C-terminal low-complexity sequence repeats of Mycobacterium smegmatis Ku modulate DNA binding.
Kushwaha, Ambuj K; Grove, Anne
2013-01-24
Ku protein is an integral component of the NHEJ (non-homologous end-joining) pathway of DSB (double-strand break) repair. Both eukaryotic and prokaryotic Ku homologues have been characterized and shown to bind DNA ends. A unique feature of Mycobacterium smegmatis Ku is its basic C-terminal tail that contains several lysine-rich low-complexity PAKKA repeats that are absent from homologues encoded by obligate parasitic mycobacteria. Such PAKKA repeats are also characteristic of mycobacterial Hlp (histone-like protein) for which they have been shown to confer the ability to appose DNA ends. Unexpectedly, removal of the lysine-rich extension enhances DNA-binding affinity, but an interaction between DNA and the PAKKA repeats is indicated by the observation that only full-length Ku forms multiple complexes with a short stem-loop-containing DNA previously designed to accommodate only one Ku dimer. The C-terminal extension promotes DNA end-joining by T4 DNA ligase, suggesting that the PAKKA repeats also contribute to efficient end-joining. We suggest that low-complexity lysine-rich sequences have evolved repeatedly to modulate the function of unrelated DNA-binding proteins.
International Nuclear Information System (INIS)
Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo
2012-01-01
A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution
Energy Technology Data Exchange (ETDEWEB)
Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo [Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)
2012-08-31
A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution.
The protein network surrounding the human telomere repeat binding factors TRF1, TRF2, and POT1.
Directory of Open Access Journals (Sweden)
Richard J Giannone
2010-08-01
Full Text Available Telomere integrity (including telomere length and capping is critical in overall genomic stability. Telomere repeat binding factors and their associated proteins play vital roles in telomere length regulation and end protection. In this study, we explore the protein network surrounding telomere repeat binding factors, TRF1, TRF2, and POT1 using dual-tag affinity purification in combination with multidimensional protein identification technology liquid chromatography--tandem mass spectrometry (MudPIT LC-MS/MS. After control subtraction and data filtering, we found that TRF2 and POT1 co-purified all six members of the telomere protein complex, while TRF1 identified five of six components at frequencies that lend evidence towards the currently accepted telomere architecture. Many of the known TRF1 or TRF2 interacting proteins were also identified. Moreover, putative associating partners identified for each of the three core components fell into functional categories such as DNA damage repair, ubiquitination, chromosome cohesion, chromatin modification/remodeling, DNA replication, cell cycle and transcription regulation, nucleotide metabolism, RNA processing, and nuclear transport. These putative protein-protein associations may participate in different biological processes at telomeres or, intriguingly, outside telomeres.
FR-like EBNA1 binding repeats in the human genome
International Nuclear Information System (INIS)
D'Herouel, Aymeric Fouquier; Birgersdotter, Anna; Werner, Maria
2010-01-01
Epstein-Barr virus (EBV) is widely spread in the human population. EBV nuclear antigen 1 (EBNA1) is a transcription factor that activates viral genes and is necessary for viral replication and partitioning, which binds the EBV genome cooperatively. We identify similar EBNA1 repeat binding sites in the human genome using a nearest-neighbor positional weight matrix. Previously experimentally verified EBNA1 sites in the human genome are successfully recovered by our approach. Most importantly, 40 novel regions are identified in the human genome, constituted of tandemly repeated binding sites for EBNA1. Genes located in the vicinity of these regions are presented as possible targets for EBNA1-mediated regulation. Among these, four are discussed in more detail: IQCB1, IMPG1, IRF2BP2 and TPO. Incorporating the cooperative actions of EBNA1 is essential when identifying regulatory regions in the human genome and we believe the findings presented here are highly valuable for the understanding of EBV-induced phenotypic changes.
International Nuclear Information System (INIS)
Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.
1988-01-01
A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors
DEFF Research Database (Denmark)
Peng, Xu; Brügger, Kim; Shen, Biao
2003-01-01
terminally modified and corresponds to SSO454, an open reading frame of previously unassigned function. It binds specifically to DNA fragments carrying double and single repeat sequences, binding on one side of the repeat structure, and producing an opening of the opposite side of the DNA structure. It also...... recognizes both main families of repeat sequences in S. solfataricus. The recombinant protein, expressed in Escherichia coli, showed the same binding properties to the SRSR repeat as the native one. The SSO454 protein exhibits a tripartite internal repeat structure which yields a good sequence match...... with a helix-turn-helix DNA-binding motif. Although this putative motif is shared by other archaeal proteins, orthologs of SSO454 were only detected in species within the Sulfolobus genus and in the closely related Acidianus genus. We infer that the genus-specific protein induces an opening of the structure...
Casas-Vila, Núria; Scheibe, Marion; Freiwald, Anja; Kappei, Dennis; Butter, Falk
2015-11-17
To date, telomere research in fungi has mainly focused on Saccharomyces cerevisiae and Schizosaccharomyces pombe, despite the fact that both yeasts have degenerated telomeric repeats in contrast to the canonical TTAGGG motif found in vertebrates and also several other fungi. Using label-free quantitative proteomics, we here investigate the telosome of Neurospora crassa, a fungus with canonical telomeric repeats. We show that at least six of the candidates detected in our screen are direct TTAGGG-repeat binding proteins. While three of the direct interactors (NCU03416 [ncTbf1], NCU01991 [ncTbf2] and NCU02182 [ncTay1]) feature the known myb/homeobox DNA interaction domain also found in the vertebrate telomeric factors, we additionally show that a zinc-finger protein (NCU07846) and two proteins without any annotated DNA-binding domain (NCU02644 and NCU05718) are also direct double-strand TTAGGG binders. We further find two single-strand binders (NCU02404 [ncGbp2] and NCU07735 [ncTcg1]). By quantitative label-free interactomics we identify TTAGGG-binding proteins in Neurospora crassa, suggesting candidates for telomeric factors that are supported by phylogenomic comparison with yeast species. Intriguingly, homologs in yeast species with degenerated telomeric repeats are also TTAGGG-binding proteins, e.g. in S. cerevisiae Tbf1 recognizes the TTAGGG motif found in its subtelomeres. However, there is also a subset of proteins that is not conserved. While a rudimentary core TTAGGG-recognition machinery may be conserved across yeast species, our data suggests Neurospora as an emerging model organism with unique features.
Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters
International Nuclear Information System (INIS)
Singh, S.; Yamashita, A.; Gouaux, E.
2007-01-01
Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational
Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters
Energy Technology Data Exchange (ETDEWEB)
Singh,S.; Yamashita, A.; Gouaux, E.
2007-01-01
Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the
Inoue, D; Santiago, P; Horne, W C; Baron, R
1997-10-03
Transgenic mice expressing human T cell leukemia virus type I (HTLV-I)-tax under the control of HTLV-I-long terminal repeat (LTR) promoter develop skeletal abnormalities with high bone turnover and myelofibrosis. In these animals, Tax is highly expressed in bone with a pattern of expression restricted to osteoclasts and spindle-shaped cells within the endosteal myelofibrosis. To test the hypothesis that lineage-specific transcription factors promote transgene expression from the HTLV-I-LTR in osteoclasts, we first examined tax expression in transgenic bone marrow cultures. Expression was dependent on 1alpha,25-dihydroxycholecalciferol and coincided with tartrate-resistant acid phosphatase (TRAP) expression, a marker of osteoclast differentiation. Furthermore, Tax was expressed in vitronectin receptor-positive mononuclear precursors as well as in mature osteoclast-like cells (OCLs). Consistent with our hypothesis, electrophoretic mobility shift assays revealed the presence of an OCL nuclear factor (NFOC-1) that binds to the LTR 21-base pair direct repeat, a region critical for the promoter activity. This binding is further enhanced by Tax. Since NFOC-1 is absent in macrophages and conserved in osteoclasts among species including human, such a factor may play a role in lineage determination and/or in expression of the differentiated osteoclast phenotype.
International Nuclear Information System (INIS)
Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir; Mayer, Claudine
2005-01-01
The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02 Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry
de Lange, Orlando; Wolf, Christina; Dietze, Jörn; Elsaesser, Janett; Morbitzer, Robert; Lahaye, Thomas
2014-06-01
The tandem repeats of transcription activator like effectors (TALEs) mediate sequence-specific DNA binding using a simple code. Naturally, TALEs are injected by Xanthomonas bacteria into plant cells to manipulate the host transcriptome. In the laboratory TALE DNA binding domains are reprogrammed and used to target a fused functional domain to a genomic locus of choice. Research into the natural diversity of TALE-like proteins may provide resources for the further improvement of current TALE technology. Here we describe TALE-like proteins from the endosymbiotic bacterium Burkholderia rhizoxinica, termed Bat proteins. Bat repeat domains mediate sequence-specific DNA binding with the same code as TALEs, despite less than 40% sequence identity. We show that Bat proteins can be adapted for use as transcription factors and nucleases and that sequence preferences can be reprogrammed. Unlike TALEs, the core repeats of each Bat protein are highly polymorphic. This feature allowed us to explore alternative strategies for the design of custom Bat repeat arrays, providing novel insights into the functional relevance of non-RVD residues. The Bat proteins offer fertile grounds for research into the creation of improved programmable DNA-binding proteins and comparative insights into TALE-like evolution. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Juan eLi
2015-11-01
Full Text Available Nitrogen recycling and redistribution are important for the environmental stress response of plants. In non nitrogen-fixing plants, ureide metabolism is crucial to nitrogen recycling from organic sources. Various studies have suggested that the rate-limiting components of ureide metabolism respond to environmental stresses. However, the underlying regulation mechanism is not well understood. In this report, rice ureidoglycolate amidohydrolase (OsUAH, which is a recently identified enzyme catalyzing the final step of ureide degradation, was identified as low-temperature- (LT but not abscisic acid- (ABA regulated. To elucidate the LT regulatory mechanism at the transcriptional level, we isolated and characterized the promoter region of OsUAH (POsUAH. Series deletions revealed that a minimal region between -522 and -420 relative to the transcriptional start site was sufficient for the cold induction of POsUAH. Detailed analyses of this 103-bp fragment indicated that a C-repeat/dehydration-responsive (CRT/DRE element localized at position -434 was essential for LT-responsive expression. A rice C-repeat-binding factors/DRE-binding proteins 1 (CBFs/DREB1s subfamily member, OsCBF3, was screened to specifically bind to the CRT/DRE element in the minimal region both in yeast one-hybrid assays and in in vitro gel-shift analysis. Moreover, the promoter could be exclusively trans-activated by the interaction between the CRT/DRE element and OsCBF3 in vivo. These findings may help to elucidate the regulation mechanism of stress-responsive ureide metabolism genes and provide an example of the member-specific manipulation of the CBF/DREB1 subfamily.
Solution properties of the archaeal CRISPR DNA repeat-binding homeodomain protein Cbp2
DEFF Research Database (Denmark)
Kenchappa, Chandra; Heiðarsson, Pétur Orri; Kragelund, Birthe
2013-01-01
Clustered regularly interspaced short palindromic repeats (CRISPR) form the basis of diverse adaptive immune systems directed primarily against invading genetic elements of archaea and bacteria. Cbp1 of the crenarchaeal thermoacidophilic order Sulfolobales, carrying three imperfect repeats, binds...... specifically to CRISPR DNA repeats and has been implicated in facilitating production of long transcripts from CRISPR loci. Here, a second related class of CRISPR DNA repeat-binding protein, denoted Cbp2, is characterized that contains two imperfect repeats and is found amongst members of the crenarchaeal...... in facilitating high affinity DNA binding of Cbp2 by tethering the two domains. Structural studies on mutant proteins provide support for Cys(7) and Cys(28) enhancing high thermal stability of Cbp2(Hb) through disulphide bridge formation. Consistent with their proposed CRISPR transcriptional regulatory role, Cbp2...
Alternative Conformations of the Tau Repeat Domain in Complex with an Engineered Binding Protein*
Grüning, Clara S. R.; Mirecka, Ewa A.; Klein, Antonia N.; Mandelkow, Eckhard; Willbold, Dieter; Marino, Stephen F.; Stoldt, Matthias; Hoyer, Wolfgang
2014-01-01
The aggregation of Tau into paired helical filaments is involved in the pathogenesis of several neurodegenerative diseases, including Alzheimer disease. The aggregation reaction is characterized by conformational conversion of the repeat domain, which partially adopts a cross-β-structure in the resulting amyloid-like fibrils. Here, we report the selection and characterization of an engineered binding protein, β-wrapin TP4, targeting the Tau repeat domain. TP4 was obtained by phage display using the four-repeat Tau construct K18ΔK280 as a target. TP4 binds K18ΔK280 as well as the longest isoform of human Tau, hTau40, with nanomolar affinity. NMR spectroscopy identified two alternative TP4-binding sites in the four-repeat domain, with each including two hexapeptide motifs with high β-sheet propensity. Both binding sites contain the aggregation-determining PHF6 hexapeptide within repeat 3. In addition, one binding site includes the PHF6* hexapeptide within repeat 2, whereas the other includes the corresponding hexapeptide Tau(337–342) within repeat 4, denoted PHF6**. Comparison of TP4-binding with Tau aggregation reveals that the same regions of Tau are involved in both processes. TP4 inhibits Tau aggregation at substoichiometric concentration, demonstrating that it interferes with aggregation nucleation. This study provides residue-level insight into the interaction of Tau with an aggregation inhibitor and highlights the structural flexibility of Tau. PMID:24966331
Impact of Alu repeats on the evolution of human p53 binding sites
Directory of Open Access Journals (Sweden)
Sirotin Michael V
2011-01-01
Full Text Available Abstract Background The p53 tumor suppressor protein is involved in a complicated regulatory network, mediating expression of ~1000 human genes. Recent studies have shown that many p53 in vivo binding sites (BSs reside in transposable repeats. The relationship between these BSs and functional p53 response elements (REs remains unknown, however. We sought to understand whether the p53 REs also reside in transposable elements and particularly in the most-abundant Alu repeats. Results We have analyzed ~160 functional p53 REs identified so far and found that 24 of them occur in repeats. More than half of these repeat-associated REs reside in Alu elements. In addition, using a position weight matrix approach, we found ~400,000 potential p53 BSs in Alu elements genome-wide. Importantly, these putative BSs are located in the same regions of Alu repeats as the functional p53 REs - namely, in the vicinity of Boxes A/A' and B of the internal RNA polymerase III promoter. Earlier nucleosome-mapping experiments showed that the Boxes A/A' and B have a different chromatin environment, which is critical for the binding of p53 to DNA. Here, we compare the Alu-residing p53 sites with the corresponding Alu consensus sequences and conclude that the p53 sites likely evolved through two different mechanisms - the sites overlapping with the Boxes A/A' were generated by CG → TG mutations; the other sites apparently pre-existed in the progenitors of several Alu subfamilies, such as AluJo and AluSq. The binding affinity of p53 to the Alu-residing sites generally correlates with the age of Alu subfamilies, so that the strongest sites are embedded in the 'relatively young' Alu repeats. Conclusions The primate-specific Alu repeats play an important role in shaping the p53 regulatory network in the context of chromatin. One of the selective factors responsible for the frequent occurrence of Alu repeats in introns may be related to the p53-mediated regulation of Alu
Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee
2013-09-15
Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Lijiang Gu
2013-12-01
Full Text Available C-repeat-binding factors (CBFs are a type of important regulon in stress-related signal transduction pathways that control plant tolerance of abiotic stress. Ammopiptanthus mongolicus is the only evergreen broadleaf shrub in the northwest desert of China. The species shows strong resistance to environmental stress, especially to cold stress. An A. mongolicus CBF1 gene (AmCBF1 was cloned and transformed into tobacco. Expression of AmCBF1 could be detected in A. mongolicus shortly after exposure to low temperature of 4°C. Analysis on ratio of electrolytic leakage, soluble sugar content, free proline content, malondialdehyde (MDA content and peroxidase (POD activity before and after cold treatment (4°C for 24 h indicated AmCBF1 conferred higher cold tolerance to AmCBF1 transgenic tobacco compared with the wild type and empty vector transformed tobacco.
DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats.
de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas
2015-11-16
Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni
2017-08-01
Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.
2013-01-01
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I
2013-03-29
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.
DEFF Research Database (Denmark)
Skjødt, Mikkel-Ole; Palarasah, Yaseelan; Rasmussen, Karina Juhl
2010-01-01
The lectin complement pathway has important functions in vertebrate host defence and accumulating evidence of primordial complement components trace its emergence to invertebrate phyla. We introduce two putative mannose-binding lectin homologues (CioMBLs) from the urochordate species Ciona intest...... protease in the epithelia cells lining the stomach and intestine. In conclusion we present two urochordate MBLs and identify an associated serine protease, which support the concept of an evolutionary ancient origin of the lectin complement pathway....
Solution structure of the twelfth cysteine-rich ligand-binding repeat in rat megalin
International Nuclear Information System (INIS)
Wolf, Christian A.; Dancea, Felician; Shi Meichen; Bade-Noskova, Veronika; Rueterjans, Heinz; Kerjaschki, Dontscho; Luecke, Christian
2007-01-01
Megalin, an approx. 600 kDa transmembrane glycoprotein that acts as multi-ligand transporter, is a member of the low density lipoprotein receptor gene family. Several cysteine-rich repeats, each consisting of about 40 residues, are responsible for the multispecific binding of ligands. The solution structure of the twelfth cysteine-rich ligand-binding repeat with class A motif found in megalin features two short β-strands and two helical turns, yielding the typical fold with a I-III, II-V and IV-VI disulfide bridge connectivity pattern and a calcium coordination site at the C-terminal end. The resulting differences in electrostatic surface potential compared to other ligand-binding modules of this gene family, however, may be responsible for the functional divergence
Energy Technology Data Exchange (ETDEWEB)
Dai, Shuyan; Sun, Cancan; Tan, Kemin; Ye, Sheng; Zhang, Rongguang
2017-09-01
Eukaryotic thrombospondin type 3 repeat (TT3R) is an efficient calcium ion (Ca2+) binding motif only found in mammalian thrombospondin family. TT3R has also been found in prokaryotic cellulase Cel5G, which was thought to forfeit the Ca2+-binding capability due to the formation of intra-repeat disulfide bonds, instead of the inter-repeat ones possessed by eukaryotic TT3Rs. In this study, we have identified an enormous number of prokaryotic TT3R-containing proteins belonging to several different protein families, including outer membrane protein A (OmpA), an important structural protein connecting the outer membrane and the periplasmic peptidoglycan layer in gram-negative bacteria. Here, we report the crystal structure of the periplasmic region of OmpA from Capnocytophaga gingivalis, which contains a linker region comprising five consecutive TT3Rs. The structure of OmpA-TT3R exhibits a well-ordered architecture organized around two tightly-coordinated Ca2+ and confirms the presence of abnormal intra-repeat disulfide bonds. Further mutagenesis studies showed that the Ca2+-binding capability of OmpA-TT3R is indeed dependent on the proper formation of intra-repeat disulfide bonds, which help to fix a conserved glycine residue at its proper position for Ca2+ coordination. Additionally, despite lacking inter repeat disulfide bonds, the interfaces between adjacent OmpA-TT3Rs are enhanced by both hydrophobic and conserved aromatic-proline interactions.
Cloning and characterization of maize ZmSPK1, a homologue to ...
African Journals Online (AJOL)
hope&shola
2006-03-15
Mar 15, 2006 ... homologue to nonfermenting1-related protein kinase2 ... RT-PCR analysis showed that the ZmSPK1 expression was induced by mannitol, salt and ... MAPKKK in which each component is activated by .... It has been one of the main ... Protein kinase ATP-binding region signature is shown in gray box.
Directory of Open Access Journals (Sweden)
Bateman Alex
2009-09-01
Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication
Friedrich, Nikolas; Santos, Joana M; Liu, Yan; Palma, Angelina S; Leon, Ester; Saouros, Savvas; Kiso, Makoto; Blackman, Michael J; Matthews, Stephen; Feizi, Ten; Soldati-Favre, Dominique
2010-01-15
Numerous intracellular pathogens exploit cell surface glycoconjugates for host cell recognition and entry. Unlike bacteria and viruses, Toxoplasma gondii and other parasites of the phylum Apicomplexa actively invade host cells, and this process critically depends on adhesins (microneme proteins) released onto the parasite surface from intracellular organelles called micronemes (MIC). The microneme adhesive repeat (MAR) domain of T. gondii MIC1 (TgMIC1) recognizes sialic acid (Sia), a key determinant on the host cell surface for invasion by this pathogen. By complementation and invasion assays, we demonstrate that TgMIC1 is one important player in Sia-dependent invasion and that another novel Sia-binding lectin, designated TgMIC13, is also involved. Using BLAST searches, we identify a family of MAR-containing proteins in enteroparasitic coccidians, a subclass of apicomplexans, including T. gondii, suggesting that all these parasites exploit sialylated glycoconjugates on host cells as determinants for enteric invasion. Furthermore, this protein family might provide a basis for the broad host cell range observed for coccidians that form tissue cysts during chronic infection. Carbohydrate microarray analyses, corroborated by structural considerations, show that TgMIC13, TgMIC1, and its homologue Neospora caninum MIC1 (NcMIC1) share a preference for alpha2-3- over alpha2-6-linked sialyl-N-acetyllactosamine sequences. However, the three lectins also display differences in binding preferences. Intense binding of TgMIC13 to alpha2-9-linked disialyl sequence reported on embryonal cells and relatively strong binding to 4-O-acetylated-Sia found on gut epithelium and binding of NcMIC1 to 6'sulfo-sialyl Lewis(x) might have implications for tissue tropism.
International Nuclear Information System (INIS)
Takagaki, Yoshio; Manley, J.L.; MacDonald, C.C.; Shenk, T.
1992-01-01
Cleavage stimulation factor is one of the multiple factors required for 3'-end cleavage of mammalian pre-mRNAs. The authors have shown previously that this factor is composed of three subunits with estimated molecular masses of 77, 64, and 50 kDa and that the 64-kDa subunit can be UV-cross linked to RNA in a polyadenylylation signal (AAUAAA)-dependent manner. They have now isolated cDNAs encoding the 64-kDa subunit of human cleavage stimulation factor. The 64-kDa subunit contains a ribonucleoprotein-type RNA binding domain in the N-terminal region and a repeat structure in the C-terminal region in which a pentapeptide sequence (consensus MEARA/G) is repeated 12 times and the formation of a long α-helix stabilized by salt bridges is predicted. An ∼270-amino acid segment surrounding this repeat structure is highly enriched in proline and glycine residues (∼20% for each). When cloned 64-kDa subunit was expressed in Escherichia coli, an N-terminal fragment containing the RNA binding domain bound to RNAs in a polyadenylylation-signal-independent manner, suggesting that the RNA binding domain is directly involved in the binding of the 64-kDa subunit to pre-mRNAs
DEFF Research Database (Denmark)
Madsen, Jens; Tornøe, Ida; Nielsen, Ole
2003-01-01
CRP-ductin is a protein expressed mainly by mucosal epithelial cells in the mouse. Sequence homologies indicate that CRP-ductin is the mouse homologue of human gp-340, a glycoprotein that agglutinates microorganisms and binds the lung mucosal collectin surfactant protein-D (SP-D). Here we report...... that purified CRP-ductin binds human SP-D in a calcium-dependent manner and that the binding is not inhibited by maltose. The same properties have previously been observed for gp-340 binding of SP-D. CRP-ductin also showed calcium-dependent binding to both gram-positive and -negative bacteria. A polyclonal...... antibody raised against gp-340 reacted specifically with CRP-ductin in Western blots. Immunoreactivity to CRP-ductin was found in the exocrine pancreas, in epithelial cells throughout the gastrointestinal tract and in the parotid ducts. A panel of RNA preparations from mouse tissues was screened for CRP...
Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.
2016-01-01
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946
Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J
2016-01-15
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Directory of Open Access Journals (Sweden)
Youn-Bok Lee
2013-12-01
Full Text Available The GGGGCC (G4C2 intronic repeat expansion within C9ORF72 is the most common genetic cause of amyotrophic lateral sclerosis (ALS and frontotemporal dementia (FTD. Intranuclear neuronal RNA foci have been observed in ALS and FTD tissues, suggesting that G4C2 RNA may be toxic. Here, we demonstrate that the expression of 38× and 72× G4C2 repeats form intranuclear RNA foci that initiate apoptotic cell death in neuronal cell lines and zebrafish embryos. The foci colocalize with a subset of RNA binding proteins, including SF2, SC35, and hnRNP-H in transfected cells. Only hnRNP-H binds directly to G4C2 repeats following RNA immunoprecipitation, and only hnRNP-H colocalizes with 70% of G4C2 RNA foci detected in C9ORF72 mutant ALS and FTD brain tissues. We show that expanded G4C2 repeats are potently neurotoxic and bind hnRNP-H and other RNA binding proteins. We propose that RNA toxicity and protein sequestration may disrupt RNA processing and contribute to neurodegeneration.
Modulation of CRISPR locus transcription by the repeat-binding protein Cbp1 in Sulfolobus
DEFF Research Database (Denmark)
Deng, Ling; Kenchappa, Chandra Shekar; Peng, Xu
2012-01-01
CRISPR loci are essential components of the adaptive immune system of archaea and bacteria. They consist of long arrays of repeats separated by DNA spacers encoding guide RNAs (crRNA), which target foreign genetic elements. Cbp1 (CRISPR DNA repeat binding protein) binds specifically to the multiple...... direct repeats of CRISPR loci of members of the acidothermophilic, crenarchaeal order Sulfolobales. cbp1 gene deletion from Sulfolobus islandicus REY15A produced a strong reduction in pre-crRNA yields from CRISPR loci but did not inhibit the foreign DNA targeting capacity of the CRISPR/Cas system....... Conversely, overexpression of Cbp1 in S. islandicus generated an increase in pre-crRNA yields while the level of reverse strand transcripts from CRISPR loci remained unchanged. It is proposed that Cbp1 modulates production of longer pre-crRNA transcripts from CRISPR loci. A possible mechanism...
C-repeat/dehydration-responsive element binding proteins are transcription factors that play a critical role in plant response to temperature stress. Over-expression of CBF/DREB genes has been demonstrated to enhance temperature stress tolerance. A series of physiological and biochemical modificat...
A chemokine-binding domain in the tumor necrosis factor receptor from variola (smallpox) virus.
Alejo, Alí; Ruiz-Argüello, M Begoña; Ho, Yin; Smith, Vincent P; Saraiva, Margarida; Alcami, Antonio
2006-04-11
Variola virus (VaV) is the causative agent of smallpox, one of the most devastating diseases encountered by man, that was eradicated in 1980. The deliberate release of VaV would have catastrophic consequences on global public health. However, the mechanisms that contribute to smallpox pathogenesis are poorly understood at the molecular level. The ability of viruses to evade the host defense mechanisms is an important determinant of viral pathogenesis. Here we show that the tumor necrosis factor receptor (TNFR) homologue CrmB encoded by VaV functions not only as a soluble decoy TNFR but also as a highly specific binding protein for several chemokines that mediate recruitment of immune cells to mucosal surfaces and the skin, sites of virus entry and viral replication at late stages of smallpox. CrmB binds chemokines through its C-terminal domain, which is unrelated to TNFRs, was named smallpox virus-encoded chemokine receptor (SECRET) domain and uncovers a family of poxvirus chemokine inhibitors. An active SECRET domain was found in another viral TNFR (CrmD) and three secreted proteins encoded by orthopoxviruses. These findings identify a previously undescribed chemokine-binding and inhibitory domain unrelated to host chemokine receptors and a mechanism of immune modulation in VaV that may influence smallpox pathogenesis.
A chemokine-binding domain in the tumor necrosis factor receptor from variola (smallpox) virus
Alejo, Alí; Ruiz-Argüello, M. Begoña; Ho, Yin; Smith, Vincent P.; Saraiva, Margarida; Alcami, Antonio
2006-01-01
Variola virus (VaV) is the causative agent of smallpox, one of the most devastating diseases encountered by man, that was eradicated in 1980. The deliberate release of VaV would have catastrophic consequences on global public health. However, the mechanisms that contribute to smallpox pathogenesis are poorly understood at the molecular level. The ability of viruses to evade the host defense mechanisms is an important determinant of viral pathogenesis. Here we show that the tumor necrosis factor receptor (TNFR) homologue CrmB encoded by VaV functions not only as a soluble decoy TNFR but also as a highly specific binding protein for several chemokines that mediate recruitment of immune cells to mucosal surfaces and the skin, sites of virus entry and viral replication at late stages of smallpox. CrmB binds chemokines through its C-terminal domain, which is unrelated to TNFRs, was named smallpox virus-encoded chemokine receptor (SECRET) domain and uncovers a family of poxvirus chemokine inhibitors. An active SECRET domain was found in another viral TNFR (CrmD) and three secreted proteins encoded by orthopoxviruses. These findings identify a previously undescribed chemokine-binding and inhibitory domain unrelated to host chemokine receptors and a mechanism of immune modulation in VaV that may influence smallpox pathogenesis. PMID:16581912
TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.
Directory of Open Access Journals (Sweden)
Shuai Wang
Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.
Mycobacterium smegmatis Ku binds DNA without free ends.
Kushwaha, Ambuj K; Grove, Anne
2013-12-01
Ku is central to the non-homologous end-joining pathway of double-strand-break repair in all three major domains of life, with eukaryotic homologues being associated with more diversified roles compared with prokaryotic and archaeal homologues. Ku has a conserved central 'ring-shaped' core domain. While prokaryotic homologues lack the N- and C-terminal domains that impart functional diversity to eukaryotic Ku, analyses of Ku from certain prokaryotes such as Pseudomonas aeruginosa and Mycobacterium smegmatis have revealed the presence of distinct C-terminal extensions that modulate DNA-binding properties. We report in the present paper that the lysine-rich C-terminal extension of M. smegmatis Ku contacts the core protein domain as evidenced by an increase in DNA-binding affinity and a decrease in thermal stability and intrinsic tryptophan fluorescence upon its deletion. Ku deleted for this C-terminus requires free DNA ends for binding, but translocates to internal DNA sites. In contrast, full-length Ku can directly bind DNA without free ends, suggesting that this property is conferred by its C-terminus. Such binding to internal DNA sites may facilitate recruitment to sites of DNA damage. The results of the present study also suggest that extensions beyond the shared core domain may have independently evolved to expand Ku function.
Ben-Simhon, Zohar; Judeinstein, Sylvie; Nadler-Hassar, Talia; Trainin, Taly; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron
2011-11-01
Anthocyanins are the major pigments responsible for the pomegranate (Punica granatum L.) fruit skin color. The high variability in fruit external color in pomegranate cultivars reflects variations in anthocyanin composition. To identify genes involved in the regulation of anthocyanin biosynthesis pathway in the pomegranate fruit skin we have isolated, expressed and characterized the pomegranate homologue of the Arabidopsis thaliana TRANSPARENT TESTA GLABRA1 (TTG1), encoding a WD40-repeat protein. The TTG1 protein is a regulator of anthocyanins and proanthocyanidins (PAs) biosynthesis in Arabidopsis, and acts by the formation of a transcriptional regulatory complex with two other regulatory proteins: bHLH and MYB. Our results reveal that the pomegranate gene, designated PgWD40, recovered the anthocyanin, PAs, trichome and seed coat mucilage phenotype in Arabidopsis ttg1 mutant. PgWD40 expression and anthocyanin composition in the skin were analyzed during pomegranate fruit development, in two accessions that differ in skin color intensity and timing of appearance. The results indicate high positive correlation between the total cyanidin derivatives quantity (red pigments) and the expression level of PgWD40. Furthermore, strong correlation was found between the steady state levels of PgWD40 transcripts and the transcripts of pomegranate homologues of the structural genes PgDFR and PgLDOX. PgWD40, PgDFR and PgLDOX expression also correlated with the expression of pomegranate homologues of the regulatory genes PgAn1 (bHLH) and PgAn2 (MYB). On the basis of our results we propose that PgWD40 is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development and that expression of PgWD40, PgAn1 and PgAn2 in the pomegranate fruit skin is required to regulate the expression of downstream structural genes involved in the anthocyanin biosynthesis.
Jaendling, Alessa; Ramayah, Soshila; Pryce, David W; McFarlane, Ramsay J
2008-02-01
Translin is a conserved protein which associates with the breakpoint junctions of chromosomal translocations linked with the development of some human cancers. It binds to both DNA and RNA and has been implicated in mRNA metabolism and regulation of genome stability. It has a binding partner, translin-associated protein X (TRAX), levels of which are regulated by the translin protein in higher eukaryotes. In this study we find that this regulatory function is conserved in the lower eukaryotes, suggesting that translin and TRAX have important functions which provide a selective advantage to both unicellular and multi-cellular eukaryotes, indicating that this function may not be tissue-specific in nature. However, to date, the biological importance of translin and TRAX remains unclear. Here we systematically investigate proposals that suggest translin and TRAX play roles in controlling mitotic cell proliferation, DNA damage responses, genome stability, meiotic/mitotic recombination and stability of GT-rich repeat sequences. We find no evidence for translin and/or TRAX primary function in these pathways, indicating that the conserved biochemical function of translin is not implicated in primary pathways for regulating genome stability and/or segregation.
Isolation and characterization of an AGAMOUS homologue from cocoa
Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.
2006-01-01
We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that
Directory of Open Access Journals (Sweden)
Boian S Alexandrov
Full Text Available Trinucleotide repeats sequences (TRS represent a common type of genomic DNA motif whose expansion is associated with a large number of human diseases. The driving molecular mechanisms of the TRS ongoing dynamic expansion across generations and within tissues and its influence on genomic DNA functions are not well understood. Here we report results for a novel and notable collective breathing behavior of genomic DNA of tandem TRS, leading to propensity for large local DNA transient openings at physiological temperature. Our Langevin molecular dynamics (LMD and Markov Chain Monte Carlo (MCMC simulations demonstrate that the patterns of openings of various TRSs depend specifically on their length. The collective propensity for DNA strand separation of repeated sequences serves as a precursor for outsized intermediate bubble states independently of the G/C-content. We report that repeats have the potential to interfere with the binding of transcription factors to their consensus sequence by altered DNA breathing dynamics in proximity of the binding sites. These observations might influence ongoing attempts to use LMD and MCMC simulations for TRS-related modeling of genomic DNA functionality in elucidating the common denominators of the dynamic TRS expansion mutation with potential therapeutic applications.
Crystal structure of a bacterial homologue of the bile acid sodium symporter ASBT
Hu, Nien-Jen; Iwata, So; Cameron, Alexander D.; Drew, David
2011-01-01
High cholesterol levels greatly increase the risk of cardiovascular disease. By its conversion into bile acids, about 50% of cholesterol is eliminated from the body. However bile acids released from the bile duct are constantly recycled, being reabsorbed in the intestine via the Apical Sodium dependent Bile acid Transporter (ASBT). It has been shown in animal models that plasma cholesterol levels are significantly lowered by specific inhibitors of ASBT1,2, thus ASBT is a target for hypercholesterolemia drugs. Here, we describe the crystal structure of a bacterial homologue of ASBT from Neisseria meningitidis (ASBTNM) at 2.2Å. ASBTNM contains two inverted structural repeats of five transmembrane helices. A Core domain of six helices harbours two sodium ions while the remaining helices form a Panel-like domain. Overall the architecture of the protein is remarkably similar to the sodium-proton antiporter NhaA3 despite no detectable sequence homology. A bile acid molecule is situated between the Core and Panel domains in a large hydrophobic cavity. Residues near to this cavity have been shown to affect the binding of specific inhibitors of human ASBT4. The position of the bile acid together with the molecular architecture suggests the rudiments of a possible transport mechanism. PMID:21976025
Directory of Open Access Journals (Sweden)
Aixin Li
2017-09-01
Full Text Available C-repeat binding factors (CBF are a subfamily of AP2 transcription factors that play critical roles in the regulation of plant cold tolerance and growth in low temperature. In the present work, we sought to perform a detailed investigation into global transcriptional regulation of plant hormone signaling associated genes in transgenic plants engineered with CBF genes. RNA samples from Arabidopsis thaliana plants overexpressing two CBF genes, CBF2 and CBF3, were subjected to Illumina HiSeq 2000 RNA sequencing (RNA-Seq. Our results showed that more than half of the hormone associated genes that were differentially expressed in CBF2 or CBF3 transgenic plants were related to auxin signal transduction and metabolism. Most of these alterations in gene expression could lead to repression of auxin signaling. Accordingly, the IAA content was significantly decreased in young tissues of plants overexpressing CBF2 and CBF3 compared with wild type. In addition, genes associated with the biosynthesis of Jasmonate (JA and Salicylic acid (SA, as well as the signal sensing of Brassinolide (BR and SA, were down-regulated, while genes associated with Gibberellin (GA deactivation were up-regulated. In general, overexpression of CBF2 and CBF3 negatively affects multiple plant hormone signaling pathways in Arabidopsis. The transcriptome analysis using CBF2 and CBF3 transgenic plants provides novel and integrated insights into the interaction between CBFs and plant hormones, particularly the modulation of auxin signaling, which may contribute to the improvement of crop yields under abiotic stress via molecular engineering using CBF genes.
Barreales, Eva G; Vicente, Cláudia M; de Pedro, Antonio; Santos-Aberturas, Javier; Aparicio, Jesús F
2018-05-15
The biosynthesis of small-size polyene macrolides is ultimately controlled by a couple of transcriptional regulators that act in a hierarchical way. A Streptomyces antibiotic regulatory protein-large ATP-binding regulator of the LuxR family (SARP-LAL) regulator binds the promoter of a PAS-LuxR regulator-encoding gene and activates its transcription, and in turn, the gene product of the latter activates transcription from various promoters of the polyene gene cluster directly. The primary operator of PimR, the archetype of SARP-LAL regulators, contains three heptameric direct repeats separated by four-nucleotide spacers, but the regulator can also bind a secondary operator with only two direct repeats separated by a 3-nucleotide spacer, both located in the promoter region of its unique target gene, pimM A similar arrangement of operators has been identified for PimR counterparts encoded by gene clusters for different antifungal secondary metabolites, including not only polyene macrolides but peptidyl nucleosides, phoslactomycins, or cycloheximide. Here, we used promoter engineering and quantitative transcriptional analyses to determine the contributions of the different heptameric repeats to transcriptional activation and final polyene production. Optimized promoters have thus been developed. Deletion studies and electrophoretic mobility assays were used for the definition of DNA-binding boxes formed by 22-nucleotide sequences comprising two conserved heptameric direct repeats separated by four-nucleotide less conserved spacers. The cooperative binding of PimR SARP appears to be the mechanism involved in the binding of regulator monomers to operators, and at least two protein monomers are required for efficient binding. IMPORTANCE Here, we have shown that a modulation of the production of the antifungal pimaricin in Streptomyces natalensis can be accomplished via promoter engineering of the PAS-LuxR transcriptional activator pimM The expression of this gene is
An, Dong; Ma, Qiuxiang; Wang, Hongxia; Yang, Jun; Zhou, Wenzhi; Zhang, Peng
2017-05-01
Cassava MeCBF1 is a typical CBF transcription factor mediating cold responses but its low expression in apical buds along with a retarded response cause inefficient upregulation of downstream cold-related genes, rendering cassava chilling-sensitive. Low temperature is a major abiotic stress factor affecting survival, productivity and geographic distribution of important crops worldwide. The C-repeat/dehydration-responsive element binding transcription factors (CBF/DREB) are important regulators of abiotic stress response in plants. In this study, MeCBF1, a CBF-like gene, was identified in the tropical root crop cassava (Manihot esculenta Crantz). The MeCBF1 encodes a protein that shares strong homology with DREB1As/CBFs from Arabidopsis as well as other species. The MeCBF1 was localized to the nucleus and is mainly expressed in stem and mature leaves, but not in apical buds or stem cambium. MeCBF1 expression was not only highly responsive to cold, but also significantly induced by salt, PEG and ABA treatment. Several stress-associated cis-elements were found in its promoter region, e.g., ABRE-related, MYC recognition sites, and MYB responsive element. Compared with AtCBF1, the MeCBF1 expression induced by cold in cassava was retarded and upregulated only after 4 h, which was also confirmed by its promoter activity. Overexpression of MeCBF1 in transgenic Arabidopsis and cassava plants conferred enhanced crytolerance. The CBF regulon was smaller and not entirely co-regulated with MeCBF1 expression in overexpressed cassava. The retarded MeCBF1 expression in response to cold and attenuated CBF-regulon might lead cassava to chilling sensitivity.
Gangloff, Y G; Pointud, J C; Thuault, S; Carré, L; Romier, C; Muratoglu, S; Brand, M; Tora, L; Couderc, J L; Davidson, I
2001-08-01
The RNA polymerase II transcription factor TFIID comprises the TATA binding protein (TBP) and a set of TBP-associated factors (TAF(II)s). TFIID has been extensively characterized for yeast, Drosophila, and humans, demonstrating a high degree of conservation of both the amino acid sequences of the constituent TAF(II)s and overall molecular organization. In recent years, it has been assumed that all the metazoan TAF(II)s have been identified, yet no metazoan homologues of yeast TAF(II)47 (yTAF(II)47) and yTAF(II)65 are known. Both of these yTAF(II)s contain a histone fold domain (HFD) which selectively heterodimerizes with that of yTAF(II)25. We have cloned a novel mouse protein, TAF(II)140, containing an HFD and a plant homeodomain (PHD) finger, which we demonstrated by immunoprecipitation to be a mammalian TFIID component. TAF(II)140 shows extensive sequence similarity to Drosophila BIP2 (dBIP2) (dTAF(II)155), which we also show to be a component of Drosophila TFIID. These proteins are metazoan homologues of yTAF(II)47 as their HFDs selectively heterodimerize with dTAF(II)24 and human TAF(II)30, metazoan homologues of yTAF(II)25. We further show that yTAF(II)65 shares two domains with the Drosophila Prodos protein, a recently described potential dTAF(II). These conserved domains are critical for yTAF(II)65 function in vivo. Our results therefore identify metazoan homologues of yTAF(II)47 and yTAF(II)65.
Pazman, C; Mayes, C A; Fanto, M; Haynes, S R; Mlodzik, M
2000-04-01
The small GTPase Ras plays an important role in many cellular signaling processes. Ras activity is negatively regulated by GTPase activating proteins (GAPs). It has been proposed that RasGAP may also function as an effector of Ras activity. We have identified and characterized the Drosophila homologue of the RasGAP-binding protein G3BP encoded by rasputin (rin). rin mutants are viable and display defects in photoreceptor recruitment and ommatidial polarity in the eye. Mutations in rin/G3BP genetically interact with components of the Ras signaling pathway that function at the level of Ras and above, but not with Raf/MAPK pathway components. These interactions suggest that Rin is required as an effector in Ras signaling during eye development, supporting an effector role for RasGAP. The ommatidial polarity phenotypes of rin are similar to those of RhoA and the polarity genes, e.g. fz and dsh. Although rin/G3BP interacts genetically with RhoA, affecting both photoreceptor differentiation and polarity, it does not interact with the gain-of-function genotypes of fz and dsh. These data suggest that Rin is not a general component of polarity generation, but serves a function specific to Ras and RhoA signaling pathways.
Adaptive evolution of transcription factor binding sites
Directory of Open Access Journals (Sweden)
Berg Johannes
2004-10-01
Full Text Available Abstract Background The regulation of a gene depends on the binding of transcription factors to specific sites located in the regulatory region of the gene. The generation of these binding sites and of cooperativity between them are essential building blocks in the evolution of complex regulatory networks. We study a theoretical model for the sequence evolution of binding sites by point mutations. The approach is based on biophysical models for the binding of transcription factors to DNA. Hence we derive empirically grounded fitness landscapes, which enter a population genetics model including mutations, genetic drift, and selection. Results We show that the selection for factor binding generically leads to specific correlations between nucleotide frequencies at different positions of a binding site. We demonstrate the possibility of rapid adaptive evolution generating a new binding site for a given transcription factor by point mutations. The evolutionary time required is estimated in terms of the neutral (background mutation rate, the selection coefficient, and the effective population size. Conclusions The efficiency of binding site formation is seen to depend on two joint conditions: the binding site motif must be short enough and the promoter region must be long enough. These constraints on promoter architecture are indeed seen in eukaryotic systems. Furthermore, we analyse the adaptive evolution of genetic switches and of signal integration through binding cooperativity between different sites. Experimental tests of this picture involving the statistics of polymorphisms and phylogenies of sites are discussed.
