampling in atomic force microscopy (AFM) imaging followed by different image reconstruction techniques based on sparse approximation as well as interpolation. The main reasons for using undersampling is that it reduces the path length and thereby the s...

  3. Error-corrected AFM: a simple and broadly applicable approach for substantially improving AFM image accuracy. (United States)

    Bosse, James L; Huey, Bryan D


    Atomic force microscopy (AFM) has become an indispensable tool for imaging the topography and properties of surfaces at the nanoscale. A ubiquitous problem, however, is that optimal accuracy demands smooth surfaces, slow scanning, and expert users, contrary to many AFM applications and practical use patterns. Accordingly, a simple correction to AFM topographic images is implemented, incorporating error signals such as deflection and/or amplitude data that have long been available but quantitatively underexploited. This is demonstrated to substantially improve both height and lateral accuracy for expert users, with a corresponding 3-5 fold decrease in image error. Common image artifacts due to inexperienced AFM use, generally poorly scanned surfaces, or high speed images acquired in as fast as 7 s, are also shown to be effectively rectified, returning results equivalent to standard 'expert-user' images. This concept is proven for contact mode AFM, AC-mode, and high speed imaging, as well as property mapping such as phase contrast, with obvious extensions to many specialized AFM variations as well. Conveniently, as this correction procedure is based on either real time or post-processing, it is easily employed for future as well as legacy AFM systems and data. Such error-corrected AFM therefore offers a simple, broadly applicable approach for more accurate, more efficient, and more user-friendly implementation of AFM for nanoscale topography and property mapping.

  4. Structure Assisted Compressed Sensing Reconstruction of Undersampled AFM Images

    DEFF Research Database (Denmark)

    Oxvig, Christian Schou; Arildsen, Thomas; Larsen, Torben


    The use of compressed sensing in atomic force microscopy (AFM) can potentially speed-up image acquisition, lower probe-specimen interaction, or enable super resolution imaging. The idea in compressed sensing for AFM is to spatially undersample the specimen, i.e. only acquire a small fraction...

  5. Robust Repetitive Controller for Fast AFM Imaging

    CERN Document Server

    Necipoglu, Serkan; Has, Yunus; Guvenc, Levent; Basdogan, Cagatay


    Currently, Atomic Force Microscopy (AFM) is the most preferred Scanning Probe Microscopy (SPM) method due to its numerous advantages. However, increasing the scanning speed and reducing the interaction forces between the probe's tip and the sample surface are still the two main challenges in AFM. To meet these challenges, we take advantage of the fact that the lateral movements performed during an AFM scan is a repetitive motion and propose a Repetitive Controller (RC) for the z-axis movements of the piezo-scanner. The RC utilizes the profile of the previous scan line while scanning the current line to achieve a better scan performance. The results of the scanning experiments performed with our AFM set-up show that the proposed RC significantly outperforms a conventional PI controller that is typically used for the same task. The scan error and the average tapping forces are reduced by 66% and 58%, respectively when the scan speed is increased by 7-fold.

  6. AFM imaging of fenestrated liver sinusoidal endothelial cells. (United States)

    Braet, F; Wisse, E


    Each microscope with its dedicated sample preparation technique provides the investigator with a specific set of data giving an instrument-determined (or restricted) insight into the structure and function of a tissue, a cell or parts thereof. Stepwise improvements in existing techniques, both instrumental and preparative, can sometimes cross barriers in resolution and image quality. Of course, investigators get really excited when completely new principles of microscopy and imaging are offered in promising new instruments, such as the AFM. The present paper summarizes a first phase of studies on the thin endothelial cells of the liver. It describes the preparation-dependent differences in AFM imaging of these cells after isolation. Special point of interest concerned the dynamics of the fenestrae, thought to filter lipid-carrying particles during their transport from the blood to the liver cells. It also describes the attempts to image the details of these cells when alive in cell cultures. It explains what physical conditions, mainly contributed to the scanning stylus, are thought to play a part in the limitations in imaging these cells. The AFM also offers promising specifications to those interested in cell surface details, such as membrane-associated structures, receptors, coated pits, cellular junctions and molecular aggregations or domains. The AFM also offers nano-manipulation possibilities, strengths and elasticity measurements, force interactions, affinity measurements, stiffness and other physical aspects of membranes and cytoskeleton. The potential for molecular approaches is there. New developments in cantilever construction and computer software promise to bring real time video imaging to the AFM. Home made accessories for the first generation of AFM are now commodities in commercial instruments and make the life of the AFM microscopist easier. Also, the combination of different microscopies, such as AFM and TEM, or AFM and SEM find their way to the

  7. Imaging resolution of AFM with probes modified with FIB. (United States)

    Skibinski, J; Rebis, J; Wejrzanowski, T; Rozniatowski, K; Pressard, K; Kurzydlowski, K J


    This study concerns imaging of the structure of materials using AFM tapping (TM) and phase imaging (PI) mode, using probes modified with focused ion beam (FIB). Three kinds of modifications were applied - thinning of the cantilever, sharpening of the tip and combination of these two modifications. Probes shaped in that way were used for AFM investigations with Bruker AFM Nanoscope 8. As a testing material, titanium roughness standard supplied by Bruker was used. The results show that performed modifications influence the oscillation of the probes. In particular thinning of the cantilever enables one to acquire higher self-resonant frequencies, which can be advantageous for improving the quality of imaging in PI mode. It was found that sharpening the tip improves imaging resolution in tapping mode, which is consistent with existing knowledge, but lowered the quality of high frequency topography images. In this paper the Finite Element Method (FEM) was used to explain the results obtained experimentally.

  8. A Multifunctional Frontloading Approach for Repeated Recycling of a Pressure-Controlled AFM Micropipette.

    Directory of Open Access Journals (Sweden)

    Phillip Roder

    Full Text Available Fluid force microscopy combines the positional accuracy and force sensitivity of an atomic force microscope (AFM with nanofluidics via a microchanneled cantilever. However, adequate loading and cleaning procedures for such AFM micropipettes are required for various application situations. Here, a new frontloading procedure is described for an AFM micropipette functioning as a force- and pressure-controlled microscale liquid dispenser. This frontloading procedure seems especially attractive when using target substances featuring high costs or low available amounts. Here, the AFM micropipette could be filled from the tip side with liquid from a previously applied droplet with a volume of only a few μL using a short low-pressure pulse. The liquid-loaded AFM micropipettes could be then applied for experiments in air or liquid environments. AFM micropipette frontloading was evaluated with the well-known organic fluorescent dye rhodamine 6G and the AlexaFluor647-labeled antibody goat anti-rat IgG as an example of a larger biological compound. After micropipette usage, specific cleaning procedures were tested. Furthermore, a storage method is described, at which the AFM micropipettes could be stored for a few hours up to several days without drying out or clogging of the microchannel. In summary, the rapid, versatile and cost-efficient frontloading and cleaning procedure for the repeated usage of a single AFM micropipette is beneficial for various application situations from specific surface modifications through to local manipulation of living cells, and provides a simplified and faster handling for already known experiments with fluid force microscopy.

  9. A Multifunctional Frontloading Approach for Repeated Recycling of a Pressure-Controlled AFM Micropipette. (United States)

    Roder, Phillip; Hille, Carsten


    Fluid force microscopy combines the positional accuracy and force sensitivity of an atomic force microscope (AFM) with nanofluidics via a microchanneled cantilever. However, adequate loading and cleaning procedures for such AFM micropipettes are required for various application situations. Here, a new frontloading procedure is described for an AFM micropipette functioning as a force- and pressure-controlled microscale liquid dispenser. This frontloading procedure seems especially attractive when using target substances featuring high costs or low available amounts. Here, the AFM micropipette could be filled from the tip side with liquid from a previously applied droplet with a volume of only a few μL using a short low-pressure pulse. The liquid-loaded AFM micropipettes could be then applied for experiments in air or liquid environments. AFM micropipette frontloading was evaluated with the well-known organic fluorescent dye rhodamine 6G and the AlexaFluor647-labeled antibody goat anti-rat IgG as an example of a larger biological compound. After micropipette usage, specific cleaning procedures were tested. Furthermore, a storage method is described, at which the AFM micropipettes could be stored for a few hours up to several days without drying out or clogging of the microchannel. In summary, the rapid, versatile and cost-efficient frontloading and cleaning procedure for the repeated usage of a single AFM micropipette is beneficial for various application situations from specific surface modifications through to local manipulation of living cells, and provides a simplified and faster handling for already known experiments with fluid force microscopy.

  10. Image auto-zoom technology for AFM automation

    Institute of Scientific and Technical Information of China (English)

    LIU Wen-liang; QIAN Jian-qiang; LI Yuan


    For the case of atomic force microscope (AFM) automation, we extract the most valuable sub-region of a given AFM image automatically for succeeding scanning to get the higher resolution of interesting region. Two objective functions are sum-marized based on the analysis of evaluation of the information of a sub-region, and corresponding algorithm principles based on standard deviation and Discrete Cosine Transform (DCT) compression are determined from math. Algorithm realizations are analyzed and two select patterns of sub-region: fixed grid mode and sub-region walk mode are compared. To speed up the algorithm of DCT compression which is too slow to practical applied, a new algorithm is proposed based on analysis of DCT's block computing feature, and it can perform hundreds times faster than original. Implementation result of the algorithms proves that this technology can be applied to the AFM automatic operation. Finally the difference between the two objective functions is discussed with detail computations.

  11. Cellular transfer and AFM imaging of cancer cells using Bioimprint

    Directory of Open Access Journals (Sweden)

    Melville DOS


    Full Text Available Abstract A technique for permanently capturing a replica impression of biological cells has been developed to facilitate analysis using nanometer resolution imaging tools, namely the atomic force microscope (AFM. The method, termed Bioimprint™, creates a permanent cell 'footprint' in a non-biohazardous Poly (dimethylsiloxane (PDMS polymer composite. The transfer of nanometer scale biological information is presented as an alternative imaging technique at a resolution beyond that of optical microscopy. By transferring cell topology into a rigid medium more suited for AFM imaging, many of the limitations associated with scanning of biological specimens can be overcome. Potential for this technique is demonstrated by analyzing Bioimprint™ replicas created from human endometrial cancer cells. The high resolution transfer of this process is further detailed by imaging membrane morphological structures consistent with exocytosis. The integration of soft lithography to replicate biological materials presents an enhanced method for the study of biological systems at the nanoscale.

  12. Tissue section AFM: In situ ultrastructural imaging of native biomolecules (United States)

    Graham, Helen K.; Hodson, Nigel W.; Hoyland, Judith A.; Millward-Sadler, Sarah J.; Garrod, David; Scothern, Anthea; Griffiths, Christopher E.M.; Watson, Rachel E.B.; Cox, Thomas R.; Erler, Janine T.; Trafford, Andrew W.; Sherratt, Michael J.


    Conventional approaches for ultrastructural high-resolution imaging of biological specimens induce profound changes in bio-molecular structures. By combining tissue cryo-sectioning with non-destructive atomic force microscopy (AFM) imaging we have developed a methodology that may be applied by the non-specialist to both preserve and visualize bio-molecular structures (in particular extracellular matrix assemblies) in situ. This tissue section AFM technique is capable of: i) resolving nm–µm scale features of intra- and extracellular structures in tissue cryo-sections; ii) imaging the same tissue region before and after experimental interventions; iii) combining ultrastructural imaging with complimentary microscopical and micromechanical methods. Here, we employ this technique to: i) visualize the macro-molecular structures of unstained and unfixed fibrillar collagens (in skin, cartilage and intervertebral disc), elastic fibres (in aorta and lung), desmosomes (in nasal epithelium) and mitochondria (in heart); ii) quantify the ultrastructural effects of sequential collagenase digestion on a single elastic fibre; iii) correlate optical (auto fluorescent) with ultrastructural (AFM) images of aortic elastic lamellae. PMID:20144712

  13. AFM-IR: Technology and Applications in Nanoscale Infrared Spectroscopy and Chemical Imaging. (United States)

    Dazzi, Alexandre; Prater, Craig B


    Atomic force microscopy-based infrared spectroscopy (AFM-IR) is a rapidly emerging technique that provides chemical analysis and compositional mapping with spatial resolution far below conventional optical diffraction limits. AFM-IR works by using the tip of an AFM probe to locally detect thermal expansion in a sample resulting from absorption of infrared radiation. AFM-IR thus can provide the spatial resolution of AFM in combination with the chemical analysis and compositional imaging capabilities of infrared spectroscopy. This article briefly reviews the development and underlying technology of AFM-IR, including recent advances, and then surveys a wide range of applications and investigations using AFM-IR. AFM-IR applications that will be discussed include those in polymers, life sciences, photonics, solar cells, semiconductors, pharmaceuticals, and cultural heritage. In the Supporting Information , the authors provide a theoretical section that reviews the physics underlying the AFM-IR measurement and detection mechanisms.

  14. Intrinsically high-Q dynamic AFM imaging in liquid with a significantly extended needle tip. (United States)

    Minary-Jolandan, Majid; Tajik, Arash; Wang, Ning; Yu, Min-Feng


    Atomic force microscope (AFM) probe with a long and rigid needle tip was fabricated and studied for high Q factor dynamic (tapping mode) AFM imaging of samples submersed in liquid. The extended needle tip over a regular commercially available tapping-mode AFM cantilever was sufficiently long to keep the AFM cantilever from submersed in liquid, which significantly minimized the hydrodynamic damping involved in dynamic AFM imaging of samples in liquid. Dynamic AFM imaging of samples in liquid at an intrinsic Q factor of over 100 and an operational frequency of over 200 kHz was demonstrated. The method has the potential to be extended to acquire viscoelastic material properties and provide truly gentle imaging of soft biological samples in physiological environments.

  15. Simultaneous AFM nano-patterning and imaging for photomask repair

    NARCIS (Netherlands)

    Keyvani, A.; Tamer, M.S.; Es, M.H. van; Sadeghian Marnani, H.


    In this paper we present a new AFM based nano-patterning technique that can be used for fast defect repairing of high resolution photomasks and possibly other high-speed nano-patterning applications. The proposed method works based on hammering the sample with tapping mode AFM followed by wet cleani

  16. Closer look at the effect of AFM imaging conditions on the apparent dimensions of surface nanobubbles. (United States)

    Walczyk, Wiktoria; Schönherr, Holger


    To date, TM AFM (tapping mode or intermittent contact mode atomic force microscopy) is the most frequently applied direct imaging technique to visualize surface nanobubbles at the solid-aqueous interface. On one hand, AFM is the only profilometric technique that provides estimates of the bubbles' nanoscopic dimensions. On the other hand, the nanoscopic contact angles of surface nanobubbles estimated from their apparent dimensions that are deduced from AFM "height" images of nanobubbles differ markedly from the macrocopic water contact angles on the identical substrates. Here we show in detail how the apparent bubble height and width of surface nanobubbles on highly oriented pyrolytic graphite (HOPG) depend on the free amplitude of the cantilever oscillations and the amplitude setpoint ratio. (The role of these two AFM imaging parameters and their interdependence has not been studied so far for nanobubbles in a systematic way.) In all experiments, even with optimal scanning parameters, nanobubbles at the HOPG-water interface appeared to be smaller in the AFM images than their true size, which was estimated using a method presented herein. It was also observed that the severity of the underestimate increased with increasing bubble height and radius of curvature. The nanoscopic contact angle of >130° for nanobubbles on HOPG extrapolated to zero interaction force was only slightly overestimated and hence significantly higher than the macroscopic contact angle of water on HOPG (63 ± 2°). Thus, the widely reported contact angle discrepancy cannot be solely attributed to inappropriate AFM imaging conditions.

  17. Surface features on Sahara soil dust particles made visible by atomic force microscope (AFM) phase images


    Andreae, M. O.; G. Helas


    We show that atomic force microscopy (AFM) phase images can reveal surface features of soil dust particles, which are not evident using other microscopic methods. The non-contact AFM method is able to resolve topographical structures in the nanometer range as well as to uncover repulsive atomic forces and attractive van der Waals' forces, and thus gives insight to surface properties. Though the method does not allow quantitative assignment in terms of chemical compound description, it clearly...

  18. Fractal analysis of AFM images of the surface of Bowman's membrane of the human cornea. (United States)

    Ţălu, Ştefan; Stach, Sebastian; Sueiras, Vivian; Ziebarth, Noël Marysa


    The objective of this study is to further investigate the ultrastructural details of the surface of Bowman's membrane of the human cornea, using atomic force microscopy (AFM) images. One representative image acquired of Bowman's membrane of a human cornea was investigated. The three-dimensional (3-D) surface of the sample was imaged using AFM in contact mode, while the sample was completely submerged in optisol solution. Height and deflection images were acquired at multiple scan lengths using the MFP-3D AFM system software (Asylum Research, Santa Barbara, CA), based in IGOR Pro (WaveMetrics, Lake Oswego, OR). A novel approach, based on computational algorithms for fractal analysis of surfaces applied for AFM data, was utilized to analyze the surface structure. The surfaces revealed a fractal structure at the nanometer scale. The fractal dimension, D, provided quantitative values that characterize the scale properties of surface geometry. Detailed characterization of the surface topography was obtained using statistical parameters, in accordance with ISO 25178-2: 2012. Results obtained by fractal analysis confirm the relationship between the value of the fractal dimension and the statistical surface roughness parameters. The surface structure of Bowman's membrane of the human cornea is complex. The analyzed AFM images confirm a fractal nature of the surface, which is not taken into account by classical surface statistical parameters. Surface fractal dimension could be useful in ophthalmology to quantify corneal architectural changes associated with different disease states to further our understanding of disease evolution.

  19. Sub-surface imaging of carbon nanotube-polymer composites using dynamic AFM methods. (United States)

    Cadena, Maria J; Misiego, Rocio; Smith, Kyle C; Avila, Alba; Pipes, Byron; Reifenberger, Ron; Raman, Arvind


    High-resolution sub-surface imaging of carbon nanotube (CNT) networks within polymer nanocomposites is demonstrated through electrical characterization techniques based on dynamic atomic force microscopy (AFM). We compare three techniques implemented in the single-pass configuration: DC-biased amplitude modulated AFM (AM-AFM), electrostatic force microscopy (EFM) and Kelvin probe force microscopy (KPFM) in terms of the physics of sub-surface image formation and experimental robustness. The methods were applied to study the dispersion of sub-surface networks of single-walled nanotubes (SWNTs) in a polyimide (PI) matrix. We conclude that among these methods, the KPFM channel, which measures the capacitance gradient (∂C/∂d) at the second harmonic of electrical excitation, is the best channel to obtain high-contrast images of the CNT network embedded in the polymer matrix, without the influence of surface conditions. Additionally, we propose an analysis of the ∂C/∂d images as a tool to characterize the dispersion and connectivity of the CNTs. Through the analysis we demonstrate that these AFM-based sub-surface methods probe sufficiently deep within the SWNT composites, to resolve clustered networks that likely play a role in conductivity percolation. This opens up the possibility of dynamic AFM-based characterization of sub-surface dispersion and connectivity in nanostructured composites, two critical parameters for nanocomposite applications in sensors and energy storage devices.

  20. A rapid and automated relocation method of an AFM probe for high-resolution imaging (United States)

    Zhou, Peilin; Yu, Haibo; Shi, Jialin; Jiao, Niandong; Wang, Zhidong; Wang, Yuechao; Liu, Lianqing


    The atomic force microscope (AFM) is one of the most powerful tools for high-resolution imaging and high-precision positioning for nanomanipulation. The selection of the scanning area of the AFM depends on the use of the optical microscope. However, the resolution of an optical microscope is generally no larger than 200 nm owing to wavelength limitations of visible light. Taking into consideration the two determinants of relocation—relative angular rotation and positional offset between the AFM probe and nano target—it is therefore extremely challenging to precisely relocate the AFM probe to the initial scan/manipulation area for the same nano target after the AFM probe has been replaced, or after the sample has been moved. In this paper, we investigate a rapid automated relocation method for the nano target of an AFM using a coordinate transformation. The relocation process is both simple and rapid; moreover, multiple nano targets can be relocated by only identifying a pair of reference points. It possesses a centimeter-scale location range and nano-scale precision. The main advantages of this method are that it overcomes the limitations associated with the resolution of optical microscopes, and that it is label-free on the target areas, which means that it does not require the use of special artificial markers on the target sample areas. Relocation experiments using nanospheres, DNA, SWCNTs, and nano patterns amply demonstrate the practicality and efficiency of the proposed method, which provides technical support for mass nanomanipulation and detection based on AFM for multiple nano targets that are widely distributed in a large area.

  1. A rapid and automated relocation method of an AFM probe for high-resolution imaging. (United States)

    Zhou, Peilin; Yu, Haibo; Shi, Jialin; Jiao, Niandong; Wang, Zhidong; Wang, Yuechao; Liu, Lianqing


    The atomic force microscope (AFM) is one of the most powerful tools for high-resolution imaging and high-precision positioning for nanomanipulation. The selection of the scanning area of the AFM depends on the use of the optical microscope. However, the resolution of an optical microscope is generally no larger than 200 nm owing to wavelength limitations of visible light. Taking into consideration the two determinants of relocation-relative angular rotation and positional offset between the AFM probe and nano target-it is therefore extremely challenging to precisely relocate the AFM probe to the initial scan/manipulation area for the same nano target after the AFM probe has been replaced, or after the sample has been moved. In this paper, we investigate a rapid automated relocation method for the nano target of an AFM using a coordinate transformation. The relocation process is both simple and rapid; moreover, multiple nano targets can be relocated by only identifying a pair of reference points. It possesses a centimeter-scale location range and nano-scale precision. The main advantages of this method are that it overcomes the limitations associated with the resolution of optical microscopes, and that it is label-free on the target areas, which means that it does not require the use of special artificial markers on the target sample areas. Relocation experiments using nanospheres, DNA, SWCNTs, and nano patterns amply demonstrate the practicality and efficiency of the proposed method, which provides technical support for mass nanomanipulation and detection based on AFM for multiple nano targets that are widely distributed in a large area.

  2. Surface features on Sahara soil dust particles made visible by atomic force microscope (AFM) phase images (United States)

    Helas, G.; Andreae, M. O.


    We show that atomic force microscopy (AFM) phase images can reveal surface features of soil dust particles, which are not evident using other microscopic methods. The non-contact AFM method is able to resolve topographical structures in the nanometer range as well as to uncover repulsive atomic forces and attractive van der Waals' forces, and thus gives insight to surface properties. Though the method does not allow quantitative assignment in terms of chemical compound description, it clearly shows deposits of distinguishable material on the surface. We apply this technique to dust aerosol particles from the Sahara collected over the Atlantic Ocean and describe micro-features on the surfaces of such particles.

  3. Imaging and force measurement of LDL and HDL by AFM in air and liquid. (United States)

    Gan, Chaoye; Ao, Meiying; Liu, Zhanghua; Chen, Yong


    The size and biomechanical properties of lipoproteins are tightly correlated with their structures/functions. While atomic force microscopy (AFM) has been used to image lipoproteins the force measurement of these nano-sized particles is missing. We detected that the sizes of LDL and HDL in liquid are close to the commonly known values. The Young's modulus of LDL or HDL is ∼0.4 GPa which is similar to that of some viral capsids or nanovesicles but greatly larger than that of various liposomes. The adhesive force of LDL or HDL is small (∼200 pN). The comparison of AFM detection in air and liquid was also performed which is currently lacking. Our data may provide useful information for better understanding and AFM detection of lipoproteins.

  4. First-principles AFM image simulation with frozen density embedding theory (United States)

    Sakai, Yuki; Lee, Alex J.; Chelikowsky, James R.

    We present efficient first-principles method of non-contact atomic force microscopy (nc-AFM). Ordinary nc-AFM simulations based on density functional theory (DFT) require exhaustive computational cost because it involves thousands of total energy calculations. Regarding the sample as a fixed external potential can reduce the computational cost, and we adopt frozen density embedding theory (FDET) for this purpose. Simulated nc-AFM images with FDET using a carbon monoxide tip well reproduces the full DFT images of benzene, pentacene, and graphene, although optimized tip-sample distances and interaction energies in FDET are underestimated and overestimated, respectively. The FDET-based simulation method is promising for AFM image simulation of surfaces and two-dimensional materials. This work was supported by U.S. DOE under Grant No. DE-FG02-06ER46286 and Award No. DE-SC0008877, and by Welch Foundation under Grant F-1837. Computational resources are provided by NERSC and TACC.

  5. AFM imaging and analysis of local mechanical properties for detection of surface pattern of functional groups

    Energy Technology Data Exchange (ETDEWEB)

    Knotek, Petr, E-mail: [University of Pardubice, Faculty of Chemical Technology, Joint Laboratory of Solid State Chemistry of IMC ASCR and University of Pardubice, Studentska 573, 532 10 Pardubice (Czech Republic); Chanova, Eliska; Rypacek, Frantisek [Institute of Macromolecular Chemistry, Academy of Sciences of the Czech Republic, Heyrovskeho sq. 2, 162 06 Prague (Czech Republic)


    In this work we evaluate the applicability of different atomic force microscopy (AFM) modes, such as Phase Shift Imaging, Atomic Force Acoustic Microscopy (AFAM) and Force Spectroscopy, for mapping of the distribution pattern of low-molecular-weight biomimetic groups on polymer biomaterial surfaces. Patterns with either random or clustered spatial distribution of bioactive peptide group derived from fibronectin were prepared by surface deposition of functional block copolymer nano-colloids and grafted with RGDS peptide containing the sequence of amino acids arginine–glycine–aspartic acid–serine (conventionally labeled as RGDS) and carrying biotin as a tag. The biotin-tagged peptides were labeled with 40 nm streptavidin-modified Au nanospheres. The peptide molecules were localized through the detection of bound Au nanospheres by AFM, and thus, the surface distribution of peptides was revealed. AFM techniques capable of monitoring local mechanical properties of the surface were proved to be the most efficient for identification of Au nano-markers. The efficiency was successfully demonstrated on two different patterns, i.e. random and clustered distribution of RGDS peptides on structured surface of the polymer biomaterial. Highlights: ► Bioactive peptides for cell adhesion on PLA-b-PEO biomimetic surface were visualized. ► The biotin-tagged RGDS peptides were labeled with streptavidin-Au nanospheres. ► The RGDS pattern was detected using different atomic force microscopy (AFM) modes. ► Phase Shift Image was proved to be suitable method for studying peptide distribution.

  6. SEM and AFM images of pyrite surfaces after bioleaching by the indigenous Thiobacillus thiooxidans. (United States)

    Liu, H-L; Chen, B-Y; Lan, Y-W; Cheng, Y-C


    The bioleaching mechanism of pyrite by the indigenous Thiobacillus thiooxidans was examined with the aid of scanning electron microscopy (SEM) and atomic force microscopy (AFM) images of the pyrite surface. The presence of pyrite eliminated the lag phase during growth of this microorganism. This was due to the stimulatory effect on cell growth of the slight amount of Cu2+ that had leached from the pyrite. Zn2+ was found to be much more readily solubilized than Cu2+. The efficiency of bioleaching was four times higher than that of chemical leaching. SEM images provided evidence of direct cell attachment onto the pyrite surface, thereby enhancing the bioleaching rate. Furthermore, extracellular polymeric substances (EPSs) were found on the pyrite surface after 4 days of oxidation. AFM images showed that the pyrite surface area positively correlated with the oxidation rate. A combination of direct and indirect mechanism is probably responsible for the oxidation of pyrite by T. thiooxidans.

  7. AFM tip characterization by using FFT filtered images of step structures. (United States)

    Yan, Yongda; Xue, Bo; Hu, Zhenjiang; Zhao, Xuesen


    The measurement resolution of an atomic force microscope (AFM) is largely dependent on the radius of the tip. Meanwhile, when using AFM to study nanoscale surface properties, the value of the tip radius is needed in calculations. As such, estimation of the tip radius is important for analyzing results taken using an AFM. In this study, a geometrical model created by scanning a step structure with an AFM tip was developed. The tip was assumed to have a hemispherical cone shape. Profiles simulated by tips with different scanning radii were calculated by fast Fourier transform (FFT). By analyzing the influence of tip radius variation on the spectra of simulated profiles, it was found that low-frequency harmonics were more susceptible, and that the relationship between the tip radius and the low-frequency harmonic amplitude of the step structure varied monotonically. Based on this regularity, we developed a new method to characterize the radius of the hemispherical tip. The tip radii estimated with this approach were comparable to the results obtained using scanning electron microscope imaging and blind reconstruction methods.

  8. Robust deposition of lambda DNA on mica for imaging by AFM in air. (United States)

    Cervantes, Nancy Anabel Gerling; Gutiérrez-Medina, Braulio


    Long DNA molecules remain difficult to image by atomic force microscopy (AFM) because of their tendency to entanglement and spontaneous formation of networks. We present a comparison of two different DNA deposition methods operating at room temperature and humidity conditions, aimed at reproducible imaging of isolated and relaxed λ DNA conformations by AFM in air. We first demonstrate that a standard deposition procedure, consisting in adsorption of DNA in the presence of divalent cations followed by washing and air-drying steps, yields a coexistence of different types of λ DNA networks with a only a few isolated DNA chains. In contrast, deposition using a spin-coating-based technique results in reproducible coverage of a significant fraction of the substrate area by isolated and relaxed λ DNA molecules, with the added benefit of a reduction in the effect of a residual layer that normally embeds DNA strands and leads to an apparent DNA height closer to the expected value. Furthermore, we show that deposition by spin-coating is also well-suited to visualize DNA-protein complexes. These results indicate that spin-coating is a simple, powerful alternative for reproducible sample preparation for AFM imaging.

  9. AFM imaging reveals the tetrameric structure of the TRPM8 channel

    Energy Technology Data Exchange (ETDEWEB)

    Stewart, Andrew P.; Egressy, Kinga; Lim, Annabel [Department of Pharmacology, University of Cambridge, Tennis Court Road, Cambridge CB2 1PD (United Kingdom); Edwardson, J. Michael, E-mail: [Department of Pharmacology, University of Cambridge, Tennis Court Road, Cambridge CB2 1PD (United Kingdom)


    Several members of the transient receptor potential (TRP) channel superfamily have been shown to assemble as tetramers. Here we have determined the subunit stoichiometry of the transient receptor potential M8 (TRPM8) channel using atomic force microscopy (AFM). TRPM8 channels were isolated from transfected cells, and complexes were formed between the channels and antibodies against a V5 epitope tag present on each subunit. The complexes were then subjected to AFM imaging. A frequency distribution of the molecular volumes of antibody decorated channels had a peak at 1305 nm{sup 3}, close to the expected size of a TRPM8 tetramer. The frequency distribution of angles between pairs of bound antibodies had two peaks, at 93{sup o} and 172{sup o}, confirming that the channel assembles as a tetramer. We suggest that this assembly pattern is common to all members of the TRP channel superfamily.

  10. Surface features on Sahara soil dust particles made visible by atomic force microscope (AFM phase images

    Directory of Open Access Journals (Sweden)

    M. O. Andreae


    Full Text Available We show that atomic force microscopy (AFM phase images can reveal surface features of soil dust particles, which are not evident using other microscopic methods. The non-contact AFM method is able to resolve topographical structures in the nanometer range as well as to uncover repulsive atomic forces and attractive van der Waals' forces, and thus gives insight to surface properties. Though the method does not allow quantitative assignment in terms of chemical compound description, it clearly shows deposits of distinguishable material on the surface. We apply this technique to dust aerosol particles from the Sahara collected over the Atlantic Ocean and describe micro-features on the surfaces of such particles.

  11. Surface features on Sahara soil dust particles made visible by atomic force microscope (AFM phase images

    Directory of Open Access Journals (Sweden)

    G. Helas


    Full Text Available We show that atomic force microscopy (AFM phase images can reveal surface features of soil dust particles, which are not evident using other microscopic methods. The non-contact AFM method is able to resolve topographical structures in the nanometer range as well as to uncover repulsive atomic forces and attractive van der Waals' forces, and thus gives insight to surface properties. Though the method does not allow quantitative assignment in terms of chemical compound description, it clearly shows deposits of distinguishable material on the surface. We apply this technique to dust aerosol particles from the Sahara collected over the Atlantic Ocean and describe micro-features on the surfaces of such particles.

  12. Source coding model for repeated snapshot imaging

    CERN Document Server

    Li, Junhui; Yang, Dongyue; wu, Guohua; Yin, Longfei; Guo, Hong


    Imaging based on successive repeated snapshot measurement is modeled as a source coding process in information theory. The necessary number of measurement to maintain a certain level of error rate is depicted as the rate-distortion function of the source coding. Quantitative formula of the error rate versus measurement number relation is derived, based on the information capacity of imaging system. Second order fluctuation correlation imaging (SFCI) experiment with pseudo-thermal light verifies this formula, which paves the way for introducing information theory into the study of ghost imaging (GI), both conventional and computational.

  13. A new approach of recognition of ellipsoidal micro- and nanoparticles on AFM images and determination of their sizes (United States)

    Akhmadeev, Albert A.; Salakhov, Myakzyum Kh


    In this work we develop an approach of automatic recognition of ellipsoidal particles on the atomic force microscopy (AFM) image and determination of their size, which is based on image segmentation and the surface approximation by ellipsoids. In addition to the comparative simplicity and rapidity of processing, this method allows us to determine the size of particles, the surface of which is not completely visible on the image. The proposed method showed good results on simulated images including noisy ones. Using this algorithm the size distributions of silica particles on experimental AFM images have been determined.

  14. On the Accuracy of Imaging on the Nanometer Scale:Geometry versus Material Properties in High Resolution AFM Studies

    Institute of Scientific and Technical Information of China (English)

    Adam; Mechler; Janos; Kokavecz; Peter; Heszler


    1 Results Intermittent Contact Mode Atomic Force Microscopy (ICM-AFM) imaging of sub-micron morphology is a routine operation in many fields of research from materials science to molecular biology,typically used to obtain three dimensional geometrical measures of surface structures.When it comes to the nanometer-angstrom range,however,quantitative interpretation of AFM morphology is less straightforward.Reports of non-topography-originated features as well as anomalies and conflicting reports in nanostr...

  15. Optical imaging beyond the diffraction limit by SNEM: Effects of AFM tip modifications with thiol monolayers on imaging quality

    Energy Technology Data Exchange (ETDEWEB)

    Cumurcu, Aysegul [Materials Science and Technology of Polymers, MESA+ Institute for Nanotechnology, University of Twente, Enschede NL-7500 (Netherlands); Dutch Polymer Institute (DPI), P.O. Box 902, 5600 AX, Eindhoven (Netherlands); Diaz, Jordi [Scientific and Technological Centers of the University of Barcelona, C/ Lluís Solé i Sabaris, 1-3, 08028 Barcelona (Spain); Lindsay, Ian D. [Nanophysics and Soft Matter Group, H.H. Wills Physics Laboratory, University of Bristol, Tyndall Avenue, Bristol BS8 1TL (United Kingdom); Beer, Sissi de; Duvigneau, Joost [Materials Science and Technology of Polymers, MESA+ Institute for Nanotechnology, University of Twente, Enschede NL-7500 (Netherlands); Schön, Peter [Materials Science and Technology of Polymers, MESA+ Institute for Nanotechnology, University of Twente, Enschede NL-7500 (Netherlands); NanoBioInterface, Research Center Design and Technology, Saxion University of Applied Sciences, 7500 KB Enschede (Netherlands); Julius Vancso, G., E-mail: [Materials Science and Technology of Polymers, MESA+ Institute for Nanotechnology, University of Twente, Enschede NL-7500 (Netherlands)


    Tip-enhanced nanoscale optical imaging techniques such as apertureless scanning near-field optical microscopy (a-SNOM) and scanning near-field ellipsometric microscopy (SNEM) applications can suffer from a steady degradation in performance due to adhesion of atmospheric contaminants to the metal coated tip. Here, we demonstrate that a self-assembled monolayer (SAM) of ethanethiol (EtSH) is an effective means of protecting gold-coated atomic force microscopy (AFM) probe tips from accumulation of surface contaminants during prolonged exposure to ambient air. The period over which they yield consistent and reproducible results for scanning near-field ellipsometric microscopy (SNEM) imaging is thus extended. SNEM optical images of a microphase separated polystyrene-block-poly (methylmethacrylate) (PS-b-PMMA) diblock copolymer film, which were captured with bare and SAM-protected gold-coated AFM probes, both immediately after coating and following five days of storage in ambient air, were compared. During this period the intensity of the optical signals from the untreated gold tip fell by 66%, while those from the SAM protected tip fell by 14%. Additionally, gold coated AFM probe tips were modified with various lengths of alkanethiols to measure the change in intensity variation in the optical images with SAM layer thickness. The experimental results were compared to point dipole model calculations. While a SAM of 1-dodecanethiol (DoSH) was found to strongly suppress field enhancement we find that it can be locally removed from the tip apex by deforming the molecules under load, restoring SNEM image contrast. - Highlights: • SAM of ethanethiol is used to prevent contamination of gold coated tips. • Functionalizing gold coated tips with a SAM lead to reproducible SNEM imaging. • Point dipole model agreed with the experimental results of the SNEM images. • SAM of 1-dodecanethiol was found to strongly suppress field enhancement in SNEM. • SAM of 1-dodecanethiol

  16. Investigation of the influence of UV irradiation on collagen thin films by AFM imaging

    Energy Technology Data Exchange (ETDEWEB)

    Stylianou, Andreas, E-mail:; Yova, Dido; Alexandratou, Eleni


    Collagen is the major fibrous extracellular matrix protein and due to its unique properties, it has been widely used as biomaterial, scaffold and cell-substrate. The aim of the paper was to use Atomic Force Microscopy (AFM) in order to investigate well-characterized collagen thin films after ultraviolet light (UV) irradiation. The films were also used as in vitro culturing substrates in order to investigate the UV-induced alterations to fibroblasts. A special attention was given in the alteration on collagen D-periodicity. For short irradiation times, spectroscopy (fluorescence/absorption) studies demonstrated that photodegradation took place and AFM imaging showed alterations in surface roughness. Also, it was highlighted that UV-irradiation had different effects when it was applied on collagen solution than on films. Concerning fibroblast culturing, it was shown that fibroblast behavior was affected after UV irradiation of both collagen solution and films. Furthermore, after a long irradiation time, collagen fibrils were deformed revealing that collagen fibrils are consisting of multiple shells and D-periodicity occurred on both outer and inner shells. The clarification of the effects of UV light on collagen and the induced modifications of cell behavior on UV-irradiated collagen-based surfaces will contribute to the better understanding of cell–matrix interactions in the nanoscale and will assist in the appropriate use of UV light for sterilizing and photo-cross-linking applications. - Highlights: • Collagen thin films were formed and exposed in UV irradiation. • Collagen thin films were formed from UV-irradiated collagen solution. • Nanocharacterization of collagen thin films by AFM • Fluorescence and absorption spectroscopy studies on collagen films • Investigation of fibroblast response on collagen films.

  17. AFM imaging of bacteria in liquid media immobilized on gelatin coated mica surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Doktycz, M.J.; Sullivan, C.J.; Hoyt, P.R.; Pelletier, D.A.; Wu, S.; Allison, D.P


    Immobilization of particulates, especially biomolecules and cells, onto surfaces is critical for imaging with the atomic force microscope (AFM). In this paper, gelatin coated mica surfaces are shown to be suitable for immobilizing and imaging both gram positive, Staphylococcus aureus, and gram negative, Escherichia coli, bacteria in both air and liquid environments. Gelatin coated surfaces are shown to be superior to poly-L-lysine coated surfaces that are commonly used for the immobilization of cells. This cell immobilization technique is being developed primarily for live cell imaging of Rhodopseudomonas palustris. The genome of R. palustris has been sequenced and the organism is the target of intensive studies aimed at understanding genome function. Images of R. palustris grown both aerobically and anaerobically in liquid media are presented. Images in liquid media show the bacteria is rod shaped and smooth while images in air show marked irregularity and folding of the surface. Significant differences in the vertical dimension are also apparent with the height of the bacteria in liquid being substantially greater than images taken in air. In air immobilized bacterial flagella are clearly seen while in liquid this structure is not visible. Additionally, significant morphological differences are observed that depend on the method of bacterial growth.

  18. BOREAS AFM-6 NOAA/ETL 35 GHz Cloud/Turbulence Radar GIF Images (United States)

    Martner, Brooks E.; Newcomer, Jeffrey A. (Editor); Hall, Forrest G.; Smith, David E. (Technical Monitor)


    The Boreal Ecosystem-Atmosphere Study (BOREAS) Airborne Fluxes and Meteorology (AFM)-6 team from the National Oceanic and Atmospheric Administration/Environment Technology Laboratory (NOAA/ETL) operated a 35-GHz cloud-sensing radar in the Northern Study Area (NSA) near the Old Jack Pine (OJP) tower from 16 Jul 1994 to 08 Aug 1994. This data set contains a time series of GIF images that show the structure of the lower atmosphere. The NOAA/ETL 35-GHz cloud/turbulence radar GIF images are available from the Earth Observing System Data and Information System (EOSDIS) Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC). The data files are available on a CD-ROM (see document number 20010000884).

  19. Noncontact AFM Imaging of Atomic Defects on the Rutile TiO2 (110) Surface

    DEFF Research Database (Denmark)

    Lauritsen, Jeppe Vang


    The atomic force microscope (AFM) operated in the noncontact mode (nc-AFM) offers a unique tool for real space, atomic-scale characterisation of point defects and molecules on surfaces, irrespective of the substrate being electrically conducting or non-conducting. The nc-AFM has therefore in rece...... on the rutile TiO2(110) surface. The present Chapter continues the review of nc-AFM initiated in Chap. 7 by Barth....

  20. Surface characterization and AFM imaging of mixed fibrinogen-surfactant films. (United States)

    Hassan, Natalia; Maldonado-Valderrama, Julia; Gunning, A Patrick; Morris, Victor J; Ruso, Juan M


    This study describes the adsorption behavior of mixed protein/surfactant systems at the air-water interface: specifically fibrinogen and the fluorinated and hydrogenated surfactants (C(8)FONa, C(8)HONa, and C(12)HONa). Surface tension techniques and atomic force microscopy (AFM) have been combined to investigate the adsorption behavior of these mixed systems. Interfacial rheology showed that fibrinogen has a low dilatational modulus at the air-water interface when compared to other proteins, suggesting the formation of a weak surface network. Fluorinated and hydrogenated surfactants severely decreased the dilatational modulus of the adsorbed fibrinogen film at the air-water interface. These measurements suggest the progressive displacement of fibrinogen from the air-water interface by both types of surfactants. However, in the case of fibrinogen/fluorinated surfactant systems, surface tension and dilatational rheology measurements suggest the formation of complexes with improved surface activity. AFM imaging of fibrinogen in the presence and absence of surfactants provided new information on the structure of mixed surface films, and revealed new features of the interaction of fibrinogen with hydrogenated and fluorinated surfactants. These studies suggest complexes formed between fibrinogen and fluorinated surfactants which are more surface active than fibrinogen, while the absence of interaction between fibrinogen and hydrogenated surfactants (C(8)HONa and C(12)HONa) results in compaction of the surface layer.

  1. Optical imaging beyond the diffraction limit by SNEM: effects of AFM tip modifications with thiol monolayers on imaging quality. (United States)

    Cumurcu, Aysegul; Diaz, Jordi; Lindsay, Ian D; de Beer, Sissi; Duvigneau, Joost; Schön, Peter; Vancso, G Julius


    Tip-enhanced nanoscale optical imaging techniques such as apertureless scanning near-field optical microscopy (a-SNOM) and scanning near-field ellipsometric microscopy (SNEM) applications can suffer from a steady degradation in performance due to adhesion of atmospheric contaminants to the metal coated tip. Here, we demonstrate that a self-assembled monolayer (SAM) of ethanethiol (EtSH) is an effective means of protecting gold-coated atomic force microscopy (AFM) probe tips from accumulation of surface contaminants during prolonged exposure to ambient air. The period over which they yield consistent and reproducible results for scanning near-field ellipsometric microscopy (SNEM) imaging is thus extended. SNEM optical images of a microphase separated polystyrene-block-poly (methylmethacrylate) (PS-b-PMMA) diblock copolymer film, which were captured with bare and SAM-protected gold-coated AFM probes, both immediately after coating and following five days of storage in ambient air, were compared. During this period the intensity of the optical signals from the untreated gold tip fell by 66%, while those from the SAM protected tip fell by 14%. Additionally, gold coated AFM probe tips were modified with various lengths of alkanethiols to measure the change in intensity variation in the optical images with SAM layer thickness. The experimental results were compared to point dipole model calculations. While a SAM of 1-dodecanethiol (DoSH) was found to strongly suppress field enhancement we find that it can be locally removed from the tip apex by deforming the molecules under load, restoring SNEM image contrast.

  2. Atomic force microscopy for analyzing metaphase chromosomes: comparison of AFM images with fluorescence labeling images of banding patterns. (United States)

    Hoshi, Osamu; Ushiki, Tatsuo


    The combined use of fluorescence microscopy with atomic force microscopy (AFM) has been introduced to analyze the replication-banding patterns of human chromosomes. Human lymphocytes synchronized with excess thymidine are treated with 5-ethynyl-2'-deoxyuridine (EdU) during the late S phase. EdU-labeled DNA is detected in metaphase chromosomes using Alexa Fluor 488(®) azide, through the 1,3-dipolar cycloaddition reaction of organic azides with the terminal acetylene group of EdU. Chromosomes with EdU incorporated during the late S phase show a banding pattern similar to the G-banding pattern of normal human chromosomes. The comparison between the fluorescence and AFM image of the same chromosome indicates the presence of ridges and grooves in the chromatid arms, which correspond to G-positive and G-negative bands, respectively. This technique of EdU-labeled replication bands combined with AFM is useful to analyze the structure of chromosomes in relation to the banding pattern.

  3. The effect of PeakForce tapping mode AFM imaging on the apparent shape of surface nanobubbles. (United States)

    Walczyk, Wiktoria; Schön, Peter M; Schönherr, Holger


    Until now, TM AFM (tapping mode or intermittent contact mode atomic force microscopy) has been the most often applied direct imaging technique to analyze surface nanobubbles at the solid-aqueous interface. While the presence and number density of nanobubbles can be unequivocally detected and estimated, it remains unclear how much the a priori invasive nature of AFM affects the apparent shapes and dimensions of the nanobubbles. To be able to successfully address the unsolved questions in this field, the accurate knowledge of the nanobubbles' dimensions, radii of curvature etc is necessary. In this contribution we present a comparative study of surface nanobubbles on HOPG (highly oriented pyrolytic graphite) in water acquired with (i) TM AFM and (ii) the recently introduced PFT (PeakForce tapping) mode, in which the force exerted on the nanobubbles rather than the amplitude of the resonating cantilever is used as the AFM feedback parameter during imaging. In particular, we analyzed how the apparent size and shape of nanobubbles depend on the maximum applied force in PFT AFM. Even for forces as small as 73 pN, the nanobubbles appeared smaller than their true size, which was estimated from an extrapolation of the bubble height to zero applied force. In addition, the size underestimation was found to be more pronounced for larger bubbles. The extrapolated true nanoscopic contact angles for nanobubbles on HOPG, measured in PFT AFM, ranged from 145° to 175° and were only slightly underestimated by scanning with non-zero forces. This result was comparable to the nanoscopic contact angles of 160°-175° measured using TM AFM in the same set of experiments. Both values disagree, in accordance with the literature, with the macroscopic contact angle of water on HOPG, measured here to be 63° ± 2°.

  4. Tracer kinetic modeling of [(11)C]AFM, a new PET imaging agent for the serotonin transporter. (United States)

    Naganawa, Mika; Nabulsi, Nabeel; Planeta, Beata; Gallezot, Jean-Dominique; Lin, Shu-Fei; Najafzadeh, Soheila; Williams, Wendol; Ropchan, Jim; Labaree, David; Neumeister, Alexander; Huang, Yiyun; Carson, Richard E


    [(11)C]AFM, or [(11)C]2-[2-(dimethylaminomethyl)phenylthio]-5-fluoromethylphenylamine, is a new positron emission tomography (PET) radioligand with high affinity and selectivity for the serotonin transporter (SERT). The purpose of this study was to determine the most appropriate kinetic model to quantify [(11)C]AFM binding in the healthy human brain. Positron emission tomography data and arterial input functions were acquired from 10 subjects. Compartmental modeling and the multilinear analysis-1(MA1) method were tested using the arterial input functions. The one-tissue model showed a lack of fit in low-binding regions, and the two-tissue model failed to estimate parameters reliably. Regional time-activity curves were well described by MA1. The rank order of [(11)C]AFM binding potential (BPND) matched well with the known regional SERT densities. For routine use of [(11)C]AFM, several noninvasive methods for quantification of regional binding were evaluated, including simplified reference tissue models (SRTM and SRTM2), and multilinear reference tissue models (MRTM and MRTM2). The best methods for region of interest (ROI) analysis were MA1, MRTM2, and SRTM2, with fixed population kinetic values ( or b') for the reference methods. The MA1 and MRTM2 methods were best for parametric imaging. These results showed that [(11)C]AFM is a suitable PET radioligand to image and quantify SERT in humans.

  5. Replication and dimensional quality control of industrial nanoscale surfaces using calibrated AFM measurements and SEM image processing

    DEFF Research Database (Denmark)

    Tosello, Guido; Hansen, Hans Nørgaard; Marinello, F.


    application of AFM to calibrate height, depth and pitch of sub-micrometer features and SEM image processing to detect replication accuracy in terms of number of replicated features. Surface replication is analyzed using a metrological approach: nano-features on nickel stampers and injection...

  6. Cobaltocenium-functionalized poly(propylene imine) dendrimers: redox and electromicrogravimetric studies and AFM imaging. (United States)

    Takada, K; Díaz, D J; Abruña, H D; Cuadrado, I; González, B; Casado, C M; Alonso, B; Morán, M; Losada, J


    The first four generations of cobaltocenium-functionalized, diaminobutane-based poly(propylene imine) dendrimers DAB-dend-Cb,(PFb)x (x = 4, 8, 16, and 32; Cb=[Co(eta5-C5H4CONH)(eta5-C5H5)] (1-4) have been synthesized and characterized. The redox activity of the cobaltocenium centers in 1-4 has been characterized by using cyclic voltammetry and the electrochemical quartz-crystal microbalance (EQCM). All of the dendrimers exhibit reversible redox chemistry associated with the cobaltocenium/cobaltocene redox couple. Upon reduction. the dendrimers exhibit a tendency to electrodeposit onto the electrode surface, which is more pronounced for the higher generations. Pt and glassy carbon electrodes could be modified with films derived from 1-4,exhibiting a well-defined and persistent electrochemical response. EQCM measurements show that the dendrimers adsorb, at open circuit, onto platinum surfaces at monolayer or submonolayer coverage. Cathodic potential scanning past -0.75 V at which the cobaltocenium sites are reduced, gave rise to the electrodeposition of multilayer equivalents of the dendrimers. The additional material gradually desorbs upon re-oxidation so that only a monolayer equivalent remains on the electrode surface. Changes in film morphology as a function of dendrimer generation and surface coverage were studied by using admittance measurements of the quartz-crystal resonator on the basis of its electrical equivalent circuit, especially in terms of its resistance parameter. In general, we find that films of the lower dendrimer generation 1 behave rigidly, whereas those of the higher generation 4 exhibit viscoelastic behavior with an intermediate behavior being exhibited by 2 and 3. Using tapping-mode atomic force microscopy (AFM). we have been able to obtain molecularly resolved images of dendrimer 4 adsorbed on a Pt(111) electrode.

  7. Three-channel false colour AFM images for improved interpretation of complex surfaces: a study of filamentous cyanobacteria. (United States)

    Kurk, Toby; Adams, David G; Connell, Simon D; Thomson, Neil H


    Imaging signals derived from the atomic force microscope (AFM) are typically presented as separate adjacent images with greyscale or pseudo-colour palettes. We propose that information-rich false-colour composites are a useful means of presenting three-channel AFM image data. This method can aid the interpretation of complex surfaces and facilitate the perception of information that is convoluted across data channels. We illustrate this approach with images of filamentous cyanobacteria imaged in air and under aqueous buffer, using both deflection-modulation (contact) mode and amplitude-modulation (tapping) mode. Topography-dependent contrast in the error and tertiary signals aids the interpretation of the topography signal by contributing additional data, resulting in a more detailed image, and by showing variations in the probe-surface interaction. Moreover, topography-independent contrast and topography-dependent contrast in the tertiary data image (phase or friction) can be distinguished more easily as a consequence of the three dimensional colour-space.

  8. The effect of low-temperature plasma on bacteria as observed by repeated AFM imaging

    Energy Technology Data Exchange (ETDEWEB)

    Pompl, Rene; Jamitzky, Ferdinand; Shimizu, Tetsuji; Steffes, Bernd; Bunk, Wolfram; Morfill, Gregor Eugen [Max-Planck Institute for Extraterrestrial Physics, 85748 Garching (Germany); Schmidt, Hans-Ulrich [Institute for Medical Microbiology, Munich Schwabing Hospital, Munich (Germany); Georgi, Matthias; Ramrath, Katrin; Stolz, Wilhelm [Clinic for Dermatology, Allergology and Environmental Medicine, Munich Schwabing Hospital, Munich (Germany); Stark, Robert W [Center for Nanoscience and Department of Earth and Environmental Sciences, Ludwig-Maximilians-Universitaet Muenchen, Munich (Germany); Urayama, Takuya; Fujii, Shuitsu [ADTEC Plasma Technology Co. Ltd, Fukuyama (Japan)], E-mail:


    Research on low-temperature atmospheric plasma sources (LTAPS) has grown strongly over the last few years, in part driven by possible medical 'in vivo' applications. LTAPS offer new technology for medicine and biomedical engineering. Important application examples include in situ production of reactive molecules and ions, delivery at the molecular level, contact-free and self-sterilizing devices. An important issue is the efficient bactericidal effect of LTAPS, which has already been studied widely in vitro. In spite of the many investigations, details of the plasma effect on bacteria are still largely unknown. To contribute to a better understanding of the sterilization process, we investigated the morphological changes of bacteria using atomic force microscopy before and after plasma treatment at high resolution. We examined both gram-positive and gram-negative bacteria at different plasma exposure times. Additionally, the effect of UV radiation as one agent in the plasma was investigated separately. Our results suggest that several sterilizing mechanisms exist and they proceed at different timescales.

  9. Nanoscale structural features determined by AFM for single virus particles (United States)

    Chen, Shu-Wen W.; Odorico, Michael; Meillan, Matthieu; Vellutini, Luc; Teulon, Jean-Marie; Parot, Pierre; Bennetau, Bernard; Pellequer, Jean-Luc


    In this work, we propose ``single-image analysis'', as opposed to multi-image averaging, for extracting valuable information from AFM images of single bio-particles. This approach allows us to study molecular systems imaged by AFM under general circumstances without restrictions on their structural forms. As feature exhibition is a resolution correlation, we have performed AFM imaging on surfaces of tobacco mosaic virus (TMV) to demonstrate variations of structural patterns with probing resolution. Two AFM images were acquired with the same tip at different probing resolutions in terms of pixel width, i.e., 1.95 and 0.49 nm per pixel. For assessment, we have constructed an in silico topograph based on the three-dimensional crystal structure of TMV as a reference. The prominent artifacts observed in the AFM-determined shape of TMV were attributed to tip convolutions. The width of TMV rod was systematically overestimated by ~10 nm at both probing resolutions of AFM. Nevertheless, the effects of tip convolution were less severe in vertical orientation so that the estimated height of TMV by AFM imaging was in close agreement with the in silico X-ray topograph. Using dedicated image processing algorithms, we found that at low resolution (i.e., 1.95 nm per pixel), the extracted surface features of TMV can be interpreted as a partial or full helical repeat (three complete turns with ~7.0 nm in length), while individual protein subunits (~2.5 nm) were perceivable only at high resolution. The present study shows that the scales of revealed structural features in AFM images are subject to both probing resolution and processing algorithms for image analysis.

  10. Nanoscale structural features determined by AFM for single virus particles. (United States)

    Chen, Shu-wen W; Odorico, Michael; Meillan, Matthieu; Vellutini, Luc; Teulon, Jean-Marie; Parot, Pierre; Bennetau, Bernard; Pellequer, Jean-Luc


    In this work, we propose "single-image analysis", as opposed to multi-image averaging, for extracting valuable information from AFM images of single bio-particles. This approach allows us to study molecular systems imaged by AFM under general circumstances without restrictions on their structural forms. As feature exhibition is a resolution correlation, we have performed AFM imaging on surfaces of tobacco mosaic virus (TMV) to demonstrate variations of structural patterns with probing resolution. Two AFM images were acquired with the same tip at different probing resolutions in terms of pixel width, i.e., 1.95 and 0.49 nm per pixel. For assessment, we have constructed an in silico topograph based on the three-dimensional crystal structure of TMV as a reference. The prominent artifacts observed in the AFM-determined shape of TMV were attributed to tip convolutions. The width of TMV rod was systematically overestimated by ~10 nm at both probing resolutions of AFM. Nevertheless, the effects of tip convolution were less severe in vertical orientation so that the estimated height of TMV by AFM imaging was in close agreement with the in silico X-ray topograph. Using dedicated image processing algorithms, we found that at low resolution (i.e., 1.95 nm per pixel), the extracted surface features of TMV can be interpreted as a partial or full helical repeat (three complete turns with ~7.0 nm in length), while individual protein subunits (~2.5 nm) were perceivable only at high resolution. The present study shows that the scales of revealed structural features in AFM images are subject to both probing resolution and processing algorithms for image analysis.

  11. Unspecific membrane protein-lipid recognition: combination of AFM imaging, force spectroscopy, DSC and FRET measurements. (United States)

    Borrell, Jordi H; Montero, M Teresa; Morros, Antoni; Domènech, Òscar


    In this work, we will describe in quantitative terms the unspecific recognition between lactose permease (LacY) of Escherichia coli, a polytopic model membrane protein, and one of the main components of the inner membrane of this bacterium. Supported lipid bilayers of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol (POPG) (3:1, mol/mol) in the presence of Ca(2+) display lateral phase segregation that can be distinguished by atomic force microscopy (AFM) as well as force spectroscopy. LacY shows preference for fluid (Lα) phases when it is reconstituted in POPE : POPG (3:1, mol/mol) proteoliposomes at a lipid-to-protein ratio of 40. When the lipid-to-protein ratio is decreased down to 0.5, two domains can be distinguished by AFM. While the upper domain is formed by self-segregated units of LacY, the lower domain is constituted only by phospholipids in gel (Lβ) phase. On the one hand, classical differential scanning calorimetry (DSC) measurements evidenced the segregation of a population of phospholipids and point to the existence of a boundary region at the lipid-protein interface. On the other hand, Förster Resonance Energy Transfer (FRET) measurements in solution evidenced that POPE is selectively recognized by LacY. A binary pseudophase diagram of POPE : POPG built from AFM observations enables to calculate the composition of the fluid phase where LacY is inserted. These results are consistent with a model where POPE constitutes the main component of the lipid-LacY interface segregated from the fluid bulk phase where POPG predominates. Copyright © 2015 John Wiley & Sons, Ltd.

  12. In situ AFM imaging of apolipoprotein A-I directly derived from plasma HDL. (United States)

    Gan, Chaoye; Wang, Zhexuan; Chen, Yong


    The major apolipoproteins of plasma lipoproteins play vital roles in the structural integrity and physiological functions of lipoproteins. More than ten structural models of apolipoprotein A-I (apoA-I), the major apolipoprotein of high-density lipoprotein (HDL), have been developed successively. In these models, apoA-I was supposed to organize in a ring-shaped form. To date, however, there is no direct evidence under physiological condition. Here, atomic force microscopy (AFM) was used to in situ visualize the organization of apoA-I, which was exposed via depletion of the lipid component of plasma HDL pre-immobilized on functionalized mica sheets. For the first time, the ring-shaped coarse structure and three detailed structures (crescent-shaped, gapped "O"-shaped, and parentheses-shaped structures, respectively) of apoA-I in plasma HDL, which have the ability of binding scavenger receptors, were directly observed and quantitatively measured by AFM. The three detailed structures probably represent the different extents to which the lipid component of HDL was depleted. Data on lipid depletion of HDL may provide clues to understand lipid insertion of HDL. These data provide important information for the understanding of the structure/maturation of plasma HDL. Moreover, they suggest a powerful method for directly visualizing the major apolipoproteins of plasma lipoproteins or the protein component of lipoprotein-like lipid-protein complexes. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. AFM's path to atomic resolution



    We review progress in improving the spatial resolution of atomic force microscopy (AFM) under vacuum. After an introduction to the basic imaging principle and a conceptual comparison to scanning tunneling microscopy (STM), we outline the main challenges of AFM as well as the solutions that have evolved in the first 20 years of its existence. Some crucial steps along AFM's path toward higher resolution are discussed, followed by an outlook on current and future applications.

  14. Self assembly of epicuticular waxes on living plant surfaces imaged by atomic force microscopy (AFM). (United States)

    Koch, Kerstin; Neinhuis, Christoph; Ensikat, Hans-Jürgen; Barthlott, Wilhelm


    The cuticle of terrestrial vascular plants and some bryophytes is covered with a complex mixture of lipids, usually called epicuticular waxes. Self-assembly processes of wax molecules lead to crystalline three-dimensional micro- and nanostructures that emerge from an underlying wax film. This paper presents the first AFM study on wax regeneration on the surfaces of living plants and the very early stages of wax crystal formation at the molecular level. Wax formation was analysed on the leaves of Euphorbia lathyris, Galanthus nivalis, and Ipheion uniflorum. Immediately after wax removal, regeneration of a wax film began, consisting of individual layers of, typically, 3-5 nm thickness. Subsequently, several different stages of crystal growth could be distinguished, and different patterns of wax regeneration as well as considerable variation in regeneration speed were found.

  15. Hydrocarbons in phlogopite from Kasenyi kamafugitic rocks (SW Uganda): cross-correlated AFM, confocal microscopy and Raman imaging (United States)

    Moro, Daniele; Valdrè, Giovanni; Mesto, Ernesto; Scordari, Fernando; Lacalamita, Maria; Ventura, Giancarlo Della; Bellatreccia, Fabio; Scirè, Salvatore; Schingaro, Emanuela


    This study presents a cross-correlated surface and near surface investigation of two phlogopite polytypes from Kasenyi kamafugitic rocks (SW Uganda) by means of advanced Atomic Force Microscopy (AFM), confocal microscopy and Raman micro-spectroscopy. AFM revealed comparable nanomorphology and electrostatic surface potential for the two mica polytypes. A widespread presence of nano-protrusions located on the mica flake surface was also observed, with an aspect ratio (maximum height/maximum width) from 0.01 to 0.09. Confocal microscopy showed these features to range from few nm to several μm in dimension, and shapes from perfectly circular to ellipsoidic and strongly elongated. Raman spectra collected across the bubbles showed an intense and convolute absorption in the range 3000–2800 cm‑1, associated with weaker bands at 1655, 1438 and 1297 cm‑1, indicating the presence of fluid inclusions consisting of aliphatic hydrocarbons, alkanes and cycloalkanes, with minor amounts of oxygenated compounds, such as carboxylic acids. High-resolution Raman images provided evidence that these hydrocarbons are confined within the bubbles. This work represents the first direct evidence that phlogopite, a common rock-forming mineral, may be a possible reservoir for hydrocarbons.

  16. Hydrocarbons in phlogopite from Kasenyi kamafugitic rocks (SW Uganda): cross-correlated AFM, confocal microscopy and Raman imaging (United States)

    Moro, Daniele; Valdrè, Giovanni; Mesto, Ernesto; Scordari, Fernando; Lacalamita, Maria; Ventura, Giancarlo Della; Bellatreccia, Fabio; Scirè, Salvatore; Schingaro, Emanuela


    This study presents a cross-correlated surface and near surface investigation of two phlogopite polytypes from Kasenyi kamafugitic rocks (SW Uganda) by means of advanced Atomic Force Microscopy (AFM), confocal microscopy and Raman micro-spectroscopy. AFM revealed comparable nanomorphology and electrostatic surface potential for the two mica polytypes. A widespread presence of nano-protrusions located on the mica flake surface was also observed, with an aspect ratio (maximum height/maximum width) from 0.01 to 0.09. Confocal microscopy showed these features to range from few nm to several μm in dimension, and shapes from perfectly circular to ellipsoidic and strongly elongated. Raman spectra collected across the bubbles showed an intense and convolute absorption in the range 3000–2800 cm−1, associated with weaker bands at 1655, 1438 and 1297 cm−1, indicating the presence of fluid inclusions consisting of aliphatic hydrocarbons, alkanes and cycloalkanes, with minor amounts of oxygenated compounds, such as carboxylic acids. High-resolution Raman images provided evidence that these hydrocarbons are confined within the bubbles. This work represents the first direct evidence that phlogopite, a common rock-forming mineral, may be a possible reservoir for hydrocarbons. PMID:28098185

  17. Kinetics of interaction of HIV fusion protein (gp41) with lipid membranes studied by real-time AFM imaging

    Energy Technology Data Exchange (ETDEWEB)

    Bitler, Arkady, E-mail: [Department of Chemical Research Support (Israel); Lev, Naama; Fridmann-Sirkis, Yael; Blank, Lior [Department of Biological Chemistry, Weizmann Institute of Science, Rehovot 76100 (Israel); Cohen, Sidney R. [Department of Chemical Research Support (Israel); Shai, Yechiel [Department of Biological Chemistry, Weizmann Institute of Science, Rehovot 76100 (Israel)


    One of the most important steps in the process of viral infection is a fusion between cell membrane and virus, which is mediated by the viral envelope glycoprotein. The study of activity of the glycoprotein in the post-fusion state is important for understanding the progression of infection. Here we present a first real-time kinetic study of the activity of gp41 (the viral envelope glycoprotein of human immunodeficiency virus-HIV) and its two mutants in the post-fusion state with nanometer resolution by atomic force microscopy (AFM). Tracking the changes in the phosphatidylcholine (PC) and phosphatidylcholine-phosphatidylserine (PC:PS) membrane integrity over one hour by a set of AFM images revealed differences in the interaction of the three types of protein with zwitterionic and negatively charged membranes. A quantitative analysis of the slow kinetics of hole formation in the negatively charged lipid bilayer is presented. Specifically, analysis of the rate of roughness change for the three types of proteins suggests that they exhibit different types of kinetic behavior.

  18. Adsorption of modified dextrins to a hydrophobic surface: QCM-D studies, AFM imaging, and dynamic contact angle measurements. (United States)

    Sedeva, Iliana G; Fetzer, Renate; Fornasiero, Daniel; Ralston, John; Beattie, David A


    The adsorption of three dextrin-based polymers, regular wheat dextrin (Dextrin TY), phenyl succinate dextrin (PS Dextrin), and styrene oxide dextrin (SO Dextrin) on a model hydrophobic surface, consisting of a mixed alkanethiol layer on gold, has been characterized using the quartz crystal microbalance with dissipation monitoring (QCM-D). The three polymers exhibited varying affinities and capacity for adsorption on the hydrophobic substrate. Atomic force microscope (AFM) imaging of the polymer layers indicates that all three polymers fully cover the surface. The effect of the three polymers on the static contact angle of the surface was studied using captive bubble contact angle measurements. The three polymers were seen to reduce the receding contact angle by similar amounts (approximately 14°) in spite of having varying adsorbed amounts and differences in adsorbed layer water content. Although no differences were observed in the ability of the polymers to reduce the static contact angle, measurements of the dynamic contact angle between a rising air bubble and the polymer covered substrate yielded stark differences between the polymers, with one polymer (SO Dextrin) slowing the dewetting by an order of magnitude more than the other two polymers. The differences in dewetting behavior correlate with the adsorbed layer characteristics determined by QCM-D and AFM. The role of the dynamic and static contact angle in the performance of a polymer as depressant is discussed.

  19. Zeta potential, contact angles, and AFM imaging of protein conformation adsorbed on hybrid nanocomposite surfaces. (United States)

    Pinho, Ana C; Piedade, Ana P


    The sputtering deposition of gold (Au) and poly(tetrafluoroethylene) (PTFE) was used to prepare a nanocomposite hybrid thin film suitable for protein adsorption while maintaining the native conformation of the biological material. The monolithic PTFE and the nanocomposite PTFE/Au thin films, with Au content up to 1 at %, were co-deposited by r.f. magnetron sputtering using argon as a discharge gas and deposited onto 316L stainless steel substrates, the most commonly used steel in biomaterials. The deposited thin films, before and after bovine serum albumin (BSA) adsorption, were thoroughly characterized with special emphasis on the surface properties/characteristics by atomic force microscopy (AFM), zeta potential, and static and dynamic contact angle measurements, in order to assess the relationship between structure and conformational changes. The influence of a pre-adsorbed peptide (RGD) was also evaluated. The nanotopographic and chemical changes induced by the presence of gold in the nanocomposite thin films enable RGD bonding, which is critical for the maintenance of the BSA native conformation after adsorption.

  20. Absorption Spectroscopy and Imaging from the Visible through Mid-IR with 20 nm Resolution Using AFM probes (United States)

    Centrone, Andrea


    Correlated nanoscale composition and optical property maps are important to engineer nanomaterials in applications ranging from photovoltaics to sensing and therapeutics. Wavelengths (λs) from the visible to near-IR probe electronic transitions in materials, providing information regarding band gap and defects while light in mid-IR probes vibrational transitions and provide chemical composition. However, light diffraction limits the lateral resolution of conventional micro-spectroscopic techniques to approximately λ/2, which is insufficient to image nanomaterials. Additionally, the λ-dependent resolution impedes direct comparison of spectral maps from different spectral ranges. Photo Thermal Induced Resonance (PTIR) is a novel technique that circumvents light diffraction by employing an AFM tip as a local detector for measuring light absorption with λ-independent nanoscale resolution. Our PTIR setup combines an AFM microscope with three lasers providing λ-tunability from 500 nm to 16000 nm continuously. The AFM tip transduces locally the sample thermal expansion induced by light absorption into large cantilever oscillations. Local absorption spectra (electronic or vibrational) and maps are obtained recording the amplitude of the tip deflection as a function of λ and position, respectively. The working principles of the PTIR technique will be described first, and nano-patterned polymer samples will be used to evaluate its lateral resolution, sensitivity and linearity. Results show that the PTIR signal intensity is proportional to the local absorbed energy suggesting applicability of this technique for quantitative chemical analysis at nanoscale, at least for thin (less than 1000 nm thick) samples. Additionally, a λ-independent resolution as high as 20 nm is demonstrated across the whole spectral range. In the second part of the talk, PTIR will be applied to image the dark plasmonic resonance of gold Asymmetric Split Ring Resonators (A-SRRs) in the mid

  1. Indications of chemical bond contrast in AFM images of a hydrogen-terminated silicon surface (United States)

    Labidi, Hatem; Koleini, Mohammad; Huff, Taleana; Salomons, Mark; Cloutier, Martin; Pitters, Jason; Wolkow, Robert A.


    The origin of bond-resolved atomic force microscope images remains controversial. Moreover, most work to date has involved planar, conjugated hydrocarbon molecules on a metal substrate thereby limiting knowledge of the generality of findings made about the imaging mechanism. Here we report the study of a very different sample; a hydrogen-terminated silicon surface. A procedure to obtain a passivated hydrogen-functionalized tip is defined and evolution of atomic force microscopy images at different tip elevations are shown. At relatively large tip-sample distances, the topmost atoms appear as distinct protrusions. However, on decreasing the tip-sample distance, features consistent with the silicon covalent bonds of the surface emerge. Using a density functional tight-binding-based method to simulate atomic force microscopy images, we reproduce the experimental results. The role of the tip flexibility and the nature of bonds and false bond-like features are discussed.

  2. Indications of chemical bond contrast in AFM images of a hydrogen-terminated silicon surface (United States)

    Labidi, Hatem; Koleini, Mohammad; Huff, Taleana; Salomons, Mark; Cloutier, Martin; Pitters, Jason; Wolkow, Robert A.


    The origin of bond-resolved atomic force microscope images remains controversial. Moreover, most work to date has involved planar, conjugated hydrocarbon molecules on a metal substrate thereby limiting knowledge of the generality of findings made about the imaging mechanism. Here we report the study of a very different sample; a hydrogen-terminated silicon surface. A procedure to obtain a passivated hydrogen-functionalized tip is defined and evolution of atomic force microscopy images at different tip elevations are shown. At relatively large tip-sample distances, the topmost atoms appear as distinct protrusions. However, on decreasing the tip-sample distance, features consistent with the silicon covalent bonds of the surface emerge. Using a density functional tight-binding-based method to simulate atomic force microscopy images, we reproduce the experimental results. The role of the tip flexibility and the nature of bonds and false bond-like features are discussed. PMID:28194036

  3. Development of an algorithm for tip-related artifacts identification in AFM biological film imaging

    Directory of Open Access Journals (Sweden)

    Rubens Bernardes-Filho


    Full Text Available One major drawback identified in atomic force microscopy imaging is the dependence of the image's precision on the shape of the probe tip. In this paper a simple algorithm is proposed to provide artifact identification signaling in-situ tip features in atomic force microscopy images. The base of the identifications lied when the angle formed between two scanned points was kept the same as the tip sweeps a certain length of the sample. The potential of the described method was illustrated on a chitosan polysaccharide film. The images produced were compared to evaluate tip-artifact regions. This algorithm showed promise as a tool in the measurement and characterization fields to separate true images from artificial images in probe microscopy.Um aspecto limitante a plena interpretação de imagens geradas por microscopia de força atômica é a interação entre a superfie varrida e ponta de varredura do sistema gerando artefatos de imagens. Para a identificação desses artefatos, propomos neste texto, um algoritmo simples capaz de assinalar esse tipo de irregularidade de imagem. A medida tem por princípio a identificação de ângulos similares formados entre dois pontos sobre a espécie varrida. O potencial de aplicação do método proposto é aqui ilustrado sobre um filme de polissacarídeo quitosana. As imagens geradas são comparadas entre si, indicando regiões de artefatos típicos gerados pela ponta de varredura. Este algoritmo apresenta-se como uma ferramenta útil a cientistas e usuários, permitindo a separação de aspectos reais e artificiais, que são fundamentais para uma melhor caracterização e medida.

  4. Repfinder: Finding approximately repeated scene elements for image editing

    KAUST Repository

    Cheng, Ming-Ming


    Repeated elements are ubiquitous and abundant in both manmade and natural scenes. Editing such images while preserving the repetitions and their relations is nontrivial due to overlap, missing parts, deformation across instances, illumination variation, etc. Manually enforcing such relations is laborious and error-prone. We propose a novel framework where user scribbles are used to guide detection and extraction of such repeated elements. Our detection process, which is based on a novel boundary band method, robustly extracts the repetitions along with their deformations. The algorithm only considers the shape of the elements, and ignores similarity based on color, texture, etc. We then use topological sorting to establish a partial depth ordering of overlapping repeated instances. Missing parts on occluded instances are completed using information from other instances. The extracted repeated instances can then be seamlessly edited and manipulated for a variety of high level tasks that are otherwise difficult to perform. We demonstrate the versatility of our framework on a large set of inputs of varying complexity, showing applications to image rearrangement, edit transfer, deformation propagation, and instance replacement. © 2010 ACM.

  5. AFM功能化成像与分子识别研究进展%Research progress of AFM functionalized imaging and molecular recognition

    Institute of Scientific and Technical Information of China (English)

    徐小媛; 叶学松


    In the past decades, AFM have great advances in high resolution molecular imaging and single molecule detection applications. AFM single molecular force 8pectroscopy(SMFS)are available to explore polymer structural changes, molecular identification of bio-signal transmission or protein folding process and unfolding process,the evidence of the relation between structural changes and functions is provided. Some progresses are mentioned such as using AFM in funcuonalization decoration, in locating using SMFS surface protein and polysaccharide and their elasticity. Prospects are also provided concerning future work and difficulties in AFM application.%在过去的几十年间,AFM在高分辨率分子成像与单分子检测上的应用得到了很大进展.AFM单分子力光谱学(SMFS)模式可以用于研究聚合物结构变化,生物信号传导过程的分子识别或蛋白折叠过程.提出了使用AFM进行功能化修饰和SMFS用于定位表面蛋白与多糖,研究表面蛋白的分子延展性的一些进展,并展望了研究前景与难点.

  6. Optical imaging beyond the diffraction limit by SNEM: Effects of AFM tip modifications with thiol monolayers on imaging quality

    NARCIS (Netherlands)

    Cumurcu, Aysegul; Diaz, J.; Lindsay, I.D.; Beer, de S.; Duvigneau, J.; Schön, P.M.; Vancso, G.J.


    Tip-enhanced nanoscale optical imaging techniques such as apertureless scanning near-field optical microscopy (a-SNOM) and scanning near-field ellipsometric microscopy (SNEM) applications can suffer from a steady degradation in performance due to adhesion of atmospheric contaminants to the metal coa

  7. Savinase action on bovine serum albumin (BSA) monolayers demonstrated with measurements at the air-water interface and liquid Atomic Force Microscopy (AFM) imaging

    DEFF Research Database (Denmark)

    Balashev, Konstantin; Callisen, Thomas H; Svendsen, Allan;


    We studied the enzymatic action of Savinase on bovine serum albumin (BSA) organized in a monolayer spread at the air/water interface or adsorbed at the mica surface. We carried out two types of experiments. In the first one we followed the degradation of the protein monolayer by measuring...... the surface pressure and surface area decrease versus time. In the second approach we applied AFM imaging of the supported BSA monolayers adsorbed on mica solid supports and extracted information for the enzyme action by analyzing the obtained images of the surface topography in the course of enzyme action...

  8. Quasar Variability Measurements With SDSS Repeated Imaging and POSS Data

    CERN Document Server

    Ivezic, Z; Juric, M; Anderson, S; Hall, P B; Richards, G T; Rockosi, C M; Vanden Berk, Daniel E; Turner, E L; Knapp, G R; Gunn, J E; Schlegel, D J; Strauss, M A; Schneider, D P


    We analyze the properties of quasar variability using repeated SDSS imaging data in five UV-to-far red photometric bands, accurate to 0.02 mag, for 13,000 spectroscopically confirmed quasars. The observed time lags span the range from 3 hours to over 3 years, and constrain the quasar variability for rest-frame time lags of up to two years, and at rest-frame wavelengths from 1000 Ang. to 6000 Ang. We demonstrate that 66,000 SDSS measurements of magnitude differences can be described within the measurement noise by a simple function of only three free parameters. The addition of POSS data constrains the long-term behavior of quasar variability and provides evidence for a turn-over in the structure function. This turn-over indicates that the characteristic time scale for optical variability of quasars is of the order 1 year.

  9. AFM study of montmorillonite

    Energy Technology Data Exchange (ETDEWEB)

    Pettersson, Torbjoern; Thormann, Esben; Claesson, Per (Dept. of Chemistry, Surface Chemistry, Royal Inst. of Technology, Stockholm (Sweden))


    Na-montmorillonite and Ca-montmorillonite particles have been attached to molecularly flat mica surfaces using simple evaporation of montmorillonite solutions. The particles stick to the surface by strong van der Waals forces. The homogeneity of the montmorillonite particle surfaces has been evaluated by AFM imaging and by AFM force raster measurements. As a control, molecularly smooth mica surfaces were used, and the data obtained for montmorillonite was compared with the data obtained for mica. In images of the size 100x100 nm we can identify variations on the Na-montmorillonite particle surfaces. This variation is attributed to inhomogeneities of the montmorillonite particles. The inhomogeneous nature of the montmorillonite surface is also clearly demonstrated by the force raster measurement, in particular the force raster adhesion maps show larger variations and a more patterned structure for montmorillonite than for mica. Thus, any attempt to model the interaction between montmorillonite particles using a model of ideally flat surfaces with a homogeneous charge distribution is an oversimplification. We suggest that this explains the differences between measured swelling pressures and modelling results

  10. Measuring bacterial cells size with AFM. (United States)

    Osiro, Denise; Filho, Rubens Bernardes; Assis, Odilio Benedito Garrido; Jorge, Lúcio André de Castro; Colnago, Luiz Alberto


    Atomic Force Microscopy (AFM) can be used to obtain high-resolution topographical images of bacteria revealing surface details and cell integrity. During scanning however, the interactions between the AFM probe and the membrane results in distortion of the images. Such distortions or artifacts are the result of geometrical effects related to bacterial cell height, specimen curvature and the AFM probe geometry. The most common artifact in imaging is surface broadening, what can lead to errors in bacterial sizing. Several methods of correction have been proposed to compensate for these artifacts and in this study we describe a simple geometric model for the interaction between the tip (a pyramidal shaped AFM probe) and the bacterium (Escherichia coli JM-109 strain) to minimize the enlarging effect. Approaches to bacteria immobilization and examples of AFM images analysis are also described.

  11. In Situ AFM Imaging of Microstructural Changes Associated with The Spin Transition in [Fe(Htrz2(Trz](Bf4 Nanoparticles

    Directory of Open Access Journals (Sweden)

    María D. Manrique-Juárez


    Full Text Available Topographic images of [Fe(Htrz2(trz](BF4 nanoparticles were acquired across the first-order spin transition using variable-temperature atomic force microscopy (AFM in amplitude modulation mode. These studies revealed a complex morphology of the particles consisting of aggregates of small nanocrystals, which expand, separate and re-aggregate due to the mechanical stress during the spin-state switching events. Both reversible (prompt or slow recovery and irreversible effects (fatigue on the particle morphology were evidenced and correlated with the spin crossover properties.

  12. Repeat scanning technology for laser ultrasonic propagation imaging (United States)

    Lee, Jung-Ryul; Yenn Chong, See; Sunuwar, Nitam; Park, Chan Yik


    Laser ultrasonic scanning in combination with contact or non-contact sensors provides new paradigms in structural health management (SHM) and non-destructive in-process quality control (IPQC) for large composite structures. Wave propagation imaging technology based on laser ultrasonic scanning and fixed-point sensing shows remarkable advantages, such as minimal need for embedded sensors in SHM, minimum invasive defect visualization in IPQC and general capabilities of curved and complex target inspection, and temporal reference-free inspection. However, as with other SHM methods and non-destructive evaluation based on ultrasound, the signal-to-noise ratio (SNR) is a prevalent issue in real structural applications, especially with non-contact thin-composite sensing or with thick and heterogeneous composites. This study proposes a high-speed repeat scanning technique for laser ultrasonic propagation imaging (UPI) technology, which is realized with the scanning speed of 1 kHz of a Q-switched continuous wave laser, and precise control of the laser beam pulses for identical point scanning. As a result, the technique enables the achievement of significant improvement in the SNR to inspect real-world composite structures. The proposed technique provides enhanced results for impact damage detection in a 2 mm thick wing box made of carbon-fiber-reinforced plastic, despite the low sensitivity of non-contact laser ultrasonic sensing. A field-applicable pure laser UPI system has been developed using a laser Doppler vibrometer as the non-contact ultrasonic sensor. The proposed technique enables the visualization of the disbond defect in a 15 mm thick wind blade specimen made of glass-fiber-reinforced plastic, despite the high dissipation of ultrasound in the thick composite.

  13. PREFACE: Non-contact AFM Non-contact AFM (United States)

    Giessibl, Franz J.; Morita, Seizo


    This special issue is focussed on high resolution non-contact atomic force microscopy (AFM). Non-contact atomic force microscopy was established approximately 15 years ago as a tool to image conducting and insulating surfaces with atomic resolution. Since 1998, an annual international conference has taken place, and although the proceedings of these conferences are a useful source of information, several key developments warrant devoting a special issue to this subject. In the theoretic field, the possibility of supplementing established techniques such as scanning tunneling microscopy (STM) and Kelvin probe microscopy with atomically resolved force micrsoscopy poses many challenges in the calculation of contrast and contrast reversal. The surface science of insulators, self-assembled monolayers and adsorbates on insulators is a fruitful field for the application of non-contact AFM: several articles in this issue are devoted to these subjects. Atomic imaging and manipulation have been pioneered using STM, but because AFM allows the measurement of forces, AFM has had a profound impact in this field as well. Three-dimensional force spectroscopy has allowed many important insights into surface science. In this issue a combined 3D tunneling and force microscopy is introduced. Non-contact AFM typically uses frequency modulation to measure force gradients and was initially used mainly in a vacuum. As can be seen in this issue, frequency modulation is now also used in ambient conditions, allowing better spatial and force resolution. We thank all of the contributors for their time and efforts in making this special issue possible. We are also very grateful to the staff of IOP Publishing for handling the administrative aspects and for steering the refereeing process. Non-contact AFM contents Relation between the chemical force and the tunnelling current in atomic point contacts: a simple model Pavel Jelínek, Martin Ondrácek and Fernando Flores Theoretical simulation of

  14. Surface analysis with STM and AFM

    CERN Document Server

    Magonov, Sergi N


    Scanning tunneling microscopy (STM) and atomic force microscopy (AFM) are powerful tools for surface examination. In the past, many STM and AFM studies led to erroneous conclusions due to lack of proper theoretical considerations and of an understanding of how image patterns are affected by measurement conditions. For this book, two world experts, one on theoretical analysis and the other on experimental characterization, have joined forces to bring together essential components of STM and AFM studies: The practical aspects of STM, the image simulation by surface electron density plot calculat

  15. A semi-automated AFM photomask repair process for manufacturing application using SPR6300 (United States)

    Dellagiovanna, Mario; Yoshioka, Hidenori; Miyashita, Hiroyuki; Murai, Shiaki; Nakaue, Takuya; Takaoka, Osamu; Uemoto, Atsushi; Kikuchi, Syuichi; Hagiwara, Ryoji; Benard, Stephane


    For almost a decade Nanomachining application has been studied and developed to repair next generation of photomasks. This technique, based on Atomic Force Microscopy (AFM), applies a mechanical removing of the defects with almost negligible quartz-damage, high accuracy of the edge-placement and without spurious depositions (stain, implanted elements, etc.) that may affect the optical transmission. SII NanoTechnology Inc. (SIINT) is carrying out a joint-development project with DNP Photomask Europe S.p.A. (DPE) that has allowed the installation in DPE of the next generation state-of-the-art AFM based system SPR6300 to meet the repair specifications for the 65 nm Node. Drift phenomena of the AFM probe represent one of the major obstacles for whichever kind of nano-manipulation (imaging and material or pattern modification). AFM drift undermines the repeatability and accuracy performances of the process. The repair methodology, called NewDLock, implemented on SPR6300, is a semi-automated procedure by which the drift amount, regardless of its origin, is estimated in advance and compensated during the process. Now AFM Nanomachining approach is going to reveal properties of repeatability and user-friendly utilization that make it suitable for the production environment.

  16. Using Atomic Force Microscopy (AFM) in the Nanometer Structure Imaging of Starch%原子力显微镜(AFM)在淀粉纳米级结构分析中的应用

    Institute of Scientific and Technical Information of China (English)

    黄强; 罗发兴



  17. Studying post-etching silicon crystal defects on 300mm wafer by automatic defect review AFM (United States)

    Zandiatashbar, Ardavan; Taylor, Patrick A.; Kim, Byong; Yoo, Young-kook; Lee, Keibock; Jo, Ahjin; Lee, Ju Suk; Cho, Sang-Joon; Park, Sang-il


    light scattering. Likewise, SEM cannot be used effectively for post-inspection defect review and classification of these very shallow types of defects. To verify and obtain accurate shape and three-dimensional information of those defects, automatic defect review AFM (ADR AFM) is utilized for accurate locating and imaging of DOI. In ADR AFM, non-contact mode imaging is used for non-destructive characterization and preserving tip sharpness for data repeatability and reproducibility. Locating DOI and imaging are performed automatically with a throughput of many defects per hour. Topography images of DOI has been collected and compared with SEM images. The ADR AFM has been shown as a non-destructive metrology tool for defect review and obtaining three-dimensional topography information.

  18. Imaging of lactic acid bacteria with AFM-elasticity and adhesion maps and their relationship to biological and structural data

    Energy Technology Data Exchange (ETDEWEB)

    Schaer-Zammaretti, Prisca; Ubbink, Job


    The adhesion of lactic acid bacteria to the intestinal epithelium is one of the most important factors determining probiotic ability of a bacterial strain. Studying bacterial adhesion requires knowledge of the structure and properties of the bacterial surface, which can be studied by atomic force microscopy under native conditions. The observation of the surface topography of bacteria from the species Lactobacillus crispatus, L. helveticus and L. johnsonii shows major differences between bacteria having a crystalline-like protein layer as part of the cell wall and those without such layers. Force volume images calculated into elasticity and adhesion force maps of different bacterial strains show that L. crispatus and L. helveticus have a surface with a homogeneous stiffness with no adhesion events. This is most likely caused by the S-layer, which completely covers the surface of the bacteria. We infer that the absence of adhesion peaks is caused by the semi-crystalline character of such protein layers, in agreement with the results obtained from electron microscopy. Analysis of a number of L. johnsonii strains shows that these bacteria have surface properties which strongly differ from the L. crispatus and L. helveticus strains. For L. johnsonii DMS20533 and L. johnsonii ATCC33200 high adhesion forces are observed, which can be related to a surface rich in polysaccharides. L. johnsonii ATCC332 has lower adhesion forces compared to the other two and, furthermore, the surface topography shows depressions. We suppose that this strain has a surface pattern consisting of crystalline-like proteins alternating with polysaccharide-rich domains. The wide variety in surface properties of lactobacilli could well have wide-ranging implications for food processing and for health benefits.

  19. Modeling the behavior of signal-to-noise ratio for repeated snapshot imaging

    CERN Document Server

    Li, Junhui; Yang, Dongyue; Wu, Guohua; Yin, Longfei; Guo, Hong


    For imaging of static object by the means of sequential repeated independent measurements, a theoretical modeling of the behavior of signal-to-noise ratio (SNR) with varying number of measurement is developed, based on the information capacity of optical imaging systems. Experimental veritification of imaging using pseudo-thermal light source is implemented, for both the direct average of multiple measurements, and the image reconstructed by second order fluctuation correlation (SFC) which is closely related to ghost imaging. Successful curve fitting of data measured under different conditions verifies the model.

  20. 一种基于临近点集数据融合的AFM动态成像方法%An Improved AFM Dynamic Imaging Method Based on Data Fusion of Neighboring Point Set

    Institute of Scientific and Technical Information of China (English)

    董晓坤; 方勇纯; 张玉东


    The atomic force microscopy (AFM) is an important tool in the field of nanotechnology and nanomanipulation.Based on the filtering and data fusion methods, this paper proposes an innovative imaging method to enhauce the imaging precision of AFM along the Z direction.Specifically, this article first introduces the common imaging method utilized by commercial AFMs, then presents an improved dynamic imaging method based on data fusion of neighboring point set to deal with the large imaging error along the Z direction due to the AFM nonlinear characteristics when scanning a highly coarse surface or scanning with a high speed.Finally, some simulation and experimental results are included to demonstrate the superior performance of the proposed imaging method.%原子力显微镜(Atomic force microscopy,AFM)是纳米技术和纳米操作领域中最重要的研究工具之一.本文针对扫描成像的原子力显微镜,提出了一种改进的AFM动态成像方法,该方法分析了AFM系统中样品与针尖之间的非线性力对成像精度的影响,通过对扫描过程中获得的成像数据进行融合滤波,有效地提高了快速AFM的成像精度.具体而言,论文首先分析了原子力显微镜当前成像方法存在的主要问题,然后针对在高速扫描或者样品形貌高度有突变时,因AFM系统中非线性因素而引起的成像误差,提出了一种基于临近点集数据融合的改进动态成像方法,以提高AFM对于样品表面形貌的成像精度.最后分别利用原子力显微镜仿真平台数据和实验数据,验证了本文提出的改进成像方法的性能.

  1. Nephrotoxicity in mice after repeated imaging using 111In- labeled peptides

    NARCIS (Netherlands)

    M.L. Melis (Marleen); E. Vegt (Erik); M.W. Konijnenberg (Mark); M. de Visser (Monique); M. Bijster (Magda); M. Vermeij (Marcel); E.P. Krenning (Eric); O.C. Boerman (Otto); M. de Jong (Marion)


    textabstractWe determined the renal radiation dose of a series of111Inlabeled peptides using animal SPECT. Because the animals' health deteriorated, renal toxicity was assessed. Methods: Wild-type and megalin-deficient mice were imaged repeatedly at 3- to 6-wk intervals to quantify renal retention a

  2. Nephrotoxicity in mice after repeated imaging using 111In-labeled peptides.

    NARCIS (Netherlands)

    Melis, M.; Vegt, E.; Konijnenberg, M.W.; Visser, M. de; Bijster, M.; Vermeij, M.; Krenning, E.P.; Boerman, O.C.; Jong, M. de


    We determined the renal radiation dose of a series of (111)In-labeled peptides using animal SPECT. Because the animals' health deteriorated, renal toxicity was assessed. METHODS: Wild-type and megalin-deficient mice were imaged repeatedly at 3- to 6-wk intervals to quantify renal retention after inj

  3. High-speed AFM of human chromosomes in liquid (United States)

    Picco, L. M.; Dunton, P. G.; Ulcinas, A.; Engledew, D. J.; Hoshi, O.; Ushiki, T.; Miles, M. J.


    Further developments of the previously reported high-speed contact-mode AFM are described. The technique is applied to the imaging of human chromosomes at video rate both in air and in water. These are the largest structures to have been imaged with high-speed AFM and the first imaging in liquid to be reported. A possible mechanism that allows such high-speed contact-mode imaging without significant damage to the sample is discussed in the context of the velocity dependence of the measured lateral force on the AFM tip.

  4. Tobacco mosaic virus as an AFM tip calibrator. (United States)

    Trinh, Minh-Hieu; Odorico, Michael; Bellanger, Laurent; Jacquemond, Mireille; Parot, Pierre; Pellequer, Jean-Luc


    The study of high-resolution topographic surfaces of isolated single molecules is one of the applications of atomic force microscopy (AFM). Since tip-induced distortions are significant in topographic images the exact AFM tip shape must be known in order to correct dilated AFM height images using mathematical morphology operators. In this work, we present a protocol to estimate the AFM tip apex radius using tobacco mosaic virus (TMV) particles. Among the many advantages of TMV, are its non-abrasivity, thermal stability, bio-compatibility with other isolated single molecules and stability when deposited on divalent ion pretreated mica. Compared to previous calibration systems, the advantage of using TMV resides in our detailed knowledge of the atomic structure of the entire rod-shaped particle. This property makes it possible to interpret AFM height images in term of the three-dimensional structure of TMV. Results obtained in this study show that when a low imaging force is used, the tip is sensing viral protein loops whereas at higher imaging force the tip is sensing the TMV particle core. The known size of the TMV particle allowed us to develop a tip-size estimation protocol which permits the successful erosion of tip-convoluted AFM height images. Our data shows that the TMV particle is a well-adapted calibrator for AFM tips for imaging single isolated biomolecules. The procedure developed in this study is easily applicable to any other spherical viral particles.

  5. Comparing Destination Image and Loyalty between First-time and Repeat-visit Tourists

    Directory of Open Access Journals (Sweden)

    Mohamad M.


    Full Text Available The objective of this study was to investigate the difference between destination image and loyalty among first-time and repeat-visit tourists. The study was undertaken to examine aspects of underlying factors of destination image that influenced tourists’ willingness to recommend Malaysia to their friends and relatives as well as spread positive word-of-mouth to others. In addition, it was to ascertain the relationship between destination image and loyalty among first-time and repeat-visit tourists. The data was collected at Kuala Lumpur International Airport at the departure hall using self-administered questionnaires. 248 usable questionnaires were returned and analysed. The findings of the study revealed that both groups of tourists perceived Malaysia as providing a nature-based destination. The study also empirically proved that both first-time and repeat-visit tourists were willing to disseminate positive word-of-mouth and recommend Malaysia to their friends and relatives as a vacation destination to visit. However, there was a significant difference in destination loyalty between first-visit and repeat-visit tourists.

  6. Sharing my fifteen years experiences in the research field of Atomic Force Microscopy (AFM)


    Guha T


    Atomic Force Microscope (AFM) was developed by Binnig and his coworkers in the year 1986. He was awarded Nobel Prize in physics for this work in 1986 in sharing with Rohrer and Ruska. Rationale to develop AFM: Scanning Tunneling Microscope (STM), the precursor to AFM is efficient in imaging electrically conducting specimen at atomic resolution. The impetus for development of AFM came to Binnig’s mind because of relatively poor efficiency of STM to image electrically non-conducting bi...

  7. Contact nanomechanical measurements with the AFM (United States)

    Geisse, Nicholas


    The atomic force microscope (AFM) has found broad use in the biological sciences largely due to its ability to make measurements on unfixed and unstained samples under liquid. In addition to imaging at multiple spatial scales ranging from micro- to nanometer, AFMs are commonly used as nanomechanical probes. This is pertinent for cell biology, as it has been demonstrated that the geometrical and mechanical properties of the extracellular microenvironment are important in such processes as cancer, cardiovascular disease, muscular dystrophy, and even the control of cell life and death. Indeed, the ability to control and quantify these external geometrical and mechanical parameters arises as a key issue in the field. Because AFM can quantitatively measure the mechanical properties of various biological samples, novel insights to cell function and to cell-substrate interactions are now possible. As the application of AFM to these types of problems is widened, it is important to understand the performance envelope of the technique and its associated data analyses. This talk will discuss the important issues that must be considered when mechanical models are applied to real-world data. Examples of the effect of different model assumptions on our understanding of the measured material properties will be shown. Furthermore, specific examples of the importance of mechanical stimuli and the micromechanical environment to the structure and function of biological materials will be presented.

  8. Repeatability of Detecting Visual Cortex Activity in Functional Magnetic Resonance Imaging

    Directory of Open Access Journals (Sweden)

    Mahboubeh Ma'soumbeigi


    Full Text Available Introduction As functional magnetic resonance imaging (fMRI is too expensive and time consuming, its frequent implementation is difficult. The aim of this study is to evaluate repeatability of detecting visual cortex activity in fMRI. Materials and Methods In this study, 15 normal volunteers (10 female, 5 male; Mean age±SD: 24.7±3.8 years attended. Functional magnetic resonance images were obtained during a visual task of sine-wave with spatial frequency of 1.84 cpd and temporal frequency of 8 Hz in three scan runs. Two runs of functional images were provided consecutively in a session, and the third run was provided 1-6 weeks later. The activation map was created using the data obtained from the block-designed fMRI study. Voxels whose Z value was above a threshold of 2.3, at a significance level p=0.05, were considered activated. After image processing, the blood oxygen level dependent (BOLD signal changes and the number of activated voxels in response to visual stimuli were compared in different runs. Results The results of this study demonstrate no significant difference between the number of activated voxels and BOLD signal in first and second runs in one session (Paired t-test, p>0.05. Moreover, there is a considerable correlation between first and second scan runs (rsignal=0.74, p=0.006 and rvoxel=0.62, p=0.03, while the correlation between the runs in separate sessions is weak (rsignal=0.28, p=0.38 and rvoxel=0.32, p=0.31. Conclusion Since the repeatability of BOLD signal and number of activated voxels in one session is considerably better than that in the separate sessions, it is suggested that in fMRI visual studies that need repeated scanning, scans should be acquired during a single session.

  9. Intracranial aneurysms that repeatedly reopen over time after coiling: imaging characteristics and treatment outcome

    Energy Technology Data Exchange (ETDEWEB)

    Rooij, Willem J. van; Sprengers, Marieke E.; Sluzewski, Menno [St Elisabeth Ziekenhuis, Department of Radiology, Tilburg (Netherlands); Beute, Guus N. [St Elisabeth Ziekenhuis, Department of Neurosurgery, Tilburg (Netherlands)


    We report imaging and clinical characteristics of patients with aneurysms that repeatedly reopened over time and were coiled three times or more during a follow-up period of 2-11 years. At angiographic follow-up of 624 of 827 aneurysms coiled between 1995 and 2005, 74 aneurysms (8.9%) reopened and were additionally coiled. During an extended follow-up, 12 aneurysms (1.5%) in 12 patients repeatedly reopened and were repeatedly coiled. Initial aneurysm sizes ranged from 15 to 30 mm. Four aneurysms contained intraluminal thrombus. Eight aneurysms were associated with subarachnoid hemorrhage and two with a mass effect, and two were incidentally discovered. The locations of aneurysms were basilar artery (eight), carotid artery (two), anterior communicating artery (one) and middle cerebral artery (one). Altogether, 49 coil treatments were performed in the 12 aneurysms, ranging from three to six coil treatments per aneurysm. Of the 49 coil treatments, 20 (41%) were performed with a supporting device. There were no procedural complications (0%, 97.5% CI 0-5.7%). The mean clinical follow-up period was 70.6 months (median 60, range 25-135 months). All 12 patients are neurologically doing well (GOS 5). Reopening was by compaction in nine aneurysms and by migration of coils into intraluminal thrombus in three aneurysms. In two aneurysms, late regrowth became apparent at 76 and 95 months after the previous coiling. Aneurysms that reopen over time and need to be coiled for a second time should be imaged at regular intervals to detect repeated reopening or regrowth. The treatment strategy of regular follow-up and additional treatments when necessary is effective and safe. (orig.)

  10. Application of AFM from microbial cell to biofilm. (United States)

    Wright, Chris J; Shah, Maia Kierann; Powell, Lydia C; Armstrong, Ian


    Atomic Force Microscopy (AFM) has proven itself over recent years as an essential tool for the analysis of microbial systems. This article will review how AFM has been used to study microbial systems to provide unique insight into their behavior and relationship with their environment. Immobilization of live cells has enabled AFM imaging and force measurement to provide understanding of the structure and function of numerous microbial cells. At the macromolecular level AFM investigation into the properties of surface macromolecules and the energies associated with their mechanical conformation and functionality has helped unravel the complex interactions of microbial cells. At the level of the whole cell AFM has provided an integrated analysis of how the microbial cell exploits its environment through its selective, adaptable interface, the cell surface. In addition to these areas of study the AFM investigation of microbial biofilms has been vital for industrial and medical process analysis. There exists a tremendous potential for the future application of AFM to microbial systems and this has been strengthened by the trend to use AFM in combination with other characterization methods, such as confocal microscopy and Raman spectroscopy, to elucidate dynamic cellular processes.

  11. Validity and repeatability of a depth camera-based surface imaging system for thigh volume measurement. (United States)

    Bullas, Alice M; Choppin, Simon; Heller, Ben; Wheat, Jon


    Complex anthropometrics such as area and volume, can identify changes in body size and shape that are not detectable with traditional anthropometrics of lengths, breadths, skinfolds and girths. However, taking these complex with manual techniques (tape measurement and water displacement) is often unsuitable. Three-dimensional (3D) surface imaging systems are quick and accurate alternatives to manual techniques but their use is restricted by cost, complexity and limited access. We have developed a novel low-cost, accessible and portable 3D surface imaging system based on consumer depth cameras. The aim of this study was to determine the validity and repeatability of the system in the measurement of thigh volume. The thigh volumes of 36 participants were measured with the depth camera system and a high precision commercially available 3D surface imaging system (3dMD). The depth camera system used within this study is highly repeatable (technical error of measurement (TEM) of <1.0% intra-calibration and ~2.0% inter-calibration) but systematically overestimates (~6%) thigh volume when compared to the 3dMD system. This suggests poor agreement yet a close relationship, which once corrected can yield a usable thigh volume measurement.

  12. Estimation of AFM tip shape and status in linewidth and profile measurement. (United States)

    Han, Guoqiang; Jiang, Zhuangde; Jing, Weixuan; Prewett, Philip D; Jiang, Kyle


    An atomic force microscopy image is a dilation of the specimen surface with the probe tip. Tips wear or are damaged as they are used. And AFM tip shape and position status make AFM images distorted. So it is necessary to characterize AFM tip shape and position parameters so as to reconstruct AFM images. A geometric model-based approach is presented to estimate AFM tip shape and position status by AFM images of test specimens and scanning electron microscope (SEM) images of AFM tip. In this model, the AFM tip is characterized by using a dynamic cone model. The geometric relationship between AFM tip and the sample structure is revealed in linewidth and profile measurement. The method can easily calculate the tip parameters including half-cone angle, installation angle, scanning tilting angle and curvature radius, and easily estimate the position status of AFM tip when AFM tip moves on the specimen. The results of linewidth and profile measurement are amended accurately through this approach.

  13. [Application of atomic force microscopy (AFM) in ophthalmology]. (United States)

    Milka, Michał; Mróz, Iwona; Jastrzebska, Maria; Wrzalik, Roman; Dobrowolski, Dariusz; Roszkowska, Anna M; Moćko, Lucyna; Wylegała, Edward


    Atomic force microscopy (AFM) allows to examine surface of different biological objects in the nearly physiological conditions at the nanoscale. The purpose of this work is to present the history of introduction and the potential applications of the AFM in ophthalmology research and clinical practice. In 1986 Binnig built the AFM as a next generation of the scanning tunnelling microscope (STM). The functional principle of AFM is based on the measurement of the forces between atoms on the sample surface and the probe. As a result, the three-dimensional image of the surface with the resolution on the order of nanometres can be obtained. Yamamoto used as the first the AFM on a wide scale in ophthalmology. The first investigations used the AFM method to study structure of collagen fibres of the cornea and of the sclera. Our research involves the analysis of artificial intraocular lenses (IOLs). According to earlier investigations, e.g. Lombardo et al., the AFM was used to study only native IOLs. Contrary to the earlier investigations, we focused our measurements on lenses explanted from human eyes. The surface of such lenses is exposed to the influence of the intraocular aqueous environment, and to the related impacts of biochemical processes. We hereby present the preliminary results of our work in the form of AFM images depicting IOL surface at the nanoscale. The images allowed us to observe early stages of the dye deposit formation as well as local calcinosis. We believe that AFM is a very promising tool for studying the structure of IOL surface and that further observations will make it possible to explain the pathomechanism of artificial intraocular lens opacity formation.

  14. Tumor suppressor protein SMAR1 modulates the roughness of cell surface: combined AFM and SEM study

    Directory of Open Access Journals (Sweden)

    Mamgain Hitesh


    Full Text Available Abstract Background Imaging tools such as scanning electron microscope (SEM and atomic force microscope (AFM can be used to produce high-resolution topographic images of biomedical specimens and hence are well suited for imaging alterations in cell morphology. We have studied the correlation of SMAR1 expression with cell surface smoothness in cell lines as well as in different grades of human breast cancer and mouse tumor sections. Methods We validated knockdown and overexpression of SMAR1 using RT-PCR as well as Western blotting in human embryonic kidney (HEK 293, human breast cancer (MCF-7 and mouse melanoma (B16F1 cell lines. The samples were then processed for cell surface roughness studies using atomic force microscopy (AFM and scanning electron microscopy (SEM. The same samples were used for microarray analysis as well. Tumors sections from control and SMAR1 treated mice as well as tissues sections from different grades of human breast cancer on poly L-lysine coated slides were used for AFM and SEM studies. Results Tumor sections from mice injected with melanoma cells showed pronounced surface roughness. In contrast, tumor sections obtained from nude mice that were first injected with melanoma cells followed by repeated injections of SMAR1-P44 peptide, exhibited relatively smoother surface profile. Interestingly, human breast cancer tissue sections that showed reduced SMAR1 expression exhibited increased surface roughness compared to the adjacent normal breast tissue. Our AFM data establishes that treatment of cells with SMAR1-P44 results into increase in cytoskeletal volume that is supported by comparative gene expression data showing an increase in the expression of specific cytoskeletal proteins compared to the control cells. Altogether, these findings indicate that tumor suppressor function of SMAR1 might be exhibited through smoothening of cell surface by regulating expression of cell surface proteins. Conclusion Tumor suppressor

  15. Raman and AFM study of gamma irradiated plastic bottle sheets (United States)

    Ali, Yasir; Kumar, Vijay; Sonkawade, R. G.; Dhaliwal, A. S.


    In this investigation, the effects of gamma irradiation on the structural properties of plastic bottle sheet are studied. The Plastic sheets were exposed with 1.25MeV 60Co gamma rays source at various dose levels within the range from 0-670 kGy. The induced modifications were followed by micro-Raman and atomic force microscopy (AFM). The Raman spectrum shows the decrease in Raman intensity and formation of unsaturated bonds with an increase in the gamma dose. AFM image displays rough surface morphology after irradiation. The detailed Raman analysis of plastic bottle sheets is presented here, and the results are correlated with the AFM observations.

  16. Stabilization and acidic dissolution mechanism of single-crystalline ZnO(0001) surfaces in electrolytes studied by in-situ AFM imaging and ex-situ LEED. (United States)

    Valtiner, Markus; Borodin, Sergiy; Grundmeier, Guido


    A combined approach of pH-dependent in-situ AFM topography and ex-situ LEED studies of the stability and dissolution of single-crystalline ZnO(0001)-Zn surfaces in aqueous media is presented. Hydroxide-stabilized and single-crystalline ZnO(0001)-Zn surfaces turned out to be stable within a wide pH range between 11 and 4 around the point of zero charge of pH PZC = 8.7 +/- 0.2. Hydroxide stabilization turned out to be a very effective stabilization mechanism for polar oxide surfaces in electrolyte solutions. The dissolution of the oxide surface started at an acidic pH level of 5.5 and occurred selectively at the pre-existing step edges, which consist of nonpolar surfaces. In comparison, the oxide dissolution along the ZnO(0001) direction proved to be effectively inhibited above a pH value of 3.8. On the basis of these microscopic observations, the mechanistic understanding of the acidic dissolution process of ZnO could be supported. Moreover, both the in-situ AFM and the ex-situ LEED studies showed that the stabilization mechanism of the ZnO(0001) surfaces changes in acidic electrolytes. At pH values below 3.8, the hydroxide-stabilized surface is destabilized by dissolution of the well-ordered radical3. radical3. R30 hydroxide ad-layer as proven by LEED. Restabilization occurs and leads to the formation of triangular nanoterraces with a specific edge termination. However, below pH 4 the surface structure of the crystal itself is ill-defined on the macroscopic scale because preferable etching along crystal defects as dislocations into the bulk oxide results in very deep hexagonal etching pits.

  17. Integrating the Radiology Information System with Computerised Provider Order Entry: The Impact on Repeat Medical Imaging Investigations. (United States)

    Vecellio, Elia; Georgiou, Andrew


    Repeat and redundant procedures in medical imaging are associated with increases in resource utilisation and labour costs. Unnecessary medical imaging in some modalities, such as X-Ray (XR) and Computed Tomography (CT) is an important safety issue because it exposes patients to ionising radiation which can be carcinogenic and is associated with higher rates of cancer. The aim of this study was to assess the impact of implementing an integrated Computerised Provider Order Entry (CPOE)/Radiology Information System (RIS)/Picture Archiving and Communications System (PACS) system on the number of XR and CT imaging procedures (including repeat imaging requests) for inpatients at a large metropolitan hospital. The study found that patients had an average 0.47 fewer XR procedures and 0.07 fewer CT procedures after the implementation of the integrated system. Part of this reduction was driven by a lower rate of repeat procedures: the average inpatient had 0.13 fewer repeat XR procedures within 24-hours of the previous identical XR procedure. A similar decrease was not evident for repeat CT procedures. Reduced utilisation of imaging procedures (especially those within very short intervals from the previous identical procedure, which are more likely to be redundant) has implications for the safety of patients and the cost of medical imaging services.

  18. A review of the application of atomic force microscopy (AFM) in food science and technology. (United States)

    Liu, Shaoyang; Wang, Yifen


    Atomic force microscopy (AFM) is a powerful nanoscale analysis technique used in food area. This versatile technique can be used to acquire high-resolution sample images and investigate local interactions in air or liquid surroundings. In this chapter, we explain the principles of AFM and review representative applications of AFM in gelatin, casein micelle, carrageenan, gellan gum, starch, and interface. We elucidate new knowledge revealed with AFM as well as ways to use AFM to obtain morphology and rheology information in different food fields.

  19. Overt attention and context factors: the impact of repeated presentations, image type, and individual motivation.

    Directory of Open Access Journals (Sweden)

    Kai Kaspar

    Full Text Available The present study investigated the dynamic of the attention focus during observation of different categories of complex scenes and simultaneous consideration of individuals' memory and motivational state. We repeatedly presented four types of complex visual scenes in a pseudo-randomized order and recorded eye movements. Subjects were divided into groups according to their motivational disposition in terms of action orientation and individual rating of scene interest.Statistical analysis of eye-tracking data revealed that the attention focus successively became locally expressed by increasing fixation duration; decreasing saccade length, saccade frequency, and single subject's fixation distribution over images; and increasing inter-subject variance of fixation distributions. The validity of these results was supported by verbal reports. This general tendency was weaker for the group of subjects who rated the image set as interesting as compared to the other group. Additionally, effects were partly mediated by subjects' motivational disposition. Finally, we found a generally strong impact of image type on eye movement parameters. We conclude that motivational tendencies linked to personality as well as individual preferences significantly affected viewing behaviour. Hence, it is important and fruitful to consider inter-individual differences on the level of motivation and personality traits within investigations of attention processes. We demonstrate that future studies on memory's impact on overt attention have to deal appropriately with several aspects that had been out of the research focus until now.

  20. AFM Structural Characterization of Drinking Water Biofilm ... (United States)

    Due to the complexity of mixed culture drinking water biofilm, direct visual observation under in situ conditions has been challenging. In this study, atomic force microscopy (AFM) revealed the three dimensional morphology and arrangement of drinking water relevant biofilm in air and aqueous solution. Operating parameters were optimized to improve imaging of structural details for a mature biofilm in liquid. By using a soft cantilever (0.03 N/m) and slow scan rate (0.5 Hz), biofilm and individual bacterial cell’s structural topography were resolved and continuously imaged in liquid without loss of spatial resolution or sample damage. The developed methodology will allow future in situ investigations to temporally monitor mixed culture drinking water biofilm structural changes during disinfection treatments. Due to the complexity of mixed culture drinking water biofilm, direct visual observation under in situ conditions has been challenging. In this study, atomic force microscopy (AFM) revealed the three dimensional morphology and arrangement of drinking water relevant biofilm in air and aqueous solution. Operating parameters were optimized to improve imaging of structural details for a mature biofilm in liquid. By using a soft cantilever (0.03 N/m) and slow scan rate (0.5 Hz), biofilm and individual bacterial cell’s structural topography were resolved and continuously imaged in liquid without loss of spatial resolution or sample damage. The developed methodo

  1. Electrically conducting, ultra-sharp, high aspect-ratio probes for AFM fabricated by electron-beam-induced deposition of platinum

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Jason, E-mail: [Clarendon Laboratory, Department of Physics, University of Oxford, Oxford OX1 3PU (United Kingdom); Kocher, Paul; Ramanujan, Chandra S; Sharp, David N [Clarendon Laboratory, Department of Physics, University of Oxford, Oxford OX1 3PU (United Kingdom); Torimitsu, Keiichi [NTT Basic Research Laboratories, NTT Corporation, Atsugi, 243-0198 (Japan); Ryan, John F [Clarendon Laboratory, Department of Physics, University of Oxford, Oxford OX1 3PU (United Kingdom)


    We report on the fabrication of electrically conducting, ultra-sharp, high-aspect ratio probes for atomic force microscopy by electron-beam-induced deposition of platinum. Probes of 4.0 ±1.0 nm radius-of-curvature are routinely produced with high repeatability and near-100% yield. Contact-mode topographical imaging of the granular nature of a sputtered gold surface is used to assess the imaging performance of the probes, and the derived power spectral density plots are used to quantify the enhanced sensitivity as a function of spatial frequency. The ability of the probes to reproduce high aspect-ratio features is illustrated by imaging a close-packed array of nanospheres. The electrical resistance of the probes is measured to be of order 100 kΩ. - Highlights: • Electrically conducting, ultra-sharp, high aspect-ratio probes for AFM with radius-of-curvature 4.0±±1.0 nm. • AFM probe fabrication by electron-beam-induced deposition of platinum. • Enhanced spatial resolution demonstrated through AFM of sputtered gold grains. • AFM imaging of deep clefts and recesses on a close-packed array of nanospheres.

  2. Worldwide widespread decadal-scale decrease of glacier speed revealed using repeat optical satellite images

    Directory of Open Access Journals (Sweden)

    T. Heid


    Full Text Available Matching of repeat optical satellite images to derive glacier velocities is an approach that is much used within glaciology. Lately, focus has been put into developing, improving, automating and comparing different image matching methods. This makes it now possible to investigate glacier dynamics within large regions of the world and also between regions to improve knowledge about glacier dynamics in space and time. In this study we investigate whether the negative glacier mass balance seen over large parts of the world has caused the glaciers to change their speeds. The studied regions are Pamir, Caucasus, Penny Ice Cap, Alaska Range and Patagonia. In addition we derive speed changes for Karakoram, a region assumed to have positive mass balance and that contains many surge-type glaciers. We find that the mapped glaciers in the five regions with negative mass balance have decreased their speeds over the last decades, Pamir by 43 % in average per decade, Caucasus by 8 % in average per decade, Penny Ice Cap by 25 % in average per decade, Alaska Range by 11 % in average per decade and Patagonia by 20 % in average per decade. Glaciers in Karakoram have generally increased their speeds, but surging glaciers and glaciers with flow instabilities are most prominent in this area.

  3. AFM measurements on ferrous materials

    Directory of Open Access Journals (Sweden)

    Ros Yáñez, T.


    Full Text Available The Atomic Force Microscope (AFM has been successfully used for the characterisation of the surface topography of a very wide range of materials. The AFM is an interesting technique to study the surface of materials and specifically to study surface effects in steel, e.g. after polishing and/or after etching. This technique allows not only to study the topography of the samples, but it is also a useful tool to obtain structural details of surfaces and for the identification of different phases. In this paper, some applications are shown concerning the study of the microstructure of multiphase-steels.

    El Microcopio de Fuerza Atómica (AFM es utilizado en la caracterización topográfica de una gran variedad de materiales. El AFM es una interesante técnica para el estudio de la superficie de los aceros, ya sea con ataque químico o no. Esta técnica es también una útil herramienta para obtener detalles estructurales en las superficies y en la identificación de fases. En este trabajo algunas de estas aplicaciones son mostradas en el estudio de la microestructura de aceros multifásicos.

  4. Modeling the Interaction between AFM Tips and Pinned Surface Nanobubbles. (United States)

    Guo, Zhenjiang; Liu, Yawei; Xiao, Qianxiang; Schönherr, Holger; Zhang, Xianren


    Although the morphology of surface nanobubbles has been studied widely with different AFM modes, AFM images may not reflect the real shapes of the nanobubbles due to AFM tip-nanobubble interactions. In addition, the interplay between surface nanobubble deformation and induced capillary force has not been well understood in this context. In our work we used constraint lattice density functional theory to investigate the interaction between AFM tips and pinned surface nanobubbles systematically, especially concentrating on the effects of tip hydrophilicity and shape. For a hydrophilic tip contacting a nanobubble, its hydrophilic nature facilitates its departure from the bubble surface, displaying a weak and intermediate-range attraction. However, when the tip squeezes the nanobubble during the approach process, the nanobubble shows an elastic effect that prevents the tip from penetrating the bubble, leading to a strong nanobubble deformation and repulsive interactions. On the contrary, a hydrophobic tip can easily pierce the vapor-liquid interface of the nanobubble during the approach process, leading to the disappearance of the repulsive force. In the retraction process, however, the adhesion between the tip and the nanobubble leads to a much stronger lengthening effect on nanobubble deformation and a strong long-range attractive force. The trends of force evolution from our simulations agree qualitatively well with recent experimental AFM observations. This favorable agreement demonstrates that our model catches the main intergradient of tip-nanobubble interactions for pinned surface nanobubbles and may therefore provide important insight into how to design minimally invasive AFM experiments.

  5. [Study of the Raman-AFM system for simultaneous measurements of Raman spectrum and micro/nano-structures]. (United States)

    Shi, Bin; Zhang, Hai-jun; Wu, Lan; Zhang, Dong-xian


    This paper proposes a novel technique of Raman-atomic force microscopy (AFM) combining micro region Raman spectroscopy and AFM imaging. An in-situ probe unit which can simultaneously realize the detection of Raman spectrum and the measurement of AFM image was designed, and a related Raman-AFM system was constructed. Using this system, some experiments were carried out to acquire micro region Raman spectra and AFM images of ZnO nano-particle and TiO2 film. The results show that the Raman spectra of both samples are in agreement with theoretical vaues, and the AFM images represent their micro/nano-structures quite well. These researches prove the feasibility of the Raman-AFM technique which has the potential of being widely applied in the fields of Raman spectroscopy and micro/nano-technology.

  6. Multiple regimes of operation in bimodal AFM: understanding the energy of cantilever eigenmodes. (United States)

    Kiracofe, Daniel; Raman, Arvind; Yablon, Dalia


    One of the key goals in atomic force microscopy (AFM) imaging is to enhance material property contrast with high resolution. Bimodal AFM, where two eigenmodes are simultaneously excited, confers significant advantages over conventional single-frequency tapping mode AFM due to its ability to provide contrast between regions with different material properties under gentle imaging conditions. Bimodal AFM traditionally uses the first two eigenmodes of the AFM cantilever. In this work, the authors explore the use of higher eigenmodes in bimodal AFM (e.g., exciting the first and fourth eigenmodes). It is found that such operation leads to interesting contrast reversals compared to traditional bimodal AFM. A series of experiments and numerical simulations shows that the primary cause of the contrast reversals is not the choice of eigenmode itself (e.g., second versus fourth), but rather the relative kinetic energy between the higher eigenmode and the first eigenmode. This leads to the identification of three distinct imaging regimes in bimodal AFM. This result, which is applicable even to traditional bimodal AFM, should allow researchers to choose cantilever and operating parameters in a more rational manner in order to optimize resolution and contrast during nanoscale imaging of materials.

  7. Effect of post crosslinking haze on the repeatability of Scheimpflug-based and slit-scanning imaging devices

    Directory of Open Access Journals (Sweden)

    Rohit Shetty


    Full Text Available Purpose: The aim of this study was to analyze the effect of postcollagen crosslinking (CXL haze on the measurement and repeatability of pachymetry and mean keratometry (Km of four corneal topographers. Materials and Methods: Sixty eyes of sixty patients with progressive keratoconus who had undergone accelerated CXL (ACXL underwent imaging with a scanning slit imaging device (Orbscan II and three Scheimpflug imaging devices (Pentacam HR, Sirius, and Galilei. Post-ACXL haze was measured using the densitometry software on the Pentacam HR. Readings of the thinnest corneal thickness (TCT and Km from three scans of each device were analyzed. Effect of haze on the repeatability of TCT and Km measurements was evaluated using regression models. Repeatability was assessed by coefficient of variation. Results: Corneal densitometry in different zones affected the repeatability of TCT measurement of Orbscan (P < 0.05 significantly but not the repeatability of TCT with Pentacam HR and Sirius (P = 0.03 and 0.05, respectively. Km values were affected by haze when measured with the Pentacam HR (P < 0.05. The repeatability of Km readings for all devices was unaffected by haze. In the anterior 0–2 mm and 2–6 mm zone, TCT (P = 0.43 and 0.45, respectively, Km values (P = 0.4 and 0.6, respectively, repeatability of TCT (P = 0.1 in both zones, and Km (P = 0.5 and 0.1, respectively with Galilei were found to be the most reliable. Conclusion: Galilei measurements appear to be least affected by post-ACXL haze when compared with other devices. Hence, topography measurements in the presence of haze need to be interpreted with caution.

  8. A Description of Quasar Variability Measured Using Repeated SDSS and POSS Imaging

    CERN Document Server

    MacLeod, Chelsea L; Sesar, Branimir; de Vries, Wim; Kochanek, Christopher S; Kelly, Brandon C; Becker, Andrew C; Lupton, Robert H; Hall, Patrick B; Richards, Gordon T; Anderson, Scott F; Schneider, Donald P


    We provide a quantitative description and statistical interpretation of the optical continuum variability of quasars. The Sloan Digital Sky Survey (SDSS) has obtained repeated imaging in five UV-to-IR photometric bands for 34,727 spectroscopically confirmed quasars. About 10,000 quasars have an average of 60 observations in each band obtained over a decade along stripe 82 (S82), whereas the remaining ~25,000 have 2-3 observations due to scan overlaps. The observed time lags span the range from a day to almost 10 years, and constrain quasar variability at rest-frame time lags of up to 4 years, and at rest-frame wavelengths from 1000A to 6000A. We publicly release a user-friendly catalog of quasars from the SDSS Data Release 7 that have been observed at least twice in SDSS or once in both SDSS and the Palomar Observatory Sky Survey, and we use it to analyze the ensemble properties of quasar variability. Based on a damped random walk (DRW) model defined by a characteristic time scale and an asymptotic variabilit...

  9. Repeat optical satellite images reveal widespread and long term decrease in land-terminating glacier speeds

    Directory of Open Access Journals (Sweden)

    T. Heid


    Full Text Available By matching of repeat optical satellite images it is now possible to investigate glacier dynamics within large regions of the world and also between regions to improve knowledge about glacier dynamics in space and time. In this study we investigate whether the negative glacier mass balance seen over large parts of the world has caused the glaciers to change their speeds. The studied regions are Pamir, Caucasus, Penny Ice Cap, Alaska Range and Patagonia. In addition we derive speed changes for Karakoram, a region assumed to have positive mass balance and that contains many surge-type glaciers. We find that the mapped glaciers in the five regions with negative mass balance have over the last decades decreased their velocity at an average rate per decade of: 43 % in the Pamir, 8 % in the Caucasus, 25 % on Penny Ice Cap, 11 % in the Alaska Range and 20 % in Patagonia. Glaciers in Karakoram have generally increased their speeds, but surging glaciers and glaciers with flow instabilities are most prominent in this area. Therefore the calculated average speed change is not representative for this area.

  10. Optimization of phase contrast in bimodal amplitude modulation AFM

    Directory of Open Access Journals (Sweden)

    Mehrnoosh Damircheli


    Full Text Available Bimodal force microscopy has expanded the capabilities of atomic force microscopy (AFM by providing high spatial resolution images, compositional contrast and quantitative mapping of material properties without compromising the data acquisition speed. In the first bimodal AFM configuration, an amplitude feedback loop keeps constant the amplitude of the first mode while the observables of the second mode have not feedback restrictions (bimodal AM. Here we study the conditions to enhance the compositional contrast in bimodal AM while imaging heterogeneous materials. The contrast has a maximum by decreasing the amplitude of the second mode. We demonstrate that the roles of the excited modes are asymmetric. The operational range of bimodal AM is maximized when the second mode is free to follow changes in the force. We also study the contrast in trimodal AFM by analyzing the kinetic energy ratios. The phase contrast improves by decreasing the energy of second mode relative to those of the first and third modes.