StaRProtein, A Web Server for Prediction of the Stability of Repeat Proteins
Xu, Yongtao; Zhou, Xu; Huang, Meilan
2015-01-01
Repeat proteins have become increasingly important due to their capability to bind to almost any proteins and the potential as alternative therapy to monoclonal antibodies. In the past decade repeat proteins have been designed to mediate specific protein-protein interactions. The tetratricopeptide and ankyrin repeat proteins are two classes of helical repeat proteins that form different binding pockets to accommodate various partners. It is important to understand the factors that define folding and stability of repeat proteins in order to prioritize the most stable designed repeat proteins to further explore their potential binding affinities. Here we developed distance-dependant statistical potentials using two classes of alpha-helical repeat proteins, tetratricopeptide and ankyrin repeat proteins respectively, and evaluated their efficiency in predicting the stability of repeat proteins. We demonstrated that the repeat-specific statistical potentials based on these two classes of repeat proteins showed paramount accuracy compared with non-specific statistical potentials in: 1) discriminate correct vs. incorrect models 2) rank the stability of designed repeat proteins. In particular, the statistical scores correlate closely with the equilibrium unfolding free energies of repeat proteins and therefore would serve as a novel tool in quickly prioritizing the designed repeat proteins with high stability. StaRProtein web server was developed for predicting the stability of repeat proteins. PMID:25807112
LENUS (Irish Health Repository)
Murphy, Derek M
2009-01-01
BACKGROUND: Neuroblastoma, a cancer derived from precursor cells of the sympathetic nervous system, is a major cause of childhood cancer related deaths. The single most important prognostic indicator of poor clinical outcome in this disease is genomic amplification of MYCN, a member of a family of oncogenic transcription factors. METHODOLOGY: We applied MYCN chromatin immunoprecipitation to microarrays (ChIP-chip) using MYCN amplified\\/non-amplified cell lines as well as a conditional knockdown cell line to determine the distribution of MYCN binding sites within all annotated promoter regions. CONCLUSION: Assessment of E-box usage within consistently positive MYCN binding sites revealed a predominance for the CATGTG motif (p<0.0016), with significant enrichment of additional motifs CATTTG, CATCTG, CAACTG in the MYCN amplified state. For cell lines over-expressing MYCN, gene ontology analysis revealed enrichment for the binding of MYCN at promoter regions of numerous molecular functional groups including DNA helicases and mRNA transcriptional regulation. In order to evaluate MYCN binding with respect to other genomic features, we determined the methylation status of all annotated CpG islands and promoter sequences using methylated DNA immunoprecipitation (MeDIP). The integration of MYCN ChIP-chip and MeDIP data revealed a highly significant positive correlation between MYCN binding and DNA hypermethylation. This association was also detected in regions of hemizygous loss, indicating that the observed association occurs on the same homologue. In summary, these findings suggest that MYCN binding occurs more commonly at CATGTG as opposed to the classic CACGTG E-box motif, and that disease associated over expression of MYCN leads to aberrant binding to additional weaker affinity E-box motifs in neuroblastoma. The co-localization of MYCN binding and DNA hypermethylation further supports the dual role of MYCN, namely that of a classical transcription factor affecting the
Itoh, Aiko; Nonaka, Yasuhiro; Ogawa, Takashi; Nakamura, Takanori; Nishi, Nozomu
2017-11-01
We previously reported that galectin-9 (Gal-9), an immunomodulatory animal lectin, could bind to insoluble collagen preparations and exerted direct cytocidal effects on immune cells. In the present study, we found that mature insoluble elastin is capable of binding Gal-9 and other members of the human galectin family. Lectin blot analysis of a series of commercial water-soluble elastin preparations, PES-(A) ~ PES-(E), revealed that only PES-(E) contained substances recognized by Gal-9. Gal-9-interacting substances in PES-(E) were affinity-purified, digested with trypsin and then analyzed by reversed-phase HPLC. Peptide fragments derived from five members of the small leucine-rich repeat proteoglycan family, versican, lumican, osteoglycin/mimecan, prolargin, and fibromodulin, were identified by N-terminal amino acid sequence analysis. The results indicate that Gal-9 and possibly other galectins recognize glycans attached to small leucine-rich repeat proteoglycans associated with insoluble elastin and also indicate the possibility that mature insoluble elastin serves as an extracellular reservoir for galectins.
Directory of Open Access Journals (Sweden)
Henrik Gross
Full Text Available The Epstein-Barr Virus (EBV -encoded EBNA2 protein, which is essential for the in vitro transformation of B-lymphocytes, interferes with cellular processes by binding to proteins via conserved sequence motifs. Its Arginine-Glycine (RG repeat element contains either symmetrically or asymmetrically di-methylated arginine residues (SDMA and ADMA, respectively. EBNA2 binds via its SDMA-modified RG-repeat to the survival motor neurons protein (SMN and via the ADMA-RG-repeat to the NP9 protein of the human endogenous retrovirus K (HERV-K (HML-2 Type 1. The hypothesis of this work was that the methylated RG-repeat mimics an epitope shared with cellular proteins that is used for interaction with target structures. With monoclonal antibodies against the modified RG-repeat, we indeed identified cellular homologues that apparently have the same surface structure as methylated EBNA2. With the SDMA-specific antibodies, we precipitated the Sm protein D3 (SmD3 which, like EBNA2, binds via its SDMA-modified RG-repeat to SMN. With the ADMA-specific antibodies, we precipitated the heterogeneous ribonucleoprotein K (hnRNP K. Specific binding of the ADMA- antibody to hnRNP K was demonstrated using E. coli expressed/ADMA-methylated hnRNP K. In addition, we show that EBNA2 and hnRNP K form a complex in EBV- infected B-cells. Finally, hnRNP K, when co-expressed with EBNA2, strongly enhances viral latent membrane protein 2A (LMP2A expression by an unknown mechanism as we did not detect a direct association of hnRNP K with DNA-bound EBNA2 in gel shift experiments. Our data support the notion that the methylated surface of EBNA2 mimics the surface structure of cellular proteins to interfere with or co-opt their functional properties.
Novel Drosophila receptor that binds multiple growth factors
International Nuclear Information System (INIS)
Rosner, M.R.; Thompson, K.L.; Garcia, V.; Decker, S.J.
1986-01-01
The authors have recently reported the identification of a novel growth factor receptor from Drosophila cell cultures that has dual binding specificity for both insulin and epidermal growth factor (EGF). This 100 kDa protein is also antigenically related to the cytoplasmic region of the mammalian EGF receptor-tyrosine kinase. They now report that this protein binds to mammalian nerve growth factor and human transforming growth factor alpha as well as insulin and EGF with apparent dissociation constants ranging from 10 -6 to 10 -8 M. The 100 kDa protein can be affinity-labeled with these 125 I-labeled growth factors after immunoprecipitation with anti-EGF receptor antiserum. These four growth factors appear to share a common binding site, as evidenced by their ability to block affinity labelling by 125 I-insulin. No significant binding to the 100 kDa protein was observed with platelet-derived growth factor, transforming growth factor beta, or glucagon. The 100 kDa Drosophila protein has a unique ligand-binding spectrum with no direct counterpart in mammalian cells and may represent an evolutionary precursor of the mammalian receptors for these growth factors
Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved
Directory of Open Access Journals (Sweden)
Manasi S. Apte
2012-01-01
Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.
International Nuclear Information System (INIS)
Leitersdorf, E.; Hobbs, H.H.; Fourie, A.M.; Jacobs, M.; Van Der Westhuyzen, D.R.; Coetzee, G.A.
1988-01-01
The ligand-binding domain of the low density lipoprotein (LDL) receptor is composed of seven cysteine-rich repeats, each ∼ 40 amino acids long. Previous studies showed that if the first repeat of the ligand-binding domain (encoded by exon 2) is deleted, the receptor fails to bind an anti-LDL receptor monoclonal antibody (IgG-C7) but continues to bind LDL with high affinity. Cultured fibroblasts from a Black South African Xhosa patient (TT) with the clinical syndrome of homozygous familial hypercholesterolemia demonstrated high-affinity cell-surface binding of 125 I-labeled LDL but not 125 I-labeled IgG-C7. previous haplotype analysis, using 10 restriction fragment length polymorphic sites, suggested that the patient inherited two identical LDL receptor alleles. The polymerase chain reaction technique was used to selectively amplify exon 2 of the LDL receptor gene from this patient. Sequence analysis of the amplified fragment disclosed a deletion of six base pairs that removes two amino acids, aspartic acid and glycine, from the first cysteine-rich ligand binding repeat. The mutation creates a new Pst I restriction site that can be used to detect the deletion. The existence of this mutant allele confirms that the epitope of IgG-C7 is located in the first cysteine-rich repeat and that this repeat is not necessary for LDL binding. The mutant gene produced a normally sized 120-kilodalton LDL receptor precursor protein that matured to the 160-kilodalton form at less than one-fourth the normal rate
Armadillo Repeat Containing 8α Binds to HRS and Promotes HRS Interaction with Ubiquitinated Proteins
Tomaru, Koji; Ueda, Atsuhisa; Suzuki, Takeyuki; Kobayashi, Nobuaki; Yang, Jun; Yamamoto, Masaki; Takeno, Mitsuhiro; Kaneko, Takeshi; Ishigatsubo, Yoshiaki
2010-01-01
Recently, we reported that a complex with an essential role in the degradation of Fructose-1,6-bisphosphatase in yeast is well conserved in mammalian cells; we named this mammalian complex C-terminal to the Lissencephaly type-1-like homology (CTLH) complex. Although the function of the CTLH complex remains unclear, here we used yeast two-hybrid screening to isolate Hepatocyte growth factor-regulated tyrosine kinase substrate (HRS) as a protein binding to a key component of CTLH complex, Armadillo repeat containing 8 (ARMc8) α. The association was confirmed by a yeast two-hybrid assay and a co-immunoprecipitation assay. The proline-rich domain of HRS was essential for the association. As demonstrated through immunofluorescence microscopy, ARMc8α co-localized with HRS. ARMc8α promoted the interaction of HRS with various ubiquitinated proteins through the ubiquitin-interacting motif. These findings suggest that HRS mediates protein endosomal trafficking partly through its interaction with ARMc8α. PMID:20224683
Directory of Open Access Journals (Sweden)
Jianrao HU, Mingfu CAO, Jiong Chen
2009-10-01
Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].
Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald
2013-08-01
Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.
Schulz, Timothy A; Choi, Mal-Gi; Raychaudhuri, Sumana; Mears, Jason A; Ghirlando, Rodolfo; Hinshaw, Jenny E; Prinz, William A
2009-12-14
Sterols are transferred between cellular membranes by vesicular and poorly understood nonvesicular pathways. Oxysterol-binding protein-related proteins (ORPs) have been implicated in sterol sensing and nonvesicular transport. In this study, we show that yeast ORPs use a novel mechanism that allows regulated sterol transfer between closely apposed membranes, such as organelle contact sites. We find that the core lipid-binding domain found in all ORPs can simultaneously bind two membranes. Using Osh4p/Kes1p as a representative ORP, we show that ORPs have at least two membrane-binding surfaces; one near the mouth of the sterol-binding pocket and a distal site that can bind a second membrane. The distal site is required for the protein to function in cells and, remarkably, regulates the rate at which Osh4p extracts and delivers sterols in a phosphoinositide-dependent manner. Together, these findings suggest a new model of how ORPs could sense and regulate the lipid composition of adjacent membranes.
Directory of Open Access Journals (Sweden)
Gan Lijun
2011-12-01
Full Text Available Abstract Background Single-repeat R3 MYB transcription factors (single-repeat MYBs play important roles in controlling trichome patterning in Arabidopsis. It was proposed that single-repeat MYBs negatively regulate trichome formation by competing with GLABRA1 (GL1 for binding GLABRA3/ENHANCER OF GLABRA3 (GL3/EGL3, thus inhibiting the formation of activator complex TTG1(TRANSPARENT TESTA GLABRA1-GL3/EGL3-GL1 that is required for the activation of GLABRA2 (GL2, whose product is a positive regulator of trichome formation. Previously we identified a novel single-repeat MYB transcription factor, TRICHOMELESS1 (TCL1, which negatively regulates trichome formation on the inflorescence stems and pedicels by directly suppressing the expression of GL1. Results We analyzed here the role of TRICHOMELESS2 (TCL2, a previously-uncharacterized single-repeat MYB transcription factor in trichome patterning in Arabidopsis. We showed that TCL2 is closely related to TCL1, and like TCL1 and other single-repeat MYBs, TCL2 interacts with GL3. Overexpression of TCL2 conferred glabrous phenotype while knockdown of TCL2 via RNAi induced ectopic trichome formation on the inflorescence stems and pedicels, a phenotype that was previously observed in tcl1 mutants. These results suggested that TCL2 may have overlapping function with TCL1 in controlling trichome formation on inflorescences. On the other hand, although the transcription of TCL2, like TCL1, is not controlled by the activator complex formed by GL1 and GL3, and TCL2 and TCL1 proteins are more than 80% identical at the amino acid level, the expression of TCL2 under the control of TCL1 promoter only partially recovered the mutant phenotype of tcl1, implying that TCL2 and TCL1 are not fully functional equivalent. Conclusions TCL2 function redundantly with TCL1 in controlling trichome formation on inflorescences, but they are not fully functional equivalent. Transcription of TCL2 is not controlled by activator complex
Factors influencing repeated teenage pregnancy: a review and meta-analysis.
Maravilla, Joemer C; Betts, Kim S; Couto E Cruz, Camila; Alati, Rosa
2017-11-01
Existing evidence of predictors of repeated teenage pregnancy has not been assessed rigorously. This systematic review provides a comprehensive evaluation of protective and risk factors that are associated with repeated teenage pregnancy through a metaanalytical consensus. We used PubMed, EMBASE, CINAHL, ProQuest, PsychINFO, ScienceDirect, Scopus, and Web of Science databases from 1997-2015 and the reference list of other relevant research papers and related reviews. Eligibility criteria included (1) epidemiologic studies that analyzed factors associated with repeated pregnancy or birth among adolescents pregnancy, and (2) experimental studies with an observational component that was adjusted for the intervention. We performed narrative synthesis of study characteristics, participant characteristics, study results, and quality assessment. We also conducted random-effects and quality-effects metaanalyses with meta-regression to obtain pooled odds ratios of identified factors and to determine sources of between-study heterogeneity. Twenty-six eligible epidemiologic studies, most from the United States (n=24), showed >47 factors with no evidence of publication bias for each metaanalysis. Use of contraception (pooled odds ratio, 0.60; 95% confidence interval, 0.35-1.02), particularly long-acting reversible contraceptives (pooled odds ratio, 0.19; 95% confidence interval, 0.08-0.45), considerably reduced repeated teenage pregnancy risk. Among studies about contraception, the number of follow-up visits (adjusted coefficient, 0.72; P=.102) and country of study (unadjusted coefficient, 2.57; permuted P=.071) explained between-study heterogeneity. Education-related factors, which included higher level of education (pooled odds ratio, 0.74; 95% confidence interval, 0.60-0.91) and school continuation (pooled odds ratio, 0.53; 95% confidence interval, 0.33-0.84), were found to be protective. Conversely, depression (pooled odds ratio, 1.46; 95% confidence interval, 1
Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R
2013-02-01
Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment.
ABFs, a family of ABA-responsive element binding factors.
Choi, H; Hong, J; Ha, J; Kang, J; Kim, S Y
2000-01-21
Abscisic acid (ABA) plays an important role in environmental stress responses of higher plants during vegetative growth. One of the ABA-mediated responses is the induced expression of a large number of genes, which is mediated by cis-regulatory elements known as abscisic acid-responsive elements (ABREs). Although a number of ABRE binding transcription factors have been known, they are not specifically from vegetative tissues under induced conditions. Considering the tissue specificity of ABA signaling pathways, factors mediating ABA-dependent stress responses during vegetative growth phase may thus have been unidentified so far. Here, we report a family of ABRE binding factors isolated from young Arabidopsis plants under stress conditions. The factors, isolated by a yeast one-hybrid system using a prototypical ABRE and named as ABFs (ABRE binding factors) belong to a distinct subfamily of bZIP proteins. Binding site selection assay performed with one ABF showed that its preferred binding site is the strong ABRE, CACGTGGC. ABFs can transactivate an ABRE-containing reporter gene in yeast. Expression of ABFs is induced by ABA and various stress treatments, whereas their induction patterns are different from one another. Thus, a new family of ABRE binding factors indeed exists that have the potential to activate a large number of ABA/stress-responsive genes in Arabidopsis.
Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved
Apte, Manasi S.; Meller, Victoria H.
2011-01-01
Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will co...
Modulation of DNA binding by gene-specific transcription factors.
Schleif, Robert F
2013-10-01
The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.
Directory of Open Access Journals (Sweden)
Srinivas Garlapati
2011-03-01
Full Text Available Translation of Giardiavirus (GLV mRNA is initiated at an internal ribosome entry site (IRES in the viral transcript. The IRES localizes to a downstream portion of 5' untranslated region (UTR and a part of the early downstream coding region of the transcript. Recent studies indicated that the IRES does not require a pre-initiation complex to initiate translation but may directly recruit the small ribosome subunit with the help of a number of trans-activating protein factors. A La autoantigen homologue in the viral host Giardia lamblia, GlLa, was proposed as one of the potential trans-activating factors based on its specific binding to GLV-IRES in vitro. In this study, we further elucidated the functional role of GlLa in GLV-IRES mediated translation in Giardia by knocking down GlLa with antisense morpholino oligo, which resulted in a reduction of GLV-IRES activity by 40%. An over-expression of GlLa in Giardia moderately stimulated GLV-IRES activity by 20%. A yeast inhibitory RNA (IRNA, known to bind mammalian and yeast La autoantigen and inhibit Poliovirus and Hepatitis C virus IRES activities in vitro and in vivo, was also found to bind to GlLa protein in vitro and inhibited GLV-IRES function in vivo. The C-terminal domain of La autoantigen interferes with the dimerization of La and inhibits its function. An over-expression of the C-terminal domain (200-348aa of GlLa in Giardia showed a dominant-negative effect on GLV-IRES activity, suggesting a potential inhibition of GlLa dimerization. HA tagged GlLa protein was detected mainly in the cytoplasm of Giardia, thus supporting a primary role of GlLa in translation initiation in Giardiavirus.
International Nuclear Information System (INIS)
Zhao Cunyou; Chen Yali; Park, Jiyoung; Kim, Jae Bum; Tang Hong
2004-01-01
Transcription initiation from HIV-1 long terminal repeat (LTR) promoter requires the virally encoded transactivator, Tat, and several cellular co-factors to accomplish the Tat-dependent processive transcription elongation. Individual cellular transcription activators, LBP-1b and Oct-1, on the other hand, have been shown to inhibit LTR promoter activities probably via competitive binding against TFIID to the TATA-box in LTR promoter. To explore the genetic interference strategies against the viral replication, we took advantage of the existence of the bipartite DNA binding domains and the repression domains of LBP-1b and Oct-1 factors to generate a chimeric transcription repressor. Our results indicated that the fusion protein of LBP-1b and Oct-1 exhibited higher DNA binding affinity to the viral promoter than the individual factors, and little interference with the host cell gene expression due to its anticipated rare cognate DNA sites in the host cell genome. Moreover, the chimera exerted increased Tat-dependent repression of transcription initiation at the LTR promoter both in vitro and in vivo compared to LBP-1b, Oct-1 or combination of LBP-1b and Oct-1. These results might provide the lead in generating a therapeutic reagent useful to suppress HIV-1 replication
Townsend, Philip D; Dixon, Christopher H; Slootweg, Erik J; Sukarta, Octavina C A; Yang, Ally W H; Hughes, Timothy R; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Goverse, Aska; Cann, Martin J
2018-03-02
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable the immune system to recognize and respond to pathogen attack. An early consequence of immune activation is transcriptional reprogramming, and some NLRs have been shown to act in the nucleus and interact with transcription factors. The Rx1 NLR protein of potato is further able to bind and distort double-stranded DNA. However, Rx1 host targets that support a role for Rx1 in transcriptional reprogramming at DNA are unknown. Here, we report a functional interaction between Rx1 and Nb Glk1, a Golden2-like transcription factor. Rx1 binds to Nb Glk1 in vitro and in planta. Nb Glk1 binds to known Golden2-like consensus DNA sequences. Rx1 reduces the binding affinity of Nb Glk1 for DNA in vitro. Nb Glk1 activates cellular responses to potato virus X, whereas Rx1 associates with Nb Glk1 and prevents its assembly on DNA in planta unless activated by PVX. This study provides new mechanistic insight into how an NLR can coordinate an immune signaling response at DNA following pathogen perceptions. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Origin-Dependent Inverted-Repeat Amplification: Tests of a Model for Inverted DNA Amplification.
Directory of Open Access Journals (Sweden)
Bonita J Brewer
2015-12-01
Full Text Available DNA replication errors are a major driver of evolution--from single nucleotide polymorphisms to large-scale copy number variations (CNVs. Here we test a specific replication-based model to explain the generation of interstitial, inverted triplications. While no genetic information is lost, the novel inversion junctions and increased copy number of the included sequences create the potential for adaptive phenotypes. The model--Origin-Dependent Inverted-Repeat Amplification (ODIRA-proposes that a replication error at pre-existing short, interrupted, inverted repeats in genomic sequences generates an extrachromosomal, inverted dimeric, autonomously replicating intermediate; subsequent genomic integration of the dimer yields this class of CNV without loss of distal chromosomal sequences. We used a combination of in vitro and in vivo approaches to test the feasibility of the proposed replication error and its downstream consequences on chromosome structure in the yeast Saccharomyces cerevisiae. We show that the proposed replication error-the ligation of leading and lagging nascent strands to create "closed" forks-can occur in vitro at short, interrupted inverted repeats. The removal of molecules with two closed forks results in a hairpin-capped linear duplex that we show replicates in vivo to create an inverted, dimeric plasmid that subsequently integrates into the genome by homologous recombination, creating an inverted triplication. While other models have been proposed to explain inverted triplications and their derivatives, our model can also explain the generation of human, de novo, inverted amplicons that have a 2:1 mixture of sequences from both homologues of a single parent--a feature readily explained by a plasmid intermediate that arises from one homologue and integrates into the other homologue prior to meiosis. Our tests of key features of ODIRA lend support to this mechanism and suggest further avenues of enquiry to unravel the origins
Origin-Dependent Inverted-Repeat Amplification: Tests of a Model for Inverted DNA Amplification.
Brewer, Bonita J; Payen, Celia; Di Rienzi, Sara C; Higgins, Megan M; Ong, Giang; Dunham, Maitreya J; Raghuraman, M K
2015-12-01
DNA replication errors are a major driver of evolution--from single nucleotide polymorphisms to large-scale copy number variations (CNVs). Here we test a specific replication-based model to explain the generation of interstitial, inverted triplications. While no genetic information is lost, the novel inversion junctions and increased copy number of the included sequences create the potential for adaptive phenotypes. The model--Origin-Dependent Inverted-Repeat Amplification (ODIRA)-proposes that a replication error at pre-existing short, interrupted, inverted repeats in genomic sequences generates an extrachromosomal, inverted dimeric, autonomously replicating intermediate; subsequent genomic integration of the dimer yields this class of CNV without loss of distal chromosomal sequences. We used a combination of in vitro and in vivo approaches to test the feasibility of the proposed replication error and its downstream consequences on chromosome structure in the yeast Saccharomyces cerevisiae. We show that the proposed replication error-the ligation of leading and lagging nascent strands to create "closed" forks-can occur in vitro at short, interrupted inverted repeats. The removal of molecules with two closed forks results in a hairpin-capped linear duplex that we show replicates in vivo to create an inverted, dimeric plasmid that subsequently integrates into the genome by homologous recombination, creating an inverted triplication. While other models have been proposed to explain inverted triplications and their derivatives, our model can also explain the generation of human, de novo, inverted amplicons that have a 2:1 mixture of sequences from both homologues of a single parent--a feature readily explained by a plasmid intermediate that arises from one homologue and integrates into the other homologue prior to meiosis. Our tests of key features of ODIRA lend support to this mechanism and suggest further avenues of enquiry to unravel the origins of interstitial
International Nuclear Information System (INIS)
Azevedo, W.F.; Ward, R.J.; Lombardi, F.R.; Arni, R.K.; Soares, A.M.; Giglio, J.R.; Fontes, M.R.M.
1997-01-01
Full text. Phospho lipases A2 (PLA 2 ; E C 3.1.1.4, phosphatides s n-2 acyl hydrolases) hydrolysis the s n-2 ester bond of phospholipids showing enhanced activity at lamellar or membrane surfaces. Intracellular PLA 2 s are involved at phospholipid metabolism and signal transduction, whereas extracellular PLA 2 s are found in mammalian pancreatic juices, the venoms of snakes, lizards and insects. Based on their high primary sequence similarity, extracellular PLA 2 s are separated into Classes I, II and III. Class II PLA 2 s are found in snake venoms of Crotalidae an Viperidae species, and include the sub-family of Lys PLA 2 s homologue. he coordination of the Ca 2+ ion in the PLA 2 calcium-binding loop includes and aspartate at position 49. In the catalytically active PLA 2 s, this calcium ion plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The conservative substitution Asp49-Lys results in a decreased calcium affinity with a concomitant loss of catalytic activity, and naturally occurring PLA 2 s-homologues showing the same substitution are catalytically inactive. However, the Lys PLA 2 s possess cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid layers by a ca 2+ -independent mechanism for which there is no evidence of lipid hydrolysis. Lys 49 PLA 2 homologues have been isolated from several Bothrops spp. venoms including B. moojeni. Therefore, in order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ independent membrane damaging activities we have determined the crystal structure of MjTX-II, a Lys 49 homologue from the venom of B. moojeni. The model presented has been determined at 2.0 A resolution and refined to a crystallographic residual of 19.7% (R f ree=28.1%). (author)
Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.
Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji
2015-08-01
Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.
Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation.
Gaviglio, Angela L; Knelson, Erik H; Blobe, Gerard C
2017-05-01
High-risk neuroblastoma is characterized by undifferentiated neuroblasts and low schwannian stroma content. The tumor stroma contributes to the suppression of tumor growth by releasing soluble factors that promote neuroblast differentiation. Here we identify heparin-binding epidermal growth factor-like growth factor (HBEGF) as a potent prodifferentiating factor in neuroblastoma. HBEGF mRNA expression is decreased in human neuroblastoma tumors compared with benign tumors, with loss correlating with decreased survival. HBEGF protein is expressed only in stromal compartments of human neuroblastoma specimens, with tissue from high-stage disease containing very little stroma or HBEGF expression. In 3 human neuroblastoma cell lines (SK-N-AS, SK-N-BE2, and SH-SY5Y), soluble HBEGF is sufficient to promote neuroblast differentiation and decrease proliferation. Heparan sulfate proteoglycans and heparin derivatives further enhance HBEGF-induced differentiation by forming a complex with the epidermal growth factor receptor, leading to activation of the ERK1/2 and STAT3 pathways and up-regulation of the inhibitor of DNA binding transcription factor. These data support a role for loss of HBEGF in the neuroblastoma tumor microenvironment in neuroblastoma pathogenesis.-Gaviglio, A. L., Knelson, E. H., Blobe, G. C. Heparin-binding epidermal growth factor-like growth factor promotes neuroblastoma differentiation. © FASEB.
Prediction of nucleosome positioning based on transcription factor binding sites.
Directory of Open Access Journals (Sweden)
Xianfu Yi
Full Text Available BACKGROUND: The DNA of all eukaryotic organisms is packaged into nucleosomes, the basic repeating units of chromatin. The nucleosome consists of a histone octamer around which a DNA core is wrapped and the linker histone H1, which is associated with linker DNA. By altering the accessibility of DNA sequences, the nucleosome has profound effects on all DNA-dependent processes. Understanding the factors that influence nucleosome positioning is of great importance for the study of genomic control mechanisms. Transcription factors (TFs have been suggested to play a role in nucleosome positioning in vivo. PRINCIPAL FINDINGS: Here, the minimum redundancy maximum relevance (mRMR feature selection algorithm, the nearest neighbor algorithm (NNA, and the incremental feature selection (IFS method were used to identify the most important TFs that either favor or inhibit nucleosome positioning by analyzing the numbers of transcription factor binding sites (TFBSs in 53,021 nucleosomal DNA sequences and 50,299 linker DNA sequences. A total of nine important families of TFs were extracted from 35 families, and the overall prediction accuracy was 87.4% as evaluated by the jackknife cross-validation test. CONCLUSIONS: Our results are consistent with the notion that TFs are more likely to bind linker DNA sequences than the sequences in the nucleosomes. In addition, our results imply that there may be some TFs that are important for nucleosome positioning but that play an insignificant role in discriminating nucleosome-forming DNA sequences from nucleosome-inhibiting DNA sequences. The hypothesis that TFs play a role in nucleosome positioning is, thus, confirmed by the results of this study.
Morikawa, Kazuya; Shiina, Takashi; Murakami, Shinya; Toyoshima, Yoshinori
2002-03-13
Sigma factor binding proteins are involved in modifying the promoter preferences of the RNA polymerase in bacteria. We found the nuclear encoded protein (SibI) that is transported into chloroplasts and interacts specifically with the region 4 of Sig1 in Arabidopsis. SibI and its homologue, T3K9.5 are novel proteins, which are not homologous to any protein of known function. The expression of sibI was tissue specific, light dependent, and developmentally timed. We suggest the transcriptional regulation by sigma factor binding proteins to function in the plastids of higher plant.
Directory of Open Access Journals (Sweden)
Chaban Christina
2010-11-01
Full Text Available Abstract Background About 10% of all genes in eukaryote genomes are predicted to encode transcription factors. The specific binding of transcription factors to short DNA-motifs influences the expression of neighbouring genes. However, little is known about the DNA-protein interaction itself. To date there are only a few suitable methods to characterise DNA-protein-interactions, among which the EMSA is the method most frequently used in laboratories. Besides EMSA, several protocols describe the effective use of an ELISA-based transcription factor binding assay e.g. for the analysis of human NFκB binding to specific DNA sequences. Results We provide a unified protocol for this type of ELISA analysis, termed DNA-Protein-Interaction (DPI-ELISA. Qualitative analyses with His-epitope tagged plant transcription factors expressed in E. coli revealed that EMSA and DPI-ELISA result in comparable and reproducible data. The binding of AtbZIP63 to the C-box and AtWRKY11 to the W2-box could be reproduced and validated by both methods. We next examined the physical binding of the C-terminal DNA-binding domains of AtWRKY33, AtWRKY50 and AtWRKY75 to the W2-box. Although the DNA-binding domain is highly conserved among the WRKY proteins tested, the use of the DPI-ELISA discloses differences in W2-box binding properties between these proteins. In addition to these well-studied transcription factor families, we applied our protocol to AtBPC2, a member of the so far uncharacterised plant specific Basic Pentacysteine transcription factor family. We could demonstrate binding to GA/TC-dinucleotide repeat motifs by our DPI-ELISA protocol. Different buffers and reaction conditions were examined. Conclusions We successfully applied our DPI-ELISA protocol to investigate the DNA-binding specificities of three different classes of transcription factors from Arabidopsis thaliana. However, the analysis of the binding affinity of any DNA-binding protein to any given DNA
Molecular Evolution of the Oxygen-Binding Hemerythrin Domain.
Directory of Open Access Journals (Sweden)
Claudia Alvarez-Carreño
Full Text Available The evolution of oxygenic photosynthesis during Precambrian times entailed the diversification of strategies minimizing reactive oxygen species-associated damage. Four families of oxygen-carrier proteins (hemoglobin, hemerythrin and the two non-homologous families of arthropodan and molluscan hemocyanins are known to have evolved independently the capacity to bind oxygen reversibly, providing cells with strategies to cope with the evolutionary pressure of oxygen accumulation. Oxygen-binding hemerythrin was first studied in marine invertebrates but further research has made it clear that it is present in the three domains of life, strongly suggesting that its origin predated the emergence of eukaryotes.Oxygen-binding hemerythrins are a monophyletic sub-group of the hemerythrin/HHE (histidine, histidine, glutamic acid cation-binding domain. Oxygen-binding hemerythrin homologs were unambiguously identified in 367/2236 bacterial, 21/150 archaeal and 4/135 eukaryotic genomes. Overall, oxygen-binding hemerythrin homologues were found in the same proportion as single-domain and as long protein sequences. The associated functions of protein domains in long hemerythrin sequences can be classified in three major groups: signal transduction, phosphorelay response regulation, and protein binding. This suggests that in many organisms the reversible oxygen-binding capacity was incorporated in signaling pathways. A maximum-likelihood tree of oxygen-binding hemerythrin homologues revealed a complex evolutionary history in which lateral gene transfer, duplications and gene losses appear to have played an important role.Hemerythrin is an ancient protein domain with a complex evolutionary history. The distinctive iron-binding coordination site of oxygen-binding hemerythrins evolved first in prokaryotes, very likely prior to the divergence of Firmicutes and Proteobacteria, and spread into many bacterial, archaeal and eukaryotic species. The later evolution of the
Zhu, Yunye; Huang, Shengxiong; Miao, Min; Tang, Xiaofeng; Yue, Junyang; Wang, Wenjie; Liu, Yongsheng
2015-06-01
One hundred DDB1 (damaged DNA binding protein-1)-binding WD40-repeat domain (DWD) family genes were identified in the S. lycopersicum genome. The DWD genes encode proteins presumably functioning as the substrate recognition subunits of the cullin4-ring ubiquitin E3 ligase complex. These findings provide candidate genes and a research platform for further gene functionality and molecular breeding study. A subclass of DDB1 (damaged DNA binding protein-1)-binding WD40-repeat domain (DWD) family proteins has been demonstrated to function as the substrate recognition subunits of the cullin4-ring ubiquitin E3 ligase complex. However, little information is available about the cognate subfamily genes in tomato (S. lycopersicum). In this study, based on the recently released tomato genome sequences, 100 tomato genes encoding DWD proteins that potentially interact with DDB1 were identified and characterized, including analyses of the detailed annotations, chromosome locations and compositions of conserved amino acid domains. In addition, a phylogenetic tree, which comprises of three main groups, of the subfamily genes was constructed. The physical interaction between tomato DDB1 and 14 representative DWD proteins was determined by yeast two-hybrid and co-immunoprecipitation assays. The subcellular localization of these 14 representative DWD proteins was determined. Six of them were localized in both nucleus and cytoplasm, seven proteins exclusively in cytoplasm, and one protein either in nucleus and cytoplasm, or exclusively in cytoplasm. Comparative genomic analysis demonstrated that the expansion of these subfamily members in tomato predominantly resulted from two whole-genome triplication events in the evolution history.
Repeated swim stress alters brain benzodiazepine receptors measured in vivo
International Nuclear Information System (INIS)
Weizman, R.; Weizman, A.; Kook, K.A.; Vocci, F.; Deutsch, S.I.; Paul, S.M.
1989-01-01
The effects of repeated swim stress on brain benzodiazepine receptors were examined in the mouse using both an in vivo and in vitro binding method. Specific in vivo binding of [ 3 H]Ro15-1788 to benzodiazepine receptors was decreased in the hippocampus, cerebral cortex, hypothalamus, midbrain and striatum after repeated swim stress (7 consecutive days of daily swim stress) when compared to nonstressed mice. In vivo benzodiazepine receptor binding was unaltered after repeated swim stress in the cerebellum and pons medulla. The stress-induced reduction in in vivo benzodiazepine receptor binding did not appear to be due to altered cerebral blood flow or to an alteration in benzodiazepine metabolism or biodistribution because there was no difference in [14C]iodoantipyrine distribution or whole brain concentrations of clonazepam after repeated swim stress. Saturation binding experiments revealed a change in both apparent maximal binding capacity and affinity after repeated swim stress. Moreover, a reduction in clonazepam's anticonvulsant potency was also observed after repeated swim stress [an increase in the ED50 dose for protection against pentylenetetrazol-induced seizures], although there was no difference in pentylenetetrazol-induced seizure threshold between the two groups. In contrast to the results obtained in vivo, no change in benzodiazepine receptor binding kinetics was observed using the in vitro binding method. These data suggest that environmental stress can alter the binding parameters of the benzodiazepine receptor and that the in vivo and in vitro binding methods can yield substantially different results
Repeated swim stress alters brain benzodiazepine receptors measured in vivo
Energy Technology Data Exchange (ETDEWEB)
Weizman, R.; Weizman, A.; Kook, K.A.; Vocci, F.; Deutsch, S.I.; Paul, S.M.
1989-06-01
The effects of repeated swim stress on brain benzodiazepine receptors were examined in the mouse using both an in vivo and in vitro binding method. Specific in vivo binding of (/sup 3/H)Ro15-1788 to benzodiazepine receptors was decreased in the hippocampus, cerebral cortex, hypothalamus, midbrain and striatum after repeated swim stress (7 consecutive days of daily swim stress) when compared to nonstressed mice. In vivo benzodiazepine receptor binding was unaltered after repeated swim stress in the cerebellum and pons medulla. The stress-induced reduction in in vivo benzodiazepine receptor binding did not appear to be due to altered cerebral blood flow or to an alteration in benzodiazepine metabolism or biodistribution because there was no difference in (14C)iodoantipyrine distribution or whole brain concentrations of clonazepam after repeated swim stress. Saturation binding experiments revealed a change in both apparent maximal binding capacity and affinity after repeated swim stress. Moreover, a reduction in clonazepam's anticonvulsant potency was also observed after repeated swim stress (an increase in the ED50 dose for protection against pentylenetetrazol-induced seizures), although there was no difference in pentylenetetrazol-induced seizure threshold between the two groups. In contrast to the results obtained in vivo, no change in benzodiazepine receptor binding kinetics was observed using the in vitro binding method. These data suggest that environmental stress can alter the binding parameters of the benzodiazepine receptor and that the in vivo and in vitro binding methods can yield substantially different results.
Zamiri, Bita; Reddy, Kaalak; Macgregor, Robert B; Pearson, Christopher E
2014-02-21
Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.
Directory of Open Access Journals (Sweden)
Matthew W Parker
Full Text Available Neuropilin (Nrp receptors function as essential cell surface receptors for the Vascular Endothelial Growth Factor (VEGF family of proangiogenic cytokines and the semaphorin 3 (Sema3 family of axon guidance molecules. There are two Nrp homologues, Nrp1 and Nrp2, which bind to both overlapping and distinct members of the VEGF and Sema3 family of molecules. Nrp1 specifically binds the VEGF-A(164/5 isoform, which is essential for developmental angiogenesis. We demonstrate that VEGF-A specific binding is governed by Nrp1 residues in the b1 coagulation factor domain surrounding the invariant Nrp C-terminal arginine binding pocket. Further, we show that Sema3F does not display the Nrp-specific binding to the b1 domain seen with VEGF-A. Engineered soluble Nrp receptor fragments that selectively sequester ligands from the active signaling complex are an attractive modality for selectively blocking the angiogenic and chemorepulsive functions of Nrp ligands. Utilizing the information on Nrp ligand binding specificity, we demonstrate Nrp constructs that specifically sequester Sema3 in the presence of VEGF-A. This establishes that unique mechanisms are used by Nrp receptors to mediate specific ligand binding and that these differences can be exploited to engineer soluble Nrp receptors with specificity for Sema3.
DEFF Research Database (Denmark)
Wade, M; Blake, M C; Jambou, R C
1995-01-01
consensus E2F site, significantly decrease the binding stability of all of the forms of E2F tested. The rate of association of E2F-1/DP-1 heterodimers with the inverted repeat wild type site was not significantly different from those with the two single site mutated probes. Furthermore, the mutations...
Detection and properties of A-factor-binding protein from Streptomyces griseus
International Nuclear Information System (INIS)
Miyake, K.; Horinouchi, S.; Yoshida, M.; Chiba, N.; Mori, K.; Nogawa, N.; Morikawa, N.; Beppu, T.
1989-01-01
The optically active form of tritium-labeled A-factor (2-isocapryloyl-3R-hydroxymethyl-gamma-butyrolactone), a pleiotropic autoregulator responsible for streptomycin production, streptomycin resistance, and sporulation in Streptomyces griseus, was chemically synthesized. By using the radioactive A-factor, a binding protein for A-factor was detected in the cytoplasmic fraction of this organism. The binding protein had an apparent molecular weight of approximately 26,000, as determined by gel filtration. Scatchard analysis suggested that A-factor bound the protein in the molar ratio of 1:1 with a binding constant, Kd, of 0.7 nM. The number of the binding protein was roughly estimated to be 37 per genome. The inducing material virginiae butanolide C (VB-C), which has a structure very similar to that of A-factor and is essential for virginiamycin production in Streptomyces virginiae, did not inhibit binding. In addition, no protein capable of specifically binding 3 H-labeled VB-C was found in S. griseus. Together with the observation that VB-C had almost no biological activity on the restoration of streptomycin production or sporulation in an A-factor-deficient mutant of S. griseus, these results indicated that the binding protein had a strict ligand specificity. Examination for an A-factor-binding protein in Streptomyces coelicolor A3(2) and Streptomyces lividans showed the absence of any specifically binding protein
Genetics Home Reference: core binding factor acute myeloid leukemia
... binding factor acute myeloid leukemia Core binding factor acute myeloid leukemia Printable PDF Open All Close All Enable Javascript ... on PubMed (1 link) PubMed OMIM (1 link) LEUKEMIA, ACUTE MYELOID Sources for This Page Goyama S, Mulloy JC. Molecular ...
Transcription factor binding sites prediction based on modified nucleosomes.
Directory of Open Access Journals (Sweden)
Mohammad Talebzadeh
Full Text Available In computational methods, position weight matrices (PWMs are commonly applied for transcription factor binding site (TFBS prediction. Although these matrices are more accurate than simple consensus sequences to predict actual binding sites, they usually produce a large number of false positive (FP predictions and so are impoverished sources of information. Several studies have employed additional sources of information such as sequence conservation or the vicinity to transcription start sites to distinguish true binding regions from random ones. Recently, the spatial distribution of modified nucleosomes has been shown to be associated with different promoter architectures. These aligned patterns can facilitate DNA accessibility for transcription factors. We hypothesize that using data from these aligned and periodic patterns can improve the performance of binding region prediction. In this study, we propose two effective features, "modified nucleosomes neighboring" and "modified nucleosomes occupancy", to decrease FP in binding site discovery. Based on these features, we designed a logistic regression classifier which estimates the probability of a region as a TFBS. Our model learned each feature based on Sp1 binding sites on Chromosome 1 and was tested on the other chromosomes in human CD4+T cells. In this work, we investigated 21 histone modifications and found that only 8 out of 21 marks are strongly correlated with transcription factor binding regions. To prove that these features are not specific to Sp1, we combined the logistic regression classifier with the PWM, and created a new model to search TFBSs on the genome. We tested the model using transcription factors MAZ, PU.1 and ELF1 and compared the results to those using only the PWM. The results show that our model can predict Transcription factor binding regions more successfully. The relative simplicity of the model and capability of integrating other features make it a superior method
Ververis, J; Ku, L; Delafontaine, P
1994-02-01
Insulin-like growth factor I is an important mitogen for vascular smooth muscle cells, and its effects are regulated by several binding proteins. Western ligand blotting of conditioned medium from rat aortic smooth muscle cells detected a 24 kDa binding protein and a 28 kDa glycosylated variant of this protein, consistent with insulin-like growth factor binding protein-4 by size. Low amounts of a glycosylated 38 to 42 kDa doublet (consistent with binding protein-3) and a 31 kDa non-glycosylated protein also were present. Basic fibroblast growth factor markedly increased secretion of the 24 kDa binding protein and its 28 kDa glycosylated variant. This effect was dose- and time-dependent and was inhibited by co-incubation with cycloheximide. Crosslinking of [125I]-insulin-like growth factor I to cell monolayers revealed no surface-associated binding proteins, either basally or after agonist treatment. Induction of binding protein production by fibroblast growth factor at sites of vascular injury may be important in vascular proliferative responses in vivo.
Gupta, Atul K.; Seneviratne, J. M.; Joshi, G. K.; Kumar, Anil
2012-01-01
Signaling pathways that activate different mitogen-activated protein kinases (MAPKs) in response to certain environmental conditions, play important role in mating type switching (Fus3) and pathogenicity (Pmk1) in many fungi. In order to determine the roles of such regulatory genes in Tilletia indica, the causal pathogen of Karnal bunt (KB) of wheat, semi-quantitative and quantitative RT-PCR was carried out to isolate and determine the expression of MAP kinase homologues during fungal growth and development under in vitro culture. Maximum expression of TiFus3 and TiPmk1 genes were observed at 14th and 21st days of culture and decreased thereafter. To investigate whether the fungus alters the expression levels of same kinases upon interaction with plants, cultures were treated with 1% of host factors (extracted from S-2 stage of wheat spikes). Such treatment induced the expression of MAPks in time dependent manner compared to the absence of host factors. These results suggest that host factor(s) provide certain signal(s) which activate TiFus3 and TiPmk1 during morphogenetic development of T. indica. The results also provides a clue about the role of host factors in enhancing the disease potential due to induction of MAP kinases involved in fungal development and pathogenecity. PMID:22547988
Structural Fingerprints of Transcription Factor Binding Site Regions
Directory of Open Access Journals (Sweden)
Peter Willett
2009-03-01
Full Text Available Fourier transforms are a powerful tool in the prediction of DNA sequence properties, such as the presence/absence of codons. We have previously compiled a database of the structural properties of all 32,896 unique DNA octamers. In this work we apply Fourier techniques to the analysis of the structural properties of human chromosomes 21 and 22 and also to three sets of transcription factor binding sites within these chromosomes. We find that, for a given structural property, the structural property power spectra of chromosomes 21 and 22 are strikingly similar. We find common peaks in their power spectra for both Sp1 and p53 transcription factor binding sites. We use the power spectra as a structural fingerprint and perform similarity searching in order to find transcription factor binding site regions. This approach provides a new strategy for searching the genome data for information. Although it is difficult to understand the relationship between specific functional properties and the set of structural parameters in our database, our structural fingerprints nevertheless provide a useful tool for searching for function information in sequence data. The power spectrum fingerprints provide a simple, fast method for comparing a set of functional sequences, in this case transcription factor binding site regions, with the sequences of whole chromosomes. On its own, the power spectrum fingerprint does not find all transcription factor binding sites in a chromosome, but the results presented here show that in combination with other approaches, this technique will improve the chances of identifying functional sequences hidden in genomic data.
International Nuclear Information System (INIS)
Canduri, R.J.; Ward, R.J.; Azevedo Junior, G.W.F. de; Arni, R.K.; Soares, A.M.; Giglio, J.R.