  11. Optimization of phase contrast in bimodal amplitude modulation AFM. (United States)

    Damircheli, Mehrnoosh; Payam, Amir F; Garcia, Ricardo


    Bimodal force microscopy has expanded the capabilities of atomic force microscopy (AFM) by providing high spatial resolution images, compositional contrast and quantitative mapping of material properties without compromising the data acquisition speed. In the first bimodal AFM configuration, an amplitude feedback loop keeps constant the amplitude of the first mode while the observables of the second mode have not feedback restrictions (bimodal AM). Here we study the conditions to enhance the compositional contrast in bimodal AM while imaging heterogeneous materials. The contrast has a maximum by decreasing the amplitude of the second mode. We demonstrate that the roles of the excited modes are asymmetric. The operational range of bimodal AM is maximized when the second mode is free to follow changes in the force. We also study the contrast in trimodal AFM by analyzing the kinetic energy ratios. The phase contrast improves by decreasing the energy of second mode relative to those of the first and third modes.

  12. Acquisition of a Modular, Multi-laser, Raman-AFM Instrument for Multdisciplinary Research (United States)


    Acquisition of a Modular, Multi-laser, Raman- AFM Instrument for Multdisciplinary Research A four-laser, confocal Raman/Atomic Force Scanning...microscope (Raman- AFM ) (priced at ~ $496,000) has been acquired From Horiba Scientific. Acquisition of this instrument has enhanced the research and...capabilities as well as provides high resolution topographical and depth imaging capabilities through the AFM . The views, opinions and/or findings

  13. Image analysis as a non-destructive method to assess regrowth of weeds after repeated flame weeding

    DEFF Research Database (Denmark)

    Rask, Anne Merete; Kristoffersen, Palle; Andreasen, Christian


    Efficient non-chemical weed control like flame weeding often requires repeated treatments. In weed control experiments the effect of each treatment may be estimated by removing and weighing the remaining weed biomass after the treatment, but the method influences the weed plants ability to regrow......, and therefore it may influence the long-term effect of repeated treatments. Visual assessment of weed cover or image analysis do not affect the remaining parts of the weed plants after treatment, but the methods may have other disadvantages. In order to evaluate and compare three methods we measured changes...... in vegetation cover of perennial ryegrass after flaming by (1) a simple image analysis programme counting green pixels, (2) visual assessment of images and (3) by taking biomass samples. Plants were flame treated with eight different dosages (0, 20, 30, 35, 45, 60, 90 and 180 kg propane ha-1) and with various...


    Energy Technology Data Exchange (ETDEWEB)

    MacLeod, Chelsea L.; Ivezic, Zeljko; Becker, Andrew C.; Anderson, Scott F. [Department of Astronomy, University of Washington, Box 351580, Seattle, WA 98195 (United States); Sesar, Branimir [Division of Physics, Mathematics and Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States); De Vries, Wim [Department of Physics, University of California, One Shields Ave, Davis, CA 95616 (United States); Kochanek, Christopher S. [Department of Astronomy, Ohio State University, 140 West 18th Avenue, Columbus, OH 43210 (United States); Kelly, Brandon C. [Department of Physics, University of California, Santa Barbara, CA 93106 (United States); Lupton, Robert H. [Department of Astrophysical Sciences, Princeton University, Princeton, New Jersey 08544 (United States); Hall, Patrick B. [Department of Physics and Astronomy, York University, Toronto, ON M3J 1P3 (Canada); Richards, Gordon T. [Department of Physics, Drexel University, 3141 Chestnut Street, Philadelphia, PA 19104 (United States); Schneider, Donald P. [Department of Astronomy and Astrophysics, Pennsylvania State University, 525 Davey Laboratory, University Park, PA 16802 (United States)


    We provide a quantitative description and statistical interpretation of the optical continuum variability of quasars. The Sloan Digital Sky Survey (SDSS) has obtained repeated imaging in five UV-to-IR photometric bands for 33,881 spectroscopically confirmed quasars. About 10,000 quasars have an average of 60 observations in each band obtained over a decade along Stripe 82 (S82), whereas the remaining {approx}25,000 have 2-3 observations due to scan overlaps. The observed time lags span the range from a day to almost 10 years, and constrain quasar variability at rest-frame time lags of up to 4 years, and at rest-frame wavelengths from 1000 A to 6000 A. We publicly release a user-friendly catalog of quasars from the SDSS Data Release 7 that have been observed at least twice in SDSS or once in both SDSS and the Palomar Observatory Sky Survey, and we use it to analyze the ensemble properties of quasar variability. Based on a damped random walk (DRW) model defined by a characteristic timescale and an asymptotic variability amplitude that scale with the luminosity, black hole mass, and rest wavelength for individual quasars calibrated in S82, we can fully explain the ensemble variability statistics of the non-S82 quasars such as the exponential distribution of large magnitude changes. All available data are consistent with the DRW model as a viable description of the optical continuum variability of quasars on timescales of {approx}5-2000 days in the rest frame. We use these models to predict the incidence of quasar contamination in transient surveys such as those from the Palomar Transient Factory and Large Synoptic Survey Telescope.

  15. Development of the designed ankyrin repeat protein (DARPin) G3 for HER2 molecular imaging

    Energy Technology Data Exchange (ETDEWEB)

    Goldstein, Robert; Livanos, Maria; Bhavsar, Gaurav; Rashid, Mohammed; Miranda, Enrique; Tolner, Berend; Meyer, Tim; Chester, Kerry [UCL Cancer Institute, London (United Kingdom); Sosabowski, Jane; Leyton, Julius; Mather, Stephen [Queen Mary University of London, Centre for Molecular Oncology, Barts Cancer Institute, London (United Kingdom); Vigor, Kim [Clare Hall Laboratories, Biotherapeutics Development Unit, Cancer Research UK, South Mimms (United Kingdom); Nagy-Davidescu, Gabriela; Plueckthun, Andreas [Universitaet Zuerich, Biochemisches Institut, Zuerich (Switzerland); Yeung, Jenny [UCL Cancer Institute, London (United Kingdom); UCL Institute of Child Health, London (United Kingdom)


    Human epidermal growth factor receptor-2 (HER2) overexpression is a predictor of response to anti-HER2 therapy in breast and gastric cancer. Currently, HER2 status is assessed by tumour biopsy, but this may not be representative of the larger tumour mass or other metastatic sites, risking misclassification and selection of suboptimal therapy. The designed ankyrin repeat protein (DARPin) G3 binds HER2 with high affinity at an epitope that does not overlap with trastuzumab and is biologically inert. We hypothesized that radiolabelled DARPin G3 would be capable of selectively imaging HER2-positive tumours, and aimed to identify a suitable format for clinical application. G3 DARPins tagged with hexahistidine (His{sub 6}) or with histidine glutamate (HE){sub 3} and untagged G3 DARPins were manufactured using a GMP-compatible Pichia pastoris protocol and radiolabelled with {sup 125}I, or with {sup 111}In via DOTA linked to a C-terminal cysteine. BALB/c mice were injected with radiolabelled G3 and tissue biodistribution was evaluated by gamma counting. The lead construct ((HE){sub 3}-G3) was assessed in mice bearing HER2-positive human breast tumour (BT474) xenografts. For both isotopes, (HE){sub 3}-G3 had significantly lower liver uptake than His{sub 6}-G3 and untagged G3 counterparts in non-tumour-bearing mice, and there was no significantly different liver uptake between His{sub 6}-G3 and untagged G3. (HE){sub 3}-G3 was taken forward for evaluation in mice bearing HER2-positive tumour xenografts. The results demonstrated that radioactivity from {sup 111}In-(HE){sub 3}-G3 was better maintained in tumours and cleared faster from serum than radioactivity from {sup 125}I-(HE){sub 3}-G3, achieving superior tumour-to-blood ratios (343.7 ± 161.3 vs. 22.0 ± 11.3 at 24 h, respectively). On microSPECT/CT, {sup 111}In-labelled and {sup 125}I-labelled (HE){sub 3}-G3 could image HER2-positive tumours at 4 h after administration, but there was less normal tissue uptake of

  16. Characterization of large area nanostructured surfaces using AFM measurements

    DEFF Research Database (Denmark)

    Calaon, Matteo; Hansen, Hans Nørgaard; Tosello, Guido;


    magnitude of the 3D surface amplitude parameters chosen for the analysis, when increasing the Al purity from 99,5% to 99,999%. AFM was then employed to evaluate the periodical arrangements of the nano structured cells. Image processing was used to estimate the average areas value, the height variation...

  17. AFM reconstruction of complex-shaped chiral plasmonic nanostructures

    CERN Document Server

    Kondratov, Alexey V; Gainutdinov, Radmir V


    A significant part of the optical metamaterial phenomena has the plasmonic nature and their investigation requires very accurate knowledge of the fabricated structures shape with a focus on the periodical features. We describe a consistent approach to the shape reconstruction of the plasmonic nanostructures. This includes vertical and tilted spike AFM probes fabrication, AFM imaging and specific post-processing. We studied a complex-shaped chiral metamaterial and conclude that the described post-processing routine extends possibilities of the existing deconvolution algorithms in the case of periodical structures with known rotational symmetry, by providing valuable information about periodical features.

  18. Introduction to Atomic Force Microscopy (AFM) in Biology. (United States)

    Kreplak, Laurent


    The atomic force microscope (AFM) has the unique capability of imaging biological samples with molecular resolution in buffer solution over a wide range of time scales from milliseconds to hours. In addition to providing topographical images of surfaces with nanometer- to angstrom-scale resolution, forces between single molecules and mechanical properties of biological samples can be investigated from the nano-scale to the micro-scale. Importantly, the measurements are made in buffer solutions, allowing biological samples to "stay alive" within a physiological-like environment while temporal changes in structure are measured-e.g., before and after addition of chemical reagents. These qualities distinguish AFM from conventional imaging techniques of comparable resolution, e.g., electron microscopy (EM). This unit provides an introduction to AFM on biological systems and describes specific examples of AFM on proteins, cells, and tissues. The physical principles of the technique and methodological aspects of its practical use and applications are also described. © 2016 by John Wiley & Sons, Inc.

  19. 3D Color Digital Elevation Map of AFM Sample (United States)


    This color image is a three dimensional (3D) view of a digital elevation map of a sample collected by NASA's Phoenix Mars Lander's Atomic Force Microscope (AFM). The image shows four round pits, only 5 microns in depth, that were micromachined into the silicon substrate, which is the background plane shown in red. This image has been processed to reflect the levelness of the substrate. A Martian particle only one micrometer, or one millionth of a meter, across is held in the upper left pit. The rounded particle shown at the highest magnification ever seen from another world is a particle of the dust that cloaks Mars. Such dust particles color the Martian sky pink, feed storms that regularly envelop the planet and produce Mars' distinctive red soil. The particle was part of a sample informally called 'Sorceress' delivered to the AFM on the 38th Martian day, or sol, of the mission (July 2, 2008). The AFM is part of Phoenix's microscopic station called MECA, or the Microscopy, Electrochemistry, and Conductivity Analyzer. The AFM was developed by a Swiss-led consortium, with Imperial College London producing the silicon substrate that holds sampled particles. The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  20. Performance evaluation of an automatic anatomy segmentation algorithm on repeat or four-dimensional CT images using a deformable image registration method (United States)

    Wang, He; Garden, Adam S.; Zhang, Lifei; Wei, Xiong; Ahamad, Anesa; Kuban, Deborah A.; Komaki, Ritsuko; O’Daniel, Jennifer; Zhang, Yongbin; Mohan, Radhe; Dong, Lei


    Purpose Auto-propagation of anatomical region-of-interests (ROIs) from the planning CT to daily CT is an essential step in image-guided adaptive radiotherapy. The goal of this study was to quantitatively evaluate the performance of the algorithm in typical clinical applications. Method and Materials We previously adopted an image intensity-based deformable registration algorithm to find the correspondence between two images. In this study, the ROIs delineated on the planning CT image were mapped onto daily CT or four-dimentional (4D) CT images using the same transformation. Post-processing methods, such as boundary smoothing and modification, were used to enhance the robustness of the algorithm. Auto-propagated contours for eight head-and-neck patients with a total of 100 repeat CTs, one prostate patient with 24 repeat CTs, and nine lung cancer patients with a total of 90 4D-CT images were evaluated against physician-drawn contours and physician-modified deformed contours using the volume-overlap-index (VOI) and mean absolute surface-to-surface distance (ASSD). Results The deformed contours were reasonably well matched with daily anatomy on repeat CT images. The VOI and mean ASSD were 83% and 1.3 mm when compared to the independently drawn contours. A better agreement (greater than 97% and less than 0.4 mm) was achieved if the physician was only asked to correct the deformed contours. The algorithm was robust in the presence of random noise in the image. Conclusion The deformable algorithm may be an effective method to propagate the planning ROIs to subsequent CT images of changed anatomy, although a final review by physicians is highly recommended. PMID:18722272

  1. A Semi-Automated Positioning System for contact-mode Atomic Force Microscopy (AFM). (United States)

    Roy, Rajarshi; Chen, Wenjin; Cong, Lei; Goodell, Lauri A; Foran, David J; Desai, Jaydev P


    Contact mode Atomic Force Microscopy (CM-AFM) is popularly used by the biophysics community to study mechanical properties of cells cultured in petri dishes, or tissue sections fixed on microscope slides. While cells are fairly easy to locate, sampling in spatially heterogeneous tissue specimens is laborious and time-consuming at higher magnifications. Furthermore, tissue registration across multiple magnifications for AFM-based experiments is a challenging problem, suggesting the need to automate the process of AFM indentation on tissue. In this work, we have developed an image-guided micropositioning system to align the AFM probe and human breast-tissue cores in an automated manner across multiple magnifications. Our setup improves efficiency of the AFM indentation experiments considerably. Note to Practitioners: Human breast tissue is by nature heterogeneous, and in the samples we studied, epithelial tissue is formed by groups of functional breast epithelial cells that are surrounded by stromal tissue in a complex intertwined way. Therefore sampling a specific cell type on an unstained specimen is very difficult. To aid us, we use digital stained images of the same tissue annotated by a certified pathologist to identify the region of interest (ROI) at a coarse magnification and an image-guided positioning system to place the unstained tissue near the AFM probe tip. Using our setup, we could considerably reduce AFM operating time and we believe that our setup is a viable supplement to commercial AFM stages with limited X-Y range.

  2. Dicty_cDB: AFM658 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Representative seq. ID - (Link to Original site) Representa...tive DNA sequence >AFM658 (AFM658Q) /CSM/AF/AFM6-C/AFM658Q.Seq.d/ XXXXXXXXXXTTACANG

  3. Implementing atomic force microscopy (AFM) for studying kinetics of gold nanoparticle's growth

    DEFF Research Database (Denmark)

    Georgiev, P.; Bojinova, A.; Kostova, B.


    In a novel experimental approach Atomic Force Microscopy (AFM) was applied as a tool for studying the kinetics of gold nanoparticle growth. The gold nanoparticles were obtained by classical Turkevich citrate synthesis at two different temperatures. From the analysis of AFM images during the synth......In a novel experimental approach Atomic Force Microscopy (AFM) was applied as a tool for studying the kinetics of gold nanoparticle growth. The gold nanoparticles were obtained by classical Turkevich citrate synthesis at two different temperatures. From the analysis of AFM images during...... approach. We also compared AFM experimental data with Dynamic Light Scattering (DLS) and with Transmission Electron Microscopy (TEM) data. The experimental data from all the applied methods were fitted with two step Finke-Watzky kinetics model and the corresponding kinetics constants were obtained...

  4. The Effect of Image Quality, Repeated Study, and Assessment Method on Anatomy Learning (United States)

    Fenesi, Barbara; Mackinnon, Chelsea; Cheng, Lucia; Kim, Joseph A.; Wainman, Bruce C.


    The use of two-dimensional (2D) images is consistently used to prepare anatomy students for handling real specimen. This study examined whether the quality of 2D images is a critical component in anatomy learning. The visual clarity and consistency of 2D anatomical images was systematically manipulated to produce low-quality and high-quality…

  5. AFM Imaging of Natural Optical Structures

    Directory of Open Access Journals (Sweden)

    Dinara Sultanovna Dallaeva


    Full Text Available The research in this field is focused to the investigation of biological structures with superior optical features. The study presents atomic force microscopy of biological optical structures on butterfly wings. The bright blue and dark black color scales exhibit the different topography. These scales were compared to the visually the same color scales of other two species of butterflies. The histograms of heights distribution are presented and show similar results for the scales of one color for different species.

  6. AFM imaging of natural optical structures (United States)

    Dallaeva, Dinara; Tománek, Pavel; Prokopyeva, Elena; Kaspar, Pavel; Grmela, Lubomír.; Škarvada, Pavel


    The colors of some living organisms assosiated with the surface structure. Irridesence butterfly wings is an example of such coloration. Optical effects such as interference, diffraction, polarization are responsible for physical colors appearance. Alongside with amazing beauty this structure represent interest for design of optical devices. Here we report the results of morphology investigation by atomic force microscopy. The difference in surface structure of black and blue wings areas is clearly observed. It explains the angle dependence of the wing blue color, since these micrometer and sub-micrometer quasiperiodical structures could control the light propagation, absorption and reflection.

  7. Images of Azurin Protein Studied by AFM

    Institute of Scientific and Technical Information of China (English)

    WANG Nan; WANG Yuan-liang


    Azurins, a wild type and a genetically mutant K27 altered one, were immobilized on annealed gold surface and investigated by means of atomic force microscopy. It was found that the surface coverage and height distribution of the adsorbed protein molecules are different from each other, which is possibly the result of the different orientation on the surface. It is believed that the wild type azurin is connected to gold surface by the disulphide bridge; while the mutant, K27C, might be through the thiol groups of the cysteine residues on their surface.

  8. Repeatability, Reproducibility and Standardisation of a Laser Doppler Imaging Technique for the Evaluation of Normal Mouse Hindlimb Perfusion

    Directory of Open Access Journals (Sweden)

    Arturo Brunetti


    Full Text Available Background. Preclinical perfusion studies are useful for the improvement of diagnosis and therapy in dermatologic, cardiovascular and rheumatic human diseases. The Laser Doppler Perfusion Imaging (LDPI technique has been used to evaluate superficial alterations of the skin microcirculation in surgically induced murine hindlimb ischemia. We assessed the reproducibility and the accuracy of LDPI acquisitions and identified several critical factors that could affect LDPI measurements in mice. Methods. Twenty mice were analysed. Statistical standardisation and a repeatability and reproducibility analysis were performed on mouse perfusion signals with respect to differences in body temperature, the presence or absence of hair, the type of anaesthesia used for LDPI measurements and the position of the mouse body. Results. We found excellent correlations among measurements made by the same operator (i.e., repeatability under the same experimental conditions and by two different operators (i.e., reproducibility. A Bland-Altman analysis showed the absence of bias in repeatability (p = 0.29 or reproducibility (p = 0.89. The limits of agreement for repeatability were –0.357 and –0.033, and for reproducibility, they were –0.270 and 0.238. Significant differences in perfusion values were observed in different experimental groups. Conclusions. Different experimental conditions must be considered as a starting point for the evaluation of new drugs and strategic therapies.

  9. Insights into Epoxy Network Nanostructural Heterogeneity Using AFM-IR. (United States)

    Morsch, Suzanne; Liu, Yanwen; Lyon, Stuart B; Gibbon, Simon R


    The first direct observation of a chemically heterogeneous nanostructure within an epoxy resin is reported. Epoxy resins comprise the matrix component of many high performance composites, coatings and adhesives, yet the molecular network structure that underpins the performance of these industrially essential materials is not well understood. Internal nodular morphologies have repeatedly been reported for epoxy resins analyzed using SEM or AFM, yet the origin of these features remains a contentious subject, and epoxies are still commonly assumed to be chemically homogeneous. Uniquely, in this contribution we use the recently developed AFM-IR technique to eliminate previous differences in interpretation, and establish that nodule features correspond to heterogeneous network connectivity within an epoxy phenolic formulation.

  10. Cryogenic AFM-STM for mesoscopic physics (United States)

    Le Sueur, H.

    Electronic spectroscopy based on electron tunneling gives access to the electronic density of states (DOS) in conductive materials, and thus provides detailed information about their electronic properties. During this thesis work, we have developed a microscope in order to perform spatially resolved (10 nm) tunneling spectroscopy, with an unprecedented energy resolution (10 μeV), on individual nanocircuits. This machine combines an Atomic Force Microscope (AFM mode) together with a Scanning Tunneling Spectroscope (STS mode) and functions at very low temperatures (30 mK). In the AFM mode, the sample topography is recorded using a piezoelectric quartz tuning fork, which allows us to locate and image nanocircuits. Tunneling can then be performed on conductive areas of the circuit. With this microscope, we have measured the local DOS in a hybrid Superconductor-Normal metal-Superconductor (S-N-S) structure. In such circuit, the electronic properties of N and S are modified by the superconducting proximity effect. In particular, for short N wires, we have observed a minigap independent of position in the DOS of the N wire, as was previously predicted. Moreover, when varying the superconducting phase difference between the S electrodes, we have measured the modification of the minigap and its disappearance when the phase difference equals π. Our experimental results for the DOS, and its dependences (on phase, position, N length), are quantitatively accounted for by the quasiclassical theory of superconductivity. Some predictions of this theory are observed for the first time. La spectroscopie électronique basée sur l'effet tunnel donne accès à la densité d'états des électrons (DOS) dans les matériaux conducteurs, et renseigne ainsi en détail sur leurs propriétés électroniques. Au cours de cette thèse, nous avons développé un microscope permettant d'effectuer la spectroscopie tunnel résolue spatialement (10 nm) de nanocircuits individuels, avec une r

  11. Dicty_cDB: AFM665 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM665 (Link to dictyBase) - - - - - (Link to Original site) AFM...665F 165 - - - - - - Show AFM665 Library AF (Link to library) Clone ID AFM665 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...665 (AFM665Q) /CSM/AF/AFM6-C/AFM665Q.Seq.d/ ATTTTCAATTTTTCTAATTTTTAATTTTTTTATATATATACATAA

  12. Dicty_cDB: AFM685 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM685 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...685Z 532 - - - - Show AFM685 Library AF (Link to library) Clone ID AFM685 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...685 (AFM685Q) /CSM/AF/AFM6-D/AFM685Q.Seq.d/ XXXXXXXXXXATCACCACAATCANCAATATCAACAACATCAACAA

  13. Dicty_cDB: AFM503 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM503 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...503Z 790 - - - - Show AFM503 Library AF (Link to library) Clone ID AFM503 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...503 (AFM503Q) /CSM/AF/AFM5-A/AFM503Q.Seq.d/ XXXXXXXXXXGGTAAGNCTNTTNCNTNGGAGGTGAAGGTAGGGGC

  14. Dicty_cDB: AFM504 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM504 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...504Z 623 - - - - Show AFM504 Library AF (Link to library) Clone ID AFM504 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...504 (AFM504Q) /CSM/AF/AFM5-A/AFM504Q.Seq.d/ XXXXXXXXXXTGANCAAAATTTAGTTGATTGCTCTGGTCCAGAAG

  15. Dicty_cDB: AFM307 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM307 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...307Z 314 - - - - Show AFM307 Library AF (Link to library) Clone ID AFM307 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...307 (AFM307Q) /CSM/AF/AFM3-A/AFM307Q.Seq.d/ XXXXXXXXXXCGTCATGAAAGAAGATGCCATCGTTTGTAACATTG

  16. Dicty_cDB: AFM579 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM579 (Link to dictyBase) - - - - - (Link to Original site) AFM...579F 522 - - - - - - Show AFM579 Library AF (Link to library) Clone ID AFM579 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...579 (AFM579Q) /CSM/AF/AFM5-D/AFM579Q.Seq.d/ ATTCATCACCCTACAATTTAATTACATACATATATATATATAAAC

  17. Dicty_cDB: AFM826 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM826 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...826Z 165 - - - - Show AFM826 Library AF (Link to library) Clone ID AFM826 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...826 (AFM826Q) /CSM/AF/AFM8-B/AFM826Q.Seq.d/ XXXXXXXXXXTAAATCAATTCCAGATTTATTGGAATTGGATCATC

  18. Dicty_cDB: AFM586 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM586 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...586Z 766 - - - - Show AFM586 Library AF (Link to library) Clone ID AFM586 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...586 (AFM586Q) /CSM/AF/AFM5-D/AFM586Q.Seq.d/ XXXXXXXXXXGTCGCTTCAGATCCATTATCAAATATCACCGAACC

  19. Dicty_cDB: AFM607 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM607 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...607Z 617 - - - - Show AFM607 Library AF (Link to library) Clone ID AFM607 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...607 (AFM607Q) /CSM/AF/AFM6-A/AFM607Q.Seq.d/ XXXXXXXXXXANNACAAGAAATAAANCAAGANCAATTGAGTCNAC

  20. Dicty_cDB: AFM818 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM818 (Link to dictyBase) - - - - - (Link to Original site) AFM...818F 156 - - - - - - Show AFM818 Library AF (Link to library) Clone ID AFM818 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...818 (AFM818Q) /CSM/AF/AFM8-A/AFM818Q.Seq.d/ GGAAGTTAGAGCAGCAGTAGTAGTAGTAGCAGTAGTAGTAGTTAG

  1. Dicty_cDB: AFM279 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM279 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...279Z 657 - - - - Show AFM279 Library AF (Link to library) Clone ID AFM279 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...279 (AFM279Q) /CSM/AF/AFM2-D/AFM279Q.Seq.d/ XXXXXXXXXXTCCAAACTATGGAAGAATTAGTACTACCAACAAGA

  2. Dicty_cDB: AFM692 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM692 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...692Z 739 - - - - Show AFM692 Library AF (Link to library) Clone ID AFM692 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...692 (AFM692Q) /CSM/AF/AFM6-D/AFM692Q.Seq.d/ XXXXXXXXXXATGGCAAAACAGTTGGGGTTTAACCACTCGTACCA

  3. Dicty_cDB: AFM861 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM861 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...861Z 711 - - - - Show AFM861 Library AF (Link to library) Clone ID AFM861 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...861 (AFM861Q) /CSM/AF/AFM8-C/AFM861Q.Seq.d/ XXXXXXXXXXTCGAAGATGTAAAGAAAATCGCTACCTCACAAAAA

  4. Dicty_cDB: AFM360 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM360 (Link to dictyBase) - - - - - (Link to Original site) AFM...360F 630 - - - - - - Show AFM360 Library AF (Link to library) Clone ID AFM360 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...360 (AFM360Q) /CSM/AF/AFM3-C/AFM360Q.Seq.d/ ATCTATAGCTTTATATTAAAAAGATAATTTAAAAATGTTTAAAAG

  5. Dicty_cDB: AFM562 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM562 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...562Z 759 - - - - Show AFM562 Library AF (Link to library) Clone ID AFM562 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...562 (AFM562Q) /CSM/AF/AFM5-C/AFM562Q.Seq.d/ XXXXXXXXXXCAATAATTGATCTTCAGGGTATTAAATCATATTCA

  6. Dicty_cDB: AFM246 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM246 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...246Z 559 - - - - Show AFM246 Library AF (Link to library) Clone ID AFM246 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...246 (AFM246Q) /CSM/AF/AFM2-B/AFM246Q.Seq.d/ XXXXXXXXXXAGATTAAACAATTCATTCTTGATGAATGTGATACC

  7. Dicty_cDB: AFM321 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM321 (Link to dictyBase) - - - - - (Link to Original site) AFM...321F 684 - - - - - - Show AFM321 Library AF (Link to library) Clone ID AFM321 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...321 (AFM321Q) /CSM/AF/AFM3-A/AFM321Q.Seq.d/ AATTATAACAATTATTAAAAACAAAAAGATATTTTGTTTTTTCTT

  8. Dicty_cDB: AFM359 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM359 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...359Z 711 - - - - Show AFM359 Library AF (Link to library) Clone ID AFM359 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...359 (AFM359Q) /CSM/AF/AFM3-C/AFM359Q.Seq.d/ XXXXXXXXXXGATCCAGACGTTGAAAGAGATTTACTTGATATTTT

  9. Dicty_cDB: AFM642 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM642 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...642Z 645 - - - - Show AFM642 Library AF (Link to library) Clone ID AFM642 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...642 (AFM642Q) /CSM/AF/AFM6-B/AFM642Q.Seq.d/ XXXXXXXXXXAATTATGTAAGAAATATAACTGTTTATTGATGGTT

  10. Dicty_cDB: AFM168 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM168 (Link to dictyBase) - - - - - (Link to Original site) AFM...168F 592 - - - - - - Show AFM168 Library AF (Link to library) Clone ID AFM168 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...168 (AFM168Q) /CSM/AF/AFM1-C/AFM168Q.Seq.d/ ATTAAACTTTTTGTCACATATATAATTAAATAAAATGTCAGAAAG

  11. Dicty_cDB: AFM880 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM880 (Link to dictyBase) - - - - - (Link to Original site) AFM...880F 569 - - - - - - Show AFM880 Library AF (Link to library) Clone ID AFM880 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...880 (AFM880Q) /CSM/AF/AFM8-D/AFM880Q.Seq.d/ ACTTTTACTTAAATAATTTCCAAAATGTCAGAAACTACACCAGTT

  12. Dicty_cDB: AFM247 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM247 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...247Z 829 - - - - Show AFM247 Library AF (Link to library) Clone ID AFM247 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...247 (AFM247Q) /CSM/AF/AFM2-B/AFM247Q.Seq.d/ XXXXXXXXXXTCCCTTTAGTCCTANATAANAGGTGGTACCAATTT

  13. Dicty_cDB: AFM446 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM446 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...446Z 724 - - - - Show AFM446 Library AF (Link to library) Clone ID AFM446 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...446 (AFM446Q) /CSM/AF/AFM4-B/AFM446Q.Seq.d/ XXXXXXXXXXCCATTAGATGCAAGAGGTGAAGTTGATGAATGTGC

  14. Dicty_cDB: AFM419 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM419 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...419Z 552 - - - - Show AFM419 Library AF (Link to library) Clone ID AFM419 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...419 (AFM419Q) /CSM/AF/AFM4-A/AFM419Q.Seq.d/ XXXXXXXXXXGTGAACAAAGAACTCACATCAGACATTACAGTTTA

  15. Dicty_cDB: AFM361 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM361 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...361Z 702 - - - - Show AFM361 Library AF (Link to library) Clone ID AFM361 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...361 (AFM361Q) /CSM/AF/AFM3-C/AFM361Q.Seq.d/ XXXXXXXXXXAGTTATCAGATTCCTGTTTTGTTATCTCTTCAACT

  16. Dicty_cDB: AFM190 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM190 (Link to dictyBase) - - - - - (Link to Original site) AFM...190F 158 - - - - - - Show AFM190 Library AF (Link to library) Clone ID AFM190 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...190 (AFM190Q) /CSM/AF/AFM1-D/AFM190Q.Seq.d/ ATTCAAAAAAAAAAATATTAAATCATTGTAGTATTTTGTTCNTAT

  17. Dicty_cDB: AFM447 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM447 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...447Z 647 - - - - Show AFM447 Library AF (Link to library) Clone ID AFM447 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...447 (AFM447Q) /CSM/AF/AFM4-B/AFM447Q.Seq.d/ XXXXXXXXXXATATGCTTAATAAACCAATTGAAAATATTGTTTTC

  18. Dicty_cDB: AFM842 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM842 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...842Z 358 - - - - Show AFM842 Library AF (Link to library) Clone ID AFM842 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...842 (AFM842Q) /CSM/AF/AFM8-B/AFM842Q.Seq.d/ XXXXXXXXXXTGTTGGTGCTGGTCGTGTTGAACAACTCGATACTA

  19. Dicty_cDB: AFM519 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM519 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...519Z 820 - - - - Show AFM519 Library AF (Link to library) Clone ID AFM519 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...519 (AFM519Q) /CSM/AF/AFM5-A/AFM519Q.Seq.d/ XXXXXXXXXXTTTAAAAATAAAAGGTGTATGCAAATTTTGTAAAC

  20. Dicty_cDB: AFM105 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM105 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...105Z 742 - - - - Show AFM105 Library AF (Link to library) Clone ID AFM105 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...105 (AFM105Q) /CSM/AF/AFM1-A/AFM105Q.Seq.d/ XXXXXXXXXXATCAATATAGTTTATAACTCAACCCAACGTTATGA

  1. Dicty_cDB: AFM563 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM563 (Link to dictyBase) - - - - - (Link to Original site) AFM...563F 592 - - - - - - Show AFM563 Library AF (Link to library) Clone ID AFM563 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...563 (AFM563Q) /CSM/AF/AFM5-C/AFM563Q.Seq.d/ ATTTAAACAACTAAACAGATAAATTTAAAAAAATGGGATTCGATT

  2. Dicty_cDB: AFM379 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM379 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...379Z 655 - - - - Show AFM379 Library AF (Link to library) Clone ID AFM379 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...379 (AFM379Q) /CSM/AF/AFM3-D/AFM379Q.Seq.d/ XXXXXXXXXXACGTGCCGTTGGTAATATTGTCACTGGTGAATCTA

  3. Dicty_cDB: AFM283 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM283 (Link to dictyBase) - - - - AFM283P (Link to Original site) AFM283F 572 AFM...283Z 658 AFM283P 1210 - - Show AFM283 Library AF (Link to library) Clone ID AFM283 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM283P (Link to... Original site) Representative DNA sequence >AFM283 (AFM283Q) /CSM/AF/AFM2-D/AFM283Q.Seq.d/ TTGCAATTGTTTCCCA

  4. Dicty_cDB: AFM378 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM378 (Link to dictyBase) - - - - AFM378P (Link to Original site) AFM378F 580 AFM...378Z 726 AFM378P 1286 - - Show AFM378 Library AF (Link to library) Clone ID AFM378 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM378P (Link to... Original site) Representative DNA sequence >AFM378 (AFM378Q) /CSM/AF/AFM3-D/AFM378Q.Seq.d/ GAATTAAAAATAATAC

  5. Dicty_cDB: AFM388 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM388 (Link to dictyBase) - - - - AFM388P (Link to Original site) AFM388F 137 AFM...388Z 260 AFM388P 377 - - Show AFM388 Library AF (Link to library) Clone ID AFM388 (Link dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM388P (Link to ...Original site) Representative DNA sequence >AFM388 (AFM388Q) /CSM/AF/AFM3-D/AFM388Q.Seq.d/ ATTTTTTTTTTCCTAAC

  6. Dicty_cDB: AFM241 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM241 (Link to dictyBase) - - - - AFM241P (Link to Original site) AFM241F 620 AFM...241Z 717 AFM241P 1317 - - Show AFM241 Library AF (Link to library) Clone ID AFM241 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM241P (Link to... Original site) Representative DNA sequence >AFM241 (AFM241Q) /CSM/AF/AFM2-B/AFM241Q.Seq.d/ ATTGTCATAATAATAT

  7. Dicty_cDB: AFM380 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM380 (Link to dictyBase) - - - - AFM380P (Link to Original site) AFM380F 573 AFM...380Z 180 AFM380P 733 - - Show AFM380 Library AF (Link to library) Clone ID AFM380 (Link dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM380P (Link to ...Original site) Representative DNA sequence >AFM380 (AFM380Q) /CSM/AF/AFM3-D/AFM380Q.Seq.d/ AAAATTATTTCCCACCC

  8. Dicty_cDB: AFM744 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM744 (Link to dictyBase) - - - - AFM744P (Link to Original site) AFM744F 591 AFM...744Z 685 AFM744P 1256 - - Show AFM744 Library AF (Link to library) Clone ID AFM744 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM744P (Link to... Original site) Representative DNA sequence >AFM744 (AFM744Q) /CSM/AF/AFM7-B/AFM744Q.Seq.d/ ATATATATAAAAAATG

  9. Dicty_cDB: AFM445 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM445 (Link to dictyBase) - - - - AFM445P (Link to Original site) AFM445F 595 AFM...445Z 725 AFM445P 1300 - - Show AFM445 Library AF (Link to library) Clone ID AFM445 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM445P (Link to... Original site) Representative DNA sequence >AFM445 (AFM445Q) /CSM/AF/AFM4-B/AFM445Q.Seq.d/ ATGGGTAATGAAATTT

  10. Dicty_cDB: AFM628 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM628 (Link to dictyBase) - - - - AFM628P (Link to Original site) AFM628F 615 AFM...628Z 714 AFM628P 1309 - - Show AFM628 Library AF (Link to library) Clone ID AFM628 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM628P (Link to... Original site) Representative DNA sequence >AFM628 (AFM628Q) /CSM/AF/AFM6-B/AFM628Q.Seq.d/ ACCCAAGTGAATTCAT

  11. Dicty_cDB: AFM221 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM221 (Link to dictyBase) - - - - AFM221P (Link to Original site) AFM221F 624 AFM...221Z 732 AFM221P 1336 - - Show AFM221 Library AF (Link to library) Clone ID AFM221 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM221P (Link to... Original site) Representative DNA sequence >AFM221 (AFM221Q) /CSM/AF/AFM2-A/AFM221Q.Seq.d/ ACACAACAATTTATAA

  12. Dicty_cDB: AFM713 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM713 (Link to dictyBase) - - - - AFM713P (Link to Original site) AFM713F 511 AFM...713Z 676 AFM713P 1167 - - Show AFM713 Library AF (Link to library) Clone ID AFM713 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM713P (Link to... Original site) Representative DNA sequence >AFM713 (AFM713Q) /CSM/AF/AFM7-A/AFM713Q.Seq.d/ TCAATATTGCGAGACG

  13. Dicty_cDB: AFM173 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM173 (Link to dictyBase) - - - - AFM173P (Link to Original site) AFM173F 595 AFM...173Z 662 AFM173P 1237 - - Show AFM173 Library AF (Link to library) Clone ID AFM173 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM173P (Link to... Original site) Representative DNA sequence >AFM173 (AFM173Q) /CSM/AF/AFM1-D/AFM173Q.Seq.d/ ATTTTCCAATTGATAA

  14. Dicty_cDB: AFM302 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM302 (Link to dictyBase) - - - - AFM302P (Link to Original site) AFM302F 518 AFM...302Z 768 AFM302P 1266 - - Show AFM302 Library AF (Link to library) Clone ID AFM302 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM302P (Link to... Original site) Representative DNA sequence >AFM302 (AFM302Q) /CSM/AF/AFM3-A/AFM302Q.Seq.d/ AATTGATAAAATTAAA

  15. Dicty_cDB: AFM362 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM362 (Link to dictyBase) - - - - AFM362P (Link to Original site) AFM362F 524 AFM...362Z 752 AFM362P 1256 - - Show AFM362 Library AF (Link to library) Clone ID AFM362 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM362P (Link to... Original site) Representative DNA sequence >AFM362 (AFM362Q) /CSM/AF/AFM3-C/AFM362Q.Seq.d/ TGGAATATTTTTTTTT

  16. Dicty_cDB: AFM425 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM425 (Link to dictyBase) - - - - AFM425P (Link to Original site) AFM425F 539 AFM...425Z 724 AFM425P 1243 - - Show AFM425 Library AF (Link to library) Clone ID AFM425 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM425P (Link to... Original site) Representative DNA sequence >AFM425 (AFM425Q) /CSM/AF/AFM4-B/AFM425Q.Seq.d/ AAAAAAATAATGATCA

  17. Dicty_cDB: AFM104 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM104 (Link to dictyBase) - - - - AFM104P (Link to Original site) AFM104F 547 AFM...104Z 579 AFM104P 1106 - - Show AFM104 Library AF (Link to library) Clone ID AFM104 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM104P (Link to... Original site) Representative DNA sequence >AFM104 (AFM104Q) /CSM/AF/AFM1-A/AFM104Q.Seq.d/ TTCAGCAACAACAAAA

  18. Dicty_cDB: AFM606 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM606 (Link to dictyBase) - - - - AFM606P (Link to Original site) AFM606F 607 AFM...606Z 742 AFM606P 1329 - - Show AFM606 Library AF (Link to library) Clone ID AFM606 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM606P (Link to... Original site) Representative DNA sequence >AFM606 (AFM606Q) /CSM/AF/AFM6-A/AFM606Q.Seq.d/ AAGTTTAGAATTAGAA

  19. Dicty_cDB: AFM609 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM609 (Link to dictyBase) - - - - AFM609P (Link to Original site) AFM609F 641 AFM...609Z 705 AFM609P 1326 - - Show AFM609 Library AF (Link to library) Clone ID AFM609 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM609P (Link to... Original site) Representative DNA sequence >AFM609 (AFM609Q) /CSM/AF/AFM6-A/AFM609Q.Seq.d/ CAGATGTAATACCAAC

  20. Dicty_cDB: AFM803 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM803 (Link to dictyBase) - - - - AFM803P (Link to Original site) AFM803F 608 AFM...803Z 750 AFM803P 1338 - - Show AFM803 Library AF (Link to library) Clone ID AFM803 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM803P (Link to... Original site) Representative DNA sequence >AFM803 (AFM803Q) /CSM/AF/AFM8-A/AFM803Q.Seq.d/ AATCTATTTTATTTTT

  1. Dicty_cDB: AFM537 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM537 (Link to dictyBase) - - - - AFM537P (Link to Original site) AFM537F 220 AFM...537Z 668 AFM537P 868 - - Show AFM537 Library AF (Link to library) Clone ID AFM537 (Link dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM537P (Link to ...Original site) Representative DNA sequence >AFM537 (AFM537Q) /CSM/AF/AFM5-B/AFM537Q.Seq.d/ ATTAAATTCCATCATTG

  2. Dicty_cDB: AFM426 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM426 (Link to dictyBase) - - - - AFM426P (Link to Original site) AFM426F 579 AFM...426Z 658 AFM426P 1217 - - Show AFM426 Library AF (Link to library) Clone ID AFM426 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM426P (Link to... Original site) Representative DNA sequence >AFM426 (AFM426Q) /CSM/AF/AFM4-B/AFM426Q.Seq.d/ GAAAAATAAATTTATT

  3. Dicty_cDB: AFM715 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM715 (Link to dictyBase) - - - - AFM715P (Link to Original site) AFM715F 169 AFM...715Z 265 AFM715P 414 - - Show AFM715 Library AF (Link to library) Clone ID AFM715 (Link dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM715P (Link to ...Original site) Representative DNA sequence >AFM715 (AFM715Q) /CSM/AF/AFM7-A/AFM715Q.Seq.d/ AATTTATTTTTTTTCAT

  4. Dicty_cDB: AFM659 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM659 (Link to dictyBase) - - - - AFM659P (Link to Original site) AFM659F 686 AFM...659Z 742 AFM659P 1408 - - Show AFM659 Library AF (Link to library) Clone ID AFM659 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM659P (Link to... Original site) Representative DNA sequence >AFM659 (AFM659Q) /CSM/AF/AFM6-C/AFM659Q.Seq.d/ GTTAAAAAGGAAGTGA

  5. Dicty_cDB: AFM134 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM134 (Link to dictyBase) - - - - AFM134P (Link to Original site) AFM134F 542 AFM...134Z 759 AFM134P 1281 - - Show AFM134 Library AF (Link to library) Clone ID AFM134 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM134P (Link to... Original site) Representative DNA sequence >AFM134 (AFM134Q) /CSM/AF/AFM1-B/AFM134Q.Seq.d/ AATTTTATTTTTAATC

  6. Dicty_cDB: AFM627 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM627 (Link to dictyBase) - - - - AFM627P (Link to Original site) AFM627F 484 AFM...627Z 523 AFM627P 987 - - Show AFM627 Library AF (Link to library) Clone ID AFM627 (Link dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM627P (Link to ...Original site) Representative DNA sequence >AFM627 (AFM627Q) /CSM/AF/AFM6-B/AFM627Q.Seq.d/ TNTGGNCAAGGTTGTAG

  7. Dicty_cDB: AFM194 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM194 (Link to dictyBase) - - - - AFM194P (Link to Original site) AFM194F 623 AFM...194Z 703 AFM194P 1306 - - Show AFM194 Library AF (Link to library) Clone ID AFM194 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM194P (Link to... Original site) Representative DNA sequence >AFM194 (AFM194Q) /CSM/AF/AFM1-D/AFM194Q.Seq.d/ ATTTTATAATCACTGT

  8. Dicty_cDB: AFM471 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM471 (Link to dictyBase) - - - - AFM471P (Link to Original site) AFM471F 537 AFM...471Z 694 AFM471P 1211 - - Show AFM471 Library AF (Link to library) Clone ID AFM471 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM471P (Link to... Original site) Representative DNA sequence >AFM471 (AFM471Q) /CSM/AF/AFM4-C/AFM471Q.Seq.d/ ATATAAAAAATGGCAT

  9. Dicty_cDB: AFM191 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM191 (Link to dictyBase) - - - - AFM191P (Link to Original site) AFM191F 623 AFM...191Z 747 AFM191P 1350 - - Show AFM191 Library AF (Link to library) Clone ID AFM191 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM191P (Link to... Original site) Representative DNA sequence >AFM191 (AFM191Q) /CSM/AF/AFM1-D/AFM191Q.Seq.d/ ATTTTCTATTTTCTTT

  10. Dicty_cDB: AFM536 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM536 (Link to dictyBase) - - - - AFM536P (Link to Original site) AFM536F 144 AFM...536Z 443 AFM536P 567 - - Show AFM536 Library AF (Link to library) Clone ID AFM536 (Link dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM536P (Link to ...Original site) Representative DNA sequence >AFM536 (AFM536Q) /CSM/AF/AFM5-B/AFM536Q.Seq.d/ ATTTATTTATCTGTTTA

  11. Dicty_cDB: AFM473 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM473 (Link to dictyBase) - - - - AFM473P (Link to Original site) AFM473F 580 AFM...473Z 725 AFM473P 1285 - - Show AFM473 Library AF (Link to library) Clone ID AFM473 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM473P (Link to... Original site) Representative DNA sequence >AFM473 (AFM473Q) /CSM/AF/AFM4-D/AFM473Q.Seq.d/ AATTTCATCATTTTCC

  12. Dicty_cDB: AFM825 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM825 (Link to dictyBase) - - - - AFM825P (Link to Original site) AFM825F 551 AFM...825Z 684 AFM825P 1215 - - Show AFM825 Library AF (Link to library) Clone ID AFM825 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM825P (Link to... Original site) Representative DNA sequence >AFM825 (AFM825Q) /CSM/AF/AFM8-B/AFM825Q.Seq.d/ AACTAAATTAAATAAA

  13. Dicty_cDB: AFM133 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM133 (Link to dictyBase) - - - - AFM133P (Link to Original site) AFM133F 638 AFM...133Z 647 AFM133P 1265 - - Show AFM133 Library AF (Link to library) Clone ID AFM133 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM133P (Link to... Original site) Representative DNA sequence >AFM133 (AFM133Q) /CSM/AF/AFM1-B/AFM133Q.Seq.d/ AAAACATCTCTATTTT

  14. Dicty_cDB: AFM794 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM794 (Link to dictyBase) - - - - AFM794P (Link to Original site) AFM794F 623 AFM...794Z 698 AFM794P 1301 - - Show AFM794 Library AF (Link to library) Clone ID AFM794 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM794P (Link to... Original site) Representative DNA sequence >AFM794 (AFM794Q) /CSM/AF/AFM7-D/AFM794Q.Seq.d/ TAATAATAATTATTAT

  15. Dicty_cDB: AFM166 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM166 (Link to dictyBase) - - - - AFM166P (Link to Original site) AFM166F 580 AFM...166Z 741 AFM166P 1301 - - Show AFM166 Library AF (Link to library) Clone ID AFM166 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM166P (Link to... Original site) Representative DNA sequence >AFM166 (AFM166Q) /CSM/AF/AFM1-C/AFM166Q.Seq.d/ ATCACACATAAAAAAT

  16. Dicty_cDB: AFM817 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM817 (Link to dictyBase) - - - - AFM817P (Link to Original site) AFM817F 138 AFM...817Z 521 AFM817P 639 - - Show AFM817 Library AF (Link to library) Clone ID AFM817 (Link dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM817P (Link to ...Original site) Representative DNA sequence >AFM817 (AFM817Q) /CSM/AF/AFM8-A/AFM817Q.Seq.d/ AATTATTTAGACCACAC

  17. Dicty_cDB: AFM558 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM558 (Link to dictyBase) - - - - AFM558P (Link to Original site) AFM558F 578 AFM...558Z 737 AFM558P 1295 - - Show AFM558 Library AF (Link to library) Clone ID AFM558 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM558P (Link to... Original site) Representative DNA sequence >AFM558 (AFM558Q) /CSM/AF/AFM5-C/AFM558Q.Seq.d/ GCATATACATATACAT

  18. Dicty_cDB: AFM474 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM474 (Link to dictyBase) - - - - AFM474P (Link to Original site) AFM474F 537 AFM...474Z 755 AFM474P 1272 - - Show AFM474 Library AF (Link to library) Clone ID AFM474 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM474P (Link to... Original site) Representative DNA sequence >AFM474 (AFM474Q) /CSM/AF/AFM4-D/AFM474Q.Seq.d/ CAACATGTTCAAAATT

  19. Dicty_cDB: AFM712 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM712 (Link to dictyBase) - - - - AFM712P (Link to Original site) AFM712F 557 AFM...712Z 696 AFM712P 1233 - - Show AFM712 Library AF (Link to library) Clone ID AFM712 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM712P (Link to... Original site) Representative DNA sequence >AFM712 (AFM712Q) /CSM/AF/AFM7-A/AFM712Q.Seq.d/ ATATCAGCAGCTAAAA

  20. Dicty_cDB: AFM520 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM520 (Link to dictyBase) - - - - AFM520P (Link to Original site) AFM520F 612 AFM...520Z 731 AFM520P 1323 - - Show AFM520 Library AF (Link to library) Clone ID AFM520 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM520P (Link to... Original site) Representative DNA sequence >AFM520 (AFM520Q) /CSM/AF/AFM5-A/AFM520Q.Seq.d/ ATTCATTCAATTTTGT

  1. Dicty_cDB: AFM843 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM843 (Link to dictyBase) - - - - AFM843P (Link to Original site) AFM843F 553 AFM...843Z 735 AFM843P 1268 - - Show AFM843 Library AF (Link to library) Clone ID AFM843 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM843P (Link to... Original site) Representative DNA sequence >AFM843 (AFM843Q) /CSM/AF/AFM8-B/AFM843Q.Seq.d/ ATTAAACAACTCAAAA

  2. Dicty_cDB: AFM240 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM240 (Link to dictyBase) - - - - AFM240P (Link to Original site) AFM240F 638 AFM...240Z 291 AFM240P 909 - - Show AFM240 Library AF (Link to library) Clone ID AFM240 (Link dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM240P (Link to ...Original site) Representative DNA sequence >AFM240 (AFM240Q) /CSM/AF/AFM2-B/AFM240Q.Seq.d/ TATTAAAAAAATGTACT

  3. Dicty_cDB: AFM855 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM855 (Link to dictyBase) - - - - AFM855P (Link to Original site) AFM855F 541 AFM...855Z 649 AFM855P 1170 - - Show AFM855 Library AF (Link to library) Clone ID AFM855 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM855P (Link to... Original site) Representative DNA sequence >AFM855 (AFM855Q) /CSM/AF/AFM8-C/AFM855Q.Seq.d/ ANATTAAAAGTTAACT

  4. Dicty_cDB: AFM418 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM418 (Link to dictyBase) - - - - AFM418P (Link to Original site) AFM418F 125 AFM...418Z 150 AFM418P 255 - - Show AFM418 Library AF (Link to library) Clone ID AFM418 (Link dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM418P (Link to ...Original site) Representative DNA sequence >AFM418 (AFM418Q) /CSM/AF/AFM4-A/AFM418Q.Seq.d/ ACACACATACTTTCATT

  5. Dicty_cDB: AFM427 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM427 (Link to dictyBase) - - - - AFM427P (Link to Original site) AFM427F 553 AFM...427Z 609 AFM427P 1142 - - Show AFM427 Library AF (Link to library) Clone ID AFM427 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM427P (Link to... Original site) Representative DNA sequence >AFM427 (AFM427Q) /CSM/AF/AFM4-B/AFM427Q.Seq.d/ ATTCATTCAATTTTGT

  6. Dicty_cDB: AFM746 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM746 (Link to dictyBase) - - - - AFM746P (Link to Original site) AFM746F 621 AFM...746Z 733 AFM746P 1334 - - Show AFM746 Library AF (Link to library) Clone ID AFM746 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM746P (Link to... Original site) Representative DNA sequence >AFM746 (AFM746Q) /CSM/AF/AFM7-B/AFM746Q.Seq.d/ ATTTACAGTTACTGAA

  7. Dicty_cDB: AFM174 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM174 (Link to dictyBase) - - - - AFM174P (Link to Original site) AFM174F 544 AFM...174Z 566 AFM174P 1090 - - Show AFM174 Library AF (Link to library) Clone ID AFM174 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM174P (Link to... Original site) Representative DNA sequence >AFM174 (AFM174Q) /CSM/AF/AFM1-D/AFM174Q.Seq.d/ ATTCAATTTTGTAATT

  8. Dicty_cDB: AFM386 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM386 (Link to dictyBase) - - - - AFM386P (Link to Original site) AFM386F 618 AFM...386Z 757 AFM386P 1355 - - Show AFM386 Library AF (Link to library) Clone ID AFM386 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM386P (Link to... Original site) Representative DNA sequence >AFM386 (AFM386Q) /CSM/AF/AFM3-D/AFM386Q.Seq.d/ AGAACTGTTACAGCAG

  9. Dicty_cDB: AFM106 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM106 (Link to dictyBase) - - - - AFM106P (Link to Original site) AFM106F 527 AFM...106Z 527 AFM106P 1034 - - Show AFM106 Library AF (Link to library) Clone ID AFM106 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM106P (Link to... Original site) Representative DNA sequence >AFM106 (AFM106Q) /CSM/AF/AFM1-A/AFM106Q.Seq.d/ AATTTTTTTTCTTTTC

  10. Dicty_cDB: AFM862 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM862 (Link to dictyBase) - - - - AFM862P (Link to Original site) AFM862F 837 AFM...862Z 612 AFM862P 1429 - - Show AFM862 Library AF (Link to library) Clone ID AFM862 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM862P (Link to... Original site) Representative DNA sequence >AFM862 (AFM862Q) /CSM/AF/AFM8-C/AFM862Q.Seq.d/ AAGGTAGTGACAACAT

  11. Dicty_cDB: AFM802 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM802 (Link to dictyBase) - - - - AFM802P (Link to Original site) AFM802F 128 AFM...802Z 117 AFM802P 225 - - Show AFM802 Library AF (Link to library) Clone ID AFM802 (Link dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM802P (Link to ...Original site) Representative DNA sequence >AFM802 (AFM802Q) /CSM/AF/AFM8-A/AFM802Q.Seq.d/ ATAAATATAAATAATAA

  12. Dicty_cDB: AFM325 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM325 (Link to dictyBase) - - - - AFM325P (Link to Original site) AFM325F 457 AFM...325Z 563 AFM325P 1000 - - Show AFM325 Library AF (Link to library) Clone ID AFM325 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM325P (Link to... Original site) Representative DNA sequence >AFM325 (AFM325Q) /CSM/AF/AFM3-B/AFM325Q.Seq.d/ CAAAAAGTTTTTTCAC

  13. Dicty_cDB: AFM771 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM771 (Link to dictyBase) - - - - AFM771P (Link to Original site) AFM771F 695 AFM...771Z 862 AFM771P 1537 - - Show AFM771 Library AF (Link to library) Clone ID AFM771 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM771P (Link to... Original site) Representative DNA sequence >AFM771 (AFM771Q) /CSM/AF/AFM7-C/AFM771Q.Seq.d/ GAGGGCAACGGGATAT

  14. Dicty_cDB: AFM585 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM585 (Link to dictyBase) - - - - AFM585P (Link to Original site) AFM585F 600 AFM...585Z 768 AFM585P 1348 - - Show AFM585 Library AF (Link to library) Clone ID AFM585 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM585P (Link to... Original site) Representative DNA sequence >AFM585 (AFM585Q) /CSM/AF/AFM5-D/AFM585Q.Seq.d/ AATTTTGTAATTATAA

  15. Dicty_cDB: AFM453 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM453 (Link to dictyBase) - - - - AFM453P (Link to Original site) AFM453F 422 AFM...453Z 720 AFM453P 1122 - - Show AFM453 Library AF (Link to library) Clone ID AFM453 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM453P (Link to... Original site) Representative DNA sequence >AFM453 (AFM453Q) /CSM/AF/AFM4-C/AFM453Q.Seq.d/ AAATTAAAAAAATAAA

  16. Dicty_cDB: AFM578 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM578 (Link to dictyBase) - - - - AFM578P (Link to Original site) AFM578F 727 AFM...578Z 447 AFM578P 1154 - - Show AFM578 Library AF (Link to library) Clone ID AFM578 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM578P (Link to... Original site) Representative DNA sequence >AFM578 (AFM578Q) /CSM/AF/AFM5-D/AFM578Q.Seq.d/ ATCGCCTCACTTTTTA

  17. Dicty_cDB: AFM103 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM103 (Link to dictyBase) - - - - AFM103P (Link to Original site) AFM103F 125 AFM...103Z 666 AFM103P 771 - - Show AFM103 Library AF (Link to library) Clone ID AFM103 (Link dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM103P (Link to ...Original site) Representative DNA sequence >AFM103 (AFM103Q) /CSM/AF/AFM1-A/AFM103Q.Seq.d/ AATATTTTAGTTTTAGG

  18. Dicty_cDB: AFM220 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM220 (Link to dictyBase) - - - - AFM220P (Link to Original site) AFM220F 634 AFM...220Z 697 AFM220P 1311 - - Show AFM220 Library AF (Link to library) Clone ID AFM220 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM220P (Link to... Original site) Representative DNA sequence >AFM220 (AFM220Q) /CSM/AF/AFM2-A/AFM220Q.Seq.d/ ATTATTTTTTATTTTA

  19. Dicty_cDB: AFM856 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM856 (Link to dictyBase) - - - - AFM856P (Link to Original site) AFM856F 505 AFM...856Z 554 AFM856P 1039 - - Show AFM856 Library AF (Link to library) Clone ID AFM856 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM856P (Link to... Original site) Representative DNA sequence >AFM856 (AFM856Q) /CSM/AF/AFM8-C/AFM856Q.Seq.d/ ATTCAATTTTGTAATT

  20. Dicty_cDB: AFM472 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM472 (Link to dictyBase) - - - - AFM472P (Link to Original site) AFM472F 693 AFM...472Z 695 AFM472P 1368 - - Show AFM472 Library AF (Link to library) Clone ID AFM472 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM472P (Link to... Original site) Representative DNA sequence >AFM472 (AFM472Q) /CSM/AF/AFM4-C/AFM472Q.Seq.d/ ATTTCAAGTTTAACTA

  1. Dicty_cDB: AFM691 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM691 (Link to dictyBase) - - - - AFM691P (Link to Original site) AFM691F 606 AFM...691Z 709 AFM691P 1295 - - Show AFM691 Library AF (Link to library) Clone ID AFM691 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM691P (Link to... Original site) Representative DNA sequence >AFM691 (AFM691Q) /CSM/AF/AFM6-D/AFM691Q.Seq.d/ AATAATAATAATAATA

  2. Dicty_cDB: AFM686 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM686 (Link to dictyBase) - - - - AFM686P (Link to Original site) AFM686F 655 AFM...686Z 688 AFM686P 1323 - - Show AFM686 Library AF (Link to library) Clone ID AFM686 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM686P (Link to... Original site) Representative DNA sequence >AFM686 (AFM686Q) /CSM/AF/AFM6-D/AFM686Q.Seq.d/ ACACCTTATTTATTAT

  3. Dicty_cDB: AFM610 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM610 (Link to dictyBase) - - - - AFM610P (Link to Original site) AFM610F 134 AFM...610Z 234 AFM610P 348 - - Show AFM610 Library AF (Link to library) Clone ID AFM610 (Link dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM610P (Link to ...Original site) Representative DNA sequence >AFM610 (AFM610Q) /CSM/AF/AFM6-A/AFM610Q.Seq.d/ ATTGTAGTATTTTGTTC

  4. Dicty_cDB: AFM881 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM881 (Link to dictyBase) - - - - AFM881P (Link to Original site) AFM881F 604 AFM...881Z 557 AFM881P 1141 - - Show AFM881 Library AF (Link to library) Clone ID AFM881 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM881P (Link to... Original site) Representative DNA sequence >AFM881 (AFM881Q) /CSM/AF/AFM8-D/AFM881Q.Seq.d/ ATTTTCTCCATCATCA

  5. Dicty_cDB: AFM452 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM452 (Link to dictyBase) - - - - AFM452P (Link to Original site) AFM452F 126 AFM...452Z 412 AFM452P 518 - - Show AFM452 Library AF (Link to library) Clone ID AFM452 (Link dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM452P (Link to ...Original site) Representative DNA sequence >AFM452 (AFM452Q) /CSM/AF/AFM4-C/AFM452Q.Seq.d/ AATAAACAATCAAATAA

  6. Dicty_cDB: AFM666 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM666 (Link to dictyBase) - - - - AFM666P (Link to Original site) AFM666F 624 AFM...666Z 657 AFM666P 1261 - - Show AFM666 Library AF (Link to library) Clone ID AFM666 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM666P (Link to... Original site) Representative DNA sequence >AFM666 (AFM666Q) /CSM/AF/AFM6-C/AFM666Q.Seq.d/ ATAAAATATTTTAATA

  7. Dicty_cDB: AFM772 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM772 (Link to dictyBase) - - - - AFM772P (Link to Original site) AFM772F 609 AFM...772Z 754 AFM772P 1343 - - Show AFM772 Library AF (Link to library) Clone ID AFM772 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM772P (Link to... Original site) Representative DNA sequence >AFM772 (AFM772Q) /CSM/AF/AFM7-C/AFM772Q.Seq.d/ ATTTAATAATACACAT

  8. Dicty_cDB: AFM747 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM747 (Link to dictyBase) - - - - AFM747P (Link to Original site) AFM747F 585 AFM...747Z 743 AFM747P 1308 - - Show AFM747 Library AF (Link to library) Clone ID AFM747 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM747P (Link to... Original site) Representative DNA sequence >AFM747 (AFM747Q) /CSM/AF/AFM7-B/AFM747Q.Seq.d/ ATTTAGGTCCTATATT

  9. Dicty_cDB: AFM643 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM643 (Link to dictyBase) - - - - AFM643P (Link to Original site) AFM643F 581 AFM...643Z 599 AFM643P 1160 - - Show AFM643 Library AF (Link to library) Clone ID AFM643 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID AFM643P (Link to... Original site) Representative DNA sequence >AFM643 (AFM643Q) /CSM/AF/AFM6-B/AFM643Q.Seq.d/ ATAGTAATTATTTTTT

  10. Immobilizing live Escherichia coli for AFM studies of surface dynamics

    Energy Technology Data Exchange (ETDEWEB)

    Lonergan, N.E.; Britt, L.D.; Sullivan, C.J., E-mail:


    Atomic force microscopy (AFM) is a probe-based technique that permits high resolution imaging of live bacterial cells. However, stably immobilizing cells to withstand the probe-based lateral forces remains an obstacle in AFM mediated studies, especially those of live, rod shaped bacteria in nutrient media. Consequently, AFM has been under-utilized in the research of bacterial surface dynamics. The aim of the current study was to immobilize a less adherent Escherichia coli strain in a method that both facilitates AFM imaging in nutrient broth and preserves overall cell viability. Immobilization reagents and buffers were systematically evaluated and the cell membrane integrity was monitored in all sample preparations. As expected, the biocompatible gelatin coated surfaces facilitated stable cell attachment in lower ionic strength buffers, yet poorly immobilized cells in higher ionic strength buffers. In comparison, poly-L-lysine surfaces bound cells in both low and high ionic strength buffers. The benefit of the poly-L-lysine binding capacity was offset by the compromised membrane integrity exhibited by cells on poly-L-lysine surfaces. However, the addition of divalent cations and glucose to the immobilization buffer was found to mitigate this unfavorable effect. Ultimately, immobilization of E. coli cells on poly-L-lysine surfaces in a lower ionic strength buffer supplemented with Mg{sup 2+} and Ca{sup 2+} was determined to provide optimal cell attachment without compromising the overall cell viability. Cells immobilized in this method were stably imaged in media through multiple division cycles. Furthermore, permeability assays indicated that E. coli cells recover from the hypoosmotic stress caused by immobilization in low ionic strength buffers. Taken together, this data suggests that stable immobilization of viable cells on poly-L-lysine surfaces can be accomplished in lower ionic strength buffers that are supplemented with divalent cations for membrane

  11. A Low Cost Metal-Free Vascular Access Mini-Port for Artifact Free Imaging and Repeated Injections in Mice.

    Directory of Open Access Journals (Sweden)

    Teresa Fiebig

    Full Text Available Small injection ports for mice are increasingly used for drug testing or when administering contrast agents. Commercially available mini-ports are expensive single-use items that cause imaging-artifacts. We developed and tested an artifact-free, low-cost, vascular access mini-port (VAMP for mice.Leakage testing of the VAMP was conducted with high speed bolus injections of different contrast agents. VAMP-induced artifacts were assessed using a micro-CT and a small animal MRI (9.4T scanner ex vivo. Repeated contrast administration was performed in vivo.With the VAMP there was no evidence of leakage with repeated punctures, high speed bolus contrast injections, and drawing of blood samples. In contrast to the tested commercially available ports, the VAMP did not cause artifacts with MRI or CT imaging.The VAMP is an alternative to commercially available mini-ports and has useful applications in animal research involving imaging procedures and contrast agent testing.

  12. Pitfalls in Suspected Acute Aortic Syndrome: Impact of Appropriate and If Required Repeated Imaging

    Directory of Open Access Journals (Sweden)

    C. Meier


    Full Text Available The incidence of acute aortic syndrome is low, but the spontaneous course is often life-threatening. Adequate ECG-gated imaging is fundamental within the diagnostic workup. We here report a case of a 53-year-old man presenting with atypical chest pain, slight increase of D dimers at admission, and extended diameter of the ascending aorta accompanied by mild aortic regurgitation. Interpretation of an initial contrast-enhanced computed tomography was false negative due to inadequate gating and motion artifacts, thereby judging a tiny contrast signal in the left anterior quadrant of the ascending aorta as a pseudointimal flap. By hazard, cardiac magnetic resonance imaging demonstrated an ulcer-like lesion superior to the aortic root, leading to aortic surgery at the last moment. As sensitivity of imaging is not 100%, this example underlines that second imaging studies might be necessary if the first imaging is negative, but the clinical suspicion still remains high.

  13. Repeatability of dose painting by numbers treatment planning in prostate cancer radiotherapy based on multiparametric magnetic resonance imaging (United States)

    van Schie, Marcel A.; Steenbergen, Peter; Viet Dinh, Cuong; Ghobadi, Ghazaleh; van Houdt, Petra J.; Pos, Floris J.; Heijmink, Stijn W. T. J. P.; van der Poel, Henk G.; Renisch, Steffen; Vik, Torbjørn; van der Heide, Uulke A.


    Dose painting by numbers (DPBN) refers to a voxel-wise prescription of radiation dose modelled from functional image characteristics, in contrast to dose painting by contours which requires delineations to define the target for dose escalation. The direct relation between functional imaging characteristics and DPBN implies that random variations in images may propagate into the dose distribution. The stability of MR-only prostate cancer treatment planning based on DPBN with respect to these variations is as yet unknown. We conducted a test-retest study to investigate the stability of DPBN for prostate cancer in a semi-automated MR-only treatment planning workflow. Twelve patients received a multiparametric MRI on two separate days prior to prostatectomy. The tumor probability (TP) within the prostate was derived from image features with a logistic regression model. Dose mapping functions were applied to acquire a DPBN prescription map that served to generate an intensity modulated radiation therapy (IMRT) treatment plan. Dose calculations were done on a pseudo-CT derived from the MRI. The TP and DPBN map and the IMRT dose distribution were compared between both MRI sessions, using the intraclass correlation coefficient (ICC) to quantify repeatability of the planning pipeline. The quality of each treatment plan was measured with a quality factor (QF). Median ICC values for the TP and DPBN map and the IMRT dose distribution were 0.82, 0.82 and 0.88, respectively, for linear dose mapping and 0.82, 0.84 and 0.94 for square root dose mapping. A median QF of 3.4% was found among all treatment plans. We demonstrated the stability of DPBN radiotherapy treatment planning in prostate cancer, with excellent overall repeatability and acceptable treatment plan quality. Using validated tumor probability modelling and simple dose mapping techniques it was shown that despite day-to-day variations in imaging data still consistent treatment plans were obtained.

  14. The effect of image quality, repeated study, and assessment method on anatomy learning. (United States)

    Fenesi, Barbara; Mackinnon, Chelsea; Cheng, Lucia; Kim, Joseph A; Wainman, Bruce C


    The use of two-dimensional (2D) images is consistently used to prepare anatomy students for handling real specimen. This study examined whether the quality of 2D images is a critical component in anatomy learning. The visual clarity and consistency of 2D anatomical images was systematically manipulated to produce low-quality and high-quality images of the human hand and human eye. On day 0, participants learned about each anatomical specimen from paper booklets using either low-quality or high-quality images, and then completed a comprehension test using either 2D images or three-dimensional (3D) cadaveric specimens. On day 1, participants relearned each booklet, and on day 2 participants completed a final comprehension test using either 2D images or 3D cadaveric specimens. The effect of image quality on learning varied according to anatomical content, with high-quality images having a greater effect on improving learning of hand anatomy than eye anatomy (high-quality vs. low-quality for hand anatomy P = 0.018; high-quality vs. low-quality for eye anatomy P = 0.247). Also, the benefit of high-quality images on hand anatomy learning was restricted to performance on short-answer (SA) questions immediately after learning (high-quality vs. low-quality on SA questions P = 0.018), but did not apply to performance on multiple-choice (MC) questions (high-quality vs. low-quality on MC questions P = 0.109) or after participants had an additional learning opportunity (24 hours later) with anatomy content (high vs. low on SA questions P = 0.643). This study underscores the limited impact of image quality on anatomy learning, and questions whether investment in enhancing image quality of learning aids significantly promotes knowledge development. Anat Sci Educ 10: 249-261. © 2016 American Association of Anatomists. © 2016 American Association of Anatomists.

  15. Repeatability and Reproducibility of Quantitative Corneal Shape Analysis after Orthokeratology Treatment Using Image-Pro Plus Software (United States)

    Mei, Ying; Tang, Zhiping


    Purpose. To evaluate the repeatability and reproducibility of quantitative analysis of the morphological corneal changes after orthokeratology treatment using “Image-Pro Plus 6.0” software (IPP). Methods. Three sets of measurements were obtained: two sets by examiner 1 with 5 days apart and one set by examiner 2 on the same day. Parameters of the eccentric distance, eccentric angle, area, and roundness of the corneal treatment zone were measured using IPP. The intraclass correlation coefficient (ICC) and repetitive coefficient (COR) were used to calculate the repeatability and reproducibility of these three sets of measurements. Results. ICC analysis suggested “excellent” reliability of more than 0.885 for all variables, and COR values were less than 10% for all variables within the same examiner. ICC analysis suggested “excellent” reliability for all variables of more than 0.90, and COR values were less than 10% for all variables between different examiners. All extreme values of the eccentric distance and area of the treatment zone pointed to the same material number in three sets of measurements. Conclusions. IPP could be used to acquire the exact data of the characteristic morphological corneal changes after orthokeratology treatment with good repeatability and reproducibility. This trial is registered with trial registration number: ChiCTR-IPR-14005505.

  16. Repeatability and Reproducibility of Quantitative Corneal Shape Analysis after Orthokeratology Treatment Using Image-Pro Plus Software

    Directory of Open Access Journals (Sweden)

    Ying Mei


    Full Text Available Purpose. To evaluate the repeatability and reproducibility of quantitative analysis of the morphological corneal changes after orthokeratology treatment using “Image-Pro Plus 6.0” software (IPP. Methods. Three sets of measurements were obtained: two sets by examiner 1 with 5 days apart and one set by examiner 2 on the same day. Parameters of the eccentric distance, eccentric angle, area, and roundness of the corneal treatment zone were measured using IPP. The intraclass correlation coefficient (ICC and repetitive coefficient (COR were used to calculate the repeatability and reproducibility of these three sets of measurements. Results. ICC analysis suggested “excellent” reliability of more than 0.885 for all variables, and COR values were less than 10% for all variables within the same examiner. ICC analysis suggested “excellent” reliability for all variables of more than 0.90, and COR values were less than 10% for all variables between different examiners. All extreme values of the eccentric distance and area of the treatment zone pointed to the same material number in three sets of measurements. Conclusions. IPP could be used to acquire the exact data of the characteristic morphological corneal changes after orthokeratology treatment with good repeatability and reproducibility. This trial is registered with trial registration number: ChiCTR-IPR-14005505.

  17. AFM studies of nonspecific binding of enzyme on DNA

    Institute of Scientific and Technical Information of China (English)

    张益; 谢恒月; 等


    Atomic force microscope(AFM) is used to study restriction endonuclease digestion of plasmid DNA,pWRr plasmid DNA is digested by Hind Ⅲ,and the specific and the nonspecific binding of the restriction endonuclease are imaged,and the biological function of the enzyme binding to nonspecific sites is discussed.In addition,it is found that nonspecific binding of Hind ǚ could not induce the DNA characteristic bending angle.

  18. Investigation of biopolymer networks by means of AFM (United States)

    Keresztes, Z.; Rigó, T.; Telegdi, J.; Kálmán, E.

    Natural hydrogel alginate was investigated by means of atomic force microscopy (AFM) to gain microscale information on the morphological and rheological properties of the biopolymer network cross-linked by various cations. Local rheological properties of the gels measured by force spectroscopy gave correlation between increasing ion selectivity and increasing polymer elasticity. Adhesive forces acting between the surface of the gel and the probe, and also the intrinsic rheological properties of bulk polymers affect the microscopical image formation.

  19. In situ, controlled and reproducible attachment of carbon nanotubes onto conductive AFM tips

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Jianxun [International Center for Materials Nanoarchitectonics (MANA), National Institute for Materials Science, 1-1 Namiki, Tsukuba, Ibaraki 305-0044 (Japan); Chinese Academy of Science Key Laboratory for Biomedical Effects of Nanomaterials and Nanosafty, National Center for Nanoscience and Technology of China, No. 11, Bei yi tiao, Zhong Guan Cun, Beijing 100190 (China); Shingaya, Yoshitaka [International Center for Materials Nanoarchitectonics (MANA), National Institute for Materials Science, 1-1 Namiki, Tsukuba, Ibaraki 305-0044 (Japan); Zhao, Yuliang [Chinese Academy of Science Key Laboratory for Biomedical Effects of Nanomaterials and Nanosafty, National Center for Nanoscience and Technology of China, No. 11, Bei yi tiao, Zhong Guan Cun, Beijing 100190 (China); Nakayama, Tomonobu, E-mail: [International Center for Materials Nanoarchitectonics (MANA), National Institute for Materials Science, 1-1 Namiki, Tsukuba, Ibaraki 305-0044 (Japan)


    Graphical abstract: - Highlights: • An effective and controllable method was developed to fabricate CNT AFM probes in-situ. • Individual carbon nanotube was assembled. • The alignment angle and protruding length of as-produced CNT probes are excellent. - Abstract: Owing to the small diameter, wear resistance, high aspect ratio of their cylindrical structure and outstanding young's modulus, carbon nanotubes are regarded as excellent probes for atomic force microscope (AFM) imaging and various applications. To take the best out of carbon nanotubes’ potentials as AFM probes, we present a facile and reliable method to attach a single carbon nanotube onto an AFM probe covered with conductive Au layer. The method involves the following steps: positioning the AFM probe exactly onto a designated multiple-walled carbon nanotube growing vertically on a conductive substrate, establishing physical contact of the probe apex to the carbon nanotube with an appropriate force, and finally flowing a DC current of typically 100 μA from the AFM probe to the substrate through the carbon nanotube. The current flow results in the fracture and attachment of the carbon nanotube onto the AFM probe. Our method is similar to that reported in previous studies to cut and assemble carbon nanotubes by flowing current under SEM, but by our method we succeed to achieve superior control of protruding length and reproducible attachment angle of the carbon nanotube in one step. Moreover, it is now possible to reliably prepare carbon nanotube probes in-situ during AFM experiments.

  20. Nano-Wilhelmy investigation of dynamic wetting properties of AFM tips through tip-nanobubble interaction. (United States)

    Wang, Yuliang; Wang, Huimin; Bi, Shusheng; Guo, Bin


    The dynamic wetting properties of atomic force microscopy (AFM) tips are of much concern in many AFM-related measurement, fabrication, and manipulation applications. In this study, the wetting properties of silicon and silicon nitride AFM tips are investigated through dynamic contact angle measurement using a nano-Wilhelmy balance based method. This is done by capillary force measurement during extension and retraction motion of AFM tips relative to interfacial nanobubbles. The working principle of the proposed method and mathematic models for dynamic contact angle measurement are presented. Geometric models of AFM tips were constructed using scanning electronic microscopy (SEM) images taken from different view directions. The detailed process of tip-nanobubble interaction was investigated using force-distance curves of AFM on nanobubbles. Several parameters including nanobubble height, adhesion and capillary force between tip and nanobubbles are extracted. The variation of these parameters was studied over nanobubble surfaces. The dynamic contact angles of the AFM tips were calculated from the capillary force measurements. The proposed method provides direct measurement of dynamic contact angles for AFM tips and can also be taken as a general approach for nanoscale dynamic wetting property investigation.

  1. Restoration of defects generated on the DAST crystal surface by scanning with AFM cantilever tip

    Energy Technology Data Exchange (ETDEWEB)

    Nanjo, Hiroshi; Komatsu, Kyoji; Suzuki, Toshishige M


    We have developed a simple method to restore the defects and holes generated on the (001) surface of 4-(4-Dimethylaminostyryl)-1-methylpyridinium tosylate (DAST) crystal by scanning the crystal with a cantilever tip of an atomic force microscope (AFM). The change in the surface morphology upon repeated scan process was followed by AFM observation at appropriate intervals. By adjustment of applied force on the cantilever, molecular-scale flatness on the crystal surface was restored. We proposed the following mechanism for the restoration: AFM tip carries the small fragment of DAST near step-edge and fills the holes or defects on the surface. After several times scanning of the AFM tip with the fragment, the defect-free surface was restored on the DAST crystal by filling the fragment in satisfying the ionic interaction around the holes.

  2. The prodromal phase of leucine-rich repeat kinase 2-associated Parkinson disease: Clinical and imaging Studies. (United States)

    Pont-Sunyer, Claustre; Tolosa, Eduardo; Caspell-Garcia, Chelsea; Coffey, Christopher; Alcalay, Roy N; Chan, Piu; Duda, John E; Facheris, Maurizio; Fernández-Santiago, Rubén; Marek, Kenneth; Lomeña, Francisco; Marras, Connie; Mondragon, Elisabet; Saunders-Pullman, Rachel; Waro, Bjorg


    Asymptomatic, nonmanifesting carriers of leucine-rich repeat kinase 2 mutations are at increased risk of developing PD. Clinical and neuroimaging features may be associated with gene carriage and/or may demarcate individuals at greater risk for phenoconversion to PD. To investigate clinical and dopamine transporter single-photon emission computed tomography imaging characteristics of leucine-rich repeat kinase 2 asymptomatic carriers. A total of 342 carriers' and 259 noncarriers' relatives of G2019S leucine-rich repeat kinase 2/PD patients and 39 carriers' and 31 noncarriers' relatives of R1441G leucine-rich repeat kinase 2/PD patients were evaluated. Motor and nonmotor symptoms were assessed using specific scales and questionnaires. Neuroimaging quantitative data were obtained in 81 carriers and compared with 41 noncarriers. G2019S carriers scored higher in motor scores and had lower radioligand uptake compared to noncarriers, but no differences in nonmotor symptoms scores were observed. R1441G carriers scored higher in motor scores, had lower radioligand uptake, and had higher scores in depression, dysautonomia, and Rapid Eye Movements Sleep Behavior Disorder Screening Questionnaire scores, but had better cognition scores than noncarriers. Among G2019S carriers, a group with "mild motor signs" was identified, and was significantly older, with worse olfaction and lower radioligand uptake. G2019S and R1441G carriers differ from their noncarriers' relatives in higher motor scores and slightly lower radioligand uptake. Nonmotor symptoms were mild, and different nonmotor profiles were observed in G2019S carriers compared to R1441G carriers. A group of G2019S carriers with known prodromal features was identified. Longitudinal studies are required to determine whether such individuals are at short-term risk of developing overt parkinsonism. © 2017 International Parkinson and Movement Disorder Society. © 2017 International Parkinson and Movement Disorder Society.

  3. [Decrease in N170 evoked potential component latency during repeated presentation of face images]. (United States)

    Verkhliutov, V M; Ushakov, V L; Strelets, V B


    The 15 healthy volunteers EEG from 28 channels was recorded during the presentation of visual stimuli in the form of face and building images. The stimuli were presented in two series. The first series consisted of 60 face and 60 building images presented in random order. The second series consisted of 30 face and 30 building images. The second series began 1.5-2 min after the end of the first ore. No instruction was given to the participants. P1, N170 and VPP EP components were identified for both stimuli categories. These components were located in the medial parietal area (Brodmann area 40). P1 and N170 components were recorded in the superior temporal fissure (Brodmann area 21, STS region), the first component had the latency 120 ms, the second one--155 ms. VPP was recorded with the latency 190 ms (Brodmann area 19). Dynamic mapping of EP components with the latency from 97 to 242 ms revealed the removal of positive maximums from occipital to frontal areas through temporal ones and their subsequent returning to occipital areas through the central ones. During the comparison of EP components to face and building images the amplitude differences were revealed in the following areas: P1--in frontal, central and anterior temporal areas, N170--in frontal, central, temporal and parietal areas, VPP--in all areas. It was also revealed that N170 latency was 12 ms shorter for face than for building images. It was proposed that the above mentioned N170 latency decrease for face in comparison with building images is connected with the different space location of the fusiform area responsible for face and building images recognition. Priming--the effect that is revealed during the repetitive face images presentation is interpreted as the manifestation of functional heterogeneity of the fusiform area responsible for the face images recognition. The hypothesis is put forward that the parts of extrastriate cortex which are located closer to the central retinotopical

  4. An AFM Observation on Fossil Cytoplasm

    Institute of Scientific and Technical Information of China (English)

    WANG Xin; YU Junping; FANG Xiaohong


    Fossil cytoplasm is a new research topic of interest in paleobotany. Atomic force microscope (AFM) is a new technology applied widely in physics and biology; however, it is rarely used in paleontology. Here we applied AFM for the first time to study fossil cytoplasm. The results indicate that the fossil cytoplasm is heterogeneous and full of ultrastructures, just like extant cytoplasm, and that the application of AFM, especially in combination with other techniques, can reveal the subcellular details of fossil plants with more confidence.

  5. Repeated exposure of the developing rat brain to magnetic resonance imaging did not affect neurogenesis, cell death or memory function

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Changlian [Center for Brain Repair and Rehabilitation, University of Gothenburg (Sweden); Department of Pediatrics, The Third Affiliated Hospital, Zhengzhou University (China); Gao, Jianfeng [Center for Brain Repair and Rehabilitation, University of Gothenburg (Sweden); Department of Pediatrics, The Third Affiliated Hospital, Zhengzhou University (China); Department of Physiology, Henan Traditional Medical University (China); Li, Qian; Huang, Zhiheng; Zhang, Yu; Li, Hongfu [Center for Brain Repair and Rehabilitation, University of Gothenburg (Sweden); Department of Pediatrics, The Third Affiliated Hospital, Zhengzhou University (China); Kuhn, Hans-Georg [Center for Brain Repair and Rehabilitation, University of Gothenburg (Sweden); Blomgren, Klas, E-mail: [Center for Brain Repair and Rehabilitation, University of Gothenburg (Sweden); Department of Pediatric Oncology, The Queen Silvia Children' s Hospital, Gothenburg (Sweden)


    Research highlights: {yields} The effect of MRI on the developing brain is a matter of debate. {yields} Repeated exposure to MRI did not affect neurogenesis. {yields} Memory function was not affected by repeated MRI during development. {yields} Neither late gestation nor young postnatal brains were affected by MRI. {yields} Repeated MRI did not cause cell death in the neurogenic region of the hippocampus. -- Abstract: The effect of magnetic fields on the brain is a matter of debate. The objective of this study was to investigate whether repeated exposure to strong magnetic fields, such as during magnetic resonance imaging (MRI), could elicit changes in the developing rat brain. Embryonic day 15 (E15) and postnatal day 14 (P14) rats were exposed to MRI using a 7.05 T MR system. The animals were anesthetized and exposed for 35 min per day for 4 successive days. Control animals were anesthetized but no MRI was performed. Body temperature was maintained at 37 {sup o}C. BrdU was injected after each session (50 mg/kg). One month later, cell proliferation, neurogenesis and astrogenesis in the dentate gyrus were evaluated, revealing no effects of MRI, neither in the E15, nor in the P14 group. DNA damage in the dentate gyrus in the P14 group was evaluated on P18, 1 day after the last session, using TUNEL staining. There was no difference in the number of TUNEL-positive cells after MRI compared with controls, neither in mature neurons, nor in newborn progenitors (BrdU/TUNEL double-labeled cells). Novel object recognition was performed to assess memory function 1 month after MRI. There was no difference in the recognition index observed after MRI compared with the control rats, neither for the E15, nor for the P14 group. In conclusion, repeated exposure to MRI did not appear to affect neurogenesis, cell death or memory function in rats, neither in late gestation (E15-E18) nor in young postnatal (P14-P17) rats.

  6. Tipping solutions: emerging 3D nano-fabrication/ -imaging technologies


    Seniutinas Gediminas; Balčytis Armandas; Reklaitis Ignas; Chen Feng; Davis Jeffrey; David Christian; Juodkazis Saulius


    The evolution of optical microscopy from an imaging technique into a tool for materials modification and fabrication is now being repeated with other characterization techniques, including scanning electron microscopy (SEM), focused ion beam (FIB) milling/imaging, and atomic force microscopy (AFM). Fabrication and in situ imaging of materials undergoing a three-dimensional (3D) nano-structuring within a 1−100 nm resolution window is required for future manufacturing of devices. This level of ...

  7. A wide-range metrology AFM and its applications (United States)

    Lin, Xiaofeng; Zhang, Haijun; Zhang, Dongxian


    In view of the fact that the application field of a dual tunneling-unit scanning tunneling microscope (DTU-STM) was strongly limited by sample conductivity, a dual imaging unit atomic force microscope (DIU-AFM) was developed for wide-range nano-metrology. A periodic grating is employed as a reference sample. The DIU-AFM simultaneously scans the grating and a test sample by using one single XY scanner. Their images thus have the same lateral size, and the length of the test sample image can be precisely measured by counting the number of periodic features of the reference grating. We further developed a new method of implementing wide-range nano-metrology. By alternatively moving the XY scanner in the X direction using a step motor, a series of pairs of images are obtained and can be spliced into two wide-range reference and test ones, respectively. Again, the two spliced images are of the same size, and the length of test image can be measured based on the reference grating features. In this way, wide-range metrology with nanometer order accuracy is successfully realized.

  8. Repeated Structural Imaging Reveals Nonlinear Progression of Experience-Dependent Volume Changes in Human Motor Cortex. (United States)

    Wenger, Elisabeth; Kühn, Simone; Verrel, Julius; Mårtensson, Johan; Bodammer, Nils Christian; Lindenberger, Ulman; Lövdén, Martin


    Evidence for experience-dependent structural brain change in adult humans is accumulating. However, its time course is not well understood, as intervention studies typically consist of only 2 imaging sessions (before vs. after training). We acquired up to 18 structural magnetic resonance images over a 7-week period while 15 right-handed participants practiced left-hand writing and drawing. After 4 weeks, we observed increases in gray matter of both left and right primary motor cortices relative to a control group; 3 weeks later, these differences were no longer reliable. Time-series analyses revealed that gray matter in the primary motor cortices expanded during the first 4 weeks and then partially renormalized, in particular in the right hemisphere, despite continued practice and increasing task proficiency. Similar patterns of expansion followed by partial renormalization are also found in synaptogenesis, cortical map plasticity, and maturation, and may qualify as a general principle of structural plasticity. Research on human brain plasticity needs to encompass more than 2 measurement occasions to capture expansion and potential renormalization processes over time. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  9. Conductive-AFM Patterning of Organic Semiconductors. (United States)

    Brown, Benjamin P; Picco, Loren; Miles, Mervyn J; Faul, Charl F J


    Using a conductive atomic force microscope (c-AFM) redox-writing technique, it is shown that it is possible to locally, and reversibly, pattern conducting, and nonconducting features on the surface of a low molecular weight aniline-based organic (semi)-conductor thin film using a commercial c-AFM. It is shown that application of a voltage between the tip and sample causes localized redox reactions at the surface without damage.

  10. Immobilizing live Escherichia coli for AFM studies of surface dynamics. (United States)

    Lonergan, N E; Britt, L D; Sullivan, C J


    Atomic force microscopy (AFM) is a probe-based technique that permits high resolution imaging of live bacterial cells. However, stably immobilizing cells to withstand the probe-based lateral forces remains an obstacle in AFM mediated studies, especially those of live, rod shaped bacteria in nutrient media. Consequently, AFM has been under-utilized in the research of bacterial surface dynamics. The aim of the current study was to immobilize a less adherent Escherichia coli strain in a method that both facilitates AFM imaging in nutrient broth and preserves overall cell viability. Immobilization reagents and buffers were systematically evaluated and the cell membrane integrity was monitored in all sample preparations. As expected, the biocompatible gelatin coated surfaces facilitated stable cell attachment in lower ionic strength buffers, yet poorly immobilized cells in higher ionic strength buffers. In comparison, poly-l-lysine surfaces bound cells in both low and high ionic strength buffers. The benefit of the poly-l-lysine binding capacity was offset by the compromised membrane integrity exhibited by cells on poly-l-lysine surfaces. However, the addition of divalent cations and glucose to the immobilization buffer was found to mitigate this unfavorable effect. Ultimately, immobilization of E. coli cells on poly-l-lysine surfaces in a lower ionic strength buffer supplemented with Mg(2+) and Ca(2+) was determined to provide optimal cell attachment without compromising the overall cell viability. Cells immobilized in this method were stably imaged in media through multiple division cycles. Furthermore, permeability assays indicated that E. coli cells recover from the hypoosmotic stress caused by immobilization in low ionic strength buffers. Taken together, this data suggests that stable immobilization of viable cells on poly-l-lysine surfaces can be accomplished in lower ionic strength buffers that are supplemented with divalent cations for membrane stabilization

  11. Diffusion-weighted magnetic resonance imaging for assessment of lung lesions: repeatability of the apparent diffusion coefficient measurement

    Energy Technology Data Exchange (ETDEWEB)

    Bernardin, L.; Douglas, N.H.M.; Collins, D.J.; Giles, S.L.; O' Flynn, E.A.M.; Orton, M.; DeSouza, N.M. [Institute of Cancer Research and Royal Marsden NHS Foundation Trust, CRUK and EPSRC Cancer Imaging Centre, Surrey (United Kingdom)


    To establish repeatability of apparent diffusion coefficients (ADCs) acquired from free-breathing diffusion-weighted magnetic resonance imaging (DW-MRI) in malignant lung lesions and investigate effects of lesion size, location and respiratory motion. Thirty-six malignant lung lesions (eight patients) were examined twice (1- to 5-h interval) using T1-weighted, T2-weighted and axial single-shot echo-planar DW-MRI (b = 100, 500, 800 s/mm{sup 2}) during free-breathing. Regions of interest around target lesions on computed b = 800 s/mm{sup 2} images by two independent observers yielded ADC values from maps (pixel-by-pixel fitting using all b values and a mono-exponential decay model). Intra- and inter-observer repeatability was assessed per lesion, per patient and by lesion size (> or <2 cm) or location. ADCs were similar between observers (mean ± SD, 1.15 ± 0.28 x 10{sup -3} mm{sup 2}/s, observer 1; 1.15 ± 0.29 x 10{sup -3} mm{sup 2}/s, observer 2). Intra-observer coefficients of variation of the mean [median] ADC per lesion and per patient were 11 % [11.4 %], 5.7 % [5.7 %] for observer 1 and 9.2 % [9.5 %], 3.9 % [4.7 %] for observer 2 respectively; inter-observer values were 8.9 % [9.3 %] (per lesion) and 3.0 % [3.7 %] (per patient). Inter-observer coefficient of variation (CoV) was greater for lesions <2 cm (n = 20) compared with >2 cm (n = 16) (10.8 % vs 6.5 % ADC{sub mean}, 11.3 % vs 6.7 % ADC{sub median}) and for mid (n = 14) vs apical (n = 9) or lower zone (n = 13) lesions (13.9 %, 2.7 %, 3.8 % respectively ADC{sub mean}; 14.2 %, 2.8 %, 4.7 % respectively ADC{sub median}). Free-breathing DW-MRI of whole lung achieves good intra- and inter-observer repeatability of ADC measurements in malignant lung tumours. (orig.)

  12. Tip characterization method using multi-feature characterizer for CD-AFM. (United States)

    Orji, Ndubuisi G; Itoh, Hiroshi; Wang, Chumei; Dixson, Ronald G; Walecki, Peter S; Schmidt, Sebastian W; Irmer, Bernd


    In atomic force microscopy (AFM) metrology, the tip is a key source of uncertainty. Images taken with an AFM show a change in feature width and shape that depends on tip geometry. This geometric dilation is more pronounced when measuring features with high aspect ratios, and makes it difficult to obtain absolute dimensions. In order to accurately measure nanoscale features using an AFM, the tip dimensions should be known with a high degree of precision. We evaluate a new AFM tip characterizer, and apply it to critical dimension AFM (CD-AFM) tips used for high aspect ratio features. The characterizer is made up of comb-shaped lines and spaces, and includes a series of gratings that could be used as an integrated nanoscale length reference. We also demonstrate a simulation method that could be used to specify what range of tip sizes and shapes the characterizer can measure. Our experiments show that for non re-entrant features, the results obtained with this characterizer are consistent to 1nm with the results obtained by using widely accepted but slower methods that are common practice in CD-AFM metrology. A validation of the integrated length standard using displacement interferometry indicates a uniformity of better than 0.75%, suggesting that the sample could be used as highly accurate and SI traceable lateral scale for the whole evaluation process.

  13. Repeatability of Choroidal Thickness Measurements on Enhanced Depth Imaging Optical Coherence Tomography Using Different Posterior Boundaries. (United States)

    Vuong, Vivian S; Moisseiev, Elad; Cunefare, David; Farsiu, Sina; Moshiri, Ala; Yiu, Glenn


    To assess the reliability of manual choroidal thickness measurements by comparing different posterior boundary definitions of the choroidal-scleral junction on enhanced depth imaging optical coherence tomography (EDI-OCT). Reliability analysis. Two graders marked the choroidal-scleral junction with segmentation software using different posterior boundaries: (1) the outer border of the choroidal vessel lumen, (2) the outer border of the choroid stroma, and (3) the inner border of the sclera, to measure the vascular choroidal thickness (VCT), stromal choroidal thickness (SCT), and total choroidal thickness (TCT), respectively. Measurements were taken at 0.5-mm intervals from 1.5 mm nasal to 1.5 mm temporal to the fovea, and averaged continuously across the central 3 mm of the macula. Intraclass correlation coefficient (ICC) and coefficient of reliability (CR) were compared to assess intergrader and intragrader reliability. Choroidal thickness measurements varied significantly with different posterior boundaries (P choroidal-scleral junction visibility was Choroidal thickness measurements are more reproducible when measured to the border of the choroid stroma (SCT) than the vascular lumen (VCT) or sclera (TCT). Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Diamond-modified AFM probes: from diamond nanowires to atomic force microscopy-integrated boron-doped diamond electrodes. (United States)

    Smirnov, Waldemar; Kriele, Armin; Hoffmann, René; Sillero, Eugenio; Hees, Jakob; Williams, Oliver A; Yang, Nianjun; Kranz, Christine; Nebel, Christoph E


    In atomic force microscopy (AFM), sharp and wear-resistant tips are a critical issue. Regarding scanning electrochemical microscopy (SECM), electrodes are required to be mechanically and chemically stable. Diamond is the perfect candidate for both AFM probes as well as for electrode materials if doped, due to diamond's unrivaled mechanical, chemical, and electrochemical properties. In this study, standard AFM tips were overgrown with typically 300 nm thick nanocrystalline diamond (NCD) layers and modified to obtain ultra sharp diamond nanowire-based AFM probes and probes that were used for combined AFM-SECM measurements based on integrated boron-doped conductive diamond electrodes. Analysis of the resonance properties of the diamond overgrown AFM cantilevers showed increasing resonance frequencies with increasing diamond coating thicknesses (i.e., from 160 to 260 kHz). The measured data were compared to performed simulations and show excellent correlation. A strong enhancement of the quality factor upon overgrowth was also observed (120 to 710). AFM tips with integrated diamond nanowires are shown to have apex radii as small as 5 nm and where fabricated by selectively etching diamond in a plasma etching process using self-organized metal nanomasks. These scanning tips showed superior imaging performance as compared to standard Si-tips or commercially available diamond-coated tips. The high imaging resolution and low tip wear are demonstrated using tapping and contact mode AFM measurements by imaging ultra hard substrates and DNA. Furthermore, AFM probes were coated with conductive boron-doped and insulating diamond layers to achieve bifunctional AFM-SECM probes. For this, focused ion beam (FIB) technology was used to expose the boron-doped diamond as a recessed electrode near the apex of the scanning tip. Such a modified probe was used to perform proof-of-concept AFM-SECM measurements. The results show that high-quality diamond probes can be fabricated, which are

  15. Confocal Raman-AFM, A New Tool for Materials Research (United States)

    Schmidt, Ute


    Characterization of heterogeneous systems, e.g. polymers, on the nanometer scale continues to grow in importance and to impact key applications in the field of materials science, nanotechnology and catalysis. The development of advanced polymeric materials for such applications requires detailed information about the physical and chemical properties of these materials on the nanometer scale. However, some details about the phase-separation process in polymers are difficult to study with conventional characterization techniques due to the inability of these methods to chemically differentiate materials with good spatial resolution, without damage, staining or preferential solvent washing. The CR-AFM is a breakthrough in microscopy. It combines three measuring techniques in one instrument: a high resolution confocal optical microscope, an extremely sensitive Raman spectroscopy system, and an Atomic Force Microscope. Using this instrument, the high spatial and topographical resolution obtained with an AFM can be directly linked to the chemical information gained by Confocal Raman spectroscopy. To demonstrate the capabilities of this unique combination of measuring techniques, polymer blend films, spin coated on glass substrates, have been characterized. AFM measurements reveal the structural and mechanical properties of the films, whereas Raman spectral images show the chemical composition of the blends.

  16. Probing cytoskeletal structures by coupling optical superresolution and AFM techniques for a correlative approach. (United States)

    Chacko, Jenu Varghese; Zanacchi, Francesca Cella; Diaspro, Alberto


    In this article, we describe and show the application of some of the most advanced fluorescence superresolution techniques, STED AFM and STORM AFM microscopy towards imaging of cytoskeletal structures, such as microtubule filaments. Mechanical and structural properties can play a relevant role in the investigation of cytoskeletal structures of interest, such as microtubules, that provide support to the cell structure. In fact, the mechanical properties, such as the local stiffness and the elasticity, can be investigated by AFM force spectroscopy with tens of nanometers resolution. Force curves can be analyzed in order to obtain the local elasticity (and the Young's modulus calculation by fitting the force curves from every pixel of interest), and the combination with STED/STORM microscopy integrates the measurement with high specificity and yields superresolution structural information. This hybrid modality of superresolution-AFM working is a clear example of correlative multimodal microscopy.

  17. Functional extension of high-speed AFM for wider biological applications. (United States)

    Uchihashi, Takayuki; Watanabe, Hiroki; Fukuda, Shingo; Shibata, Mikihiro; Ando, Toshio


    High-speed atomic force microscopy (HS-AFM) has been established and used, which can visualize biomolecules in dynamic action at high spatiotemporal resolution without disturbing their function. Various studies conducted in the past few years have demonstrated that the dynamic structure and action of biomolecules revealed with HS-AFM can provide greater insights than ever before into how the molecules function. However, this microscopy has still limitations in some regards. Recently, efforts have been carried out to overcome some of the limitations. As a result, it has now become possible to visualize dynamic processes occurring even on live cells and perform simultaneous observations of topographic and fluorescent images at a high rate. In this review, we focus on technical developments for expanding the range of objects and phenomena observable by HS-AFM as well as for granting multiple functionalities to HS-AFM.

  18. Dicty_cDB: AFM648 [Dicty_cDB

    Lifescience Database Archive (English)


  19. Hydration states of AFm cement phases

    Energy Technology Data Exchange (ETDEWEB)

    Baquerizo, Luis G., E-mail: [Innovation, Holcim Technology Ltd., CH-5113 Holderbank (Switzerland); Matschei, Thomas [Innovation, Holcim Technology Ltd., CH-5113 Holderbank (Switzerland); Scrivener, Karen L. [Laboratory of Construction Materials, Ecole Polytechnique Fédérale de Lausanne, CH-1015 Lausanne (Switzerland); Saeidpour, Mahsa; Wadsö, Lars [Building Materials, Lund University, Box 124, 221 000 Lund (Sweden)


    The AFm phase, one of the main products formed during the hydration of Portland and calcium aluminate cement based systems, belongs to the layered double hydrate (LDH) family having positively charged layers and water plus charge-balancing anions in the interlayer. It is known that these phases present different hydration states (i.e. varying water content) depending on the relative humidity (RH), temperature and anion type, which might be linked to volume changes (swelling and shrinkage). Unfortunately the stability conditions of these phases are insufficiently reported. This paper presents novel experimental results on the different hydration states of the most important AFm phases: monocarboaluminate, hemicarboaluminate, strätlingite, hydroxy-AFm and monosulfoaluminate, and the thermodynamic properties associated with changes in their water content during absorption/desorption. This data opens the possibility to model the response of cementitious systems during drying and wetting and to engineer systems more resistant to harsh external conditions.

  20. Graphene MEMS: AFM probe performance improvement. (United States)

    Martin-Olmos, Cristina; Rasool, Haider Imad; Weiller, Bruce H; Gimzewski, James K


    We explore the feasibility of growing a continuous layer of graphene in prepatterned substrates, like an engineered silicon wafer, and we apply this as a mold for the fabrication of AFM probes. This fabrication method proves the fabrication of SU-8 devices coated with graphene in a full-wafer parallel technology and with high yield. It also demonstrates that graphene coating enhances the functionality of SU-8 probes, turning them conductive and more resistant to wear. Furthermore, it opens new experimental possibilities such as studying graphene-graphene interaction at the nanoscale with the precision of an AFM or the exploration of properties in nonplanar graphene layers.

  1. AFM characterization of protein net formation on a fibrous medium

    Directory of Open Access Journals (Sweden)

    Assis O.B.G.


    Full Text Available Lysozyme protein net is set on a glass fiber support using the self-assembly technique. Enzymatic film formation is followed by surface imaging via atomic force microscopy (AFM. Change in roughness as a function of deposition time is used as an indirect indicator of film formation. The objective was to form a protein film that would have no effect on the permeability of the medium, aiming at its application as a bioactive membrane or reactor suitable for bacteria and chemical interactions in aqueous media.

  2. Sharing my fifteen years experiences in the research field of Atomic Force Microscopy (AFM

    Directory of Open Access Journals (Sweden)

    Guha T


    Full Text Available Atomic Force Microscope (AFM was developed by Binnig and his coworkers in the year 1986. He was awarded Nobel Prize in physics for this work in 1986 in sharing with Rohrer and Ruska. Rationale to develop AFM: Scanning Tunneling Microscope (STM, the precursor to AFM is efficient in imaging electrically conducting specimen at atomic resolution. The impetus for development of AFM came to Binnig’s mind because of relatively poor efficiency of STM to image electrically non-conducting biological samples. He wondered why the surfaces be always imaged with a current but not with a force. He thought if small forces of interactions between a probe tip atoms and specimen surface atoms could be detected and amplified then imaging of biological specimen would be possible at a very high resolution. AFM working Principle: AFM is a Scanning Probe Microscopy (SPM by which imaging is realized by interaction of a probe with sample surface without any beam (light, electron and lens system. The probe is attached to a soft and sensitive cantilever and either specimen is scanned by probe or specimen scans itself under a stationary probe. Probe’s spring constant must be small and the deflection must be measurable along with high resonance frequency. The most commonly associated force with AFM is called Vander Waals force. Three modes of working are contact mode, non contact mode and tapping mode. In contact zone, the probe tip attached with cantilever is held less than a few A˚ from the sample surface and the inter-atomic force between the atoms of probe tip and sample surface is repulsive. In non-contact zone, the probe tip is held at a distance of 100s of A˚ from the sample surface and the inter-atomic force here is long range Vander Waals interaction and is attractive in nature. AFM is also called Scanning Force Microscope because the force of interaction between probe tip atoms and surface atoms is amplified to generate a signal voltage which modulates video

  3. Edge Effects and Coupling Effects in Atomic Force Microscope Images

    Institute of Scientific and Technical Information of China (English)

    ZHANGXiang-jun; MENGYong-gang; WENShi-zhu


    The AFM images were obtained by an atomic force microscope (AFM) and transformed from the deformation of AFM micro cantilever probe. However, due to the surface topography and surface forces applied on the AFM tip of sample, the deformation of AFM probe results in obvious edge effects and coupling effects in the AFM images. The deformation of AFM probe was analyzed,the mechanism of the edge effects and the coupling effects was investigated, and their results in the AFM images were studied. It is demanstrated by the theoretical analysis and AFM experiments that the edge effects make lateral force images more clear than the topography images, also make extraction of frictional force force from lateral force images mare complex and difficult. While the coupling effects make the comparison between topography images and lateral force images mare advantage to acquire precise topography information by AFM.

  4. AFM plough YBCO micro bridges: substrate effects

    CSIR Research Space (South Africa)

    Elkaseh, A


    Full Text Available AFM nanolithography was used as a novel cutting technique to define micro-size YBCO superconducting constrictions. Researchers studied the substrate effects on MgO and STO substrates and showed that the observed Shapiro steps from the bridges on STO...

  5. Dr. A.F.M. Reijnders, centenarian

    NARCIS (Netherlands)

    Bas, C.


    A few weeks ago a reprint was distributed of an interesting paper on the formation of spores by metamorphosis of basidia in fruiting bodies of Mycocalia and Scleroderma. That in itself was not so remarkable. But it is really a small miracle that this paper was written by Dr. A.F.M. Reijnders at the

  6. Conductance of AFM Deformed Carbon Nanotubes (United States)

    Svizhenko, Alexei; Maiti, Amitesh; Anatram, M. P.; Biegel, Bryan (Technical Monitor)


    This viewgraph presentation provides information on the electrical conductivity of carbon nanotubes upon deformation by atomic force microscopy (AFM). The density of states and conductance were computed using four orbital tight-binding method with various parameterizations. Different chiralities develop bandgap that varies with chirality.

  7. AFM-CMM integrated instrument user manual

    DEFF Research Database (Denmark)

    Marinello, Francesco; Bariani, Paolo

    This manual gives general important guidelines for a proper use of the integrated AFM-CMM instrument. More information can be collected reading: • N. Kofod Ph.D thesis [1]; • P. Bariani Ph.D thesis [2]; • Dualscope DME 95-200 operation manuals [3]; • SPIP help [4] • Stitching software user manual...

  8. Insight into mechanics of AFM tip-based nanomachining: bending of cantilevers and machined grooves (United States)

    Al-Musawi, R. S. J.; Brousseau, E. B.; Geng, Y.; Borodich, F. M.


    Atomic force microscope (AFM) tip-based nanomachining is currently the object of intense research investigations. Values of the load applied to the tip at the free end of the AFM cantilever probe used for nanomachining are always large enough to induce plastic deformation on the specimen surface contrary to the small load values used for the conventional contact mode AFM imaging. This study describes an important phenomenon specific for AFM nanomachining in the forward direction: under certain processing conditions, the deformed shape of the cantilever probe may change from a convex to a concave orientation. The phenomenon can principally change the depth and width of grooves machined, e.g. the grooves machined on a single crystal copper specimen may increase by 50% on average following such a change in the deformed shape of the cantilever. It is argued that this phenomenon can take place even when the AFM-based tool is operated in the so-called force-controlled mode. The study involves the refined theoretical analysis of cantilever probe bending, the analysis of experimental signals monitored during the backward and forward AFM tip-based machining and the inspection of the topography of produced grooves.

  9. Insight into mechanics of AFM tip-based nanomachining: bending of cantilevers and machined grooves. (United States)

    Al-Musawi, R S J; Brousseau, E B; Geng, Y; Borodich, F M


    Atomic force microscope (AFM) tip-based nanomachining is currently the object of intense research investigations. Values of the load applied to the tip at the free end of the AFM cantilever probe used for nanomachining are always large enough to induce plastic deformation on the specimen surface contrary to the small load values used for the conventional contact mode AFM imaging. This study describes an important phenomenon specific for AFM nanomachining in the forward direction: under certain processing conditions, the deformed shape of the cantilever probe may change from a convex to a concave orientation. The phenomenon can principally change the depth and width of grooves machined, e.g. the grooves machined on a single crystal copper specimen may increase by 50% on average following such a change in the deformed shape of the cantilever. It is argued that this phenomenon can take place even when the AFM-based tool is operated in the so-called force-controlled mode. The study involves the refined theoretical analysis of cantilever probe bending, the analysis of experimental signals monitored during the backward and forward AFM tip-based machining and the inspection of the topography of produced grooves.

  10. Accelerated design and quality control of impact modifiers for plastics through atomic force microscopy (AFM) analysis (United States)

    Moeller, Gunter


    Standard polymer resins are often too brittle or do not meet other mechanical property requirements for typical polymer applications. To achieve desired properties it is common to disperse so called ``impact modifiers'', which are spherical latex particles with diameters of much less than one micrometer, into the pure resin. Understanding and control of the entire process from latex particle formation to subsequent dispersion into polymer resins are necessary to accelerate the development of new materials that meet specific application requirements. In this work AFM imaging and nanoindentation techniques in combination with AFM-based spectroscopic techniques were applied to assess latex formation and dispersion. The size and size distribution of the latex particles can be measured based on AFM amplitude modulation images. AFM phase images provide information about the chemical homogeneity of individual particles. Nanoindentation may be used to estimate their elastic and viscoelastic properties. Proprietary creep and nanoscale Dynamic Mechanical Analysis (DMA) tests that we have developed were used to measure these mechanical properties. The small size of dispersed latex inclusions requires local mechanical and spectroscopic analysis techniques with high lateral and spatial resolution. We applied the CRAVE AFM method, developed at NIST, to perform mechanical analysis of individual latex inclusions and compared results with those obtained using nanoscale DMA. NanoIR, developed by Anasys Inc., and principal component confocal Raman were used for spectroscopic analysis and results from both techniques compared.

  11. TU-AB-BRA-05: Repeatability of [F-18]-NaF PET Imaging Biomarkers for Bone Lesions: A Multicenter Study

    Energy Technology Data Exchange (ETDEWEB)

    Lin, C; Bradshaw, T; Perk, T; Harmon, S; Jeraj, R [University of Wisconsin - Madison, School of Medicine and Public Health, Madison, WI (United States); Liu, G


    Purpose: Quantifying the repeatability of imaging biomarkers is critical for assessing therapeutic response. While therapeutic efficacy has been traditionally quantified by SUV metrics, imaging texture features have shown potential for use as quantitative biomarkers. In this study we evaluated the repeatability of quantitative {sup 18}F-NaF PET-derived SUV metrics and texture features in bone lesions from patients in a multicenter study. Methods: Twenty-nine metastatic castrate-resistant prostate cancer patients received whole-body test-retest NaF PET/CT scans from one of three harmonized imaging centers. Bone lesions of volume greater than 1.5 cm{sup 3} were identified and automatically segmented using a SUV>15 threshold. From each lesion, 55 NaF PET-derived texture features (including first-order, co-occurrence, grey-level run-length, neighbor gray-level, and neighbor gray-tone difference matrix) were extracted. The test-retest repeatability of each SUV metric and texture feature was assessed with Bland-Altman analysis. Results: A total of 315 bone lesions were evaluated. Of the traditional SUV metrics, the repeatability coefficient (RC) was 12.6 SUV for SUVmax, 2.5 SUV for SUVmean, and 4.3 cm{sup 3} for volume. Their respective intralesion coefficients of variation (COVs) were 12%, 17%, and 6%. Of the texture features, COV was lowest for entropy (0.03%) and highest for kurtosis (105%). Lesion intraclass correlation coefficient (ICC) was lowest for maximum correlation coefficient (ICC=0.848), and highest for entropy (ICC=0.985). Across imaging centers, repeatability of texture features and SUV varied. For example, across imaging centers, COV for SUVmax ranged between 11–23%. Conclusion: Many NaF PET-derived SUV metrics and texture features for bone lesions demonstrated high repeatability, such as SUVmax, entropy, and volume. Several imaging texture features demonstrated poor repeatability, such as SUVtotal and SUVstd. These results can be used to establish

  12. Test-retest repeatability of myocardial blood flow and infarct size using {sup 11}C-acetate micro-PET imaging in mice

    Energy Technology Data Exchange (ETDEWEB)

    Croteau, Etienne; Renaud, Jennifer M.; McDonald, Matthew; Klein, Ran; DaSilva, Jean N.; Beanlands, Rob S.B.; DeKemp, Robert A. [University of Ottawa Heart Institute, National Cardiac PET Centre, Ottawa, Ontario (Canada)


    Global and regional responses of absolute myocardial blood flow index (iMBF) are used as surrogate markers to assess response to therapies in coronary artery disease. In this study, we assessed the test-retest repeatability of iMBF imaging, and the accuracy of infarct sizing in mice using {sup 11}C-acetate PET. {sup 11}C-Acetate cardiac PET images were acquired in healthy controls, endothelial nitric oxide synthase (eNOS) knockout transgenic mice, and mice after myocardial infarction (MI) to estimate global and regional iMBF, and myocardial infarct size compared to {sup 18}F-FDG PET and ex-vivo histology results. Global test-retest iMBF values had good coefficients of repeatability (CR) in healthy mice, eNOS knockout mice and normally perfused regions in MI mice (CR = 1.6, 2.0 and 1.5 mL/min/g, respectively). Infarct size measured on {sup 11}C-acetate iMBF images was also repeatable (CR = 17 %) and showed a good correlation with the infarct sizes found on {sup 18}F-FDG PET and histopathology (r{sup 2} > 0.77; p < 0.05). {sup 11}C-Acetate micro-PET assessment of iMBF and infarct size is repeatable and suitable for serial investigation of coronary artery disease progression and therapy. (orig.)

  13. Tip-enhanced Raman mapping with top-illumination AFM. (United States)

    Chan, K L Andrew; Kazarian, Sergei G


    Tip-enhanced Raman mapping is a powerful, emerging technique that offers rich chemical information and high spatial resolution. Currently, most of the successes in tip-enhanced Raman scattering (TERS) measurements are based on the inverted configuration where tips and laser are approaching the sample from opposite sides. This results in the limitation of measurement for transparent samples only. Several approaches have been developed to obtain tip-enhanced Raman mapping in reflection mode, many of which involve certain customisations of the system. We have demonstrated in this work that it is also possible to obtain TERS nano-images using an upright microscope (top-illumination) with a gold-coated Si atomic force microscope (AFM) cantilever without significant modification to the existing integrated AFM/Raman system. A TERS image of a single-walled carbon nanotube has been achieved with a spatial resolution of ∼ 20-50 nm, demonstrating the potential of this technique for studying non-transparent nanoscale materials.

  14. Tip-enhanced Raman mapping with top-illumination AFM

    Energy Technology Data Exchange (ETDEWEB)

    Chan, K L Andrew; Kazarian, Sergei G, E-mail: [Department of Chemical Engineering, Imperial College London, SW7 2AZ (United Kingdom)


    Tip-enhanced Raman mapping is a powerful, emerging technique that offers rich chemical information and high spatial resolution. Currently, most of the successes in tip-enhanced Raman scattering (TERS) measurements are based on the inverted configuration where tips and laser are approaching the sample from opposite sides. This results in the limitation of measurement for transparent samples only. Several approaches have been developed to obtain tip-enhanced Raman mapping in reflection mode, many of which involve certain customisations of the system. We have demonstrated in this work that it is also possible to obtain TERS nano-images using an upright microscope (top-illumination) with a gold-coated Si atomic force microscope (AFM) cantilever without significant modification to the existing integrated AFM/Raman system. A TERS image of a single-walled carbon nanotube has been achieved with a spatial resolution of {approx} 20-50 nm, demonstrating the potential of this technique for studying non-transparent nanoscale materials.

  15. Tip-enhanced Raman mapping with top-illumination AFM (United States)

    Chan, K. L. Andrew; Kazarian, Sergei G.


    Tip-enhanced Raman mapping is a powerful, emerging technique that offers rich chemical information and high spatial resolution. Currently, most of the successes in tip-enhanced Raman scattering (TERS) measurements are based on the inverted configuration where tips and laser are approaching the sample from opposite sides. This results in the limitation of measurement for transparent samples only. Several approaches have been developed to obtain tip-enhanced Raman mapping in reflection mode, many of which involve certain customisations of the system. We have demonstrated in this work that it is also possible to obtain TERS nano-images using an upright microscope (top-illumination) with a gold-coated Si atomic force microscope (AFM) cantilever without significant modification to the existing integrated AFM/Raman system. A TERS image of a single-walled carbon nanotube has been achieved with a spatial resolution of ~ 20-50 nm, demonstrating the potential of this technique for studying non-transparent nanoscale materials.

  16. AFM/MFM hybrid nanocharacterization of martensitic transformation and degradation for Fe-Pd shape memory alloy (United States)

    Suzuki, Takayuki; Nagatani, Kohei; Hirano, Kazumi; Teramoto, Tokuo; Taya, Minoru


    Martensitic transformation and degradation characteristics for Fe-Pd ferromagnetic shape memory alloy were investigated by the developed AFM (Atomic Force Microscope)/MFM (Magnetic Force Microscope) hybrid nano-characterization technique. In AFM martensitic transformation was detected by the changes of surface topography of martensite plates. In MFM martensitic transformation was detected by the changes of magnetic domain structures. This technique has an advantage that martensitic transformation characteristics such as martensitic transformation temperature and reverse transformation temperature can be measured at microscopic and nanoscopic small area. Degradation characteristics of martensitic transformation under cyclic loading were also detected by the changes of AFM and MFM images. In AFM images surface topography of martensite plates became flat and in MFM images the morphology of magnetic domain structures became unfocused under cyclic loading. Then it was found that the hybrid nano-characterization was very high sensitive technique to evaluate degradation for Fe-Pd ferromagnetic shape memory alloy.

  17. Digital Image Analysis of Flowering in the Repeat-Blooming Creosotebush (Larrea tridentata) in Relation to Climatic Factors (United States)

    Benton, L. M.; Kurc, S. A.


    Recent studies have shown that phenology (seasonal timing of life cycle events) is an effective integrator of the impacts of climate change on natural systems. Thus, understanding the climate signals that activate plant phenological responses (e.g., flowering and leaf production) will allow for improved modeling efforts and more effective ecosystem management strategies to mitigate the effects of climate change. With warmer and drier weather patterns predicted for the Desert Southwest in the coming century it can be expected that plant phenological patterns will be altered as a result. The most dominant and widespread shrub species of the warm desert ecosystems of North America is the creosotebush (Larrea tridentata). Consequently, creosotebush has a major impact on the structure, functioning, and flow of resources (i.e., carbon, water, and energy) in these regions, and when in bloom serves as an abundant and reliable food source for hundreds of pollinating insects that synchronize their emergence with flowering time. In this study, we hypothesize that frequency, duration and abundance of flowers in the repeat-blooming creosotebush are regulated by (1) temperature during the spring and (2) soil moisture below the depth of atmospheric demand in the summer. We make use of daily digital images from three stations at the Santa Rita Experimental Range in southern Arizona. These stations are located within the footprint of an eddy covariance tower, where continuous records of precipitation, air temperature, soil temperature, soil moisture at various depths, and net radiation are also being collected. Unlike more discrete methods used to observe seasonal changes in vegetation, use of daily images results in a continuous record that can be directly compared to micrometeorological data, allowing us to evaluate the bloom-up response of creosotebush alongside (1) air temperature, (2) soil temperature, and (3) soil water content fluctuations across time. We show that this

  18. Optical Beam Deflection Based AFM with Integrated Hardware and Software Platform for an Undergraduate Engineering Laboratory

    Directory of Open Access Journals (Sweden)

    Siu Hong Loh


    Full Text Available Atomic force microscopy (AFM has been used extensively in nanoscience research since its invention. Recently, many teaching laboratories in colleges, undergraduate institutions, and even high schools incorporate AFM as an effective teaching tool for nanoscience education. This paper presents an optical beam deflection (OBD based atomic force microscope, designed specifically for the undergraduate engineering laboratory as a teaching instrument. An electronic module for signal conditioning was built with components that are commonly available in an undergraduate electronic laboratory. In addition to off-the-shelf mechanical parts and optics, the design of custom-built mechanical parts waskept as simple as possible. Hence, the overall cost for the setup is greatly reduced. The AFM controller was developed using National Instruments Educational Laboratory Virtual Instrumentation Suite (NI ELVIS, an integrated hardware and software platform which can be programmed in LabVIEW. A simple yet effective control algorithm for scanning and feedback control was developed. Despite the use of an educational platform and low-cost components from the undergraduate laboratory, the developed AFM is capable of performing imaging in constant-force mode with submicron resolution and at reasonable scanning speed (approximately 18 min per image. Therefore, the AFM is suitable to be used as an educational tool for nanoscience. Moreover, the construction of the system can be a valuable educational experience for electronic and mechanical engineering students.

  19. Noise in NC-AFM measurements with significant tip–sample interaction (United States)

    Lübbe, Jannis; Temmen, Matthias


    Summary The frequency shift noise in non-contact atomic force microscopy (NC-AFM) imaging and spectroscopy consists of thermal noise and detection system noise with an additional contribution from amplitude noise if there are significant tip–sample interactions. The total noise power spectral density D Δ f(f m) is, however, not just the sum of these noise contributions. Instead its magnitude and spectral characteristics are determined by the strongly non-linear tip–sample interaction, by the coupling between the amplitude and tip–sample distance control loops of the NC-AFM system as well as by the characteristics of the phase locked loop (PLL) detector used for frequency demodulation. Here, we measure D Δ f(f m) for various NC-AFM parameter settings representing realistic measurement conditions and compare experimental data to simulations based on a model of the NC-AFM system that includes the tip–sample interaction. The good agreement between predicted and measured noise spectra confirms that the model covers the relevant noise contributions and interactions. Results yield a general understanding of noise generation and propagation in the NC-AFM and provide a quantitative prediction of noise for given experimental parameters. We derive strategies for noise-optimised imaging and spectroscopy and outline a full optimisation procedure for the instrumentation and control loops.

  20. Combined force spectroscopy, AFM and calorimetric studies to reveal the nanostructural organization of biomimetic membranes. (United States)

    Suárez-Germà, C; Morros, A; Montero, M T; Hernández-Borrell, J; Domènech, Ò


    In this work we studied a binary lipid matrix of 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (POPG), a composition that mimics the inner membrane of Escherichia coli. More specifically, liposomes with varying fractions of POPG were analysed by differential scanning calorimetry (DSC) and a binary phase diagram of the system was created. Additionally, we performed atomic force microscopy (AFM) imaging of supported lipid bilayers (SLBs) of similar compositions at different temperatures, in order to create a pseudo-binary phase diagram specific to this membrane model. AFM study of SLBs is of particular interest, as it is conceived as the most adequate technique not only for studying lipid bilayer systems but also for imaging and even nanomanipulating inserted membrane proteins. The construction of the above-mentioned phase diagram enabled us to grasp better the thermodynamics of the thermal lipid transition from a gel-like POPE:POPG phase system to a more fluid phase system. Finally, AFM force spectroscopy (FS) was used to determine the nanomechanics of these two lipid phases at 27°C and at different POPG fractions. The resulting data correlated with the specific composition of each phase was calculated from the AFM phase diagram obtained. All the experiments were done in the presence of 10 mM of Ca(2+), as this ion is commonly used when performing AFM with negatively charged phospholipids.

  1. Nanoscale thermal AFM of polymers: transient heat flow effects. (United States)

    Duvigneau, Joost; Schönherr, Holger; Vancso, G Julius


    Thermal transport around the nanoscale contact area between the heated atomic force microscopy (AFM) probe tip and the specimen under investigation is a central issue in scanning thermal microscopy (SThM). Polarized light microscopy and AFM imaging of the temperature-induced crystallization of poly(ethylene terephthalate) (PET) films in the region near the tip were used in this study to unveil the lateral heat transport. The radius of the observed lateral surface isotherm at 133 °C ranged from 2.2 ± 0.5 to 18.7 ± 0.5 μm for tip-polymer interface temperatures between 200 and 300 °C with contact times varying from 20 to 120 s, respectively. In addition, the heat transport into polymer films was assessed by measurements of the thermal expansion of poly(dimethyl siloxane) (PDMS) films with variable thickness on silicon supports. Our data showed that heat transport in the specimen normal (z) direction occurred to depths exceeding 1000 μm using representative non-steady-state SThM conditions (i.e., heating from 40 to 180 °C at a rate of 10 °C s(-1)). On the basis of the experimental results, a 1D steady-state model for heat transport was developed, which shows the temperature profile close to the tip-polymer contact. The model also indicates that ≤1% of the total power generated in the heater area, which is embedded in the cantilever end, is transported into the polymer through the tip-polymer contact interface. Our results complement recent efforts in the evaluation and improvement of existing theoretical models for thermal AFM, as well as advance further developments of SThM for nanoscale thermal materials characterization and/or manipulation via scanning thermal lithography (SThL).