1997-01-01
Full text. Phospho lipases A2 (PLA 2 ) are small enzymes that specifically hydrolysed the sn-2 ester bond of phospholipids, preferentially in lamellar or micellar aggregates at membrane surfaces. These enzymes are widely distributed in nature and have been extensively studied. Toxic proteins from venoms from Bothrops species include catalytically active PLA 2 s and calcium independent PLA 2L ys 49 homologues. The substitution of Asp49 by Lys greatly diminishes the ability of these PLA 2 to bind calcium, an ion that plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The Lys 49 PLA 2 homologues and therefore catalytically inactive yet maintain cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid bilayers by a poorly understood Ca 2+ independente mechanism. Lys49 PLA 2 homologues demonstrate a specific toxic activity against skeletal muscle, affecting only muscle fibers and leaving other tissue structure such as connective tissue, nerves and vessels essentially unharmed. In order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ -independent membrane damaging activities, we have determined the crystal structure of Pr TX-I, a Lys49 variant from the venom of B. pirajai. The model presented has been determined at 2.8 angstrom resolution and refined to a crystallographic residual of 19.7% (R free =29.7%). (author)
Fenyk, Stepan; Townsend, Philip D.; Dixon, Christopher H.; Spies, Gerhard B.; de San Eustaquio Campillo, Alba; Slootweg, Erik J.; Westerhof, Lotte B.; Gawehns, Fleur K. K.; Knight, Marc R.; Sharples, Gary J.; Goverse, Aska; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.
2015-01-01
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable cells to respond to pathogen attack. Several NLRs act in the nucleus; however, conserved nuclear targets that support their role in immunity are unknown. Previously, we noted a structural homology between the nucleotide-binding domain of NLRs and DNA replication origin-binding Cdc6/Orc1 proteins. Here we show that the NB-ARC (nucleotide-binding, Apaf-1, R-proteins, and CED-4) domain of the Rx1 NLR of potato binds nucleic acids. Rx1 induces ATP-dependent bending and melting of DNA in vitro, dependent upon a functional P-loop. In situ full-length Rx1 binds nuclear DNA following activation by its cognate pathogen-derived effector protein, the coat protein of potato virus X. In line with its obligatory nucleocytoplasmic distribution, DNA binding was only observed when Rx1 was allowed to freely translocate between both compartments and was activated in the cytoplasm. Immune activation induced by an unrelated NLR-effector pair did not trigger an Rx1-DNA interaction. DNA binding is therefore not merely a consequence of immune activation. These data establish a role for DNA distortion in Rx1 immune signaling and define DNA as a molecular target of an activated NLR. PMID:26306038
A Structural Model for Binding of the Serine-Rich Repeat Adhesin GspB to Host Carbohydrate Receptors
Energy Technology Data Exchange (ETDEWEB)
Pyburn, Tasia M.; Bensing, Barbara A.; Xiong, Yan Q.; Melancon, Bruce J.; Tomasiak, Thomas M.; Ward, Nicholas J.; Yankovskaya, Victoria; Oliver, Kevin M.; Cecchini, Gary; Sulikowski, Gary A.; Tyska, Matthew J.; Sullam, Paul M.; Iverson, T.M. (VA); (UCLA); (Vanderbilt); (UCSF)
2014-10-02
GspB is a serine-rich repeat (SRR) adhesin of Streptococcus gordonii that mediates binding of this organism to human platelets via its interaction with sialyl-T antigen on the receptor GPIb{alpha}. This interaction appears to be a major virulence determinant in the pathogenesis of infective endocarditis. To address the mechanism by which GspB recognizes its carbohydrate ligand, we determined the high-resolution x-ray crystal structure of the GspB binding region (GspB{sub BR}), both alone and in complex with a disaccharide precursor to sialyl-T antigen. Analysis of the GspB{sub BR} structure revealed that it is comprised of three independently folded subdomains or modules: (1) an Ig-fold resembling a CnaA domain from prokaryotic pathogens; (2) a second Ig-fold resembling the binding region of mammalian Siglecs; (3) a subdomain of unique fold. The disaccharide was found to bind in a pocket within the Siglec subdomain, but at a site distinct from that observed in mammalian Siglecs. Confirming the biological relevance of this binding pocket, we produced three isogenic variants of S. gordonii, each containing a single point mutation of a residue lining this binding pocket. These variants have reduced binding to carbohydrates of GPIb{alpha}. Further examination of purified GspB{sub BR}-R484E showed reduced binding to sialyl-T antigen while S. gordonii harboring this mutation did not efficiently bind platelets and showed a significant reduction in virulence, as measured by an animal model of endocarditis. Analysis of other SRR proteins revealed that the predicted binding regions of these adhesins also had a modular organization, with those known to bind carbohydrate receptors having modules homologous to the Siglec and Unique subdomains of GspBBR. This suggests that the binding specificity of the SRR family of adhesins is determined by the type and organization of discrete modules within the binding domains, which may affect the tropism of organisms for different tissues.
Magill, C P; Jackson, S P; Bell, S D
2001-12-14
Archaea possess two general transcription factors that are required to recruit RNA polymerase (RNAP) to promoters in vitro. These are TBP, the TATA-box-binding protein and TFB, the archaeal homologue of TFIIB. Thus, the archaeal and eucaryal transcription machineries are fundamentally related. In both RNAP II and archaeal transcription systems, direct contacts between TFB/TFIIB and the RNAP have been demonstrated to mediate recruitment of the polymerase to the promoter. However the subunit(s) directly contacted by these factors has not been identified. Using systematic yeast two-hybrid and biochemical analyses we have identified an interaction between the N-terminal domain of TFB and an evolutionarily conserved subunit of the RNA polymerase, RpoK. Intriguingly, homologues of RpoK are found in all three nuclear RNA polymerases (Rpb6) and also in the bacterial RNA polymerase (omega-subunit).
Using TESS to predict transcription factor binding sites in DNA sequence.
Schug, Jonathan
2008-03-01
This unit describes how to use the Transcription Element Search System (TESS). This Web site predicts transcription factor binding sites (TFBS) in DNA sequence using two different kinds of models of sites, strings and positional weight matrices. The binding of transcription factors to DNA is a major part of the control of gene expression. Transcription factors exhibit sequence-specific binding; they form stronger bonds to some DNA sequences than to others. Identification of a good binding site in the promoter for a gene suggests the possibility that the corresponding factor may play a role in the regulation of that gene. However, the sequences transcription factors recognize are typically short and allow for some amount of mismatch. Because of this, binding sites for a factor can typically be found at random every few hundred to a thousand base pairs. TESS has features to help sort through and evaluate the significance of predicted sites.
Directory of Open Access Journals (Sweden)
V Chandana Epa
Full Text Available Designed Ankyrin Repeat Proteins are a class of novel binding proteins that can be selected and evolved to bind to targets with high affinity and specificity. We are interested in the DARPin H10-2-G3, which has been evolved to bind with very high affinity to the human epidermal growth factor receptor 2 (HER2. HER2 is found to be over-expressed in 30% of breast cancers, and is the target for the FDA-approved therapeutic monoclonal antibodies trastuzumab and pertuzumab and small molecule tyrosine kinase inhibitors. Here, we use computational macromolecular docking, coupled with several interface metrics such as shape complementarity, interaction energy, and electrostatic complementarity, to model the structure of the complex between the DARPin H10-2-G3 and HER2. We analyzed the interface between the two proteins and then validated the structural model by showing that selected HER2 point mutations at the putative interface with H10-2-G3 reduce the affinity of binding up to 100-fold without affecting the binding of trastuzumab. Comparisons made with a subsequently solved X-ray crystal structure of the complex yielded a backbone atom root mean square deviation of 0.84-1.14 Ångstroms. The study presented here demonstrates the capability of the computational techniques of structural bioinformatics in generating useful structural models of protein-protein interactions.
Rossi, Raffaella; Granoff, Dan M; Beernink, Peter T
2013-11-04
Factor H-binding protein (fHbp) is a component of a meningococcal vaccine recently licensed in Europe for prevention of serogroup B disease, and a second vaccine in clinical development. The protein specifically binds human factor H (fH), which down-regulates complement activation and enhances resistance to bactericidal activity. There are conflicting data from studies in human fH transgenic mice on whether binding of human fH to fHbp vaccines decreases immunogenicity, and whether mutant fHbp vaccines with decreased fH binding have enhanced immunogenicity. fHbp can be classified into two sub-families based on sequence divergence and immunologic cross-reactivity. Previous studies of mutant fHbp vaccines with low fH binding were from sub-family B, which account for approximately 60% of serogroup B case isolates. In the present study, we evaluated the immunogenicity of two mutant sub-family A fHbp vaccines containing single substitutions, T221A or D211A, which resulted in 15- or 30-fold lower affinity for human fH, respectively, than the corresponding control wild-type fHbp vaccine. In transgenic mice with high serum concentrations of human fH, both mutant vaccines elicited significantly higher IgG titers and higher serum bactericidal antibody responses than the control fHbp vaccine that bound human fH. Thus, mutations introduced into a sub-family A fHbp antigen to decrease fH binding can increase protective antibody responses in human fH transgenic mice. Collectively the data suggest that mutant fHbp antigens with decreased fH binding will result in superior vaccines in humans. Copyright © 2013 Elsevier Ltd. All rights reserved.
Factor VIIa binding and internalization in hepatocytes
DEFF Research Database (Denmark)
Hjortoe, G; Sorensen, B B; Petersen, L C
2005-01-01
The liver is believed to be the primary clearance organ for coagulation proteases, including factor VIIa (FVIIa). However, at present, clearance mechanisms for FVIIa in liver are unknown. To obtain information on the FVIIa clearance mechanism, we investigated the binding and internalization...... no effect. HEPG2 cells internalized FVIIa with a rate of 10 fmol 10(-5) cells h(-1). In contrast to HEPG2 cells, FVIIa binding to primary rat hepatocytes was completely independent of TF, and excess unlabeled FVIIa partly reduced the binding of 125I-FVIIa to rat hepatocytes. Further, compared with HEPG2...... cells, three- to fourfold more FVIIa bound to rat primary hepatocytes, and the bound FVIIa was internalized at a faster rate. Similar FVIIa binding and internalization profiles were observed in primary human hepatocytes. Plasma inhibitors had no effect on FVIIa binding and internalization in hepatocytes...
Factor VII and protein C are phosphatidic acid-binding proteins.
Tavoosi, Narjes; Smith, Stephanie A; Davis-Harrison, Rebecca L; Morrissey, James H
2013-08-20
Seven proteins in the human blood clotting cascade bind, via their GLA (γ-carboxyglutamate-rich) domains, to membranes containing exposed phosphatidylserine (PS), although with membrane binding affinities that vary by 3 orders of magnitude. Here we employed nanodiscs of defined phospholipid composition to quantify the phospholipid binding specificities of these seven clotting proteins. All bound preferentially to nanobilayers in which PS headgroups contained l-serine versus d-serine. Surprisingly, however, nanobilayers containing phosphatidic acid (PA) bound substantially more of two of these proteins, factor VIIa and activated protein C, than did equivalent bilayers containing PS. Consistent with this finding, liposomes containing PA supported higher proteolytic activity by factor VIIa and activated protein C toward their natural substrates (factors X and Va, respectively) than did PS-containing liposomes. Moreover, treating activated human platelets with phospholipase D enhanced the rates of factor X activation by factor VIIa in the presence of soluble tissue factor. We hypothesize that factor VII and protein C bind preferentially to the monoester phosphate of PA because of its accessibility and higher negative charge compared with the diester phosphates of most other phospholipids. We further found that phosphatidylinositol 4-phosphate, which contains a monoester phosphate attached to its myo-inositol headgroup, also supported enhanced enzymatic activity of factor VIIa and activated protein C. We conclude that factor VII and protein C bind preferentially to monoester phosphates, which may have implications for the function of these proteases in vivo.
Monolayer structures of alkyl aldehydes: Odd-membered homologues
International Nuclear Information System (INIS)
Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.
2011-01-01
Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.
Fenyk, Stepan; Townsend, Philip D; Dixon, Christopher H; Spies, Gerhard B; de San Eustaquio Campillo, Alba; Slootweg, Erik J; Westerhof, Lotte B; Gawehns, Fleur K K; Knight, Marc R; Sharples, Gary J; Goverse, Aska; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J
2015-10-09
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable cells to respond to pathogen attack. Several NLRs act in the nucleus; however, conserved nuclear targets that support their role in immunity are unknown. Previously, we noted a structural homology between the nucleotide-binding domain of NLRs and DNA replication origin-binding Cdc6/Orc1 proteins. Here we show that the NB-ARC (nucleotide-binding, Apaf-1, R-proteins, and CED-4) domain of the Rx1 NLR of potato binds nucleic acids. Rx1 induces ATP-dependent bending and melting of DNA in vitro, dependent upon a functional P-loop. In situ full-length Rx1 binds nuclear DNA following activation by its cognate pathogen-derived effector protein, the coat protein of potato virus X. In line with its obligatory nucleocytoplasmic distribution, DNA binding was only observed when Rx1 was allowed to freely translocate between both compartments and was activated in the cytoplasm. Immune activation induced by an unrelated NLR-effector pair did not trigger an Rx1-DNA interaction. DNA binding is therefore not merely a consequence of immune activation. These data establish a role for DNA distortion in Rx1 immune signaling and define DNA as a molecular target of an activated NLR. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
The decorin sequence SYIRIADTNIT binds collagen type I
DEFF Research Database (Denmark)
Kalamajski, Sebastian; Aspberg, Anders; Oldberg, Ake
2007-01-01
Decorin belongs to the small leucine-rich repeat proteoglycan family, interacts with fibrillar collagens, and regulates the assembly, structure, and biomechanical properties of connective tissues. The decorin-collagen type I-binding region is located in leucine-rich repeats 5-6. Site......-directed mutagenesis of this 54-residue-long collagen-binding sequence identifies Arg-207 and Asp-210 in leucine-rich repeat 6 as crucial for the binding to collagen. The synthetic peptide SYIRIADTNIT, which includes Arg-207 and Asp-210, inhibits the binding of full-length recombinant decorin to collagen in vitro....... These collagen-binding amino acids are exposed on the exterior of the beta-sheet-loop structure of the leucine-rich repeat. This resembles the location of interacting residues in other leucine-rich repeat proteins....
Directory of Open Access Journals (Sweden)
Diego La Mendola
2014-05-01
Full Text Available Prion disorders are a group of fatal neurodegenerative conditions of mammals. The key molecular event in the pathogenesis of such diseases is the conformational conversion of prion protein, PrPC, into a misfolded form rich in β-sheet structure, PrPSc, but the detailed mechanistic aspects of prion protein conversion remain enigmatic. There is uncertainty on the precise physiological function of PrPC in healthy individuals. Several evidences support the notion of its role in copper homeostasis. PrPC binds Cu2+ mainly through a domain composed by four to five repeats of eight amino acids. In addition to mammals, PrP homologues have also been identified in birds, reptiles, amphibians and fish. The globular domain of protein is retained in the different species, suggesting that the protein carries out an essential common function. However, the comparison of amino acid sequences indicates that prion protein has evolved differently in each vertebrate class. The primary sequences are strongly conserved in each group, but these exhibit a low similarity with those of mammals. The N-terminal domain of different prions shows tandem amino acid repeats with an increasing amount of histidine residues going from amphibians to mammals. The difference in the sequence affects the number of copper binding sites, the affinity and the coordination environment of metal ions, suggesting that the involvement of prion in metal homeostasis may be a specific characteristic of mammalian prion protein. In this review, we describe the similarities and the differences in the metal binding of different species’ prion protein, as revealed by studies carried out on the entire protein and related peptide fragments.
Characterization of a second ligand binding site of the insulin receptor
International Nuclear Information System (INIS)
Hao Caili; Whittaker, Linda; Whittaker, Jonathan
2006-01-01
Insulin binding to its receptor is characterized by high affinity, curvilinear Scatchard plots, and negative cooperativity. These properties may be the consequence of binding of insulin to two receptor binding sites. The N-terminal L1 domain and the C-terminus of the α subunit contain one binding site. To locate a second site, we examined the binding properties of chimeric receptors in which the L1 and L2 domains and the first Fibronectin Type III repeat of the insulin-like growth factor-I receptor were replaced by corresponding regions of the insulin receptor. Substitutions of the L2 domain and the first Fibronectin Type III repeat together with the L1 domain produced 80- and 300-fold increases in affinity for insulin. Fusion of these domains to human immunoglobulin Fc fragment produced a protein which bound insulin with a K d of 2.9 nM. These data strongly suggest that these domains contain an insulin binding site
Deng, Dong; Yan, Chuangye; Wu, Jianping; Pan, Xiaojing; Yan, Nieng
2014-04-01
Transcription activator-like (TAL) effectors specifically bind to double stranded (ds) DNA through a central domain of tandem repeats. Each TAL effector (TALE) repeat comprises 33-35 amino acids and recognizes one specific DNA base through a highly variable residue at a fixed position in the repeat. Structural studies have revealed the molecular basis of DNA recognition by TALE repeats. Examination of the overall structure reveals that the basic building block of TALE protein, namely a helical hairpin, is one-helix shifted from the previously defined TALE motif. Here we wish to suggest a structure-based re-demarcation of the TALE repeat which starts with the residues that bind to the DNA backbone phosphate and concludes with the base-recognition hyper-variable residue. This new numbering system is consistent with the α-solenoid superfamily to which TALE belongs, and reflects the structural integrity of TAL effectors. In addition, it confers integral number of TALE repeats that matches the number of bound DNA bases. We then present fifteen crystal structures of engineered dHax3 variants in complex with target DNA molecules, which elucidate the structural basis for the recognition of bases adenine (A) and guanine (G) by reported or uncharacterized TALE codes. Finally, we analyzed the sequence-structure correlation of the amino acid residues within a TALE repeat. The structural analyses reported here may advance the mechanistic understanding of TALE proteins and facilitate the design of TALEN with improved affinity and specificity.
Kumar, L; Sridhara, S; Singh, B P; Gangal, S V
1998-11-01
Previous studies have established the role of Imperata cylindrica (Ic) pollen in type I allergic disorders. However, no systematic information is available on the allergen composition of Ic pollen extract. To characterize the IgE-binding proteins of Ic pollen extract and to detect the presence of grass group 1, 4 and 5 allergen homologues, if any. Pollen extract of Ic was analyzed by in vivo and in vitro procedures such as intradermal tests (ID), enzyme-linked immunosorbent assay (ELISA), ELISA-inhibition, thin-layer isoelectric focusing (TLIEF), sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. Dot blot assay was carried out to check the presence of well-known group 1, 4, and 5 allergen homologues in Ic pollen extract. Out of 303 respiratory allergies patients skin-tested, 27 showed sensitivity to Ic pollen extract. Specific IgE levels were elevated in all 15 serum samples tested. The extract prepared for this study was found to be highly potent since it required only 400 ng of homologous proteins for 50% inhibition of binding in ELISA inhibition assays. TLIEF of Ic pollen extract showed 44 silver-stained bands (pI 3.5-7.0) while SDS-PAGE resolved it into 24 Coomassie-Brilliant-Blue-stained bands (MW 100-10 kD). Immunoblotting with individual patient sera recognized 7 major IgE-binding bands (MW 85, 62, 57, 43, 40, 28 and 16 kD) in Ic pollen extract. A panel of monoclonal antibodies, specific to group 1, 4 and 5 allergens from Phleum pratense pollen extract identified group 5 and group 4 homologues in Ic pollen extract. Ic pollen extract was characterized for the protein profile by TLIEF and SDS-PAGE. IgE reactivity was determined by ELISA and immunoblot. Monoclonal antibodies to group 5 and group 4 allergens reacted weakly showing that this pollen contains group 5 and group 4 homologous allergens.
Directory of Open Access Journals (Sweden)
Phelan Anne
2007-06-01
Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.
Sueldo, D.J.; Shimels, M.Z.; Spiridon, L.N.; Caldararu, O.; Petrescu, A.J.; Joosten, M.H.A.J.; Tameling, W.I.L.
2015-01-01
•Plant nucleotide-binding, leucine-rich repeat (NB-LRR) proteins confer immunity to pathogens possessing the corresponding avirulence proteins. Activation of NB-LRR proteins is often associated with induction of the hypersensitive response (HR), a form of programmed cell death. •NRC1 (NB-LRR
Giuntini, Serena; Reason, Donald C; Granoff, Dan M
2011-09-01
Binding of the complement-downregulating protein factor H (fH) to the surface of the meningococcus is important for survival of the organism in human serum. The meningococcal vaccine candidate factor H binding protein (fHbp) is an important ligand for human fH. While some fHbp-specific monoclonal antibodies (MAbs) block binding of fH to fHbp, the stoichiometry of blocking in the presence of high serum concentrations of fH and its effect on complement-mediated bactericidal activity are unknown. To investigate this question, we constructed chimeric antibodies in which the human IgG1 constant region was paired with three murine fHbp-specific binding domains designated JAR 3, JAR 5, and MAb502. By surface plasmon resonance, the association rates for binding of all three MAbs to immobilized fHbp were >50-fold higher than that for binding of fH to fHbp, and the MAb dissociation rates were >500-fold lower than that for fH. While all three MAbs elicited similar C1q-dependent C4b deposition on live bacteria (classical complement pathway), only those antibodies that inhibited binding of fH to fHbp (JAR 3 and JAR 5) had bactericidal activity with human complement. MAb502, which did not inhibit fH binding, had complement-mediated bactericidal activity only when tested with fH-depleted human complement. When an IgG1 anti-fHbp MAb binds to sparsely exposed fHbp on the bacterial surface, there appears to be insufficient complement activation for bacteriolysis unless fH binding also is inhibited. The ability of fHbp vaccines to elicit protective antibodies, therefore, is likely to be enhanced if the antibody repertoire is of high avidity and includes fH-blocking activity.
Suzuki, Toru; Muto, Shinsuke; Miyamoto, Saku; Aizawa, Kenichi; Horikoshi, Masami; Nagai, Ryozo
2003-08-01
Transcription involves molecular interactions between general and regulatory transcription factors with further regulation by protein-protein interactions (e.g. transcriptional cofactors). Here we describe functional interaction between DNA-binding transcription factor and histone chaperone. Affinity purification of factors interacting with the DNA-binding domain of the transcription factor Sp1 showed Sp1 to interact with the histone chaperone TAF-I, both alpha and beta isoforms. This interaction was specific as Sp1 did not interact with another histone chaperone CIA nor did other tested DNA-binding regulatory factors (MyoD, NFkappaB, p53) interact with TAF-I. Interaction of Sp1 and TAF-I occurs both in vitro and in vivo. Interaction with TAF-I results in inhibition of DNA-binding, and also likely as a result of such, inhibition of promoter activation by Sp1. Collectively, we describe interaction between DNA-binding transcription factor and histone chaperone which results in negative regulation of the former. This novel regulatory interaction advances our understanding of the mechanisms of eukaryotic transcription through DNA-binding regulatory transcription factors by protein-protein interactions, and also shows the DNA-binding domain to mediate important regulatory interactions.
Effect of cobratoxin binding on the normal mode vibration within acetylcholine binding protein.
Bertaccini, Edward J; Lindahl, Erik; Sixma, Titia; Trudell, James R
2008-04-01
Recent crystal structures of the acetylcholine binding protein (AChBP) have revealed surprisingly small structural alterations upon ligand binding. Here we investigate the extent to which ligand binding may affect receptor dynamics. AChBP is a homologue of the extracellular component of ligand-gated ion channels (LGICs). We have previously used an elastic network normal-mode analysis to propose a gating mechanism for the LGICs and to suggest the effects of various ligands on such motions. However, the difficulties with elastic network methods lie in their inability to account for the modest effects of a small ligand or mutation on ion channel motion. Here, we report the successful application of an elastic network normal mode technique to measure the effects of large ligand binding on receptor dynamics. The present calculations demonstrate a clear alteration in the native symmetric motions of a protein due to the presence of large protein cobratoxin ligands. In particular, normal-mode analysis revealed that cobratoxin binding to this protein significantly dampened the axially symmetric motion of the AChBP that may be associated with channel gating in the full nAChR. The results suggest that alterations in receptor dynamics could be a general feature of ligand binding.
Ding, Yang; Zhao, Jinhong; Nie, Ying; Fan, Bei; Wu, Shujuan; Zhang, Yu; Sheng, Jiping; Shen, Lin; Zhao, Ruirui; Tang, Xuanming
2016-11-02
Effects of salicylic acid (SA) on gibberellin (GA) homeostasis, C-repeat/dehydration-responsive element binding factor (CBF) pathway, and antioxidant enzyme systems linked to chilling- and oxidative-stress tolerance in tomato fruit were investigated. Mature green tomatoes (Solanum lycopersicum L. cv. Moneymaker) were treated with 0, 0.5, and 1 mM SA solution for 15 min before storage at 4 °C for 28 days. In comparison to 0 or 0.5 mM SA, 1 mM SA significantly decreased the chilling injury (CI) index in tomato fruit. In the SA-treated fruit, the upregulation of GA biosynthetic gene (GA3ox1) expression was followed by gibberellic acid (GA 3 ) surge and DELLA protein degradation. CBF1 participated in the SA-modulated tolerance and stimulated the expression of GA catabolic gene (GA2ox1). Furthermore, 1 mM SA enhanced activities of antioxidant enzymes and, thus, reduced reactive oxygen species accumulation. Our findings suggest that SA might protect tomato fruit from CI and oxidative damage through regulating GA metabolism, CBF1 gene expression, and antioxidant enzyme activities.
Alanine repeats influence protein localization in splicing speckles and paraspeckles.
Chang, Shuo-Hsiu; Chang, Wei-Lun; Lu, Chia-Chen; Tarn, Woan-Yuh
2014-12-16
Mammalian splicing regulatory protein RNA-binding motif protein 4 (RBM4) has an alanine repeat-containing C-terminal domain (CAD) that confers both nuclear- and splicing speckle-targeting activities. Alanine-repeat expansion has pathological potential. Here we show that the alanine-repeat tracts influence the subnuclear targeting properties of the RBM4 CAD in cultured human cells. Notably, truncation of the alanine tracts redistributed a portion of RBM4 to paraspeckles. The alanine-deficient CAD was sufficient for paraspeckle targeting. On the other hand, alanine-repeat expansion reduced the mobility of RBM4 and impaired its splicing activity. We further took advantage of the putative coactivator activator (CoAA)-RBM4 conjoined splicing factor, CoAZ, to investigate the function of the CAD in subnuclear targeting. Transiently expressed CoAZ formed discrete nuclear foci that emerged and subsequently separated-fully or partially-from paraspeckles. Alanine-repeat expansion appeared to prevent CoAZ separation from paraspeckles, resulting in their complete colocalization. CoAZ foci were dynamic but, unlike paraspeckles, were resistant to RNase treatment. Our results indicate that the alanine-rich CAD, in conjunction with its conjoined RNA-binding domain(s), differentially influences the subnuclear localization and biogenesis of RBM4 and CoAZ. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Large Polyglutamine Repeats Cause Muscle Degeneration in SCA17 Mice
Directory of Open Access Journals (Sweden)
Shanshan Huang
2015-10-01
Full Text Available In polyglutamine (polyQ diseases, large polyQ repeats cause juvenile cases with different symptoms than those of adult-onset patients, who carry smaller expanded polyQ repeats. The mechanisms behind the differential pathology mediated by different polyQ repeat lengths remain unknown. By studying knockin mouse models of spinal cerebellar ataxia-17 (SCA17, we found that a large polyQ (105 glutamines in the TATA-box-binding protein (TBP preferentially causes muscle degeneration and reduces the expression of muscle-specific genes. Direct expression of TBP with different polyQ repeats in mouse muscle revealed that muscle degeneration is mediated only by the large polyQ repeats. Different polyQ repeats differentially alter TBP’s interaction with neuronal and muscle-specific transcription factors. As a result, the large polyQ repeat decreases the association of MyoD with TBP and DNA promoters. Our findings suggest that specific alterations in protein interactions by large polyQ repeats may account for the unique pathology in juvenile polyQ diseases.
Large Polyglutamine Repeats Cause Muscle Degeneration in SCA17 Mice
Huang, Shanshan; Yang, Su; Guo, Jifeng; Yan, Sen; Gaertig, Marta A.; Li, Shihua; Li, Xiao-Jiang
2015-01-01
SUMMARY In polyglutamine (polyQ) diseases, large polyQ repeats cause juvenile cases with different symptoms than adult-onset patients, who carry smaller expanded polyQ repeats. The mechanisms behind the differential pathology mediated by different polyQ repeat lengths remain unknown. By studying knock-in mouse models of spinal cerebellar ataxia-17 (SCA17), we found that a large polyQ (105 glutamines) in the TATA box-binding protein (TBP) preferentially causes muscle degeneration and reduces the expression of muscle-specific genes. Direct expression of TBP with different polyQ repeats in mouse muscle revealed that muscle degeneration is mediated only by the large polyQ repeats. Different polyQ repeats differentially alter TBP’s interaction with neuronal and muscle-specific transcription factors. As a result, the large polyQ repeat decreases the association of MyoD with TBP and DNA promoters. Our findings suggest that specific alterations in protein interactions by large polyQ repeats may account for the unique pathology in juvenile polyQ diseases. PMID:26387956
Hofer, Philipp; Zöchmeister, Cornelia; Behm, Christian; Brezina, Stefanie; Baierl, Andreas; Doriguzzi, Angelina; Vanas, Vanita; Holzmann, Klaus; Sutterlüty-Fall, Hedwig; Gsur, Andrea
2017-04-25
MNS16A, a functional polymorphic tandem repeat minisatellite, is located in the promoter region of an antisense transcript of the human telomerase reverse transcriptase gene. MNS16A promoter activity depends on the variable number of tandem repeats (VNTR) presenting varying numbers of transcription factor binding sites for GATA binding protein 1. Although MNS16A has been investigated in multiple cancer epidemiology studies with incongruent findings, functional data of only two VNTRs (VNTR-243 and VNTR-302) were available thus far, linking the shorter VNTR to higher promoter activity.For the first time, we investigated promoter activity of all six VNTRs of MNS16A in cell lines of colorectal, lung and prostate cancer using Luciferase reporter assay. In all investigated cell lines shorter VNTRs showed higher promoter activity. While this anticipated indirect linear relationship was affirmed for colorectal cancer SW480 (P = 0.006), a piecewise linear regression model provided significantly better model fit in lung cancer A-427 (P = 6.9 × 10-9) and prostate cancer LNCaP (P = 0.039). In silico search for transcription factor binding sites in MNS16A core repeat element suggested a higher degree of complexity involving X-box binding protein 1, general transcription factor II-I, and glucocorticoid receptor alpha in addition to GATA binding protein 1.Further functional studies in additional cancers are requested to extend our knowledge of MNS16A functionality uncovering potential cancer type-specific differences. Risk alleles may vary in different malignancies and their determination in vitro could be relevant for interpretation of genotype data.
Directory of Open Access Journals (Sweden)
Wang Haiyang
2002-12-01
Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.
Comprehensive human transcription factor binding site map for combinatory binding motifs discovery.
Directory of Open Access Journals (Sweden)
Arnoldo J Müller-Molina
Full Text Available To know the map between transcription factors (TFs and their binding sites is essential to reverse engineer the regulation process. Only about 10%-20% of the transcription factor binding motifs (TFBMs have been reported. This lack of data hinders understanding gene regulation. To address this drawback, we propose a computational method that exploits never used TF properties to discover the missing TFBMs and their sites in all human gene promoters. The method starts by predicting a dictionary of regulatory "DNA words." From this dictionary, it distills 4098 novel predictions. To disclose the crosstalk between motifs, an additional algorithm extracts TF combinatorial binding patterns creating a collection of TF regulatory syntactic rules. Using these rules, we narrowed down a list of 504 novel motifs that appear frequently in syntax patterns. We tested the predictions against 509 known motifs confirming that our system can reliably predict ab initio motifs with an accuracy of 81%-far higher than previous approaches. We found that on average, 90% of the discovered combinatorial binding patterns target at least 10 genes, suggesting that to control in an independent manner smaller gene sets, supplementary regulatory mechanisms are required. Additionally, we discovered that the new TFBMs and their combinatorial patterns convey biological meaning, targeting TFs and genes related to developmental functions. Thus, among all the possible available targets in the genome, the TFs tend to regulate other TFs and genes involved in developmental functions. We provide a comprehensive resource for regulation analysis that includes a dictionary of "DNA words," newly predicted motifs and their corresponding combinatorial patterns. Combinatorial patterns are a useful filter to discover TFBMs that play a major role in orchestrating other factors and thus, are likely to lock/unlock cellular functional clusters.
Poly-dipeptides encoded by the C9orf72 repeats bind nucleoli, impede RNA biogenesis, and kill cells.
Kwon, Ilmin; Xiang, Siheng; Kato, Masato; Wu, Leeju; Theodoropoulos, Pano; Wang, Tao; Kim, Jiwoong; Yun, Jonghyun; Xie, Yang; McKnight, Steven L
2014-09-05
Many RNA regulatory proteins controlling pre-messenger RNA splicing contain serine:arginine (SR) repeats. Here, we found that these SR domains bound hydrogel droplets composed of fibrous polymers of the low-complexity domain of heterogeneous ribonucleoprotein A2 (hnRNPA2). Hydrogel binding was reversed upon phosphorylation of the SR domain by CDC2-like kinases 1 and 2 (CLK1/2). Mutated variants of the SR domains changing serine to glycine (SR-to-GR variants) also bound to hnRNPA2 hydrogels but were not affected by CLK1/2. When expressed in mammalian cells, these variants bound nucleoli. The translation products of the sense and antisense transcripts of the expansion repeats associated with the C9orf72 gene altered in neurodegenerative disease encode GRn and PRn repeat polypeptides. Both peptides bound to hnRNPA2 hydrogels independent of CLK1/2 activity. When applied to cultured cells, both peptides entered cells, migrated to the nucleus, bound nucleoli, and poisoned RNA biogenesis, which caused cell death. Copyright © 2014, American Association for the Advancement of Science.
Human corpus luteum: presence of epidermal growth factor receptors and binding characteristics
International Nuclear Information System (INIS)
Ayyagari, R.R.; Khan-Dawood, F.S.
1987-01-01
Epidermal growth factor receptors are present in many reproductive tissues but have not been demonstrated in the human corpus luteum. To determine the presence of epidermal growth factor receptors and its binding characteristics, we carried out studies on the plasma cell membrane fraction of seven human corpora lutea (days 16 to 25) of the menstrual cycle. Specific epidermal growth factor receptors were present in human corpus luteum. Insulin, nerve growth factor, and human chorionic gonadotropin did not competitively displace epidermal growth factor binding. The optimal conditions for corpus luteum-epidermal growth factor receptor binding were found to be incubation for 2 hours at 4 degrees C with 500 micrograms plasma membrane protein and 140 femtomol 125 I-epidermal growth factor per incubate. The number (mean +/- SEM) of epidermal growth factor binding sites was 12.34 +/- 2.99 X 10(-19) mol/micrograms protein; the dissociation constant was 2.26 +/- 0.56 X 10(-9) mol/L; the association constant was 0.59 +/- 0.12 X 10(9) L/mol. In two regressing corpora lutea obtained on days 2 and 3 of the menstrual cycle, there was no detectable specific epidermal growth factor receptor binding activity. Similarly no epidermal growth factor receptor binding activity could be detected in ovarian stromal tissue. Our findings demonstrate that specific receptors for epidermal growth factor are present in the human corpus luteum. The physiologic significance of epidermal growth factor receptors in human corpus luteum is unknown, but epidermal growth factor may be involved in intragonadal regulation of luteal function
The Mycobacterium tuberculosis homologue of the Mycobacterium ...
African Journals Online (AJOL)
With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...
Expansion of protein domain repeats.
Directory of Open Access Journals (Sweden)
Asa K Björklund
2006-08-01
Full Text Available Many proteins, especially in eukaryotes, contain tandem repeats of several domains from the same family. These repeats have a variety of binding properties and are involved in protein-protein interactions as well as binding to other ligands such as DNA and RNA. The rapid expansion of protein domain repeats is assumed to have evolved through internal tandem duplications. However, the exact mechanisms behind these tandem duplications are not well-understood. Here, we have studied the evolution, function, protein structure, gene structure, and phylogenetic distribution of domain repeats. For this purpose we have assigned Pfam-A domain families to 24 proteomes with more sensitive domain assignments in the repeat regions. These assignments confirmed previous findings that eukaryotes, and in particular vertebrates, contain a much higher fraction of proteins with repeats compared with prokaryotes. The internal sequence similarity in each protein revealed that the domain repeats are often expanded through duplications of several domains at a time, while the duplication of one domain is less common. Many of the repeats appear to have been duplicated in the middle of the repeat region. This is in strong contrast to the evolution of other proteins that mainly works through additions of single domains at either terminus. Further, we found that some domain families show distinct duplication patterns, e.g., nebulin domains have mainly been expanded with a unit of seven domains at a time, while duplications of other domain families involve varying numbers of domains. Finally, no common mechanism for the expansion of all repeats could be detected. We found that the duplication patterns show no dependence on the size of the domains. Further, repeat expansion in some families can possibly be explained by shuffling of exons. However, exon shuffling could not have created all repeats.
International Nuclear Information System (INIS)
Jacob, E.; O'Brien, H.A.W.; Mollin, D.L.
1977-01-01
A new radioisotope dilution assay for vitamin B 12 -intrinsic factor complex is described. The method is based on the use of the binding type intrinsic antibody (the binding reagent), which when combined with the intrinsic factor-vitamin B 12 complex (labelled ligand), is quantitatively adsorbed onto zirconium phosphate gel pH 6.25. The new assay has been shown to provide a measure of intrinsic factor comparable with other intrinsic factor assays, but it has the important advantage of being able to measure the unlabelled vitamin B 12 -intrinsic factor complex (unlabelled ligand), and will, therefore, be valuable in the study of physiological events in the gastrointestinal tract. During the study, it was found that there is some evidence for at least two types of binding intrinsic factor antibody: One which combines preferentially with the intrinsic factor-vitamin B 12 complex and one which combines equally well with this complex or with free intrinsic factor. (author)
Detection of a Yersinia pestis gene homologue in rodent samples
Directory of Open Access Journals (Sweden)
Timothy A. Giles
2016-08-01
Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.
Comparison of Transcription Factor Binding Site Models
Bhuyan, Sharifulislam
2012-05-01
Modeling of transcription factor binding sites (TFBSs) and TFBS prediction on genomic sequences are important steps to elucidate transcription regulatory mechanism. Dependency of transcription regulation on a great number of factors such as chemical specificity, molecular structure, genomic and epigenetic characteristics, long distance interaction, makes this a challenging problem. Different experimental procedures generate evidence that DNA-binding domains of transcription factors show considerable DNA sequence specificity. Probabilistic modeling of TFBSs has been moderately successful in identifying patterns from a family of sequences. In this study, we compare performances of different probabilistic models and try to estimate their efficacy over experimental TFBSs data. We build a pipeline to calculate sensitivity and specificity from aligned TFBS sequences for several probabilistic models, such as Markov chains, hidden Markov models, Bayesian networks. Our work, containing relevant statistics and evaluation for the models, can help researchers to choose the most appropriate model for the problem at hand.
Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam
2017-10-01
In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Sahijdak, W.M.; Yang, Chin-Rang; Zuckerman, J.S.; Meyers, M.; Boothman, D.A.
1994-01-01
We analyzed alterations in transcription factor binding to specific, known promoter DNA consensus sequences between irradiated and unirradiated radioresistant human melanoma (U1-Mel) cells. The goal of this study was to begin to investigate which transcription factors and DNA-binding sites are responsible for the induction of specific transcripts and proteins after ionizing radiation. Transcription factor binding was observed using DNA band-shift assays and oligonucleotide competition analyses. Confluence-arrested U1-Mel cells were irradiated (4.5 Gy) and harvested at 4 h. Double-stranded oligonucleotides containing known DNA-binding consensus sites for specific transcription factors were used. Increased DNA binding activity after ionizing radiation was noted with oligonucleotides containing the CREB, NF-kB and Sp1 consensus sites. No changes in protein binding to AP-1, AP-2, AP-3, or CTF/NF1, GRE or Oct-1 consensus sequences were noted. X-ray activation of select transcription factors, which bind certain consensus sites in promoters, may cause specific induction or repression of gene transcription. 22 refs., 2 figs
International Nuclear Information System (INIS)
Bertin, Benjamin; Caby, Stephanie; Oger, Frederik; Sasorith, Souphatta; Wurtz, Jean-Marie; Pierce, Raymond J.
2005-01-01
In an attempt to understand development and differentiation processes of the parasitic blood fluke Schistosoma mansoni, several members of the nuclear receptor superfamily were cloned, including SmFtz-F1 (S. mansoni Fushi Tarazu-factor 1). The Ftz-F1 nuclear receptor subfamily only contains orphan receptors that bind to their response element as monomers. Whereas SmFtz-F1 displays these basic functional properties, we have identified an original and specific interaction between SmFtz-F1 and the schistosome RXR homologue, SmRXR1. The mammalian two-hybrid assay showed that the D, E, and F domains of SmFtz-F1 were capable of interacting specifically with the E domain of SmRXR1 but not with that of mouse RXRα. Using three-dimensional LBD homology modelling and structure-guided mutagenesis, we were able to demonstrate the essential role of exposed residues located in the dimerization interfaces of both receptors in the maintenance of the interaction. Cotransfection experiments with constructions encoding full-length nuclear receptors show that SmRXR1 potentiates the transcriptional activity of SmFtz-F1 from various promoters. Nevertheless, the lack of identification of a dimeric response element for this SmFtz-F1/SmRXR1 heterodimer seems to indicate a 'tethering' mechanism. Thus, our results suggest for the first time that a member of the Ftz-F1 family could heterodimerize functionally with a homologue of the universal heterodimerization partner of nuclear receptors. This unique property confirms that SmFtz-F1 may be involved in the development and differentiation of schistosome-specific structures
Position specific variation in the rate of evolution intranscription factor binding sites
Energy Technology Data Exchange (ETDEWEB)
Moses, Alan M.; Chiang, Derek Y.; Kellis, Manolis; Lander, EricS.; Eisen, Michael B.
2003-08-28
The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Here we analyze the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikataeto study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artifacts of computational motif finding algorithms. As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative
Babbitt, G A
2010-10-15
The spurious (or nonfunctional) binding of transcription factors (TF) to the wrong locations on DNA presents a formidable challenge to genomes given the relatively low ceiling for sequence complexity within the short lengths of most binding motifs. The high potential for the occurrence of random motifs and subsequent nonfunctional binding of many transcription factors should theoretically lead to natural selection against the occurrence of spurious motif throughout the genome. However, because of the active role that chromatin can influence over eukaryotic gene regulation, it may also be expected that many supposed spurious binding sites could escape purifying selection if (A) they simply occur in regions of high nucleosome occupancy or (B) their surrounding chromatin was dynamically involved in their identity and function. We compared nucleosome occupancy and the presence/absence of functionally conserved chromatin context to the strength of selection against spurious binding of various TF binding motifs in Saccharomyces yeast. While we find no direct relationship with nucleosome occupancy, we find strong evidence that transcription factors spatially associated with evolutionarily conserved chromatin states are under relaxed selection against accidental binding. Transcription factors (with/without) a conserved chromatin context were found to occur on average, (87.7%/49.3%) of their expected frequencies. Functional binding motifs with conserved chromatin contexts were also significantly shorter in length and more often clustered. These results indicate a role of chromatin context dependency in relaxing selection against spurious binding in nearly half of all TF binding motifs throughout the yeast genome. 2010 Elsevier B.V. All rights reserved.
Phosphatase and tensin homologue deleted on chromosome 10 ...
African Journals Online (AJOL)
Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...
Triiodothyronine radioimmunoassay. Comparison of the different factors between two technics
International Nuclear Information System (INIS)
Gehin-Fouque, F.; Etling, N.; Pradelles, P.; Bornet, H.
1980-01-01
Triiodothyronine concentration was determined in human serum and in thyroid extracts by two radioimmunoassay technics. Both antibodies, radioactive T 3 , stable T 3 , protein-binding-hormone inhibitors, methods used to separate the free from the bound fractions were different. Each factor from a method was substituted to the homologue of the other method. The results occasionnally showed a variation of 32% in the first method and 50% in the second one. However the results gave a correct interpretation of the triiodothyronine values measured in human serum and in thyroid extracts [fr
Directory of Open Access Journals (Sweden)
Ronne Hans
2008-11-01
Full Text Available Abstract Background The rate of mRNA transcription is controlled by transcription factors that bind to specific DNA motifs in promoter regions upstream of protein coding genes. Recent results indicate that not only the presence of a motif but also motif context (for example the orientation of a motif or its location relative to the coding sequence is important for gene regulation. Results In this study we present ContextFinder, a tool that is specifically aimed at identifying cases where motif context is likely to affect gene regulation. We used ContextFinder to examine the role of motif context in S. cerevisiae both for DNA binding by transcription factors and for effects on gene expression. For DNA binding we found significant patterns of motif location bias, whereas motif orientations did not seem to matter. Motif context appears to affect gene expression even more than it affects DNA binding, as biases in both motif location and orientation were more frequent in promoters of co-expressed genes. We validated our results against data on nucleosome positioning, and found a negative correlation between preferred motif locations and nucleosome occupancy. Conclusion We conclude that the requirement for stable binding of transcription factors to DNA and their subsequent function in gene regulation can impose constraints on motif context.
Xu, F; Liang, X; Lin, B; Su, F
1999-03-01
Based on the linear retention equation of the logarithm of the capacity factor (logk') vs. the methanol volume fraction (psi) of aqueous binary mobile phase in soil leaching column chromatography, the intersection point rule for the logk' of homologues and weak polar chlorobenzenes, with psi, as well as with boiling point, has been derived due to existence of the similar interactions among solutes of the same series, stationary phase (soil) and eluent (methanol-water). These rules were testified by experimental data of homologues (n-alkylbenzenes, methylbenzenes) and weak polar chlorobenzenes.
RNA binding specificity of Ebola virus transcription factor VP30.
Schlereth, Julia; Grünweller, Arnold; Biedenkopf, Nadine; Becker, Stephan; Hartmann, Roland K
2016-09-01
The transcription factor VP30 of the non-segmented RNA negative strand Ebola virus balances viral transcription and replication. Here, we comprehensively studied RNA binding by VP30. Using a novel VP30:RNA electrophoretic mobility shift assay, we tested truncated variants of 2 potential natural RNA substrates of VP30 - the genomic Ebola viral 3'-leader region and its complementary antigenomic counterpart (each ∼155 nt in length) - and a series of other non-viral RNAs. Based on oligonucleotide interference, the major VP30 binding region on the genomic 3'-leader substrate was assigned to the internal expanded single-stranded region (∼ nt 125-80). Best binding to VP30 was obtained with ssRNAs of optimally ∼ 40 nt and mixed base composition; underrepresentation of purines or pyrimidines was tolerated, but homopolymeric sequences impaired binding. A stem-loop structure, particularly at the 3'-end or positioned internally, supports stable binding to VP30. In contrast, dsRNA or RNAs exposing large internal loops flanked by entirely helical arms on both sides are not bound. Introduction of a 5´-Cap(0) structure impaired VP30 binding. Also, ssDNAs bind substantially weaker than isosequential ssRNAs and heparin competes with RNA for binding to VP30, indicating that ribose 2'-hydroxyls and electrostatic contacts of the phosphate groups contribute to the formation of VP30:RNA complexes. Our results indicate a rather relaxed RNA binding specificity of filoviral VP30, which largely differs from that of the functionally related transcription factor of the Paramyxoviridae which binds to ssRNAs as short as 13 nt with a preference for oligo(A) sequences.
National Research Council Canada - National Science Library
Wang, Yong-Dong
1999-01-01
.... The key approach is to prevent the binding of two transcription factors, ESX and AP-2, to the consensus DNA binding sites contained within the Her2/neu promoter resulting in inhibition of transcription factor function...
Specific binding of atrial natriuretic factor in brain microvessels
International Nuclear Information System (INIS)
Chabrier, P.E.; Roubert, P.; Braquet, P.
1987-01-01
Cerebral capillaries constitute the blood-brain barrier. Studies of specific receptors (neurotransmitters or hormones) located on this structure can be performed by means of radioligand-binding techniques on isolated brain microvessels. The authors examined on pure bovine cerebral microvessel preparations the binding of atrial natriuretic factor (ANF), using 125 I-labeled ANF. Saturation and competition experiments demonstrated the presence of a single class of ANF-binding sites with high affinity and with a binding capacity of 58 fmol/mg of protein. The binding of 125 I-labeled ANF to brain microvessels is specific, reversible, and time dependent, as is shown by association-dissociation experiments. The demonstration of specific ANF-binding sites on brain microvessels supposes a physiological role of ANF on brain microvasculature. The coexistence of ANF and angiotensin II receptors on this cerebrovascular tissue suggests that the two circulating peptides may act as mutual antagonists in the regulation of brain microcirculation and/or blood-brain barrier function
Characterization of four RecQ homologues from rice (Oryza sativa L. cv. Nipponbare)
International Nuclear Information System (INIS)
Saotome, Ai; Kimura, Seisuke; Mori, Yoko; Uchiyama, Yukinobu; Morohashi, Kengo; Sakaguchi, Kengo
2006-01-01
The RecQ family of DNA helicases is conserved throughout the biological kingdoms. In this report, we have characterized four RecQ homologues clearly expressed in rice. OsRecQ1, OsRecQ886, and OsRecQsim expressions were strongly detected in meristematic tissues. Transcription of the OsRecQ homologues was differentially induced by several types of DNA-damaging agents. The expression of four OsRecQ homologues was induced by MMS and bleomycin. OsRecQ1 and OsRecQ886 were induced by H 2 O 2 , and MitomycinC strongly induced the expression of OsRecQ1. Transient expression of OsRecQ/GFP fusion proteins demonstrated that OsRecQ2 and OsRecQ886 are found in nuclei, whereas OsRecQ1 and OsRecQsim are found in plastids. Neither OsRecQ1 nor OsRecQsim are induced by light. These results indicate that four of the RecQ homologues have different and specific functions in DNA repair pathways, and that OsRecQ1 and OsRecQsim may not involve in plastid differentiation but different aspects of a plastid-specific DNA repair system
A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein
Wang, W.; Takezawa, D.; Poovaiah, B. W.
1996-01-01
A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.
DNA-binding specificity and molecular functions of NAC transcription factors
DEFF Research Database (Denmark)
Olsen, Addie Nina; Ernst, Heidi Asschenfeldt; Lo Leggio, Leila
2005-01-01
The family of NAC (NAM/ATAF1,2/CUC2) transcription factors has been implicated in a wide range of plant processes, but knowledge on the DNA-binding properties of the family is limited. Using a reiterative selection procedure on random oligonucleotides, we have identified consensus binding sites....... Furthermore, NAC protein binding to the CaMV 35S promoter was shown to depend on sequences similar to the consensus of the selected oligonucleotides. Electrophoretic mobility shift assays demonstrated that NAC proteins bind DNA as homo- or heterodimers and that dimerization is necessary for stable DNA binding....... The ability of NAC proteins to dimerize and to bind DNAwas analysed by structure-based mutagenesis. This identified two salt bridge-forming residues essential for NAC protein dimerization. Alteration of basic residues in a loop region containing several highly conserved residues abolished DNA binding. Thus...
International Nuclear Information System (INIS)
Sundaresan, Ramya; Samen, Ulrike; Ponnuraj, Karthe
2011-01-01
Expression, purification and crystallization of Srr-1-K4BD, a human keratin 4-binding domain of serine-rich repeat protein 1 from S. agalactiae, was carried out. Native crystals of Srr-1-K4BD diffracted to 3.8 Å resolution using synchrotron radiation. Serine-rich repeat protein 1 (Srr-1) is a surface protein from Streptococcus agalactiae. A 17 kDa region of this protein has been identified to bind to human keratin 4 (K4) and is termed the Srr-1 K4-binding domain (Srr-1-K4BD). Recombinant Srr-1-K4BD was overexpressed in Escherichia coli BL21 (DE3) cells. Native and selenomethionine-substituted proteins were prepared using Luria–Bertani (LB) and M9 minimal media, respectively. A two-step purification protocol was carried out to obtain a final homogenous sample of Srr-1-K4BD. Crystals of native Srr-1-K4BD were obtained using PEG 3350 as a precipitant. The crystals diffracted to 3.8 Å resolution using synchrotron radiation and belonged to space group P2 1 , with unit-cell parameters a = 47.56, b = 59.48, c = 94.71 Å, β = 93.95°
International Nuclear Information System (INIS)
Marshman, Emma; Streuli, Charles H
2002-01-01
Insulin-like growth factor (IGF)-mediated proliferation and survival are essential for normal development in the mammary gland during puberty and pregnancy. IGFs interact with IGF-binding proteins and regulate their function. The present review focuses on the role of IGFs and IGF-binding proteins in the mammary gland and describes how modulation of their actions occurs by association with hormones, other growth factors and the extracellular matrix. The review will also highlight the involvement of the IGF axis in breast cancer
Directory of Open Access Journals (Sweden)
Yaron Orenstein
Full Text Available The new technology of protein binding microarrays (PBMs allows simultaneous measurement of the binding intensities of a transcription factor to tens of thousands of synthetic double-stranded DNA probes, covering all possible 10-mers. A key computational challenge is inferring the binding motif from these data. We present a systematic comparison of four methods developed specifically for reconstructing a binding site motif represented as a positional weight matrix from PBM data. The reconstructed motifs were evaluated in terms of three criteria: concordance with reference motifs from the literature and ability to predict in vivo and in vitro bindings. The evaluation encompassed over 200 transcription factors and some 300 assays. The results show a tradeoff between how the methods perform according to the different criteria, and a dichotomy of method types. Algorithms that construct motifs with low information content predict PBM probe ranking more faithfully, while methods that produce highly informative motifs match reference motifs better. Interestingly, in predicting high-affinity binding, all methods give far poorer results for in vivo assays compared to in vitro assays.
International Nuclear Information System (INIS)
Denner, Joachim; Specke, Volker; Thiesen, Ulla; Karlas, Alexander; Kurth, Reinhard
2003-01-01
Human-tropic porcine endogenous retroviruses (PERV) such as PERV-A and PERV-B can infect human cells and are therefore a potential risk to recipients of xenotransplants. A similar risk is posed by recombinant viruses containing the receptor-binding site of PERV-A and large parts of the genome of the ecotropic PERV-C including its long terminal repeat (LTR). We describe here the unique organization of the PERV-C LTR and its changes during serial passage of recombinant virus in human cells. An increase in virus titer correlated with an increase in LTR length, caused by multiplication of 37-bp repeats containing nuclear factor Y binding sites. Luciferase dual reporter assays revealed a correlation between the number of repeats and the extent of expression. No alterations have been observed in the receptor-binding site, indicating that the increased titer is due to the changes in the LTR. These data indicate that recombinant PERVs generated during infection of human cells can adapt and subsequently replicate with greater efficiency
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
Repeatability of Maternal Report on Prenatal, Perinatal and Early Postnatal Factors
DEFF Research Database (Denmark)
Hermann, Diana; Suling, Marc; Reisch, Lucia
2011-01-01
To investigate the repeatability of maternal self-reported prenatal, perinatal and early postnatal factors within the IDEFICS (Identification and prevention of dietary- and lifestyle-induced health effects in children and infants) study. Design: Data are from the baseline survey of the longitudin...
Repeat workers' compensation claims: risk factors, costs and work disability
2011-01-01
Background The objective of our study was to describe factors associated with repeat workers' compensation claims and to compare the work disability arising in workers with single and multiple compensation claims. Methods All initial injury claims lodged by persons of working age during a five year period (1996 to 2000) and any repeat claims were extracted from workers' compensation administrative data in the state of Victoria, Australia. Groups of workers with single and multiple claims were identified. Descriptive analysis of claims by affliction, bodily location, industry segment, occupation, employer and workplace was undertaken. Survival analysis determined the impact of these variables on the time between the claims. The economic impact and duration of work incapacity associated with initial and repeat claims was compared between groups. Results 37% of persons with an initial claim lodged a second claim. This group contained a significantly greater proportion of males, were younger and more likely to be employed in manual occupations and high-risk industries than those with single claims. 78% of repeat claims were for a second injury. Duration between the claims was shortest when the working conditions had not changed. The initial claims of repeat claimants resulted in significantly (p claims. Conclusions A substantial proportion of injured workers experience a second occupational injury or disease. These workers pose a greater economic burden than those with single claims, and also experience a substantially greater cumulative period of work disability. There is potential to reduce the social, health and economic burden of workplace injury by enacting prevention programs targeted at these workers. PMID:21696637
Górnaś, Paweł
2015-04-01
The tocochromanol profile was studied in seed oils recovered from by-products of fruit industry, five dessert and seven crab apple varieties grown in Eastern Europe (Latvia). The seed oils obtained from dessert apples were characterized by higher contents of tocopherols (191.05-379.08 mg/100g oil) when compared to seed oils recovered from crab apples (130.55-202.54 mg/100g oil). The predominant homologues of tocopherol in all the studied samples were α and β over γ and δ. However, seed oils recovered from the apple cultivars 'Antej' and 'Beforest' had a unique profile of four tocopherol homologues (α:β:γ:δ) 91.41:80.55:72.46:79.03 and 114.55:112.84:78.69:73.00 mg/100g oil, respectively. A single dilution of seed oils in 2-propanol facilitated the direct use samples in the DPPH assay as well as injection into the RP-HPLC system containing a PFP (pentafluorophenyl) column, which resulted in a rapid separation of all four tocopherol homologues with excellent repeatability and reproducibility. Copyright © 2014 Elsevier Ltd. All rights reserved.
Structural analysis of sumoylated proteins in Schizosaccharomyces pombe
DEFF Research Database (Denmark)
Jørgensen, Maria Louise Mønster
or Sap1-DNA interactions. In addition, the Sap1 function relationship was investigated in vivo by repeating a search for suppressors of the slow growth phenotype of abp1Δ cbh1Δ mutants. Autonomously replicating sequence binding protein 1 (Abp1) and cenp-B homologue 1 (Cbh1) co-localise with Sap1 in some...
Modeling Shear Induced Von Willebrand Factor Binding to Collagen
Dong, Chuqiao; Wei, Wei; Morabito, Michael; Webb, Edmund; Oztekin, Alparslan; Zhang, Xiaohui; Cheng, Xuanhong
2017-11-01
Von Willebrand factor (vWF) is a blood glycoprotein that binds with platelets and collagen on injured vessel surfaces to form clots. VWF bioactivity is shear flow induced: at low shear, binding between VWF and other biological entities is suppressed; for high shear rate conditions - as are found near arterial injury sites - VWF elongates, activating its binding with platelets and collagen. Based on parameters derived from single molecule force spectroscopy experiments, we developed a coarse-grain molecular model to simulate bond formation probability as a function of shear rate. By introducing a binding criterion that depends on the conformation of a sub-monomer molecular feature of our model, the model predicts shear-induced binding, even for conditions where binding is highly energetically favorable. We further investigate the influence of various model parameters on the ability to predict shear-induced binding (vWF length, collagen site density and distribution, binding energy landscape, and slip/catch bond length) and demonstrate parameter ranges where the model provides good agreement with existing experimental data. Our results may be important for understanding vWF activity and also for achieving targeted drug therapy via biomimetic synthetic molecules. National Science Foundation (NSF),Division of Mathematical Sciences (DMS).
DNA residence time is a regulatory factor of transcription repression
Clauß, Karen; Popp, Achim P.; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N. Henriette
2017-01-01
Abstract Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. PMID:28977492
Oxygen dependency of epidermal growth factor receptor binding and DNA synthesis of rat hepatocytes
International Nuclear Information System (INIS)
Hirose, Tetsuro; Terajima, Hiroaki; Yamauchi, Akira
1997-01-01
Background/Aims: Changes in oxygen availability modulate replicative responses in several cell types, but the effects on hepatocyte replication remain unclear. We have studied the effects of transient nonlethal hypoxia on epidermal growth factor receptor binding and epidermal growth factor-induced DNA synthesis of rat hepatocytes. Methods: Lactate dehydrogenase activity in culture supernatant, intracellular adenosine triphosphate content, 125 I-epidermal growth factor specific binding, epidermal growth factor receptor protein expression, and 3 H-thymidine incorporation were compared between hepatocytes cultured in hypoxia and normoxia. Results: Hypoxia up to 3 h caused no significant increase in lactate dehydrogenase activity in the culture supernatant, while intracellular adenosine triphosphate content decreased time-dependently and was restored to normoxic levels by reoxygenation (nonlethal hypoxia). Concomitantly, 125 I-epidermal growth factor specific binding to hepatocytes decreased time-dependently (to 54.1% of normoxia) and was restored to control levels by reoxygenation, although 125 I-insulin specific binding was not affected. The decrease in 125 I-epidermal growth factor specific binding was explained by the decrease in the number or available epidermal growth factor receptors (21.37±3.08 to 12.16±1.42 fmol/10 5 cells), while the dissociation constant of the receptor was not affected. The change in the number of available receptors was not considered to be due to receptor degradation-resynthesis, since immuno-detection of the epidermal growth factor receptor revealed that the receptor protein expression did not change during hypoxia and reoxygenation, and since neither actinomycin D nor cycloheximide affected the recovery of 125 I-epidermal growth factor binding by reoxygenation. Inhibition of epidermal growth factor-induced DNA synthesis after hypoxia (to 75.4% of normoxia by 3 h hypoxia) paralleled the decrease in 125 I-epidermal growth factor binding
Pereira, L A; van der Knaap, J A; van den Boom, V; van den Heuvel, F A; Timmers, H T
2001-11-01
The human RNA polymerase II transcription factor B-TFIID consists of TATA-binding protein (TBP) and the TBP-associated factor (TAF) TAF(II)170 and can rapidly redistribute over promoter DNA. Here we report the identification of human TBP-binding regions in human TAF(II)170. We have defined the TBP interaction domain of TAF(II)170 within three amino-terminal regions: residues 2 to 137, 290 to 381, and 380 to 460. Each region contains a pair of Huntington-elongation-A subunit-Tor repeats and exhibits species-specific interactions with TBP family members. Remarkably, the altered-specificity TBP mutant (TBP(AS)) containing a triple mutation in the concave surface is defective for binding the TAF(II)170 amino-terminal region of residues 1 to 504. Furthermore, within this region the TAF(II)170 residues 290 to 381 can inhibit the interaction between Drosophila TAF(II)230 (residues 2 to 81) and TBP through competition for the concave surface of TBP. Biochemical analyses of TBP binding to the TATA box indicated that TAF(II)170 region 290-381 inhibits TBP-DNA complex formation. Importantly, the TBP(AS) mutant is less sensitive to TAF(II)170 inhibition. Collectively, our results support a mechanism in which TAF(II)170 induces high-mobility DNA binding by TBP through reversible interactions with its concave DNA binding surface.
Peng, Hui; Zheng, Yunyun; Chen, Maojiao; Wang, Ying; Xiao, Yazhong; Gao, Yi
2014-04-02
A novel starch-binding domain (SBD) that represents a new carbohydrate-binding module family (CBM69) was identified in the α-amylase (AmyP) of the recently established alpha-amylase subfamily GH13_37. The SBD and its homologues come mostly from marine bacteria, and phylogenetic analysis indicates that they are closely related to the CBM20 and CBM48 families. The SBD exhibited a binding preference toward raw rice starch, but the truncated mutant (AmyPΔSBD) still retained similar substrate preference. Kinetic analyses revealed that the SBD plays an important role in soluble starch hydrolysis because different catalytic efficiencies have been observed in AmyP and the AmyPΔSBD. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Menand, Benoit
2002-01-01
TOR (target of rapamycin) protein kinases were identified in yeast, mammals and Drosophila as central controllers of cell growth. Thu, G1 to S phases progression through the cell cycle is blocked by rapamycin, a drug which specifically inhibits TOR activity by forming a ternary complex with the peptidyl-prolyl isomerase FKBP12 (FK506 and rapamycin binding protein), and the FKBP-rapamycin binding domain (FRB) of TOR proteins. This work presents the study, the Arabidopsis homologue of yeast and...
Energy Technology Data Exchange (ETDEWEB)
Choi, Suzy; Kim, Hyun Jin, E-mail: kimhyunjin@skku.edu
2014-01-03
Highlights: •Split-ubiquitin MY2H screen identified GATE16 as an interacting protein of TRPML3. •TRPML3 specifically binds to a mammalian ATG8 homologue GATE16, not to LC3B. •The interaction of TRPML3 with GATE16 facilitates autophagosome formation. •GATE16 is expressed in both autophagosome and extra-autophagosomal compartments. -- Abstract: TRPML3 is a Ca{sup 2+} permeable cation channel expressed in multiple intracellular compartments. Although TRPML3 is implicated in autophagy, how TRPML3 can regulate autophagy is not understood. To search interacting proteins with TRPML3 in autophagy, we performed split-ubiquitin membrane yeast two-hybrid (MY2H) screening with TRPML3-loop as a bait and identified GATE16, a mammalian ATG8 homologue. GST pull-down assay revealed that TRPML3 and TRPML3-loop specifically bind to GATE16, not to LC3B. Co-immunoprecipitation (co-IP) experiments showed that TRPML3 and TRPML3-loop pull down only the lipidated form of GATE16, indicating that the interaction occurs exclusively at the organellar membrane. The interaction of TRPML3 with GATE16 and GATE16-positive vesicle formation were increased in starvation induced autophagy, suggesting that the interaction facilitates the function of GATE16 in autophagosome formation. However, GATE16 was not required for TRPML3 trafficking to autophagosomes. Experiments using dominant-negative (DN) TRPML3(D458K) showed that GATE16 is localized not only in autophagosomes but also in extra-autophagosomal compartments, by contrast with LC3B. Since GATE16 acts at a later stage of the autophagosome biogenesis, our results suggest that TRPML3 plays a role in autophagosome maturation through the interaction with GATE16, by providing Ca{sup 2+} in the fusion process.
Conservation of transcription factor binding events predicts gene expression across species
Hemberg, Martin; Kreiman, Gabriel
2011-01-01
Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to funct...
ARHGEF7 (Beta-PIX acts as guanine nucleotide exchange factor for leucine-rich repeat kinase 2.
Directory of Open Access Journals (Sweden)
Karina Haebig
Full Text Available BACKGROUND: Mutations within the leucine-rich repeat kinase 2 (LRRK2 gene are a common cause of familial and sporadic Parkinson's disease. The multidomain protein LRRK2 exhibits overall low GTPase and kinase activity in vitro. METHODOLOGY/PRINCIPAL FINDINGS: Here, we show that the rho guanine nucleotide exchange factor ARHGEF7 and the small GTPase CDC42 are interacting with LRRK2 in vitro and in vivo. GTPase activity of full-length LRRK2 increases in the presence of recombinant ARHGEF7. Interestingly, LRRK2 phosphorylates ARHGEF7 in vitro at previously unknown phosphorylation sites. We provide evidence that ARHGEF7 might act as a guanine nucleotide exchange factor for LRRK2 and that R1441C mutant LRRK2 with reduced GTP hydrolysis activity also shows reduced binding to ARHGEF7. CONCLUSIONS/SIGNIFICANCE: Downstream effects of phosphorylation of ARHGEF7 through LRRK2 could be (i a feedback control mechanism for LRRK2 activity as well as (ii an impact of LRRK2 on actin cytoskeleton regulation. A newly identified familial mutation N1437S, localized within the GTPase domain of LRRK2, further underlines the importance of the GTPase domain of LRRK2 in Parkinson's disease pathogenesis.
International Nuclear Information System (INIS)
Soutar, A.K.; Knight, B.L.; Patel, D.D.
1989-01-01
The coding region of the low density lipoprotein (LDL)-receptor gene from a patient (MM) with homozygous familial hypercholesterolemia (FH) has been sequenced from six overlapping 500-base-pair amplified fragments of the cDNA from cultured skin fibroblasts. Two separate single nucleotide base changes from the normal sequence were detected. The first involved substitution of guanine for adenine in the third position of the codon for amino acid residue Cys-27 and did not affect the protein sequence. The second mutation was substitution of thymine for cytosine in the DNA for the codon for amino acid residue 664, changing the codon from CCG (proline) to CTG (leucine) and introducing a new site for the restriction enzyme PstI. MM is a true homozygote with two identical genes, and the mutation cosegregated with clinically diagnosed FH in his family in which first cousin marriages occurred frequently. LDL receptors in MM's skin fibroblasts bind less LDL than normal and with reduced affinity. Thus this naturally occurring single point mutation affects both intracellular transport of the protein and ligand binding and occurs in growth factor-like repeat C, a region that has not previously been found to influence LDL binding
Inhibition by Siomycin and Thiostrepton of Both Aminoacyl-tRNA and Factor G Binding to Ribosomes
Ll, Juan Modole; Cabrer, Bartolomé; Parmeggiani, Andrea; Azquez, David V
1971-01-01
Siomycin, a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G, is shown also to inhibit binding of aminoacyl-tRNA; however, it does not impair binding of fMet-tRNA and completion of the initiation complex. Moreover, unlike other inhibitors of aminoacyl-tRNA binding (tetracycline, sparsomycin, and streptogramin A), siomycin completely abolishes the GTPase activity associated with the binding of aminoacyl-tRNA catalyzed by factor Tu. A single-site interaction of siomycin appears to be responsible for its effect on both the binding of the aminoacyl-tRNA-Tu-GTP complex and that of factor G. PMID:4331558
Characterization and DNA-binding specificities of Ralstonia TAL-like effectors
Li, Lixin
2013-07-01
Transcription activator-like effectors (TALEs) from Xanthomonas sp. have been used as customizable DNA-binding modules for genome-engineering applications. Ralstonia solanacearum TALE-like proteins (RTLs) exhibit similar structural features to TALEs, including a central DNA-binding domain composed of 35 amino acid-long repeats. Here, we characterize the RTLs and show that they localize in the plant cell nucleus, mediate DNA binding, and might function as transcriptional activators. RTLs have a unique DNA-binding architecture and are enriched in repeat variable di-residues (RVDs), which determine repeat DNA-binding specificities. We determined the DNA-binding specificities for the RVD sequences ND, HN, NP, and NT. The RVD ND mediates highly specific interactions with C nucleotide, HN interacts specifically with A and G nucleotides, and NP binds to C, A, and G nucleotides. Moreover, we developed a highly efficient repeat assembly approach for engineering RTL effectors. Taken together, our data demonstrate that RTLs are unique DNA-targeting modules that are excellent alternatives to be tailored to bind to user-selected DNA sequences for targeted genomic and epigenomic modifications. These findings will facilitate research concerning RTL molecular biology and RTL roles in the pathogenicity of Ralstonia spp. © 2013 The Author.
Directory of Open Access Journals (Sweden)
Behnaz Heydarchi
Full Text Available An important feature of a potential vaccine against HIV is the production of broadly neutralising antibodies (BrNAbs capable of potentially blocking infectivity of a diverse array of HIV strains. BrNAbs naturally arise in some HIV infected individuals after several years of infection and their serum IgG can neutralise various HIV strains across different subtypes. We previously showed that vaccination of cows with HIV gp140 AD8 trimers resulted in a high titre of serum IgG against HIV envelope (Env that had strong BrNAb activity. These polyclonal BrNAbs concentrated into the colostrum during the late stage of pregnancy and can be harvested in vast quantities immediately after calving. In this study, we investigated the effect of prolonged HIV gp140 vaccination on bovine colostrum IgG HIV Env-binding and BrNAb activity over subsequent pregnancies. Repeated immunisation led to a maintained high titre of HIV Env specific IgG in the colostrum batches, but this did not increase through repeated cycles. Colostrum IgG from all batches also strongly competed with sCD4 binding to gp140 Env trimer and with human-derived monoclonal VRC01 and b12 BrNAbs that bind the CD4 binding site (CD4bs. Furthermore, competition neutralisation assays using RSC3 Env gp120 protein core and a derivative CD4bs mutant, RSC3 Δ371I/P363N, showed that CD4bs neutralising antibodies contribute to the neutralising activity of all batches of purified bovine colostrum IgG. This result indicates that the high IgG titre/avidity of anti-CD4bs antibodies with BrNAb activity was achieved during the first year of vaccination and was sustained throughout the years of repeated vaccinations in the cow tested. Although IgG of subsequent colostrum batches may have a higher avidity towards the CD4bs, the overall breadth in neutralisation was not enhanced. This implies that the boosting vaccinations over 4 years elicited a polyclonal antibody response that maintained the proportion of both
Asap: a framework for over-representation statistics for transcription factor binding sites
DEFF Research Database (Denmark)
Marstrand, Troels T; Frellsen, Jes; Moltke, Ida
2008-01-01
-founded choice. METHODOLOGY: We introduce a software package, Asap, for fast searching with position weight matrices that include several standard methods for assessing over-representation. We have compared the ability of these methods to detect over-represented transcription factor binding sites in artificial......BACKGROUND: In studies of gene regulation the efficient computational detection of over-represented transcription factor binding sites is an increasingly important aspect. Several published methods can be used for testing whether a set of hypothesised co-regulated genes share a common regulatory...... regime based on the occurrence of the modelled transcription factor binding sites. However there is little or no information available for guiding the end users choice of method. Furthermore it would be necessary to obtain several different software programs from various sources to make a well...
Genome-wide conserved consensus transcription factor binding motifs are hyper-methylated
Directory of Open Access Journals (Sweden)
Down Thomas A
2010-09-01
Full Text Available Abstract Background DNA methylation can regulate gene expression by modulating the interaction between DNA and proteins or protein complexes. Conserved consensus motifs exist across the human genome ("predicted transcription factor binding sites": "predicted TFBS" but the large majority of these are proven by chromatin immunoprecipitation and high throughput sequencing (ChIP-seq not to be biological transcription factor binding sites ("empirical TFBS". We hypothesize that DNA methylation at conserved consensus motifs prevents promiscuous or disorderly transcription factor binding. Results Using genome-wide methylation maps of the human heart and sperm, we found that all conserved consensus motifs as well as the subset of those that reside outside CpG islands have an aggregate profile of hyper-methylation. In contrast, empirical TFBS with conserved consensus motifs have a profile of hypo-methylation. 40% of empirical TFBS with conserved consensus motifs resided in CpG islands whereas only 7% of all conserved consensus motifs were in CpG islands. Finally we further identified a minority subset of TF whose profiles are either hypo-methylated or neutral at their respective conserved consensus motifs implicating that these TF may be responsible for establishing or maintaining an un-methylated DNA state, or whose binding is not regulated by DNA methylation. Conclusions Our analysis supports the hypothesis that at least for a subset of TF, empirical binding to conserved consensus motifs genome-wide may be controlled by DNA methylation.
The actin homologue MreB organizes the bacterial cell membrane
Strahl, H.; Burmann, F.; Hamoen, L.W.
2014-01-01
The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate
Piepkorn, Michael W.
1981-01-01
Antithrombin III binds to, and thereby augments the fluorescence of, dansyl-(5-dimethylaminonaphthalene-1-sulphonyl)-heparin; platelet factor 4 binding to the fluorescent heparin has little of this effect. Competition studies in which antithrombin III competes with platelet factor 4 for heparin binding demonstrate that heparin can simultaneously bind both proteins. PMID:7317004
Genome Binding and Gene Regulation by Stem Cell Transcription Factors
J.H. Brandsma (Johan)
2016-01-01
markdownabstractNearly all cells of an individual organism contain the same genome. However, each cell type transcribes a different set of genes due to the presence of different sets of cell type-specific transcription factors. Such transcription factors bind to regulatory regions such as promoters
Incorporating evolution of transcription factor binding sites into ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
Identifying transcription factor binding sites (TFBSs) is essential to elucidate ... alignments with parts annotated as gap lessly aligned TFBSs (pair-profile hits) are generated. Moreover, the pair- profile related parameters are derived in a sound statistical framework. ... Much research has gone into the study of the evolution of.
Endothelial cell capture of heparin-binding growth factors under flow.
Directory of Open Access Journals (Sweden)
Bing Zhao
2010-10-01
Full Text Available Circulation is an important delivery method for both natural and synthetic molecules, but microenvironment interactions, regulated by endothelial cells and critical to the molecule's fate, are difficult to interpret using traditional approaches. In this work, we analyzed and predicted growth factor capture under flow using computer modeling and a three-dimensional experimental approach that includes pertinent circulation characteristics such as pulsatile flow, competing binding interactions, and limited bioavailability. An understanding of the controlling features of this process was desired. The experimental module consisted of a bioreactor with synthetic endothelial-lined hollow fibers under flow. The physical design of the system was incorporated into the model parameters. The heparin-binding growth factor fibroblast growth factor-2 (FGF-2 was used for both the experiments and simulations. Our computational model was composed of three parts: (1 media flow equations, (2 mass transport equations and (3 cell surface reaction equations. The model is based on the flow and reactions within a single hollow fiber and was scaled linearly by the total number of fibers for comparison with experimental results. Our model predicted, and experiments confirmed, that removal of heparan sulfate (HS from the system would result in a dramatic loss of binding by heparin-binding proteins, but not by proteins that do not bind heparin. The model further predicted a significant loss of bound protein at flow rates only slightly higher than average capillary flow rates, corroborated experimentally, suggesting that the probability of capture in a single pass at high flow rates is extremely low. Several other key parameters were investigated with the coupling between receptors and proteoglycans shown to have a critical impact on successful capture. The combined system offers opportunities to examine circulation capture in a straightforward quantitative manner that
Cell-type specificity of ChIP-predicted transcription factor binding sites
Directory of Open Access Journals (Sweden)
Håndstad Tony
2012-08-01
Full Text Available Abstract Background Context-dependent transcription factor (TF binding is one reason for differences in gene expression patterns between different cellular states. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq identifies genome-wide TF binding sites for one particular context—the cells used in the experiment. But can such ChIP-seq data predict TF binding in other cellular contexts and is it possible to distinguish context-dependent from ubiquitous TF binding? Results We compared ChIP-seq data on TF binding for multiple TFs in two different cell types and found that on average only a third of ChIP-seq peak regions are common to both cell types. Expectedly, common peaks occur more frequently in certain genomic contexts, such as CpG-rich promoters, whereas chromatin differences characterize cell-type specific TF binding. We also find, however, that genotype differences between the cell types can explain differences in binding. Moreover, ChIP-seq signal intensity and peak clustering are the strongest predictors of common peaks. Compared with strong peaks located in regions containing peaks for multiple transcription factors, weak and isolated peaks are less common between the cell types and are less associated with data that indicate regulatory activity. Conclusions Together, the results suggest that experimental noise is prevalent among weak peaks, whereas strong and clustered peaks represent high-confidence binding events that often occur in other cellular contexts. Nevertheless, 30-40% of the strongest and most clustered peaks show context-dependent regulation. We show that by combining signal intensity with additional data—ranging from context independent information such as binding site conservation and position weight matrix scores to context dependent chromatin structure—we can predict whether a ChIP-seq peak is likely to be present in other cellular contexts.
Kucharski, Amir N; Scott, Caitlin E; Davis, Jonathan P; Kekenes-Huskey, Peter M
2016-08-25
Parvalbumin (PV) is a globular calcium (Ca(2+))-selective protein expressed in a variety of biological tissues. Our computational studies of the rat β-parvalbumin (β-PV) isoform seek to elucidate the molecular thermodynamics of Ca(2+) versus magnesium (Mg(2+)) binding at the protein's two EF-hand motifs. Specifically, we have utilized molecular dynamics (MD) simulations and a mean-field electrolyte model (mean spherical approximation (MSA) theory) to delineate how the EF-hand scaffold controls the "local" thermodynamics of Ca(2+) binding selectivity over Mg(2+). Our MD simulations provide the probability density of metal-chelating oxygens within the EF-hand scaffolds for both Ca(2+) and Mg(2+), as well the conformational strain induced by Mg(2+) relative to Ca(2+) binding. MSA theory utilizes the binding domain oxygen and charge distributions to predict the chemical potential of ion binding, as well as their corresponding concentrations within the binding domain. We find that the electrostatic and steric contributions toward ion binding were similar for Mg(2+) and Ca(2+), yet the latter was 5.5 kcal/mol lower in enthalpy when internal strain within the EF hand was considered. We therefore speculate that beyond differences in dehydration energies for the Ca(2+) versus Mg(2+), strain induced in the β-PV EF hand by cation binding significantly contributes to the nearly 10,000-fold difference in binding affinity reported in the literature. We further complemented our analyses of local factors governing cation binding selectivity with whole-protein (global) contributions, such as interhelical residue-residue contacts and solvent exposure of hydrophobic surface. These contributions were found to be comparable for both Ca(2+)- and Mg(2+)-bound β-PV, which may implicate local factors, EF-hand strain, and dehydration, in providing the primary means of selectivity. We anticipate these methods could be used to estimate metal binding thermodynamics across a broad range of
Factors Associated with Preference for Repeat Cesarean in Neyshabur Pregnant Women
Directory of Open Access Journals (Sweden)
Ali Gholami
2014-01-01
Conclusions: As observed in this study, most pregnant women with previous caesarean delivery prefer repeated caesarean delivery rather than VD in their subsequent pregnancy and educational level of pregnant women and doctor′s advice were important factors that influenced this preference. This subject suggests the need to counsel pregnant women with an obstetrician before select delivery type.
Naruto, Keiko; Minoura, Katsuhiko; Okuda, Ryouhei; Taniguchi, Taizo; In, Yasuko; Ishida, Toshimasa; Tomoo, Koji
2010-10-08
Investigation of the mechanism of tau polymerization is indispensable for finding inhibitory conditions or identifying compounds preventing the formation of paired helical filament or oligomers. Tau contains a microtubule-binding domain consisting of three or four repeats in its C-terminal half. It has been considered that the key event in tau polymerization is the formation of a β-sheet structure arising from a short hexapeptide (306)VQIVYK(311) in the third repeat of tau. In this paper, we report for the first time that the C-H⋯π interaction between Ile308 and Tyr310 is the elemental structural scaffold essential for forming a dry "steric zipper" structure in tau amyloid fibrils. Copyright © 2010 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Gleiter, C.H.; Cain, C.J.; Weiss, S.R.; Post, R.M.; Marangos, P.J. (National Institute on Alcohol Abuse and Alcoholism, Bethesda, MD (USA))
1989-07-01
({sup 3}H)Nimodipine and high-affinity ({sup 125}I)omega-conotoxin GVIA (CgTX) binding were investigated in membranes from rat cerebral cortex, cerebellum, and hippocampus after electrically and chemically induced seizures. Animals were decapitated 30 min after a single electroconvulsive shock (ECS) or lidocaine-induced seizure and 24 h after the last of 10 once-daily ECS or six once-daily lidocaine-induced seizures. After a single ECS, ({sup 3}H)nimodipine and ({sup 125}I)CgTX binding sites decreased in cerebral cortex (by 10% and 17%, respectively). A downregulation of ({sup 3}H)nimodipine binding sites in hippocampus occurred after single and repeated lidocaine-induced seizures (by 24% and 11%, respectively), whereas ({sup 125}I)CgTX binding remained unaltered. An earlier report on changes in ({sup 3}H)nitrendipine binding after chronic ECS in cortex and hippocampus was not confirmed.
Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera.
Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross
2002-12-01
The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.
Vetere, A; Li, W-C; Paroni, F; Juhl, K; Guo, L; Nishimura, W; Dai, X; Bonner-Weir, S; Sharma, A
2010-01-01
The basic helix-loop-helix transcription factor neurogenin-3 (NGN3) commits the fates of pancreatic progenitors to endocrine cell types, but knowledge of the mechanisms regulating the choice between proliferation and differentiation of these progenitors is limited. Using a chromatin immunoprecipitation cloning approach, we searched for direct targets of NGN3 and identified a zinc-finger transcription factor, OVO homologue-like 1 (OVOL1). Transactivation experiments were carried out to elucidate the functional role of NGN3 in Ovol1 gene expression. Embryonic and adult rodents pancreases were immunostained for OVOL1, Ki67 and NGN3. We showed that NGN3 negatively regulates transcription of Ovol1 in an E-box-dependent fashion. The presence of either NGN3 or NEUROD1, but not MYOD, reduced endogenous Ovol1 mRNA. OVOL1 was detected in pancreatic tissue around embryonic day 15.5, after which OVOL1 levels dramatically increased. In embryonic pancreas, OVOL1 protein levels were low in NGN3(+) or Ki67(+) cells, but high in quiescent differentiated cells. OVOL1 presence was maintained in adult pancreas, where it was detected in islets, pancreatic ducts and some acinar cells. Additionally OVOL1 presence was lacking in proliferating ductules in regenerating pancreas and induced in cells as they began to acquire their differentiated phenotype. The timing of OVOL1 appearance in pancreas and its increased levels in differentiated cells suggest that OVOL1 promotes the transition of cells from a proliferating, less-differentiated state to a quiescent more-differentiated state. We conclude that OVOL1, a downstream target of NGN3, may play an important role in regulating the balance between proliferation and differentiation of pancreatic cells.
The impact of nonclinical factors on repeat cesarean section.
Stafford, R S
1991-01-02
Nonclinical factors, including the setting in which health care takes place, influence clinical decisions. This research measures the independent effects of organizational and socioeconomic factors on repeat cesarean section use in California. Of 45,425 births to women with previous cesarean sections in 1986, vaginal birth after cesarean section occurred in 10.9%. Sizable nonclinical variations were noted. By hospital ownership, rates ranged from 4.9% (for-profit hospitals) to 29.2% (University of California). Variations also existed by hospital teaching level (nonteaching hospitals, 7.0%, vs formalized teaching hospitals, 23.3%); payment source (private insurance, 8.1%, vs indigent services, 25.2%); and obstetric volume (low-volume hospitals, 5.4%, vs high-volume hospitals, 16.6%). Multiple logistic regression demonstrated that these variables had independent effects after accounting for their overlapping influences and the effects of patient characteristics. The observed variations demonstrate the prominence of nonclinical factors in decision making and question the clinical appropriateness of current practice patterns.
Solution structure of an archaeal DNA binding protein with an eukaryotic zinc finger fold.
Directory of Open Access Journals (Sweden)
Florence Guillière
Full Text Available While the basal transcription machinery in archaea is eukaryal-like, transcription factors in archaea and their viruses are usually related to bacterial transcription factors. Nevertheless, some of these organisms show predicted classical zinc fingers motifs of the C2H2 type, which are almost exclusively found in proteins of eukaryotes and most often associated with transcription regulators. In this work, we focused on the protein AFV1p06 from the hyperthermophilic archaeal virus AFV1. The sequence of the protein consists of the classical eukaryotic C2H2 motif with the fourth histidine coordinating zinc missing, as well as of N- and C-terminal extensions. We showed that the protein AFV1p06 binds zinc and solved its solution structure by NMR. AFV1p06 displays a zinc finger fold with a novel structure extension and disordered N- and C-termini. Structure calculations show that a glutamic acid residue that coordinates zinc replaces the fourth histidine of the C2H2 motif. Electromobility gel shift assays indicate that the protein binds to DNA with different affinities depending on the DNA sequence. AFV1p06 is the first experimentally characterised archaeal zinc finger protein with a DNA binding activity. The AFV1p06 protein family has homologues in diverse viruses of hyperthermophilic archaea. A phylogenetic analysis points out a common origin of archaeal and eukaryotic C2H2 zinc fingers.
International Nuclear Information System (INIS)
Booij, Jan; Bruin, Kora de; Gunning, W. Boudewijn
2006-01-01
In recent years, several PET and SPECT studies have shown loss of striatal dopamine transporter (DAT) binding in amphetamine (AMPH) users. However, the use of DAT SPECT tracers to detect AMPH-induced changes in DAT binding has not been validated. We therefore examined if repeated administration of D-AMPH or methamphetamine (METH) may induce loss of binding to striatal DATs in rats by using an experimental biodistribution study design and a SPECT tracer for the DAT ([ 123 I]FP-CIT). Methods: Groups of male rats (n=10 per group) were treated with D-AMPH (10 mg/kg body weight), METH (10 mg/kg body weight), or saline, twice a day for 5 consecutive days. Five days later, [ 123 I]FP-CIT was injected intravenously, and 2 h later, the rats were sacrificed and radioactivity was assayed. Results: In D-AMPH but not METH-treated rats, striatal [ 123 I]FP-CIT uptake was significantly lower (approximately 17%) than in the control group. Conclusion: These data show that [ 123 I]FP-CIT can be used to detect AMPH-induced changes in DAT binding and may validate the use of DAT radiotracers to study AMPH-induced changes in striatal DAT binding in vivo
Silva, Andréa de Albuquerque Arruda; Coutinho, Isabela C; Katz, Leila; Souza, Alex Sandro Rolland
2013-03-01
Repeat teen pregnancy is a frequent issue and is considered an aggravating factor for increased maternal and fetal morbidity and social problems. The aim of the study was to identify factors associated with repeat teen pregnancy. A case-control study was conducted in 90 postpartum adolescents with more than one pregnancy (cases) and 90 adult women with a history of only one pregnancy during adolescence (controls). Statistical analysis used hierarchical logistic regression with 5% significance. Early sexual initiation (pregnancy (pregnancy, while partner change was inversely associated. Repeat teen pregnancy was mainly associated with reproductive and socioeconomic factors. Partner change appeared as a protective factor. Measures should be adopted during the postpartum period of teenage mothers in order to avoid repeat pregnancy.
Characterization and cloning of TMV resistance gene N homologues ...
African Journals Online (AJOL)
Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...
Directory of Open Access Journals (Sweden)
Kamala Boonyodying
2012-06-01
Full Text Available A number of heavy metal-binding proteins have been used to study bioremediation. CXXC motif, a metal binding domain containing Cys-X-X-Cys motif, has been identified in various organisms. These proteins are capable of binding various types of heavy metals. In this study, heavy metal binding domain (CXXC motif recombinant protein encoded from mcsA gene of S. aureus were cloned and overexpressed in Escherichia coli. The factors involved in the metal-binding activity were determined in order to analyze the potential of recombinant protein for bioremediation. A recombinant protein can be bound to Cd2+, Co2+, Cu2+ and Zn2+. The thermal stability of a recombinant protein was tested, and the results showed that the metal binding activity to Cu2+ and Zn2+ still exist after treating the protein at 85ºC for 30 min. The temperature and pH that affected the metal binding activity was tested and the results showed that recombinant protein was still bound to Cu2+ at 65ºC, whereas a pH of 3-7 did not affect the metal binding E. coli harboring a pRset with a heavy metal-binding domain CXXC motif increased the resistance of heavy metals against CuCl2 and CdCl2. This study shows that metal binding domain (CXXC motif recombinant protein can be effectively bound to various types of heavy metals and may be used as a potential tool for studying bioremediation.
Collins, James; van Pijkeren, Jan-Peter; Svensson, Lisbeth; Claesson, Marcus J; Sturme, Mark; Li, Yin; Cooney, Jakki C; van Sinderen, Douwe; Walker, Alan W; Parkhill, Julian; Shannon, Oonagh; O'Toole, Paul W
2012-09-01
The marketplace for probiotic foods is burgeoning, measured in billions of euro per annum. It is imperative, however, that all bacterial strains are fully assessed for human safety. The ability to bind fibrinogen is considered a potential pathogenicity trait that can lead to platelet aggregation, serious medical complications, and in some instances, death. Here we examined strains from species frequently used as probiotics for their ability to bind human fibrinogen. Only one strain (CCUG 47825), a Lactobacillus salivarius isolate from a case of septicaemia, was found to strongly adhere to fibrinogen. Furthermore, this strain was found to aggregate human platelets at a level comparable to the human pathogen Staphylococcus aureus. By sequencing the genome of CCUG 47825, we were able to identify candidate genes responsible for fibrinogen binding. Complementing the genetic analysis with traditional molecular microbiological techniques enabled the identification of the novel fibrinogen receptor, CCUG_2371. Although only strain CCUG 47825 bound fibrinogen under laboratory conditions, homologues of the novel fibrinogen binding gene CCUG_2371 are widespread among L. salivarius strains, maintaining their potential to bind fibrinogen if expressed. We highlight the fact that without a full genetic analysis of strains for human consumption, potential pathogenicity traits may go undetected. © 2012 Blackwell Publishing Ltd.