  2. Dicty_cDB: AFM873 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available uences producing significant alignments: (bits) Value AFM873 (AFM873Q) /CSM/AF/AFM8-D/AFM873Q.Seq.d/ 258 2e-...49 own update 2009. 4. 3 Homology vs DNA Score E Sequences producing significant alignments: (bits) Value... update 2009. 4.15 Homology vs Protein Score E Sequences producing significant alignments: (bits) Value ( P5

  3. An AFM-based pit-measuring method for indirect measurements of cell-surface membrane vesicles. (United States)

    Zhang, Xiaojun; Chen, Yuan; Chen, Yong


    Circulating membrane vesicles, which are shed from many cell types, have multiple functions and have been correlated with many diseases. Although circulating membrane vesicles have been extensively characterized, the status of cell-surface membrane vesicles prior to their release is less understood due to the lack of effective measurement methods. Recently, as a powerful, micro- or nano-scale imaging tool, atomic force microscopy (AFM) has been applied in measuring circulating membrane vesicles. However, it seems very difficult for AFM to directly image/identify and measure cell-bound membrane vesicles due to the similarity of surface morphology between membrane vesicles and cell surfaces. Therefore, until now no AFM studies on cell-surface membrane vesicles have been reported. In this study, we found that air drying can induce the transformation of most cell-surface membrane vesicles into pits that are more readily detectable by AFM. Based on this, we developed an AFM-based pit-measuring method and, for the first time, used AFM to indirectly measure cell-surface membrane vesicles on cultured endothelial cells. Using this approach, we observed and quantitatively measured at least two populations of cell-surface membrane vesicles, a nanoscale population (AFM-based pit-measuring method is potentially useful for studying cell-surface membrane vesicles and for investigating the mechanisms of membrane vesicle formation/release.

  4. Dynamic bioluminescence imaging for quantitative tumour burden assessment using IV or IP administration of d-luciferin: effect on intensity, time kinetics and repeatability of photon emission

    Energy Technology Data Exchange (ETDEWEB)

    Keyaerts, Marleen; Vanhove, Chris; Caveliers, Vicky; Bossuyt, Axel; Lahoutte, Tony [Vrije Universiteit Brussel (VUB), In Vivo Cellular and Molecular Imaging (ICMI) Laboratory, Brussels (Belgium); University Hospital Brussels (UZ-Brussel), Department of Nuclear Medicine, Brussels (Belgium); Verschueren, Jacob [University of Antwerp, Bio-Imaging lab, Department of Biomedical Sciences, Antwerp (Belgium); Bos, Tomas J. [Vrije Universiteit Brussel (VUB), Department of Haematology and Immunology, Brussels (Belgium); Tchouate-Gainkam, Lea O.; Peleman, Cindy [Vrije Universiteit Brussel (VUB), In Vivo Cellular and Molecular Imaging (ICMI) Laboratory, Brussels (Belgium); Breckpot, Karine [Vrije Universiteit Brussel (VUB), Laboratory of Molecular and Cellular Therapy, Department of Physiology and Immunology, Brussels (Belgium)


    In vivo bioluminescence imaging (BLI) is a promising technique for non-invasive tumour imaging. d-luciferin can be administrated intraperitonealy or intravenously. This will influence its availability and, therefore, the bioluminescent signal. The aim of this study is to compare the repeatability of BLI measurement after IV versus IP administration of d-luciferin and assess the correlation between photon emission and histological cell count both in vitro and in vivo. Fluc-positive R1M cells were subcutaneously inoculated in nu/nu mice. Dynamic BLI was performed after IV or IP administration of d-luciferin. Maximal photon emission (PE{sub max}) was calculated. For repeatability assessment, every acquisition was repeated after 4 h and analysed using Bland-Altman method. A second group of animals was serially imaged, alternating IV and IP administration up to 21 days. When mice were killed, PE{sub max} after IV administration was correlated with histological cell number. The coefficients of repeatability were 80.2% (IV) versus 95.0% (IP). Time-to-peak is shorter, and its variance lower for IV (p < 0.0001). PE{sub max} was 5.6 times higher for IV. A trend was observed towards lower photon emission per cell in larger tumours. IV administration offers better repeatability and better sensitivity when compared to IP. In larger tumours, multiple factors may contribute to underestimation of tumour burden. It might, therefore, be beneficial to test novel therapeutics on small tumours to enable an accurate evaluation of tumour burden. (orig.)

  5. A microfluidic AFM cantilever based dispensing and aspiration platform

    NARCIS (Netherlands)

    Van Oorschot, R.; Perez Garza, H.H.; Derks, R.J.S.; Staufer, U.; Ghatkesar, M.K.


    We present the development of a microfluidic AFM (atomic force microscope) cantilever-based platform to enable the local dispensing and aspiration of liquid with volumes in the pico-to-femtoliter range. The platform consists of a basic AFM measurement system, microfluidic AFM chip, fluidic interface

  6. New insights into the mucoadhesion of pectins by AFM roughness parameters in combination with SPR

    DEFF Research Database (Denmark)

    Joergensen, Lars; Klösgen, Beate; Simonsen, Adam Cohen;


    The object of this study was to assess the mucoadhesion of the three main commercially available types of pectin by atomic force microscopy (AFM) and surface Plasmon resonance (SPR). Polyacrylic acid and polyvinyl pyrrolidone were used as positive and negative control, respectively. Image analysis...

  7. AFM analysis of bleaching effects on dental enamel microtopography

    Energy Technology Data Exchange (ETDEWEB)

    Pedreira de Freitas, Ana Carolina, E-mail: [Departamento de Dentistica, Faculdade de Odontologia da Universidade de Sao Paulo, Av. Prof. Lineu Prestes, 2227 - Cidade Universitaria, CEP 05508-000, Sao Paulo (Brazil); Cardoso Espejo, Luciana, E-mail: [Departamento de Dentistica, Faculdade de Odontologia da Universidade de Sao Paulo, Av. Prof. Lineu Prestes, 2227 - Cidade Universitaria, CEP 05508-000, Sao Paulo (Brazil); Brossi Botta, Sergio, E-mail: [Departamento de Dentistica, Faculdade de Odontologia da Universidade de Sao Paulo, Av. Prof. Lineu Prestes, 2227 - Cidade Universitaria, CEP 05508-000, Sao Paulo (Brazil); Sa Teixeira, Fernanda de, E-mail: [Laboratorio de Filmes Finos, Instituto de Fisica da Universidade de Sao Paulo, Rua do Matao, Travessa R, 187 - Cidade Universitaria, CEP 05314-970, Sao Paulo (Brazil); Cerqueira, Luz Maria Aparecida A., E-mail: [Departamento de Dentistica, Faculdade de Odontologia da Universidade de Sao Paulo, Av. Prof. Lineu Prestes, 2227 - Cidade Universitaria, CEP 05508-000, Sao Paulo (Brazil); Garone-Netto, Narciso, E-mail: [Departamento de Dentistica, Faculdade de Odontologia da Universidade de Sao Paulo, Av. Prof. Lineu Prestes, 2227 - Cidade Universitaria, CEP 05508-000, Sao Paulo (Brazil); Bona Matos, Adriana, E-mail: [Departamento de Dentistica, Faculdade de Odontologia da Universidade de Sao Paulo, Av. Prof. Lineu Prestes, 2227 - Cidade Universitaria, CEP 05508-000, Sao Paulo (Brazil); Barbosa da Silveira Salvadori, Maria Cecilia, E-mail: [Laboratorio de Filmes Finos, Instituto de Fisica da Universidade de Sao Paulo, Rua do Matao, Travessa R, 187 - Cidade Universitaria, CEP 05314-970, Sao Paulo (Brazil)


    The purpose of this in vitro study was to test a new methodology to evaluate the effects of 35% hydrogen peroxide agent on the microtopography of sound enamel using an atomic force microscope (AFM). The buccal sound surfaces of three extracted human lower incisors were used, without polishing the surfaces to maintain them with natural morphology. These unpolished surfaces were subjected to bleaching procedure with 35% hydrogen peroxide that consisted of 4 applications of the bleaching agent on enamel surfaces for 10 min each application. Surface images were obtained in a 15 {mu}m x 15 {mu}m area using an AFM. The roughness (Ra and RMS) and the power spectral density (PSD) were obtained before and after the bleaching treatment. As results we could inquire that the PSD analyses were very suitable to identifying the morphological changes on the surfaces, while the Ra and RMS parameters were insufficient to represent the morphological alterations promoted by bleaching procedure on enamel. The morphological wavelength in the range of visible light spectrum (380-750 nm) was analyzed, showing a considerable increase of the PSD with the bleaching treatment.

  8. AFM analysis of bleaching effects on dental enamel microtopography (United States)

    Pedreira de Freitas, Ana Carolina; Espejo, Luciana Cardoso; Botta, Sergio Brossi; Teixeira, Fernanda de Sa; Luz, Maria Aparecida A. Cerqueira; Garone-Netto, Narciso; Matos, Adriana Bona; Salvadori, Maria Cecilia Barbosa da Silveira


    The purpose of this in vitro study was to test a new methodology to evaluate the effects of 35% hydrogen peroxide agent on the microtopography of sound enamel using an atomic force microscope (AFM). The buccal sound surfaces of three extracted human lower incisors were used, without polishing the surfaces to maintain them with natural morphology. These unpolished surfaces were subjected to bleaching procedure with 35% hydrogen peroxide that consisted of 4 applications of the bleaching agent on enamel surfaces for 10 min each application. Surface images were obtained in a 15 μm × 15 μm area using an AFM. The roughness (Ra and RMS) and the power spectral density (PSD) were obtained before and after the bleaching treatment. As results we could inquire that the PSD analyses were very suitable to identifying the morphological changes on the surfaces, while the Ra and RMS parameters were insufficient to represent the morphological alterations promoted by bleaching procedure on enamel. The morphological wavelength in the range of visible light spectrum (380-750 nm) was analyzed, showing a considerable increase of the PSD with the bleaching treatment.

  9. Ultra thin films of nanocrystalline Ge studied by AFM and interference enhanced Raman scattering

    Indian Academy of Sciences (India)

    S Balaji; S Mohan; D V S Muthu; A K Sood


    Initial growth stages of the ultra thin films of germanium (Ge) prepared by ion beam sputter deposition have been studied using atomic force microscope (AFM) and interference enhanced Raman scattering. The growth of the films follows Volmer-Weber growth mechanism. Analysis of the AFM images shows that Ostwald ripening of the grains occurs as the thickness of the film increases. Raman spectra of the Ge films reveal phonon confinement along the growth direction and show that the misfit strain is relieved for film thickness greater than 4 nm.

  10. Morphological analysis of polymers on hair fibers by SEM and AFM

    Directory of Open Access Journals (Sweden)

    Valéria Fernandes Monteiro


    Full Text Available The polyquaternium 7® polymer is widely used in cosmetic formulations. Morphologic alterations in hair fibers were observed after the application of the polyquaternium 7® polymer, using SEM and AFM. Continuous applications of this product indicated that it accumulates on the fibers, improving the aspect of the hair surface. Quantitative analysis of the images obtained by AFM was undertaken. The data obtained for the hair surface roughness indicates that the fibers treated with the polymer presented higher roughness than the untreated hair fibers.

  11. Repeatability of Brain Volume Measurements Made with the Atlas-based Method from T1-weighted Images Acquired Using a 0.4 Tesla Low Field MR Scanner. (United States)

    Goto, Masami; Suzuki, Makoto; Mizukami, Shinya; Abe, Osamu; Aoki, Shigeki; Miyati, Tosiaki; Fukuda, Michinari; Gomi, Tsutomu; Takeda, Tohoru


    An understanding of the repeatability of measured results is important for both the atlas-based and voxel-based morphometry (VBM) methods of magnetic resonance (MR) brain volumetry. However, many recent studies that have investigated the repeatability of brain volume measurements have been performed using static magnetic fields of 1-4 tesla, and no study has used a low-strength static magnetic field. The aim of this study was to investigate the repeatability of measured volumes using the atlas-based method and a low-strength static magnetic field (0.4 tesla). Ten healthy volunteers participated in this study. Using a 0.4 tesla magnetic resonance imaging (MRI) scanner and a quadrature head coil, three-dimensional T1-weighted images (3D-T1WIs) were obtained from each subject, twice on the same day. VBM8 software was used to construct segmented normalized images [gray matter (GM), white matter (WM), and cerebrospinal fluid (CSF) images]. The regions-of-interest (ROIs) of GM, WM, CSF, hippocampus (HC), orbital gyrus (OG), and cerebellum posterior lobe (CPL) were generated using WFU PickAtlas. The percentage change was defined as[100 × (measured volume with first segmented image - mean volume in each subject)/(mean volume in each subject)]The average percentage change was calculated as the percentage change in the 6 ROIs of the 10 subjects. The mean of the average percentage changes for each ROI was as follows: GM, 0.556%; WM, 0.324%; CSF, 0.573%; HC, 0.645%; OG, 1.74%; and CPL, 0.471%. The average percentage change was higher for the orbital gyrus than for the other ROIs. We consider that repeatability of the atlas-based method is similar between 0.4 and 1.5 tesla MR scanners. To our knowledge, this is the first report to show that the level of repeatability with a 0.4 tesla MR scanner is adequate for the estimation of brain volume change by the atlas-based method.

  12. BOREAS AFM-6 Surface Meteorological Data (United States)

    Wilczak, James; Hall, Forrest G. (Editor); Newcomer, Jeffrey A. (Editor); Smith, David E. (Technical Monitor)


    The Boreal Ecosystem-Atmosphere Study (BOREAS) Airborne Fluxes and Meteorology (AFM)-6 team from the National Oceanic and Atmospheric Adminsitration/Environment Technology Laboratory (NOAA/ETL) collected surface meteorological data from 21 May to 20 Sep 1994 near the Southern Study Area-Old Jack Pine (SSA-OJP) tower site. The data are in tabular ASCII files. The surface meteorological data are available from the Earth Observing System Data and Information System (EOSDIS) Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC). The data files are available on a CD-ROM (see document number 20010000884).

  13. Structural insight into iodide uptake by AFm phases. (United States)

    Aimoz, Laure; Wieland, Erich; Taviot-Guého, Christine; Dähn, Rainer; Vespa, Marika; Churakov, Sergey V


    The ability of cement phases carrying positively charged surfaces to retard the mobility of (129)I, present as iodide (I(-)) in groundwater, was investigated in the context of safe disposal of radioactive waste. (125)I sorption experiments on ettringite, hydrotalcite, chloride-, carbonate- and sulfate-containing AFm phases indicated that calcium-monosulfate (AFm-SO(4)) is the only phase that takes up trace levels of iodide. The structures of AFm phases prepared by coprecipitating iodide with other anions were investigated in order to understand this preferential uptake mechanism. X-ray diffraction (XRD) investigations showed a segregation of monoiodide (AFm-I(2)) and Friedel's salt (AFm-Cl(2)) for I-Cl mixtures, whereas interstratifications of AFm-I(2) and hemicarboaluminate (AFm-OH-(CO(3))(0.5)) were observed for the I-CO(3) systems. In contrast, XRD measurements indicated the formation of a solid solution between AFm-I(2) and AFm-SO(4) for the I-SO(4) mixtures. Extended X-ray absorption fine structure spectroscopy showed a modification of the coordination environment of iodine in I-CO(3) and in I-SO(4) samples compared to pure AFm-I(2). This is assumed to be due to the introduction of stacking faults in I-CO(3) samples on one hand and due to the presence of sulfate and associated space-filling water molecules as close neighbors in I-SO(4) samples on the other hand. The formation of a solid solution between AFm-I(2) and AFm-SO(4), with a short-range mixing of iodide and sulfate, implies that AFm-SO(4) bears the potential to retard (129)I.

  14. The repeatability and characteristics of right ventricular longitudinal strain imaging by speckle-tracking echocardiography in healthy dogs. (United States)

    Morita, T; Nakamura, K; Osuga, T; Yokoyama, N; Khoirun, N; Morishita, K; Sasaki, N; Ohta, H; Takiguchi, M


    To assess the repeatability and characteristics of echocardiographic indices of the right ventricular (RV) function derived from speckle-tracking echocardiography. Fourteen laboratory Beagles and 103 privately owned dogs without cardiac disease were involved in this study. Right ventricular longitudinal strain, strain rate, and a strain-related index for assessing RV dyssynchrony derived from speckle-tracking echocardiography were obtained by two different observers using five Beagles. Within-day, between-day, and interobserver coefficients of variation and the intraclass correlation coefficient of speckle-tracking echocardiography indices were determined. Both speckle-tracking echocardiography and conventional indices of RV function, including the peak velocity of systolic tricuspid annular motion, tricuspid annulus plane systolic excursion, fractional area change, and the Tei index, were obtained from 14 Beagles and 103 privately owned dogs. Relationships between echocardiographic indices and the body weight, heart rate, age, and sex were estimated by regression analysis. Speckle-tracking echocardiographic indices showed good within-day repeatability, between-day and interobserver repeatability were moderate to good. In large dogs, RV longitudinal strain, strain rate, and fractional area change were significantly decreased, while the index of RV dyssynchrony, systolic tricuspid annular motion, tricuspid annulus plane systolic excursion, and the Tei index were increased. All speckle-tracking and conventional echocardiographic indices were correlated with the body weight. The speckle-tracking echocardiography indices were highly repeatable and body weight affected speckle-tracking echocardiography indices in dogs. Further studies are needed to apply speckle-tracking echocardiography indices in dogs with cardiac disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Applications of AFM in semiconductor R&D and manufacturing at 45 nm technology node and beyond (United States)

    Lee, Moon-Keun; Shin, Minjung; Bao, Tianming; Song, Chul-Gi; Dawson, Dean; Ihm, Dong-Chul; Ukraintsev, Vladimir


    Continuing demand for high performance microelectronic products propelled integrated circuit technology into 45 nm node and beyond. The shrinking device feature geometry created unprecedented challenges for dimension metrology in semiconductor manufacturing and research and development. Automated atomic force microscope (AFM) has been used to meet the challenge and characterize narrower lines, trenches and holes at 45nm technology node and beyond. AFM is indispensable metrology techniques capable of non-destructive full three-dimensional imaging, surface morphology characterization and accurate critical dimension (CD) measurements. While all available dimensional metrology techniques approach their limits, AFM continues to provide reliable information for development and control of processes in memory, logic, photomask, image sensor and data storage manufacturing. In this paper we review up-todate applications of automated AFM in every mentioned above semiconductor industry sector. To demonstrate benefits of AFM at 45 nm node and beyond we compare capability of automated AFM with established in-line and off-line metrologies like critical dimension scanning electron microscopy (CDSEM), optical scatterometry (OCD) and transmission electronic microscopy (TEM).

  16. New AFM Techniques for Investigating Molecular Growth Mechanisms of Protein Crystals (United States)

    Li, Huayu; Nadarajah, Arunan; Konnert, John H.; Pusey, Marc L.


    Atomic Force Microscopy (AFM) has emerged as a powerful technique for investigating protein crystal growth. Earlier AFM studies were among the first to demonstrate that these crystals grew by dislocation and 2D nucleation growth mechanisms [1]. These investigations were restricted to the micron range where only surface features, such as dislocation hillocks and 2D islands are visible. Most AFM instruments can scan at higher resolutions and have the potential to resolve individual protein molecules at nanometer ranges. Such scans are essential for determining the molecular packing arrangements on crystal faces and for probing the growth process at the molecular level. However, at this resolution the AFM tip influences the image produced, with the resulting image being a convolution of the tip shape and the surface morphology [2]. In most studies this problem is resolved by deconvoluting the image to obtain the true surface morphology. Although deconvolution routines work reasonably well for simple one- dimensional shapes, for complex surfaces this approach does not produce accurate results. In this study we devised a new approach which takes advantage of the precise molecular order of crystal surfaces, combined with the knowledge of individual molecular shapes from the crystallographic data of the protein and the AFM tip shape. This information is used to construct expected theoretical AFM images by convoluting the tip shape with the constructed crystal surface shape for a given surface packing arrangement. By comparing the images from actual AFM scans with the constructed ones for different possible surface packing arrangements, the correct packing arrangement can be conclusively determined. This approach was used in this study to determine the correct one from two possible packing arrangements on (I 10) faces of tetragonal lysozyme crystals. Another novel AFM technique was also devised to measure the dimension of individual growth units of the crystal faces

  17. Repeatability of hypoxia PET imaging using [{sup 18}F]HX4 in lung and head and neck cancer patients: a prospective multicenter trial

    Energy Technology Data Exchange (ETDEWEB)

    Zegers, Catharina M.L.; Elmpt, Wouter van; Lambin, Philippe [Maastricht University Medical Centre, Department of Radiation Oncology (MAASTRO), GROW - School for Oncology and Developmental Biology, Maastricht (Netherlands); Szardenings, Katrin [Threshold Pharmaceuticals, South San Francisco, CA (United States); Kolb, Hartmuth; Chien, David [Siemens Medical Solutions USA, Inc., Siemens Molecular Imaging Biomarker Research, Culver City, CA (United States); Waxman, Alan [Cedars-Sinai Medical Center, Los Angeles, CA (United States); Subramaniam, Rathan M. [Boston University School of Medicine, Boston, MA (United States); Johns Hopkins Medical Institutions, Division of Nuclear Medicine, Russell H Morgan Department of Radiology and Radiologic Sciences, Baltimore, MD (United States); Moon, Dae Hyuk [University of Ulsan College of Medicine, Department of Nuclear Medicine, Asan Medical Center, Seoul (Korea, Republic of); Brunetti, Jacqueline C. [Holy Name Medical Center, Teaneck, NJ (United States); Srinivas, Shyam M. [Cleveland Clinic, Department of Nuclear Medicine, Imaging Institute, Cleveland, OH (United States)


    Hypoxia is an important factor influencing tumor progression and treatment efficacy. The aim of this study was to investigate the repeatability of hypoxia PET imaging with [{sup 18}F]HX4 in patients with head and neck and lung cancer. Nine patients with lung cancer and ten with head and neck cancer were included in the analysis (NCT01075399). Two sequential pretreatment [{sup 18}F]HX4 PET/CT scans were acquired within 1 week. The maximal and mean standardized uptake values (SUV{sub max} and SUV{sub mean}) were defined and the tumor-to-background ratios (TBR) were calculated. In addition, hypoxic volumes were determined as the volume of the tumor with a TBR >1.2 (HV{sub 1.2}). Bland Altman analysis of the uptake parameters was performed and coefficients of repeatability were calculated. To evaluate the spatial repeatability of the uptake, the PET/CT images were registered and a voxel-wise comparison of the uptake was performed, providing a correlation coefficient. All parameters of [{sup 18}F]HX4 uptake were significantly correlated between scans: SUV{sub max} (r = 0.958, p < 0.001), SUV{sub mean} (r = 0.946, p < 0.001), TBR{sub max} (r = 0.962, p < 0.001) and HV{sub 1.2} (r = 0.995, p < 0.001). The relative coefficients of repeatability were 15 % (SUV{sub mean}), 17 % (SUV{sub max}) and 17 % (TBR{sub max}). Voxel-wise analysis of the spatial uptake pattern within the tumors provided an average correlation of 0.65 ± 0.14. Repeated hypoxia PET scans with [{sup 18}F]HX4 provide reproducible and spatially stable results in patients with head and neck cancer and patients with lung cancer. [{sup 18}F]HX4 PET imaging can be used to assess the hypoxic status of tumors and has the potential to aid hypoxia-targeted treatments. (orig.)

  18. An In Vivo Evaluation of the Effect of Repeated Administration and Clearance of Targeted Contrast Agents on Molecular Imaging Signal Enhancement

    Directory of Open Access Journals (Sweden)

    Jason E. Streeter, Paul A. Dayton


    Full Text Available Competitive inhibition diminishes ligand adhesion as receptor sites become occupied with competing ligands. It is unknown if this effect occurs in ultrasound molecular imaging studies where endothelial binding sites become occupied with adherent bubbles or bubble fragments. The goal of this pilot study was to assess the effect that repeated administration and clearance of targeted agents has on successive adhesion. Two groups of animals were imaged with 3-D ultrasonic molecular imaging. Injections and imaging were performed on Group 1 at time 0 and 60 minutes. Group 2 received injections of microbubbles at 0, 15, 30, 45 and 60 minutes with imaging at 0 and 60 minutes. At 60 minutes, Group 1 targeting relative to baseline was not significantly different from Group 2 (1.06±0.27 vs. 1.08±0.34, p=0.93. Data suggest that multiple injections of targeted microbubbles do not block sufficient binding sites to bias molecular imaging data in serial studies.

  19. [AFM fishing of proteins under impulse electric field]. (United States)

    Ivanov, Yu D; Pleshakova, T O; Malsagova, K A; Kaysheva, A L; Kopylov, A T; Izotov, A A; Tatur, V Yu; Vesnin, S G; Ivanova, N D; Ziborov, V S; Archakov, A I


    A combination of (atomic force microscopy)-based fishing (AFM-fishing) and mass spectrometry allows to capture protein molecules from solutions, concentrate and visualize them on an atomically flat surface of the AFM chip and identify by subsequent mass spectrometric analysis. In order to increase the AFM-fishing efficiency we have applied pulsed voltage with the rise time of the front of about 1 ns to the AFM chip. The AFM-chip was made using a conductive material, highly oriented pyrolytic graphite (HOPG). The increased efficiency of AFM-fishing has been demonstrated using detection of cytochrome b5 protein. Selection of the stimulating pulse with a rise time of 1 ns, corresponding to the GHz frequency range, by the effect of intrinsic emission from water observed in this frequency range during water injection into the cell.

  20. An AFM-based pit-measuring method for indirect measurements of cell-surface membrane vesicles

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xiaojun [Nanoscale Science and Technology Laboratory, Institute for Advanced Study, Nanchang University, Nanchang, Jiangxi 330031 (China); Department of Biotechnology, Nanchang University, Nanchang, Jiangxi 330031 (China); Chen, Yuan [Nanoscale Science and Technology Laboratory, Institute for Advanced Study, Nanchang University, Nanchang, Jiangxi 330031 (China); Chen, Yong, E-mail: [Nanoscale Science and Technology Laboratory, Institute for Advanced Study, Nanchang University, Nanchang, Jiangxi 330031 (China); Department of Biotechnology, Nanchang University, Nanchang, Jiangxi 330031 (China)


    Highlights: • Air drying induced the transformation of cell-surface membrane vesicles into pits. • An AFM-based pit-measuring method was developed to measure cell-surface vesicles. • Our method detected at least two populations of cell-surface membrane vesicles. - Abstract: Circulating membrane vesicles, which are shed from many cell types, have multiple functions and have been correlated with many diseases. Although circulating membrane vesicles have been extensively characterized, the status of cell-surface membrane vesicles prior to their release is less understood due to the lack of effective measurement methods. Recently, as a powerful, micro- or nano-scale imaging tool, atomic force microscopy (AFM) has been applied in measuring circulating membrane vesicles. However, it seems very difficult for AFM to directly image/identify and measure cell-bound membrane vesicles due to the similarity of surface morphology between membrane vesicles and cell surfaces. Therefore, until now no AFM studies on cell-surface membrane vesicles have been reported. In this study, we found that air drying can induce the transformation of most cell-surface membrane vesicles into pits that are more readily detectable by AFM. Based on this, we developed an AFM-based pit-measuring method and, for the first time, used AFM to indirectly measure cell-surface membrane vesicles on cultured endothelial cells. Using this approach, we observed and quantitatively measured at least two populations of cell-surface membrane vesicles, a nanoscale population (<500 nm in diameter peaking at ∼250 nm) and a microscale population (from 500 nm to ∼2 μm peaking at ∼0.8 μm), whereas confocal microscopy only detected the microscale population. The AFM-based pit-measuring method is potentially useful for studying cell-surface membrane vesicles and for investigating the mechanisms of membrane vesicle formation/release.

  1. Effects of the AFM tip trace on nanobundles formation on the polymer surface

    Energy Technology Data Exchange (ETDEWEB)

    Yan Yongda, E-mail: [Key Laboratory of Micro-systems and Micro-structures Manufacturing of Ministry of Education, Harbin Institute of Technology, Harbin, Heilongjiang 150001 (China); Center for Precision Engineering, Harbin Institute of Technology, Harbin, Heilongjiang 150001 (China); Sun Yang; Yang Yanting; Hu Zhenjiang [Key Laboratory of Micro-systems and Micro-structures Manufacturing of Ministry of Education, Harbin Institute of Technology, Harbin, Heilongjiang 150001 (China); Center for Precision Engineering, Harbin Institute of Technology, Harbin, Heilongjiang 150001 (China); Zhao Xuesen [Center for Precision Engineering, Harbin Institute of Technology, Harbin, Heilongjiang 150001 (China)


    Highlights: Black-Right-Pointing-Pointer The AFM tip is used to scratch the PC surface once to form nanobundle structures. Black-Right-Pointing-Pointer Effects of the tip trace on bundles formation are studied based on a modified AFM. Black-Right-Pointing-Pointer The sample scanning mode is feasible for perfect nanobundle structures formation. - Abstract: Atomic Force Microscope (AFM) has become a popular experimental tool for the nanotribological studies. Nanobundles formation perpendicular to the scanning direction has been reported as a typical wear mode for the thermoplastics, and such bundle structures are also considered as sinusoidal wave micro-/nanostructures now. In the present study, the AFM tip based nanomechanical machining method is employed to scratch a polymer Polycarbonate (PC) surface for only once with the normal load of several micro-Newtons in order to achieve the perfect regular nanobundle structures. Based on a modified AFM system, effects of different tip traces in the tip scanning mode and in the sample scanning mode on nanobundles formation on the PC surface are studied. The experimental results show that the controlled reciprocal movement of the stage in the sample scanning mode is feasible for perfect nanobundle structures formation. Moreover, effects of the normal load and the feed on bundles formation in the sample scanning mode are analyzed. Experimental results reveal that the feed value directly affects the formed patterns including the bundles and grooves structures. The reciprocal effect of the tip trace is the decisive factor of forming ideal nanobundles. The repeating times on the same area acted by the tip which are larger than twice are necessary to form a perfect nanobundle structure.

  2. Inter- and Intra-Observer Repeatability of Quantitative Whole-Body, Diffusion-Weighted Imaging (WBDWI in Metastatic Bone Disease.

    Directory of Open Access Journals (Sweden)

    Matthew D Blackledge

    Full Text Available Quantitative whole-body diffusion-weighted MRI (WB-DWI is now possible using semi-automatic segmentation techniques. The method enables whole-body estimates of global Apparent Diffusion Coefficient (gADC and total Diffusion Volume (tDV, both of which have demonstrated considerable utility for assessing treatment response in patients with bone metastases from primary prostate and breast cancers. Here we investigate the agreement (inter-observer repeatability between two radiologists in their definition of Volumes Of Interest (VOIs and subsequent assessment of tDV and gADC on an exploratory patient cohort of nine. Furthermore, each radiologist was asked to repeat his or her measurements on the same patient data sets one month later to identify the intra-observer repeatability of the technique. Using a Markov Chain Monte Carlo (MCMC estimation method provided full posterior probabilities of repeatability measures along with maximum a-posteriori values and 95% confidence intervals. Our estimates of the inter-observer Intraclass Correlation Coefficient (ICCinter for log-tDV and median gADC were 1.00 (0.97-1.00 and 0.99 (0.89-0.99 respectively, indicating excellent observer agreement for these metrics. Mean gADC values were found to have ICCinter = 0.97 (0.81-0.99 indicating a slight sensitivity to outliers in the derived distributions of gADC. Of the higher order gADC statistics, skewness was demonstrated to have good inter-user agreement with ICCinter = 0.99 (0.86-1.00, whereas gADC variance and kurtosis performed relatively poorly: 0.89 (0.39-0.97 and 0.96 (0.69-0.99 respectively. Estimates of intra-observer repeatability (ICCintra demonstrated similar results: 0.99 (0.95-1.00 for log-tDV, 0.98 (0.89-0.99 and 0.97 (0.83-0.99 for median and mean gADC respectively, 0.64 (0.25-0.88 for gADC variance, 0.85 (0.57-0.95 for gADC skewness and 0.85 (0.57-0.95 for gADC kurtosis. Further investigation of two anomalous patient cases revealed that a very small

  3. Single molecule transcription profiling with AFM

    Energy Technology Data Exchange (ETDEWEB)

    Reed, Jason [Department of Chemistry and Biochemistry, UCLA, Los Angeles, CA 90095 (United States); Mishra, Bud [Departments of Computer Science and Mathematics, Courant Institute of Mathematical Sciences, New York University, New York, NY 10012 (United States); Pittenger, Bede [Veeco Instruments, Santa Barbara, CA 93117 (United States); Magonov, Sergei [Veeco Instruments, Santa Barbara, CA 93117 (United States); Troke, Joshua [Department of Pathology and Center for Cell Control, an NIH Nanomedicine Development Center, UCLA, Los Angeles, CA 90095 (United States); Teitell, Michael A [Department of Pathology and Center for Cell Control, an NIH Nanomedicine Development Center, UCLA, Los Angeles, CA 90095 (United States); Gimzewski, James K [Department of Chemistry and Biochemistry, UCLA, Los Angeles, CA 90095 (United States)


    Established techniques for global gene expression profiling, such as microarrays, face fundamental sensitivity constraints. Due to greatly increasing interest in examining minute samples from micro-dissected tissues, including single cells, unorthodox approaches, including molecular nanotechnologies, are being explored in this application. Here, we examine the use of single molecule, ordered restriction mapping, combined with AFM, to measure gene transcription levels from very low abundance samples. We frame the problem mathematically, using coding theory, and present an analysis of the critical error sources that may serve as a guide to designing future studies. We follow with experiments detailing the construction of high density, single molecule, ordered restriction maps from plasmids and from cDNA molecules, using two different enzymes, a result not previously reported. We discuss these results in the context of our calculations.

  4. BOREAS AFM-06 Mean Wind Profile Data (United States)

    Wilczak, James; Hall, Forrest G. (Editor); Newcomer, Jeffrey A. (Editor); Smith, David E. (Technical Monitor)


    The Boreal Ecosystem-Atmosphere Study (BOREAS) Airborne Fluxes and Meteorology (AFM)-6 team from the National Oceanic and Atmospheric Administration/Environment Technology Laboratory (NOAA/ETL) operated a 915-MHz wind/Radio Acoustic Sounding System (RASS) profiler system in the Southern Study Area (SSA) near the Old Jack Pine (OJP) tower from 21 May 1994 to 20 Sep 1994. The data set provides wind profiles at 38 heights, containing the variables of wind speed; wind direction; and the u-, v-, and w-components of the total wind. The data are stored in tabular ASCII files. The mean wind profile data are available from the Earth Observing System Data and Information System (EOSDIS) Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC). The data files are available on a CD-ROM (see document number 20010000884).

  5. BOREAS AFM-6 Boundary Layer Height Data (United States)

    Wilczak, James; Hall, Forrest G. (Editor); Newcomer, Jeffrey A. (Editor); Smith, David E. (Technical Monitor)


    The Boreal Ecosystem-Atmosphere Study (BOREAS) Airborne Fluxes and Meteorology (AFM)-6 team from National Oceanic and Atmospheric Adminsitration/Environment Technology Laboratory (NOAA/ETL) operated a 915-MHz wind/Radio Acoustic Sounding System (RASS) profiler system in the Southern Study Area (SSA) near the Old Jack Pine (OJP) site. This data set provides boundary layer height information over the site. The data were collected from 21 May 1994 to 20 Sep 1994 and are stored in tabular ASCII files. The boundary layer height data are available from the Earth Observing System Data and Information System (EOSDIS) Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC). The data files are available on a CD-ROM (see document number 20010000884).

  6. BOREAS AFM-06 Mean Temperature Profile Data (United States)

    Wilczak, James; Hall, Forrest G. (Editor); Newcomer, Jeffrey A. (Editor); Smith, David E. (Technical Monitor)


    The Boreal Ecosystem-Atmosphere Study (BOREAS) Airborne Fluxes and Meteorology (AFM)-6 team from the National Oceanic and Atmospheric Adminsitration/Environment Technology Laboratory (NOAA/ETL) operated a 915-MHz wind/Radio Acoustic Sounding System (RASS) profiler system in the Southern Study Area (SSA) near the Old Jack Pine (OJP) tower from 21 May 1994 to 20 Sep 1994. The data set provides temperature profiles at 15 heights, containing the variables of virtual temperature, vertical velocity, the speed of sound, and w-bar. The data are stored in tabular ASCII files. The mean temperature profile data are available from the Earth Observing System Data and Information System (EOSDIS) Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC). The data files are available on a CD-ROM (see document number 20010000884).

  7. AFM study of steel corrosion in aqueous solutions in concrete

    Directory of Open Access Journals (Sweden)

    Díaz-Benito, B.


    Full Text Available Early corrosion stages are studied in carbon steel by means of a solution simulating that contained in concrete pores. Non-carbonated solution contains 5% NaCl. The atomic force microscopy (AFM technique is used to study material performance after different immersion times (up to 48 h. Obtained data are compared to electrochemical ones (corrosion potential and polarization resistance. Analysis of images and roughness evolution along time shows that steel initially tends to reach passivity, although the passive layer rapidly loses its protective character due to chloride attack.

    Este trabajo estudia los primeros estados de la corrosión de un acero al carbono en una disolución que simula la existente en los poros del hormigón, sin carbonatar, con un 5% de NaCl. Para ello, se ha empleado la técnica de microscopía de fuerza atómica (AFM, estudiando el comportamiento del material tras diferentes tiempos de inmersión, hasta 48 h, en la disolución. Estos datos se comparan con datos electroquímicos (potencial de corrosión y resistencia de polarización. El análisis de las imágenes y la evolución de la rugosidad con el tiempo muestran que el acero tiende inicialmente a pasivarse, pero la capa pasiva pierde rápidamente su carácter protector debido al ataque de los cloruros.

  8. AFM Studies of Lunar Soils and Application to the Mars 2001 Mission (United States)

    Weitz, C. M.; Anderson, M. S.; Marshall, J.


    The upcoming Mars 01 mission will carry an Atomic Force Microscope (AFM) as part of the Mars Environmental Compatibility Assessment (MECA) instrument. By operating in a tapping mode, the AFM is capable of sub-nanometer resolution in three dimensions and can distinguish between substances of different compositions by employing phase contrast imaging. To prepare for the Mars 01 mission, we are testing the AFM on a lunar soil to determine its ability to define particle shapes and sizes and grain-surface textures. The test materials are from the Apollo 17 soil 79221, which is a mixture of agglutinates, impact and volcanic beads, and mare and highland rock and mineral fragments. The majority of the lunar soil particles are less than 100 microns in size, comparable to the sizes estimated for martian dust. We have used the AFM to examine several different soil particles at various resolutions. The instrument has demonstrated the ability to identify parallel ridges characteristic of twinning on a 150 micron plagioclase feldspar particle. Extremely small (10-100 nanometer) adhering particles are visible on the surface of the feldspar grain, and they appear elongate with smooth surfaces. Phase contrast imaging of the nanometer particles shows several compositions to be present. When the AFM was applied to a 100 micron glass spherule, it was possible to define an extremely smooth surface; this is in clear contrast to results from a basalt fragment which exhibited a rough surface texture. Also visible on the surface of the glass spherule were chains of 100 nanometer and smaller impact melt droplets. For the '01 Mars mission, the AFM is intended to define the size and shape distributions of soil particles, in combination with the NMCA optical microscope system and images from the Robot Arm Camera (RAC). These three data sets will provide a means of assessing potentially hazardous soil and dust properties. The study that we have conducted on the lunar soils now suggests that the

  9. Spin-3/2 Ising model AFM/AFM two-layer lattice with crystal field

    Institute of Scientific and Technical Information of China (English)

    Erhan Albayrak; Ali Yigit


    The spin-3/2 Ising model is investigated for the case of antiferromagnetic (AFM/AFM) interactions on the two-layer Bethe lattice by using the exact recursion relations in the pairwise approach for given coordination numbers q = 3, 4 and 6 when the layers are under the influences of equal external magnetic and equal crystal fields. The ground state, (GS) phase diagrams are obtained on the different planes in detail and then the temperature-dependent phase diagrams of the system are calculated accordingly. It is observed that the system presents both second- and first-order phase transitions for all q, therefore, tricritical points. It is also found that the system exhibits double-critical end points and isolated points. The model aiso presents two Néel temperatures, T_N, and the existence of which leads to the reentrant behaviour.

  10. Characterization of regional left ventricular function in nonhuman primates using magnetic resonance imaging biomarkers: a test-retest repeatability and inter-subject variability study.

    Directory of Open Access Journals (Sweden)

    Smita Sampath

    Full Text Available Pre-clinical animal models are important to study the fundamental biological and functional mechanisms involved in the longitudinal evolution of heart failure (HF. Particularly, large animal models, like nonhuman primates (NHPs, that possess greater physiological, biochemical, and phylogenetic similarity to humans are gaining interest. To assess the translatability of these models into human diseases, imaging biomarkers play a significant role in non-invasive phenotyping, prediction of downstream remodeling, and evaluation of novel experimental therapeutics. This paper sheds insight into NHP cardiac function through the quantification of magnetic resonance (MR imaging biomarkers that comprehensively characterize the spatiotemporal dynamics of left ventricular (LV systolic pumping and LV diastolic relaxation. MR tagging and phase contrast (PC imaging were used to quantify NHP cardiac strain and flow. Temporal inter-relationships between rotational mechanics, myocardial strain and LV chamber flow are presented, and functional biomarkers are evaluated through test-retest repeatability and inter subject variability analyses. The temporal trends observed in strain and flow was similar to published data in humans. Our results indicate a dominant dimension based pumping during early systole, followed by a torsion dominant pumping action during late systole. Early diastole is characterized by close to 65% of untwist, the remainder of which likely contributes to efficient filling during atrial kick. Our data reveal that moderate to good intra-subject repeatability was observed for peak strain, strain-rates, E/circumferential strain-rate (CSR ratio, E/longitudinal strain-rate (LSR ratio, and deceleration time. The inter-subject variability was high for strain dyssynchrony, diastolic strain-rates, peak torsion and peak untwist rate. We have successfully characterized cardiac function in NHPs using MR imaging. Peak strain, average systolic strain

  11. Detection of the Sidewall of a Micro Structure Based on Torsional Resonance Mode 3 D-AFM%基于扭转谐振模式3D-AFM的微结构侧壁形貌检测

    Institute of Scientific and Technical Information of China (English)

    刘璐; 徐建国; 吴森; 张锐; 徐临燕; 胡晓东


    To measure the critical dimensions of the sidewall of micro structures of semiconductor de-vices, a three dimensional atomic force microscope (3D-AFM) system was established.A cantilever probe with a flared tip was used in this 3D-AFM and the 3D-AFM was operated in torsional resonance mode for sidewall detection.We firstly gave a brief introduction of the system design, and then presented a series of experiments which obtained the lateral sensitivity of the system and showed the variation of the cantilever oscillation with respect to the tip-sample distance.By using this 3D-AFM system, the line-scanning and area-scanning were processed on the sidewall of a grid sample.The profile image had good repeatability and was in accord with the result of a conventional tapping mode measurement, showing that the presented 3D-AFM system as well as the torsional resonance mode can be applied to sidewall detec-tion.%针对半导体器件微结构侧壁关键尺寸检测需求,设计了一套三维原子力显微镜(3D-AFM)系统.该系统采用针尖末梢为喇叭口形的悬臂梁探针,以扭转谐振模式实现横向轻敲扫描.介绍了该3D-AFM系统的结构组成和工作原理,对系统的横向检测灵敏度进行了标定,获得了喇叭口针尖与样品侧壁横向接近过程中探针扭转振幅的变化曲线.利用该系统对栅格标样侧壁局部形貌进行了线扫描和面扫描,所得轮廓具有较好的重复性,且测量所得形貌特征与常规轻敲模式扫描结果一致,表明本文所述3D-AFM系统及工作模式能够用于微结构侧壁形貌的检测.

  12. Brain Tumor Classification Using AFM in Combination with Data Mining Techniques

    Directory of Open Access Journals (Sweden)

    Marlene Huml


    Full Text Available Although classification of astrocytic tumors is standardized by the WHO grading system, which is mainly based on microscopy-derived, histomorphological features, there is great interobserver variability. The main causes are thought to be the complexity of morphological details varying from tumor to tumor and from patient to patient, variations in the technical histopathological procedures like staining protocols, and finally the individual experience of the diagnosing pathologist. Thus, to raise astrocytoma grading to a more objective standard, this paper proposes a methodology based on atomic force microscopy (AFM derived images made from histopathological samples in combination with data mining techniques. By comparing AFM images with corresponding light microscopy images of the same area, the progressive formation of cavities due to cell necrosis was identified as a typical morphological marker for a computer-assisted analysis. Using genetic programming as a tool for feature analysis, a best model was created that achieved 94.74% classification accuracy in distinguishing grade II tumors from grade IV ones. While utilizing modern image analysis techniques, AFM may become an important tool in astrocytic tumor diagnosis. By this way patients suffering from grade II tumors are identified unambiguously, having a less risk for malignant transformation. They would benefit from early adjuvant therapies.

  13. Brain tumor classification using AFM in combination with data mining techniques. (United States)

    Huml, Marlene; Silye, René; Zauner, Gerald; Hutterer, Stephan; Schilcher, Kurt


    Although classification of astrocytic tumors is standardized by the WHO grading system, which is mainly based on microscopy-derived, histomorphological features, there is great interobserver variability. The main causes are thought to be the complexity of morphological details varying from tumor to tumor and from patient to patient, variations in the technical histopathological procedures like staining protocols, and finally the individual experience of the diagnosing pathologist. Thus, to raise astrocytoma grading to a more objective standard, this paper proposes a methodology based on atomic force microscopy (AFM) derived images made from histopathological samples in combination with data mining techniques. By comparing AFM images with corresponding light microscopy images of the same area, the progressive formation of cavities due to cell necrosis was identified as a typical morphological marker for a computer-assisted analysis. Using genetic programming as a tool for feature analysis, a best model was created that achieved 94.74% classification accuracy in distinguishing grade II tumors from grade IV ones. While utilizing modern image analysis techniques, AFM may become an important tool in astrocytic tumor diagnosis. By this way patients suffering from grade II tumors are identified unambiguously, having a less risk for malignant transformation. They would benefit from early adjuvant therapies.

  14. Dynamic FDG PET/CT imaging with diuresis demonstrates an enterovesical fistula in a lymphoma patient with repeated colon diverticulitis. (United States)

    Kao, Pan-Fu; Ting, Wen-Chien; Hsiao, Pei-Ching; Kao, Yu-Lin; Chang, Pai-Jung; Lee, Jong-Kang


    A 43-year-old male patient with follicular B-cell lymphoma was referred for a FDG PET/CT scan due to severe left lower abdominal pain to rule out recurrent cancer. These FDG PET/CT images and previous FDG PET/CT images 5 months ago both revealed an air bubble in the urinary bladder on the CT images. He had a recurrent urinary tract infection history for 6 months. A list-mode dynamic data acquisition with diuresis intravenous injection revealed linear FDG activity extending from the upper-left portion of the bladder to a soft tissue mass in the lower-left pelvic region. An enterovesical fistula was confirmed by surgery.

  15. Versatile method for AFM-tip functionalization with biomolecules: fishing a ligand by means of an in situ click reaction (United States)

    Kumar, Rakesh; Ramakrishna, Shivaprakash N.; Naik, Vikrant V.; Chu, Zonglin; Drew, Michael E.; Spencer, Nicholas D.; Yamakoshi, Yoko


    A facile and universal method for the functionalization of an AFM tip has been developed for chemical force spectroscopy (CFS) studies of intermolecular interactions of biomolecules. A click reaction between tripod-acetylene and an azide-linker-ligand molecule was successfully carried out on the AFM tip surface and used for the CFS study of ligand-receptor interactions.A facile and universal method for the functionalization of an AFM tip has been developed for chemical force spectroscopy (CFS) studies of intermolecular interactions of biomolecules. A click reaction between tripod-acetylene and an azide-linker-ligand molecule was successfully carried out on the AFM tip surface and used for the CFS study of ligand-receptor interactions. Electronic supplementary information (ESI) available: Experimental details with synthesis and characterization of compounds. Procedures for modifications of Au surfaces and AFM tips. AFM images and full PM-IRRAS spectra of modified surfaces. Detailed procedure for QCM measurement. A table showing ligand-receptor interaction probability. NMR, IR and MS charts. See DOI: 10.1039/c5nr01495f

  16. Advanced fabrication process for combined atomic force-scanning electrochemical microscopy (AFM-SECM) probes. (United States)

    Eifert, Alexander; Mizaikoff, Boris; Kranz, Christine


    An advanced software-controlled focused ion beam (FIB) patterning process for the fabrication of combined atomic force-scanning electrochemical microscopy (AFM-SECM) probes is reported. FIB milling is a standard process in scanning probe microscopy (SPM) for specialized SPM probe fabrication. For AFM-SECM, milling of bifunctional probes usually requires several milling steps. Milling such complex multi-layer/multi-material structures using a single milling routine leads to significantly reduced fabrication times and costs. Based on an advanced patterning routine, a semi-automated FIB milling routine for fabricating combined AFM-SECM probes with high reproducibility is presented with future potential for processing at a wafer level. The fabricated bifunctional probes were electrochemically characterized using cyclic voltammetry, and their performance for AFM-SECM imaging experiments was tested. Different insulation materials (Parylene-C and SixNy) have been evaluated with respect to facilitating the overall milling process, the influence on the electrochemical behavior and the long-term stability of the obtained probes. Furthermore, the influence of material composition and layer sequence to the overall shape and properties of the combined probes were evaluated.

  17. Helium ion beam induced growth of hammerhead AFM probes

    NARCIS (Netherlands)

    Nanda, G.; Veldhoven, E. van; Maas, D.J.; Sadeghian Marnani, H.; Alkemade, P.F.A.


    The authors report the direct-write growth of hammerhead atomic force microscope (AFM) probes by He+ beam induced deposition of platinum-carbon. In order to grow a thin nanoneedle on top of a conventional AFM probe, the authors move a focused He+ beam during exposure to a PtC precursor gas. In the f

  18. Fabrication and analysis of cylindrical resin AFM microcantilevers

    Energy Technology Data Exchange (ETDEWEB)

    Cheneler, D., E-mail: [School of Mechanical Engineering, The University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom); Bowen, J. [School of Chemical Engineering, The University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom); Leigh, S.J.; Purssell, C.P.; Billson, D.R.; Hutchins, D.A. [School of Engineering, University of Warwick, Coventry CV4 7AL (United Kingdom); Ward, M.C.L. [School of Mechanical Engineering, The University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom)


    In this paper a new method of fabricating cylindrical resin microcantilevers using the Direct Digital Manufacturing (DDM) technique of Micro-stereolithography (MSL) is described. The method is rapid and commercially viable, allowing the fabrication of atomic force microscope (AFM) cantilevers which exhibit much larger spring constants than those currently commercial available. This allows for experimentation in a force regime orders of magnitude higher than currently possible using the AFM. This makes these cantilevers ideally suited for AFM-based depth sensing indentation. Due to their geometry, the assumptions used in the standard Euler-Bernoulli beam theory usually used to analyse AFM cantilevers may no longer be valid. Therefore approximate analytical solutions based on Timoshenko beam theory have been derived for the stiffness and resonant frequency of these cantilevers. Prototypes of the cantilevers have been fabricated and tested. Results show good agreement between experiment and theory. -- Highlights: {yields} Direct Digital Manufacturing (DDM) has been used to make commercially viable AFM cantilevers. {yields} Analytical expressions for resonant frequency of Timoshenko beams has been derived. {yields} Dynamics of cylindrical AFM cantilevers has been discussed. {yields} Expressions for dynamic properties of conical AFM cantilevers has been derived. {yields} Effect of metallisation of cylindrical AFM cantilevers has been discussed.

  19. Measurement of Surface Displacement and Deformation of Mass Movements Using Least Squares Matching of Repeat High Resolution Satellite and Aerial Images

    Directory of Open Access Journals (Sweden)

    Misganu Debella-Gilo


    Full Text Available Displacement and deformation are fundamental measures of Earth surface mass movements such as glacier flow, rockglacier creep and rockslides. Ground-based methods of monitoring such mass movements can be costly, time consuming and limited in spatial and temporal coverage. Remote sensing techniques, here matching of repeat optical images, are increasingly used to obtain displacement and deformation fields. Strain rates are usually computed in a post-processing step based on the gradients of the measured velocity field. This study explores the potential of automatically and directly computing velocity, rotation and strain rates on Earth surface mass movements simultaneously from the matching positions and the parameters of the geometric transformation models using the least squares matching (LSM approach. The procedures are exemplified using bi-temporal high resolution satellite and aerial images of glacier flow, rockglacier creep and land sliding. The results show that LSM matches the images and computes longitudinal strain rates, transverse strain rates and shear strain rates reliably with mean absolute deviations in the order of 10−4 (one level of significance below the measured values as evaluated on stable grounds. The LSM also improves the accuracy of displacement estimation of the pixel-precision normalized cross-correlation by over 90% under ideal (simulated circumstances and by about 25% for real multi-temporal images of mass movements.

  20. Fabrication and buckling dynamics of nanoneedle AFM probes

    Energy Technology Data Exchange (ETDEWEB)

    Beard, J D; Gordeev, S N, E-mail: [Department of Physics, University of Bath, Claverton Down, Bath BA2 7AY (United Kingdom)


    A new method for the fabrication of high-aspect-ratio probes by electron beam induced deposition is described. This technique allows the fabrication of cylindrical 'nanoneedle' structures on the atomic force microscope (AFM) probe tip which can be used for accurate imaging of surfaces with high steep features. Scanning electron microscope (SEM) imaging showed that needles with diameters in the range of 18-100 nm could be obtained by this technique. The needles were shown to undergo buckling deformation under large tip-sample forces. The deformation was observed to recover elastically under vertical deformations of up to {approx} 60% of the needle length, preventing damage to the needle. A technique of stabilizing the needle against buckling by coating it with additional electron beam deposited carbon was also investigated; it was shown that coated needles of 75 nm or greater total diameter did not buckle even under tip-sample forces of {approx} 1.5 {mu}N.

  1. Fluorescence Imaging of Hepatocellular Carcinoma Cells Labeled with Gold Nanorods and Detection by AFM%金纳米棒标记HepG2人肝癌细胞的荧光成像及其AFM探测

    Institute of Scientific and Technical Information of China (English)

    孙桂敏; 杨培慧; 孙俊环; 蔡继业


    金纳米棒具有独特的光学性质,在生物医学领域有着广泛而重要的应用前景.本文制备了长径比为8∶1的金纳米棒,其在480 nm波长激发下,在560 nm和707 nm波长处有两个荧光发射峰.基于金纳米棒的荧光性质,将其标记于HepG2人肝癌细胞表面,利用激光扫描共聚焦显微镜对标记后的细胞进行荧光成像.在488 nm激发下,获得了绿色和红色两种颜色的荧光图像,并进一步用高分辨率的原子力显微镜探测了GNRs标记后细胞形貌及机械性质的变化.%Due to the unique and tunable optical properties, gold nanorods have potential and important applications in the biomedical field. In this paper, gold nanorods with the aspect ratio 8 were prepared, an outstanding fluorescence feature of the gold nanorods excited at 480 ran was observed in terms of a strong fluorescence emission at 707 nm and a relatively weak fluorescence at 560 nm. Based on their fluorescence properties , HepG2 cells were labeled by this type of gold nanorods, and were studied by using laser scanning confocal microscope. Green and red fluorescence images of gold nanorods were collected under the excitation of 488 nm. Furthermore, high-resolution atomic force microscopy was used to obtain the morphology and mechanical properties changes of the HepGz cells.

  2. BOREAS AFM-07 SRC Surface Meteorological Data (United States)

    Osborne, Heather; Hall, Forrest G. (Editor); Newcomer, Jeffrey A. (Editor); Young, Kim; Wittrock, Virginia; Shewchuck, Stan; Smith, David E. (Technical Monitor)


    The Saskatchewan Research Council (SRC) collected surface meteorological and radiation data from December 1993 until December 1996. The data set comprises Suite A (meteorological and energy balance measurements) and Suite B (diffuse solar and longwave measurements) components. Suite A measurements were taken at each of ten sites, and Suite B measurements were made at five of the Suite A sites. The data cover an approximate area of 500 km (North-South) by 1000 km (East-West) (a large portion of northern Manitoba and northern Saskatchewan). The measurement network was designed to provide researchers with a sufficient record of near-surface meteorological and radiation measurements. The data are provided in tabular ASCII files, and were collected by Aircraft Flux and Meteorology (AFM)-7. The surface meteorological and radiation data are available from the Earth Observing System Data and Information System (EOSDIS) Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC). The data files are available on a CD-ROM (see document number 20010000884).

  3. The necessity of repeated assessment of imaging studies contained in medical records in medico-legal opinions

    Directory of Open Access Journals (Sweden)

    Aleksandra Borowska-Solonynko


    Full Text Available The paper presents two case reports of living victims, in which imaging studies of the chest conducted at a medical facility were an essential part of the medico-legal opinion. The first case was that of a young male hospitalized due to CT evidence of bilateral rib fractions, who claimed to have been assaulted by police officers. The other case was that of a six week old baby hospitalized due to chest X-ray evidence of right hand side rib fractions. The chest X-ray was performed due to one bruise found on the baby’s forehead and two small bruises on the back, which gave rise to suspicions of child abuse. In both cases, expert witnesses in radiology definitively excluded the presence of any fractures. These cases indicate that a new assessment of imaging studies contained in medical records is needed. Expert opinions based solely on the description of imaging studies may result in grave consequences.

  4. Direct observation of hydration of TiO 2 on Ti using electrochemical AFM: freely corroding versus potentiostatically held (United States)

    Bearinger, Jane P.; Orme, Christine A.; Gilbert, Jeremy L.


    Hydration of titanium/titanium oxide surfaces under freely corroding and potentiostatically held conditions has been characterized using electrochemical atomic force microscopy (EC AFM). In contrast to conventional high vacuum techniques, AFM enables measurement of morphological surface structure in the in situ hydrated state. Electrochemical probes in the imaging environment further enable acquisition of electrical characteristics during AFM imaging. Experiments were performed on etched, electropolished commercially pure titanium. As noted by direct observation and corroborated by power spectral density (Fourier analysis) measurements, oxide domes cover the titanium surface and grow laterally during hydration. Applied potential altered the growth rate. Under open circuit potential conditions, growth proceeded approximately six times faster than under a -1 V applied voltage ( 1098±52 nm2/ min ± versus 184.84±19 nm2/min). Film growth increased electrical resistance and lowered interfacial capacitance based on step polarization impedance spectroscopy tests.

  5. Deployment Repeatability (United States)


    controlled to great precision, but in a Cubesat , there may be no attitude determination at all. Such a Cubesat might treat sun angle and tumbling rates as...could be sensitive to small differences in motor controller timing. In these cases, the analyst might choose to model the entire deployment path, with...knowledge of the material damage model or motor controller timing precision. On the other hand, if many repeated and environmentally representative

  6. In situ Stiffness Adjustment of AFM Probes by Two Orders of Magnitude. (United States)

    de Laat, Marcel Lambertus Cornelis; Pérez Garza, Héctor Hugo; Ghatkesar, Murali Krishna


    The choice on which type of cantilever to use for Atomic Force Microscopy (AFM) depends on the type of the experiment being done. Typically, the cantilever has to be exchanged when a different stiffness is required and the entire alignment has to be repeated. In the present work, a method to adjust the stiffness in situ of a commercial AFM cantilever is developed. The adjustment is achieved by changing the effective length of the cantilever by electrostatic pull-in. By applying a voltage between the cantilever and an electrode (with an insulating layer at the point of contact), the cantilever snaps to the electrode, reducing the cantilever's effective length. An analytical model was developed to find the pull-in voltage of the system. Subsequently, a finite element model was developed to study the pull-in behavior. The working principle of this concept is demonstrated with a proof-of-concept experiment. The electrode was positioned close to the cantilever by using a robotic nanomanipulator. To confirm the change in stiffness, the fundamental resonance frequency of the cantilever was measured for varying electrode positions. The results match with the theoretical expectations. The stiffness was adjusted in situ in the range of 0.2 N/m to 27 N/m, covering two orders of magnitude in one single cantilever. This proof-of-concept is the first step towards a micro fabricated prototype, that integrates the electrode positioning system and cantilever that can be used for actual AFM experiments.

  7. Feedback from an image of finger and an actual finger produce similar prismatic after-effect: a repeated measures study

    DEFF Research Database (Denmark)

    Wilms, Inge Linda; Assentoft, Emilie


    by seeing their fingertip. In the second condition subjects saw an image of a fingertip. The results indicate that the two conditions are significantly different. The study is an important step in understanding what actually makes a difference in training when trying to convert paper-and-pencil training...... if it is the format rather than the indirectness of the feedback creating this difference. 27 healthy subjects were subjected to a single session of Prism Adaptation Training under two different feedback conditions. In the first feedback condition, subjects were exposed to visual feedback on pointing precision...

  8. Structural impact of cations on lipid bilayer models: nanomechanical properties by AFM-force spectroscopy. (United States)

    Redondo-Morata, Lorena; Giannotti, Marina I; Sanz, Fausto


    Atomic Force Microscopy (AFM) has become an invaluable tool for studying the micro- and nanoworlds. As a stand-alone, high-resolution imaging technique and force transducer, it defies most other surface instrumentation in ease of use, sensitivity and versatility. The main strength of AFM relies on the possibility to operate in an aqueous environment on a wide variety of biological samples, from single molecules - DNA or proteins - to macromolecular assemblies like biological membranes. Understanding the effect of mechanical stress on membranes is of primary importance in biophysics, since cells are known to perform their function under a complex combination of forces. In the later years, AFM-based Force-Spectroscopy (AFM-FS) has provided a new vista on membrane mechanics in a confined area within the nanometer realm, where most of the specific molecular interactions take place. Lipid membranes are electrostatically charged entities that physiologically coexist with electrolyte solutions. Thus, specific interactions with ions are a matter of considerable interest. The distribution of ions in the solution and their interaction with the membranes are factors that substantially modify the structure and dynamics of the cell membranes. Furthermore, signaling processes are modified by the membrane capability of retaining ions. Supported Lipid Bilayers (SLBs) are a versatile tool to investigate phospholipid membranes mimicking biological surfaces. In the present contribution, we review selected experiments on the mechanical stability of SLBs as models of lipid membranes by means of AFM-FS, with special focus on the effect of cations and ionic strength in the overall nanomechanical stability.

  9. An Algorithm for Repeated Trajectory Bistatic Spotlight SAR Widefield Imaging%同航线双基聚束式SAR宽场景成像算法

    Institute of Scientific and Technical Information of China (English)

    张磊; 井伟; 邢孟道; 保铮


    该文在现有双基SAR成像研究的基础上,提出了同航线双基聚束式SAR成像的算法.该算法首先对回波信号进行方位预处理实现信号支撑区的不模糊,然后利用传统波数域的成像算法聚焦.该算法较双基极坐标算法有更高的聚焦精度并且没有几何形变.它不仅适用于平行航线的双基成像,其思路也完全适用于其它聚束模式的成像处理.最后通过仿真验证了算法的正确性.%Based on the current research on bistatic SAR image, a new algorithm to process data of repeated trajectory bistatic spotlight SAR system is proposed. The algorithm first suppress azimuth aliasing with an azimuth preprocess step, and focus image with traditional wavenumber domain algorithm. It is with high focusing accuracy without distortion involved, by which well focused image over large scene can be obtained. The principal of the azimuth preprocess is also suited to deal with other spotlight SAR mode. And a numeric simulation confirms the validity of the algorithm.