DEFF Research Database (Denmark)
Lindemose, Søren; Jensen, Michael Krogh; de Velde, Jan Van
2014-01-01
regulatory networks of 12 NAC transcription factors. Our data offer specific single-base resolution fingerprints for most TFs studied and indicate that NAC DNA-binding specificities might be predicted from their DNA-binding domain's sequence. The developed methodology, including the application......Target gene identification for transcription factors is a prerequisite for the systems wide understanding of organismal behaviour. NAM-ATAF1/2-CUC2 (NAC) transcription factors are amongst the largest transcription factor families in plants, yet limited data exist from unbiased approaches to resolve...... the DNA-binding preferences of individual members. Here, we present a TF-target gene identification workflow based on the integration of novel protein binding microarray data with gene expression and multi-species promoter sequence conservation to identify the DNA-binding specificities and the gene...
Dictyostelium cells bind a secreted autocrine factor that represses cell proliferation.
Choe, Jonathan M; Bakthavatsalam, Deenadayalan; Phillips, Jonathan E; Gomer, Richard H
2009-02-02
Dictyostelium cells secrete the proteins AprA and CfaD. Cells lacking either AprA or CfaD proliferate faster than wild type, while AprA or CfaD overexpressor cells proliferate slowly, indicating that AprA and CfaD are autocrine factors that repress proliferation. CfaD interacts with AprA and requires the presence of AprA to slow proliferation. To determine if CfaD is necessary for the ability of AprA to slow proliferation, whether AprA binds to cells, and if so whether the binding requires the presence of CfaD, we examined the binding and effect on proliferation of recombinant AprA. We find that the extracellular accumulation of AprA increases with cell density and reaches a concentration of 0.3 microg/ml near a stationary cell density. When added to wild-type or aprA- cells, recombinant AprA (rAprA) significantly slows proliferation at 0.1 microg/ml and higher concentrations. From 4 to 64 microg/ml, the effect of rAprA is at a plateau, slowing but not stopping proliferation. The proliferation-inhibiting activity of rAprA is roughly the same as that of native AprA in conditioned growth medium. Proliferating aprA- cells show saturable binding of rAprA to 92,000 +/- 11,000 cell-surface receptors with a KD of 0.03 +/- 0.02 microg/ml. There appears to be one class of binding site, and no apparent cooperativity. Native AprA inhibits the binding of rAprA to aprA- cells with a Ki of 0.03 mug/ml, suggesting that the binding kinetics of rAprA are similar to those of native AprA. The proliferation of cells lacking CrlA, a cAMP receptor-like protein, or cells lacking CfaD are not affected by rAprA. Surprisingly, both cell types still bind rAprA. Together, the data suggest that AprA functions as an autocrine proliferation-inhibiting factor by binding to cell surface receptors. Although AprA requires CfaD for activity, it does not require CfaD to bind to cells, suggesting the possibility that cells have an AprA receptor and a CfaD receptor, and activation of both receptors is
Gilbert, G E; Drinkwater, D
1993-09-21
Phosphatidylserine, a negatively charged lipid, is exposed on the platelet membrane following cell stimulation, correlating with the expression of factor VIII receptors. We have explored the importance of the negative electrostatic potential of phosphatidylserine vs chemical moieties of phosphatidylserine for specific membrane binding of factor VIII. Fluorescein-labeled factor VIII bound to membranes containing 15% phosphatidic acid, a negatively charged phospholipid, with low affinity compared to phosphatidylserine-containing membranes. Binding was not specific as it was inhibited by other proteins in plasma. Factor VIII bound to membranes containing 10% phosphatidylserine in spite of a varying net charge provided by 0-15% stearylamine, a positively charged lipid. The soluble phosphatidylserine moiety, O-phospho-L-serine, inhibited factor VIII binding to phosphatidylserine-containing membranes with a Ki of 20 mM, but the stereoisomer, O-phospho-D-serine, was 5-fold less effective. Furthermore, binding of factor VIII to membranes containing synthetic phosphatidyl-D-serine was 5-fold less than binding to membranes containing phosphatidyl-L-serine. Membranes containing synthetic phosphatidyl-L-homoserine, differing from phosphatidylserine by a single methylene, supported high-affinity binding, but it was not specific as factor VIII was displaced by other plasma proteins. O-Phospho-L-serine also inhibited the binding of factor VIII to platelet-derived microparticles with a Ki of 20 mM, and the stereoisomer was 4-fold less effective. These results indicate that membrane binding of factor VIII is mediated by a stereoselective recognition O-phospho-L-serine of phosphatidylserine and that negative electrostatic potential is of lesser importance.
Czudnochowski, Nadine; Wang, Amy Liya; Finer-Moore, Janet; Stroud, Robert M
2013-10-23
Human pseudouridine (Ψ) synthase Pus1 (hPus1) modifies specific uridine residues in several non-coding RNAs: tRNA, U2 spliceosomal RNA, and steroid receptor activator RNA. We report three structures of the catalytic core domain of hPus1 from two crystal forms, at 1.8Å resolution. The structures are the first of a mammalian Ψ synthase from the set of five Ψ synthase families common to all kingdoms of life. hPus1 adopts a fold similar to bacterial Ψ synthases, with a central antiparallel β-sheet flanked by helices and loops. A flexible hinge at the base of the sheet allows the enzyme to open and close around an electropositive active-site cleft. In one crystal form, a molecule of Mes [2-(N-morpholino)ethane sulfonic acid] mimics the target uridine of an RNA substrate. A positively charged electrostatic surface extends from the active site towards the N-terminus of the catalytic domain, suggesting an extensive binding site specific for target RNAs. Two α-helices C-terminal to the core domain, but unique to hPus1, extend along the back and top of the central β-sheet and form the walls of the RNA binding surface. Docking of tRNA to hPus1 in a productive orientation requires only minor conformational changes to enzyme and tRNA. The docked tRNA is bound by the electropositive surface of the protein employing a completely different binding mode than that seen for the tRNA complex of the Escherichia coli homologue TruA. Copyright © 2013 Elsevier Ltd. All rights reserved.
Potential Role of the Last Half Repeat in TAL Effectors Revealed by a Molecular Simulation Study
Directory of Open Access Journals (Sweden)
Hua Wan
2016-01-01
Full Text Available TAL effectors (TALEs contain a modular DNA-binding domain that is composed of tandem repeats. In all naturally occurring TALEs, the end of tandem repeats is invariantly a truncated half repeat. To investigate the potential role of the last half repeat in TALEs, we performed comparative molecular dynamics simulations for the crystal structure of DNA-bound TALE AvrBs3 lacking the last half repeat and its modeled structure having the last half repeat. The structural stability analysis indicates that the modeled system is more stable than the nonmodeled system. Based on the principle component analysis, it is found that the AvrBs3 increases its structural compactness in the presence of the last half repeat. The comparison of DNA groove parameters of the two systems implies that the last half repeat also causes the change of DNA major groove binding efficiency. The following calculation of hydrogen bond reveals that, by stabilizing the phosphate binding with DNA at the C-terminus, the last half repeat helps to adopt a compact conformation at the protein-DNA interface. It further mediates more contacts between TAL repeats and DNA nucleotide bases. Finally, we suggest that the last half repeat is required for the high-efficient recognition of DNA by TALE.
Splicing factor 1 modulates dietary restriction and TORC1 pathway longevity in C. elegans
DEFF Research Database (Denmark)
Heintz, Caroline; Doktor, Thomas K; Lanjuin, Anne
2017-01-01
via splicing factor 1 (SFA-1; the C. elegans homologue of SF1, also known as branchpoint binding protein, BBP). We show that SFA-1 is specifically required for lifespan extension by dietary restriction and by modulation of the TORC1 pathway components AMPK, RAGA-1 and RSKS-1/S6 kinase. We also...... homeostasis is a biomarker and predictor of life expectancy in Caenorhabditis elegans. Using transcriptomics and in-depth splicing analysis in young and old animals fed ad libitum or subjected to dietary restriction, we find defects in global pre-mRNA splicing with age that are reduced by dietary restriction...
Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA
International Nuclear Information System (INIS)
Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.
2007-01-01
Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres
Directory of Open Access Journals (Sweden)
Guray Kuzu
2016-07-01
Full Text Available Dosage compensation is an essential process that equalizes transcript levels of X-linked genes between sexes by forming a domain of coordinated gene expression. Throughout the evolution of Diptera, many different X-chromosomes acquired the ability to be dosage compensated. Once each newly evolved X-chromosome is targeted for dosage compensation in XY males, its active genes are upregulated two-fold to equalize gene expression with XX females. In Drosophila melanogaster, the CLAMP zinc finger protein links the dosage compensation complex to the X-chromosome. However, the mechanism for X-chromosome identification has remained unknown. Here, we combine biochemical, genomic and evolutionary approaches to reveal that expansion of GA-dinucleotide repeats likely accumulated on the X-chromosome over evolutionary time to increase the density of CLAMP binding sites, thereby driving the evolution of dosage compensation. Overall, we present new insight into how subtle changes in genomic architecture, such as expansions of a simple sequence repeat, promote the evolution of coordinated gene expression.
DNA binding and unwinding by Hel308 helicase requires dual functions of a winged helix domain.
Northall, Sarah J; Buckley, Ryan; Jones, Nathan; Penedo, J Carlos; Soultanas, Panos; Bolt, Edward L
2017-09-01
Hel308 helicases promote genome stability linked to DNA replication in archaea, and have homologues in metazoans. In the crystal structure of archaeal Hel308 bound to a tailed DNA duplex, core helicase domains encircle single-stranded DNA (ssDNA) in a "ratchet" for directional translocation. A winged helix domain (WHD) is also present, but its function is mysterious. We investigated the WHD in full-length Hel308, identifying that mutations in a solvent exposed α-helix resulted in reduced DNA binding and unwinding activities. When isolated from the rest of Hel308, the WHD protein alone bound to duplex DNA but not ssDNA, and DNA binding by WHD protein was abolished by the same mutations as were analyzed in full-length Hel308. Isolated WHD from a human Hel308 homologue (HelQ) also bound to duplex DNA. By disrupting the interface between the Hel308 WHD and a RecA-like domain, a topology typical of Ski2 helicases, we show that this is crucial for ATPase and helicase activities. The data suggest a model in which the WHD promotes activity of Hel308 directly, through binding to duplex DNA that is distinct from ssDNA binding by core helicase, and indirectly through interaction with the RecA-like domain. We propose how the WHD may contribute to ssDNA translocation, resulting in DNA helicase activity or in removal of other DNA bound proteins by "reeling" ssDNA. Copyright © 2017 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Booij, Jan [Department of Nuclear Medicine, Academic Medical Center, 1105 AZ Amsterdam (Netherlands)]. E-mail: j.booij@amc.uva.nl; Bruin, Kora de [Department of Nuclear Medicine, Academic Medical Center, 1105 AZ Amsterdam (Netherlands); Gunning, W. Boudewijn [Department of Neurology, Epilepsy Centre Kempenhaeghe, 5590 AB Heeze (Netherlands)
2006-04-15
In recent years, several PET and SPECT studies have shown loss of striatal dopamine transporter (DAT) binding in amphetamine (AMPH) users. However, the use of DAT SPECT tracers to detect AMPH-induced changes in DAT binding has not been validated. We therefore examined if repeated administration of D-AMPH or methamphetamine (METH) may induce loss of binding to striatal DATs in rats by using an experimental biodistribution study design and a SPECT tracer for the DAT ([{sup 123}I]FP-CIT). Methods: Groups of male rats (n=10 per group) were treated with D-AMPH (10 mg/kg body weight), METH (10 mg/kg body weight), or saline, twice a day for 5 consecutive days. Five days later, [{sup 123}I]FP-CIT was injected intravenously, and 2 h later, the rats were sacrificed and radioactivity was assayed. Results: In D-AMPH but not METH-treated rats, striatal [{sup 123}I]FP-CIT uptake was significantly lower (approximately 17%) than in the control group. Conclusion: These data show that [{sup 123}I]FP-CIT can be used to detect AMPH-induced changes in DAT binding and may validate the use of DAT radiotracers to study AMPH-induced changes in striatal DAT binding in vivo.
Directory of Open Access Journals (Sweden)
Harry S Courtney
Full Text Available The non-immune binding of immunoglobulins by bacteria is thought to contribute to the pathogenesis of infections. M-related proteins (Mrp are group A streptococcal (GAS receptors for immunoglobulins, but it is not known if this binding has any impact on virulence. To further investigate the binding of immunoglobulins to Mrp, we engineered mutants of an M type 4 strain of GAS by inactivating the genes for mrp, emm, enn, sof, and sfbX and tested these mutants in IgG-binding assays. Inactivation of mrp dramatically decreased the binding of human IgG, whereas inactivation of emm, enn, sof, and sfbx had only minor effects, indicating that Mrp is a major IgG-binding protein. Binding of human immunoglobulins to a purified, recombinant form of Mrp indicated that it selectively binds to the Fc domain of human IgG, but not IgA or IgM and that it preferentially bound subclasses IgG₁>IgG₄>IgG₂>IgG₃. Recombinant proteins encompassing different regions of Mrp were engineered and used to map its IgG-binding domain to its A-repeat region and a recombinant protein with 3 A-repeats was a better inhibitor of IgG binding than one with a single A-repeat. A GAS mutant expressing Mrp with an in-frame deletion of DNA encoding the A-repeats had a dramatically reduced ability to bind human IgG and to grow in human blood. Mrp exhibited host specificity in binding IgG; human IgG was the best inhibitor of the binding of IgG followed by pig, horse, monkey, and rabbit IgG. IgG from goat, mouse, rat, cow, donkey, chicken, and guinea pig were poor inhibitors of binding. These findings indicate that Mrp preferentially binds human IgG and that this binding contributes to the ability of GAS to resist phagocytosis and may be a factor in the restriction of GAS infections to the human host.
Dictyostelium cells bind a secreted autocrine factor that represses cell proliferation
Directory of Open Access Journals (Sweden)
Phillips Jonathan E
2009-02-01
Full Text Available Abstract Background Dictyostelium cells secrete the proteins AprA and CfaD. Cells lacking either AprA or CfaD proliferate faster than wild type, while AprA or CfaD overexpressor cells proliferate slowly, indicating that AprA and CfaD are autocrine factors that repress proliferation. CfaD interacts with AprA and requires the presence of AprA to slow proliferation. To determine if CfaD is necessary for the ability of AprA to slow proliferation, whether AprA binds to cells, and if so whether the binding requires the presence of CfaD, we examined the binding and effect on proliferation of recombinant AprA. Results We find that the extracellular accumulation of AprA increases with cell density and reaches a concentration of 0.3 μg/ml near a stationary cell density. When added to wild-type or aprA- cells, recombinant AprA (rAprA significantly slows proliferation at 0.1 μg/ml and higher concentrations. From 4 to 64 μg/ml, the effect of rAprA is at a plateau, slowing but not stopping proliferation. The proliferation-inhibiting activity of rAprA is roughly the same as that of native AprA in conditioned growth medium. Proliferating aprA- cells show saturable binding of rAprA to 92,000 ± 11,000 cell-surface receptors with a KD of 0.03 ± 0.02 μg/ml. There appears to be one class of binding site, and no apparent cooperativity. Native AprA inhibits the binding of rAprA to aprA- cells with a Ki of 0.03 μg/ml, suggesting that the binding kinetics of rAprA are similar to those of native AprA. The proliferation of cells lacking CrlA, a cAMP receptor-like protein, or cells lacking CfaD are not affected by rAprA. Surprisingly, both cell types still bind rAprA. Conclusion Together, the data suggest that AprA functions as an autocrine proliferation-inhibiting factor by binding to cell surface receptors. Although AprA requires CfaD for activity, it does not require CfaD to bind to cells, suggesting the possibility that cells have an AprA receptor and a Cfa
Insulin-like growth factor binding protein 3 in inflammatory bowel disease
DEFF Research Database (Denmark)
Kirman, Irena; Whelan, Richard Larry; Jain, Suvinit
2005-01-01
Epithelial cell growth regulation has been reported to be altered in inflammatory bowel disease (IBD) patients. The cell growth regulatory factor, insulin-like growth factor binding protein 3 (IGFBP-3), may be partly responsible for this phenomenon. So far, IGFBP-3 levels have been assessed...
Quantification of transcription factor-DNA binding affinity in a living cell.
Belikov, Sergey; Berg, Otto G; Wrange, Örjan
2016-04-20
The apparent dissociation constant (Kd) for specific binding of glucocorticoid receptor (GR) and androgen receptor (AR) to DNA was determined in vivo in Xenopus oocytes. The total nuclear receptor concentration was quantified as specifically retained [(3)H]-hormone in manually isolated oocyte nuclei. DNA was introduced by nuclear microinjection of single stranded phagemid DNA, chromatin is then formed during second strand synthesis. The fraction of DNA sites occupied by the expressed receptor was determined by dimethylsulphate in vivo footprinting and used for calculation of the receptor-DNA binding affinity. The forkhead transcription factor FoxA1 enhanced the DNA binding by GR with an apparent Kd of ∼1 μM and dramatically stimulated DNA binding by AR with an apparent Kd of ∼0.13 μM at a composite androgen responsive DNA element containing one FoxA1 binding site and one palindromic hormone receptor binding site known to bind one receptor homodimer. FoxA1 exerted a weak constitutive- and strongly cooperative DNA binding together with AR but had a less prominent effect with GR, the difference reflecting the licensing function of FoxA1 at this androgen responsive DNA element. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Telomere binding protein TRB1 is associated with promoters of translation machinery genes in vivo
Czech Academy of Sciences Publication Activity Database
Schrumpfová, P.; Vychodilová, I.; Hapala, J.; Schorová, Š.; Dvořáček, Vojtěch; Fajkus, Jiří
2016-01-01
Roč. 90, 1-2 (2016), s. 189-206 ISSN 0167-4412 R&D Projects: GA ČR(CZ) GA13-06943S Institutional support: RVO:68081707 Keywords : Telomere repeat binding * ChIP-seq * Arabidopsis thaliana Subject RIV: BO - Biophysics Impact factor: 3.356, year: 2016
Xu, Meixiang; Cross, Courtney E; Speidel, Jordan T; Abdel-Rahman, Sherif Z
2016-10-01
The O 6 -methylguanine-DNA methyltransferase (MGMT) protein removes O 6 -alkyl-guanine adducts from DNA. MGMT expression can thus alter the sensitivity of cells and tissues to environmental and chemotherapeutic alkylating agents. Previously, we defined the haplotype structure encompassing single nucleotide polymorphisms (SNPs) in the MGMT promoter/enhancer (P/E) region and found that haplotypes, rather than individual SNPs, alter MGMT promoter activity. The exact mechanism(s) by which these haplotypes exert their effect on MGMT promoter activity is currently unknown, but we noted that many of the SNPs comprising the MGMT P/E haplotypes are located within or in close proximity to putative transcription factor binding sites. Thus, these haplotypes could potentially affect transcription factor binding and, subsequently, alter MGMT promoter activity. In this study, we test the hypothesis that MGMT P/E haplotypes affect MGMT promoter activity by altering transcription factor (TF) binding to the P/E region. We used a promoter binding TF profiling array and a reporter assay to evaluate the effect of different P/E haplotypes on TF binding and MGMT expression, respectively. Our data revealed a significant difference in TF binding profiles between the different haplotypes evaluated. We identified TFs that consistently showed significant haplotype-dependent binding alterations (p ≤ 0.01) and revealed their role in regulating MGMT expression using siRNAs and a dual-luciferase reporter assay system. The data generated support our hypothesis that promoter haplotypes alter the binding of TFs to the MGMT P/E and, subsequently, affect their regulatory function on MGMT promoter activity and expression level.
Kibbey, Megan M; Jameson, Mark J; Eaton, Erin M; Rosenzweig, Steven A
2006-03-01
Signaling by the insulin-like growth factor (IGF)-1 receptor (IGF-1R) has been implicated in the promotion and aggressiveness of breast, prostate, colorectal, and lung cancers. The IGF binding proteins (IGFBPs) represent a class of natural IGF antagonists that bind to and sequester IGF-1/2 from the IGF-1R, making them attractive candidates as therapeutics for cancer prevention and control. Recombinant human IGFBP-2 significantly attenuated IGF-1-stimulated MCF-7 cell proliferation with coaddition of 20 or 100 nM IGFBP-2 (50 or 80% inhibition, respectively). We previously identified IGF-1 contact sites both upstream and downstream of the CWCV motif (residues 247-250) in human IGFBP-2 (J Biol Chem 276:2880-2889, 2001). To further test their contributions to IGFBP-2 function, the single tryptophan in human IGFBP-2, Trp-248, was selectively cleaved with 2-(2'nitrophenylsulfenyl)-3-methyl-3 bromoindolenine (BNPS-skatole) and the BNPS-skatole products IGFBP-2(1-248) and IGFBP-2(249-289) as well as IGFBP-2(1-190) were expressed as glutathione S-transferase-fusion proteins and purified. Based on competition binding analysis, deletion of residues 249 to 289 caused an approximately 20-fold decrease in IGF-1 binding affinity (IGFBP-2 EC50 = 0.35 nM and IGFBP-2(1-248) = 7 nM). Removal of the remainder of the C-terminal domain had no further effect on affinity (IGFBP-2(1-190) EC50 = 9.2 nM). In kinetic assays, IGFBP-2(1-248) and IGFBP-2(1-190) exhibited more rapid association and dissociation rates than full-length IGFBP-2. These results confirm that regions upstream and downstream of the CWCV motif participate in IGF-1 binding. They further support the development of full-length IGFBP-2 as a cancer therapeutic.
Ni, Y; Nesrallah, J; Agnew, M; Geske, F J; Favaloro, E J
2013-01-01
Introduction Laboratory diagnosis of von Willebrand disease (VWD) requires determination of both von Willebrand factor (VWF) protein levels and activity. Current VWF activity tests include the ristocetin cofactor assay and the collagen-binding assay (VWF:CB). The goal of this investigation is to characterize a new collagen-binding assay and to determine its effectiveness in identifying VWD. Methods Analytical studies were carried out to characterize the performance of a new VWF:CB ELISA. Additionally, samples from a normal population were tested as were well-characterized type 1 and type 2 VWD samples. Results Repeatability and within-laboratory precision studies resulted in coefficients of variation (CVs) of ≤11%. A linear range of 1–354% (0.01–3.54 IU/mL) was determined, along with a limit of detection and a lower limit of quantitation of 1.6% and 4.0% (0.016 and 0.04 IU/mL), respectively. Samples tested from apparently healthy individuals resulted in a normal range of 54–217% (0.54–2.17 IU/mL). Known VWD type 1 and type 2 samples were also analyzed by the ELISA, with 99% of samples having VWF:CB below the normal reference range and an estimated 96% sensitivity and 87% specificity using a VWF collagen-binding/antigen cutoff ratio of 0.50. Conclusion This new VWF:CB ELISA provides an accurate measure of collagen-binding activity that aids in the diagnosis and differentiation of type 1 from type 2 VWD. PMID:23107512
A systems biology approach to transcription factor binding site prediction.
Directory of Open Access Journals (Sweden)
Xiang Zhou
2010-03-01
Full Text Available The elucidation of mammalian transcriptional regulatory networks holds great promise for both basic and translational research and remains one the greatest challenges to systems biology. Recent reverse engineering methods deduce regulatory interactions from large-scale mRNA expression profiles and cross-species conserved regulatory regions in DNA. Technical challenges faced by these methods include distinguishing between direct and indirect interactions, associating transcription regulators with predicted transcription factor binding sites (TFBSs, identifying non-linearly conserved binding sites across species, and providing realistic accuracy estimates.We address these challenges by closely integrating proven methods for regulatory network reverse engineering from mRNA expression data, linearly and non-linearly conserved regulatory region discovery, and TFBS evaluation and discovery. Using an extensive test set of high-likelihood interactions, which we collected in order to provide realistic prediction-accuracy estimates, we show that a careful integration of these methods leads to significant improvements in prediction accuracy. To verify our methods, we biochemically validated TFBS predictions made for both transcription factors (TFs and co-factors; we validated binding site predictions made using a known E2F1 DNA-binding motif on E2F1 predicted promoter targets, known E2F1 and JUND motifs on JUND predicted promoter targets, and a de novo discovered motif for BCL6 on BCL6 predicted promoter targets. Finally, to demonstrate accuracy of prediction using an external dataset, we showed that sites matching predicted motifs for ZNF263 are significantly enriched in recent ZNF263 ChIP-seq data.Using an integrative framework, we were able to address technical challenges faced by state of the art network reverse engineering methods, leading to significant improvement in direct-interaction detection and TFBS-discovery accuracy. We estimated the accuracy
Human pentraxin 3 binds to the complement regulator c4b-binding protein.
Directory of Open Access Journals (Sweden)
Anne Braunschweig
Full Text Available The long pentraxin 3 (PTX3 is a soluble recognition molecule with multiple functions including innate immune defense against certain microbes and the clearance of apoptotic cells. PTX3 interacts with recognition molecules of the classical and lectin complement pathways and thus initiates complement activation. In addition, binding of PTX3 to the alternative complement pathway regulator factor H was shown. Here, we show that PTX3 binds to the classical and lectin pathway regulator C4b-binding protein (C4BP. A PTX3-binding site was identified within short consensus repeats 1-3 of the C4BP α-chain. PTX3 did not interfere with the cofactor activity of C4BP in the fluid phase and C4BP maintained its complement regulatory activity when bound to PTX3 on surfaces. While C4BP and factor H did not compete for PTX3 binding, the interaction of C4BP with PTX3 was inhibited by C1q and by L-ficolin. PTX3 bound to human fibroblast- and endothelial cell-derived extracellular matrices and recruited functionally active C4BP to these surfaces. Whereas PTX3 enhanced the activation of the classical/lectin pathway and caused enhanced C3 deposition on extracellular matrix, deposition of terminal pathway components and the generation of the inflammatory mediator C5a were not increased. Furthermore, PTX3 enhanced the binding of C4BP to late apoptotic cells, which resulted in an increased rate of inactivation of cell surface bound C4b and a reduction in the deposition of C5b-9. Thus, in addition to complement activators, PTX3 interacts with complement inhibitors including C4BP. This balanced interaction on extracellular matrix and on apoptotic cells may prevent excessive local complement activation that would otherwise lead to inflammation and host tissue damage.
DEFF Research Database (Denmark)
Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D
2011-01-01
The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-m...
Wages and employment in a repeated game with revenue fluctuations
DEFF Research Database (Denmark)
Schultz, Christian
1997-01-01
Empirical investigations suggests that the real wage is surprisingly flat over the business cycle. This paper analyses a repeated game between a union and a firm which can contribute to explaining the flat wage. The parties cannot enter binding contracts, and revenue is fluctuating. The paper...... focuses on the best subgame-perfect equilibrium among those sharing the expected surplus in given fixed shares - e.g. equal shares. It is shown that (for moderate discount factors) this equilibrium has a more counter-cyclical wage, than what would be the case if the parties shared the surplus in each...
Distinct patterns of epigenetic marks and transcription factor binding ...
Indian Academy of Sciences (India)
Distinct patterns of epigenetic marks and transcription factor binding sites across promoters of sense-intronic long noncoding RNAs. Sourav Ghosh, Satish Sati, Shantanu Sengupta and Vinod Scaria. J. Genet. 94, 17–25. Gencode V9 lncRNA gene : 11004. Known lncRNA : 1175. Novel lncRNA : 5898. Putative lncRNA :.
Cooperative binding of transcription factors promotes bimodal gene expression response.
Directory of Open Access Journals (Sweden)
Pablo S Gutierrez
Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.
Poly-dipeptides encoded by the C9ORF72 repeats block global protein translation.
Kanekura, Kohsuke; Yagi, Takuya; Cammack, Alexander J; Mahadevan, Jana; Kuroda, Masahiko; Harms, Matthew B; Miller, Timothy M; Urano, Fumihiko
2016-05-01
The expansion of the GGGGCC hexanucleotide repeat in the non-coding region of the Chromosome 9 open-reading frame 72 (C9orf72) gene is the most common genetic cause of frontotemporal dementia (FTD) and amyotrophic lateral sclerosis (ALS). This genetic alteration leads to the accumulation of five types of poly-dipeptides translated from the GGGGCC hexanucleotide repeat. Among these, poly-proline-arginine (poly-PR) and poly-glycine-arginine (poly-GR) peptides are known to be neurotoxic. However, the mechanisms of neurotoxicity associated with these poly-dipeptides are not clear. A proteomics approach identified a number of interacting proteins with poly-PR peptide, including mRNA-binding proteins, ribosomal proteins, translation initiation factors and translation elongation factors. Immunostaining of brain sections from patients with C9orf72 ALS showed that poly-GR was colocalized with a mRNA-binding protein, hnRNPA1. In vitro translation assays showed that poly-PR and poly-GR peptides made insoluble complexes with mRNA, restrained the access of translation factors to mRNA, and blocked protein translation. Our results demonstrate that impaired protein translation mediated by poly-PR and poly-GR peptides plays a role in neurotoxicity and reveal that the pathways altered by the poly-dipeptides-mRNA complexes are potential therapeutic targets for treatment of C9orf72 FTD/ALS. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
DEFF Research Database (Denmark)
Gaigg, B; Neergaard, T B; Schneiter, R
2001-01-01
Deletion of the yeast gene ACB1 encoding Acb1p, the yeast homologue of the acyl-CoA-binding protein (ACBP), resulted in a slower growing phenotype that adapted into a faster growing phenotype with a frequency >1:10(5). A conditional knockout strain (Y700pGAL1-ACB1) with the ACB1 gene under contro...
Kroczynska, Barbara; Evangelista, Christina M; Samant, Shalaka S; Elguindi, Ebrahim C; Blond, Sylvie Y
2004-03-19
The murine tumor cell DnaJ-like protein 1 or MTJ1/ERdj1 is a membrane J-domain protein enriched in microsomal and nuclear fractions. We previously showed that its lumenal J-domain stimulates the ATPase activity of the molecular chaperone BiP/GRP78 (Chevalier, M., Rhee, H., Elguindi, E. C., and Blond, S. Y. (2000) J. Biol. Chem. 275, 19620-19627). MTJ1/ERdj1 also contains a large carboxyl-terminal cytosolic extension composed of two tryptophan-mediated repeats or SANT domains for which the function(s) is unknown. Here we describe the cloning of the human homologue HTJ1 and its interaction with alpha(1)-antichymotrypsin (ACT), a member of the serine proteinase inhibitor (serpin) family. The interaction was initially identified in a two-hybrid screening and further confirmed in vitro by dot blots, native electrophoresis, and fluorescence studies. The second SANT domain of HTJ1 (SANT2) was found to be sufficient for binding to ACT, both in yeast and in vitro. Single tryptophan-alanine substitutions at two strictly conserved residues significantly (Trp-497) or totally (Trp-520) abolished the interaction with ACT. SANT2 binds to human ACT with an intrinsic affinity equal to 0.5 nm. Preincubation of ACT with nearly stoichiometric concentrations of SANT2 wild-type but not SANT2: W520A results in an apparent loss of ACT inhibitory activity toward chymotrypsin. Kinetic analysis indicates that the formation of the covalent inhibitory complex ACT-chymotrypsin is significantly delayed in the presence of SANT2 with no change on the catalytic efficiency of the enzyme. This work demonstrates for the first time that the SANT2 domain of MTJ1/HTJ1/ERdj1 mediates stable and high affinity protein-protein interactions.
Wong, Marian Y. L.; Beasley, Amanda L.; Douglass, Tasman; Whalan, Steve; Scott, Anna
2017-12-01
Determining the extent of repeatable differences in the behavior of animals and the factors that influence behavioral expression is important for understanding individual fitness and population processes, thereby aiding in species conservation. However, little is known about the causes of variation in the repeatability of behavioral differences among species because rarely have comparative studies been undertaken to examine the repeatability of behavioral differences among individuals within their natural ecological settings. Using two species of endemic subtropical anemonefishes, Amphiprion mccullochi and A. latezonatus at Lord Howe and North Solitary Islands, Australia, we conducted an in situ comparative analysis of personality traits, examining the repeatability of boldness, sociability and aggression as well as the potential role of environmental and social factors on behavioral expression. For A. mccullochi, only boldness and aggression were highly repeatable and these behaviors formed a behavioral syndrome. For A. latezonatus, none of the three behaviors were repeatable due to low-inter-individual variation in behavior. We suggest that the harsher and more variable environmental and social conditions experienced by A. latezonatus have resulted in reduced repeatability in behavior, in contrast to A. mccullochi which typically inhabits a more stable lagoonal reef environment. Additionally, group size and size rank, rather than nearest-neighbor distance and anemone size, influenced the expression of these behaviors in both species, suggesting that behavioral variation was more sensitive to social than environmental factors. Overall, differences in repeatability between these closely related species likely reflect adaptations to contrasting environmental and social conditions, although alternative explanations must be considered. The differences in behavioral consistency between these two endemic anemonefishes could lead to disparity in their resilience to
Directory of Open Access Journals (Sweden)
Yu-Chen Chuang
2018-06-01
Full Text Available Phalaenopsis bellina is a scented orchid emitting large amount of monoterpenes. GERANYL DIPHOSPHATE SYNTHASE (PbGDPS is the key enzyme for monoterpene biosynthesis, and shows concomitant expression with the emission of monoterpenes during flower development in P. bellina. Here, we identified a dual repeat cis-element in the GDPS promoter that is critical for monoterpene biosynthesis in Phalaenopsis orchids. A strong correlation between the dual repeat and the monoterpene production was revealed by examination of the GDPS promoter fragments over 12 Phalaenopsis species. Serial-deletion of the 2-kb GDPS promoter fragments demonstrated that the integrity of the dual repeat was crucial for its promoter activities. By screening the Arabidopsis transcription factors (TFs cDNA library using yeast one-hybrid assay, AtbZIP18, a member of group I of bZIP TFs, was identified to be able to bind the dual repeat. We then identified PbbZIP4 in the transcriptome of P. bellina, showing 83% identity in the DNA binding region with that of AtbZIP18, and the expression level of PbbZIP4 was higher in the scented orchids. In addition, PbbZIP4 transactivated the GDPS promoter fragment containing the dual repeat in dual luciferase assay. Furthermore, transient ectopic expression of PbbZIP4 induced a 10-fold production of monoterpenoids in the scentless orchid. In conclusion, these results indicate that the dual repeat is a real TF-bound cis-element significant for GDPS gene expression, and thus subsequent monoterpene biosynthesis in the scented Phalaenopsis orchids.
International Nuclear Information System (INIS)
Stein, B.; Kraemer, M.R.; Rahmsdorf, H.J.; Ponta, H.; Herrlich, P.
1989-01-01
UV irradiation, but not visible sunlight, induces the transcription of human immunodeficiency virus type 1 (HIV-1). Chimeric constructs carrying all or parts of the HIV-1 long terminal repeat linked to an indicator gene were transfected into HeLa cells or murine and human T-cell lines, and their response to irradiation was tested. The cis-acting element conferring UV responsiveness is identical to the sequence binding transcription factor NF kappa B. UV irradiation enhances NF kappa B binding activity as assayed by gel retardation experiments. Interestingly, the requirement for UV irradiation can be replaced by cocultivation of transfected cells with UV-irradiated nontransfected (HIV-1-negative) cells. A UV-induced extracellular protein factor is detected in the culture medium conditioned by UV-treated cells. The factor is produced upon UV irradiation by several murine and human cell lines, including HeLa, Molt-4, and Jurkat, and acts on several cells. These data suggest that the UV response of keratinocytes in human skin can be magnified and spread to deeper layers that are more shielded, including the Langerhans cells, and that this indirect UV response may contribute to the activation of HIV-1 in humans
G = MAT: linking transcription factor expression and DNA binding data.
Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak
2011-01-31
Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/.
G = MAT: Linking Transcription Factor Expression and DNA Binding Data
Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak
2011-01-01
Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/. PMID:21297945
Directory of Open Access Journals (Sweden)
Jayedul Hassan
2015-06-01
Full Text Available Anthrax, caused by Bacillus anthracis is an acute, febrile disease of warm blooded animals including humans. Social norms and poverty in addition to climatic factors such as soil conditions, seasons of year, ambient temperature and rainfall influence the persistence of the B. anthracis and anthrax outbreaks. The present study was designed to reveal the factors influencing the repeated outbreak of anthrax in Bangladesh. Considering the previous outbreaks of anthrax, Sirajganj, Bogra, Kushtia, Tangail and Mymensingh districts of Bangladesh were selected for this study. To elucidate the factors, qualitative data relating to the animal management, knowledge and behavior of the people; and quantitative data relating to soil conditions, ambient temperature and rainfall were acquired, and analyzed critically. Based on the outbreak histories, a year was divided into two seasons, anthrax prone season (May-November and anthrax dry season (December-April. Anthrax spores could be isolated from 11.67% (n=14/120 of the soil samples collected from the study areas. The present study revealed that poor knowledge, lack of awareness, improper carcass disposal, inadequate vaccination, high Ca content and moisture in the soil along with high ambient temperature and rainfall during the anthrax prone season were the possible influencing factors of repeated outbreaks of anthrax in the study areas. Intensive propaganda to create public awareness of anthrax together with proper vaccination may reduce anthrax outbreaks in Bangladesh.
Calcium-dependent binding of Escherichia coli alpha-hemolysin to erythrocytes
International Nuclear Information System (INIS)
Boehm, D.F.
1989-01-01
Alpha hemolysin (AH), a protein secreted by certain strains of Escherichia coli, causes lysis of erythrocytes (RBCs) and is cytotoxic for other cells. The primary structure of AH contains an eight amino acid sequence tandemly repeated 13 times near the C-terminus. These repeated sequences are essential for hemolytic activity. AH also requires an unknown modification by an accessory protein, Hly C, for hemolytic activity. The role of calcium in the interaction of Ah with RBCs was investigated using recombinant strains which produced active and inactive forms of the toxin. Hemolytic activity was calcium-dependent. Osmotic protection experiments and immunoblots of SDS-PAGE separated proteins from washed, toxin-treated RBCs showed that the binding of active AH to RBCs was calcium-dependent. Binding of active AH to RBCs increased the calcium permeability of RBC membranes and resulted in changes in membrane protein profiles. The changes in membrane proteins did not cause the lysis of the cells. These results were consistent with a mechanism of lysis involving the formation of cation-selective pores in the membranes of target cells. 45 Ca-autoradiography of the recombinant hemolysins separated by SDS-PAGE and transferred to nitrocellulose showed that active AH bound calcium. The domain involved in binding calcium was identified as the tandemly repeated sequences since a deletion hemolysin missing 11 of the 13 repeated sequences did not bind calcium. This deletion hemolysin was non-hemolytic and did not bind to RBC membranes. Hemolysin lacking the Hly C modification was also non-hemolytic and did not bind to RBC membranes. This unmodified AH contained the repeated sequences and bound calcium as efficiently as active AH
Directory of Open Access Journals (Sweden)
Adler Joël
2007-12-01
Full Text Available Abstract Background Many parasitic organisms, eukaryotes as well as bacteria, possess surface antigens with amino acid repeats. Making up the interface between host and pathogen such repetitive proteins may be virulence factors involved in immune evasion or cytoadherence. They find immunological applications in serodiagnostics and vaccine development. Here we use proteins which contain perfect repeats as a basis for comparative genomics between parasitic and free-living organisms. Results We have developed Reptile http://reptile.unibe.ch, a program for proteome-wide probabilistic description of perfect repeats in proteins. Parasite proteomes exhibited a large variance regarding the proportion of repeat-containing proteins. Interestingly, there was a good correlation between the percentage of highly repetitive proteins and mean protein length in parasite proteomes, but not at all in the proteomes of free-living eukaryotes. Reptile combined with programs for the prediction of transmembrane domains and GPI-anchoring resulted in an effective tool for in silico identification of potential surface antigens and virulence factors from parasites. Conclusion Systemic surveys for perfect amino acid repeats allowed basic comparisons between free-living and parasitic organisms that were directly applicable to predict proteins of serological and parasitological importance. An on-line tool is available at http://genomics.unibe.ch/dora.
International Nuclear Information System (INIS)
Evans, T.; Reitman, M.; Felsenfeld, G.
1988-01-01
The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites
Directory of Open Access Journals (Sweden)
Zhang Xian
2017-01-01
Full Text Available A full-length cDNA encoding a candidate Oxysterol-binding protein(OSBP from Aspergillus oryzae (AoOSBP was cloned and expressed in Escherichia coli as a maltose-binding protein (MBP fusion protein. The MBP-AoOSBP protein from the importantly industrial fungus A. oryzae was purified by amylose resin and chromatography column. SDS-PAGE showed that MBP-AoOSBP has an estimated molecular weight of 182 kDa. OSBP and its homologues (ORPs own the affinity for oxysterols, cholesterol and glycerophospholipids. According to the superiority of A. oryzae in the fermented foods and also in food-grade productions pharmaceutical enzyme manufacture, it is meaningful to identify the biochemical properties of OSBP in A. oryzae.
Diagnostic utility of leptin and insulin-like growth factor binding ...
African Journals Online (AJOL)
Serum levels of leptin, insulin growth factor binding protein-2 (IGFBP-2) and alpha fetoprotein (AFP) were measured. ... renewal in response to nutrients. IGF pathway is not only involved in cell growth in tissue culture, but it is also involved in ...
Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok
2003-07-05
Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.
International Nuclear Information System (INIS)
Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok
2003-01-01
Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable
G = MAT: linking transcription factor expression and DNA binding data.
Directory of Open Access Journals (Sweden)
Konstantin Tretyakov
Full Text Available Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/.
International Nuclear Information System (INIS)
Bhattacharya, Monolekha; Das, Amit Kumar
2011-01-01
Highlights: ► The regulatory sequences recognized by TcrX have been identified. ► The regulatory region comprises of inverted repeats segregated by 30 bp region. ► The mode of binding of TcrX with regulatory sequence is unique. ► In silico TcrX–DNA docked model binds one of the inverted repeats. ► Both phosphorylated and unphosphorylated TcrX binds regulatory sequence in vitro. -- Abstract: TcrY, a histidine kinase, and TcrX, a response regulator, constitute a two-component system in Mycobacterium tuberculosis. tcrX, which is expressed during iron scarcity, is instrumental in the survival of iron-dependent M. tuberculosis. However, the regulator of tcrX/Y has not been fully characterized. Crosslinking studies of TcrX reveal that it can form oligomers in vitro. Electrophoretic mobility shift assays (EMSAs) show that TcrX recognizes two regions in the promoter that are comprised of inverted repeats separated by ∼30 bp. The dimeric in silico model of TcrX predicts binding to one of these inverted repeat regions. Site-directed mutagenesis and radioactive phosphorylation indicate that D54 of TcrX is phosphorylated by H256 of TcrY. However, phosphorylated and unphosphorylated TcrX bind the regulatory sequence with equal efficiency, which was shown with an EMSA using the D54A TcrX mutant.
From Cell Death to Metabolism: Holin-Antiholin Homologues with New Functions
DEFF Research Database (Denmark)
van den Esker, Marielle H.; Kovács, Ákos T.; Kuipers, Oscar P.
2017-01-01
, but their functions can be different, depending on the species. Using a series of biochemical and genetic approaches, in a recent article in mBio, Charbonnier et al. (mBio 8:e00976-17, 2017, https://doi.org/10.1128/mBio.00976-17) demonstrate that the antiholin homologue in Bacillus subtilis transports pyruvate...
Film repeats in radiology department
International Nuclear Information System (INIS)
Suwan, A. Z.; Al-Shakharah, A. I
1997-01-01
During a one year period, 4910 radiographs of 55780 films were repeated. The objective of our study was to analyse and to classify the causes in order to minimize the repeats, cut the expenses and to provide optimal radiographs for accurate diagnosis. Analysis of the different factors revealed that, 43.6% of film repeats in our service were due to faults in exposure factors, centering comprises 15.9% of the repeats, while too much collimation was responsible for 7.6% of these repeats. All of which can be decreased by awareness and programmed training of technicians. Film blurring caused by patient motion was also responsible for 4.9% for radiographs reexamination, which can be minimized by detailed explanation to the patient and providing the necessary privacy. Fogging of X-Ray films by improper storage or inadequate handling or processing faults were responsible for 14.5% in repeats in our study. Methods and criteria for proper storage and handling of films were discussed. Recommendation for using modern day-light and laser processor has been high lighted. Artefacts are noticeably high in our cases, due to spinal dresses and frequent usage of precious metals for c osmotic purposes in this part of the world. The repeated films comprise 8.8% of all films We conclude that, the main factor responsible for repeats of up to 81.6% of cases was the technologists, thus emphasizing the importance of adequate training of the technologists. (authors). 15 refs., 9 figs., 1 table
Wilczak, N; Kuhl, N; Chesik, D; Geerts, A; Luiten, P; De Keyser, J
The binding characteristics of [(125) I]insulin-like growth factor (IGF)-I were studied in human brain and pituitary gland. Competition binding studies with DES(1-3)IGF-I and R-3 -IGF-I, which display high affinity for the IGF-I receptor and low affinity for IGF binding proteins (IGFBPs), were
The superfamily of C3b/C4b-binding proteins
DEFF Research Database (Denmark)
Kristensen, Torsten; D'Eustachio, P; Ogata, R T
1987-01-01
The determination of primary structures by amino acid and nucleotide sequencing for the C3b-and/or C4b-binding proteins H, C4BP, CR1, B, and C2 has revealed the presence of a common structural element. This element is approximately 60 amino acids long and is repeated in a tandem fashion, commencing...... at the amino-terminal end of each molecule. Two other complement components, C1r and C1s, have two of these repeating units in the carboxy-terminal region of their noncatalytic A chains. Three noncomplement proteins, beta 2-glycoprotein I (beta 2I), the interleukin 2 receptor (IL 2 receptor), and the b chain...... of factor XIII, have 4, 2 and 10 of these repeating units, respectively. These proteins obviously belong to the above family, although there is no evidence that they interact with C3b and/or C4b. Human haptoglobin and rat leukocyte common antigen also contain two and three repeating units, respectively...
Conservation of transcription factor binding events predicts gene expression across species
Hemberg, Martin; Kreiman, Gabriel
2011-01-01
Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to function, defined as expression of the target genes. We show that (i) there is a significantly higher degree of conservation of TFBEs when the target gene is expressed in both species; (ii) there is increased conservation of binding events for groups of TFs compared to individual TFs; and (iii) conserved TFBEs have a greater impact on the expression of their target genes than non-conserved ones. These results link conservation of structural elements (TFBEs) to conservation of function (gene expression) and suggest a higher degree of functional conservation than implied by previous studies. PMID:21622661
Graffigna, Mabel Nora; Belli, Susana H; de Larrañaga, Gabriela; Fainboim, Hugo; Estepo, Claudio; Peres, Silvia; García, Natalia; Levalle, Oscar
2009-03-01
to assess the presence of nonalcoholic fatty liver disease in patients with risk factors for this pathology (obesity, dyslipidemia, metabolic syndrome and diabetes type 2) and to determine the role of insulin, HOMA index, insulin-like growth factor-binding protein-1, sex hormone-binding globulin and plasminogen activator inhibitor type 1, as biochemical markers. Ninety-one patients with risk factors for nonalcoholic fatty liver disease were evaluated. Serum transaminases, insulin, sex hormone-binding globulin, insulin-like growth factor-binding protein-1 and plasminogen activator inhibitor type 1 were measured. The diagnosis of fatty liver was performed by ultrasonography and liver biopsies were performed to 31 subjects who had steatosis by ultrasonography and high alanine aminotransferase. Nonalcoholic fatty liver disease was present in 65 out of 91 patients (71,4%). Liver biopsy performed to 31 subjects confirmed nonalcoholic steatohepatitis. Twenty-five patients had different degrees of fibrosis. Those individuals with fatty liver had higher waist circumference, serum levels of triglycerides, insulin and HOMA index, and lower serum insulin-like growth factor-binding protein-1 concentration. The degree ofhepatic steatosis by ultrasonography was positively correlated to waist circumference, triglycerides, insulin and HOMA index (p<0,003; p<0,003; p<0,002 and p<0,001, respectively), and was negatively correlated to HDL-cholesterol and insulin-like growth factor-binding protein-1 (p<0,025 and p<0,018, respectively). We found a high prevalence of NAFLD in patients with risk factors, most of them overweight or obese. Although SHBG and PAI-1 have a closely relationship to insulin resistance, they did not show to be markers of NAFLD. Regardless of low IGFBP-1 levels associated with NAFLD, serum IGFBP-1 measure is less accessible than insulin and triglycerides levels, HOMA index and waist circumference. Moreover, it is not a better marker for NAFLD than the above
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Factors associated with repeat induced abortion in Kenya.
Maina, Beatrice W; Mutua, Michael M; Sidze, Estelle M
2015-10-12
Over six million induced abortions were reported in Africa in 2008 with over two million induced abortions occurring in Eastern Africa. Although a significant proportion of women in the region procure more than one abortion during their reproductive period, there is a dearth of research on factors associated with repeat abortion. Data for this study come from the Magnitude and Incidence of Unsafe Abortion Study conducted by the African Population and Health Research Center in Kenya in 2012. The study used a nationally-representative sample of 350 facilities (level II to level VI) that offer post-abortion services for complications following induced and spontaneous abortions. A prospective morbidity survey tool was used by health providers in 328 facilities to collect information on socio-demographic charateristics, reproductive health history and contraceptive use at conception for all patients presenting for post-abortion services. Our analysis is based on data recorded on 769 women who were classified as having had an induced abortion. About 16 % of women seeking post abortion services for an induced abortion reported to have had a previous induced abortion. Being separated or divorced or widowed, having no education, having unwanted pregnancy, having 1-2 prior births and using traditional methods of contraception were associated with a higher likelihood of a repeat induced abortion. The findings point to the need to address the reasons why women with first time induced abortion do not have the necessary information to prevent unintended pregnancies and further induced abortions. Possible explanations linked to the quality of post-abortion family planning and coverage of long-acting methods should be explored.
Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas
Li, Chaoqiong; Fu, Qiantang; Niu, Longjian; Luo, Li; Chen, Jianghua; Xu, Zeng-Fu
2017-01-01
Recent research revealed that TERMINAL FLOWER 1 (TFL1) homologues are involved in the critical developmental process of floral initiation in several plant species. In this study, the functions of three putative TFL1 homologues (JcTFL1a, JcTFL1b and JcTFL1c) in the biofuel plant Jatropha curcas were analysed using the transgenic approach. JcTFL1b and JcTFL1c, but not JcTFL1a, could complement the TFL1 function and rescue early flowering and determinate inflorescence phenotype in tfl1-14 Arabidopsis mutant, thus suggesting that JcTFL1b and JcTFL1c may be homologues of TFL1. Transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c showed late flowering, whereas only JcTFL1b and JcTFL1c overexpression delayed flowering in transgenic Arabidopsis. JcTFL1b-RNAi transgenic Jatropha consistently exhibited moderately early flowering phenotype. JcFT and JcAP1 were significantly downregulated in transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c, which suggested that the late flowering phenotype of these transgenic Jatropha may result from the repressed expression of JcFT and JcAP1. Our results indicate that these three JcTFL1 genes play redundant roles in repressing flowering in Jatropha. PMID:28225036
Behaviour of the homologues of Rf and Db in complexing media
International Nuclear Information System (INIS)
Trubert, D.; Monroy Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Servajean, V.; Constantinescu, O.; Constantinescu, M.; Ardisson, G.; Barci, V.; Weiss, B.
1999-01-01
In order to study the chemical behaviour of the trans-actinide elements, the chemical properties of their most probable homologues have been investigated by ion exchange methods in various complexing media. A new chromatographic method allowing the determination of distribution coefficients in the case o short-lived isotopes has been developed and successfully tested with the RACHEL device. (authors)
Telomerase Repeated Amplification Protocol (TRAP).
Mender, Ilgen; Shay, Jerry W
2015-11-20
Telomeres are found at the end of eukaryotic linear chromosomes, and proteins that bind to telomeres protect DNA from being recognized as double-strand breaks thus preventing end-to-end fusions (Griffith et al. , 1999). However, due to the end replication problem and other factors such as oxidative damage, the limited life span of cultured cells (Hayflick limit) results in progressive shortening of these protective structures (Hayflick and Moorhead, 1961; Olovnikov, 1973). The ribonucleoprotein enzyme complex telomerase-consisting of a protein catalytic component hTERT and a functional RNA component hTR or hTERC - counteracts telomere shortening by adding telomeric repeats to the end of chromosomes in ~90% of primary human tumors and in some transiently proliferating stem-like cells (Shay and Wright, 1996; Shay and Wright, 2001). This results in continuous proliferation of cells which is a hallmark of cancer. Therefore, telomere biology has a central role in aging, cancer progression/metastasis as well as targeted cancer therapies. There are commonly used methods in telomere biology such as Telomere Restriction Fragment (TRF) (Mender and Shay, 2015b), Telomere Repeat Amplification Protocol (TRAP) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this detailed protocol we describe Telomere Repeat Amplification Protocol (TRAP). The TRAP assay is a popular method to determine telomerase activity in mammalian cells and tissue samples (Kim et al. , 1994). The TRAP assay includes three steps: extension, amplification, and detection of telomerase products. In the extension step, telomeric repeats are added to the telomerase substrate (which is actually a non telomeric oligonucleotide, TS) by telomerase. In the amplification step, the extension products are amplified by the polymerase chain reaction (PCR) using specific primers (TS upstream primer and ACX downstream primer) and in the detection step, the presence or absence of telomerase is
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M
1997-03-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.
Yokoyama, Ken Daigoro; Pollock, David D.
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068
C9orf72 nucleotide repeat structures initiate molecular cascades of disease.
Haeusler, Aaron R; Donnelly, Christopher J; Periz, Goran; Simko, Eric A J; Shaw, Patrick G; Kim, Min-Sik; Maragakis, Nicholas J; Troncoso, Juan C; Pandey, Akhilesh; Sattler, Rita; Rothstein, Jeffrey D; Wang, Jiou
2014-03-13
A hexanucleotide repeat expansion (HRE), (GGGGCC)n, in C9orf72 is the most common genetic cause of the neurodegenerative diseases amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Here we identify a molecular mechanism by which structural polymorphism of the HRE leads to ALS/FTD pathology and defects. The HRE forms DNA and RNA G-quadruplexes with distinct structures and promotes RNA•DNA hybrids (R-loops). The structural polymorphism causes a repeat-length-dependent accumulation of transcripts aborted in the HRE region. These transcribed repeats bind to ribonucleoproteins in a conformation-dependent manner. Specifically, nucleolin, an essential nucleolar protein, preferentially binds the HRE G-quadruplex, and patient cells show evidence of nucleolar stress. Our results demonstrate that distinct C9orf72 HRE structural polymorphism at both DNA and RNA levels initiates molecular cascades leading to ALS/FTD pathologies, and provide the basis for a mechanistic model for repeat-associated neurodegenerative diseases.
The actin homologue MreB organizes the bacterial cell membrane
Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.
2014-01-01
The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...
Molecular determinants of epidermal growth factor binding: a molecular dynamics study.
Directory of Open Access Journals (Sweden)
Jeffrey M Sanders
Full Text Available The epidermal growth factor receptor (EGFR is a member of the receptor tyrosine kinase family that plays a role in multiple cellular processes. Activation of EGFR requires binding of a ligand on the extracellular domain to promote conformational changes leading to dimerization and transphosphorylation of intracellular kinase domains. Seven ligands are known to bind EGFR with affinities ranging from sub-nanomolar to near micromolar dissociation constants. In the case of EGFR, distinct conformational states assumed upon binding a ligand is thought to be a determining factor in activation of a downstream signaling network. Previous biochemical studies suggest the existence of both low affinity and high affinity EGFR ligands. While these studies have identified functional effects of ligand binding, high-resolution structural data are lacking. To gain a better understanding of the molecular basis of EGFR binding affinities, we docked each EGFR ligand to the putative active state extracellular domain dimer and 25.0 ns molecular dynamics simulations were performed. MM-PBSA/GBSA are efficient computational approaches to approximate free energies of protein-protein interactions and decompose the free energy at the amino acid level. We applied these methods to the last 6.0 ns of each ligand-receptor simulation. MM-PBSA calculations were able to successfully rank all seven of the EGFR ligands based on the two affinity classes: EGF>HB-EGF>TGF-α>BTC>EPR>EPG>AR. Results from energy decomposition identified several interactions that are common among binding ligands. These findings reveal that while several residues are conserved among the EGFR ligand family, no single set of residues determines the affinity class. Instead we found heterogeneous sets of interactions that were driven primarily by electrostatic and Van der Waals forces. These results not only illustrate the complexity of EGFR dynamics but also pave the way for structure-based design of
Complement factor H binds malondialdehyde epitopes and protects from oxidative stress
DEFF Research Database (Denmark)
Weismann, David; Hartvigsen, Karsten; Lauer, Nadine
2011-01-01
peroxidation product that accumulates in many pathophysiological processes, including AMD. Here we identify complement factor H (CFH) as a major MDA-binding protein that can block both the uptake of MDA-modified proteins by macrophages and MDA-induced proinflammatory effects in vivo in mice. The CFH...... polymorphism H402, which is strongly associated with AMD, markedly reduces the ability of CFH to bind MDA, indicating a causal link to disease aetiology. Our findings provide important mechanistic insights into innate immune responses to oxidative stress, which may be exploited in the prevention of and therapy...
Marsh, T. L.; Reich, C. I.; Whitelock, R. B.; Olsen, G. J.; Woese, C. R. (Principal Investigator)
1994-01-01
The first step in transcription initiation in eukaryotes is mediated by the TATA-binding protein, a subunit of the transcription factor IID complex. We have cloned and sequenced the gene for a presumptive homolog of this eukaryotic protein from Thermococcus celer, a member of the Archaea (formerly archaebacteria). The protein encoded by the archaeal gene is a tandem repeat of a conserved domain, corresponding to the repeated domain in its eukaryotic counterparts. Molecular phylogenetic analyses of the two halves of the repeat are consistent with the duplication occurring before the divergence of the archael and eukaryotic domains. In conjunction with previous observations of similarity in RNA polymerase subunit composition and sequences and the finding of a transcription factor IIB-like sequence in Pyrococcus woesei (a relative of T. celer) it appears that major features of the eukaryotic transcription apparatus were well-established before the origin of eukaryotic cellular organization. The divergence between the two halves of the archael protein is less than that between the halves of the individual eukaryotic sequences, indicating that the average rate of sequence change in the archael protein has been less than in its eukaryotic counterparts. To the extent that this lower rate applies to the genome as a whole, a clearer picture of the early genes (and gene families) that gave rise to present-day genomes is more apt to emerge from the study of sequences from the Archaea than from the corresponding sequences from eukaryotes.
JASPAR 2010: the greatly expanded open-access database of transcription factor binding profiles
DEFF Research Database (Denmark)
Portales-Casamar, Elodie; Thongjuea, Supat; Kwon, Andrew T
2009-01-01
JASPAR (http://jaspar.genereg.net) is the leading open-access database of matrix profiles describing the DNA-binding patterns of transcription factors (TFs) and other proteins interacting with DNA in a sequence-specific manner. Its fourth major release is the largest expansion of the core database...... to an active research community. As binding models are refined by newer data, the JASPAR database now uses versioning of matrices: in this release, 12% of the older models were updated to improved versions. Classification of TF families has been improved by adopting a new DNA-binding domain nomenclature...
Cyanobacteria contain a structural homologue of the Hfq protein with altered RNA binding properties
DEFF Research Database (Denmark)
Bøggild, Andreas; Overgaard, Martin; Valentin-Hansen, Poul
2009-01-01
Hfq proteins are common in many species of enterobacteria, where they participate in RNA folding and translational regulation through pairing of small RNAs and messenger RNAs. Hfq proteins share the distinctive Sm fold, and form ring-shaped structures similar to those of the Sm/Lsm proteins...... proteins from the cyanobacteria Synechocystis sp. PCC 6803 and Anabaena PCC 7120 at 1.3 and 2.3 A resolution, respectively, and show that they retain the classic Sm fold despite low sequence conservation. In addition, the intersubunit contacts and RNA-binding site are divergent, and we show biochemically...
Cyanobacteria contain a structural homologue of the Hfq protein with altered RNA-binding properties
DEFF Research Database (Denmark)
Bøggild, Andreas; Overgaard, Martin; Valentin-Hansen, Poul
2009-01-01
Hfq proteins are common in many species of enterobacteria, where they participate in RNA folding and translational regulation through pairing of small RNAs and messenger RNAs. Hfq proteins share the distinctive Sm fold, and form ring-shaped structures similar to those of the Sm/Lsm proteins...... proteins from the cyanobacteria Synechocystis sp. PCC 6803 and Anabaena PCC 7120 at 1.3 and 2.3 A resolution, respectively, and show that they retain the classic Sm fold despite low sequence conservation. In addition, the intersubunit contacts and RNA-binding site are divergent, and we show biochemically...
Directory of Open Access Journals (Sweden)
Cristina Valls-Bautista
2012-11-01
Full Text Available Background: colorectal cancer is the third cancer cause of death in Spain. It is important to investigate new tumoral markers for early diagnosis, disease monitoring and prevention strategies. Telomeres protect the chromosome from degradation by nucleases and end-to-end fusion. The progressive loss of the telomeric ends of chromosomes is an important mechanism in the timing of human cellular aging. Telomeric Repeat Factor 1 (TRF1 is a protein that binds at telomere ends. Purpose: to measure the concentrations of TRF1 and the relationships among telomere length, telomerase activity, and TRF1 levels in tumor and normal colorectal mucosa. Method: from normal and tumoral samples of 83 patients who underwent surgery for colorectal cancer we analyzed TRF1 protein concentration by Western Blot, telomerase activity, by the fluorescent-telomeric repeat amplification protocol assay and telomere length by Southern Blot. Results: high levels of TRF1 were observed in 68.7% of tumor samples, while the majority of normal samples (59% showed negative or weak TRF1 concentrations. Among the tumor samples, telomere length was significantly associated with TRF1 protein levels (p = 0.023. Conclusions: a relationship was found between telomere length and TRF1 abundance protein in tumor samples, which means that TRF1 is an important factor in the tumor progression and maybe a diagnostic factor.
Directory of Open Access Journals (Sweden)
Sarah Röhrig
2016-10-01
Full Text Available The stability of repetitive sequences in complex eukaryotic genomes is safeguarded by factors suppressing homologues recombination. Prominent in this is the role of the RTR complex. In plants, it consists of the RecQ helicase RECQ4A, the topoisomerase TOP3α and RMI1. Like mammals, but not yeast, plants harbor an additional complex partner, RMI2. Here, we demonstrate that, in Arabidopsis thaliana, RMI2 is involved in the repair of aberrant replication intermediates in root meristems as well as in intrastrand crosslink repair. In both instances, RMI2 is involved independently of the DNA helicase RTEL1. Surprisingly, simultaneous loss of RMI2 and RTEL1 leads to loss of male fertility. As both the RTR complex and RTEL1 are involved in suppression of homologous recombination (HR, we tested the efficiency of HR in the double mutant rmi2-2 rtel1-1 and found a synergistic enhancement (80-fold. Searching for natural target sequences we found that RTEL1 is required for stabilizing 45S rDNA repeats. In the double mutant with rmi2-2 the number of 45S rDNA repeats is further decreased sustaining independent roles of both factors in this process. Thus, loss of suppression of HR does not only lead to a destabilization of rDNA repeats but might be especially deleterious for tissues undergoing multiple cell divisions such as the male germline.
Röhrig, Sarah; Schröpfer, Susan; Knoll, Alexander; Puchta, Holger
2016-10-01
The stability of repetitive sequences in complex eukaryotic genomes is safeguarded by factors suppressing homologues recombination. Prominent in this is the role of the RTR complex. In plants, it consists of the RecQ helicase RECQ4A, the topoisomerase TOP3α and RMI1. Like mammals, but not yeast, plants harbor an additional complex partner, RMI2. Here, we demonstrate that, in Arabidopsis thaliana, RMI2 is involved in the repair of aberrant replication intermediates in root meristems as well as in intrastrand crosslink repair. In both instances, RMI2 is involved independently of the DNA helicase RTEL1. Surprisingly, simultaneous loss of RMI2 and RTEL1 leads to loss of male fertility. As both the RTR complex and RTEL1 are involved in suppression of homologous recombination (HR), we tested the efficiency of HR in the double mutant rmi2-2 rtel1-1 and found a synergistic enhancement (80-fold). Searching for natural target sequences we found that RTEL1 is required for stabilizing 45S rDNA repeats. In the double mutant with rmi2-2 the number of 45S rDNA repeats is further decreased sustaining independent roles of both factors in this process. Thus, loss of suppression of HR does not only lead to a destabilization of rDNA repeats but might be especially deleterious for tissues undergoing multiple cell divisions such as the male germline.
Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M
2007-01-01
Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...
Simpson, M.; Mojibian, M.; Barriga, K.; Scott, F.W.; Fasano, A.; Rewers, M.; Norris, J.M.
2010-01-01
Aims To determine whether Glb1 homologue antibodies are associated with islet autoimmunity (IA) in children at increased risk for type 1 diabetes (T1D), and to investigate their relation with putative environmental correlates of T1D. Methods We selected a sample from the Diabetes Autoimmunity Study in the Young (DAISY), a prospective study of children at increased risk for T1D. Cases were those who were positive for insulin, glutamic acid decarboxylase (GAD), or insulinoma-associated antigen-2 (IA-2) autoantibodies on two consecutive visits and either diagnosed with diabetes mellitus or still autoantibody positive when selected. Controls were from the same increased risk group, of similar age as the cases but negative for autoantibodies. Sera from 91 IA cases and 82 controls were analyzed in a blinded manner for immunoglobulin G (IgG) antibodies to Glb1 homologue by ELISA. Results Adjusting for family history of T1D and HLA-DR4 positivity, Glb1 homologue antibodies were not associated with IA case status (OR: 1.01, 95% CI: 0.99 – 1.03). Adjusting for age, family history of T1D, and HLA-DR4 positivity, Glb1 homologue antibody levels were inversely associated with breast-feeding duration (beta = −0.08, p = 0.001) and directly associated with current intake of foods containing gluten (beta = 0.24, p = 0.007) in IA cases but not in controls. Zonulin, a biomarker of gut permeability, was directly associated with Glb1 homologue antibody levels in cases (beta = 0.73, p = 0.003) but not in controls. Conclusion Differences in correlates of Glb1 antibodies in IA cases and controls suggest an underlying difference in mucosal immune response. PMID:19622083
Binding and functional effects of atrial natriuretic factor in isolated rat kidney
International Nuclear Information System (INIS)
Suzuki, M.; Almeida, F.A.; Nussenzveig, D.R.; Sawyer, D.; Maack, T.
1987-01-01
A new methodological approach was developed to study the relationship between specific binding and dose-response curves of the renal effects of atrial natriuretic factor (ANF) in isolated perfused rat kidneys (IK). IK were perfused with 125 I-labeled and unlabeled ANF 1-28 to determine the following: (1) distribution, capacity (C max ), and apparent affinity (S 50 ) of specific binding of ANF 1-28 in cortex, outer medulla, and papilla and (2) dose-response curves of the effects of ANF 1-28 on renal hemodynamics and excretion of fluid and electrolytes. The kidney had a very high density of high-affinity binding sites for ANF. Cortex had >90% of total binding sites whereas papilla had <2% of total binding sites with a 10-fold lower apparent affinity than in cortex. ANF-induced increases in glomerular filtration rate and excretion of fluid and electrolytes were detectable at 10-100 pM and maximal effects occurred at 1-10 nM ANF. Below 1 nM there was no dissociation between the renal hemodynamic and natriuretic effects of ANF. There was a close agreement between dose-response and binding curves of ANF to cortex. Results demonstrates that binding site occupancy in kidney cortex and renal effects of ANF occur at near physiological concentrations of the hormone
Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level
Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.
2012-01-01
Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804
The Role of Genome Accessibility in Transcription Factor Binding in Bacteria.
Directory of Open Access Journals (Sweden)
Antonio L C Gomes
2016-04-01
Full Text Available ChIP-seq enables genome-scale identification of regulatory regions that govern gene expression. However, the biological insights generated from ChIP-seq analysis have been limited to predictions of binding sites and cooperative interactions. Furthermore, ChIP-seq data often poorly correlate with in vitro measurements or predicted motifs, highlighting that binding affinity alone is insufficient to explain transcription factor (TF-binding in vivo. One possibility is that binding sites are not equally accessible across the genome. A more comprehensive biophysical representation of TF-binding is required to improve our ability to understand, predict, and alter gene expression. Here, we show that genome accessibility is a key parameter that impacts TF-binding in bacteria. We developed a thermodynamic model that parameterizes ChIP-seq coverage in terms of genome accessibility and binding affinity. The role of genome accessibility is validated using a large-scale ChIP-seq dataset of the M. tuberculosis regulatory network. We find that accounting for genome accessibility led to a model that explains 63% of the ChIP-seq profile variance, while a model based in motif score alone explains only 35% of the variance. Moreover, our framework enables de novo ChIP-seq peak prediction and is useful for inferring TF-binding peaks in new experimental conditions by reducing the need for additional experiments. We observe that the genome is more accessible in intergenic regions, and that increased accessibility is positively correlated with gene expression and anti-correlated with distance to the origin of replication. Our biophysically motivated model provides a more comprehensive description of TF-binding in vivo from first principles towards a better representation of gene regulation in silico, with promising applications in systems biology.
Nishimura, R; Li, W; Kashishian, A; Mondino, A; Zhou, M; Cooper, J; Schlessinger, J
1993-11-01
Autophosphorylation sites of growth factor receptors with tyrosine kinase activity function as specific binding sites for Src homology 2 (SH2) domains of signaling molecules. This interaction appears to be a crucial step in a mechanism by which receptor tyrosine kinases relay signals to downstream signaling pathways. Nck is a widely expressed protein consisting exclusively of SH2 and SH3 domains, the overexpression of which causes cell transformation. It has been shown that various growth factors stimulate the phosphorylation of Nck and its association with autophosphorylated growth factor receptors. A panel of platelet-derived growth factor (PDGF) receptor mutations at tyrosine residues has been used to identify the Nck binding site. Here we show that mutation at Tyr-751 of the PDGF beta-receptor eliminates Nck binding both in vitro and in living cells. Moreover, the Y751F PDGF receptor mutant failed to mediate PDGF-stimulated phosphorylation of Nck in intact cells. A phosphorylated Tyr-751 is also required for binding of phosphatidylinositol-3 kinase to the PDGF receptor. Hence, the SH2 domains of p85 and Nck share a binding site in the PDGF receptor. Competition experiments with different phosphopeptides derived from the PDGF receptor suggest that binding of Nck and p85 is influenced by different residues around Tyr-751. Thus, a single tyrosine autophosphorylation site is able to link the PDGF receptor to two distinct SH2 domain-containing signaling molecules.
Dai, Hanjun
2017-07-26
Motivation: An accurate characterization of transcription factor (TF)-DNA affinity landscape is crucial to a quantitative understanding of the molecular mechanisms underpinning endogenous gene regulation. While recent advances in biotechnology have brought the opportunity for building binding affinity prediction methods, the accurate characterization of TF-DNA binding affinity landscape still remains a challenging problem. Results: Here we propose a novel sequence embedding approach for modeling the transcription factor binding affinity landscape. Our method represents DNA binding sequences as a hidden Markov model (HMM) which captures both position specific information and long-range dependency in the sequence. A cornerstone of our method is a novel message passing-like embedding algorithm, called Sequence2Vec, which maps these HMMs into a common nonlinear feature space and uses these embedded features to build a predictive model. Our method is a novel combination of the strength of probabilistic graphical models, feature space embedding and deep learning. We conducted comprehensive experiments on over 90 large-scale TF-DNA data sets which were measured by different high-throughput experimental technologies. Sequence2Vec outperforms alternative machine learning methods as well as the state-of-the-art binding affinity prediction methods.
DEFF Research Database (Denmark)
Chrzanowski, L; Stasiewicz, M; Owsianiak, Mikolaj
2009-01-01
hypothesize that in the presence of diesel fuel low-water-soluble ionic liquids may become more toxic to hydrocarbon-degrading microorganisms. In this study the influence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues (side-chain length from C-3 to C-18) on biodegradation of diesel fuel...... by a bacterial consortium was investigated. Whereas test performed for the consortium cultivated on disodium succinate showed that toxicity of the investigated ionic liquids decreased with increase in side-chain length, only higher homologues (C-8-C-18) caused a decrease in diesel fuel biodegradation......, respectively. We conclude that in the presence of hydrocarbons acting as a solvent, the increased bioavailability of hydrophobic homologues is responsible for the decrease in biodegradation efficiency of diesel fuel....
DEFF Research Database (Denmark)
Dagil, Robert; O'Shea, Charlotte; Nykjær, Anders
2013-01-01
megalin and investigated its interaction with gentamicin. Using NMR titration data in HADDOCK, we have generated a three-dimensional model describing the complex between megalin and gentamicin. Gentamicin binds to megalin with low affinity and exploits the common ligand binding motif previously described...... to megalin is highly similar to gentamicin binding to calreticulin. We discuss the impact of this novel insight for the future structure-based design of gentamicin antagonists....
Directory of Open Access Journals (Sweden)
Anil Raj
Full Text Available Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede.
Raj, Anil; Shim, Heejung; Gilad, Yoav; Pritchard, Jonathan K; Stephens, Matthew
2015-01-01
Understanding global gene regulation depends critically on accurate annotation of regulatory elements that are functional in a given cell type. CENTIPEDE, a powerful, probabilistic framework for identifying transcription factor binding sites from tissue-specific DNase I cleavage patterns and genomic sequence content, leverages the hypersensitivity of factor-bound chromatin and the information in the DNase I spatial cleavage profile characteristic of each DNA binding protein to accurately infer functional factor binding sites. However, the model for the spatial profile in this framework fails to account for the substantial variation in the DNase I cleavage profiles across different binding sites. Neither does it account for variation in the profiles at the same binding site across multiple replicate DNase I experiments, which are increasingly available. In this work, we introduce new methods, based on multi-scale models for inhomogeneous Poisson processes, to account for such variation in DNase I cleavage patterns both within and across binding sites. These models account for the spatial structure in the heterogeneity in DNase I cleavage patterns for each factor. Using DNase-seq measurements assayed in a lymphoblastoid cell line, we demonstrate the improved performance of this model for several transcription factors by comparing against the Chip-seq peaks for those factors. Finally, we explore the effects of DNase I sequence bias on inference of factor binding using a simple extension to our framework that allows for a more flexible background model. The proposed model can also be easily applied to paired-end ATAC-seq and DNase-seq data. msCentipede, a Python implementation of our algorithm, is available at http://rajanil.github.io/msCentipede.
Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.
2004-01-01
Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1
International Nuclear Information System (INIS)
Sabourin, P.J.; Sun, J.D.; MacGregor, J.T.; Wehr, C.M.; Birnbaum, L.S.; Lucier, G.; Henderson, R.F.
1990-01-01
Metabolism of benzene is thought to be necessary to produce the toxic effects, including carcinogenicity, associated with benzene exposure. To extrapolate from the results of rodent studies to potential health risks in man, one must know how benzene metabolism is affected by species, dose, dose rate, and repeated versus single exposures. The purpose of our studies was to determine the effect of repeated inhalation exposures on the metabolism of [14C]benzene by rodents. Benzene metabolism was assessed by characterizing and quantitating urinary metabolites, and by quantitating 14C bound to hemoglobin and micronuclei induction. F344/N rats and B6C3F1 mice were exposed, nose-only, to 600 ppm benzene or to air (control) for 6 hr/day, 5 days/week for 3 weeks. On the last day, both benzene-pretreated and control animals were exposed to 600 ppm, 14C-labeled benzene for 6 hr. Individual benzene metabolites in urine collected for 24 hr after the exposure were analyzed. There was a significant decrease in the respiratory rate of mice (but not rats) pretreated with benzene which resulted in lower levels of urinary [14C]benzene metabolites. The analyses indicated that the only effects of benzene pretreatment on the metabolite profile in rat or mouse urine were a slight shift from glucuronidation to sulfation in mice and a shift from sulfation to glucuronidation in rats. Benzene pretreatment also had no effect, in either species, on formation of [14C]benzene-derived hemoglobin adducts. Mice and rats had similar levels of hemoglobin adduct binding, despite the higher metabolism of benzene by mice. This indicates that hemoglobin adduct formation occurs with higher efficiency in rats. After 1 week of exposure to 600 ppm benzene, the frequency of micronucleated, polychromatic erythrocytes (PCEs) in mice was significantly increased
Thawani, Akanksha; Kadzik, Rachel S; Petry, Sabine
2018-05-01
How microtubules (MTs) are generated in the cell is a major question in understanding how the cytoskeleton is assembled. For several decades, γ-tubulin has been accepted as the universal MT nucleator of the cell. Although there is evidence that γ-tubulin complexes are not the sole MT nucleators, identification of other nucleation factors has proven difficult. Here, we report that the well-characterized MT polymerase XMAP215 (chTOG/Msps/Stu2p/Alp14/Dis1 homologue) is essential for MT nucleation in Xenopus egg extracts. The concentration of XMAP215 determines the extent of MT nucleation. Even though XMAP215 and the γ-tubulin ring complex (γ-TuRC) possess minimal nucleation activity individually, together, these factors synergistically stimulate MT nucleation in vitro. The amino-terminal TOG domains 1-5 of XMAP215 bind to αβ-tubulin and promote MT polymerization, whereas the conserved carboxy terminus is required for efficient MT nucleation and directly binds to γ-tubulin. In summary, XMAP215 and γ-TuRC together function as the principal nucleation module that generates MTs in cells.
Altered [125I]epidermal growth factor binding and receptor distribution in psoriasis
International Nuclear Information System (INIS)
Nanney, L.B.; Stoscheck, C.M.; Magid, M.; King, L.E. Jr.
1986-01-01
Stimulation of growth and differentiation of human epidermis by epidermal growth factor (EGF) is mediated by its binding to specific receptors. Whether EGF receptors primarily mediate cell division or differentiation in hyperproliferative disease such as psoriasis vulgaris is unclear. To study the pathogenesis of psoriasis, 4-mm2 punch biopsy specimens of normal, uninvolved, and involved psoriatic skin were assayed for EGF receptors by autoradiographic, immunohistochemical, and biochemical methods. Using autoradiographic and immunohistochemical methods, basal keratinocytes were found to contain the greatest number of EGF binding sites and immunoreactive receptors as compared to the upper layers of the epidermis in both normal epidermis and psoriatic skin. No EGF receptor differences between normal and psoriatic epidermis were observed in this layer. In the upper layers of the epidermis, a 2-fold increase in EGF binding capacity was observed in psoriatic skin as compared with normal thin or thick skin. Biochemical methods indicated that [ 125 I]EGF binding was increased in psoriatic epidermis as compared with similar thickness normal epidermis when measured on a protein basis. Epidermal growth factor was shown to increase phosphorylation of the EGF receptor in skin. EGF receptors retained in the nonmitotic stratum spinosum and parakeratotic stratum corneum may reflect the incomplete, abnormal differentiation that occurs in active psoriatic lesions. Alternatively, retained EGF receptors may play a direct role in inhibiting cellular differentiation in the suprabasal layers
Directory of Open Access Journals (Sweden)
Stephanie C Licata
Full Text Available Benzodiazepines (BZs are safe drugs for treating anxiety, sleep, and seizure disorders, but their use also results in unwanted effects including memory impairment, abuse, and dependence. The present study aimed to reveal the molecular mechanisms that may contribute to the effects of BZs in the hippocampus (HIP, an area involved in drug-related plasticity, by investigating the regulation of immediate early genes following BZ administration. Previous studies have demonstrated that both brain derived neurotrophic factor (BDNF and c-Fos contribute to memory- and abuse-related processes that occur within the HIP, and their expression is altered in response to BZ exposure. In the current study, mice received acute or repeated administration of BZs and HIP tissue was analyzed for alterations in BDNF and c-Fos expression. Although no significant changes in BDNF or c-Fos were observed in response to twice-daily intraperitoneal (i.p. injections of diazepam (10 mg/kg + 5 mg/kg or zolpidem (ZP; 2.5 mg/kg + 2.5 mg/kg, acute i.p. administration of both triazolam (0.03 mg/kg and ZP (1.0 mg/kg decreased BDNF protein levels within the HIP relative to vehicle, without any effect on c-Fos. ZP specifically reduced exon IV-containing BDNF transcripts with a concomitant increase in the association of methyl-CpG binding protein 2 (MeCP2 with BDNF promoter IV, suggesting that MeCP2 activity at this promoter may represent a ZP-specific mechanism for reducing BDNF expression. ZP also increased the association of phosphorylated cAMP response element binding protein (pCREB with BDNF promoter I. Future work should examine the interaction between ZP and DNA as the cause for altered gene expression in the HIP, given that BZs can enter the nucleus and intercalate into DNA directly.
Substrate recognition by complement convertases revealed in the C5-cobra venom factor complex
DEFF Research Database (Denmark)
Laursen, Nick Stub; Andersen, Kasper Røjkjær; Braren, Ingke
2011-01-01
with a protease subunit (Bb or C2a). We determined the crystal structures of the C3b homologue cobra venom factor (CVF) in complex with C5, and in complex with C5 and the inhibitor SSL7 at 4.3 Å resolution. The structures reveal a parallel two-point attachment between C5 and CVF, where the presence of SSL7 only...... slightly affects the C5-CVF interface, explaining the IgA dependence for SSL7-mediated inhibition of C5 cleavage. CVF functions as a relatively rigid binding scaffold inducing a conformational change in C5, which positions its cleavage site in proximity to the serine protease Bb. A general model...
Structural studies on a non-toxic homologue of type II RIPs from ...
Indian Academy of Sciences (India)
Structural studies on a non-toxic homologue of type II RIPs from bitter gourd: Molecular basis of non-toxicity, conformational selection and glycan structure. MS accepted http://www.ias.ac.in/jbiosci. THYAGESHWAR CHANDRAN, ALOK SHARMA and M VIJAYAN. J. Biosci. 40(5), October 2015, 929–941, © Indian Academy of ...
The dyad palindromic glutathione transferase P enhancer binds multiple factors including AP1.
Diccianni, M B; Imagawa, M; Muramatsu, M
1992-10-11
Glutathione Transferase P (GST-P) gene expression is dominantly regulated by an upstream enhancer (GPEI) consisting of a dyad of palindromically oriented imperfect TPA (12-O-tetradecanoyl-phorbol-13-acetate)-responsive elements (TRE). GPEI is active in AP1-lacking F9 cells as well in AP1-containing HeLa cells. Despite GPEI's similarity to a TRE, c-jun co-transfection has only a minimal effect on transactivation. Antisense c-jun and c-fos co-transfection experiments further demonstrate the lack of a role for AP1 in GPEI mediated trans-activation in F9 cells, although endogenously present AP1 can influence GPEI in HeLa cells. Co-transfection of delta fosB with c-jun, which forms an inactive c-Jun/delta FosB heterodimer that binds TRE sequences, inhibits GPEI-mediated transcription in AP1-lacking F9 cells as well as AP1-containing HeLa cells. These data suggest novel factor(s) other than AP1 are influencing GPEI. Binding studies reveal multiple nucleoproteins bind to GPEI. These factors are likely responsible for the high level of GPEI-mediated transcription observed in the absence of AP1 and during hepatocarcinogenesis.
International Nuclear Information System (INIS)
Wu, Chen; Yao, Guangyin; Zou, Minji; Chen, Guangyu; Wang, Min; Liu, Jingqian; Wang, Jiaxi; Xu, Donggang
2007-01-01
Insulin-like growth factor binding protein-3 (IGFBP-3) is known to inhibit cell proliferation and induce apoptosis in IGF-dependent and IGF-independent manners, but the mechanism underlying IGF-independent effects is not yet clear. In a yeast two-hybrid assay, IGFBP-3 was used as the bait to screen a human fetal liver cDNA library for it interactors that may potentially mediate IGFBP-3-regulated functions. N-Acetylgalactosaminyltransferase 14 (GalNAc-T14), a member of the GalNAc-Tases family, was identified as a novel IGFBP-3 binding partner. This interaction involved the ricin-type beta-trefoil domain of GalNAc-T14. The interaction between IGFBP-3 and GalNAc-T14 was reconfirmed in vitro and in vivo, using GST pull-down, co-immunoprecipitation and mammalian two-hybrid assays. Our findings may provide new clues for further study on the mechanism behind the IGF-independent effects of IGFBP-3 promoting apoptosis. The role of GalNAc-T14 as an intracellular mediator of the effects of IGFBP-3 need to be verified in future studies
Regulation of FeLV-945 by c-Myb binding and CBP recruitment to the LTR
Directory of Open Access Journals (Sweden)
Finstad Samantha L
2004-09-01
Full Text Available Abstract Background Feline leukemia virus (FeLV induces degenerative, proliferative and malignant hematologic disorders in its natural host, the domestic cat. FeLV-945 is a viral variant identified as predominant in a cohort of naturally infected animals. FeLV-945 contains a unique sequence motif in the long terminal repeat (LTR comprised of a single copy of transcriptional enhancer followed by a 21-bp sequence triplicated in tandem. The LTR is precisely conserved among independent cases of multicentric lymphoma, myeloproliferative disease and anemia in animals from the cohort. The 21-bp triplication was previously shown to act as a transcriptional enhancer preferentially in hematopoietic cells and to confer a replicative advantage. The objective of the present study was to examine the molecular mechanism by which the 21-bp triplication exerts its influence and the selective advantage responsible for its precise conservation. Results Potential binding sites for the transcription factor, c-Myb, were identified across the repeat junctions of the 21-bp triplication. Such sites would not occur in the absence of the repeat; thus, a requirement for c-Myb binding to the repeat junctions of the triplication would exert a selective pressure to conserve its sequence precisely. Electrophoretic mobility shift assays demonstrated specific binding of c-Myb to the 21-bp triplication. Reporter gene assays showed that the triplication-containing LTR is responsive to c-Myb, and that responsiveness requires the presence of both c-Myb binding sites. Results further indicated that c-Myb in complex with the 21-bp triplication recruits the transcriptional co-activator, CBP, a regulator of normal hematopoiesis. FeLV-945 replication was shown to be positively regulated by CBP in a manner dependent on the presence of the 21-bp triplication. Conclusion Binding sites for c-Myb across the repeat junctions of the 21-bp triplication may account for its precise conservation in
Janik, Katrin; Mithöfer, Axel; Raffeiner, Margot; Stellmach, Hagen; Hause, Bettina; Schlink, Katja
2017-04-01
The plant pathogen Candidatus Phytoplasma mali (P. mali) is the causative agent of apple proliferation, a disease of increasing importance in apple-growing areas within Europe. Despite its economic importance, little is known about the molecular mechanisms of disease manifestation within apple trees. In this study, we identified two TCP (TEOSINTE BRANCHED/CYCLOIDEA/PROLIFERATING CELL FACTOR) transcription factors of Malus x domestica as binding partners of the P. mali SAP11-like effector ATP_00189. Phytohormone analyses revealed an effect of P. mali infection on jasmonates, salicylic acid and abscisic acid levels, showing that P. mali affects phytohormonal levels in apple trees, which is in line with the functions of the effector assumed from its binding to TCP transcription factors. To our knowledge, this is the first characterization of the molecular targets of a P. mali effector and thus provides the basis to better understand symptom development and disease progress during apple proliferation. As SAP11 homologues are found in several Phytoplasma species infecting a broad range of different plants, SAP11-like proteins seem to be key players in phytoplasmal infection. © 2016 BSPP AND JOHN WILEY & SONS LTD.
A proteomic study of TAR-RNA binding protein (TRBP-associated factors
Directory of Open Access Journals (Sweden)
Chi Ya-Hui
2011-02-01
Full Text Available Abstract Background The human TAR RNA-binding protein, TRBP, was first identified and cloned based on its high affinity binding to the small hairpin trans-activation responsive (TAR RNA of HIV-1. TRBP has more recently been found to be a constituent of the RNA-induced silencing complex (RISC serving as a Dicer co-factor in the processing of the ~70 nucleotide pre-microRNAs(miRNAs to 21-25 nucleotide mature miRNAs. Findings Using co-immunoprecipitation and protein-identification by mass spectrometry, we characterized intracellular proteins that complex with TRBP. These interacting proteins include those that have been described to act in protein synthesis, RNA modifications and processing, DNA transcription, and cell proliferation. Conclusions Our findings provide a proteome of factors that may cooperate with TRBP in activities such as miRNA processing and in RNA interference by the RISC complex.
Ranjha, Lepakshi; Anand, Roopesh; Cejka, Petr
2014-02-28
MutLγ, a heterodimer of the MutL homologues Mlh1 and Mlh3, plays a critical role during meiotic homologous recombination. The meiotic function of Mlh3 is fully dependent on the integrity of a putative nuclease motif DQHAX2EX4E, inferring that the anticipated nuclease activity of Mlh1-Mlh3 is involved in the processing of joint molecules to generate crossover recombination products. Although a vast body of genetic and cell biological data regarding Mlh1-Mlh3 is available, mechanistic insights into its function have been lacking due to the unavailability of the recombinant protein complex. Here we expressed the yeast Mlh1-Mlh3 heterodimer and purified it into near homogeneity. We show that recombinant MutLγ is a nuclease that nicks double-stranded DNA. We demonstrate that MutLγ binds DNA with a high affinity and shows a marked preference for Holliday junctions. We also expressed the human MLH1-MLH3 complex and show that preferential binding to Holliday junctions is a conserved capacity of eukaryotic MutLγ complexes. Specific DNA recognition has never been observed with any other eukaryotic MutL homologue. MutLγ thus represents a new paradigm for the function of the eukaryotic MutL protein family. We provide insights into the mode of Holliday junction recognition and show that Mlh1-Mlh3 prefers to bind the open unstacked Holliday junction form. This further supports the model where MutLγ is part of a complex acting on joint molecules to generate crossovers in meiosis.