  10. Avoiding a Systematic Error in Assessing Fat Graft Survival in the Breast with Repeated Magnetic Resonance Imaging

    DEFF Research Database (Denmark)

    Glovinski, Peter Viktor; Herly, Mikkel; Müller, Felix C


    Several techniques for measuring breast volume (BV) are based on examining the breast on magnetic resonance imaging. However, when techniques designed to measure total BV are used to quantify BV changes, for example, after fat grafting, a systematic error is introduced because BV changes lead to ...... for assessing BV changes to determine fat graft retention and may be useful for evaluating and comparing available surgical techniques for breast augmentation and reconstruction using fat grafting.......Several techniques for measuring breast volume (BV) are based on examining the breast on magnetic resonance imaging. However, when techniques designed to measure total BV are used to quantify BV changes, for example, after fat grafting, a systematic error is introduced because BV changes lead...... to contour alterations of the breast. The volume of the altered breast includes not only the injected volume but also tissue previously surrounding the breast. Therefore, the quantitative difference in BV before and after augmentation will differ from the injected volume. Here, we present a new technique...

  11. Nonlinear Dynamical analysis of an AFM tapping mode microcantilever beam

    Directory of Open Access Journals (Sweden)

    Choura S.


    Full Text Available We focus in this paper on the modeling and dynamical analysis of a tapping mode atomic force microscopy (AFM microcantilever beam. This latter is subjected to a harmonic excitation of its base displacement and to Van der Waals and DMT contact forces at its free end. For AFM design purposes, we derive a mathematical model for accurate description of the AFM microbeam dynamics. We solve the resulting equations of motions and associated boundary conditions using the Galerkin method. We find that using one-mode approximation in tapping mode operating in the neighborhood of the contact region one-mode approximation may lead to erroneous results.

  12. BOREAS AFM-12 1-km AVHRR Seasonal Land Cover Classification (United States)

    Steyaert, Lou; Hall, Forrest G.; Newcomer, Jeffrey A. (Editor); Knapp, David E. (Editor); Loveland, Thomas R.; Smith, David E. (Technical Monitor)


    The Boreal Ecosystem-Atmosphere Study (BOREAS) Airborne Fluxes and Meteorology (AFM)-12 team's efforts focused on regional scale Surface Vegetation and Atmosphere (SVAT) modeling to improve parameterization of the heterogeneous BOREAS landscape for use in larger scale Global Circulation Models (GCMs). This regional land cover data set was developed as part of a multitemporal one-kilometer Advanced Very High Resolution Radiometer (AVHRR) land cover analysis approach that was used as the basis for regional land cover mapping, fire disturbance-regeneration, and multiresolution land cover scaling studies in the boreal forest ecosystem of central Canada. This land cover classification was derived by using regional field observations from ground and low-level aircraft transits to analyze spectral-temporal clusters that were derived from an unsupervised cluster analysis of monthly Normalized Difference Vegetation Index (NDVI) image composites (April-September 1992). This regional data set was developed for use by BOREAS investigators, especially those involved in simulation modeling, remote sensing algorithm development, and aircraft flux studies. Based on regional field data verification, this multitemporal one-kilometer AVHRR land cover mapping approach was effective in characterizing the biome-level land cover structure, embedded spatially heterogeneous landscape patterns, and other types of key land cover information of interest to BOREAS modelers.The land cover mosaics in this classification include: (1) wet conifer mosaic (low, medium, and high tree stand density), (2) mixed coniferous-deciduous forest (80% coniferous, codominant, and 80% deciduous), (3) recent visible bum, vegetation regeneration, or rock outcrops-bare ground-sparsely vegetated slow regeneration bum (four classes), (4) open water and grassland marshes, and (5) general agricultural land use/ grasslands (three classes). This land cover mapping approach did not detect small subpixel-scale landscape

  13. MR diffusion-weighted imaging-based subcutaneous tumour volumetry in a xenografted nude mouse model using 3D Slicer: an accurate and repeatable method (United States)

    Ma, Zelan; Chen, Xin; Huang, Yanqi; He, Lan; Liang, Cuishan; Liang, Changhong; Liu, Zaiyi


    Accurate and repeatable measurement of the gross tumour volume(GTV) of subcutaneous xenografts is crucial in the evaluation of anti-tumour therapy. Formula and image-based manual segmentation methods are commonly used for GTV measurement but are hindered by low accuracy and reproducibility. 3D Slicer is open-source software that provides semiautomatic segmentation for GTV measurements. In our study, subcutaneous GTVs from nude mouse xenografts were measured by semiautomatic segmentation with 3D Slicer based on morphological magnetic resonance imaging(mMRI) or diffusion-weighted imaging(DWI)(b = 0,20,800 s/mm2) . These GTVs were then compared with those obtained via the formula and image-based manual segmentation methods with ITK software using the true tumour volume as the standard reference. The effects of tumour size and shape on GTVs measurements were also investigated. Our results showed that, when compared with the true tumour volume, segmentation for DWI(P = 0.060–0.671) resulted in better accuracy than that mMRI(P < 0.001) and the formula method(P < 0.001). Furthermore, semiautomatic segmentation for DWI(intraclass correlation coefficient, ICC = 0.9999) resulted in higher reliability than manual segmentation(ICC = 0.9996–0.9998). Tumour size and shape had no effects on GTV measurement across all methods. Therefore, DWI-based semiautomatic segmentation, which is accurate and reproducible and also provides biological information, is the optimal GTV measurement method in the assessment of anti-tumour treatments. PMID:26489359

  14. Preventive effect of different toothpastes on enamel erosion: AFM and SEM studies. (United States)

    Lombardini, Marco; Ceci, Matteo; Colombo, Marco; Bianchi, Stefano; Poggio, Claudio


    The aim of the present in vitro study was the evaluation of new formulation toothpastes on preventing enamel erosion produced by a soft drink (Coca Cola), using atomic force microscopy (AFM) and scanning electron microscopy (SEM). Fifty enamel specimens were assigned to 10 groups of 5 specimens each. 1: intact enamel, 2: enamel + soft drink, 3: intact enamel + BioRepair Plus-Sensitive Teeth, 4: enamel + soft drink + BioRepair Plus-Sensitive Teeth, 5: intact enamel + BioRepair Plus-Total Protection, 6: enamel + soft drink + BioRepair Plus-Total Protection, group 7: intact enamel + Sensodyne Repair & Protect, 8: dentin + soft drink + Sensodyne Repair & Protect, 9: intact dentin + Colgate Sensitive Pro Relief, 10: dentin + soft drink + Colgate Sensitive Pro Relief. The surface of each specimen was imaged by AFM and SEM. The root mean-square roughness (Rrms ) was obtained from the AFM images and the differences in the averaged values among the groups were analyzed by ANOVA test. Comparing groups 4, 6, 8, 10 (soft drink + toothpastes) Colgate Sensitive Pro Relief promoted enamel remineralization, while BioRepair Plus-Sensitive Teeth, Biorepair Plus-Total Protection and Sensodyne Repair & Protect provided lower effectiveness in protecting enamel against erosion. the use of new formulation toothpastes can prevent enamel demineralization. © 2013 Wiley Periodicals, Inc.

  15. Sharp high-aspect-ratio AFM tips fabricated by a combination of deep reactive ion etching and focused ion beam techniques. (United States)

    Caballero, David; Villanueva, Guillermo; Plaza, Jose Antonio; Mills, Christopher A; Samitier, Josep; Errachid, Abdelhamid


    The shape and dimensions of an atomic force microscope tip are crucial factors to obtain high resolution images at the nanoscale. When measuring samples with narrow trenches, inclined sidewalls near 90 degrees or nanoscaled structures, standard silicon atomic force microscopy (AFM) tips do not provide satisfactory results. We have combined deep reactive ion etching (DRIE) and focused ion beam (FIB) lithography techniques in order to produce probes with sharp rocket-shaped silicon AFM tips for high resolution imaging. The cantilevers were shaped and the bulk micromachining was performed using the same DRIE equipment. To improve the tip aspect ratio we used FIB nanolithography technique. The tips were tested on narrow silicon trenches and over biological samples showing a better resolution when compared with standard AFM tips, which enables nanocharacterization and nanometrology of high-aspect-ratio structures and nanoscaled biological elements to be completed, and provides an alternative to commercial high aspect ratio AFM tips.

  16. Label-free and quantitative evaluation of cytotoxicity based on surface nanostructure and biophysical property of cells utilizing AFM. (United States)

    Lee, Young Ju; Lee, Gi-Ja; Kang, Sung Wook; Cheong, Youjin; Park, Hun-Kuk


    In this study, the four commonly used cytotoxicity assays and the mechanical properties as evaluated by atomic force microscopy (AFM) were compared in a cellular system. A cytotoxicity assay is the first and most essential test to evaluate biocompatibility of various toxic substances. Many of the cytotoxicity methods require complicated and labor-intensive process, as well as introduce experimental error. In addition, these methods cannot provide instantaneous and quantitative cell viability information. AFM has become an exciting analytical tool in medical, biological, and biophysical research due to its unique abilities. AFM-based force-distance curve measurements precisely measure the changes in the biophysical properties of the cell. Therefore, we observed the morphological changes and mechanical property changes in L929 cells following sodium lauryl sulfate (SLS) treatment utilizing AFM. AFM imaging showed that the toxic effects of SLS changed not only the spindle-like shape of L929 cells into a round shape, but also made a rough cell surface. As the concentration of SLS was increased, the surface roughness of L929 cell was increased, and stiffness decreased. We confirmed that inhibition of proliferation clearly increased with increases in SLS concentration based on results from MTT, WST, neutral red uptake, and LIVE/DEAD viability/cytotoxicity assays. The estimated IC₅₀ value by AFM analysis was similar to those of other conventional assays and was included within the 95% confidence interval range. We suggest that an AFM quantitative analysis of the morphological and biophysical changes in cells can be utilized as a new method for evaluating cytotoxicity.

  17. Cerebral ischemia-induced mitochondrial changes in a global ischemic rat model by AFM. (United States)

    Park, Eunkuk; Choi, Seok Keun; Kang, Sung Wook; Pak, Youngmi Kim; Lee, Gi-Ja; Chung, Joo-Ho; Park, Hun-Kuk


    Mitochondria play a central role in cell survival, and apoptotic cell death is associated with morphological changes in mitochondria. Quantification of the morphological and mechanical property changes in brain mitochondria is useful for evaluating the degree of ischemic injury and the neuroprotective effects of various drugs. This study was performed to investigate the changes in brain mitochondria in an 11-vessel occlusion ischemic model treated with magnesium sulfate (MgSO4), utilizing atomic force microscopy (AFM). Rats were randomly divided into three groups consisting of sham (n=6), global ischemia (GI, n=6), and MgSO4-treated global ischemia (MgSO4, n=6). The biophysical properties of brain mitochondria determined from AFM topographic images and adhesion force from force-distance measurements. The mean perimeter of ischemic mitochondria significantly increased to 2,396±541 nm (vs. 1,006±318 nm in control group, PAFM could be effective for evaluating neuronal injury and drug effects.

  18. AFM studies of environmental effects on nanomechanical properties and cellular structure of human hair. (United States)

    Bhushan, Bharat; Chen, Nianhuan


    Characterization of cellular structure and physical and mechanical properties of hair are essential to develop better cosmetic products and advance biological and cosmetic science. Although the morphology of the cellular structure of human hair has been traditionally investigated using scanning electron microscopy and transmission electron microscopy, these techniques provide limited capability to in situ study of the physical and mechanical properties of human hair in various environments. Atomic force microscopy (AFM) overcomes these problems and can be used for characterization in ambient conditions without requiring specific sample preparations and surface treatment. In this study, film thickness, adhesive forces and effective Young's modulus of various hair surfaces were measured at different environments (humidity and temperature) using force calibration plot technique with an AFM. Torsional resonance mode phase contrast images were also taken in order to characterize the morphology and cellular structure changes of human hair at different humidity. The correlation between the nanomechanical properties and the cellular structure of hair is discussed.

  19. Prognostic value of repeated {sup 123}I-metaiodobenzylguanidine imaging in patients with dilated cardiomyopathy with congestive heart failure before and after optimized treatments. Comparison with neurohumoral factors

    Energy Technology Data Exchange (ETDEWEB)

    Matsui, Toshiki; Tsutamoto, Takayoshi; Maeda, Keiko; Kusukawa, Junya; Kinoshita, Masahiko [Shiga Univ. of Medical Science, Otsu (Japan)


    The present study was undertaken to assess whether repeated measurement of cardiac {sup 123}I-metaiodobenzylguanidine (MIBG) imaging parameters before and after optimized treatments is useful for predicting the prognosis of patients with congestive heart failure (CHF) resulting from dilated cardiomyopathy (DCM). The subjects were 85 consecutive patients with DCM who had a left ventricular ejection fraction (LVEF) of less than 45%. The MIBG and the concentrations of neurohumoral factors were measured at baseline and after 6 months of optimized treatments. Cox proportional hazards analysis was performed to assess the various parameters before and after treatment. Twenty-three patients had a cardiac event (12 died; 11 hospitalized) during a mean follow-up period of 2 years. Although there was no difference between the baseline heart to mediastinum (H/M) ratio measured by MIBG between survivors and nonsurvivors, the H/M ratio was significantly decreased in nonsurvivors after 6 months. Multivariate analysis revealed that a high plasma concentration of brain natriuretic peptide level after 6 months (p=0.0049) and absolute changes in the H/M ratio (p=0.0046) were independent predictors of mortality. Comparison of the H/M ratio on MIBG imaging before and after optimized additional treatment provided useful information for predicting mortality and was independent of clinical and neurohumoral factors previously shown to be associated with poor prognosis in patients with DCM. (author)

  20. Roughness measurements with an AFM-CMM instrument

    DEFF Research Database (Denmark)

    Marinello, Francesco; Bariani, Paolo; De Chiffre, Leonardo;


    In this paper, application of a Large Range AFM to roughness analyses is presented: measurements on different calibration standards covering a range of 4.8×0.1 mm2 were performed. Upon extraction of single profiles from the three-dimensional data set, roughness can be evaluated in compliance...... with ISO standards. Profiles from the Large range AFM were directly compared with those obtained by a traceable stylus instrument, resulting from probing the same surface region....

  1. Characterization of the interaction between AFM tips and surface nanobubbles. (United States)

    Walczyk, Wiktoria; Schönherr, Holger


    While the presence of gaseous enclosures observed at various solid-water interfaces, the so-called "surface nanobubles", has been confirmed by many groups in recent years, their formation, properties, and stability have not been convincingly and exhaustively explained. Here we report on an atomic force microscopy (AFM) study of argon nanobubbles on highly oriented pyrolitic graphite (HOPG) in water to elucidate the properties of nanobubble surfaces and the mechanism of AFM tip-nanobubble interaction. In particular, the deformation of the nanobubble-water interface by the AFM tip and the question whether the AFM tip penetrates the nanobubble during scanning were addressed by this combined intermittent contact (tapping) mode and force volume AFM study. We found that the stiffness of nanobubbles was smaller than the cantilever spring constant and comparable with the surface tension of water. The interaction with the AFM tip resulted in severe quasi-linear deformation of the bubbles; however, in the case of tip-bubble attraction, the interface deformed toward the tip. We tested two models of tip-bubble interaction, namely, the capillary force and the dynamic interaction model, and found, depending on the tip properties, good agreement with experimental data. The results showed that the tip-bubble interaction strength and the magnitude of the bubble deformation depend strongly on tip and bubble geometry and on tip and substrate material, and are very sensitive to the presence of contaminations that alter the interfacial tension. In particular, nanobubbles interacted differently with hydrophilic and hydrophobic AFM tips, which resulted in qualitatively and quantitatively different force curves measured on the bubbles in the experiments. To minimize bubble deformation and obtain reliable AFM results, nanobubbles must be measured with a sharp hydrophilic tip and with a cantilever having a very low spring constant in a contamination-free system.

  2. The Conductance of Nanotubes Deformed by the AFM Tip (United States)

    Svizhenko, Alexei; Maiti, Amitesh; Anantram, M. P.


    The conductance drop under AFM-tip deformation can be explained by stretching of the tube length. NT sensors can be built utilizing uniform stretching. Single sp3 bond cross section cannot block electrons, because another conducting path may exist. AFM tip which forms sp3 bonds with the tube will decrease conductance. In the "table experiment" a conductance drop of 2 orders of magnitude happened only after some bonds were broken.

  3. Study of mechanical behavior of AFM silicon tips under mechanical load (United States)

    Kopycinska-Mueller, M.; Gluch, J.; Köhler, B.


    In this paper we address critical issues concerning calibration of AFM based methods used for nanoscale mechanical characterization of materials. It has been shown that calibration approaches based on macroscopic models for contact mechanics may yield excellent results in terms of the indentation modulus of the sample, but fail to provide a comprehensive and actual information concerning the tip-sample contact radius or the mechanical properties of the tip. Explanations for the severely reduced indentation modulus of the tip included the inadequacies of the models used for calculations of the tip-sample contact stiffness, discrepancies in the actual and ideal shape of the tip, presence of the amorphous silicon phase within the silicon tip, as well as negligence of the actual size of the stress field created in the tip during elastic interactions. To clarify these issues, we investigated the influence of the mechanical load applied to four AFM silicon tips on their crystalline state by exposing them to systematically increasing loads, evaluating the character of the tip-sample interactions via the load-unload stiffness curves, and assessing the state of the tips from HR-TEM images. The results presented in this paper were obtained in a series of relatively simple and basic atomic force acoustic microscopy (AFAM) experiments. The novel combination of TEM imaging of the AFM tips with the analysis of the load-unload stiffness curves gave us a detailed insight into their mechanical behavior under load conditions. We were able to identify the limits for the elastic interactions, as well as the hallmarks for phase transformation and dislocation formation and movement. The comparison of the physical dimensions of the AFM tips, geometry parameters determined from the values of the contact stiffness, and the information on the crystalline state of the tips allowed us a better understanding of the nanoscale contact.

  4. Molecular Resolution of Zeolite Surfaces as Imaged by Atomic Force Microscopy (United States)


    absorption of molecules may for our AFM study. The techniques required to use phenmenaAFM for synthetic crystals that are currently available... clinoptilolite ) single crystal by imaging with an AFM under water, salt solutions, and alcohols. 7 Previously, - AFMs have been used to nondestructively

  5. The Emergence of AFM Applications to Cell Biology: How new technologies are facilitating investigation of human cells in health and disease at the nanoscale. (United States)

    Yang, Ruiguo; Xi, Ning; Fung, Carmen Kar Man; Seiffert-Sinha, Kristina; Lai, King Wai Chiu; Sinha, Animesh A


    Atomic Force Microscopy (AFM) based nanorobotics has been used for building nano devices in semiconductors for almost a decade. Leveraging the unparallel precision localization capabilities of this technology, high resolution imaging and mechanical property characterization is now increasingly being performed in biological settings. AFM also offers the prospect for handling and manipulating biological materials at nanometer scale. It has unique advantages over other methods, permitting experiments in the liquid phase where physiological conditions can be maintained. Taking advantage of these properties, our group has visualized membrane and cytoskeletal structures of live cells by controlling the interaction force of the AFM tip with cellular components at the nN or sub-nN range. Cell stiffness changes were observed by statistically analyzing the Young's modulus values of human keratinocytes before and after specific antibody treatment. Furthermore, we used the AFM cantilever as a robotic arm for mechanical pushing, pulling and cutting to perform nanoscale manipulations of cell-associated structures. AFM guided nano-dissection, or nanosurgery was enacted on the cell in order to sever intermediate filaments connecting neighboring keratinocytes via sub 100 nm resolution cuts. Finally, we have used a functionalized AFM tip to probe cell surface receptors to obtain binding force measurements. This technique formed the basis for Single Molecule Force Spectroscopy (SMFS). In addition to enhancing our basic understanding of dynamic signaling events in cell biology, these advancements in AFM based biomedical investigations can be expected to facilitate the search for biomarkers related to disease diagnosis progress and treatment.


    Institute of Scientific and Technical Information of China (English)



    Atomic force microscopy images taken during the crystallization of polyethylene both from processed and quiescent melts are presented. Crystallization from processed melts provides further evidence of a region in front of a growing lamella that is influenced by the crystallization process, but extending only 40 nm into the melt. High-resolution images of the growing crystal tip, taken during crystallization, show no direct evidence of the existence of intermediate phases. The growing tip is shown to be slightly rounded. In-filling crystallization, occurring after the initial flush of growth,is imaged in polyethylene for the first time, and shown to continue to a temperature 8℃ below the initial crystallization temperature.


    Institute of Scientific and Technical Information of China (English)



    Atomic force microscopy images taken during the crystallization of polyethylene both from processed and quiescent melts are presented.Crystallization from processed melts provides further evidence of a region in front of a growing lamella that is influenced by the crystallization process,but extending only 40nm into the melt.High-resolution images of the growing crystal tip,taken during crystallization,show no direct evidence of the existence of intermediate phases.The growing tip is shown to be slightly rounded.In-filling crystallization,occurring after the initial flush of growth,is imaged in polyethylene for the first time,and shown to continue to a temperature 8℃ below the initial crystallization temperature.

  8. Magni: A Python Package for Compressive Sampling and Reconstruction of Atomic Force Microscopy Images

    DEFF Research Database (Denmark)

    Oxvig, Christian Schou; Pedersen, Patrick Steffen; Arildsen, Thomas


    provides researchers in compressed sensing with a selection of algorithms for reconstructing undersampled general images, and offers a consistent and rigorous way to efficiently evaluate the researchers own developed reconstruction algorithms in terms of phase transitions. The package also serves......Magni is an open source Python package that embraces compressed sensing and Atomic Force Microscopy (AFM) imaging techniques. It provides AFM-specific functionality for undersampling and reconstructing images from AFM equipment and thereby accelerating the acquisition of AFM images. Magni also...

  9. A Novel Dog-Bone Oscillating AFM Probe with Thermal Actuation and Piezoresistive Detection

    Directory of Open Access Journals (Sweden)

    Zhuang Xiong


    Full Text Available In order to effectively increase the resonance frequency and the quality factor of atomic force microscope (AFM probes, a novel oscillating probe based on a dog-bone shaped MEMS resonator was conceived, designed, fabricated and evaluated. The novel probe with 400 μm in length, 100 μm in width and 5 μm in thickness was enabled to feature MHz resonance frequencies with integrated thermal actuation and piezoresistive detection. Standard silicon micromachining was employed. Both electrical and optical measurements were carried out in air. The resonance frequency and the quality factor of the novel probe were measured to be 5.4 MHz and 4000 respectively, which are much higher than those (about several hundreds of kHz of commonly used cantilever probes. The probe was mounted onto a commercial AFM set-up through a dedicated probe-holder and circuit board. Topographic images of patterned resist samples were obtained. It is expected that the resonance frequency and the measurement bandwidth of such probes will be further increased by a proper downscaling, thus leading to a significant increase in the scanning speed capability of AFM instruments.

  10. A novel dog-bone oscillating AFM probe with thermal actuation and piezoresistive detection. (United States)

    Xiong, Zhuang; Mairiaux, Estelle; Walter, Benjamin; Faucher, Marc; Buchaillot, Lionel; Legrand, Bernard


    In order to effectively increase the resonance frequency and the quality factor of atomic force microscope (AFM) probes, a novel oscillating probe based on a dog-bone shaped MEMS resonator was conceived, designed, fabricated and evaluated. The novel probe with 400 μm in length, 100 μm in width and 5 μm in thickness was enabled to feature MHz resonance frequencies with integrated thermal actuation and piezoresistive detection. Standard silicon micromachining was employed. Both electrical and optical measurements were carried out in air. The resonance frequency and the quality factor of the novel probe were measured to be 5.4 MHz and 4000 respectively, which are much higher than those (about several hundreds of kHz) of commonly used cantilever probes. The probe was mounted onto a commercial AFM set-up through a dedicated probe-holder and circuit board. Topographic images of patterned resist samples were obtained. It is expected that the resonance frequency and the measurement bandwidth of such probes will be further increased by a proper downscaling, thus leading to a significant increase in the scanning speed capability of AFM instruments.

  11. Custom AFM for X-ray beamlines: in situ biological investigations under physiological conditions

    Energy Technology Data Exchange (ETDEWEB)

    Gumí-Audenis, B. [ESRF, The European Synchrotron, Grenoble (France); Institute for Bioengineering of Catalonia (IBEC), Barcelona (Spain); Physical Chemistry Department, Universitat de Barcelona, Barcelona (Spain); Networking Biomedical Research Center on Bioengineering, Biomaterials and Nanomedicine (CIBER-BBN), Madrid (Spain); Carlà, F. [ESRF, The European Synchrotron, Grenoble (France); Vitorino, M. V. [University of Lisboa, Falculty of Science, Biosystems and Integrative Sciences Institute - BIOISI, Lisbon (Portugal); Panzarella, A. [ESRF, The European Synchrotron, Grenoble (France); Porcar, L. [Institut Laue-Langevin, Grenoble (France); Boilot, M. [ORTEC, Marseille (France); Guerber, S. [CEA, LETI Grenoble (France); Bernard, P. [ESRF, The European Synchrotron, Grenoble (France); Rodrigues, M. S. [University of Lisboa, Falculty of Science, Biosystems and Integrative Sciences Institute - BIOISI, Lisbon (Portugal); Sanz, F.; Giannotti, M. I. [Institute for Bioengineering of Catalonia (IBEC), Barcelona (Spain); Physical Chemistry Department, Universitat de Barcelona, Barcelona (Spain); Networking Biomedical Research Center on Bioengineering, Biomaterials and Nanomedicine (CIBER-BBN), Madrid (Spain); Costa, L., E-mail: [ESRF, The European Synchrotron, Grenoble (France)


    The performance of a custom atomic force microscope for grazing-incidence X-ray experiments on hydrated soft and biological samples is presented. A fast atomic force microscope (AFM) has been developed that can be installed as a sample holder for grazing-incidence X-ray experiments at solid/gas or solid/liquid interfaces. It allows a wide range of possible investigations, including soft and biological samples under physiological conditions (hydrated specimens). The structural information obtained using the X-rays is combined with the data gathered with the AFM (morphology and mechanical properties), providing a unique characterization of the specimen and its dynamics in situ during an experiment. In this work, lipid monolayers and bilayers in air or liquid environment have been investigated by means of AFM, both with imaging and force spectroscopy, and X-ray reflectivity. In addition, this combination allows the radiation damage induced by the beam on the sample to be studied, as has been observed on DOPC and DPPC supported lipid bilayers under physiological conditions.

  12. A Novel Dog-Bone Oscillating AFM Probe with Thermal Actuation and Piezoresistive Detection † (United States)

    Xiong, Zhuang; Mairiaux, Estelle; Walter, Benjamin; Faucher, Marc; Buchaillot, Lionel; Legrand, Bernard


    In order to effectively increase the resonance frequency and the quality factor of atomic force microscope (AFM) probes, a novel oscillating probe based on a dog-bone shaped MEMS resonator was conceived, designed, fabricated and evaluated. The novel probe with 400 μm in length, 100 μm in width and 5 μm in thickness was enabled to feature MHz resonance frequencies with integrated thermal actuation and piezoresistive detection. Standard silicon micromachining was employed. Both electrical and optical measurements were carried out in air. The resonance frequency and the quality factor of the novel probe were measured to be 5.4 MHz and 4000 respectively, which are much higher than those (about several hundreds of kHz) of commonly used cantilever probes. The probe was mounted onto a commercial AFM set-up through a dedicated probe-holder and circuit board. Topographic images of patterned resist samples were obtained. It is expected that the resonance frequency and the measurement bandwidth of such probes will be further increased by a proper downscaling, thus leading to a significant increase in the scanning speed capability of AFM instruments. PMID:25365463

  13. AFM based dielectric spectroscopy: extended frequency range through excitation of cantilever higher eigenmodes. (United States)

    Miccio, Luis A; Kummali, Mohammed M; Schwartz, Gustavo A; Alegría, Ángel; Colmenero, Juan


    In the last years, a new AFM based dielectric spectroscopy approach has been developed for measuring the dielectric relaxation of materials at the nanoscale, the so called nanoDielectric Spectroscopy (nDS). In spite of the effort done so far, some experimental aspects of this technique remain still unclear. In particular, one of these aspects is the possibility of extending the experimental frequency range, to date limited at high frequencies by the resonance frequency of the AFM cantilever as a main factor. In order to overcome this limitation, the electrical excitation of cantilever higher eigenmodes for measuring the dielectric relaxation is here explored. Thus, in this work we present a detailed experimental analysis of the electrical excitation of the cantilever second eigenmode. Based on this analysis we show that the experimental frequency range of the AFM based dielectric spectroscopy can be extended by nearly two decades with a good signal-to-noise ratio. By using the combination of first and second cantilever eigenmodes we study dissipation processes on well known PVAc based polymeric samples. Both, relaxation spectra and images with molecular dynamics contrast were thus obtained over this broader frequency range.

  14. Repeatability of derived parameters from histograms following non-Gaussian diffusion modelling of diffusion-weighted imaging in a paediatric oncological cohort

    Energy Technology Data Exchange (ETDEWEB)

    Jerome, Neil P.; Miyazaki, Keiko; Collins, David J.; Orton, Matthew R.; D' Arcy, James A.; Leach, Martin O. [Cancer Research UK Cancer Imaging Centre, Division of Radiotherapy and Imaging, The Institute of Cancer Research, London (United Kingdom); Wallace, Toni; Koh, Dow-Mu [Royal Marsden NHS Foundation Trust, Department of Radiology, Sutton, Surrey (United Kingdom); Moreno, Lucas [The Institute of Cancer Research, Paediatric Drug Development Team, Division of Cancer Therapeutics and Clinical Studies, London (United Kingdom); Hospital Nino Jesus, Madrid (Spain); Royal Marsden NHS Foundation Trust, Paediatric Drug Development Unit, Children and Young People' s Unit, Sutton, Surrey (United Kingdom); Pearson, Andrew D.J.; Marshall, Lynley V.; Carceller, Fernando; Zacharoulis, Stergios [The Institute of Cancer Research, Paediatric Drug Development Team, Division of Cancer Therapeutics and Clinical Studies, London (United Kingdom); Royal Marsden NHS Foundation Trust, Paediatric Drug Development Unit, Children and Young People' s Unit, Sutton, Surrey (United Kingdom)


    To examine repeatability of parameters derived from non-Gaussian diffusion models in data acquired in children with solid tumours. Paediatric patients (<16 years, n = 17) were scanned twice, 24 h apart, using DWI (6 b-values, 0-1000 mm{sup -2} s) at 1.5 T in a prospective study. Tumour ROIs were drawn (3 slices) and all data fitted using IVIM, stretched exponential, and kurtosis models; percentage coefficients of variation (CV) calculated for each parameter at all ROI histogram centiles, including the medians. The values for ADC, D, DDC{sub α}, α, and DDC{sub K} gave CV < 10 % down to the 5th centile, with sharp CV increases below 5th and above 95th centile. K, f, and D* showed increased CV (>30 %) over the histogram. ADC, D, DDC{sub α}, and DDC{sub K} were strongly correlated (ρ > 0.9), DDC{sub α} and α were not correlated (ρ = 0.083). Perfusion- and kurtosis-related parameters displayed larger, more variable CV across the histogram, indicating observed clinical changes outside of D/DDC in these models should be interpreted with caution. Centiles below 5th for all parameters show high CV and are unreliable as diffusion metrics. The stretched exponential model behaved well for both DDC{sub α} and α, making it a strong candidate for modelling multiple-b-value diffusion imaging data. (orig.)

  15. Deconvolution of calcium fluorescent indicator signal from AFM cantilever reflection. (United States)

    Lopez-Ayon, G Monserratt; Oliver, David J; Grutter, Peter H; Komarova, Svetlana V


    Atomic force microscopy (AFM) can be combined with fluorescence microscopy to measure the changes in intracellular calcium levels (indicated by fluorescence of Ca²⁺ sensitive dye fluo-4) in response to mechanical stimulation performed by AFM. Mechanical stimulation using AFM is associated with cantilever movement, which may interfere with the fluorescence signal. The motion of the AFM cantilever with respect to the sample resulted in changes of the reflection of light back to the sample and a subsequent variation in the fluorescence intensity, which was not related to changes in intracellular Ca²⁺ levels. When global Ca²⁺ responses to a single stimulation were assessed, the interference of reflected light with the fluorescent signal was minimal. However, in experiments where local repetitive stimulations were performed, reflection artifacts, correlated with cantilever motion, represented a significant component of the fluorescent signal. We developed a protocol to correct the fluorescence traces for reflection artifacts, as well as photobleaching. An added benefit of our method is that the cantilever reflection in the fluorescence recordings can be used for precise temporal correlation of the AFM and fluorescence measurements.

  16. Pediatric Brain: Repeated Exposure to Linear Gadolinium-based Contrast Material Is Associated with Increased Signal Intensity at Unenhanced T1-weighted MR Imaging. (United States)

    Flood, Thomas F; Stence, Nicholas V; Maloney, John A; Mirsky, David M


    Purpose To determine whether repeated exposure of the pediatric brain to a linear gadolinium-based contrast agent (GBCA) is associated with an increase in signal intensity (SI) relative to that in GBCA-naive control subjects at unenhanced T1-weighted magnetic resonance (MR) imaging. Materials and Methods This single-center, retrospective study was approved by the institutional review board and compliant with HIPAA. The authors evaluated 46 pediatric patients who had undergone at least three GBCA-enhanced MR examinations (30 patients for two-group analysis and 16 for pre- and post-GBCA exposure comparisons) and 57 age-matched GBCA-naive control subjects. The SI in the globus pallidus, thalamus, dentate nucleus, and pons was measured at unenhanced T1-weighted MR imaging. Globus pallidus-thalamus and dentate nucleus-pons SI ratios were calculated and compared between groups and relative to total cumulative gadolinium dose, age, sex, and number of and mean time between GBCA-enhanced examinations. Analysis included the Wilcoxon signed rank test, Wilcoxon rank sum test, and Spearman correlation coefficient. Results Patients who underwent multiple GBCA-enhanced examinations had increased SI ratios within the dentate nucleus (mean SI ratio ± standard error of the mean for two-group comparison: 1.007 ± 0.0058 for GBCA-naive group and 1.046 ± 0.0060 for GBCA-exposed group [P mean SI ratio for pre- and post-GBCA comparison: 0.995 ± 0.0062 for pre-GBCA group and 1.035 ± 0.0063 for post-GBCA group [P mean SI ratio for two-group comparison: 1.131 ± 0.0070 for GBCA-naive group and 1.014 ± 0.0091 for GBCA-exposed group [P = .21]; mean SI ratio for pre- and post-GBCA comparison: 1.068 ± 0.0094 for pre-GBCA group and 1.093 ± 0.0134 for post-GBCA group [P = .12]). There was a significant correlation between dentate nucleus SI and total cumulative gadolinium dose (r = 0.4; 95% confidence interval [CI]: 0.03, 0.67; P = .03), but not between dentate nucleus SI and patient age

  17. Towards quantitative molecular mapping of cells by Raman microscopy: using AFM for decoupling molecular concentration and cell topography. (United States)

    Boitor, Radu; Sinjab, Faris; Strohbuecker, Stephanie; Sottile, Virginie; Notingher, Ioan


    Raman micro-spectroscopy (RMS) is a non-invasive technique for imaging live cells in vitro. However, obtaining quantitative molecular information from Raman spectra is difficult because the intensity of a Raman band is proportional to the number of molecules in the sampled volume, which depends on the local molecular concentration and the thickness of the cell. In order to understand these effects, we combined RMS with atomic force microscopy (AFM), a technique that can measure accurately the thickness profile of the cells. Solution-based calibration models for RNA and albumin were developed to create quantitative maps of RNA and proteins in individual fixed cells. The maps were built by applying the solution-based calibration models, based on partial least squares fitting (PLS), on raster-scan Raman maps, after accounting for the local cell height obtained from the AFM. We found that concentrations of RNA in the cytoplasm of mouse neuroprogenitor stem cells (NSCs) were as high as 25 ± 6 mg ml(-1), while proteins were distributed more uniformly and reached concentrations as high as ∼50 ± 12 mg ml(-1). The combined AFM-Raman datasets from fixed cells were also used to investigate potential improvements for normalization of Raman spectral maps. For all Raman maps of fixed cells (n = 10), we found a linear relationship between the scores corresponding to the first component (PC1) and the cell height profile obtained by AFM. We used PC1 scores to reconstruct the relative height profiles of independent cells (n = 10), and obtained correlation coefficients with AFM maps higher than 0.99. Using this normalization method, qualitative maps of RNA and protein were used to obtain concentrations for live NSCs. While this study demonstrates the potential of using AFM and RMS for measuring concentration maps for individual NSCs in vitro, further studies are required to establish the robustness of the normalization method based on principal component analysis when comparing

  18. Processing outcomes of the AFM probe-based machining approach with different feed directions



    We present experimental and theoretical results to describe and explain processing outcomes when producing nanochannels that are a few times wider than the atomic force microscope (AFM) probe using an AFM. This is achieved when AFM tip-based machining is performed with reciprocating motion of the tip of the AFM probe. In this case, different feed directions with respect to the orientation of the AFM probe can be used. The machining outputs of interest are the chip formation process, obtained ...

  19. Sub-diffraction nano manipulation using STED AFM. (United States)

    Chacko, Jenu Varghese; Canale, Claudio; Harke, Benjamin; Diaspro, Alberto


    In the last two decades, nano manipulation has been recognized as a potential tool of scientific interest especially in nanotechnology and nano-robotics. Contemporary optical microscopy (super resolution) techniques have also reached the nanometer scale resolution to visualize this and hence a combination of super resolution aided nano manipulation ineluctably gives a new perspective to the scenario. Here we demonstrate how specificity and rapid determination of structures provided by stimulated emission depletion (STED) microscope can aid another microscopic tool with capability of mechanical manoeuvring, like an atomic force microscope (AFM) to get topological information or to target nano scaled materials. We also give proof of principle on how high-resolution real time visualization can improve nano manipulation capability within a dense sample, and how STED-AFM is an optimal combination for this job. With these evidences, this article points to future precise nano dissections and maybe even to a nano-snooker game with an AFM tip and fluorospheres.

  20. Evaluation of surface alterations in different retreatment nickel-titanium files: AFM and SEM study. (United States)

    Can Sağlam, Baran; Görgül, Güliz


    The aim of this study was to evaluate the surface changes of nickel titanium (Ni-Ti) rotary retreatment files after three and five uses. Furthermore, the effects of 2% sodium hypochlorite and chloroform solutions and sterilization procedures on the NiTi rotary retreatment surfaces were investigated. ProTaper Retreatment files, R-endo files, and Mtwo retreatment files were used for this study. The palatinal roots of maxillary molar teeth were obturated with gutta percha and Ah26. Retreatment procedures were performed with these retreatment file systems. The surface changes of untreated NiTi rotary files that were used three and five times, immersed in NaOCl and chloroform and subjected to sterilization procedures were investigated with atomic force microscopy (AFM) and scanning electron microscopy (SEM). The RMS values, three dimensional images and SEM images at various magnifications were obtained. RMS values showed that all three NiTi rotary retreatment file systems showed significant deteriorations after three and five uses. Cracks, damages and spiral construction deteriorations were detected in the SEM images after three and five uses. Furthermore, the Mtwo 15 file was broken off after five uses. AFM data indicated that 2% NaOCl caused significant surface deteriorations on NiTi rotary files and both AFM and SEM evaluation showed that chloroform solution and sterilization procedures did not cause significant surface deteriorations. In conclusion, ProTaper retreatment, R-endo, and Mtwo retreatment files showed surface damages depending on retreatment procedures. Clinicians have to consider that retreatment files always have a tendency to break off after the third time they have been used.

  1. Towards easy and reliable AFM tip shape determination using blind tip reconstruction. (United States)

    Flater, Erin E; Zacharakis-Jutz, George E; Dumba, Braulio G; White, Isaac A; Clifford, Charles A


    Quantitative determination of the geometry of an atomic force microscope (AFM) probe tip is critical for robust measurements of the nanoscale properties of surfaces, including accurate measurement of sample features and quantification of tribological characteristics. Blind tip reconstruction, which determines tip shape from an AFM image scan without knowledge of tip or sample shape, was established most notably by Villarrubia [J. Res. Natl. Inst. Stand. Tech. 102 (1997)] and has been further developed since that time. Nevertheless, the implementation of blind tip reconstruction for the general user to produce reliable and consistent estimates of tip shape has been hindered due to ambiguity about how to choose the key input parameters, such as tip matrix size and threshold value, which strongly impact the results of the tip reconstruction. These key parameters are investigated here via Villarrubia's blind tip reconstruction algorithms in which we have added the capability for users to systematically vary the key tip reconstruction parameters, evaluate the set of possible tip reconstructions, and determine the optimal tip reconstruction for a given sample. We demonstrate the capabilities of these algorithms through analysis of a set of simulated AFM images and provide practical guidelines for users of the blind tip reconstruction method. We present a reliable method to choose the threshold parameter corresponding to an optimal reconstructed tip shape for a given image. Specifically, we show that the trend in how the reconstructed tip shape varies with threshold number is so regular that the optimal, or Goldilocks, threshold value corresponds with the peak in the derivative of the RMS difference with respect to the zero threshold curve vs. threshold number.

  2. Resonant Response of Rectangular AFM Cantilever in Liquid

    Institute of Scientific and Technical Information of China (English)

    CHEN Yu-Hang; HUANG Wen-Hao


    Dynamic characteristics of atomic force microscopy (AFM) cantilevers can be influenced by their working media.We perform an experimental study on the resonant responses of rectangular AFM cantilevers with different sizes immersed in various viscous fluids. The measured resonance frequencies in liquids are used to validate several theoretical models. Comparison shows the analytical model proposed by Sader [J. Appl. Phys. 84 (1998) 64] can give the best agreement with the experimental results with the maximum relative error nearly 16% for all the cantilevers in different liquids. The ratio between the resonant frequencies in air and water is almost independent of the cantilever length, which is consistent with the theoretical analyses.

  3. AFM Study of Structure Influence on Butterfly Wings Coloration

    Directory of Open Access Journals (Sweden)

    Dinara Sultanovna Dallaeva


    Full Text Available This study describes the structural coloration of the butterfly Vanessa Atalanta wings and shows how the atomic force microscopy (AFM can be applied to the study of wings morphology and wings surface behavior under the temperature. The role of the wings morphology in colors was investigated. Different colors of wings have different topology and can be identified by them. AFM in semi-contact mode was used to study the wings surface. The wing surface area, which is close to the butterfly body, has shiny brown color and the peak of surface roughness is about 600 nm. The changing of morphology at different temperatures is shown.

  4. BOREAS AFM-04 Twin Otter Aircraft Flux Data (United States)

    MacPherson, J. Ian; Hall, Forrest G. (Editor); Knapp, David E. (Editor); Desjardins, Raymond L.; Smith, David E. (Technical Monitor)


    The BOREAS AFM-5 team collected and processed data from the numerous radiosonde flights during the project. The goals of the AFM-05 team were to provide large-scale definition of the atmosphere by supplementing the existing AES aerological network, both temporally and spatially. This data set includes basic upper-air parameters collected from the network of upper-air stations during the 1993, 1994, and 1996 field campaigns over the entire study region. The data are contained in tabular ASCII files. The data files are available on a CD-ROM (see document number 20010000884) or from the Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC).

  5. Modular design of AFM probe with sputtered silicon tip

    DEFF Research Database (Denmark)

    Rasmussen, Peter; Thaysen, Jacob; Bouwstra, Siebe


    of the thin films constituting the cantilever. The AFM probe has an integrated tip made of a thick sputtered silicon layer, which is deposited after the probe has been defined and just before the cantilevers are released. The tips are so-called rocket tips made by reactive ion etching. We present probes...

  6. Weibull analyses of bacterial interaction forces measured using AFM

    NARCIS (Netherlands)

    van der Mei, Henderina; de Vries, Jacob; Busscher, Hendrik


    Statistically significant conclusions from interaction forces obtained by AFM are difficult to draw because of large data spreads. Weibull analysis, common in macroscopic bond-strength analyses, takes advantage of this spread to derive a Weibull distribution, yielding the probability of occurrence o

  7. AFM lithography of aluminum for fabrication of nanomechanical systems

    DEFF Research Database (Denmark)

    Davis, Zachary James; Abadal, G.; Hansen, Ole


    Nanolithography by local anodic oxidation of surfaces using atomic force microscopy (AFM) has proven to be more reproducible when using dynamic, non-contact mode. Hereby, the tip/sample interaction forces are reduced dramatically compared to contact mode, and thus tip wear is greatly reduced...

  8. AFM cantilever with in situ renewable mercury microelectrode

    NARCIS (Netherlands)

    Schön, Peter Manfred; Geerlings, J.; Tas, Niels Roelof; Sarajlic, Edin


    We report here first results obtained on a novel, in situ renewable mercury microelectrode integrated into an atomic force microscopy (AFM) cantilever. Our approach is based on a fountain pen probe with appropriate dimensions enabling reversible filling with(nonwetting) mercury under changing the

  9. AFM Structural Characterization of Drinking Water Biofilm under Physiological Conditions (United States)

    Due to the complexity of mixed culture drinking water biofilm, direct visual observation under in situ conditions has been challenging. In this study, atomic force microscopy (AFM) revealed the three dimensional morphology and arrangement of drinking water relevant biofilm in air...

  10. Dicty_cDB: AFM127 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available qrfpxxksixxxf Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value AFM127 (...ducing significant alignments: (bits) Value N ( BJ346853 ) Dictyostelium discoide...cing significant alignments: (bits) Value (Q54HY4) RecName: Full=Putative uncharacterized protein DDB_G028..

  11. Interlaboratory round robin on cantilever calibration for AFM force spectroscopy.

    NARCIS (Netherlands)

    Riet, J. te; Katan, A.J.; Rankl, C.; Stahl, S.W.; Buul, A.M. van; Phang, I.Y.; Gomez-Casado, A.; Schon, P.; Gerritsen, J.W.; Cambi, A.; Rowan, A.E.; Vancso, G.J.; Jonkheijm, P.; Huskens, J.; Oosterkamp, T.H.; Gaub, H.; Hinterdorfer, P.; Figdor, C.G.; Speller, S.


    Single-molecule force spectroscopy studies performed by Atomic Force Microscopes (AFMs) strongly rely on accurately determined cantilever spring constants. Hence, to calibrate cantilevers, a reliable calibration protocol is essential. Although the thermal noise method and the direct Sader method are

  12. AFM cantilever with in situ renewable mercury microelectrode

    NARCIS (Netherlands)

    Schön, Peter; Geerlings, Joël; Tas, Niels; Sarajlic, Edin


    We report here first results obtained on a novel, in situ renewable mercury microelectrode integrated into an atomic force microscopy (AFM) cantilever. Our approach is based on a fountain pen probe with appropriate dimensions enabling reversible filling with(nonwetting) mercury under changing the ap

  13. Nanoscale mechanical properties of single biomolecules by AFM

    NARCIS (Netherlands)

    Schön, Peter Manfred; Gosa, M.; Vancso, Gyula J.


    In the past 25 years the atomic force microscope (AFM) has become a true enabling platform in the life sciences opening entire novel avenues for structural and dynamic studies of biological systems. It enables visualization, probing and manipulation across the length scales, from single molecules to

  14. AFM Structural Characterization of Drinking Water Biofilm under Physiological Conditions (United States)

    Due to the complexity of mixed culture drinking water biofilm, direct visual observation under in situ conditions has been challenging. In this study, atomic force microscopy (AFM) revealed the three dimensional morphology and arrangement of drinking water relevant biofilm in air...

  15. Vergelijkend AFM Onderzoek: microstructuur van bitumen in relatie tot healing

    NARCIS (Netherlands)

    Schmets, A.J.M.; Nahar, S.N.; Dillingh, B.; Fischer, H.; Scarpas, A.; Erkens, S.


    In this report we present the background, the scientific and experimental approach and the results of AFM experiments performed on two different batches of bitumen. The specific bitumen researched in this project has also been studied in the context of the InfraQuest project ‘Pragmatisch Healing On

  16. Assembly of live micro-organisms on microstructured PDMS stamps by convective/capillary deposition for AFM bio-experiments. (United States)

    Dague, E; Jauvert, E; Laplatine, L; Viallet, B; Thibault, C; Ressier, L


    Immobilization of live micro-organisms on solid substrates is an important prerequisite for atomic force microscopy (AFM) bio-experiments. The method employed must immobilize the cells firmly enough to enable them to withstand the lateral friction forces exerted by the tip during scanning but without denaturing the cell interface. In this work, a generic method for the assembly of living cells on specific areas of substrates is proposed. It consists in assembling the living cells within the patterns of microstructured, functionalized poly-dimethylsiloxane (PDMS) stamps using convective/capillary deposition. This versatile approach is validated by applying it to two systems of foremost importance in biotechnology and medicine: Saccharomyces cerevisiae yeasts and Aspergillus fumigatus fungal spores. We show that this method allows multiplexing AFM nanomechanical measurements by force spectroscopy on S. cerevisiae yeasts and high-resolution AFM imaging of germinated Aspergillus conidia in buffer medium. These two examples clearly demonstrate the immense potential of micro-organism assembly on functionalized, microstructured PDMS stamps by convective/capillary deposition for performing rigorous AFM bio-experiments on living cells.

  17. Dielectric charging by AFM in tip-to-sample space mode: overview and challenges in revealing the appropriate mechanisms. (United States)

    Makasheva, K; Villeneuve-Faure, C; Laurent, C; Despax, B; Boudou, L; Teyssedre, G


    The study of charge distribution on the surface and in the bulk of dielectrics is of great scientific interest because of the information gained on the storage and transport properties of the medium. Nevertheless, the processes at the nanoscale level remain out of the scope of the commonly used diagnostic methods. Atomic force microscopy (AFM) is currently applied for both injection and imaging of charges on dielectric thin films at the nanoscale level to answer the increasing demand for characterization of miniaturized components used in microelectronics, telecommunications, electrophotography, electrets, etc. However, the mechanisms for dielectric charging by AFM are not well documented, and an analysis of the literature shows that inappropriate mechanisms are sometimes presented. It is shown here that corona discharge, frequently pointed out as a likely mechanism for dielectric charging by AFM in tip-to-sample space mode, cannot develop in such small distances. Furthermore, a review of different mechanisms surmised to be at the origin of dielectric charging at the nanoscale level is offered. Field electron emission enhanced by thermionic emission is identified as a likely mechanism for dielectric charging at the nanoscale level. Experimental validation of this mechanism is obtained for typical electric field strengths in AFM.

  18. High aspect ratio AFM Probe processing by helium-ion-beam induced deposition. (United States)

    Onishi, Keiko; Guo, Hongxuan; Nagano, Syoko; Fujita, Daisuke


    by the helium ion beam, it was observed that an original probe shape was transformed. AFM measurement of a reference sample (pitch 100-500 nm, depth 100 nm) of the lines and spaces was performed using the above probes. The conventional probes which did not bring up platinum was not able to get into the ditch enough. Therefore it was found that a salient was big and a reentrant was shallow. On the other hand, the probe which brought up platinum was able to enter enough to the depths of the ditch.jmicro;63/suppl_1/i30-a/DFU075F1F1DFU075F1Fig.1.SHIM image of the AFM probe with the Pt nano-pillar fabricated by ion-beam induced deposition.

  19. AFM Studies of Salt Concentration Effects on the (110) Surface Structure of Tetragonal Lysozyme Crystals (United States)

    Pusey, Marc Lee; Gorti, Sridhar; Forsythe, Elizabeth; Konnert, John


    Previous high resolution AFM studies of the (110) surface of tetragonal chicken egg white lysozyme crystals had shown that only one of two possible molecular surfaces is present, those constituting the completed 43 helices. These suggested that the crystal growth process was by the solution-phase assembly of the growth units, which then attach to the surface. However, the best fit for the imaged surfaces, vs. those predicted based upon the bulk crystallographic coordinates, were obtained when the packing about the 43 helices was "tightened up", while maintaining the underlying crystallographic unit cell spacing. This results in a widening of the gap between adjacent helices, and the top- most layer(s) may no longer be in contact. We postulated that the tightened packing about the helices is a result of the high salt concentrations in the bulk solution, used to crystallize the protein, driving hydrophobic interactions. Once the crystal surface is sufficiently buried by subsequent growth layers the ratio of salt to protein molecules decreases and the helices relax to their bulk crystallographic coordinates. The crystal surface helix structure is thus a reflection of the solution structure, and the tightness of the packing about the 43 helices would be a function of the bulk salt concentration. AFM images of the (110) surface of tetragonal lysozyme crystals grown under low (2%) and high (5%) NaCl concentrations reveal differences in the packing about the 43 helices consistent with the above proposal.

  20. AFM visualization of sub-50nm polyplex disposition to the nuclear pore complex without compromising the integrity of the nuclear envelope. (United States)

    Andersen, Helene; Parhamifar, Ladan; Hunter, A Christy; Shahin, Victor; Moghimi, S Moein


    It has been questioned as to whether polyplexes in the cytoplasm can reach the nuclear compartment and if so in what form. By applying atomic force microscopy (AFM) to the nuclear envelope and the nuclear pore complexes, we demonstrate that disposition of polyethylenimine (PEI)/DNA polyplexes that were microinjected into the oocytes of Xenopus laevis, as an example of a non-dividing cell, is exclusive to the nuclear pore complex (NPC). AFM images show NPCs clogged only with sub-50nm polyplexes. This mode of disposition neither altered the morphology/integrity of the nuclear membrane nor the NPC. AFM images further show polyplexes on the nucleoplasmic side of the envelope, presumably indicating species in transit. Transmission electron microscopy studies of ruptured nuclei from transfected human cell lines demonstrate the presence of sub-50nm particles resembling polyplexes in morphology compared with control preparations.

  1. Differences in granular materials for analogue modelling: Insights from repeated compression tests analyzed with X-ray Computed Tomography and image analysis software (United States)

    Klinkmueller, M.; Schreurs, G.


    Six different granular materials for analogue modelling have been investigated using a sandbox with a compressional set-up and X-ray computed tomography (XRCT). The evolving structures were evaluated with image analysis software. The sandbox has one movable sidewall that is driven by a computer-controlled servomotor at 20 cm/h. A 12 cm wide and 20 cm long sheet of hard cardboard was placed on the base of the sandbox and attached to the moving sidewall creating a velocity discontinuity. The whole sandbox was covered on the inside with Alkor foil to reduce sidewall friction. Computed Tomography was used to scan the whole volume in 3 mm increments of shortening until 15 mm maximum deformation was reached. The second approach was a scanning procedure to a maximum deformation of 80 mm in 2 mm increments of shortening for the first 10 mm and in 5 mm increments for the last 70 mm. The short deformation scans were repeated three times to investigate reproducibility. The long deformation scans were performed twice. The physical properties of the materials (table 1) have been described in a previous material benchmark. Four natural quartz sands and two artificial granular materials, corundum brown sand and glass beads, have been used. The two artificial materials were used for this experimental series as examples for very angular and very rounded sands in contrast to the sub-rounded to angular natural quartz sands. The short deformation experiments show partly large differences in thrust angles of both front and back-thrust, in timing of thrust initiation, and in the degree of undulation of thrusts. The coarse-grained sands show smooth and low undulating thrusts that are only affected by the sidewall friction whereas the thrusts in fine-grained sands undulate significantly and partly divide and merge in an anastomosing fashion. The coarse-grained sand thrusts are clearer visualized by XRCT, which indicates a wider shear zone where the material dilates. Furthermore, the

  2. The dynamics of individual nucleosomes controls the chromatin condensation pathway: direct AFM visualization of variant chromatin

    CERN Document Server

    Montel, Fabien; Castelnovo, Martin; Bednar, Jan; Dimitrov, Stefan; Angelov, Dimitar; Faivre-Moskalenko, Cendrine


    Chromatin organization and dynamics is studied in this work at scales ranging from single nucleosome to nucleosomal array by using a unique combination of biochemical assays, single molecule imaging technique and numerical modeling. We demonstrate that a subtle modification in the nucleosome structure induced by the histone variant H2A.Bbd drastically modifies the higher order organization of the nucleosomal arrays. Importantly, as directly visualized by AFM, conventional H2A nucleosomal arrays exhibit specific local organization, in contrast to H2A.Bbd arrays, which show ?beads on a string? structure. The combination of systematic image analysis and theoretical modeling allows a quantitative description relating the observed gross structural changes of the arrays to their local organization. Our results strongly suggest that higher-order organization of H1-free nucleosomal arrays is mainly determined by the fluctuation properties of individual nucleosomes. Moreover, numerical simulations suggest the existenc...

  3. Conductive-probe AFM characterization of graphene sheets bonded to gold surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Hauquier, Fanny [Laboratoire de Genie Electrique de Paris, CNRS UMR8507, SUPELEC, UPMC Univ Paris 06, Univ Paris-Sud, 11 rue Joliot Curie, F-91192, Gif-sur-Yvette (France); CEA, IRAMIS, SPCSI Chemistry of Surfaces and Interfaces Group, F-91191 Gif-sur-Yvette (France); Alamarguy, David, E-mail: [Laboratoire de Genie Electrique de Paris, CNRS UMR8507, SUPELEC, UPMC Univ Paris 06, Univ Paris-Sud, 11 rue Joliot Curie, F-91192, Gif-sur-Yvette (France); Viel, Pascal [CEA, IRAMIS, SPCSI Chemistry of Surfaces and Interfaces Group, F-91191 Gif-sur-Yvette (France); Noeel, Sophie [Laboratoire de Genie Electrique de Paris, CNRS UMR8507, SUPELEC, UPMC Univ Paris 06, Univ Paris-Sud, 11 rue Joliot Curie, F-91192, Gif-sur-Yvette (France); Filoramo, Arianna [CEA, IRAMIS, LLB, Laboratory for Molecular Electronics, F-91191 Gif-sur-Yvette (France); Huc, Vincent [Univ Paris-Sud, ICMMO, UMR CNRS 8182, 15 rue Georges Clemenceau, F-91440 Orsay (France); Houze, Frederic [Laboratoire de Genie Electrique de Paris, CNRS UMR8507, SUPELEC, UPMC Univ Paris 06, Univ Paris-Sud, 11 rue Joliot Curie, F-91192, Gif-sur-Yvette (France); Palacin, Serge [CEA, IRAMIS, SPCSI Chemistry of Surfaces and Interfaces Group, F-91191 Gif-sur-Yvette (France)


    Conducting probe atomic force microscopy (CP-AFM) has been used to perform mechanical and electrical experiments on graphene layers bonded to polyaminophenylene (PAP) films grafted on gold substrates. This technique is a new approach for the characterization of graphene sheets and represents a complementary tool to Raman spectroscopy. The combination of friction and electrical imaging reveals that different stacked graphene sheets have been successfully distinguished from each other and from the underlying PAP films. Lateral force microscopy has shown that the friction is greatly reduced on graphene sheets in comparison with the organic coating. The electrical resistance images show very different local conduction properties which can be linked to the number of underlying graphene sheets. The resistance decreases very slowly when the normal load increases. Current-voltage curves display characteristics of metal-molecule-metal junctions.

  4. Repeat-until-success quantum repeaters (United States)

    Bruschi, David Edward; Barlow, Thomas M.; Razavi, Mohsen; Beige, Almut


    We propose a repeat-until-success protocol to improve the performance of probabilistic quantum repeaters. Conventionally, these rely on passive static linear-optics elements and photodetectors to perform Bell-state measurements (BSMs) with a maximum success rate of 50%. This is a strong impediment for entanglement swapping between distant quantum memories. Every time a BSM fails, entanglement needs to be redistributed between the corresponding memories in the repeater link. The key ingredients of our scheme are repeatable BSMs. Under ideal conditions, these turn probabilistic quantum repeaters into deterministic ones. Under realistic conditions, our protocol too might fail. However, using additional threshold detectors now allows us to improve the entanglement generation rate by almost orders of magnitude, at a nominal distance of 1000 km, compared to schemes that rely on conventional BSMs. This improvement is sufficient to make the performance of our scheme comparable to the expected performance of some deterministic quantum repeaters.

  5. Nano-Bio-Mechanics of Neuroblastoma Cells Using AFM (United States)

    Bastatas, Lyndon; Matthews, James; Kang, Min; Park, Soyeun


    We have conducted an in vitro study to determine the elastic moduli of neurobalstoma cell lines using atomic force microscopy. Using a panel of cell lines established from neuroblastoma patients at different stages of disease progress and treatment, we have investigated the differences in elastic moduli during a course of cancer progression and chemotherapy. The cells were grown on the hard substrates that are chemically functionalized to enhance adhesion. We have performed the AFM indentation experiments with different applied forces from the AFM probe. For the purpose of the comparison between cell lines, the indentations were performed only on cell centers. The obtained force-distance curves were analyzed using the Hertz model in order to extract the elastic moduli. We have found that the elastic moduli of human neuroblastoma cells significantly varied during the disease progression. We postulate that the observed difference might be affected by the treatment and chemotherapy.


    Institute of Scientific and Technical Information of China (English)

    A.L. Fan; W.H. Tian; M. Kurosaki


    Nano-sized growth of zinc electrodeposit on the ferrite substrate has been studied by means of in situ scanning tunnel microscopy (STM) and atomic force micoscopy (AFM). It is found that the morphology of zinc electrodeposit varies from initial about 30nm granular crystals to layered platelet crystals with increasing deposition time by using in situ STM. With AFM, the results show that the platelet crystals ave hexagonal in shape and the hexagonal platelet crystals form steps perpendicular to the growth direction by side-by-side stacking along the (0001), surface. The mechanism of morphological change is discussed in details. It is proposed that these steps grow laterally as a result of the embedment of zinc ion clusters.

  7. BOREAS AFM-5 Level-1 Upper Air Network Data (United States)

    Barr, Alan; Hrynkiw, Charmaine; Newcomer, Jeffrey A. (Editor); Hall, Forrest G. (Editor); Smith, David E. (Technical Monitor)


    The Boreal Ecosystem-Atmosphere Study (BOREAS) Airborne Fluxes and Meteorology (AFM)-5 team collected and processed data from the numerous radiosonde flights during the project. The goals of the AFM-05 team were to provide large-scale definition of the atmosphere by supplementing the existing Atmospheric Environment Service (AES) aerological network, both temporally and spatially. This data set includes basic upper-air parameters collected from the network of upper-air stations during the 1993, 1994, and 1996 field campaigns over the entire study region. The data are contained in tabular ASCII files. The level-1 upper-air network data are available from the Earth Observing System Data and Information System (EOSDIS) Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC). The data files also are available on a CD-ROM (see document number 20010000884).