Ranjha, Lepakshi; Anand, Roopesh; Cejka, Petr
2014-01-01
MutLγ, a heterodimer of the MutL homologues Mlh1 and Mlh3, plays a critical role during meiotic homologous recombination. The meiotic function of Mlh3 is fully dependent on the integrity of a putative nuclease motif DQHAX2EX4E, inferring that the anticipated nuclease activity of Mlh1-Mlh3 is involved in the processing of joint molecules to generate crossover recombination products. Although a vast body of genetic and cell biological data regarding Mlh1-Mlh3 is available, mechanistic insights into its function have been lacking due to the unavailability of the recombinant protein complex. Here we expressed the yeast Mlh1-Mlh3 heterodimer and purified it into near homogeneity. We show that recombinant MutLγ is a nuclease that nicks double-stranded DNA. We demonstrate that MutLγ binds DNA with a high affinity and shows a marked preference for Holliday junctions. We also expressed the human MLH1-MLH3 complex and show that preferential binding to Holliday junctions is a conserved capacity of eukaryotic MutLγ complexes. Specific DNA recognition has never been observed with any other eukaryotic MutL homologue. MutLγ thus represents a new paradigm for the function of the eukaryotic MutL protein family. We provide insights into the mode of Holliday junction recognition and show that Mlh1-Mlh3 prefers to bind the open unstacked Holliday junction form. This further supports the model where MutLγ is part of a complex acting on joint molecules to generate crossovers in meiosis. PMID:24443562
DEFF Research Database (Denmark)
Lanke, E.; Kristoffersson, A.C.; Isaksson, C.
2008-01-01
, moderately decreased plasma factor VIII (FVIII) and VWF levels, and disproportionately low-plasma VWF:RCo levels. The patients were found to be heterozygous for the novel N1421K mutation, caused by a 4263C > G transversion in exon 28 of the VWF gene coding for the A1 domain. Botrocetin- and ristocetin-mediated...... binding of plasma VWF to GPIb were reduced in the patients. In vitro mutagenesis and expression in COS-7 cells confirmed the impairment of the mutant in botrocetin- and ristocetin-mediated VWF binding to GPIb. VWF collagen binding capacity was unaffected in plasma from the heterozygous individuals as well...
pH Modulates the Binding of EGR1 Transcription Factor to DNA
Mikles, David C.; Bhat, Vikas; Schuchardt, Brett J.; Deegan, Brian J.; Seldeen, Kenneth L.; McDonald, Caleb B.; Farooq, Amjad
2013-01-01
EGR1 transcription factor orchestrates a plethora of signaling cascades involved in cellular homeostasis and its down-regulation has been implicated in the development of prostate cancer. Herein, using a battery of biophysical tools, we show that the binding of EGR1 to DNA is tightly regulated by solution pH. Importantly, the binding affinity undergoes an enhancement of more than an order of magnitude with increasing pH from 5 to 8, implying that the deprotonation of an ionizable residue accounts for such behavior. This ionizable residue is identified as H382 by virtue of the fact that its substitution to non-ionizable residues abolishes pH-dependence of the binding of EGR1 to DNA. Notably, H382 inserts into the major groove of DNA and stabilizes the EGR1-DNA interaction via both hydrogen bonding and van der Waals contacts. Remarkably, H382 is predominantly conserved across other members of EGR1 family, implying that histidine protonation-deprotonation may serve as a molecular switch for modulating protein-DNA interactions central to this family of transcription factors. Collectively, our findings uncover an unexpected but a key step in the molecular recognition of EGR1 family of transcription factors and suggest that they may act as sensors of pH within the intracellular environment. PMID:23718776
Opgenorth, A; Nation, N; Graham, K; McFadden, G
1993-02-01
The epidermal growth factor (EGF) homologues encoded by vaccinia virus, myxoma virus, and malignant rabbit fibroma virus have been shown to contribute to the pathogenicity of virus infection upon inoculation of susceptible hosts. However, since the primary structures of these growth factors and the disease profiles induced by different poxvirus genera vary substantially, the degree to which the various EGF homologues perform similar roles in viral pathogenesis remains unclear. In order to determine whether different EGF-like growth factors can perform qualitatively similar functions in the induction of myxomatosis in rabbits, we created recombinant myxoma virus variants in which the native growth factor, myxoma growth factor (MGF), was disrupted and replaced with either vaccinia virus growth factor, Shope fibroma growth factor, or rat transforming growth factor alpha. Unlike the control virus containing an inactivated MGF gene, which caused marked attenuation of the disease syndrome and substantially less proliferation of the epithelial cell layers in the conjunctiva and respiratory tract, the recombinant myxoma virus strains expressing heterologous growth factors produced infections which were both clinically and histopathologically indistinguishable from wild-type myxomatosis. We conclude that these poxviral and cellular EGF-like growth factors, which are diverse with respect to primary structure and origin, have similar biological functions in the context of myxoma virus pathogenesis and are mitogenic for the same target cells.
The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK
Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A
2014-01-01
A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930
Kotani, Eiji; Muto, Sayaka; Ijiri, Hiroshi; Mori, Hajime
2015-07-01
Previous reports have indicated that the Bombyx mori nucleopolyhedrovirus (BmNPV) nucleic acid binding proteins BRO-B and BRO-E are expressed during the early stage of infection and that the BRO family likely supports the regulation of mRNA; however, no study has directly examined the function of BRO family proteins in virus-permissive cells. Here, we show that BRO-B and BRO-E associate with cellular T-cell intracellular antigen 1 homologue (BmTRN-1), a translational regulator, and other cellular translation-related proteins in silkworm cells during viral infection. We created BM-N cells that expressed BRO-B/E to study molecular interactions between BmTRN-1 and BRO-B/E and how they influenced protein synthesis. Fluorescent microscopy revealed that BmTRN-1 was localized in cytoplasmic foci during BmNPV infection. Immunofluorescence studies confirmed that BmTRN-1 and BRO-B/E were colocalized in the amorphous conspicuous cytoplasmic foci. Reporter gene studies revealed that co-expression of BRO-B/E synergistically led to a significant decrease in protein synthesis from a designed transcript carrying the 5'untranslated region of a cellular mRNA with no significant change of transcript abundance. Additionally, RNA interference-mediated knockdown of BmTRN-1 resulted in a marked inhibition of the ability of BRO-B/E to regulate the transcript. These results suggested that the association of BmTRN-1 with BRO-B/E is responsible for the inhibitory regulation of certain mRNAs at the post-transcriptional level and add an additional mechanism for how baculoviruses control protein synthesis during infection.
Conversion of MyoD to a Neurogenic Factor: Binding Site Specificity Determines Lineage
Directory of Open Access Journals (Sweden)
Abraham P. Fong
2015-03-01
Full Text Available MyoD and NeuroD2, master regulators of myogenesis and neurogenesis, bind to a “shared” E-box sequence (CAGCTG and a “private” sequence (CAGGTG or CAGATG, respectively. To determine whether private-site recognition is sufficient to confer lineage specification, we generated a MyoD mutant with the DNA-binding specificity of NeuroD2. This chimeric mutant gained binding to NeuroD2 private sites but maintained binding to a subset of MyoD-specific sites, activating part of both the muscle and neuronal programs. Sequence analysis revealed an enrichment for PBX/MEIS motifs at the subset of MyoD-specific sites bound by the chimera, and point mutations that prevent MyoD interaction with PBX/MEIS converted the chimera to a pure neurogenic factor. Therefore, redirecting MyoD binding from MyoD private sites to NeuroD2 private sites, despite preserved binding to the MyoD/NeuroD2 shared sites, is sufficient to change MyoD from a master regulator of myogenesis to a master regulator of neurogenesis.
Keilwagen, Jens; Grau, Jan; Paponov, Ivan A; Posch, Stefan; Strickert, Marc; Grosse, Ivo
2011-02-10
Transcription factors are a main component of gene regulation as they activate or repress gene expression by binding to specific binding sites in promoters. The de-novo discovery of transcription factor binding sites in target regions obtained by wet-lab experiments is a challenging problem in computational biology, which has not been fully solved yet. Here, we present a de-novo motif discovery tool called Dispom for finding differentially abundant transcription factor binding sites that models existing positional preferences of binding sites and adjusts the length of the motif in the learning process. Evaluating Dispom, we find that its prediction performance is superior to existing tools for de-novo motif discovery for 18 benchmark data sets with planted binding sites, and for a metazoan compendium based on experimental data from micro-array, ChIP-chip, ChIP-DSL, and DamID as well as Gene Ontology data. Finally, we apply Dispom to find binding sites differentially abundant in promoters of auxin-responsive genes extracted from Arabidopsis thaliana microarray data, and we find a motif that can be interpreted as a refined auxin responsive element predominately positioned in the 250-bp region upstream of the transcription start site. Using an independent data set of auxin-responsive genes, we find in genome-wide predictions that the refined motif is more specific for auxin-responsive genes than the canonical auxin-responsive element. In general, Dispom can be used to find differentially abundant motifs in sequences of any origin. However, the positional distribution learned by Dispom is especially beneficial if all sequences are aligned to some anchor point like the transcription start site in case of promoter sequences. We demonstrate that the combination of searching for differentially abundant motifs and inferring a position distribution from the data is beneficial for de-novo motif discovery. Hence, we make the tool freely available as a component of the open
International Nuclear Information System (INIS)
Anizan, N; Wahl, R L; Frey, E C; Wang, H; Zhou, X C
2015-01-01
Several applications in nuclear medicine require absolute activity quantification of single photon emission computed tomography images. Obtaining a repeatable calibration factor that converts voxel values to activity units is essential for these applications. Because source preparation and measurement of the source activity using a radionuclide activity meter are potential sources of variability, this work investigated instrumentation and acquisition factors affecting repeatability using planar acquisition of sealed sources. The calibration factor was calculated for different acquisition and geometry conditions to evaluate the effect of the source size, lateral position of the source in the camera field-of-view (FOV), source-to-camera distance (SCD), and variability over time using sealed Ba-133 sources. A small region of interest (ROI) based on the source dimensions and collimator resolution was investigated to decrease the background effect. A statistical analysis with a mixed-effects model was used to evaluate quantitatively the effect of each variable on the global calibration factor variability. A variation of 1 cm in the measurement of the SCD from the assumed distance of 17 cm led to a variation of 1–2% in the calibration factor measurement using a small disc source (0.4 cm diameter) and less than 1% with a larger rod source (2.9 cm diameter). The lateral position of the source in the FOV and the variability over time had small impacts on calibration factor variability. The residual error component was well estimated by Poisson noise. Repeatability of better than 1% in a calibration factor measurement using a planar acquisition of a sealed source can be reasonably achieved. The best reproducibility was obtained with the largest source with a count rate much higher than the average background in the ROI, and when the SCD was positioned within 5 mm of the desired position. In this case, calibration source variability was limited by the quantum
Ueshima, Shuhei; Nagata, Kyosuke; Okuwaki, Mitsuru
2017-11-15
Upstream binding factor (UBF) is a member of the high-mobility group (HMG) box protein family, characterized by multiple HMG boxes and a C-terminal acidic region (AR). UBF is an essential transcription factor for rRNA genes and mediates the formation of transcriptionally active chromatin in the nucleolus. However, it remains unknown how UBF is specifically localized to the nucleolus. Here, we examined the molecular mechanisms that localize UBF to the nucleolus. We found that the first HMG box (HMG box 1), the linker region (LR), and the AR cooperatively regulate the nucleolar localization of UBF1. We demonstrated that the AR intramolecularly associates with and attenuates the DNA binding activity of HMG boxes and confers the structured DNA preference to HMG box 1. In contrast, the LR was found to serve as a nuclear localization signal and compete with HMG boxes to bind the AR, permitting nucleolar localization of UBF1. The LR sequence binds DNA and assists the stable chromatin binding of UBF. We also showed that the phosphorylation status of the AR does not clearly affect the localization of UBF1. Our results strongly suggest that associations of the AR with HMG boxes and the LR regulate UBF nucleolar localization. Copyright © 2017 American Society for Microbiology.
Broad anti-HIV activity of the Oscillatoria agardhii agglutinin homologue lectin family.
Férir, Geoffrey; Huskens, Dana; Noppen, Sam; Koharudin, Leonardus M I; Gronenborn, Angela M; Schols, Dominique
2014-10-01
Oscillatoria agardhii agglutinin homologue (OAAH) proteins belong to a recently discovered lectin family. The founding member OAA and a designed hybrid OAAH (OPA) recognize similar but unique carbohydrate structures of Man-9, compared with other antiviral carbohydrate-binding agents (CBAs). These two newly described CBAs were evaluated for their inactivating properties on HIV replication and transmission and for their potential as microbicides. Various cellular assays were used to determine antiviral activity against wild-type and certain CBA-resistant HIV-1 strains: (i) free HIV virion infection in human T lymphoma cell lines and PBMCs; (ii) syncytium formation assay using persistently HIV-infected T cells and non-infected CD4+ T cells; (iii) DC-SIGN-mediated viral capture; and (iv) transmission to uninfected CD4+ T cells. OAA and OPA were also evaluated for their mitogenic properties and potential synergistic effects using other CBAs. OAA and OPA inhibit HIV replication, syncytium formation between HIV-1-infected and uninfected T cells, DC-SIGN-mediated HIV-1 capture and transmission to CD4+ target T cells, thereby rendering a variety of HIV-1 and HIV-2 clinical isolates non-infectious, independent of their coreceptor use. Both CBAs competitively inhibit the binding of the Manα(1-2)Man-specific 2G12 monoclonal antibody (mAb) as shown by flow cytometry and surface plasmon resonance analysis. The HIV-1 NL4.3(2G12res), NL4.3(MVNres) and IIIB(GRFTres) strains were equally inhibited as the wild-type HIV-1 strains by these CBAs. Combination studies indicate that OAA and OPA act synergistically with Hippeastrum hybrid agglutinin, 2G12 mAb and griffithsin (GRFT), with the exception of OPA/GRFT. OAA and OPA are unique CBAs with broad-spectrum anti-HIV activity; however, further optimization will be necessary for microbicidal application. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights
van der Plas, R. M.; Gomes, L.; Marquart, J. A.; Vink, T.; Meijers, J. C.; de Groot, P. G.; Sixma, J. J.; Huizinga, E. G.
2000-01-01
Binding of von Willebrand Factor (vWF) to sites of vascular injury is the first step of hemostasis. Collagen types I and III are important binding sites for vWF. We have previously determined the three-dimensional structure of the collagen binding A3 domain of vWF (Huizinga et al., Structure 1997;
Liu, Yu; Duan, Xiaoyan; Liu, Xiaolin; Guo, Jiazhong; Wang, Hongliang; Li, Zhixiong; Yang, Jing
2014-05-01
The insulin-like growth factor binding protein acid labile subunit (IGFALS) gene encodes a serum protein that binds to IGFs and regulates growth, development, and other physiological processes. We have found that sequencing of the IGFALS gene in Chinese Qinchuan beef cattle (n=300) revealed four SNP loci in exon two of the gene (g1219: T>C, g1893: T>C, g2612: G>A, and g2696: A>G). The SNP g2696: A>G resulted in a change from asparagine to aspartic acid (p. N574D) in the leucine-rich repeat region in the carboxyl-terminal domain of IGFALS. Four SNPs were in low linkage disequilibrium, and 12 different haplotypes were identified in the population. Association analysis suggested that SNP g1219: T>C had a significant association with hip width (PG displayed a significant association with stature (Pgrowth traits of bovine, and may serve as a genetic marker for selection of beef cattle for growth traits, including stature. Copyright © 2014 Elsevier B.V. All rights reserved.
FoxA1 binding to the MMTV LTR modulates chromatin structure and transcription
International Nuclear Information System (INIS)
Holmqvist, Per-Henrik; Belikov, Sergey; Zaret, Kenneth S.; Wrange, Oerjan
2005-01-01
Novel binding sites for the forkhead transcription factor family member Forkhead box A (FoxA), previously referred to as Hepatocyte Nuclear Factor 3 (HNF3), were found within the mouse mammary tumor virus long terminal repeat (MMTV LTR). The effect of FoxA1 on MMTV LTR chromatin structure, and expression was evaluated in Xenopus laevis oocytes. Mutagenesis of either of the two main FoxA binding sites showed that the distal site, -232/-221, conferred FoxA1-dependent partial inhibition of glucocorticoid receptor (GR) driven MMTV transcription. The proximal FoxA binding segment consisted of two individual FoxA sites at -57/-46 and -45/-34, respectively, that mediated an increased basal MMTV transcription. FoxA1 binding altered the chromatin structure of both the inactive- and the hormone-activated MMTV LTR. Hydroxyl radical foot printing revealed FoxA1-mediated changes in the nucleosome arrangement. Micrococcal nuclease digestion showed the hormone-dependent sub-nucleosome complex, containing ∼120 bp of DNA, to be expanded by FoxA1 binding to the proximal segment into a larger complex containing ∼200 bp. The potential function of the FoxA1-mediated expression of the MMTV provirus for maintenance of expression in different tissues is discussed
Crystal structures of the human G3BP1 NTF2-like domain visualize FxFG Nup Repeat Specificity
DEFF Research Database (Denmark)
Vognsen, Tina Reinholdt; Möller, Ingvar Rúnar; Kristensen, Ole
2013-01-01
Ras GTPase Activating Protein SH3 Domain Binding Protein (G3BP) is a potential anti-cancer drug target implicated in several cellular functions. We have used protein crystallography to solve crystal structures of the human G3BP1 NTF2-like domain both alone and in complex with an FxFG Nup repeat...... peptide. Despite high structural similarity, the FxFG binding site is located between two alpha helices in the G3BP1 NTF2-like domain and not at the dimer interface as observed for nuclear transport factor 2. ITC studies showed specificity towards the FxFG motif but not FG and GLFG motifs. The unliganded...
Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.
1994-01-01
The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...
Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine
2010-06-18
Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.
Feature binding in visual short term memory: A General Recognition Theory analysis.
Fitousi, Daniel
2017-05-23
Creating and maintaining accurate bindings of elementary features (e.g., color and shape) in visual short-term memory (VSTM) is fundamental for veridical perception. How are low-level features bound in memory? The present work harnessed a multivariate model of perception - the General Recognition Theory (GRT) - to unravel the internal representations underlying feature binding in VSTM. On each trial, preview and target colored shapes were presented in succession, appearing in either repeated or altered spatial locations. Participants gave two same/different responses: one with respect to color and one with respect to shape. Converging GRT analyses on the accuracy confusion matrices provided substantial evidence for binding in the form of violations of perceptual independence at the level of the individual stimulus, such that positive correlations were obtained when both features repeated or alternated together, while negative correlations were obtained when one feature repeated and the other alternated. This "cloverleaf" GRT pattern of binding was similar whether the spatial location of the preview and target repeated or altered. The current results are consistent with: (a) the discrete memory "slots" model of VSTM, and (b) the notion that spatial location is not necessary for the formation of "object files." The GRT approach presented here offers a viable quantitative model for testing various questions regarding feature binding in VSTM.
Occupancy classification of position weight matrix-inferred transcription factor binding sites.
Directory of Open Access Journals (Sweden)
Hollis Wright
Full Text Available BACKGROUND: Computational prediction of Transcription Factor Binding Sites (TFBS from sequence data alone is difficult and error-prone. Machine learning techniques utilizing additional environmental information about a predicted binding site (such as distances from the site to particular chromatin features to determine its occupancy/functionality class show promise as methods to achieve more accurate prediction of true TFBS in silico. We evaluate the Bayesian Network (BN and Support Vector Machine (SVM machine learning techniques on four distinct TFBS data sets and analyze their performance. We describe the features that are most useful for classification and contrast and compare these feature sets between the factors. RESULTS: Our results demonstrate good performance of classifiers both on TFBS for transcription factors used for initial training and for TFBS for other factors in cross-classification experiments. We find that distances to chromatin modifications (specifically, histone modification islands as well as distances between such modifications to be effective predictors of TFBS occupancy, though the impact of individual predictors is largely TF specific. In our experiments, Bayesian network classifiers outperform SVM classifiers. CONCLUSIONS: Our results demonstrate good performance of machine learning techniques on the problem of occupancy classification, and demonstrate that effective classification can be achieved using distances to chromatin features. We additionally demonstrate that cross-classification of TFBS is possible, suggesting the possibility of constructing a generalizable occupancy classifier capable of handling TFBS for many different transcription factors.
International Nuclear Information System (INIS)
Wang Liu; Zheng Aihua; Yi Ling; Xu Chongren; Ding Mingxiao; Deng Hongkui
2004-01-01
Nuclear reprogramming is critical for animal cloning and stem cell creation through nuclear transfer, which requires extensive remodeling of chromosomal architecture involving dramatic changes in chromatin-binding proteins. To understand the mechanism of nuclear reprogramming, it is critical to identify chromatin-binding factors specify the reprogramming process. In this report, we have developed a high-throughput selection method, based on T7 phage display and chromatin immunoprecipitation, to isolate chromatin-binding factors expressed in mouse embryonic stem cells using primary mouse embryonic fibroblast chromatin. Seven chromatin-binding proteins have been isolated by this method. We have also isolated several chromatin-binding proteins involved in hepatocyte differentiation. Our method provides a powerful tool to rapidly and selectively identify chromatin-binding proteins. The method can be used to study epigenetic modification of chromatin during nuclear reprogramming, cell differentiation, and transdifferentiation
CONREAL web server: identification and visualization of conserved transcription factor binding sites
Berezikov, E.; Guryev, V.; Cuppen, E.
2005-01-01
The use of orthologous sequences and phylogenetic footprinting approaches have become popular for the recognition of conserved and potentially functional sequences. Several algorithms have been developed for the identification of conserved transcription factor binding sites (TFBSs), which are
DEFF Research Database (Denmark)
Ó Proinsias, Keith; Ociepa, Michał; Pluta, Katarzyna
2016-01-01
The binding of vitamin B12 derivatives to human B12 transporter proteins is strongly influenced by the type and site of modification of the cobalamin original structure. We have prepared the first cobalamin derivative modified at the phosphate moiety. The reaction conditions were fully optimized...... and its limitations examined. The resulting derivatives, particularly those bearing terminal alkyne and azide groups, were isolated and used in copper-catalyzed alkyne-azide cycloaddition reactions (CuAAC). Their sensitivity towards light revealed their potential as photocleavable molecules. The binding...... abilities of selected derivatives were examined and compared with cyanocobalamin. The interaction of the alkylated derivatives with haptocorrin was less affected than the interaction with intrinsic factor. Furthermore, the configuration of the phosphate moiety was irrelevant to the binding process....
Structure of HLA-A*1101 in complex with a hepatitis B peptide homologue
DEFF Research Database (Denmark)
Blicher, Thomas; Kastrup, Jette Sandholm; Pedersen, Lars Østergaard
2006-01-01
A high-resolution structure of the human MHC-I molecule HLA-A*1101 is presented in which it forms a complex with a sequence homologue of a peptide that occurs naturally in hepatitis B virus DNA polymerase. The sequence of the bound peptide is AIMPARFYPK, while that of the corresponding natural...
Directory of Open Access Journals (Sweden)
Maartje van den Biggelaar
Full Text Available BACKGROUND: Point mutations resulting in reduced factor VIII (FVIII binding to von Willebrand factor (VWF are an important cause of mild/moderate hemophilia A. Treatment includes desmopressin infusion, which concomitantly increases VWF and FVIII plasma levels, apparently from storage pools containing both proteins. The source of these VWF/FVIII co-storage pools and the mechanism of granule biogenesis are not fully understood. METHODOLOGY/PRINCIPAL FINDINGS: We studied intracellular trafficking of FVIII variants implicated in mild/moderate hemophilia A together with VWF in HEK293 cells and primary endothelial cells. The role of VWF binding was addressed using FVIII variants displaying reduced VWF interaction. Binding studies using purified FVIII proteins revealed moderate (Arg2150His, Del2201, Pro2300Ser to severe (Tyr1680Phe, Ser2119Tyr VWF binding defects. Expression studies in HEK293 cells and primary endothelial cells revealed that all FVIII variants were present within VWF-containing organelles. Quantitative studies showed that the relative amount of FVIII storage was independent of various mutations. Substantial amounts of FVIII variants are co-stored in VWF-containing storage organelles, presumably by virtue of their ability to interact with VWF at low pH. CONCLUSIONS: Our data suggest that the potential of FVIII co-storage with VWF is not affected in mild/moderate hemophilia A caused by reduced FVIII/VWF interaction in the circulation. These data support the hypothesis that Weibel-Palade bodies comprise the desmopressin-releasable FVIII storage pool in vivo.
Directory of Open Access Journals (Sweden)
Gowda Veerabasappa T
2007-12-01
Full Text Available Abstract Background The snake venom group IIA secreted phospholipases A2 (SVPLA2, present in the Viperidae snake family exhibit a wide range of toxic and pharmacological effects. They exert their different functions by catalyzing the hydrolysis of phospholipids (PL at the membrane/water interface and by highly specific direct binding to: (i presynaptic membrane-bound or intracellular receptors; (ii natural PLA2-inhibitors from snake serum; and (iii coagulation factors present in human blood. Results Using surface plasmon resonance (SPR protein-protein interaction measurements and an in vitro biological test of inhibition of prothrombinase activity, we identify a number of Viperidae venom SVPLA2s that inhibit blood coagulation through direct binding to human blood coagulation factor Xa (FXa via a non-catalytic, PL-independent mechanism. We classify the SVPLA2s in four groups, depending on the strength of their binding. Molecular electrostatic potentials calculated at the surface of 3D homology-modeling models show a correlation with inhibition of prothrombinase activity. In addition, molecular docking simulations between SVPLA2 and FXa guided by the experimental data identify the potential FXa binding site on the SVPLA2s. This site is composed of the following regions: helices A and B, the Ca2+ loop, the helix C-β-wing loop, and the C-terminal fragment. Some of the SVPLA2 binding site residues belong also to the interfacial binding site (IBS. The interface in FXa involves both, the light and heavy chains. Conclusion We have experimentally identified several strong FXa-binding SVPLA2s that disrupt the function of the coagulation cascade by interacting with FXa by the non-catalytic PL-independent mechanism. By theoretical methods we mapped the interaction sites on both, the SVPLA2s and FXa. Our findings may lead to the design of novel, non-competitive FXa inhibitors.
Directory of Open Access Journals (Sweden)
Tiago Antonio de Souza
Full Text Available Plant pathogenic bacteria utilize an array of effector proteins to cause disease. Among them, transcriptional activator-like (TAL effectors are unusual in the sense that they modulate transcription in the host. Although target genes and DNA specificity of TAL effectors have been elucidated, how TAL proteins control host transcription is poorly understood. Previously, we showed that the Xanthomonas citri TAL effectors, PthAs 2 and 3, preferentially targeted a citrus protein complex associated with transcription control and DNA repair. To extend our knowledge on the mode of action of PthAs, we have identified new protein targets of the PthA4 variant, required to elicit canker on citrus. Here we show that all the PthA4-interacting proteins are DNA and/or RNA-binding factors implicated in chromatin remodeling and repair, gene regulation and mRNA stabilization/modification. The majority of these proteins, including a structural maintenance of chromosomes protein (CsSMC, a translin-associated factor X (CsTRAX, a VirE2-interacting protein (CsVIP2, a high mobility group (CsHMG and two poly(A-binding proteins (CsPABP1 and 2, interacted with each other, suggesting that they assemble into a multiprotein complex. CsHMG was shown to bind DNA and to interact with the invariable leucine-rich repeat region of PthAs. Surprisingly, both CsHMG and PthA4 interacted with PABP1 and 2 and showed selective binding to poly(U RNA, a property that is novel among HMGs and TAL effectors. Given that homologs of CsHMG, CsPABP1, CsPABP2, CsSMC and CsTRAX in other organisms assemble into protein complexes to regulate mRNA stability and translation, we suggest a novel role of TAL effectors in mRNA processing and translational control.
Directory of Open Access Journals (Sweden)
Janet L Smith
2015-05-01
Full Text Available DnaA, the replication initiation protein in bacteria, is an AAA+ ATPase that binds and hydrolyzes ATP and exists in a heterogeneous population of ATP-DnaA and ADP-DnaA. DnaA binds cooperatively to the origin of replication and several other chromosomal regions, and functions as a transcription factor at some of these regions. We determined the binding properties of Bacillus subtilis DnaA to genomic DNA in vitro at single nucleotide resolution using in vitro DNA affinity purification and deep sequencing (IDAP-Seq. We used these data to identify 269 binding regions, refine the consensus sequence of the DnaA binding site, and compare the relative affinity of binding regions for ATP-DnaA and ADP-DnaA. Most sites had a slightly higher affinity for ATP-DnaA than ADP-DnaA, but a few had a strong preference for binding ATP-DnaA. Of the 269 sites, only the eight strongest binding ones have been observed to bind DnaA in vivo, suggesting that other cellular factors or the amount of available DnaA in vivo restricts DnaA binding to these additional sites. Conversely, we found several chromosomal regions that were bound by DnaA in vivo but not in vitro, and that the nucleoid-associated protein Rok was required for binding in vivo. Our in vitro characterization of the inherent ability of DnaA to bind the genome at single nucleotide resolution provides a backdrop for interpreting data on in vivo binding and regulation of DnaA, and is an approach that should be adaptable to many other DNA binding proteins.
Directory of Open Access Journals (Sweden)
Andreas eWachter
2012-05-01
Full Text Available Alternative precursor mRNA splicing is a widespread phenomenon in multicellular eukaryotes and represents a major means for functional expansion of the transcriptome. While several recent studies have revealed an important link between splicing regulation and fundamental biological processes in plants, many important aspects, such as the underlying splicing regulatory mechanisms, are so far not well understood. Splicing decisions are in general based on a splicing code that is determined by the dynamic interplay of splicing-controlling factors and cis-regulatory elements. Several members of the group of heterogeneous nuclear ribonucleoprotein (hnRNP proteins are well-known regulators of splicing in animals and the comparatively few reports on some of their plant homologues revealed similar functions. This also applies to polypyrimidine tract-binding proteins (PTBs, a thoroughly investigated class of hnRNP proteins with splicing regulatory functions in both animals and plants. Further examples from plants are auto- and cross-regulatory splicing circuits of glycine-rich RNA-binding proteins (GRPs and splicing enhancement by oligouridylatebinding proteins. Besides their role in defining splice site choice, hnRNP proteins are also involved in multiple other steps of nucleic acid metabolism, highlighting the functional versatility of this group of proteins in higher eukaryotes.
DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding.
Ma, Wenxiu; Yang, Lin; Rohs, Remo; Noble, William Stafford
2017-10-01
Transcription factors (TFs) bind to specific DNA sequence motifs. Several lines of evidence suggest that TF-DNA binding is mediated in part by properties of the local DNA shape: the width of the minor groove, the relative orientations of adjacent base pairs, etc. Several methods have been developed to jointly account for DNA sequence and shape properties in predicting TF binding affinity. However, a limitation of these methods is that they typically require a training set of aligned TF binding sites. We describe a sequence + shape kernel that leverages DNA sequence and shape information to better understand protein-DNA binding preference and affinity. This kernel extends an existing class of k-mer based sequence kernels, based on the recently described di-mismatch kernel. Using three in vitro benchmark datasets, derived from universal protein binding microarrays (uPBMs), genomic context PBMs (gcPBMs) and SELEX-seq data, we demonstrate that incorporating DNA shape information improves our ability to predict protein-DNA binding affinity. In particular, we observe that (i) the k-spectrum + shape model performs better than the classical k-spectrum kernel, particularly for small k values; (ii) the di-mismatch kernel performs better than the k-mer kernel, for larger k; and (iii) the di-mismatch + shape kernel performs better than the di-mismatch kernel for intermediate k values. The software is available at https://bitbucket.org/wenxiu/sequence-shape.git. rohs@usc.edu or william-noble@uw.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Mitsuzawa, Hiroshi; Ishihama, Akira
2002-01-01
The general transcription factor TFIID consists of the TATA-binding protein (TBP) and multiple TBP-associated factors (TAFs). We previously identified two distinct WD repeat-containing TAFs, spTAF72 and spTAF73, in the fission yeast Schizosaccharomyces pombe. Here we report the identification of another S.pombe TAF, spTAF50, which is the S.pombe homolog of histone H4-like TAFs such as human TAF80, Drosophila TAF60 and Saccharomyces cerevisiae TAF60. spTAF50 was identified in a two-hybrid scre...
Mathelier, Anthony; Fornes, Oriol; Arenillas, David J; Chen, Chih-Yu; Denay, Grégoire; Lee, Jessica; Shi, Wenqiang; Shyr, Casper; Tan, Ge; Worsley-Hunt, Rebecca; Zhang, Allen W; Parcy, François; Lenhard, Boris; Sandelin, Albin; Wasserman, Wyeth W
2016-01-04
JASPAR (http://jaspar.genereg.net) is an open-access database storing curated, non-redundant transcription factor (TF) binding profiles representing transcription factor binding preferences as position frequency matrices for multiple species in six taxonomic groups. For this 2016 release, we expanded the JASPAR CORE collection with 494 new TF binding profiles (315 in vertebrates, 11 in nematodes, 3 in insects, 1 in fungi and 164 in plants) and updated 59 profiles (58 in vertebrates and 1 in fungi). The introduced profiles represent an 83% expansion and 10% update when compared to the previous release. We updated the structural annotation of the TF DNA binding domains (DBDs) following a published hierarchical structural classification. In addition, we introduced 130 transcription factor flexible models trained on ChIP-seq data for vertebrates, which capture dinucleotide dependencies within TF binding sites. This new JASPAR release is accompanied by a new web tool to infer JASPAR TF binding profiles recognized by a given TF protein sequence. Moreover, we provide the users with a Ruby module complementing the JASPAR API to ease programmatic access and use of the JASPAR collection of profiles. Finally, we provide the JASPAR2016 R/Bioconductor data package with the data of this release. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Crystal structure of a bacterial homologue of glucose transporters GLUT1-4.
Sun, Linfeng; Zeng, Xin; Yan, Chuangye; Sun, Xiuyun; Gong, Xinqi; Rao, Yu; Yan, Nieng
2012-10-18
Glucose transporters are essential for metabolism of glucose in cells of diverse organisms from microbes to humans, exemplified by the disease-related human proteins GLUT1, 2, 3 and 4. Despite rigorous efforts, the structural information for GLUT1-4 or their homologues remains largely unknown. Here we report three related crystal structures of XylE, an Escherichia coli homologue of GLUT1-4, in complex with d-xylose, d-glucose and 6-bromo-6-deoxy-D-glucose, at resolutions of 2.8, 2.9 and 2.6 Å, respectively. The structure consists of a typical major facilitator superfamily fold of 12 transmembrane segments and a unique intracellular four-helix domain. XylE was captured in an outward-facing, partly occluded conformation. Most of the important amino acids responsible for recognition of D-xylose or d-glucose are invariant in GLUT1-4, suggesting functional and mechanistic conservations. Structure-based modelling of GLUT1-4 allows mapping and interpretation of disease-related mutations. The structural and biochemical information reported here constitutes an important framework for mechanistic understanding of glucose transporters and sugar porters in general.
Dai, Qi; Ren, Aiming; Westholm, Jakub O; Duan, Hong; Patel, Dinshaw J; Lai, Eric C
2015-01-01
Recently, the BEN (BANP, E5R, and NAC1) domain was recognized as a new class of conserved DNA-binding domain. The fly genome encodes three proteins that bear only a single BEN domain ("BEN-solo" factors); namely, Insensitive (Insv), Bsg25A (Elba1), and CG9883 (Elba2). Insv homodimers preferentially bind CCAATTGG palindromes throughout the genome to mediate transcriptional repression, whereas Bsg25A and Elba2 heterotrimerize with their obligate adaptor, Elba3 (i.e., the ELBA complex), to recognize a CCAATAAG motif in the Fab-7 insulator. While these data suggest distinct DNA-binding properties of BEN-solo proteins, we performed reporter assays that indicate that both Bsg25A and Elba2 can individually recognize Insv consensus sites efficiently. We confirmed this by solving the structure of Bsg25A complexed to the Insv site, which showed that key aspects of the BEN:DNA recognition strategy are similar between these proteins. We next show that both Insv and ELBA proteins are competent to mediate transcriptional repression via Insv consensus sequences but that the ELBA complex appears to be selective for the ELBA site. Reciprocally, genome-wide analysis reveals that Insv exhibits significant cobinding to class I insulator elements, indicating that it may also contribute to insulator function. Indeed, we observed abundant Insv binding within the Hox complexes with substantial overlaps with class I insulators, many of which bear Insv consensus sites. Moreover, Insv coimmunoprecipitates with the class I insulator factor CP190. Finally, we observed that Insv harbors exclusive activity among fly BEN-solo factors with respect to regulation of Notch-mediated cell fate choices in the peripheral nervous system. This in vivo activity is recapitulated by BEND6, a mammalian BEN-solo factor that conserves the Notch corepressor function of Insv but not its capacity to bind Insv consensus sites. Altogether, our data define an array of common and distinct biochemical and functional
Cytosine methylation does not affect binding of transcription factor Sp1
International Nuclear Information System (INIS)
Harrington, M.A.; Jones, P.A.; Imagawa, M.; Karin, M.
1988-01-01
DNA methylation may be a component of a multilevel control mechanism that regulates eukaryotic gene expression. The authors used synthetic oligonucleotides to investigate the effect of cytosine methylation on the binding of the transcription factor Sp1 to its target sequence (a G+C-rich sequence known as a GC box). Concatemers of double-stranded 14-mers containing a GC box successfully competed with the human metallothionein IIA promoter for binding to Sp1 in DNase I protection experiments. The presence of 5-methylcytosine in the CpG sequence of the GC box did not influence Sp1 binding. The result was confirmed using double-stranded 20-mers containing 16 base pairs of complementary sequence. Electrophoretic gel retardation analysis of annealed 28-mers containing a GC box incubated with an Sp1-containing HeLa cell nuclear extract demonstrated the formation of DNA-protein complexes; formation of these complexes was not inhibited when an oligomer without a GC box was used as a competitor. Once again, the presence of a 5-methylcytosine residue in the GC box did not influence the binding of the protein to DNA. The results therefore preclude a direct effect of cytosine methylation on Sp1-DNA interactions
Factor requirements for transcription in the Archaeon Sulfolobus shibatae.
Qureshi, S A; Bell, S D; Jackson, S P
1997-01-01
Archaea (archaebacteria) constitute a domain of life that is distinct from Bacteria (eubacteria) and Eucarya (eukaryotes). Although archaeal cells share many morphological features with eubacteria, their transcriptional apparatus is more akin to eukaryotic RNA polymerases I, II and III than it is to eubacterial transcription systems. Thus, in addition to possessing a 10 subunit RNA polymerase and a homologue of the TATA-binding protein (TBP), Archaea possess a polypeptide termed TFB that is h...
Giuntini, Serena; Beernink, Peter T; Reason, Donald C; Granoff, Dan M
2012-01-01
Meningococcal factor H binding protein (fHbp) is a promising vaccine candidate. Anti-fHbp antibodies can bind to meningococci and elicit complement-mediated bactericidal activity directly. The antibodies also can block binding of the human complement down-regulator, factor H (fH). Without bound fH, the organism would be expected to have increased susceptibility to bacteriolysis. Here we describe bactericidal activity of two anti-fHbp mAbs with overlapping epitopes in relation to their different effects on fH binding and bactericidal activity. Both mAbs recognized prevalent fHbp sequence variants in variant group 1. Using yeast display and site-specific mutagenesis, binding of one of the mAbs (JAR 1, IgG3) to fHbp was eliminated by a single amino acid substitution, R204A, and was decreased by K143A but not by R204H or D142A. The JAR 1 epitope overlapped that of previously described mAb (mAb502, IgG2a) whose binding to fHbp was eliminated by R204A or R204H substitutions, and was decreased by D142A but not by K143A. Although JAR 1 and mAb502 appeared to have overlapping epitopes, only JAR 1 inhibited binding of fH to fHbp and had human complement-mediated bactericidal activity. mAb502 enhanced fH binding and lacked human complement-mediated bactericidal activity. To control for confounding effects of different mouse IgG subclasses on complement activation, we created chimeric mAbs in which the mouse mAb502 or JAR 1 paratopes were paired with human IgG1 constant regions. While both chimeric mAbs showed similar binding to fHbp, only JAR 1, which inhibited fH binding, had human complement-mediated bactericidal activity. The lack of human complement-mediated bactericidal activity by anti-fHbp mAb502 appeared to result from an inability to inhibit binding of fH. These results underscore the importance of inhibition of fH binding for anti-fHbp mAb bactericidal activity.
Reth, Margot; Ciric, Anita; Christensen, Guttorm N; Heimstad, Eldbjørg S; Oehme, Michael
2006-08-15
Congener and homologue group patterns of chlorinated paraffins (CPs) in biota can be influenced by different processes, but these are not well studied yet. Short- (SCCPs) and medium-chain chlorinated paraffins (MCCPs) were quantified in liver from Arctic char and seabirds (little auk and kittiwake) collected at Bear Island (European Arctic) as well as in cod from Iceland and Norway. CP concentrations were between 5 and 88 ng/g wet weight (ww) for SCCPs and between 5 and 55 ng/g ww for MCCPs with one exception of 370 ng/g measured in a liver sample from little auk. The SCCP homologue group patterns were compared with those of technical mixtures and of SCCPs present in cod liver from the Baltic Sea. The latter showed a more common SCCP homologue distribution (sum of C(11) and C(12)>60%) in contrast to cod liver from the Northwest of Europe, which had a high abundance of C(10) and C(12) congeners. Seabirds from Bear Island contained an equally distributed SCCP homologue group pattern. In Arctic char, the SCCP distribution was closer to technical products, but with a high proportion (average of 18.9%) of C(10) congeners. A comparison of C(10)/C(12) ratios confirmed the higher abundance of C(10) congeners in samples from higher latitudes. For the first time, MCCPs could be detected in Arctic samples. The average proportion of C(14) congeners was 65.8%. The C(14)/C(15) abundance ratio was similar to technical mixtures. High-chlorinated CPs (Cl(>7)) were also detectable. The average chlorine content of the SCCPs was 61.9% (59.0-63.3%), and that of the MCCPs 55.8% (54.5-57.4%).
Ontogeny of basic fibroblast growth factor binding sites in mouse ocular tissues
International Nuclear Information System (INIS)
Fayein, N.A.; Courtois, Y.; Jeanny, J.C.
1990-01-01
Basic fibroblast growth factor (bFGF) binding to ocular tissues has been studied by autoradiographical and biochemical approaches directly performed on sections during mouse embryonic and postnatal development. Frozen sections of embryos (9 to 18 days), newborns, and adults (1 day to 6 months) were incubated with iodinated bFGF. One specific FGF binding site (KD = 2.5 nM) is colocalized with heparan sulfate proteoglycans of the basement membranes and is heparitinase sensitive. It first appears at Day 9 around the neural tube, the optic vesicles, and below the head ectoderm and by Day 14 of embryonic development is found in all basement membranes of the eye. At Day 16, very intensely labeled patches appear, corresponding to mast cells which have been characterized by metachromatic staining of their heparin-rich granulations with toluidine blue. In addition to the latter binding, we have also observed a general diffuse distribution of silver grains on all tissues and preferentially in the ecto- and neuroectodermic tissues. From Days 17-18, there is heterogeneous labeling inside the retina, localized in the pigmented epithelium and in three different layers colocalized with the inner and outer plexiform layers and with the inner segments of the photoreceptors. This binding is heparitinase resistant but N-glycanase sensitive and may represent a second specific binding site corresponding to cellular FGF receptors (KD = 280 pM). Both types of binding patterns observed suggest a significant role for bFGF in eye development and physiology
DALAL, AVANI
2006-01-01
ABSTRACT This study looks at the post-purchase evaluation stage of consumers and what causes loyalty. The industry under investigation is Small Medium Sized Jewellery Retailers. The purpose of this study is to develop a deeper understanding of how customer loyalty is developed. To reach this aim the study focuses on the impact of loyalty schemes on repeat patronage. This paper aims to contribute to the existing literature on repeat patronage and factors that lead to customer loyalty. A wi...
Characterization and DNA-binding specificities of Ralstonia TAL-like effectors
Li, Lixin; Atef, Ahmed; Piatek, Agnieszka Anna; Ali, Zahir; Piatek, Marek J.; Aouida, Mustapha; Sharakuu, Altanbadralt; Mahjoub, Ali; Wang, Guangchao; Khan, Mohammad Suhail; Fedoroff, Nina V.; Zhu, Jiankang; Mahfouz, Magdy M.
2013-01-01
, including a central DNA-binding domain composed of 35 amino acid-long repeats. Here, we characterize the RTLs and show that they localize in the plant cell nucleus, mediate DNA binding, and might function as transcriptional activators. RTLs have a unique DNA
Metheetrairut, Chanatip; Ahuja, Yuri; Slack, Frank J
2017-10-02
The heterochronic pathway in C. elegans controls the relative timing of cell fate decisions during post-embryonic development. It includes a network of microRNAs (miRNAs), such as let-7, and protein-coding genes, such as the stemness factors, LIN-28 and LIN-41. Here we identified the acn-1 gene, a homologue of mammalian angiotensin-converting enzyme (ACE), as a new suppressor of the stem cell developmental defects of let-7 mutants. Since acn-1 null mutants die during early larval development, we used RNAi to characterize the role of acn-1 in C. elegans seam cell development, and determined its interaction with heterochronic factors, including let-7 and its downstream interactors - lin-41, hbl-1, and apl-1. We demonstrate that although RNAi knockdown of acn-1 is insufficient to cause heterochronic defects on its own, loss of acn-1 suppresses the retarded phenotypes of let-7 mutants and enhances the precocious phenotypes of hbl-1, though not lin-41, mutants. Conversely, the pattern of acn-1 expression, which oscillates during larval development, is disrupted by lin-41 mutants but not by hbl-1 mutants. Finally, we show that acn-1(RNAi) enhances the let-7-suppressing phenotypes caused by loss of apl-1, a homologue of the Alzheimer's disease-causing amyloid precursor protein (APP), while significantly disrupting the expression of apl-1 during the L4 larval stage. In conclusion, acn-1 interacts with heterochronic genes and appears to function downstream of let-7 and its target genes, including lin-41 and apl-1.