  8. Application of the Discrete Wavelet Transform to SEM and AFM Micrographs for Quantitative Analysis of Complex Surfaces. (United States)

    Workman, Michael J; Serov, Alexey; Halevi, Barr; Atanassov, Plamen; Artyushkova, Kateryna


    The discrete wavelet transform (DWT) has found significant utility in process monitoring, filtering, and feature isolation of SEM, AFM, and optical images. Current use of the DWT for surface analysis assumes initial knowledge of the sizes of the features of interest in order to effectively isolate and analyze surface components. Current methods do not adequately address complex, heterogeneous surfaces in which features across multiple size ranges are of interest. Further, in situations where structure-to-property relationships are desired, the identification of features relevant for the function of the material is necessary. In this work, the DWT is examined as a tool for quantitative, length-scale specific surface metrology without prior knowledge of relevant features or length-scales. A new method is explored for determination of the best wavelet basis to minimize variation in roughness and skewness measurements with respect to change in position and orientation of surface features. It is observed that the size of the wavelet does not directly correlate with the size of features on the surface, and a method to measure the true length-scale specific roughness of the surface is presented. This method is applied to SEM and AFM images of non-precious metal catalysts, yielding new length-scale specific structure-to-property relationships for chemical speciation and fuel cell performance. The relationship between SEM and AFM length-scale specific roughness is also explored. Evidence is presented that roughness distributions of SEM images, as measured by the DWT, is representative of the true surface roughness distribution obtained from AFM.

  9. Nano-Wilhelmy investigation of dynamic wetting properties of AFM tips through tip-nanobubble interaction



    The dynamic wetting properties of atomic force microscopy (AFM) tips are of much concern in many AFM-related measurement, fabrication, and manipulation applications. In this study, the wetting properties of silicon and silicon nitride AFM tips are investigated through dynamic contact angle measurement using a nano-Wilhelmy balance based method. This is done by capillary force measurement during extension and retraction motion of AFM tips relative to interfacial nanobubbles. The working princi...

  10. Leading Change: Transitioning the AFMS into a High Reliability Organization (United States)


    Employees want to know when the change is going to occur; lack of details leads to speculation and rumor, causing concern and workplace disruption...front, demonstrating how to implement the new culture in the workplace .34 People fear the unknown, and leaders can overcome this by successfully...designed to improve patient safety, communication and clinic teamwork skills. The AFMS could collaborate with the Agency for Healthcare Research and

  11. Sub-diffraction nano manipulation using STED AFM.

    Directory of Open Access Journals (Sweden)

    Jenu Varghese Chacko

    Full Text Available In the last two decades, nano manipulation has been recognized as a potential tool of scientific interest especially in nanotechnology and nano-robotics. Contemporary optical microscopy (super resolution techniques have also reached the nanometer scale resolution to visualize this and hence a combination of super resolution aided nano manipulation ineluctably gives a new perspective to the scenario. Here we demonstrate how specificity and rapid determination of structures provided by stimulated emission depletion (STED microscope can aid another microscopic tool with capability of mechanical manoeuvring, like an atomic force microscope (AFM to get topological information or to target nano scaled materials. We also give proof of principle on how high-resolution real time visualization can improve nano manipulation capability within a dense sample, and how STED-AFM is an optimal combination for this job. With these evidences, this article points to future precise nano dissections and maybe even to a nano-snooker game with an AFM tip and fluorospheres.

  12. Nanoscale rippling on polymer surfaces induced by AFM manipulation. (United States)

    D'Acunto, Mario; Dinelli, Franco; Pingue, Pasqualantonio


    Nanoscale rippling induced by an atomic force microscope (AFM) tip can be observed after performing one or many scans over the same area on a range of materials, namely ionic salts, metals, and semiconductors. However, it is for the case of polymer films that this phenomenon has been widely explored and studied. Due to the possibility of varying and controlling various parameters, this phenomenon has recently gained a great interest for some technological applications. The advent of AFM cantilevers with integrated heaters has promoted further advances in the field. An alternative method to heating up the tip is based on solvent-assisted viscoplastic deformations, where the ripples develop upon the application of a relatively low force to a solvent-rich film. An ensemble of AFM-based procedures can thus produce nanoripples on polymeric surfaces quickly, efficiently, and with an unprecedented order and control. However, even if nanorippling has been observed in various distinct modes and many theoretical models have been since proposed, a full understanding of this phenomenon is still far from being achieved. This review aims at summarizing the current state of the art in the perspective of achieving control over the rippling process on polymers at a nanoscale level.

  13. Near-Field Spectroscopy with Nanoparticles Deposited by AFM (United States)

    Anderson, Mark S.


    An alternative approach to apertureless near-field optical spectroscopy involving an atomic-force microscope (AFM) entails less complexity of equipment than does a prior approach. The alternative approach has been demonstrated to be applicable to apertureless near-field optical spectroscopy of the type using an AFM and surface enhanced Raman scattering (SERS), and is expected to be equally applicable in cases in which infrared or fluorescence spectroscopy is used. Apertureless near-field optical spectroscopy is a means of performing spatially resolved analyses of chemical compositions of surface regions of nanostructured materials. In apertureless near-field spectroscopy, it is common practice to utilize nanostructured probe tips or nanoparticles (usually of gold) having shapes and dimensions chosen to exploit plasmon resonances so as to increase spectroscopic-signal strengths. To implement the particular prior approach to which the present approach is an alternative, it is necessary to integrate a Raman spectrometer with an AFM and to utilize a special SERS-active probe tip. The resulting instrumentation system is complex, and the tasks of designing and constructing the system and using the system to acquire spectro-chemical information from nanometer-scale regions on a surface are correspondingly demanding.

  14. Stiffness of cancer cells measured with an AFM indentation method. (United States)

    Hayashi, Kozaburo; Iwata, Mayumi


    The stiffness of cancer cells and its changes during metastasis are very important for understanding the pathophysiology of cancer cells and the mechanisms of metastasis of cancer. As the first step of the studies on the mechanics of cancer cells during metastasis, we determined the elasticity and stiffness of cancer cells with an indentation method using an atomic force microscope (AFM), and compared with those of normal cells. In most of the past AFM studies, Young׳s elastic moduli of cells have been calculated from force-indentation data using Hertzian model. As this model is based on several important assumptions including infinitesimal strain and Hooke׳s linear stress-strain law, in the exact sense it cannot be applied to cells that deform very largely and nonlinearly. To overcome this problem, we previously proposed an equation F=a[exp(bδ)-1] to describe relations between force (F) and indentation (δ), where a and b are parameters relating with cellular stiffness. In the present study, we applied this method to cancer cells instead of Young׳s elastic modulus. The conclusions obtained are: 1) AFM indentation test data of cancer cells can be very well described by the above equation, 2) cancer cells are softer than normal cells, and 3) there are no significant locational differences in the stiffness of cancer cells between the central and the peripheral regions. These methods and results are useful for studying the mechanics of cancer cells and the mechanisms of metastasis.

  15. Interlaboratory round robin on cantilever calibration for AFM force spectroscopy. (United States)

    te Riet, Joost; Katan, Allard J; Rankl, Christian; Stahl, Stefan W; van Buul, Arend M; Phang, In Yee; Gomez-Casado, Alberto; Schön, Peter; Gerritsen, Jan W; Cambi, Alessandra; Rowan, Alan E; Vancso, G Julius; Jonkheijm, Pascal; Huskens, Jurriaan; Oosterkamp, Tjerk H; Gaub, Hermann; Hinterdorfer, Peter; Figdor, Carl G; Speller, Sylvia


    Single-molecule force spectroscopy studies performed by Atomic Force Microscopes (AFMs) strongly rely on accurately determined cantilever spring constants. Hence, to calibrate cantilevers, a reliable calibration protocol is essential. Although the thermal noise method and the direct Sader method are frequently used for cantilever calibration, there is no consensus on the optimal calibration of soft and V-shaped cantilevers, especially those used in force spectroscopy. Therefore, in this study we aimed at establishing a commonly accepted approach to accurately calibrate compliant and V-shaped cantilevers. In a round robin experiment involving eight different laboratories we compared the thermal noise and the Sader method on ten commercial and custom-built AFMs. We found that spring constants of both rectangular and V-shaped cantilevers can accurately be determined with both methods, although the Sader method proved to be superior. Furthermore, we observed that simultaneous application of both methods on an AFM proved an accurate consistency check of the instrument and thus provides optimal and highly reproducible calibration. To illustrate the importance of optimal calibration, we show that for biological force spectroscopy studies, an erroneously calibrated cantilever can significantly affect the derived (bio)physical parameters. Taken together, our findings demonstrated that with the pre-established protocol described reliable spring constants can be obtained for different types of cantilevers.

  16. The role of different toothpastes on preventing dentin erosion: an SEM and AFM study®. (United States)

    Poggio, Claudio; Lombardini, Marco; Vigorelli, Paolo; Colombo, Marco; Chiesa, Marco


    The aim of the present in vitro study was the evaluation of new formulation toothpastes on preventing dentin erosion produced by a soft drink (Coca Cola®), using atomic force microscopy (AFM) and scanning electron microscopy (SEM). Fifty dentin specimens were divided in treatment and control halves and were than assigned to 5 groups of 10 specimens each: group 1a: intact dentin, group 1b: dentin + soft drink, group 2a: intact dentin + Biorepair Plus-Sensitive Teeth®, group 2b: dentin + soft drink + Biorepair Plus-Sensitive Teeth®, group 3a: intact dentin + Biorepair Plus-Total Protection®, group 3b: dentin + soft drink + Biorepair Plus-Total Protection®, group 4a: intact dentin + Sensodyne Repair & Protect®, group 4b: dentin + soft drink + Sensodyne Repair & Protect®, group 5a: intact dentin + Colgate Sensitive Pro Relief®, group 5b: dentin + soft drink + Colgate Sensitive Pro Relief®. The surface of each specimen was imaged by AFM and SEM. Comparing specimens of group a and b (no demineralization and demineralization), a statistically significant difference (p Sensodyne Repair & Protect® provided higher protective effect against dentin demineralization. © 2013 Wiley Periodicals, Inc.

  17. Nitrogen ion implantation on stainless steel: AFM study of surface modification

    Energy Technology Data Exchange (ETDEWEB)

    Chico, B. [Dpto. Ingenieria de Materiales, Degradacion y Durabilidad, Centro Nacional de Investigaciones Metalurgicas (CENIM), CSIC, Avda. Gregorio del Amo, 8, 28040 Madrid (Spain)]. E-mail:; Martinez, L. [Dpto. Ciencia de los Materiales e Ingenieria Metalurgica, Facultad de Ciencias Quimicas, Universidad Complutense de Madrid, Ciudad Universitaria, 28040 Madrid (Spain); Perez, F.J. [Dpto. Ciencia de los Materiales e Ingenieria Metalurgica, Facultad de Ciencias Quimicas, Universidad Complutense de Madrid, Ciudad Universitaria, 28040 Madrid (Spain)


    This work presents a study by means of atomic force microscopy (AFM) of the modification of the surface topography of AISI 304 austenitic stainless steel after N-ion implantation, irradiated by 1 x 10{sup 15} N{sub 2}{sup +}/cm{sup 2} at 80 keV. Prior to the implantation surface modification, the samples were electropolished for the optimum observation of the surface at a small scale to obtain an initial surface with the smaller roughness. The electrolytic bath was composed of a mixture of water/sulphuric acid/orthophosphoric acid in percentages 20, 20 and 60%, respectively. Once the surface was optimized, the samples were implanted and observed by AFM, a new technique whose importance relies on its resolution power, allowing the acquisition of topographic images of the surface with nanometric resolution. Thanks to the high resolution power could be observed that ion implantation increases the surface roughness and promotes the apparition of 3 {mu}m wide and 10 nm depth craters as well as the apparition of products with singular morphology.

  18. Magnetoelectric versus thermal actuation characteristics of shear force AFM probes with piezoresistive detection (United States)

    Sierakowski, Andrzej; Kopiec, Daniel; Majstrzyk, Wojciech; Kunicki, Piotr; Janus, Paweł; Dobrowolski, Rafał; Grabiec, Piotr; Rangelow, Ivo W.; Gotszalk, Teodor


    In this paper the authors compare methods used for piezoresistive microcantilevers actuation for the atomic force microscopy (AFM) imaging in the dynamic shear force mode. The piezoresistive detection is an attractive technique comparing the optical beam detection of deflection. The principal advantage is that no external alignment of optical source and detector are needed. When the microcantilever is deflected, the stress is transferred into a change of resistivity of piezoresistors. The integration of piezoresistive read-out provides a promising solution in realizing a compact non-contact AFM. Resolution of piezoresistive read-out is limited by three main noise sources: Johnson, 1/f and thermomechanical noise. In the dynamic shear force mode measurement the method used for cantilever actuation will also affect the recorded noise in the piezoresistive detection circuit. This is the result of a crosstalk between an aluminium path (current loop used for actuation) and piezoresistors located near the base of the beam. In this paper authors described an elaborated in ITE (Institute of Electron Technology) technology of fabrication cantilevers with piezoresistive detection of deflection and compared efficiency of two methods used for cantilever actuation.

  19. Sensing inhomogeneous mechanical properties of human corneal Descemet's membrane with AFM nano-indentation. (United States)

    Di Mundo, Rosa; Recchia, Giuseppina; Parekh, Mohit; Ruzza, Alessandro; Ferrari, Stefano; Carbone, Giuseppe


    The paper describes a highly space-resolved characterization of the surface mechanical properties of the posterior human corneal layer (Descemet's membrane). This has been accomplished with Atomic Force Microscopy (AFM) nano-indentation by using a probe with a sharp tip geometry. Results indicate that the contact with this biological tissue in liquid occurs with no (or very low) adhesion. More importantly, under the same operating conditions, a broad distribution of penetration depth can be measured on different x-y positions of the tissue surface, indicating a high inhomogeneity of surface stiffness, not yet clearly reported in the literature. An important contribution to such inhomogeneity should be ascribed to the discontinuous nature of the collagen/proteoglycans fibers matrix tissue, as can be imaged by AFM when the tissue is semi-dry. Using classical contact mechanics calculations adapted to the specific geometry of the tetrahedral tip it has been found that the elastic modulus E of the material in the very proximity of the surface ranges from 0.23 to 2.6 kPa. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Prospective comparison of T2w-MRI and dynamic-contrast-enhanced MRI, 3D-MR spectroscopic imaging or diffusion-weighted MRI in repeat TRUS-guided biopsies

    Energy Technology Data Exchange (ETDEWEB)

    Portalez, Daniel [Clinique Pasteur, 45, Department of Radiology, Toulouse (France); Rollin, Gautier; Mouly, Patrick; Jonca, Frederic; Malavaud, Bernard [Hopital de Rangueil, Department of Urology, Toulouse Cedex 9 (France); Leandri, Pierre [Clinique Saint Jean, 20, Department of Urology, Toulouse (France); Elman, Benjamin [Clinique Pasteur, 45, Department of Urology, Toulouse (France)


    To compare T2-weighted MRI and functional MRI techniques in guiding repeat prostate biopsies. Sixty-eight patients with a history of negative biopsies, negative digital rectal examination and elevated PSA were imaged before repeat biopsies. Dichotomous criteria were used with visual validation of T2-weighted MRI, dynamic contrast-enhanced MRI and literature-derived cut-offs for 3D-spectroscopy MRI (choline-creatine-to-citrate ratio >0.86) and diffusion-weighted imaging (ADC x 10{sup 3} mm{sup 2}/s < 1.24). For each segment and MRI technique, results were rendered as being suspicious/non-suspicious for malignancy. Sextant biopsies, transition zone biopsies and at least two additional biopsies of suspicious areas were taken. In the peripheral zones, 105/408 segments and in the transition zones 19/136 segments were suspicious according to at least one MRI technique. A total of 28/68 (41.2%) patients were found to have cancer. Diffusion-weighted imaging exhibited the highest positive predictive value (0.52) compared with T2-weighted MRI (0.29), dynamic contrast-enhanced MRI (0.33) and 3D-spectroscopy MRI (0.25). Logistic regression showed the probability of cancer in a segment increasing 12-fold when T2-weighted and diffusion-weighted imaging MRI were both suspicious (63.4%) compared with both being non-suspicious (5.2%). The proposed system of analysis and reporting could prove clinically relevant in the decision whether to repeat targeted biopsies. (orig.)

  1. A Prospective Comparison of Selective Multiparametric Magnetic Resonance Imaging Fusion-Targeted and Systematic Transrectal Ultrasound-Guided Biopsies for Detecting Prostate Cancer in Men Undergoing Repeated Biopsies

    DEFF Research Database (Denmark)

    Boesen, Lars; Nørgaard, Nis; Løgager, Vibeke


    + 3) cancers (14/64 vs. 41/74) and more patients with intermediate/high-grade cancers (GS ≥3 + 4) (50/64 vs. 33/74) using fewer biopsy cores compared with TRUS-bx (p targeted-only" approach in men with PI-RADS ≥3 lesions reduced the number of men requiring repeated biopsies......INTRODUCTION: The aim of the study was to compare the prostate cancer (PCa) detection rate of systematic transrectal ultrasound-guided biopsies (TRUS-bx) and multiparametric-MRI targeted biopsies (mp-MRI-bx) in a repeat biopsy setting and evaluate the clinical significance following an "MRI-targeted...... by 50%, decreased low-grade cancer diagnoses by 66%, and increased intermediate/high-grade cancer diagnoses by 52%. CONCLUSIONS: MRI-targeted biopsies have a high detection rate for significant PCa in patients with prior negative transrectal ultrasound-guided biopsies and preferentially detect...

  2. Early experience with multiparametric magnetic resonance imaging-targeted biopsies under visual transrectal ultrasound guidance in patients suspicious for prostate cancer undergoing repeated biopsy

    DEFF Research Database (Denmark)

    Boesen, Lars; Noergaard, Nis; Chabanova, Elizaveta


    -RADS) and Likert classification. All underwent repeated TRUS-bx (10 cores) and mp-MRI-bx under visual TRUS guidance of any mp-MRI-suspicious lesion not targeted by systematic TRUS-bx. RESULTS: PCa was found in 39 out of 83 patients (47%) and mp-MRI identified at least one lesion with some degree of suspicion...... in all 39 patients. Both PI-RADS and Likert scoring showed a high correlation between suspicion of malignancy and biopsy results (p

  3. Solvent-mediated repair and patterning of surfaces by AFM

    Energy Technology Data Exchange (ETDEWEB)

    Elhadj, S; Chernov, A; De Yoreo, J


    A tip-based approach to shaping surfaces of soluble materials with nanometer-scale control is reported. The proposed method can be used, for example, to eliminate defects and inhomogeneities in surface shape, repair mechanical or laser-induced damage to surfaces, or perform 3D lithography on the length scale of an AFM tip. The phenomenon that enables smoothing and repair of surfaces is based on the transport of material from regions of high- to low-curvature within the solution meniscus formed in a solvent-containing atmosphere between the surface in question and an AFM tip scanned over the surface. Using in situ AFM measurements of the kinetics of surface remodeling on KDP (KH{sub 2}PO{sub 4}) crystals in humid air, we show that redistribution of solute material during relaxation of grooves and mounds is driven by a reduction in surface free energy as described by the Gibbs-Thomson law. We find that the perturbation from a flat interface evolves according to the diffusion equation where the effective diffusivity is determined by the product of the surface stiffness and the step kinetic coefficient. We also show that, surprisingly, if the tip is instead scanned over or kept stationary above an atomically flat area of the surface, a convex structure is formed with a diameter that is controlled by the dimensions of the meniscus, indicating that the presence of the tip and meniscus reduces the substrate chemical potential beneath that of the free surface. This allows one to create nanometer-scale 3D structures of arbitrary shape without the removal of substrate material or the use of extrinsic masks or chemical compounds. Potential applications of these tip-based phenomena are discussed.

  4. Single microparticles mass measurement using an AFM cantilever resonator

    CERN Document Server

    Mauro, Marco; Ferrini, Gianluca; Puglisi, Roberto; Balduzzi, Donatella; Galli, Andrea


    In this work is presented a microbalance for single microparticle sensing based on resonating AFM cantilever. The variation of the resonator eigenfrequency is related to the particle mass positioned at the free apex of the cantilever. An all-digital phase locked loop (PLL) control system is developed to detect the variations in cantilever eigenfrequency. Two particle populations of different materials are used in the experimental test, demonstrating a mass sensitivity of 15 Hz/pg in ambient conditions. Thereby it is validated the possibility of developing an inexpensive, portable and sensitive microbalance for point-mass sensing.

  5. Photonic wires sidewall roughness measures using AFM capabilities

    DEFF Research Database (Denmark)

    Malureanu, Radu; Frandsen, Lars Hagedorn


    Within the last years, interest in photonic wires and photonic crystals grew due to their demonstrated ability of controlling light propagation and characteristics. One of the limitations of such devices is due to the induced roughness during the fabrication process. Generally, an increase...... in roughness leads to loss increase thus limiting the propagation length and postponing the commercialization of such structures. In this paper we present a new algorithm for measuring the sidewall roughness of our devices based on atomic force microscope (AFM) approach. Using this algorithm, the roughness can...... be quantified and thus actions in decreasing it can be taken improving the device's performance....

  6. Progress of AFM Technology in the Study of Cells%原子力显微镜技术在细胞研究中的进展

    Institute of Scientific and Technical Information of China (English)

    刘波; 马立; 谢炜; 张志伟


    原子力显微镜(AFM)是生物显微技术的一个重要组成部分,可实现液体环境下活细胞高分辨率的成像与操作,为细胞生物学研究提供了新的方法.近年来,AFM已经逐渐发展成为集样品成像、力测量及操作等功能于一体的多功能生物细胞研究平台,在细胞研究中得到了广泛的应用.在简要介绍AFM组成与工作原理的基础上,详细阐述了近年来基于AFM成像与力谱技术的细胞研究的发展状况.针对AFM本身所存在的不足,介绍了AFM与其他技术相结合的研究成果,并对AFM在生物细胞研究中未来的发展方向进行了展望.%Atomic force microscopy (AFM) is an important part of the biological microscope technology, which can realize high resolution imaging and manipulating of living cells in liquid environment, and provide a new method for the cell biology research. In recent years, AFM has gradually developed into a multi-function biological cell research platform with the functions of the sample imaging, force measurement and operation, which has been widely used in the cell research. On the basis of the brief introduction of AFM configuration and working principle, the cell research developments based on the AFM imaging and force spectrum technology are discussed in detail. For covering the shortages of the AFM, the research results of AFM combined with other technologies are introduced, and the development trends of the AFM in the cell biology research are prospected.

  7. Nano-topographic evaluation of highly disordered fractal-like structures of immobilized oligonucleotides using AFM

    Energy Technology Data Exchange (ETDEWEB)

    Sawant, P.D. [BioNanoEngineering Laboratory, Faculty of Engineering and Industrial Sciences, Swinburne University of Technology, Hawthorn, Vic. 4122 (Australia)]. E-mail:; Nicolau, D.V. [BioNanoEngineering Laboratory, Faculty of Engineering and Industrial Sciences, Swinburne University of Technology, Hawthorn, Vic. 4122 (Australia)


    In a recent trend of micro- and nano-array technologies, polymers are gaining preference over traditional substrates such as glass, silicates, etc. as a model biosurface to immobilize biomolecules. In present paper, we compared model polymeric surfaces such as cyclo olefin copolymer (COC) and polycarbonate (PC), with traditional surfaces such as silicone-wafer and mica. We used a 2D fractal dimension method, i.e. the perimeter-area relationship (PAR) to study the immobilization of 26 base pair oligonucleotide primer on surfaces which are imaged by AFM. Results revealed that the efficiency of the vertical immobilization is in the following order: COC > PC > mica > Si-wafer which can be contributed to chemical and nano-topographical heterogeneity. This study is useful for in-depth understanding of fundamental issues such as effects of manufacturing parameters and evaluation of surface nanotopographies for the development of high-density biochips.

  8. Simultaneous topographic and amperometric membrane mapping using an AFM probe integrated biosensor. (United States)

    Stanca, Sarmiza Elena; Csaki, Andrea; Urban, Matthias; Nietzsche, Sandor; Biskup, Christoph; Fritzsche, Wolfgang


    The investigation of the plasma membrane with intercorrelated multiparameter techniques is a prerequisite for understanding its function. Presented here, is a simultaneous electrochemical and topographic study of the cell membrane using a miniaturized amperometric enzymatic biosensor. The fabrication of this biosensor is also reported. The biosensor combines a scanning force microscopy (AFM) gold-coated cantilever and an enzymatic transducer layer of peroxidases (PODs). When these enzymes are brought in contact with the substrate, the specific redox reaction produces an electric current. The intensity of this current is detected simultaneously with the surface imaging. For sensor characterization, hydroquinone-2-carboxylic acid (HQ) is selected as an intrinsic source of H(2)O(2). HQ has been electrochemically regenerated by the reduction of antraquinone-2-carboxylic acid (AQ). The biosensor reaches the steady state value of the current intensity in 1 ± 0.2s.

  9. Analysis of air adsorptive on solid surfaces by AFM and XPS

    Institute of Scientific and Technical Information of China (English)

    WANG Rong-guang; Mitsuo KIDO


    Solid surfaces of HOPG,pure copper,chromium,zinc,copper and SUS304 steel were observed in ambient air with an a.c. non-contact mode of atomic force microscope(AFM). A type of film-like-domains (adsorptive) was detected on the above surfaces. The thickness of the adsorptive was about 1.2-2.4 nm in this case. The film-like-adsorptive was confirmed to be a liquid layer by the static contact-mode scanning,the measurement of the elasticity and viscosity images,and the detection of the condensation/ evaporation phenomena when the relative humidity changed. The liquid layer is considered to be condensed water covered with organic contaminant.

  10. Stitching Grid-wise Atomic Force Microscope Images

    DEFF Research Database (Denmark)

    Vestergaard, Mathias Zacho; Bengtson, Stefan Hein; Pedersen, Malte


    Atomic Force Microscopes (AFM) are able to capture images with a resolution in the nano metre scale. Due to this high resolution, the covered area per image is relatively small, which can be problematic when surveying a sample. A system able to stitch AFM images has been developed to solve...

  11. Stitching Grid-wise Atomic Force Microscope Images

    DEFF Research Database (Denmark)

    Vestergaard, Mathias Zacho; Bengtson, Stefan Hein; Pedersen, Malte


    Atomic Force Microscopes (AFM) are able to capture images with a resolution in the nano metre scale. Due to this high resolution, the covered area per image is relatively small, which can be problematic when surveying a sample. A system able to stitch AFM images has been developed to solve this p...

  12. Repetibilidade da mensuração de imagens das características de carcaça obtidas por ultrassonografia em fêmeas Nelore Repeatability of ultrasound image measurements of carcass traits in Nellore cattle

    Directory of Open Access Journals (Sweden)

    Maria Eugênia Zerlotti Mercadante


    Full Text Available Avaliou-se a repetibilidade da mensuração de imagens de ultrassom da área do músculo longissimus dorsi (AOL e das espessuras de gordura subcutânea do lombo (EGL e da garupa (EGG. Imagens de ultrassom tomadas no lombo (entre a 12ª e a 13ª costela e na garupa (entre os músculos gluteus medium e biceps femoris de novilhas Nelore de 14 a 22 meses de idade foram classificadas em aceitáveis, marginais e rejeitáveis. As imagens aceitáveis e marginais foram mensuradas duas vezes por três técnicos em diferentes níveis de treinamento. Foram estimadas as repetibilidades entre e dentro de técnicos por classe de qualidade da imagem, para determinação do efeito da qualidade da imagem e do técnico no valor absoluto da diferença entre a primeira e a segunda mensuração dessas características. A repetibilidade para as imagens aceitáveis foi maior que para imagens marginais, tanto entre como dentro de técnicos. Na análise da diferença absoluta entre a primeira e a segunda interpretação, foram significativos os efeitos de técnico para AOL e EGL e de classe de qualidade da imagem para AOL. Em geral, o técnico com maior experiência apresentou maiores valores de repetibilidade. É recomendável que a mensuração de imagens de animais de mesmo grupo contemporâneo seja feita por um único técnico.The repeatability of ultrasound image measurements of the longissimus dorsi muscle (AOL and of the rumpfat (EGG and backfat (EGL subcutaneous thickness was evaluated. Ultrasound images taken from the back (between 12th and 13th ribs and from the rump (between gluteus medium and biceps femoris muscles of Nelore heifers at 14 and 22 months of age were classified as acceptable, marginal and rejected. The acceptable and marginal images were measured twice by three technicians at different levels of training. It was estimated repeatabilities among and within technicians by class of image quality in order to determine effect of image quality and of

  13. Repeatability of Harris Corner Detector

    Institute of Scientific and Technical Information of China (English)

    HU Lili


    Interest point detectors are commonly employed to reduce the amount of data to be processed. The ideal interest point detector would robustly select those features which are most appropriate or salient for the application and data at hand. This paper shows that interest points are geometrically stable under different transformations.This property makes interest points very successful in the context of image matching. To measure this property quantatively, we introduce a evaluation criterion: repeatability rate.

  14. The repeatability and reproducibility of fetal cardiac ventricular volume calculations utilizing Spatio-Temporal Image Correlation (STIC) and Virtual Organ Computed-aided AnaLysis (VOCAL™) (United States)

    Hamill, Neil; Romero, Roberto; Hassan, Sonia S; Lee, Wesley; Myers, Stephen A; Mittal, Pooja; Kusanovic, Juan Pedro; Chaiworapongsa, Tinnakorn; Vaisbuch, Edi; Espinoza, Jimmy; Gotsch, Francesca; Carletti, Angela; Goncalves, Luis F.; Yeo, Lami


    Objective To quantify the repeatability and reproducibility of fetal cardiac ventricular volumes obtained utilizing STIC and VOCAL™. Methods A technique was developed to compute ventricular volumes using the sub-feature: Contour Finder: Trace. Twenty-five normal pregnancies were evaluated for the following: (1) to compare the coefficient of variation (CV) in ventricular volumes between 15° and 30° rotation; (2) to compare the CV between three methods of quantifying ventricular volumes: (a) Manual Trace (b) Inversion Mode and (c) Contour Finder: Trace; and (3) to determine repeatability by calculating agreement and reliability of ventricular volumes when each STIC was measured twice by 3 observers. Reproducibility was assessed by obtaining two STICs from each of 44 normal pregnancies. For each STIC, 2 ventricular volume calculations were performed, and agreement and reliability were evaluated. Additionally, measurement error was examined. Results (1) Agreement was better with 15° rotation than 30° (15°: 3.6%, 95% CI: 3.0 – 4.2 versus 30°: 7.1%, 95% CI: 5.8 – 8.6; p<0.001); (2) ventricular volumes obtained with Contour Finder: Trace had better agreement than those obtained using either Inversion Mode (Contour Finder: Trace: 3.6%, 95% CI 3.0 – 4.2 versus Inversion Mode: 6.0%, 95% CI 4.9 – 7.2; p < 0.001) or Manual Trace (10.5%, 95% CI 8.7 – 12.5; p < 0.001); (3) ventricular volumes were repeatable with good agreement and excellent reliability for both intra-observer and inter-observer measurements; and 4) ventricular volumes were reproducible with negligible difference in agreement and good reliability. In addition, bias between STIC acquisitions was minimal (<1%; mean percent difference −0.4%, 95% limits of agreement: −5.4 – 5.9). Conclusions Fetal echocardiography utilizing STIC and VOCAL allows repeatable and reproducible calculation of ventricular volumes with the sub-feature Contour Finder: Trace. PMID:19778875

  15. Interactions between chitosan and cells measured by AFM

    Energy Technology Data Exchange (ETDEWEB)

    Hsiao, Sheng-Wen; Thien, Doan Van Hong; Ho, Ming-Hua [Department of Chemical Engineering, National Taiwan University of Science and Technology, Taipei 10617, Taiwan (China); Hsieh, Hsyue-Jen [Department of Chemical Engineering, National Taiwan University, Taipei 10617, Taiwan (China); Li, Chung-Hsing [Division of Orthodontics and Pediatric Dentistry, Department of Dentistry, Tri-Service General Hospital, Taipei, Taiwan (China); Hung, Chang-Hsiang [Department of Dentistry, Kinmen Hospital Department of Health, Taiwan (China); Li, Hsi-Hsin, E-mail: [Deputy Superintendent, Kinmen Hospital Department of Health, Taiwan (China)


    Chitosan, a biocompatible material that has been widely used in bone tissue engineering, is believed to have a high affinity to osteoblastic cells. This research is the first to prove this hypothesis. By using atomic force microscopy (AFM) with a chitosan-modified cantilever, quantitative evaluation of the interforce between chitosan and cells was carried out. A chitosan tip functionalized with Arg-Gly-Asp (RGD) was also used to measure the interforce between RGD-chitosan and osteoblastic cells. This research concluded by examining cell adhesion and spreading of chitosan substrates as further characterization of the interactions between cells and chitosan. The force measured by AFM showed that the interforce between chitosan and osteoblasts was the highest (209 nN). The smallest adhesion force (61.8 nN) appeared between chitosan and muscle fibroblasts, which did not demonstrate any osteoblastic properties. This result proved that there was a significant interaction between chitosan and bone cells, and correlated with the observations of cell attachment and spreading. The technique developed in this research directly quantified the adhesion between chitosan and cells. This is the first study to demonstrate that specific interaction exists between chitosan and osteoblasts.

  16. Comparison of particle sizes determined with impactor, AFM and SEM (United States)

    Gwaze, Patience; Annegarn, Harold J.; Huth, Joachim; Helas, Günter


    Particles size comparisons were made between conventional aerodynamic and mobility sizing techniques and physical geometric sizes measured by high resolution microscopes. Atmospheric particles were collected during the wet and dry seasons in the Amazonian ecosystems. Individual particles deposited on four stages of the MOUDI (Micro-Orifice Uniform Deposition Impactor) were characterised for particle volumes, projected surface diameters and morphologies with an Atomic Force Microscope (AFM) and a Scanning Electron Microscope (SEM). AFM and SEM size distributions were verified against distributions derived from response functions of individual MOUDI stages as specified by Winklmayr et al. [Winklmayr, W., Wang, H.-C., John, W., 1990. Adaptation of the Twomey algorithm to the inversion of cascade impactor data. Aerosol Science and Technology 13, 322-331.]. Particles indicated inherent discrepancies in sizing techniques. Particle volumes were systematically lower than expected by factors of up to 3.6. Differences were attributed to loss of mass, presumably water adsorbed on particles. Losses were high and could not be accounted for by measured humidity growth factors suggesting significant losses of other volatile compounds as well, particularly on particles that were collected during the wet season. Microscopy results showed that for hygroscopic particles, microscopy sizes depend on the relative humidity history of particles before and after sampling. Changes in relative humidity significantly altered particle morphologies. Depending on when changes occur, such losses will bias not only microscopy particle sizes but also impactor mass distributions and number concentrations derived from collected particles.

  17. Quantitative Assessment of a Novel Super-Resolution Restoration Technique Using HiRISE with Navcam Images: how much Resolution Enhancement is Possible from Repeat-Pass Observations (United States)

    Tao, Y.; Muller, J.-P.


    Higher spatial resolution imaging data is always desirable to the international community of planetary scientists interested in improving understanding of surface formation processes. We have previously developed a novel Super-resolution restoration (SRR) technique (Tao & Muller, 2016) using Gotcha sub-pixel matching, orthorectification, and segmented 4th order PDE-TV, called GPT SRR, which is able to restore 5 cm-12.5 cm near rover scale images (equivalent to Navcam projected FoV at a range of ≥ 5 m) from multiple 25 cm resolution NASA MRO HiRISE images. The SRR technique has been successfully applied to the rover traverses for the MER and MSL missions within the EU FP-7 PRoViDE project. These SRR results have revealed new surface information including the imaging of individual rocks (diameter ≥ 25 cm) by comparison of the original HiRISE image and rover Navcam orthorectified image mosaics. In this work, we seek evidence from processing a very large number of stereo reconstruction results from all Navcam stereo images within PRoViDE, registration and comparison with the corresponding SRR image, in order to derive a quantitative assessment on key features including rocks (diameter < 150 cm) and rover track wheel spacing. We summarise statistics from SRR-Navcam measurements and demonstrate that our unique SRR datasets will greatly support the geological and morphological analysis and monitoring of Martian surface and can also be applied to landing site selection, in order to avoid unsuitable terrain, for any future lander/rover as well as help to define future rover paths.

  18. AFM of the ultrastructural and mechanical properties of lipid-raft-disrupted and/or cold-treated endothelial cells. (United States)

    Wu, Li; Huang, Jie; Yu, Xiaoxue; Zhou, Xiaoqing; Gan, Chaoye; Li, Ming; Chen, Yong


    The nonionic detergent extraction at 4 °C and the cholesterol-depletion-induced lipid raft disruption are the two widely used experimental strategies for lipid raft research. However, the effects of raft disruption and/or cold treatment on the ultrastructural and mechanical properties of cells are still unclear. Here, we evaluated the effects of raft disruption and/or cold (4 °C) treatment on these properties of living human umbilical vein endothelial cells (HUVECs). At first, the cholesterol-depletion-induced raft disruption was visualized by confocal microscopy and atomic force microscopy (AFM) in combination with fluorescent quantum dots. Next, the cold-induced cell contraction and the formation of end-branched filopodia were observed by confocal microscopy and AFM. Then, the cell-surface ultrastructures were imaged by AFM, and the data showed that raft disruption and cold treatment induced opposite effects on cell-surface roughness (a significant decrease and a significant increase, respectively). Moreover, the cell-surface mechanical properties (stiffness and adhesion force) of raft-disrupted- and/or cold-treated HUVECs were measured by the force measurement function of AFM. We found that raft disruption and cold treatment induced parallel effects on cell stiffness (increase) or adhesion force (decrease) and that the combination of the two treatments caused dramatically strengthened effects. Finally, raft disruption was found to significantly impair cell migration as previously reported, whereas temporary cold treatment only caused a slight but nonsignificant decrease in cell migration performed at physiological temperature. Although the mechanisms for causing these results might be complicated and more in-depth studies will be needed, our data may provide important information for better understanding the effects of raft disruption or cold treatment on cells and the two strategies for lipid raft research.

  19. Protein coverage on silicon surfaces modified with amino-organic films: a study by AFM and angle-resolved XPS. (United States)

    Awsiuk, K; Bernasik, A; Kitsara, M; Budkowski, A; Rysz, J; Haberko, J; Petrou, P; Beltsios, K; Raczkowska, J


    An approach to determine structural features, such as surface fractional coverage F and thickness d of protein layers immobilized on silicon substrates coated with amino-organic films is presented. To demonstrate the proposed approach rabbit gamma globulins (RgG) are adsorbed from a 0.66muM solution onto SiO(2) and Si(3)N(4) modified with (3-aminopropyl)triethoxysilane (APTES). Atomic force microscopy data are analyzed by applying an integral geometry approach to yield average coverage values for silanized Si(3)N(4) and SiO(2) coated with RgG, F=0.99+/-0.01 and 0.76+/-0.08, respectively. To determine the RgG thickness d from angle-resolved X-ray photoelectron spectroscopy (ARXPS), a model of amino-organic bilayer with non-homogeneous top lamellae is introduced. For an APTES layer thickness of 1.0+/-0.1nm, calculated from independent ARXPS measurements, and for fractional surface RgG coverage determined from AFM analysis, this model yields d=1.0+/-0.2nm for the proteins on both silanized substrates. This value, confirmed by an evaluation (1.0+/-0.2nm) from integral geometry analysis of AFM images, is lower than the RgG thickness expected for monomolecular film ( approximately 4nm). Structures visible in phase contrast AFM micrographs support the suggested sparse molecular packing in the studied RgG layers. XPS data, compared for bulk and adsorbed RgG, suggest preferential localization of oxygen- and nitrogen-containing carbon groups at silanized silicon substrates. These results demonstrate the potential of the developed AFM/ARXPS approach as a method for the evaluation of surface-protein coverage homogeneity and estimation of adsorbed proteins conformation on silane-modified silicon substrates used in bioanalytical applications.

  20. No evidence of misdiagnosis in patients with multiple sclerosis and repeated positive anticardiolipin antibody testing based on magnetic resonance imaging and long term follow‐up (United States)

    Liedorp, M; Sanchez, E; van Hoogstraten, I M W; von Blomberg, B M E; Barkhof, F; Polman, C H


    Objective To determine whether patients with definite multiple sclerosis (MS) and repeated positive anticardiolipin antibody (aCL Ab) testing fulfil the recently updated criteria for the antiphospholipid syndrome (APS). Also, to determine if these patients form a separate subgroup in terms of long term follow‐up and MRI characteristics. Design A blinded case control study comparing MRI patterns between aCL Ab positive and negative MS patients with a clinical follow‐up of 7 years. Participants 8 (5.6%; male:female ratio 2:6; 6 relapsing–remitting subtype, 1 primary progressive subtype and 1 neuromyelitis optica (NMO)) of 143 consecutive patients with definite MS or NMO (71% relapsing–remitting, 18% secondary progressive and 6% primary progressive disease course; 4% NMO) showed repeated positive aCL Ab testing. Setting Outpatient clinic of a tertiary MS centre in the Netherlands. Results All eight aCL Ab positive patients had levels below 40 MPL/GPL units, with the majority of intervals between tests of at least 12 weeks. After follow‐up, none of the patients fulfilled the criteria for APS. No specific MRI features were present compared with 24 matched aCL Ab negative patients. Conclusions No aCL Ab positive MS patient fulfilled the criteria for APS, arguing against a possible misdiagnosis or coexistence. PMID:17878195

  1. Digital repeat analysis; setup and operation. (United States)

    Nol, J; Isouard, G; Mirecki, J


    Since the emergence of digital imaging, there have been questions about the necessity of continuing reject analysis programs in imaging departments to evaluate performance and quality. As a marketing strategy, most suppliers of digital technology focus on the supremacy of the technology and its ability to reduce the number of repeats, resulting in less radiation doses given to patients and increased productivity in the department. On the other hand, quality assurance radiographers and radiologists believe that repeats are mainly related to positioning skills, and repeat analysis is the main tool to plan training needs to up-skill radiographers. A comparative study between conventional and digital imaging was undertaken to compare outcomes and evaluate the need for reject analysis. However, digital technology still being at its early development stages, setting a credible reject analysis program became the major task of the study. It took the department, with the help of the suppliers of the computed radiography reader and the picture archiving and communication system, over 2 years of software enhancement to build a reliable digital repeat analysis system. The results were supportive of both philosophies; the number of repeats as a result of exposure factors was reduced dramatically; however, the percentage of repeats as a result of positioning skills was slightly on the increase for the simple reason that some rejects in the conventional system qualifying for both exposure and positioning errors were classified as exposure error. The ability of digitally adjusting dark or light images reclassified some of those images as positioning errors.

  2. The importance of correcting for variable probe-sample interactions in AFM-IR spectroscopy: AFM-IR of dried bacteria on a polyurethane film. (United States)

    Barlow, Daniel E; Biffinger, Justin C; Cockrell-Zugell, Allison L; Lo, Michael; Kjoller, Kevin; Cook, Debra; Lee, Woo Kyung; Pehrsson, Pehr E; Crookes-Goodson, Wendy J; Hung, Chia-Suei; Nadeau, Lloyd J; Russell, John N


    AFM-IR is a combined atomic force microscopy-infrared spectroscopy method that shows promise for nanoscale chemical characterization of biological-materials interactions. In an effort to apply this method to quantitatively probe mechanisms of microbiologically induced polyurethane degradation, we have investigated monolayer clusters of ∼200 nm thick Pseudomonas protegens Pf-5 bacteria (Pf) on a 300 nm thick polyether-polyurethane (PU) film. Here, the impact of the different biological and polymer mechanical properties on the thermomechanical AFM-IR detection mechanism was first assessed without the additional complication of polymer degradation. AFM-IR spectra of Pf and PU were compared with FTIR and showed good agreement. Local AFM-IR spectra of Pf on PU (Pf-PU) exhibited bands from both constituents, showing that AFM-IR is sensitive to chemical composition both at and below the surface. One distinct difference in local AFM-IR spectra on Pf-PU was an anomalous ∼4× increase in IR peak intensities for the probe in contact with Pf versus PU. This was attributed to differences in probe-sample interactions. In particular, significantly higher cantilever damping was observed for probe contact with PU, with a ∼10× smaller Q factor. AFM-IR chemical mapping at single wavelengths was also affected. We demonstrate ratioing of mapping data for chemical analysis as a simple method to cancel the extreme effects of the variable probe-sample interactions.

  3. Effect of tip mass on frequency response and sensitivity of AFM cantilever in liquid. (United States)

    Farokh Payam, Amir; Fathipour, Morteza


    The effect of tip mass on the frequency response and sensitivity of atomic force microscope (AFM) cantilever in the liquid environment is investigated. For this purpose, using Euler-Bernoulli beam theory and considering tip mass and hydrodynamic functions in a liquid environment, an expression for the resonance frequencies of AFM cantilever in liquid is derived. Then, based on this expression, the effect of the surface contact stiffness on the flexural mode of a rectangular AFM cantilever in fluid is investigated and compared with the case where the AFM cantilever operates in the air. The results show that in contrast with an air environment, the tip mass has no significant impact on the resonance frequency and sensitivity of the AFM cantilever in the liquid. Hence, analysis of AFM behaviour in liquid environment by neglecting the tip mass is logical.

  4. An AFM study of calcite dissolution in concentrated electrolyte solutions (United States)

    Ruiz Agudo, E.; Putnis, C. V.; Putnis, A.; Rodriguez-Navarro, C.


    Calcite-solution interactions are of a paramount importance in a range of processes such as the removal of heavy metals, carbon dioxide sequestration, landscape modeling, weathering of building stone and biomineralization. Water in contact with minerals often carries significant amounts of solutes; additionally, their concentration may vary due to evaporation and condensation. It is well known that calcite dissolution is affected dramatically by the presence of such solutes. Here we present investigations on the dissolution of calcite in the presence of different electrolytes. Both bulk (batch reactors) experiments and nanoscale (in situ AFM) techniques are used to study the dissolution of calcite in a range of solutions containing alkaly cations balanced by halide anions. Previous works have indicated that the ionic strength has little influence in calcite dissolution rates measured from bulk experiments (Pokrovsky et al. 2005; Glendhill and Morse, 2004). Contrary to these results, our quantitative analyses of AFM observations show an enhancement of the calcite dissolution rate with increasing electrolyte concentration. Such an effect is concentration-dependent and it is most evident in concentrated solutions. AFM experiments have been carried out in a fluid cell using calcite cleavage surfaces in contact with solutions of simple salts of the alkaly metals and halides at different undersaturations with respect to calcite to try to specify the effect of the ionic strength on etch pit spreading rate and calcite dissolution rate. These results show that the presence of soluble salts may critically affect the weathering of carbonate rocks in nature as well as the decay of carbonate stone in built cultural heritage. References: Pokrosky, O.S.; Golubev, S.V.; Schott, J. Dissolution kinetics of calcite, dolomite and magnesite at 25°C and 0 to 50 atm pCO2. Chemical Geology, 2005, 217 (3-4) 239-255. Glendhill, D.K.; Morse, J.W. Dissolution kinetics of calcite in Na

  5. Measuring the biomechanical properties of the actin in MCF-7 breast cancer cell with a combined system of AFM and SIM (United States)

    You, Minghai; Chen, Jianling; Wang, Yuhua; Jiang, Ningcheng; Xie, Shusen; Yang, Hongqin


    Biomechanics of cell plays an important role in the behavior and development of diseases, which has a profound influence on the health, structural integrity, and function of cells. In this study, we proposed a method to assess the biomechanical properties in single breast cancer cell line MCF-7 by combining structured illumination microscopy (SIM) with atomic force microscopy (AFM). High resolution optical image of actin in MCF-7 cell and its elastography were obtained. The result shows that the quantitative resolution was improved by SIM, with 490 nm of conventional fluorescence image and 285 nm of reconstructed SIM image, which could give a precise location for AFM measurement. The elasticity of actin is about in the range of 10 1000 kPa. The proposed methods will be helpful in the understanding and clinical diagnosis of diseases at single cell level.

  6. Tipping solutions: emerging 3D nano-fabrication/ -imaging technologies (United States)

    Seniutinas, Gediminas; Balčytis, Armandas; Reklaitis, Ignas; Chen, Feng; Davis, Jeffrey; David, Christian; Juodkazis, Saulius


    The evolution of optical microscopy from an imaging technique into a tool for materials modification and fabrication is now being repeated with other characterization techniques, including scanning electron microscopy (SEM), focused ion beam (FIB) milling/imaging, and atomic force microscopy (AFM). Fabrication and in situ imaging of materials undergoing a three-dimensional (3D) nano-structuring within a 1-100 nm resolution window is required for future manufacturing of devices. This level of precision is critically in enabling the cross-over between different device platforms (e.g. from electronics to micro-/nano-fluidics and/or photonics) within future devices that will be interfacing with biological and molecular systems in a 3D fashion. Prospective trends in electron, ion, and nano-tip based fabrication techniques are presented.

  7. Tipping solutions: emerging 3D nano-fabrication/ -imaging technologies

    Directory of Open Access Journals (Sweden)

    Seniutinas Gediminas


    Full Text Available The evolution of optical microscopy from an imaging technique into a tool for materials modification and fabrication is now being repeated with other characterization techniques, including scanning electron microscopy (SEM, focused ion beam (FIB milling/imaging, and atomic force microscopy (AFM. Fabrication and in situ imaging of materials undergoing a three-dimensional (3D nano-structuring within a 1−100 nm resolution window is required for future manufacturing of devices. This level of precision is critically in enabling the cross-over between different device platforms (e.g. from electronics to micro-/nano-fluidics and/or photonics within future devices that will be interfacing with biological and molecular systems in a 3D fashion. Prospective trends in electron, ion, and nano-tip based fabrication techniques are presented.

  8. Ultra-high aspect ratio replaceable AFM tips using deformation-suppressed focused ion beam milling

    DEFF Research Database (Denmark)

    Savenko, Alexey; Yildiz, Izzet; Petersen, Dirch Hjorth;


    Fabrication of ultra-high aspect ratio exchangeable and customizable tips for atomic force microscopy (AFM) using lateral focused ion beam (FIB) milling is presented. While on-axis FIB milling does allow high aspect ratio (HAR) AFM tips to be defined, lateral milling gives far better flexibility...... FIB milling strategies for obtaining sharper tips are discussed. Finally, assembly of the HAR tips on a custom-designed probe as well as the first AFM scanning is shown....

  9. Repeatability and Minimal Detectable Change in Longitudinal Median Nerve Excursion Measures During Upper Limb Neurodynamic Techniques in a Mixed Population: A Pilot Study Using Musculoskeletal Ultrasound Imaging. (United States)

    Paquette, Philippe; Lamontagne, Martin; Higgins, Johanne; Gagnon, Dany H


    This study determined test-retest reliability and minimum detectable change in longitudinal median nerve excursion during upper limb neurodynamic tests (ULNTs). Seven participants with unilateral or bilateral carpal tunnel syndrome and 11 healthy participants were randomly tested with two ULNTs (i.e., tensioner and slider). Each ULNT was performed three times each at 45° and 90° of shoulder abduction on two separate visits. Video sequences of median nerve excursion, recorded by a physical therapist using ultrasound imaging, were quantified using computer software. The generalizability theory, encompassing a G-Study and a D-study, measured the dependability coefficient (Φ) along with standard error of measurement (SEM) accuracy and allowed various testing protocols to be proposed. The highest reliability (Φ = 0.84) and lowest minimal measurement error (SEM = 0.58 mm) of the longitudinal median nerve excursion were reached during the ULNT-slider performed with 45° of shoulder abduction and when measures obtained from three different image sequences recorded during a single visit were averaged. It is recommended that longitudinal median nerve excursion measures computed from three separate image sequences recorded during a single visit be averaged in clinical practice. Ideally, adding a second visit (six image sequences) is also suggested in research protocols.

  10. New insights into morphology of high performance BHJ photovoltaics revealed by high resolution AFM. (United States)

    Wang, Dong; Liu, Feng; Yagihashi, Noritoshi; Nakaya, Masafumi; Ferdous, Sunzida; Liang, Xiaobin; Muramatsu, Atsushi; Nakajima, Ken; Russell, Thomas P


    Direct imaging of the bulk heterojunction (BHJ) thin film morphology in polymer-based solar cells is essential to understand device function and optimize efficiency. The morphology of the BHJ active layer consists of bicontinuous domains of the donor and acceptor materials, having characteristic length scales of several tens of nanometers, that reduces charge recombination, enhances charge separation, and enables electron and hole transport to their respective electrodes. Direct imaging of the morphology from the molecular to macroscopic level, though, is lacking. Though transmission electron tomography provides a 3D, real-space image of the morphology, quantifying the structure is not possible. Here we used high-resolution atomic force microscopy (AFM) in the tapping and nanomechanical modes to investigate the BHJ active layer morphology that, when combined with Ar(+) etching, provided unique insights with unparalleled spatial resolution. PCBM was seen to form a network that interpenetrated into the fibrillar network of the hole-conducting polymer, both being imbedded in a mixture of the two components. The free surface was found to be enriched with polymer crystals having a "face-on" orientation and the morphology at the anode interface was markedly different.

  11. Modelling and Measurement Uncertainty Estimation for Integrated AFM-CMM Instrument

    DEFF Research Database (Denmark)

    Hansen, Hans Nørgaard; Bariani, Paolo; De Chiffre, Leonardo


    This paper describes modelling of an integrated AFM - CMM instrument, its calibration, and estimation of measurement uncertainty. Positioning errors were seen to limit the instrument performance. Software for off-line stitching of single AFM scans was developed and verified, which allows...... compensation of such errors. A geometrical model of the instrument was produced, describing the interaction between AFM and CMM systematic errors. The model parameters were quantified through calibration, and the model used for establishing an optimised measurement procedure for surface mapping. A maximum...... uncertainty of 0.8% was achieved for the case of surface mapping of 1.2*1.2 mm2 consisting of 49 single AFM scanned areas....

  12. Optical cavity back action on an AFM microlever

    CERN Document Server

    Jourdan, Guillaume; Chevrier, Joël


    Two back action processes generated by an optical cavity based detection device can deeply transform the dynamical behavior of an AFM microlever: the photothermal force or the radiation pressure. Whereas noise damping or amplifying depends only on the detuning inside the cavity for radiation pressure back action, we present experimental results carried out under vacuum and at room temperature on the photothermal back action process which appears to be much more complex. We show for the first time that it can simultaneously act on two vibration modes in opposite direction: noise on one mode is amplified whereas it is damped on another mode. Modelisation of this effect leads us to conclude that indeed it is specific to photothermal back action and cannot be observed in case of radiation pressure back action.

  13. Compensation of motion error in a high accuracy AFM (United States)

    Cui, Yuguo; Arai, Yoshikazu; He, Gaofa; Asai, Takemi; Gao, Wei


    An atomic force microscope (AFM) system is used for large-area measurement with a spiral scanning strategy, which is composed of an air slide, an air spindle and a probe unit. The motion error which is brought from the air slide and the air spindle will increase with the increasing of the measurement area. Then the measurement accuracy will decrease. In order to achieve a high speed and high accuracy measurement, the probe scans along X-direction with constant height mode driven by the air slide, and at the same time, based on the change way of the motion error, it moves along Zdirection conducted by piezoactuator. According to the above method of error compensation, the profile measurement experiment of a micro-structured surface has been carried out. The experimental result shows that this method is effective for eliminating motion error, and it can achieve high speed and precision measurement of micro-structured surface.

  14. Mapping water uptake in organic coatings using AFM-IR. (United States)

    Morsch, S; Lyon, S; Greensmith, P; Smith, S D; Gibbon, S R


    The long-term failure of seemingly intact corrosion resistant organic coatings is thought to occur via the development of ionic transport channels, which spontaneously evolve from hydrophilic regions on immersion, i.e., as a result of localized water uptake. To this end, we investigate water uptake characteristics for industrial epoxy-phenolic can coatings after immersion in deionized water and drying. Moisture sorption and the changing nature of polymer-water interactions are assessed using FTIR for dry and pre-soaked films. More water is found to be absorbed by the pre-soaked coatings on exposure to a humid environment, with a greater degree of hydrogen-bonding between the polymer and water. Furthermore, morphological changes are then correlated to localized water uptake using the AFM-IR technique. Nanoscale softened regions develop on soaking, and these are found to absorb a greater proportion of water from a humid environment.

  15. BOREAS AFM-04 Twin Otter Aircraft Sounding Data (United States)

    MacPherson, J. Ian; Desjardins, Raymond L.; Hall, Forrest G. (Editor); Knapp, David E. (Editor); Smith, David E. (Technical Monitor)


    The Boreal Ecosystem-Atmosphere Study (BOREAS) Airborne Fluxes and Meteorology (AFM)-4 team used the National Research Council, Canada (NRC) Twin Otter aircraft to make sounding measurements through the boundary layer. These measurements included concentrations of carbon dioxide and ozone, atmospheric pressure, dry bulb temperature, potential temperature, dewpoint temperature, calculated mixing ratio, and wind speed and direction. Aircraft position, heading, and altitude were also recorded. Data were collected at both the Northern Study Area (NSA) and the Southern Study Area (SSA) in 1994 and 1996. These data are stored in tabular ASCII files. The Twin Otter aircraft sounding data are available from the Earth Observing System Data and Information System (EOSDIS) Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC). The data files also are available on a CD-ROM (see document number 20010000884).

  16. Bubble colloidal AFM probes formed from ultrasonically generated bubbles. (United States)

    Vakarelski, Ivan U; Lee, Judy; Dagastine, Raymond R; Chan, Derek Y C; Stevens, Geoffrey W; Grieser, Franz


    Here we introduce a simple and effective experimental approach to measuring the interaction forces between two small bubbles (approximately 80-140 microm) in aqueous solution during controlled collisions on the scale of micrometers to nanometers. The colloidal probe technique using atomic force microscopy (AFM) was extended to measure interaction forces between a cantilever-attached bubble and surface-attached bubbles of various sizes. By using an ultrasonic source, we generated numerous small bubbles on a mildly hydrophobic surface of a glass slide. A single bubble picked up with a strongly hydrophobized V-shaped cantilever was used as the colloidal probe. Sample force measurements were used to evaluate the pure water bubble cleanliness and the general consistency of the measurements.

  17. AFM research on Fe-based nanocrystal crystallization mechanism

    Institute of Scientific and Technical Information of China (English)


    The cross-section pattern of Fe-based alloy ribbon (Fe73.5Cu1Nb3Si13.5B9) annealed at different temperatures was investigated by AFM (atomic force microscope), and the effect mechanism of Nb and Cu in Fe-based alloy ribbon annealing was analyzed with XRD diffraction crystal analysis technique and other research results. New concepts of encapsulated grain, Nb vacancy cluster, Nb-B atom cluster and so on were proposed and used to describe the formation mechanism of α-Fe (Si) nanocrystal. Finally, a three-phase (separation phase, encapsulated phase and nanocrystalline phase) interconnected structure model in Fe-based nanocrystalline alloy was established.

  18. Optimization of functionalization conditions for protein analysis by AFM

    Energy Technology Data Exchange (ETDEWEB)

    Arroyo-Hernández, María, E-mail: [Centro de Tecnología Biomédica, Universidad Politécnica de Madrid, 28223 Pozuelo de Alarcón, Madrid (Spain); Departamento de Ciencia de Materiales, ETSI Caminos, Canales y Puertos, Universidad Politécnica de Madrid, 28040 Madrid (Spain); Daza, Rafael; Pérez-Rigueiro, Jose; Elices, Manuel; Nieto-Márquez, Jorge; Guinea, Gustavo V. [Centro de Tecnología Biomédica, Universidad Politécnica de Madrid, 28223 Pozuelo de Alarcón, Madrid (Spain); Departamento de Ciencia de Materiales, ETSI Caminos, Canales y Puertos, Universidad Politécnica de Madrid, 28040 Madrid (Spain)


    Highlights: • Highest fluorescence is obtained for central conditions. • Largest primary amine contribution is obtained for central conditions. • RMS roughness is smaller than 1 nm for all functional films. • Selected deposition conditions lead to proper RMS and functionality values. • LDH proteins adsorbed on AVS-films were observed by AFM. - Abstract: Activated vapor silanization (AVS) is used to functionalize silicon surfaces through deposition of amine-containing thin films. AVS combines vapor silanization and chemical vapor deposition techniques and allows the properties of the functionalized layers (thickness, amine concentration and topography) to be controlled by tuning the deposition conditions. An accurate characterization is performed to correlate the deposition conditions and functional-film properties. In particular, it is shown that smooth surfaces with a sufficient surface density of amine groups may be obtained with this technique. These surfaces are suitable for the study of proteins with atomic force microscopy.

  19. AFM, SEM and TEM Studies on Porous Anodic Alumina (United States)

    Zhu, Yuan Yuan; Ding, Gu Qiao; Ding, Jian Ning; Yuan, Ning Yi


    Porous anodic alumina (PAA) has been intensively studied in past decade due to its applications for fabricating nanostructured materials. Since PAA’s pore diameter, thickness and shape vary too much, a systematical study on the methods of morphology characterization is meaningful and essential for its proper development and utilization. In this paper, we present detailed AFM, SEM and TEM studies on PAA and its evolvements with abundant microstructures, and discuss the advantages and disadvantages of each method. The sample preparation, testing skills and morphology analysis are discussed, especially on the differentiation during characterizing complex cross-sections and ultrasmall nanopores. The versatility of PAAs is also demonstrated by the diversity of PAAs’ microstructure.

  20. AFM, SEM and TEM Studies on Porous Anodic Alumina

    Directory of Open Access Journals (Sweden)

    Zhu YuanYuan


    Full Text Available Abstract Porous anodic alumina (PAA has been intensively studied in past decade due to its applications for fabricating nanostructured materials. Since PAA’s pore diameter, thickness and shape vary too much, a systematical study on the methods of morphology characterization is meaningful and essential for its proper development and utilization. In this paper, we present detailed AFM, SEM and TEM studies on PAA and its evolvements with abundant microstructures, and discuss the advantages and disadvantages of each method. The sample preparation, testing skills and morphology analysis are discussed, especially on the differentiation during characterizing complex cross-sections and ultrasmall nanopores. The versatility of PAAs is also demonstrated by the diversity of PAAs’ microstructure.

  1. Quantum repeated games revisited

    CERN Document Server

    Frackiewicz, Piotr


    We present a scheme for playing quantum repeated 2x2 games based on the Marinatto and Weber's approach to quantum games. As a potential application, we study twice repeated Prisoner's Dilemma game. We show that results not available in classical game can be obtained when the game is played in the quantum way. Before we present our idea, we comment on the previous scheme of playing quantum repeated games.

  2. AFM study of glucagon fibrillation via oligomeric structures resulting in interwoven fibrils

    Energy Technology Data Exchange (ETDEWEB)

    Dong Mingdong [Interdisciplinary Nanoscience Center (iNANO), University of Aarhus, DK-8000 Aarhus C (Denmark); Hovgaard, Mads Bruun [Interdisciplinary Nanoscience Center (iNANO), University of Aarhus, DK-8000 Aarhus C (Denmark); Xu Sailong [Interdisciplinary Nanoscience Center (iNANO), University of Aarhus, DK-8000 Aarhus C (Denmark); Otzen, Daniel Erik [Interdisciplinary Nanoscience Center (iNANO), University of Aarhus, DK-8000 Aarhus C (Denmark); Besenbacher, Flemming [Interdisciplinary Nanoscience Center (iNANO), University of Aarhus, DK-8000 Aarhus C (Denmark)


    Glucagon is a 29-residue amphiphatic hormone involved in the regulation of blood glucose levels in conjunction with insulin. In concentrated aqueous solutions, glucagon spontaneously aggregates to form amyloid fibrils, destroying its biological activity. In this study we utilize the atomic force microscope (AFM) to elucidate the fibrillation mechanism of glucagon at the nanoscale under acidic conditions (pH 2.0) by visualizing the nanostructures of fibrils formed at different stages of the incubation. Hollow disc-shaped oligomers form at an early stage in the process and subsequently rearrange to more solid oligomers. These oligomers co-exist with, and most likely act as precursors for, protofibrils, which subsequently associate to form at least three different classes of higher-order fibrils of different heights. A repeat unit of around 50 nm along the main fibril axis suggests a helical arrangement of interwoven protofibrils. The diversity of oligomeric and fibrillar arrangements formed at pH 2.0 complements previous spectroscopic analyses that revealed that fibrils formed under different conditions can differ substantially in stability and secondary structure.

  3. Atomic Force Microscopy Imaging of Filamentous Aggregates from an N-Terminal Peptide Fragment of Barnase (United States)

    Shibata-Seki, Teiko; Masai, Junji; Yoshida, Kenji; Sato, Kazuki; Yanagawa, Hiroshi


    This paper reports the atomic force microscopy (AFM) imaging of filamentous aggregates derived from an N-terminal peptide fragment of barnase, a ribonuclease from Bacillus amyloliquefaciens. The sample was deposited on a freshly cleaved mica surface and observed in ambient conditions. The overall shapes of the filamentous structures imaged with two different kinds of AFMs were similar to those obtained with a transmission electron microscope (TEM), except that the filaments in AFM images were broader than those in TEM images. This broadening phenomenon characteristic of AFM images was explained in terms of the convolution-type distortion of the specimen diameter by the scanning-tip apex.

  4. Structural characterization of Fe/Ag bilayers by RBS and AFM

    Energy Technology Data Exchange (ETDEWEB)

    Tunyogi, A. [KFKI Research Institute for Particle and Nuclear Physics, H-1525 Budapest, P.O. Box 49 (Hungary)], E-mail:; Tancziko, F. [KFKI Research Institute for Particle and Nuclear Physics, H-1525 Budapest, P.O. Box 49 (Hungary); Osvath, Z. [Research Institute for Technical Physics and Materials Science, H-1525 Budapest, P.O. Box 49 (Hungary); Paszti, F. [KFKI Research Institute for Particle and Nuclear Physics, H-1525 Budapest, P.O. Box 49 (Hungary)


    Fe/Ag thin films are intensively investigated due to their special magnetic properties. Recently a deposition-order dependent asymmetric interface has been found. When iron is grown on silver, the interface is sharp, while the growth of Ag on Fe results in a long, low-energy tail of the Ag peak in the Rutherford backscattering spectrometry (RBS) spectra. The main purpose of this paper is to show that the low-energy Ag tail is caused by grain boundary diffusion, and that, when elevating the growing temperature of the Ag layer this effect becomes more significant. Two sets of polycrystalline and epitaxial Fe/Ag bilayers were prepared simultaneously onto Si(1 1 1) and MgO(1 0 0), respectively. The iron layers were grown at 250 deg. C and annealed at 450 deg. C in both sets, while the Ag layer was grown in the first set at room temperature (RT) and in the second set at 250 deg. C (HT). The sample composition, the interface sharpness and the quality of the epitaxy were studied by Rutherford backscattering spectrometry (RBS) combined with channeling effect. The surface morphology was determined by atomic force microscopy (AFM). RBS spectra show that in the case of RT samples the epitaxial MgO/Fe/Ag bilayer has sharp, well-defined interface, while for the polycrystalline Si/Fe/Ag sample the silver peak has a low-energy tail. Both the Fe and Ag peaks smeared out in the case of HT samples. AFM-images show that the RT samples have a continuous Ag layer, while the HT samples have fragmented surfaces. The RBS spectra taken on the HT samples were successfully simulated by the RBS-MAST code taking into account their fragmented structures.

  5. AFM study of the thrombogenicity of carbon-based coatings for cardiovascular applications

    Energy Technology Data Exchange (ETDEWEB)

    Karagkiozaki, V. [Department of Physics, Laboratory for Thin Films-Nanosystems and Nanometrology (LTFN), Aristotle University of Thessaloniki, Thessaloniki GR-54124 (Greece); AHEPA Hospital, 1st Cardiology Department, Aristotle University of Thessaloniki, Thessaloniki GR-54124 (Greece); Logothetidis, S. [Department of Physics, Laboratory for Thin Films-Nanosystems and Nanometrology (LTFN), Aristotle University of Thessaloniki, Thessaloniki GR-54124 (Greece)], E-mail:; Laskarakis, A. [Department of Physics, Laboratory for Thin Films-Nanosystems and Nanometrology (LTFN), Aristotle University of Thessaloniki, Thessaloniki GR-54124 (Greece); Giannoglou, G. [AHEPA Hospital, 1st Cardiology Department, Aristotle University of Thessaloniki, Thessaloniki GR-54124 (Greece); Lousinian, S. [Department of Physics, Laboratory for Thin Films-Nanosystems and Nanometrology (LTFN), Aristotle University of Thessaloniki, Thessaloniki GR-54124 (Greece)


    The new nanotechnologies in biomaterials for cardiovascular applications target at surface alterations for prevention of platelets aggregation and subsequent clotting as their usual failure arises from thrombogenicity. Knowledge of structural properties of platelets during their adhesion on nanostructure materials is required to obtain a comprehensive understanding of their activation and the conventional imaging tools require special preparation of the samples and does not guarantee the viability of the cells. Thus, in this study, the atomic force microscope (AFM) which is a non-destructive and nanoscale precision technique is implemented for the study of platelets' adhesion onto amorphous hydrogenated carbon (a-C:H) thin films and a methodology is developed. Carbon-based thin films grown by magnetron sputtering under different deposition conditions are considered to meet the requirements for biomedical applications and were selected as well-characterized, case study materials. Platelet rich plasma drawn from healthy donors was used for the study of platelets adhesion onto the a-C:H films. The fourier transform IR phase modulated spectroscopic ellipsometry (FTIRSE) (900-3500 cm{sup -1}) being a powerful, non-destructive, optical technique was used for the investigation of bonding structure of the adherent platelets onto the a-C:H materials and the contribution of the different vibration bands of the platelet bonding groups was shown and discussed. The effect of nanostructure, surface properties and wettability of the carbon thin films on their thrombogenic potential was verified and it was found that the different deposition conditions determine their structural, surface and biological properties. Thus, the tailoring of surface properties of biomaterials and the informative study of platelets-nanomaterials interactions with AFM and FTIRSE will revolutionize the development of less thrombogenic biomaterials.

  6. Hematite/silver nanoparticle bilayers on mica--AFM, SEM and streaming potential studies. (United States)

    Morga, Maria; Adamczyk, Zbigniew; Oćwieja, Magdalena; Bielańska, Elżbieta


    Bilayers of hematite/silver nanoparticles were obtained in the self-assembly process and thoroughly characterized using scanning electron microscopy (SEM), atomic force microscopy (AFM), and in situ streaming potential measurements. The hematite nanoparticles, forming a supporting layer, were 22 nm in diameter, exhibiting an isoelectric point at pH 8.9. The silver nanoparticles, used to obtain an external layer, were 29 nm in diameter, and remained negative within the pH range 3 to 11. In order to investigate the particle deposition, mica sheets were used as a model solid substrate. The coverage of the supporting layer was adjusted by changing the bulk concentration of the hematite suspension and the deposition time. Afterward, silver nanoparticle monolayers of controlled coverage were deposited under the diffusion-controlled transport. The coverage of bilayers was determined by a direct enumeration of deposited particles from SEM micrographs and AFM images. Additionally, the formation of the hematite/silver bilayers was investigated by streaming potential measurements carried out under in situ conditions. The effect of the mica substrate and the coverage of a supporting layer on the zeta potential of bilayers was systematically studied. It was established that for the coverage exceeding 0.20, the zeta potential of bilayers was independent on the substrate and the supporting layer coverage. This behavior was theoretically interpreted in terms of the 3D electrokinetic model. Beside significance for basic sciences, these measurements allowed to develop a robust method of preparing nanoparticle bilayers of controlled properties, having potential applications in catalytic processes.

  7. Flexible Helicoids, Atomic Force Microscopy (AFM Cantilevers in High Mode Vibration, and Concave Notch Hinges in Precision Measurements and Research

    Directory of Open Access Journals (Sweden)

    Yakov Tseytlin


    Full Text Available Flexible structures are the main components in many precision measuring and research systems. They provide miniaturization, repeatability, minimal damping, low measuring forces, and very high resolution. This article focuses on the modeling, development, and comparison of three typical flexible micro- nano-structures: flexible helicoids, atomic force microscopy (AFM cantilevers, and concave notch hinges. Our theory yields results which allow us to increase the accuracy and functionality of these structures in new fields of application such as the modeling of helicoidal DNA molecules’ mechanics, the definition of instantaneous center of rotation in concave flexure notch hinges, and the estimation of the increase of spring constants and resolution at higher mode vibration in AFM cantilevers with an additional concentrated and end extended mass. We developed the original kinetostatic, reverse conformal mapping of approximating contours, and non-linear thermomechanical fluctuation methods for calculation, comparison, and research of the micromechanical structures. These methods simplify complicated solutions in micro elasticity but provide them with necessary accuracy. All our calculation results in this article and in all corresponding referenced author’s publications are in a good agreement with experimental and finite element modeling data within 10% or less.

  8. Atomic force microscopy and cells: Indentation profiles around the AFM tip, cell shape changes, and other examples of experimental factors affecting modeling. (United States)

    Melzak, Kathryn A; Toca-Herrera, José L


    We use atomic force microscopy in conjunction with a fluorescence microscope capable of optical sectioning to acquire images of white blood cells while force is applied with the AFM tip. The indentation profile within the cell is compared to the profile of the AFM tip: examples are shown for indentations at the center of the cell which are reasonable matches to the tip profile, and an additional example is shown for an indentation that is on the tilted side of a highly rounded cell and that differs from the tip shape. We also demonstrate that the AFM tip can interact with internal cell structures, we show that the contact area between the cell and the substrate can increase under applied pressure, that the main body of the cell can fuse with the extended lamellipodium, and that the cell can be displaced laterally by the AFM tip. The features illustrated here are relevant to the interpretation of indentation experiments that measure cell elasticity properties, as is discussed briefly.

  9. In Situ STM and AFM of the Copper Protein Pseudomonas Aeruginosa Azurin

    DEFF Research Database (Denmark)

    Friis, Esben P.; Andersen, Jens Enevold Thaulov; Madsen, L.L.;


    Scanning tunnel (STM) and atomic force microscopy (AFM) in the in situ mode under potentiostatic control have opened new perspectives for mapping the two-dimensional organization of surface adsorbates in aqueous solution. In situ STM and AFM, however, also raise recognized problems. In the contex...

  10. Investigation of Amyloid Structures at Nanoscale via AFM based Dynamic Nanomechncial Microscopy

    DEFF Research Database (Denmark)

    Zhang, Shuai


    and material research. Among kinds of techniques, Atomic force microscopy (AFM) has the advantages in amyloid study, due to the real-space nano-resolution, the possibilities to characterize in physiological condition, and easy operation without staining requirement. The recent developed AFM based dynamic...

  11. Reconfigurable multiport EPON repeater (United States)

    Oishi, Masayuki; Inohara, Ryo; Agata, Akira; Horiuchi, Yukio


    An extended reach EPON repeater is one of the solutions to effectively expand FTTH service areas. In this paper, we propose a reconfigurable multi-port EPON repeater for effective accommodation of multiple ODNs with a single OLT line card. The proposed repeater, which has multi-ports in both OLT and ODN sides, consists of TRs, BTRs with the CDR function and a reconfigurable electrical matrix switch, can accommodate multiple ODNs to a single OLT line card by controlling the connection of the matrix switch. Although conventional EPON repeaters require full OLT line cards to accommodate subscribers from the initial installation stage, the proposed repeater can dramatically reduce the number of required line cards especially when the number of subscribers is less than a half of the maximum registerable users per OLT. Numerical calculation results show that the extended reach EPON system with the proposed EPON repeater can save 17.5% of the initial installation cost compared with a conventional repeater, and can be less expensive than conventional systems up to the maximum subscribers especially when the percentage of ODNs in lightly-populated areas is higher.

  12. Revisiting the TALE repeat. (United States)

    Deng, Dong; Yan, Chuangye; Wu, Jianping; Pan, Xiaojing; Yan, Nieng


    Transcription activator-like (TAL) effectors specifically bind to double stranded (ds) DNA through a central domain of tandem repeats. Each TAL effector (TALE) repeat comprises 33-35 amino acids and recognizes one specific DNA base through a highly variable residue at a fixed position in the repeat. Structural studies have revealed the molecular basis of DNA recognition by TALE repeats. Examination of the overall structure reveals that the basic building block of TALE protein, namely a helical hairpin, is one-helix shifted from the previously defined TALE motif. Here we wish to suggest a structure-based re-demarcation of the TALE repeat which starts with the residues that bind to the DNA backbone phosphate and concludes with the base-recognition hyper-variable residue. This new numbering system is consistent with the α-solenoid superfamily to which TALE belongs, and reflects the structural integrity of TAL effectors. In addition, it confers integral number of TALE repeats that matches the number of bound DNA bases. We then present fifteen crystal structures of engineered dHax3 variants in complex with target DNA molecules, which elucidate the structural basis for the recognition of bases adenine (A) and guanine (G) by reported or uncharacterized TALE codes. Finally, we analyzed the sequence-structure correlation of the amino acid residues within a TALE repeat. The structural analyses reported here may advance the mechanistic understanding of TALE proteins and facilitate the design of TALEN with improved affinity and specificity.

  13. Magni: A Python Package for Compressive Sampling and Reconstruction of Atomic Force Microscopy Images

    Directory of Open Access Journals (Sweden)

    Christian Schou Oxvig


    Full Text Available Magni is an open source Python package that embraces compressed sensing and Atomic Force Microscopy (AFM imaging techniques. It provides AFM-specific functionality for undersampling and reconstructing images from AFM equipment and thereby accelerating the acquisition of AFM images. Magni also provides researchers in compressed sensing with a selection of algorithms for reconstructing undersampled general images, and offers a consistent and rigorous way to efficiently evaluate the researchers own developed reconstruction algorithms in terms of phase transitions. The package also serves as a convenient platform for researchers in compressed sensing aiming at obtaining a high degree of reproducibility of their research.

  14. Kinetics of degradation of dipalmitoylphosphatidylcholine (DPPC) bilayers as a result of vipoxin phospholipase A2 activity: an atomic force microscopy (AFM) approach

    DEFF Research Database (Denmark)

    Balashev, Konstantin; Atanasov, Vasil; Mitewa, Mariana


    the occurrence and the growth rate of the bilayer defects. The special resolution of the AFM images allowed us to measure the area and the perimeter length of these defects and to draw conclusions about the kinetics of the enzyme reaction. Moreover, we also report for some unique characteristics discovered...... the volume of these crystals and we found that their growth rate follows a similar kinetic pattern as the degradation rate of the supported bilayer....

  15. BOREAS AFM-2 Wyoming King Air 1994 Aircraft Sounding Data (United States)

    Kelly, Robert D.; Hall, Forrest G. (Editor); Knapp, David E. (Editor); Smith, David E. (Technical Monitor)


    The BOREAS AFM-2 team used the University of Wyoming King Air aircraft during IFCs 1, 2, and 3 in 1994 to collected pass-by-pass fluxes (and many other statistics) for the large number of level (constant altitude), straight-line passes used in a variety of flight patterns over the SSA and NSA and areas along the transect between these study areas. The data described here form a second set, namely soundings that were incorporated into nearly every research flight by the King Air in 1994. These soundings generally went from near the surface to above the inversion layer. Most were flown immediately after takeoff or immediately after finishing the last flux pattern of that particular day's flights. The parameters that were measured include wind direction, wind speed, west wind component (u), south wind component (v), static pressure, air dry bulb temperature, potential temperature, dewpoint, temperature, water vapor mixing ratio, and CO2 concentration. Data on the aircraft's location, attitude, and altitude during data collection are also provided. These data are stored in tabular ASCH files. The data files are available on a CD-ROM (see document number 20010000884) or from the Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC).

  16. BOREAS AFM-03-NCAR Electra 1994 Aircraft Sounding Data (United States)

    Lenschow, Donald H.; Oncley, Steven P.; Hall, Forrest G. (Editor); Knapp, David E. (Editor); Smith, David E. (Technical Monitor)


    The Boreal Ecosystem-Atmosphere Study (BOREAS) Airborne Fluxes and Meteorology (AFM)-3 team used the National Center for Atmospheric Research's (NCAR) Electra aircraft to make sounding measurements to study the planetary boundary layer using in situ and remote-sensing measurements. Measurements were made of wind speed and direction, air pressure and temperature, potential temperature, dewpoint, mixing ratio of H, O, CO, concentration, and ozone concentration. Twenty-five research missions were flown over the Northern Study Area (NSA), Southern Study Area (SSA), and the transect during BOREAS Intensive Field Campaigns (IFCs) 1, 2, and 3 during 1994. All missions had from four to ten soundings through the top of the planetary boundary layer. This sounding data set contains all of the in situ vertical profiles through the boundary layer top that were made (with the exception of 'porpoise' maneuvers). Data were recorded in one-second time intervals. These data are stored in tabular ASCII files. The NCAR Electra 1994 aircraft sounding data are available from the Earth Observing System Data and Information System (EOSDIS) Oak Ridge National Laboratory (ORNL) Distributed Active Archive Center (DAAC). The data files are available on a CD-ROM (see document number 20010000884).

  17. Investigation of pyrite surface state by DFT and AFM

    Institute of Scientific and Technical Information of China (English)

    先永骏; 聂琪; 文书明; 刘建; 邓久帅


    The surface states of pyrite (FeS2) were theoretically investigated using first principle calculation based on the density functional theory (DFT). The results indicate that both the (200) and (311) surfaces of pyrite undergo significant surface atom relaxation after geometry optimization, which results in a considerable distortion of the surface region. In the normal direction, i.e., perpendicular to the surface, S atoms in the first surface layer move outward from the bulk, while Fe atoms move toward the bulk, forming an S-rich surface. The surface relaxation processes are driven by electrostatic interaction, which is evidenced by a relative decrease in the surface energy after surface relaxation. Such a relaxation process is visually interpreted through the qualitative analysis of molecular mechanics. Atomic force microscopy (AFM) analysis reveals that only sulfur atom is visible on the pyrite surface. This result is consistent with the DFT data. Such S-rich surface has important influence on the flotation properties of pyrite.

  18. Recursive quantum repeater networks

    CERN Document Server

    Van Meter, Rodney; Horsman, Clare


    Internet-scale quantum repeater networks will be heterogeneous in physical technology, repeater functionality, and management. The classical control necessary to use the network will therefore face similar issues as Internet data transmission. Many scalability and management problems that arose during the development of the Internet might have been solved in a more uniform fashion, improving flexibility and reducing redundant engineering effort. Quantum repeater network development is currently at the stage where we risk similar duplication when separate systems are combined. We propose a unifying framework that can be used with all existing repeater designs. We introduce the notion of a Quantum Recursive Network Architecture, developed from the emerging classical concept of 'recursive networks', extending recursive mechanisms from a focus on data forwarding to a more general distributed computing request framework. Recursion abstracts independent transit networks as single relay nodes, unifies software layer...

  19. Comparison of initial and tertiary centre second opinion reads of multiparametric magnetic resonance imaging of the prostate prior to repeat biopsy

    Energy Technology Data Exchange (ETDEWEB)

    Hansen, Nienke L. [University Hospital RWTH Aachen, Department of Diagnostic and Interventional Radiology, Aachen (Germany); Addenbrooke' s Hospital and University of Cambridge, CamPARI Clinic, Cambridge (United Kingdom); Koo, Brendan C.; Gallagher, Ferdia A. [Addenbrooke' s Hospital and University of Cambridge, CamPARI Clinic, Cambridge (United Kingdom); Addenbrooke' s Hospital and University of Cambridge, Department of Radiology, Cambridge (United Kingdom); Warren, Anne Y. [Addenbrooke' s Hospital and University of Cambridge, CamPARI Clinic, Cambridge (United Kingdom); Addenbrooke' s Hospital, Department of Pathology, Cambridge (United Kingdom); Doble, Andrew; Gnanapragasam, Vincent; Bratt, Ola; Kastner, Christof [Addenbrooke' s Hospital and University of Cambridge, CamPARI Clinic, Cambridge (United Kingdom); Addenbrooke' s Hospital, Department of Urology, Cambridge (United Kingdom); Barrett, Tristan [Addenbrooke' s Hospital and University of Cambridge, CamPARI Clinic, Cambridge (United Kingdom); Addenbrooke' s Hospital and University of Cambridge, Department of Radiology, Cambridge (United Kingdom); University of Cambridge School of Clinical Medicine, Department of Radiology, Box 218, Cambridge (United Kingdom)


    To investigate the value of second-opinion evaluation of multiparametric prostate magnetic resonance imaging (MRI) by subspecialised uroradiologists at a tertiary centre for the detection of significant cancer in transperineal fusion prostate biopsy. Evaluation of prospectively acquired initial and second-opinion radiology reports of 158 patients who underwent MRI at regional hospitals prior to transperineal MR/untrasound fusion biopsy at a tertiary referral centre over a 3-year period. Gleason score (GS) 7-10 cancer, positive predictive value (PPV) and negative (NPV) predictive value (±95 % confidence intervals) were calculated and compared by Fisher's exact test. Disagreement between initial and tertiary centre second-opinion reports was observed in 54 % of cases (86/158). MRIs had a higher NPV for GS 7-10 in tertiary centre reads compared to initial reports (0.89 ± 0.08 vs 0.72 ± 0.16; p = 0.04), and a higher PPV in the target area for all cancer (0.61 ± 0.12 vs 0.28 ± 0.10; p = 0.01) and GS 7-10 cancer (0.43 ± 0.12 vs 0.2 3 ± 0.09; p = 0.02). For equivocal suspicion, the PPV for GS 7-10 was 0.12 ± 0.11 for tertiary centre and 0.11 ± 0.09 for initial reads; p = 1.00. Second readings of prostate MRI by subspecialised uroradiologists at a tertiary centre significantly improved both NPV and PPV. Reporter experience may help to reduce overcalling and avoid overtargeting of lesions. (orig.)

  20. Probing Ternary Solvent Effect in High V(oc) Polymer Solar Cells Using Advanced AFM Techniques. (United States)

    Li, Chao; Ding, Yi; Soliman, Mikhael; Lorenzo, Josie; Dhasmana, Nitesh; Chantharasupawong, Panit; Ievlev, Anton V; Gesquiere, Andre J; Tetard, Laurene; Thomas, Jayan


    This work describes a simple method to develop a high V(oc) low band gap PSCs. In addition, two new atomic force microscopy (AFM)-based nanoscale characterization techniques to study the surface morphology and physical properties of the structured active layer are introduced. With the help of ternary solvent processing of the active layer and C60 buffer layer, a bulk heterojunction PSC with V(oc) more than 0.9 V and conversion efficiency 7.5% is developed. In order to understand the fundamental properties of the materials ruling the performance of the PSCs tested, AFM-based nanoscale characterization techniques including Pulsed-Force-Mode AFM (PFM-AFM) and Mode-Synthesizing AFM (MSAFM) are introduced. Interestingly, MSAFM exhibits high sensitivity for direct visualization of the donor-acceptor phases in the active layer of the PSCs. Finally, conductive-AFM (cAFM) studies reveal local variations in conductivity in the donor and acceptor phases as well as a significant increase in photocurrent in the PTB7:ICBA sample obtained with the ternary solvent processing.

  1. Images (United States)

    National Aeronautics and Space Administration — Images for the website main pages and all configurations. The upload and access points for the other images are: Website Template RSW images BSCW Images HIRENASD...

  2. Novel Method of Measuring Cantilever Deflection during an AFM Force Measurement (United States)

    Hlady, V.; Pierce, M.; Pungor, A.


    A combination of a reflection interference contrast microscope (RICM) and the atomic force microscope (AFM) was used to monitor the cantilever–surface separation distance during force measurements using the streptavidin–biotin recognition pairs. The RICM showed that the cantilever loses contact with the surface before the final rupture of the adhesive bonds is measured by the AFM detection system. This finding suggests that the immobilization of biotin by physisorbed albumin and subsequent binding of streptavidin might have created a cross-linked protein network whose cohesion is tested by the AFM cantilever with the immobilized biotin ligands. PMID:25132721

  3. Wetting properties of AFM probes by means of contact angle measurement (United States)

    Tao, Zhenhua; Bhushan, Bharat


    An atomic force microscopy (AFM) based technique was developed to measure the wetting properties of probe tips. By advancing and receding the AFM tip across the water surface, the meniscus force between the tip and the liquid was measured at the tip-water separation. The water contact angle was determined from the meniscus force. The obtained contact angle results were compared with that by the sessile drop method. It was found that the AFM based technique provided higher contact angle values than the sessile drop method. The mechanisms responsible for the difference are discussed.

  4. Retrospective 70 y-spatial analysis of repeated vine mortality patterns using ancient aerial time series, Pléiades images and multi-source spatial and field data (United States)

    Vaudour, E.; Leclercq, L.; Gilliot, J. M.; Chaignon, B.


    For any wine estate, there is a need to demarcate homogeneous within-vineyard zones ('terroirs') so as to manage grape production, which depends on vine biological condition. Until now, the studies performing digital zoning of terroirs have relied on recent spatial data and scant attention has been paid to ancient geoinformation likely to retrace past biological condition of vines and especially occurrence of vine mortality. Is vine mortality characterized by recurrent and specific patterns and if so, are these patterns related to terroir units and/or past landuse? This study aimed at performing a historical and spatial tracing of vine mortality patterns using a long time-series of aerial survey images (1947-2010), in combination with recent data: soil apparent electrical conductivity EM38 measurements, very high resolution Pléiades satellite images, and a detailed field survey. Within a 6 ha-estate in the Southern Rhone Valley, landuse and planting history were retraced and the map of missing vines frequency was constructed from the whole time series including a 2015-Pléiades panchromatic band. Within-field terroir units were obtained from a support vector machine classifier computed on the spectral bands and NDVI of Pléiades images, EM38 data and morphometric data. Repeated spatial patterns of missing vines were highlighted throughout several plantings, uprootings, and vine replacements, and appeared to match some within-field terroir units, being explained by their specific soil characteristics, vine/soil management choices and the past landuse of the 1940s. Missing vines frequency was spatially correlated with topsoil CaCO3 content, and negatively correlated with topsoil iron, clay, total N, organic C contents and NDVI. A retrospective spatio-temporal assessment of terroir therefore brings a renewed focus on some key parameters for maintaining a sustainable grape production.


    Institute of Scientific and Technical Information of China (English)

    XU Zongwei; DONG Shen; GUO Liqiu; ZHAO Qingliang


    An improved arc discharge method is developed to fabricate carbon nanotube probe of atomic force microscopy (AFM) here. First, silicon probe and carbon nanotube are manipulated under an optical microscope by two high precision microtranslators. When silicon probe and carbon nanotube are very close, several tens voltage is applied between them. And carbon nanotube is divided and attached to the end of silicon probe, which mainly due to the arc welding function.Comparing with the arc discharge method before, the new method here needs no coat silicon probe with metal film in advance, which can greatly reduce the fabrication's difficulty. The fabricated carbon nanotube probe shows good property of higher aspect ratio and can more accurately reflect the true topography of silicon grating than silicon probe. Under the same image drive force, carbon nanotube probe had less indentation depth on soft triblock copolymer sample than silicon probe. This showed that carbon nanotube probe has lower spring constant and less damage to the scan sample than silicon probe.

  6. Numerical Simulation of Nano Scanning in Intermittent-Contact Mode AFM under Q control

    CERN Document Server

    Varol, Aydin; Orun, Bilal; Basdogan, Cagatay


    We investigate nano scanning in tapping mode atomic force microscopy (AFM) under quality (Q) control via numerical simulations performed in SIMULINK. We focus on the simulation of whole scan process rather than the simulation of cantilever dynamics and the force interactions between the probe tip and the surface alone, as in most of the earlier numerical studies. This enables us to quantify the scan performance under Q control for different scan settings. Using the numerical simulations, we first investigate the effect of elastic modulus of sample (relative to the substrate surface) and probe stiffness on the scan results. Our numerical simulations show that scanning in attractive regime using soft cantilevers with high Qeff results in a better image quality. We, then demonstrate the trade-off in setting the effective Q factor (Qeff) of the probe in Q control: low values of Qeff cause an increase in tapping forces while higher ones limit the maximum achievable scan speed due to the slow response of the cantil...

  7. Optimization of Q-factor of AFM cantilevers using genetic algorithms. (United States)

    Perez-Cruz, Angel; Dominguez-Gonzalez, Aurelio; Stiharu, Ion; Osornio-Rios, Roque A


    Micro cantilever beams have been intensively used in sensing applications including to scanning profiles and surfaces where there resolution and imaging speed are critical. Force resolution is related to the Q-factor. When the micro-cantilever operates in air with small separation gaps, the Q-factor is even more reduced due to the squeeze-film damping effect. Thus, the optimization of the configuration of an AFM micro-cantilever is presented in this work with the objective of improving its Q-factor. To accomplish this task, we propose the inclusion of holes as breathing chimneys in the initial design to reduce the squeeze-film damping effect. The evaluation of the Q-factor was carried out using finite element model, which is implemented to work together with the squeeze-film damping model. The methodology applied in the optimization process was genetic algorithms, which considers as constraints the maximum allowable stress, fundamental frequency and spring constant with respect to the initial design. The results show that the optimum design, which includes holes with an optimal location, increases the Q-factor almost five times compared to the initial design.

  8. Examples of Artifacts in Atomic force Microscope Imaging%实例分析原子力显微镜使用中的假像

    Institute of Scientific and Technical Information of China (English)



    Artifacts are hot topics in AFM imaging.Typical artifacts images of AFM and their reasons were firstly summarized in this paper,then the repeated ‘bean sprout structures’,repeated circular rings and repeated triangles found in our experiments were analyzed in detail,which could be used for reference in future work.%假像是原子力显微镜(AFM)技术研究中的一个热点问题,本文首先分析了AFM实验中产生假像的常见原因及其可能产生的假像类型,然后以实验中得到的重复“豆芽形结构”、完全一致的重复圆环形貌结构和许多重复的三角形结构的AFM图像为例,分析了假像产生的原因,为AFM实验结果分析中假像的辨别处理提供了借鉴经验。

  9. The Pentapeptide Repeat Proteins

    Energy Technology Data Exchange (ETDEWEB)

    Vetting,M.; Hegde, S.; Fajardo, J.; Fiser, A.; Roderick, S.; Takiff, H.; Blanchard, J.


    The Pentapeptide Repeat Protein (PRP) family has over 500 members in the prokaryotic and eukaryotic kingdoms. These proteins are composed of, or contain domains composed of, tandemly repeated amino acid sequences with a consensus sequence of [S, T,A, V][D, N][L, F]-[S, T,R][G]. The biochemical function of the vast majority of PRP family members is unknown. The three-dimensional structure of the first member of the PRP family was determined for the fluoroquinolone resistance protein (MfpA) from Mycobacterium tuberculosis. The structure revealed that the pentapeptide repeats encode the folding of a novel right-handed quadrilateral {beta}-helix. MfpA binds to DNA gyrase and inhibits its activity. The rod-shaped, dimeric protein exhibits remarkable size, shape and electrostatic similarity to DNA.

  10. Repeating the Past (United States)

    Moore, John W.


    As part of the celebration of the Journal 's 75th year, we are scanning each Journal issue from 25, 50, and 74 years ago. Many of the ideas and practices described are so similar to present-day "innovations" that George Santayana's adage (1) "Those who cannot remember the past are condemned to repeat it" comes to mind. But perhaps "condemned" is too strong - sometimes it may be valuable to repeat something that was done long ago. One example comes from the earliest days of the Division of Chemical Education and of the Journal.

  11. Impact of two toothpastes on repairing enamel erosion produced by a soft drink: an AFM in vitro study. (United States)

    Poggio, Claudio; Lombardini, Marco; Colombo, Marco; Bianchi, Stefano


    The aim of the present in vitro study was the evaluation of two toothpastes (Sensodyne Pronamel and Biorepair Plus on repairing enamel erosion produced by a soft drink (Coca Cola), using Atomic Force Microscopy (AFM). Fifty extracted human central incisors free of caries were selected and divided in a treatment and a control half; they were kept in artificial saliva during whole experimentation. The treatment halves were divided into five groups; group 1: demineralization with soft drink; group 2: demineralization with soft drink + Pronamel; group 3: demineralization with soft drink + Biorepair Plus; group 4: intact enamel + Pronamel; group 5: intact enamel + Biorepair Plus. Specimen demineralization was carried on in 4 intervals of 2 min. In groups 2, 3, 4, and 5 the toothpastes were applied for 3 min at 0, 8, 24 and 36 h. The surface of each specimen was imaged by AFM and R(rms), root-mean-square roughness, and Maximum Depth of the cavities were registered. Amongst treatment specimens of groups 1, 2, and 3 a statistically significant difference (P<0.01) in R(rms) and Maximum Depth values was registered: the toothpastes reduced enamel demineralization. No statistical differences in R(rms) values were registered between the two toothpastes. The toothpastes tested (Pronamel and BioRepair Plus) offer a degree of protection from erosive drinks. Copyright © 2010 Elsevier Ltd. All rights reserved.

  12. Non-contact AFM investigation of influence of freezing process on the surface structure of potato starch granule (United States)

    Krok, F.; Szymońska, J.; Tomasik, P.; Szymoński, M.


    To assess the influence of the freezing process on the surface structure of a potato starch granule, a non-contact Atomic Force Microscopy (NC-AFM) investigation at ambient conditions has been undertaken. The observations were carried out for dried (oven-dried) and native (air-dried) starch. The obtained AFM images of the native starch granule surface demonstrated it as not uniformly smooth and having rough undulating appearance with layers of adsorbed water which could be removed by oven drying in 130°C. After freezing, the dried starch granule surface still consisted of nodules of about 100 nm in diameter. Significant changes in the granule surface appearance can be seen for dried starch samples frozen with some excess of water as well as for native starch samples frozen with its original water. Then the aggregation and polishing of the granules was observed and their surface revealed a microstructure with distinct ring-like protrusions of about 300 nm in diameter. Our observations tally with the amylopectine "blocket" starch granule structure model proposed in the literature and allowed to conclude that freezing may be a useful tool, among other methods, for modifying starch granule properties.

  13. Amyloid misfolding, aggregation, and the early onset of protein deposition diseases: insights from AFM experiments and computational analyses

    Directory of Open Access Journals (Sweden)

    Yuri L. Lyubchenko


    Full Text Available The development of Alzheimer's disease is believed to be caused by the assembly of amyloid β proteins into aggregates and the formation of extracellular senile plaques. Similar models suggest that structural misfolding and aggregation of proteins are associated with the early onset of diseases such as Parkinson's, Huntington's, and other protein deposition diseases. Initially, the aggregates were structurally characterized by traditional techniques such as x-ray crystallography, NMR, electron microscopy, and AFM. However, data regarding the structures formed during the early stages of the aggregation process were unknown. Experimental models of protein deposition diseases have demonstrated that the small oligomeric species have significant neurotoxicity. This highlights the urgent need to discover the properties of these species, to enable the development of efficient diagnostic and therapeutic strategies. The oligomers exist transiently, making it impossible to use traditional structural techniques to study their characteristics. The recent implementation of single-molecule imaging and probing techniques that are capable of probing transient states have enabled the properties of these oligomers to be characterized. Additionally, powerful computational techniques capable of structurally analyzing oligomers at the atomic level advanced our understanding of the amyloid aggregation problem. This review outlines the progress in AFM experimental studies and computational analyses with a primary focus on understanding the very first stage of the aggregation process. Experimental approaches can aid in the development of novel sensitive diagnostic and preventive strategies for protein deposition diseases, and several examples of these approaches will be discussed.

  14. Inhibition of cold rolled steel corrosion by Tween-20 in sulfuric acid: weight loss, electrochemical and AFM approaches. (United States)

    Mu, Guannan; Li, Xianghong


    The inhibiting action of a nonionic surfactant of Tween-20 on the corrosion of cold rolled steel (CRS) in 0.5-7.0 M sulfuric acid (H(2)SO(4)) was studied by weight loss and potentiodynamic polarization methods. Atomic force microscope (AFM) provided the surface conditions. The results show that inhibition efficiency increases with the inhibitor concentration, while it decreases with the sulfuric acid concentration. The adsorption of inhibitor on the cold rolled steel surface obeys the Langmuir adsorption isotherm equation. Effect of immersion time was studied and discussed. The effect of temperature on the corrosion behavior of cold rolled steel was also studied at four temperatures ranging from 30 to 60 degrees C, the thermodynamic parameters such as adsorption heat, adsorption free energy, and adsorption entropy were calculated. The results revealed that the adsorption was physisorption mechanism. A kinetic study of cold rolled steel in uninhibited and inhibited acid was also discussed. The kinetic parameters such as apparent activation energy, pre-exponential factor, rate constant, and reaction constant were calculated for the reactions of corrosion. The inhibition effect is satisfactorily explained by both thermodynamic and kinetic models. Polarization curves show that Tween-20 is a cathodic-type inhibitor in sulfuric acid. The results obtained from weight loss and potentiodynamic polarization are in good agreement, and the Tween-20 inhibition action could also be evidenced by surface AFM images.

  15. Measurement of cluster-cluster interaction in liquids by deposition and AFM of silicon clusters onto HOPG surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Galinis, Gediminas; Torricelli, Gauthier; Akraiam, Atea; Haeften, Klaus von, E-mail: [University of Leicester, Department of Physics and Astronomy (United Kingdom)


    We have investigated the interaction and aggregation of novel fluorescent silicon nanoclusters in liquids by measuring the size distribution of dried clusters on graphite. The clusters were produced by gas aggregation and co-deposition with a beam of water vapour. Drops of the solutions were placed on freshly cleaved highly oriented pyrolitic graphite, subsequently vacuum dried and investigated by atomic force microscopy (AFM) in ultra high vacuum. The AFM images show single clusters and agglomerates. The height distributions are Gaussian-shaped with average heights of 1 nm and widths of 1 nm. The heights never exceed 3 nm. In some regions a second cluster layer is observed. In all samples the separation between first and second layers is larger than the separation between the first layer and the graphite substrate, which we attribute to a stronger interaction between clusters and surface than the cluster self-interaction. We conclude that the separation between first and second layer represents a much better fingerprint of the original size distribution of the clusters in solution than the height of the first layer. The observation of a second cluster layer is important for using silicon clusters as building blocks for cluster-assembled materials.


    Institute of Scientific and Technical Information of China (English)

    饶群力; 王浩伟; 周尧和


    A crystalline and non-crystalline two-phase Ni-B coating was prepared by electroless deposition with potassium borohydride as reducing agent. When the deposit was heated from 10 C to 500 C, it took place three kinds of phase transformation and formed corresponding nickel borides. An Atomic Force Microscopy (AFM) was used to directly view the surface morphologies of the samples in various treated states. The AFM images indicate that nano-dimensional protrusions grow on the surface of the deposit grain during some heat treatment processes,and they are distinguished greatly from the small bulges existing in the as-plated deposit. Further studies show that the microhardness related to the surface topography of thecoating to some extent. Especially when a two-step heat treatment process was performed, the nano-dimensional protrusions on the grain surface grew upt to 40~100nm in diameter and 10~20 nm in height, and the deposit microhardness reached up to HV1500~ 1600 in the meantime.

  17. Improving the lateral resolution of quartz tuning fork-based sensors in liquid by integrating commercial AFM tips into the fiber end. (United States)

    Gonzalez, Laura; Martínez-Martín, David; Otero, Jorge; de Pablo, Pedro José; Puig-Vidal, Manel; Gómez-Herrero, Julio


    The use of quartz tuning fork sensors as probes for scanning probe microscopy is growing in popularity. Working in shear mode, some methods achieve a lateral resolution comparable with that obtained with standard cantilevered probes, but only in experiments conducted in air or vacuum. Here, we report a method to produce and use commercial AFM tips in electrically driven quartz tuning fork sensors operating in shear mode in a liquid environment. The process is based on attaching a standard AFM tip to the end of a fiber probe which has previously been sharpened. Only the end of the probe is immersed in the buffer solution during imaging. The lateral resolution achieved is about 6 times higher than that of the etched microfiber on its own.

  18. Fourier Transform Infrared (FTIR) Spectroscopy, Ultraviolet Resonance Raman (UVRR) Spectroscopy, and Atomic Force Microscopy (AFM) for Study of the Kinetics of Formation and Structural Characterization of Tau Fibrils. (United States)

    Ramachandran, Gayathri


    Kinetic studies of tau fibril formation in vitro most commonly employ spectroscopic probes such as thioflavinT fluorescence and laser light scattering or negative stain transmission electron microscopy. Here, I describe the use of Fourier transform infrared (FTIR) spectroscopy, ultraviolet resonance Raman (UVRR) spectroscopy, and atomic force microscopy (AFM) as complementary probes for studies of tau aggregation. The sensitivity of vibrational spectroscopic techniques (FTIR and UVRR) to secondary structure content allows for measurement of conformational changes that occur when the intrinsically disordered protein tau transforms into cross-β-core containing fibrils. AFM imaging serves as a gentle probe of structures populated over the time course of tau fibrillization. Together, these assays help further elucidate the structural and mechanistic complexity inherent in tau fibril formation.

  19. 应用非接触AFM鉴别表面下的原子种类%Identification of subsurface atom species using noncontact AFM

    Institute of Scientific and Technical Information of China (English)


    @@ The noncontact atomic force microscope(NCAFM)using frequency modulation(FM)technique can resolve the atomic features of the various surfaces.Recently,we found that the NC-AFM has a capability to identify or recognize atom species on a sample surface,if we can control an atomic species at the tip apex.That is,we succeeded in identification of Si and Ge atoms by imaging the Si/Ge intermixing Si(111)Surface using Si tip,where both of Si and Ge atoms are group IV elements[1].In the present experiments,we further investigate the capability of NC-AFM to identify the atom species under the surface.

  20. Study of the Raman-AFM System for Simultaneous Measurements of Raman Spectrum and Micro/Nano-Structures%用于Raman光谱与微纳米结构同步检测的Raman-AFM系统研究

    Institute of Scientific and Technical Information of China (English)

    史斌; 章海军; 吴兰; 张冬仙


    研究和发展了一种将微区拉曼(Raman)光谱检测与原子力显微镜(AFM)微纳米扫描成像相结合的新型Raman-AFM技术.设计了Raman光谱与AFM扫描成像的原位检测探头;研制出相应的Raman-AFM系统;利用该系统,对ZnO纳米颗粒和TiO2纳米薄膜开展了微区Raman光谱与微纳米结构的检测实验.研究表明,所获得的Raman光谱检测结果与理论值良好吻合,同时,AFM扫描检测得到的图像很好地表征了样品的微纳米结构,从而实现了微区Raman光谱与AFM图像的原位及同步检测,验证了这一技术的可行性,为Raman光谱技术与微纳米技术领域的实际应用提供了技术基础.%This paper proposes a novel technique of Raman-atomic force microscopy (AFM) combining micro region Raman spec-troscopy and AFM imaging. An in-situ probe unit which can simultaneously realize the detection of Raman spectrum and the measurement of AFM image was designed, and a related Raman-AFM system was constructed. Using this system, some experiments were carried out to acquire micro region Raman spectra and AFM images of ZnO nano-particle and TiO2 film. The results show that the Raman spectra of both samples are in agreement with theoretical vaues, and the AFM images represent their mi-cro/nano-structures quite well. These researches prove the feasibility of the Raman-AFM technique which has the potential of being widely applied in the fields of Raman spectroscopy and micro/nano-technology.

  1. Tablet surface characterisation by various imaging techniques

    DEFF Research Database (Denmark)

    Seitavuopio, Paulus; Rantanen, Jukka; Yliruusi, Jouko


    The aim of this study was to characterise tablet surfaces using different imaging and roughness analytical techniques including optical microscopy, scanning electron microscopy (SEM), laser profilometry and atomic force microscopy (AFM). The test materials compressed were potassium chloride (KCl......, but they do not provide quantitative information about surface roughness. Laser profilometry and AFM on the other hand provide quantitative roughness data from two different scales, laser profilometer from 1 mm and atomic force microscope from 90 microm scale. AFM is a powerful technique but other imaging...

  2. All-optical repeater. (United States)

    Silberberg, Y


    An all-optical device containing saturable gain, saturable loss, and unsaturable loss is shown to transform weak, distorted optical pulses into uniform standard-shape pulses. The proposed device performs thresholding, amplification, and pulse shaping as required from an optical repeater. It is shown that such a device could be realized by existing semiconductor technology.

  3. Bidirectional Manchester repeater (United States)

    Ferguson, J.


    Bidirectional Manchester repeater is inserted at periodic intervals along single bidirectional twisted pair transmission line to detect, amplify, and transmit bidirectional Manchester 11 code signals. Requiring only 18 TTL 7400 series IC's, some line receivers and drivers, and handful of passive components, circuit is simple and relatively inexpensive to build.

  4. Quench propagation in AFM Bi-2223 conductors for current lead applications

    CERN Document Server

    Martini, L; Berti, R; Bigoni, L; Putti, M; Volpini, G; Curcio, F


    In this paper, the authors report on the electrical and thermal properties of Bi-2223 composite conductors prepared by the "accordion-folding method" (AFM). Thermal behavior study on AFM Bi-2223 conductors similar to those that have been successfully used to assemble the cold stage of low-loss current leads for CERN, has been performed by using a newly developed experimental apparatus that is described in detail. (7 refs).

  5. Controlled nanodot fabrication by rippling polycarbonate surface using an AFM diamond tip



    The single scratching test of polymer polycarbonate (PC) sample surface using an atomic force microscope (AFM) diamond tip for fabricating ripple patterns has been studied with the focus on the evaluation of the effect of the tip scratching angle on the pattern formation. The experimental results indicated that the different oriented ripples can be easily machined by controlling the scratching angles of the AFM. And, the effects of the normal load and the feed on the ripples formation and the...

  6. Surface Microstructure of Mo(C)N Coatings Investigated by AFM (United States)

    Kuznetsova, T.; Zubar, T.; Chizhik, S.; Gilewicz, A.; Lupicka, O.; Warcholinski, B.


    MoCN coatings have been formed by cathodic arc evaporation using the mixture of acetylene and nitrogen and pure molybdenum target. The surface structure, in conjunction with x-ray data, was analyzed by atomic force microscopy (AFM). The AFM results show differently shaped grain forms on the surface of coatings investigated. The increase in carbon in chemical coatings composition results in the reduction in surface grain size and the increase in roughness of the coatings.

  7. Influence of the surface chemistry on the nanotribological behaviour of (AFM tip/graphite) couples

    Energy Technology Data Exchange (ETDEWEB)

    Jradi, Khalil [Universite du Quebec a Trois Rivieres, Centre Integre en pates et papiers, 3351 boulevard des forges, Trois Rivieres, Quebec G9A 5H7 (Canada); Schmitt, Marjorie, E-mail: [Laboratoire de Chimie Organique et Bioorganique, Ecole Nationale Superieure de Chimie de Mulhouse - CNRS, 3, rue Alfred Werner, 68093 Mulhouse Cedex (France); Bistac, Sophie [Laboratoire de Photochimie et d' Ingenierie Macromoleculaires, 3, rue Alfred Werner, 68093 Mulhouse Cedex (France)


    The development of the nanotechnology has made essential the knowledge of the tribological behaviour of carbonaceous materials, and more particularly of graphite. Atomic force microscopy (AFM) is thus used to study the friction properties at this nanoscopic scale. In this work, results concerning the friction of AFM tips against graphite pins are presented, with a particular emphasis on the effect of the chemical modification of these tips on the tribological behaviour of graphite.

  8. Duct Leakage Repeatability Testing

    Energy Technology Data Exchange (ETDEWEB)

    Walker, Iain [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Sherman, Max [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)


    Duct leakage often needs to be measured to demonstrate compliance with requirements or to determine energy or Indoor Air Quality (IAQ) impacts. Testing is often done using standards such as ASTM E1554 (ASTM 2013) or California Title 24 (California Energy Commission 2013 & 2013b), but there are several choices of methods available within the accepted standards. Determining which method to use or not use requires an evaluation of those methods in the context of the particular needs. Three factors that are important considerations are the cost of the measurement, the accuracy of the measurement and the repeatability of the measurement. The purpose of this report is to evaluate the repeatability of the three most significant measurement techniques using data from the literature and recently obtained field data. We will also briefly discuss the first two factors. The main question to be answered by this study is to determine if differences in the repeatability of these tests methods is sufficient to indicate that any of these methods is so poor that it should be excluded from consideration as an allowed procedure in codes and standards.

  9. Adhesion force imaging in air and liquid by adhesion mode atomic force microscopy

    NARCIS (Netherlands)

    van der Werf, Kees; Putman, C.A.J.; Putman, Constant A.; de Grooth, B.G.; Greve, Jan


    A new imaging mode for the atomic force microscope(AFM), yielding images mapping the adhesion force between tip and sample, is introduced. The adhesion mode AFM takes a force curve at each pixel by ramping a piezoactuator, moving the silicon‐nitride tip up and down towards the sample. During the

  10. Submolecular Resolution Imaging of molecules by Atomic Force Microscopy:The influence of the Electrostatic Force

    NARCIS (Netherlands)

    van der Lit, J.; Cicco, F.; Hapala, P.; Jelinek, P.; Swart, Ingmar


    The forces governing the contrast in submolecular resolution imaging of molecules with atomic force microscopy (AFM) have recently become a topic of intense debate. Here, we show that the electrostatic force is essential to understand the contrast in atomically resolved AFM images of polar molecules

  11. An AFM-based stiffness clamp for dynamic control of rigidity.

    Directory of Open Access Journals (Sweden)

    Kevin D Webster

    Full Text Available Atomic force microscopy (AFM has become a powerful tool for measuring material properties in biology and imposing mechanical boundary conditions on samples from single molecules to cells and tissues. Constant force or constant height can be maintained in an AFM experiment through feedback control of cantilever deflection, known respectively as a 'force clamp' or 'position clamp'. However, stiffness, the third variable in the Hookean relation F = kx that describes AFM cantilever deflection, has not been dynamically controllable in the same way. Here we present and demonstrate a 'stiffness clamp' that can vary the apparent stiffness of an AFM cantilever. This method, employable on any AFM system by modifying feedback control of the cantilever, allows rapid and reversible tuning of the stiffness exposed to the sample in a way that can decouple the role of stiffness from force and deformation. We demonstrated the AFM stiffness clamp on two different samples: a contracting fibroblast cell and an expanding polyacrylamide hydrogel. We found that the fibroblast, a cell type that secretes and organizes the extracellular matrix, exhibited a rapid, sub-second change in traction rate (dF/dt and contraction velocity (dx/dt in response to step changes in stiffness between 1-100 nN/µm. This response was independent of the absolute contractile force and cell height, demonstrating that cells can react directly to changes in stiffness alone. In contrast, the hydrogel used in our experiment maintained a constant expansion velocity (dx/dt over this range of stiffness, while the traction rate (dF/dt changed with stiffness, showing that passive materials can also behave differently in different stiffness environments. The AFM stiffness clamp presented here, which is applicable to mechanical measurements on both biological and non-biological samples, may be used to investigate cellular mechanotransduction under a wide range of controlled mechanical boundary

  12. An AFM-based stiffness clamp for dynamic control of rigidity. (United States)

    Webster, Kevin D; Crow, Ailey; Fletcher, Daniel A


    Atomic force microscopy (AFM) has become a powerful tool for measuring material properties in biology and imposing mechanical boundary conditions on samples from single molecules to cells and tissues. Constant force or constant height can be maintained in an AFM experiment through feedback control of cantilever deflection, known respectively as a 'force clamp' or 'position clamp'. However, stiffness, the third variable in the Hookean relation F = kx that describes AFM cantilever deflection, has not been dynamically controllable in the same way. Here we present and demonstrate a 'stiffness clamp' that can vary the apparent stiffness of an AFM cantilever. This method, employable on any AFM system by modifying feedback control of the cantilever, allows rapid and reversible tuning of the stiffness exposed to the sample in a way that can decouple the role of stiffness from force and deformation. We demonstrated the AFM stiffness clamp on two different samples: a contracting fibroblast cell and an expanding polyacrylamide hydrogel. We found that the fibroblast, a cell type that secretes and organizes the extracellular matrix, exhibited a rapid, sub-second change in traction rate (dF/dt) and contraction velocity (dx/dt) in response to step changes in stiffness between 1-100 nN/µm. This response was independent of the absolute contractile force and cell height, demonstrating that cells can react directly to changes in stiffness alone. In contrast, the hydrogel used in our experiment maintained a constant expansion velocity (dx/dt) over this range of stiffness, while the traction rate (dF/dt) changed with stiffness, showing that passive materials can also behave differently in different stiffness environments. The AFM stiffness clamp presented here, which is applicable to mechanical measurements on both biological and non-biological samples, may be used to investigate cellular mechanotransduction under a wide range of controlled mechanical boundary conditions.

  13. Atomic resolution in noncontact AFM by probing cantilever frequency shifts

    Institute of Scientific and Technical Information of China (English)

    Hong Yong Xie


    Rutile TiO2(001) quantum dots (or nano-marks) in different shapes were used to imitate uncleaved material surfaces or materials with rough surfaces. By numerical integration of the equation of motion of cantilever for silicon tip scanning along the [110] direction over the rutile TiO2 (001) quantum dots in ultra high vacuum (UHV), scanning routes were explored to achieve atomic resolution from frequency shift image. The tip-surface interaction forces were calculated from Lennard-Jones (12-6) potential by the Hamaker summation method. The calculated results showed that atomic resolution could be achieved by frequency shift image for TiO2 (001) surfaces of rhombohedral quantum dot scanning in a vertical route, and spherical cap quantum dot scanning in a superposition route.

  14. AFM studied the effect of celastrol on β1 integrin-mediated HUVEC adhesion and migration. (United States)

    Ke, Changhong; Jin, Hua; Cai, Jiye


    Integrin-mediated human umbilical vein endothelial cells (HUVECs) adhesion to the extracellular matrix plays a fundamental role in tumor-induced angiogenesis. Celastrol, a traditional Chinese medicine plant, has possessed anticancer and suppressed angiogenesis activities. Here, the mechanism underling the antiangiogenesis capacity of celastrol was investigated by exploring the effect of celastrol on β1(CD29) integrin-mediated cell adhesion and migration. Flow cytometry results showed that the HUVECs highly expressed CD29 and cell adhesion assay indicated that celastrol specifically inhibited the adhesion of HUVECs to fibronectin (FN) without affecting nonspecific adhesion to poly-L-lysine (PLL). After cell FN adhesion being inhibited, the cell surface nanoscale structure and adhesion force were detected by atomic force microscope (AFM). High-resolution imaging revealed that cell morphology and ultrastructure changed a lot after being treated with celastrol. The membrane average roughness (Ra) and the major forces were decreased from 31.34 ± 4.56 nm, 519.60 ± 82.86 pN of 0 μg/ml celastrol to 18.47 ± 6.53 nm, 417.79 ± 53.35 pN of 4.0 μg/ml celastrol, 10.54 ± 2.85 nm, 258.95 ± 38.98 pN of 8.0 μg/ml celastrol, respectively. Accompanying with the decrease of adhesion force, the actin cytoskeleton in the cells was obviously disturbed by the celastrol. All of these changes influenced the migration of HUVECs from the wound-healing migration assay. Taken together, our results suggest that celastrol can be as an inhibitor of HUVEC adhesion to FN. This work provides a novel approach to inhibition of tumor angiogenesis and tumor growth.

  15. AFM Bio-Mechanical Investigation of the Taxol Treatment of Breast Cancer Cells (United States)

    Smith, Dylan; Patel, Dipika; Monjaraz, Fernando; Park, Soyeun


    Cancerous cells are known to be softer and easier to deform than normal cells. Changes in mechanical properties originate from the alteration of the actin cytoskeleton. The mechanism of cancer treatment using Taxol is related to the stabilization of microtubules. It has been shown that Taxol binds to polymerized tublin, stabilizes it against disassembly, and consequently inhibits cell division. An accurate quantitative study still lacks to relate the microtubule stabilizing effect with the cellular mechanical properties. We utilized our AFM to study changes in elastic properties of treated breast cancer cells. The AFM has several advantages for precise force measurements on a localized region with nanometer lateral dimension. In previous AFM studies, measurable contributions from the underlying hard substrate have been an obstacle to accurately determine the properties on thin samples. We modified our AFM tip to obtain the exact deformation profile as well as reducing the high stresses produced. We have probed depth profiles of mechanical properties of the taxol-treated and untreated cells by varying the indentation depth of the AFM-nanoindenting experiments.

  16. Micro contact and stick-slip number between AFM probe tip and sample surface

    Institute of Scientific and Technical Information of China (English)

    张向军; 孟永钢; 温诗铸


    In an atomic force microscope (AFM), the cantilever probe, probe tip and sample surface form a micro system in which micro contact, elastic deformation, relative sliding and friction occur during scanning with the contact mode. In this paper, the energy conversion and dissipation during scanning process in the micro system is investigated based on the Mauges-Daules contact model. A dimensionless stick-slip number(η=( )) is defined to describe the micro stick-slip behavior under AFM. Through numerical simulation of the dynamics of the probe tip, it is shown that AFM lateral force is dependent on the defined stick-slip number. If η 1, the tip moves off the sticking points with an adhesion hysteresis, resulting in an energy dissipation. Therefore, the stick-slip number can serve as a characteristic parameter. Numerical simulation of AFM lateral force with different stick-slip numbers is in agreement with experimental results. Finally a method to extract frictional force from the AFM lateral force signal is proposed.

  17. A Study of Moisture Damage in Plastomeric Polymer Modified Asphalt Binder Using Functionalized AFM Tips

    Directory of Open Access Journals (Sweden)

    Rafiqul Tarefder


    Full Text Available In this study, moisture damage in plastomeric polymer modified asphalt binder is investigated using Atomic Force Microscopy (AFM with chemically functionalized AFM tips. Four different percentages of plastomeric polymers and two antistripping agents such as Kling Beta and Lime are used to modify a base asphalt binder. Chemical functional groups such as -COOH, -CH3, -NH3, and –OH, that are commonly present in plastomeric polymer modified asphalt system, are used to functionalize the AFM tips. The force distance mode of AFM is used to measure the adhesion forces between a modified asphalt sample surface and the functionalized AFM tips. This enables the measurement of adhesion within an asphalt binder system. It is shown that the adhesion force values in dry sample changed substantially from that in wet conditioned samples. It is evident from this study that plastomeric modification does not help reduce moisture damage in asphalt. The percentage change in adhesion forces due to moisture is about 20 nN for the lime modified samples, and about 50 nN for the Kling Beta modified samples. This indicates that lime is more effective than Kling Beta for reducing moisture damage in plastomeric polymer modified asphalt.

  18. Effect of AFM probe geometry on visco-hyperelastic characterization of soft materials. (United States)

    Boccaccio, Antonio; Lamberti, Luciano; Papi, Massimiliano; De Spirito, Marco; Pappalettere, Carmine


    Atomic force microscopy (AFM) nanoindentation is very suited for nano- and microscale mechanical characterization of soft materials. Although the structural response of polymeric networks that form soft matter depends on viscous effects caused by the relative slippage of polymeric chains, the usual assumption made in the AFM-based characterization is that the specimen behaves as a purely elastic material and viscous forces are negligible. However, for each geometric configuration of the AFM tip, there will be a limit indentation rate above which viscous effects must be taken into account to correctly determine mechanical properties. A parametric finite element study conducted on 12 geometric configurations of a blunt cone AFM tip (overall, the study included about 200 finite element analyses) allowed us to determine the limit indentation rate for each configuration. The selected tip dimensions cover commercially available products and account for changes in tip geometry caused by serial measurements. Nanoindentation rates cover typical experimental conditions set in AFM bio-measurements on soft matter. Viscous effects appear to be more significant in the case of sharper tips. This implies that, if quantitative data on sample viscosity are not available, using a rounded indenter and carrying out experiments below the limit indentation rate will allow errors in the determination of mechanical properties to be minimized.

  19. AFM as an analysis tool for high-capacity sulfur cathodes for Li-S batteries. (United States)

    Hiesgen, Renate; Sörgel, Seniz; Costa, Rémi; Carlé, Linus; Galm, Ines; Cañas, Natalia; Pascucci, Brigitta; Friedrich, K Andreas


    In this work, material-sensitive atomic force microscopy (AFM) techniques were used to analyse the cathodes of lithium-sulfur batteries. A comparison of their nanoscale electrical, electrochemical, and morphological properties was performed with samples prepared by either suspension-spraying or doctor-blade coating with different binders. Morphological studies of the cathodes before and after the electrochemical tests were performed by using AFM and scanning electron microscopy (SEM). The cathodes that contained polyvinylidene fluoride (PVDF) and were prepared by spray-coating exhibited a superior stability of the morphology and the electric network associated with the capacity and cycling stability of these batteries. A reduction of the conductive area determined by conductive AFM was found to correlate to the battery capacity loss for all cathodes. X-ray diffraction (XRD) measurements of Li2S exposed to ambient air showed that insulating Li2S hydrolyses to insulating LiOH. This validates the significance of electrical ex-situ AFM analysis after cycling. Conductive tapping mode AFM indicated the existence of large carbon-coated sulfur particles. Based on the analytical findings, the first results of an optimized cathode showed a much improved discharge capacity of 800 mA·g(sulfur)(-1) after 43 cycles.

  20. Quantitating membrane bleb stiffness using AFM force spectroscopy and an optical sideview setup. (United States)

    Gonnermann, Carina; Huang, Chaolie; Becker, Sarah F; Stamov, Dimitar R; Wedlich, Doris; Kashef, Jubin; Franz, Clemens M


    AFM-based force spectroscopy in combination with optical microscopy is a powerful tool for investigating cell mechanics and adhesion on the single cell level. However, standard setups featuring an AFM mounted on an inverted light microscope only provide a bottom view of cell and AFM cantilever but cannot visualize vertical cell shape changes, for instance occurring during motile membrane blebbing. Here, we have integrated a mirror-based sideview system to monitor cell shape changes resulting from motile bleb behavior of Xenopus cranial neural crest (CNC) cells during AFM elasticity and adhesion measurements. Using the sideview setup, we quantitatively investigate mechanical changes associated with bleb formation and compared cell elasticity values recorded during membrane bleb and non-bleb events. Bleb protrusions displayed significantly lower stiffness compared to the non-blebbing membrane in the same cell. Bleb stiffness values were comparable to values obtained from blebbistatin-treated cells, consistent with the absence of a functional actomyosin network in bleb protrusions. Furthermore, we show that membrane blebs forming within the cell-cell contact zone have a detrimental effect on cell-cell adhesion forces, suggesting that mechanical changes associated with bleb protrusions promote cell-cell detachment or prevent adhesion reinforcement. Incorporating a sideview setup into an AFM platform therefore provides a new tool to correlate changes in cell morphology with results from force spectroscopy experiments.