Energy Technology Data Exchange (ETDEWEB)
Peng, Jamy C. [Univ. of California, Berkeley, CA (United States)
2007-01-01
Heterochromatin constitutes a significant portion of the genome in higher eukaryotes; approximately 30% in Drosophila and human. Heterochromatin contains a high repeat DNA content and a low density of protein-encoding genes. In contrast, euchromatin is composed mostly of unique sequences and contains the majority of single-copy genes. Genetic and cytological studies demonstrated that heterochromatin exhibits regulatory roles in chromosome organization, centromere function and telomere protection. As an epigenetically regulated structure, heterochromatin formation is not defined by any DNA sequence consensus. Heterochromatin is characterized by its association with nucleosomes containing methylated-lysine 9 of histone H3 (H3K9me), heterochromatin protein 1 (HP1) that binds H3K9me, and Su(var)3-9, which methylates H3K9 and binds HP1. Heterochromatin formation and functions are influenced by HP1, Su(var)3-9, and the RNA interference (RNAi) pathway. My thesis project investigates how heterochromatin formation and function impact nuclear architecture, repeated DNA organization, and genome stability in Drosophila melanogaster. H3K9me-based chromatin reduces extrachromosomal DNA formation; most likely by restricting the access of repair machineries to repeated DNAs. Reducing extrachromosomal ribosomal DNA stabilizes rDNA repeats and the nucleolus structure. H3K9me-based chromatin also inhibits DNA damage in heterochromatin. Cells with compromised heterochromatin structure, due to Su(var)3-9 or dcr-2 (a component of the RNAi pathway) mutations, display severe DNA damage in heterochromatin compared to wild type. In these mutant cells, accumulated DNA damage leads to chromosomal defects such as translocations, defective DNA repair response, and activation of the G2-M DNA repair and mitotic checkpoints that ensure cellular and animal viability. My thesis research suggests that DNA replication, repair, and recombination mechanisms in heterochromatin differ from those in
Cong, Le; Zhou, Ruhong; Kuo, Yu-chi; Cunniff, Margaret; Zhang, Feng
2012-01-01
Transcription activator-like effectors (TALE) are sequence-specific DNA binding proteins that harbor modular, repetitive DNA binding domains. TALEs have enabled the creation of customizable designer transcriptional factors and sequence-specific nucleases for genome engineering. Here we report two improvements of the TALE toolbox for achieving efficient activation and repression of endogenous gene expression in mammalian cells. We show that the naturally occurring repeat variable diresidue (RVD) Asn-His (NH) has high biological activity and specificity for guanine, a highly prevalent base in mammalian genomes. We also report an effective TALE transcriptional repressor architecture for targeted inhibition of transcription in mammalian cells. These findings will improve the precision and effectiveness of genome engineering that can be achieved using TALEs. PMID:22828628
Partial characterization of GTP-binding proteins in Neurospora
International Nuclear Information System (INIS)
Hasunuma, K.; Miyamoto-Shinohara, Y.; Furukawa, K.
1987-01-01
Six fractions of GTP-binding proteins separated by gel filtration of a mycelial extract containing membrane components of Neurospora crassa were partially characterized. [ 35 S]GTP gamma S bound to GTP-binding protein was assayed by repeated treatments with a Norit solution and centrifugation. The binding of [ 35 S]GTP gamma S to GTP-binding proteins was competitively prevented in the presence of 0.1 to 1 mM GTP but not in the presence of ATP. These GTP-binding proteins fractionated by the gel column had Km values of 20, 7, 4, 4, 80 and 2 nM. All six fractions of these GTP-binding proteins showed the capacity to be ADP-ribosylated by pertussis toxin
The role of the leukemia-associated ETO homologue repressors in hematopoiesis
Olsson, André
2006-01-01
The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...
Anti-tumor activity of a novel HS-mimetic-vascular endothelial growth factor binding small molecule.
Directory of Open Access Journals (Sweden)
Kazuyuki Sugahara
Full Text Available The angiogenic process is controlled by variety of factors of which the vascular endothelial growth factor (VEGF pathway plays a major role. A series of heparan sulfate mimetic small molecules targeting VEGF/VEGFR pathway has been synthesized. Among them, compound 8 (2-butyl-5-chloro-3-(4-nitro-benzyl-3H-imidazole-4-carbaldehyde was identified as a significant binding molecule for the heparin-binding domain of VEGF, determined by high-throughput-surface plasmon resonance assay. The data predicted strong binding of compound 8 with VEGF which may prevent the binding of VEGF to its receptor. We compared the structure of compound 8 with heparan sulfate (HS, which have in common the functional ionic groups such as sulfate, nitro and carbaldehyde that can be located in similar positions of the disaccharide structure of HS. Molecular docking studies predicted that compound 8 binds at the heparin binding domain of VEGF through strong hydrogen bonding with Lys-30 and Gln-20 amino acid residues, and consistent with the prediction, compound 8 inhibited binding of VEGF to immobilized heparin. In vitro studies showed that compound 8 inhibits the VEGF-induced proliferation migration and tube formation of mouse vascular endothelial cells, and finally the invasion of a murine osteosarcoma cell line (LM8G7 which secrets high levels of VEGF. In vivo, these effects produce significant decrease of tumor burden in an experimental model of liver metastasis. Collectively, these data indicate that compound 8 may prevent tumor growth through a direct effect on tumor cell proliferation and by inhibition of endothelial cell migration and angiogenesis mediated by VEGF. In conclusion, compound 8 may normalize the tumor vasculature and microenvironment in tumors probably by inhibiting the binding of VEGF to its receptor.
Directory of Open Access Journals (Sweden)
Yugang Huang
2013-06-01
Full Text Available Normal 0 false false false IN X-NONE X-NONE MicrosoftInternetExplorer4 To improve the repeatability of the injection molding test result, the affecting factors were investigated by means of experiments. Besides the traditional processing parameter, the factors of test conditions were also considered. In order to focus on the molding process rather than the molded part, the curve measurement of the melt pressure at the entrance to the nozzle was used as the output characteristic. Experiments for polypropylene (PP showed that the injected volume was the key processing parameter. Within the test conditions, the injection number is the most important factor. According to the analysis the operating procedure was improved effectively. Normal 0 false false false IN X-NONE X-NONE MicrosoftInternetExplorer4 Doi: 10.12777/ijse.5.1.6-11 [How to cite this article: Huang, Y., Li, D., Liu, Y. (2013. Experimental Analysis for Factors Affecting the Repeatability of Plastics Injection Molding Tests on the Self-developed Apparatus. International Journal of Science and Engineering, 5(1,6-11. Doi: 10.12777/ijse.5.1.6-11]
Kulakovskiy, Ivan V.; Vorontsov, Ilya E.; Yevshin, Ivan S.; Sharipov, Ruslan N.; Fedorova, Alla D.; Rumynskiy, Eugene I.; Medvedeva, Yulia A.; Magana-Mora, Arturo; Bajic, Vladimir B.; Papatsenko, Dmitry A.; Kolpakov, Fedor A.; Makeev, Vsevolod J.
2017-01-01
We present a major update of the HOCOMOCO collection that consists of patterns describing DNA binding specificities for human and mouse transcription factors. In this release, we profited from a nearly doubled volume of published in vivo experiments on transcription factor (TF) binding to expand the repertoire of binding models, replace low-quality models previously based on in vitro data only and cover more than a hundred TFs with previously unknown binding specificities. This was achieved by systematic motif discovery from more than five thousand ChIP-Seq experiments uniformly processed within the BioUML framework with several ChIP-Seq peak calling tools and aggregated in the GTRD database. HOCOMOCO v11 contains binding models for 453 mouse and 680 human transcription factors and includes 1302 mononucleotide and 576 dinucleotide position weight matrices, which describe primary binding preferences of each transcription factor and reliable alternative binding specificities. An interactive interface and bulk downloads are available on the web: http://hocomoco.autosome.ru and http://www.cbrc.kaust.edu.sa/hocomoco11. In this release, we complement HOCOMOCO by MoLoTool (Motif Location Toolbox, http://molotool.autosome.ru) that applies HOCOMOCO models for visualization of binding sites in short DNA sequences.
Kulakovskiy, Ivan V.
2017-10-31
We present a major update of the HOCOMOCO collection that consists of patterns describing DNA binding specificities for human and mouse transcription factors. In this release, we profited from a nearly doubled volume of published in vivo experiments on transcription factor (TF) binding to expand the repertoire of binding models, replace low-quality models previously based on in vitro data only and cover more than a hundred TFs with previously unknown binding specificities. This was achieved by systematic motif discovery from more than five thousand ChIP-Seq experiments uniformly processed within the BioUML framework with several ChIP-Seq peak calling tools and aggregated in the GTRD database. HOCOMOCO v11 contains binding models for 453 mouse and 680 human transcription factors and includes 1302 mononucleotide and 576 dinucleotide position weight matrices, which describe primary binding preferences of each transcription factor and reliable alternative binding specificities. An interactive interface and bulk downloads are available on the web: http://hocomoco.autosome.ru and http://www.cbrc.kaust.edu.sa/hocomoco11. In this release, we complement HOCOMOCO by MoLoTool (Motif Location Toolbox, http://molotool.autosome.ru) that applies HOCOMOCO models for visualization of binding sites in short DNA sequences.
Directory of Open Access Journals (Sweden)
Chantal Sellier
2013-03-01
Full Text Available Fragile X-associated tremor/ataxia syndrome (FXTAS is an inherited neurodegenerative disorder caused by the expansion of 55–200 CGG repeats in the 5′ UTR of FMR1. These expanded CGG repeats are transcribed and accumulate in nuclear RNA aggregates that sequester one or more RNA-binding proteins, thus impairing their functions. Here, we have identified that the double-stranded RNA-binding protein DGCR8 binds to expanded CGG repeats, resulting in the partial sequestration of DGCR8 and its partner, DROSHA, within CGG RNA aggregates. Consequently, the processing of microRNAs (miRNAs is reduced, resulting in decreased levels of mature miRNAs in neuronal cells expressing expanded CGG repeats and in brain tissue from patients with FXTAS. Finally, overexpression of DGCR8 rescues the neuronal cell death induced by expression of expanded CGG repeats. These results support a model in which a human neurodegenerative disease originates from the alteration, in trans, of the miRNA-processing machinery.
Birkenbihl, Rainer P; Kracher, Barbara; Somssich, Imre E
2017-01-01
During microbial-associated molecular pattern-triggered immunity (MTI), molecules derived from microbes are perceived by cell surface receptors and upon signaling to the nucleus initiate a massive transcriptional reprogramming critical to mount an appropriate host defense response. WRKY transcription factors play an important role in regulating these transcriptional processes. Here, we determined on a genome-wide scale the flg22-induced in vivo DNA binding dynamics of three of the most prominent WRKY factors, WRKY18, WRKY40, and WRKY33. The three WRKY factors each bound to more than 1000 gene loci predominantly at W-box elements, the known WRKY binding motif. Binding occurred mainly in the 500-bp promoter regions of these genes. Many of the targeted genes are involved in signal perception and transduction not only during MTI but also upon damage-associated molecular pattern-triggered immunity, providing a mechanistic link between these functionally interconnected basal defense pathways. Among the additional targets were genes involved in the production of indolic secondary metabolites and in modulating distinct plant hormone pathways. Importantly, among the targeted genes were numerous transcription factors, encoding predominantly ethylene response factors, active during early MTI, and WRKY factors, supporting the previously hypothesized existence of a WRKY subregulatory network. Transcriptional analysis revealed that WRKY18 and WRKY40 function redundantly as negative regulators of flg22-induced genes often to prevent exaggerated defense responses. © 2016 American Society of Plant Biologists. All rights reserved.
Wiersum-Osselton, Johanna C; Marijt-van der Kreek, Tanneke; Brand, Anneke; Veldhuizen, Ingrid; van der Bom, Johanna G; de Kort, Wim
2014-01-01
First-time donation is among recognised risk factors for vasovagal reactions to blood donation and reactions are known to reduce donor return. We assessed associations between potential risk factors and vasovagal reactions and needle-related complications in first-time whole blood donation in comparison to repeat donation and analysed the impact of complications on donor return. We performed a cohort study on whole blood donations in The Netherlands from 1/1/2010 to 31/12/2010 using data extracted from the blood service information system. Donation data up to 31/12/2011 were used to ascertain donor return. In 2010 28,786 donors made first whole blood donations and there were 522,958 repeat donations. Vasovagal reactions occurred in 3.9% of first donations by males and 3.5% of first donations by females compared to in 0.2% and 0.6%, respectively, of repeat donations. Associations of vasovagal reactions with other factors including age, body weight, systolic and diastolic blood pressure were similar in first-time and repeat donors. Needle-related complications occurred in 0.2% of male and 0.5% of female first-time donations and in 0.1% and 0.3%, respectively, of repeat donations. Among first-time donors, the return rate within 1 year was 82% following an uncomplicated first donation, but 55% and 61% following vasovagal reactions and needle-related complications, respectively; the corresponding percentages among repeat donors were 86%, 58% and 82%. Among first-time donors, females suffered less than males from vasovagal reactions. Other risk factors had similar associations among first-time and repeat donors. Vasovagal reactions and needle-related complications in both first-time and repeat donors are followed by reduced donor return.
Directory of Open Access Journals (Sweden)
Umme Kolsum
2009-04-01
Full Text Available Umme Kolsum, Kay Roy, Cerys Starkey, Zoë Borrill, Nick Truman, Jørgen Vestbo, Dave SinghNorth West Lung Research Centre, University of Manchester, South Manchester University Hospitals Trust, Wythenshawe, Manchester, UKBackground: Many of the systemic manifestations of chronic obstructive pulmonary disease (COPD are mediated through increased systemic levels of inflammatory proteins. We assessed the long term repeatability of Interleukin-6 (IL-6, tumor necrosis factor-α (TNF-α, and C-reactive protein (CRP over one year and examined the relationships between these systemic markers in COPD.Methods: Fifty-eight stable COPD patients completed a baseline and one-year visit. Serum IL-6, plasma CRP, and plasma TNF-α were measured. Repeatability was expressed by intraclass correlation coefficient (Ri and the Bland–Altman method. Pearson correlations were used to determine the relationships between the systemic markers at both visits.Results: There was moderate repeatability with a very high degree of statistical significance (p ≤ 0.001 between the two visits for all the systemic biomarkers (IL-6, CRP, and TNF-α. CRP was significantly associated with IL-6 at both visits (r = 0.55, p = 0.0001, r = 0.51, p = 0.0002, respectively. There were no other significant associations between the systemic markers at either of the visits.Conclusions: Systemic inflammatory biomarkers IL-6, CRP, and TNF-α were moderately repeatable over a twelve month period in COPD patients. We have also shown that a robust and repeatable association between IL-6 and CRP exists.Keywords: interleukin-6, tumor necrosis factor-α, C-reactive protein, repeatability, COPD
The role of Cas8 in type I CRISPR interference.
Cass, Simon D B; Haas, Karina A; Stoll, Britta; Alkhnbashi, Omer S; Sharma, Kundan; Urlaub, Henning; Backofen, Rolf; Marchfelder, Anita; Bolt, Edward L
2015-05-05
CRISPR (clustered regularly interspaced short palindromic repeat) systems provide bacteria and archaea with adaptive immunity to repel invasive genetic elements. Type I systems use 'cascade' [CRISPR-associated (Cas) complex for antiviral defence] ribonucleoprotein complexes to target invader DNA, by base pairing CRISPR RNA (crRNA) to protospacers. Cascade identifies PAMs (protospacer adjacent motifs) on invader DNA, triggering R-loop formation and subsequent DNA degradation by Cas3. Cas8 is a candidate PAM recognition factor in some cascades. We analysed Cas8 homologues from type IB CRISPR systems in archaea Haloferax volcanii (Hvo) and Methanothermobacter thermautotrophicus (Mth). Cas8 was essential for CRISPR interference in Hvo and purified Mth Cas8 protein responded to PAM sequence when binding to nucleic acids. Cas8 interacted physically with Cas5-Cas7-crRNA complex, stimulating binding to PAM containing substrates. Mutation of conserved Cas8 amino acid residues abolished interference in vivo and altered catalytic activity of Cas8 protein in vitro. This is experimental evidence that Cas8 is important for targeting Cascade to invader DNA. © 2015 Authors.
The relationship between transcription initiation RNAs and CCCTC-binding factor (CTCF localization
Directory of Open Access Journals (Sweden)
Taft Ryan J
2011-08-01
Full Text Available Abstract Background Transcription initiation RNAs (tiRNAs are nuclear localized 18 nucleotide RNAs derived from sequences immediately downstream of RNA polymerase II (RNAPII transcription start sites. Previous reports have shown that tiRNAs are intimately correlated with gene expression, RNA polymerase II binding and behaviors, and epigenetic marks associated with transcription initiation, but not elongation. Results In the present work, we show that tiRNAs are commonly found at genomic CCCTC-binding factor (CTCF binding sites in human and mouse, and that CTCF sites that colocalize with RNAPII are highly enriched for tiRNAs. To directly investigate the relationship between tiRNAs and CTCF we examined tiRNAs originating near the intronic CTCF binding site in the human tumor suppressor gene, p21 (cyclin-dependent kinase inhibitor 1A gene, also known as CDKN1A. Inhibition of CTCF-proximal tiRNAs resulted in increased CTCF localization and increased p21 expression, while overexpression of CTCF-proximal tiRNA mimics decreased CTCF localization and p21 expression. We also found that tiRNA-regulated CTCF binding influences the levels of trimethylated H3K27 at the alternate upstream p21 promoter, and affects the levels of alternate p21 (p21alt transcripts. Extending these studies to another randomly selected locus with conserved CTCF binding we found that depletion of tiRNA alters nucleosome density proximal to sites of tiRNA biogenesis. Conclusions Taken together, these data suggest that tiRNAs modulate local epigenetic structure, which in turn regulates CTCF localization.
Directory of Open Access Journals (Sweden)
Tariq Waseem Chohan
2014-09-01
Full Text Available Schizophrenia is thought to arise due to a complex interaction between genetic and environmental factors during early neurodevelopment. We have recently shown that partial genetic deletion of the schizophrenia susceptibility gene neuregulin 1 (Nrg1 and adolescent stress interact to disturb sensorimotor gating, neuroendocrine activity and dendritic morphology in mice. Both stress and Nrg1 may have converging effects upon N-methyl-D-aspartate receptors (NMDARs which are implicated in the pathogenesis of schizophrenia, sensorimotor gating and dendritic spine plasticity. Using an identical repeated restraint stress paradigm to our previous study, here we determined NMDAR binding across various brain regions in adolescent Nrg1 heterozygous (HET and wild-type (WT mice using [3H] MK-801 autoradiography. Repeated restraint stress increased NMDAR binding in the ventral part of the lateral septum (LSV and the dentate gyrus (DG of the hippocampus irrespective of genotype. Partial genetic deletion of Nrg1 interacted with adolescent stress to promote an altered pattern of NMDAR binding in the infralimbic (IL subregion of the medial prefrontal cortex. In the IL, whilst stress tended to increase NMDAR binding in WT mice, it decreased binding in Nrg1 HET mice. However in the DG, stress selectively increased the expression of NMDAR binding in Nrg1 HET mice but not WT mice. These results demonstrate a Nrg1-stress interaction during adolescence on NMDAR binding in the medial prefrontal cortex.
International Nuclear Information System (INIS)
Elegheert, Jonathan; Hemel, Debbie van den; Dix, Ina; Stout, Jan; Van Beeumen, Jozef; Brigé, Ann; Savvides, Savvas N.
2009-01-01
Of the four old yellow enzyme homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. Shewanella oneidensis is an environmentally versatile Gram-negative γ-proteobacterium that is endowed with an unusually large proteome of redox proteins. Of the four old yellow enzyme (OYE) homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and were moderately pseudo-merohedrally twinned, emulating a P422 metric symmetry. The native crystals of SYE4 were of exceptional diffraction quality and provided complete data to 1.10 Å resolution using synchrotron radiation, while crystals of the reduced enzyme and of the enzyme in complex with a wide range of ligands typically led to high-quality complete data sets to 1.30–1.60 Å resolution, thus providing a rare opportunity to dissect the structure–function relationships of a good-sized enzyme (40 kDa) at true atomic resolution. Here, the attainment of a number of experimental milestones in the crystallographic studies of SYE4 and its complexes are reported, including isolation of the elusive hydride–Meisenheimer complex
Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA
Directory of Open Access Journals (Sweden)
Goldman Gustavo H
2010-01-01
Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin
Nag, Ronita; Maity, Manas Kanti; Dasgupta, Maitrayee
2005-11-01
The ABA responsive ABI3 and the auxin responsive ARF family of transcription factors bind the CATGCATG (Sph) and TGTCTC core motifs in ABA and auxin response elements (ABRE and AuxRE), respectively. Several evidences indicate ABI3s to act downstream to auxin too. Because DNA binding domain of ABI3s shows significant overlap with ARFs we enquired whether auxin responsiveness through ABI3s could be mediated by their binding to canonical AuxREs. Investigations were undertaken through in vitro gel mobility shift assays (GMSA) using the DNA binding domain B3 of PvAlf (Phaseolus vulgaris ABI3 like factor) and upstream regions of auxin responsive gene GH3 (-267 to -141) and ABA responsive gene Em (-316 to -146) harboring AuxRE and ABRE, respectively. We demonstrate that B3 domain of PvAlf could bind AuxRE only when B3 was associated with its flanking domain B2 (B2B3). Such strict requirement of B2 domain was not observed with ABRE, where B3 could bind with or without being associated with B2. This dual specificity in DNA binding of ABI3s was also demonstrated with nuclear extracts of cultured cells of Arachis hypogea. Supershift analysis of ABRE and AuxRE bound nuclear proteins with antibodies raised against B2B3 domains of PvAlf revealed that ABI3 associated complexes were detectable in association with both cis elements. Competition GMSA confirmed the same complexes to bind ABRE and AuxRE. This dual specificity of ABI3 like factors in DNA binding targeted to natural promoters responsive to ABA and auxin suggests them to have a potential role in conferring crosstalk between these two phytohormones.
Kulakovskiy, Ivan V.
2011-08-18
Motivation: Modern experimental methods provide substantial information on protein-DNA recognition. Studying arrangements of transcription factor binding sites (TFBSs) of interacting transcription factors (TFs) advances understanding of the transcription regulatory code. Results: We constructed binding motifs for TFs forming a complex with HIF-1α at the erythropoietin 3\\'-enhancer. Corresponding TFBSs were predicted in the segments around transcription start sites (TSSs) of all human genes. Using the genome-wide set of regulatory regions, we observed several strongly preferred distances between hypoxia-responsive element (HRE) and binding sites of a particular cofactor protein. The set of preferred distances was called as a preferred pair distance template (PPDT). PPDT dramatically depended on the TF and orientation of its binding sites relative to HRE. PPDT evaluated from the genome-wide set of regulatory sequences was used to detect significant PPDT-consistent binding site pairs in regulatory regions of hypoxia-responsive genes. We believe PPDT can help to reveal the layout of eukaryotic regulatory segments. © The Author 2011. Published by Oxford University Press. All rights reserved.
Transcription Factors Bind Thousands of Active and InactiveRegions in the Drosophila Blastoderm
Energy Technology Data Exchange (ETDEWEB)
Li, Xiao-Yong; MacArthur, Stewart; Bourgon, Richard; Nix, David; Pollard, Daniel A.; Iyer, Venky N.; Hechmer, Aaron; Simirenko, Lisa; Stapleton, Mark; Luengo Hendriks, Cris L.; Chu, Hou Cheng; Ogawa, Nobuo; Inwood, William; Sementchenko, Victor; Beaton, Amy; Weiszmann, Richard; Celniker, Susan E.; Knowles, David W.; Gingeras, Tom; Speed, Terence P.; Eisen, Michael B.; Biggin, Mark D.
2008-01-10
Identifying the genomic regions bound by sequence-specific regulatory factors is central both to deciphering the complex DNA cis-regulatory code that controls transcription in metazoans and to determining the range of genes that shape animal morphogenesis. Here, we use whole-genome tiling arrays to map sequences bound in Drosophila melanogaster embryos by the six maternal and gap transcription factors that initiate anterior-posterior patterning. We find that these sequence-specific DNA binding proteins bind with quantitatively different specificities to highly overlapping sets of several thousand genomic regions in blastoderm embryos. Specific high- and moderate-affinity in vitro recognition sequences for each factor are enriched in bound regions. This enrichment, however, is not sufficient to explain the pattern of binding in vivo and varies in a context-dependent manner, demonstrating that higher-order rules must govern targeting of transcription factors. The more highly bound regions include all of the over forty well-characterized enhancers known to respond to these factors as well as several hundred putative new cis-regulatory modules clustered near developmental regulators and other genes with patterned expression at this stage of embryogenesis. The new targets include most of the microRNAs (miRNAs) transcribed in the blastoderm, as well as all major zygotically transcribed dorsal-ventral patterning genes, whose expression we show to be quantitatively modulated by anterior-posterior factors. In addition to these highly bound regions, there are several thousand regions that are reproducibly bound at lower levels. However, these poorly bound regions are, collectively, far more distant from genes transcribed in the blastoderm than highly bound regions; are preferentially found in protein-coding sequences; and are less conserved than highly bound regions. Together these observations suggest that many of these poorly-bound regions are not involved in early
International Nuclear Information System (INIS)
Lutwyche, Jodi K.; Keough, Rebecca A.; Hunter, Julie; Coles, Leeanne S.; Gonda, Thomas J.
2006-01-01
Myb is a key transcription factor that can regulate proliferation, differentiation, and apoptosis, predominantly in the haemopoietic system. Abnormal expression of Myb is associated with a number of cancers, both haemopoietic and non-haemopoietic. In order to better understand the role of Myb in normal and tumorigenic processes, we undertook a cDNA array screen to identify genes that are regulated by this factor. In this way, we identified the gene encoding vascular endothelial growth factor (VEGF) as being potentially regulated by the Myb oncoprotein in myeloid cells. To determine whether this was a direct effect on VEGF gene transcription, we examined the activity of the murine VEGF promoter in the presence of either wild-type (WT) or mutant forms of Myb. It was found that WT Myb was able to activate the VEGF promoter and that a minimal promoter region of 120 bp was sufficient to confer Myb responsiveness. Surprisingly, activation of the VEGF promoter was independent of DNA binding by Myb. This was shown by the use of DNA binding-defective Myb mutants and by mutagenesis of a potential Myb-binding site in the minimal promoter. Mutation of Sp1 sites within this region abolished Myb-mediated regulation of a reporter construct, suggesting that Myb DNA binding-independent activation of VEGF expression occurs via these Sp1 binding elements. Regulation of VEGF production by Myb has implications for the potential role of Myb in myeloid leukaemias and in solid tumours where VEGF may be functioning as an autocrine growth factor
Identification of a candidate CD5 homologue in the amphibian Xenopus laevis.
Jürgens, J B; Gartland, L A; Du Pasquier, L; Horton, J D; Göbel, T W; Cooper, M D
1995-11-01
We identified a novel T cell Ag in the South African clawed toad (Xenopus laevis) by a mAb designated 2B1. This Ag is present in relatively high levels on most thymocytes, approximately 65% of splenocytes, 55% of PBL, and 65% of intestinal lymphocytes, but is rarely seen on IgM+ B cells in any of these tissues. Lymphocytes bearing the 2B1 Ag proliferate in response to stimulation with Con A or PHA, whereas the 2B1- lymphocytes are reactive to LPS. Biochemical analysis indicates that this Ag is a differentially phosphorylated glycoprotein of 71 to 82 kDa. The protein core of 64 kDa bears both N- and O-linked carbohydrate side chains. The amino-terminal protein sequence of the 2B1 Ag shares significant homology with both the macrophage scavenger receptor type 1 motif and the mammalian CD5/CD6 family. The biochemical characteristics and cellular distribution of the 2B1 Ag suggest that it represents the CD5 homologue in X. laevis. While T cells constitutively express this highly conserved molecule, Xenopus B cells acquire the CD5 homologue only when they are stimulated in the presence of T cells.
Fantl, W J; Escobedo, J A; Martin, G A; Turck, C W; del Rosario, M; McCormick, F; Williams, L T
1992-05-01
The receptor for platelet-derived growth factor (PDGF) binds two proteins containing SH2 domains, GTPase activating protein (GAP) and phosphatidylinositol 3-kinase (PI3-kinase). The sites on the receptor that mediate this interaction were identified by using phosphotyrosine-containing peptides representing receptor sequences to block specifically binding of either PI3-kinase or GAP. These results suggested that PI3-kinase binds two phosphotyrosine residues, each located in a 5 aa motif with an essential methionine at the fourth position C-terminal to the tyrosine. Point mutations at these sites caused a selective elimination of PI3-kinase binding and loss of PDGF-stimulated DNA synthesis. Mutation of the binding site for GAP prevented the receptor from associating with or phosphorylating GAP, but had no effect on PI3-kinase binding and little effect on DNA synthesis. Therefore, GAP and PI3-kinase interact with the receptor by binding to different phosphotyrosine-containing sequence motifs.
Malm, Sven; Jusko, Monika; Eick, Sigrun; Potempa, Jan; Riesbeck, Kristian; Blom, Anna M
2012-01-01
Infection with the Gram-negative pathogen Prevotella intermedia gives rise to periodontitis and a growing number of studies implies an association of P. intermedia with rheumatoid arthritis. The serine protease Factor I (FI) is the central inhibitor of complement degrading complement components C3b and C4b in the presence of cofactors such as C4b-binding protein (C4BP) and Factor H (FH). Yet, the significance of complement inhibitor acquisition in P. intermedia infection and FI binding by Gram-negative pathogens has not been addressed. Here we show that P. intermedia isolates bound purified FI as well as FI directly from heat-inactivated human serum. FI bound to bacteria retained its serine protease activity as shown in degradation experiments with (125)I-labeled C4b. Since FI requires cofactors for its activity we also investigated the binding of purified cofactors C4BP and FH and found acquisition of both proteins, which retained their activity in FI mediated degradation of C3b and C4b. We propose that FI binding by P. intermedia represents a new mechanism contributing to complement evasion by a Gram-negative bacterial pathogen associated with chronic diseases.
Directory of Open Access Journals (Sweden)
Dapeng Zhou
2018-05-01
Full Text Available Abnormally O-glycosylated MUC1 tandem repeat glycopeptide epitopes expressed by multiple types of cancer have long been attractive targets for therapy in the race against genetic mutations of tumor cells. Glycopeptide signature-guided therapy might be a more promising avenue than mutation signature-guided therapy. Three O-glycosylated peptide motifs, PDTR, GSTA, and GVTS, exist in a tandem repeat HGVTSAPDTRPAPGSTAPPA, containing five O-glycosylation sites. The exact peptide and sugar residues involved in antibody binding are poorly defined. Co-crystal structures of glycopeptides and respective monoclonal antibodies are very few. Here we review 3 groups of monoclonal antibodies: antibodies which only bind to peptide portion, antibodies which only bind to sugar portion, and antibodies which bind to both peptide and sugar portions. The antigenicity of peptide and sugar portions of glyco-MUC1 tandem repeat were analyzed according to available biochemical and structural data, especially the GSTA and GVTS motifs independent from the most studied PDTR. Tn is focused as a peptide-modifying residue in vaccine design, to induce glycopeptide-binding antibodies with cross reactivity to Tn-related tumor glycans, but not glycans of healthy cells. The unique requirement for the designs of antibody in antibody-drug conjugate, bi-specific antibodies, and chimeric antigen receptors are also discussed.
Osmotic stress regulates the strength and kinetics of sugar binding to the maltoporin channel
International Nuclear Information System (INIS)
Gurnev, Philip A; Bezrukov, Sergey M; Harries, Daniel; Adrian Parsegian, V
2010-01-01
We study the effect of osmotic stress, exerted by salts, on carbohydrate binding to the sugar-specific bacterial channel maltoporin. When the channel is reconstituted into planar lipid bilayers, single events of its occlusion by sugar are seen as transient interruptions in the flow of small ions. We find that, for most salts, changes in the free energy of maltoporin-sugar binding vary linearly with solution osmotic pressure. Such a change in binding with solution osmolarity indicates that for each salt a constant number of salt-excluding water molecules is released upon sugar-maltoporin association at all salt concentrations. We find that larger numbers of water molecules are released upon binding of the cyclic carbohydrate β-cyclodextrin (CD) than upon binding of the corresponding linear homologue maltoheptaose (m7). Remarkably, the extent to which salts affect the binding constants and rates depends sensitively on the type of salt; dehydration in solutions of different anions corresponds to the Hofmeister series. In sodium sulfate solutions, CD and m7 respectively release about 120 and 35 salt-excluding water molecules; in sodium chloride solutions, 35 and 15 waters. No water release is observed with sodium bromide. Finally, by adding adamantane, known to form an inclusion complex with CD, we can infer that CD not only dehydrates but also undergoes a conformational change upon binding to the channel. As a practical outcome, our results also demonstrate how osmotic stress can improve single-molecule detection of different solutes using protein-based nanopores.
International Nuclear Information System (INIS)
Schmidt, R.R.; Betz, H.; Rehm, H.
1988-01-01
The presynaptically active snake venom neurotoxin β-bungarotoxin (β-Butx) is known to affect neurotransmitter release by binding to a subtype of voltage-activated K + channels. Here the authors show that mast cell degranulating (MCD) peptide from bee venom inhibits the binding of 125 I-labeled β-Butx to chick and rat brain membranes with apparent K/sub i/ values of 180 nM and 1100 nM, respectively. The mechanisms of inhibition of MCD peptide is noncompetitive, as is inhibition of 125 I-β-Butx binding by the protease inhibitor homologue from mamba venom, toxin I. β-Butx and its binding antagonists thus bind to different sites of the same membrane protein. Removal of Ca 2+ by ethylene glycol bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid inhibits the binding of 125 I-β-Butx by lowering its affinity to brain membranes
Zhang, Na; Huang, Hongjun; Tan, Binghe; Wei, Yinglei; Xiong, Qingqing; Yan, Yan; Hou, Lili; Wu, Nannan; Siwko, Stefan; Cimarelli, Andrea; Xu, Jianrong; Han, Honghui; Qian, Min; Liu, Mingyao; Du, Bing
2017-10-06
Vesicular stomatitis virus (VSV) and rabies and Chandipura viruses belong to the Rhabdovirus family. VSV is a common laboratory virus to study viral evolution and host immune responses to viral infection, and recombinant VSV-based vectors have been widely used for viral oncolysis, vaccination, and gene therapy. Although the tropism of VSV is broad, and its envelope glycoprotein G is often used for pseudotyping other viruses, the host cellular components involved in VSV infection remain unclear. Here, we demonstrate that the host protein leucine-rich repeat-containing G protein-coupled receptor 4 (Lgr4) is essential for VSV and VSV-G pseudotyped lentivirus (VSVG-LV) to infect susceptible cells. Accordingly, Lgr4-deficient mice had dramatically decreased VSV levels in the olfactory bulb. Furthermore, Lgr4 knockdown in RAW 264.7 cells also significantly suppressed VSV infection, and Lgr4 overexpression in RAW 264.7 cells enhanced VSV infection. Interestingly, only VSV infection relied on Lgr4, whereas infections with Newcastle disease virus, influenza A virus (A/WSN/33), and herpes simplex virus were unaffected by Lgr4 status. Of note, assays of virus entry, cell ELISA, immunoprecipitation, and surface plasmon resonance indicated that VSV bound susceptible cells via the Lgr4 extracellular domain. Pretreating cells with an Lgr4 antibody, soluble LGR4 extracellular domain, or R-spondin 1 blocked VSV infection by competitively inhibiting VSV binding to Lgr4. Taken together, the identification of Lgr4 as a VSV-specific host factor provides important insights into understanding VSV entry and its pathogenesis and lays the foundation for VSV-based gene therapy and viral oncolytic therapeutics. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Kulakovskiy, Ivan V.; Belostotsky, A. A.; Kasianov, Artem S.; Esipova, Natalia G.; Medvedeva, Yulia; Eliseeva, Irina A.; Makeev, Vsevolod J.
2011-01-01
Motivation: Modern experimental methods provide substantial information on protein-DNA recognition. Studying arrangements of transcription factor binding sites (TFBSs) of interacting transcription factors (TFs) advances understanding
Dinesh, Bhimareddy; Squillaci, Marco A; Ménard-Moyon, Cécilia; Samorì, Paolo; Bianco, Alberto
2015-10-14
The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to transform the nanofibers into spherical structures. Moreover, the co-assembly of β and γ peptides with carbon nanotubes covalently functionalized with the same peptide generated unique dendritic assemblies. This comparative study on self-assembly using diphenylalanine backbone homologues and of the co-assembly with CNT covalent conjugates is the first example exploring the capacity of β and γ peptides to adopt precise nanostructures, particularly in combination with carbon nanotubes. The dendritic organization obtained by mixing carbon nanotubes and peptides might find interesting applications in tissue engineering and neuronal interfacing.
Czech Academy of Sciences Publication Activity Database
Tomaštíková, Eva; Cenklová, Věra; Kohoutová, Lucie; Petrovská, Beáta; Váchová, Lenka; Halada, Petr; Kočárová, Gabriela; Binarová, Pavla
2012-01-01
Roč. 12, č. 83 (2012) ISSN 1471-2229 R&D Projects: GA ČR(CZ) GA204/07/1169; GA ČR GP204/09/P155; GA ČR GAP501/12/2333; GA MŠk(CZ) LC06034; GA MŠk LC545; GA AV ČR IAA500200719 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50200510 Keywords : Arabidopsis homologue of RanBPM * CTLH-complex * LisH-CTLH domain proteins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.354, year: 2012
Park, Myoungryoul; Yun, Kilyoung; Mohanty, Bijayalaxmi; Herath, Venura; Xu, Fuyu; Wijaya, Edward; Bajic, Vladimir B.; Yun, Songjoong; De Los Reyes, Benildo G.
2010-01-01
acid (JA), salicylic acid (SA), ethylene and reactive oxygen species (ROS) responsive genes. OsMyb4 network is independent of drought response element binding protein/C-repeat binding factor (DREB/CBF) and its sub-regulons operate with possible co
A simple repeat polymorphism in the MITF-M promoter is a key regulator of white spotting in dogs.
Directory of Open Access Journals (Sweden)
Izabella Baranowska Körberg
Full Text Available The white spotting locus (S in dogs is colocalized with the MITF (microphtalmia-associated transcription factor gene. The phenotypic effects of the four S alleles range from solid colour (S to extreme white spotting (s(w. We have investigated four candidate mutations associated with the s(w allele, a SINE insertion, a SNP at a conserved site and a simple repeat polymorphism all associated with the MITF-M promoter as well as a 12 base pair deletion in exon 1B. The variants associated with white spotting at all four loci were also found among wolves and we conclude that none of these could be a sole causal mutation, at least not for extreme white spotting. We propose that the three canine white spotting alleles are not caused by three independent mutations but represent haplotype effects due to different combinations of causal polymorphisms. The simple repeat polymorphism showed extensive diversity both in dogs and wolves, and allele-sharing was common between wolves and white spotted dogs but was non-existent between solid and spotted dogs as well as between wolves and solid dogs. This finding was unexpected as Solid is assumed to be the wild-type allele. The data indicate that the simple repeat polymorphism has been a target for selection during dog domestication and breed formation. We also evaluated the significance of the three MITF-M associated polymorphisms with a Luciferase assay, and found conclusive evidence that the simple repeat polymorphism affects promoter activity. Three alleles associated with white spotting gave consistently lower promoter activity compared with the allele associated with solid colour. We propose that the simple repeat polymorphism affects cooperativity between transcription factors binding on either flanking sides of the repeat. Thus, both genetic and functional evidence show that the simple repeat polymorphism is a key regulator of white spotting in dogs.
JASPAR 2010: the greatly expanded open-access database of transcription factor binding profiles
Portales-Casamar, Elodie; Thongjuea, Supat; Kwon, Andrew T.; Arenillas, David; Zhao, Xiaobei; Valen, Eivind; Yusuf, Dimas; Lenhard, Boris; Wasserman, Wyeth W.; Sandelin, Albin
2010-01-01
JASPAR (http://jaspar.genereg.net) is the leading open-access database of matrix profiles describing the DNA-binding patterns of transcription factors (TFs) and other proteins interacting with DNA in a sequence-specific manner. Its fourth major release is the largest expansion of the core database to date: the database now holds 457 non-redundant, curated profiles. The new entries include the first batch of profiles derived from ChIP-seq and ChIP-chip whole-genome binding experiments, and 177 yeast TF binding profiles. The introduction of a yeast division brings the convenience of JASPAR to an active research community. As binding models are refined by newer data, the JASPAR database now uses versioning of matrices: in this release, 12% of the older models were updated to improved versions. Classification of TF families has been improved by adopting a new DNA-binding domain nomenclature. A curated catalog of mammalian TFs is provided, extending the use of the JASPAR profiles to additional TFs belonging to the same structural family. The changes in the database set the system ready for more rapid acquisition of new high-throughput data sources. Additionally, three new special collections provide matrix profile data produced by recent alternative high-throughput approaches. PMID:19906716
Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K
2017-03-17
Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Dynamic Factors Affecting Gaseous Ligand Binding in an Artificial Oxygen Transport Protein‡
Zhang, Lei; Andersen, Eskil M.E.; Khajo, Abdelahad; Magliozzo, Richard S.; Koder, Ronald L.
2013-01-01
We report the functional analysis of an artificial hexacoordinate oxygen transport protein, HP7, which operates via a mechanism similar to that of human neuroglobin and cytoglobin: the destabilization of one of two heme-ligating histidine residues. In the case of HP7 this is the result of the coupling of histidine side chain ligation with the burial of three charged glutamate residues on the same helix. Here we compare gaseous ligand binding, including rates, affinities and oxyferrous state lifetimes, of both heme binding sites in HP7. We find that despite the identical sequence of helices in both binding sites, there are differences in oxygen affinity and oxyferrous state lifetime which may be the result of differences in the freedom of motion imposed by the candelabra fold on the two sites of the protein. We further examine the effect of mutational removal of the buried glutamates on function. Heme iron in the ferrous state of this mutant is rapidly oxidized when when exposed to oxygen. Compared to HP7, distal histidine affinity is increased by a 22-fold decrease in the histidine ligand off-rate. EPR comparison of these ferric hemoproteins demonstrates that the mutation increases disorder at the heme binding site. NMR-detected deuterium exchange demonstrates that the mutation greatly increases water penetration into the protein core. The inability of the mutant protein to bind oxygen may be due to increased water penetration, the large decrease in binding rate caused by the increase in distal histidine affinity, or a combination of the two factors. Together these data underline the importance of the control of protein dynamics in the design of functional artificial proteins. PMID:23249163
Energy Technology Data Exchange (ETDEWEB)
Liu, Zhuo; Lin, Lin; Yuan, Cai; Nicolaes, Gerry A.F.; Chen, Liqing; Meehan, Edward J.; Furie, Bruce; Furie, Barbara; Huang, Mingdong (Harvard-Med); (UAH); (Maastricht); (Chinese Aca. Sci.)
2010-11-03
Factor VIII (FVIII) plays a critical role in blood coagulation by forming the tenase complex with factor IXa and calcium ions on a membrane surface containing negatively charged phospholipids. The tenase complex activates factor X during blood coagulation. The carboxyl-terminal C2 domain of FVIII is the main membrane-binding and von Willebrand factor-binding region of the protein. Mutations of FVIII cause hemophilia A, whereas elevation of FVIII activity is a risk factor for thromboembolic diseases. The C2 domain-membrane interaction has been proposed as a target of intervention for regulation of blood coagulation. A number of molecules that interrupt FVIII or factor V (FV) binding to cell membranes have been identified through high throughput screening or structure-based design. We report crystal structures of the FVIII C2 domain under three new crystallization conditions, and a high resolution (1.15 {angstrom}) crystal structure of the FVIII C2 domain bound to a small molecular inhibitor. The latter structure shows that the inhibitor binds to the surface of an exposed {beta}-strand of the C2 domain, Trp{sup 2313}-His{sup 2315}. This result indicates that the Trp{sup 2313}-His{sup 2315} segment is an important constituent of the membrane-binding motif and provides a model to understand the molecular mechanism of the C2 domain membrane interaction.
Identification of NoxD/Pro41 as the homologue of the p22phox NADPH oxidase subunit in fungi.
Lacaze, Isabelle; Lalucque, Hervé; Siegmund, Ulrike; Silar, Philippe; Brun, Sylvain
2015-03-01
NADPH oxidases (Nox) are membrane complexes that produce O2(-). Researches in mammals, plants and fungi highlight the involvement of Nox-generated ROS in cell proliferation, differentiation and defense. In mammals, the core enzyme gp91(phox)/Nox2 is associated with p22(phox) forming the flavocytochrome b558 ready for activation by a cytosolic complex. Intriguingly, no homologue of the p22(phox) gene has been found in fungal genomes, questioning how the flavoenzyme forms. Using whole genome sequencing combined with phylogenetic analysis and structural studies, we identify the fungal p22(phox) homologue as being mutated in the Podospora anserina mutant IDC(509). Functional studies show that the fungal p22(phox), PaNoxD, acts along PaNox1, but not PaNox2, a second fungal gp91(phox) homologue. Finally, cytological analysis of functional tagged versions of PaNox1, PaNoxD and PaNoxR shows clear co-localization of PaNoxD and PaNox1 and unravel a dynamic assembly of the complex in the endoplasmic reticulum and in the vacuolar system. © 2014 John Wiley & Sons Ltd.
Valachova, Bernadeta; Brezovakova, Veronika; Bugos, Ondrej; Jadhav, Santosh; Smolek, Tomas; Novak, Petr; Zilka, Norbert
2018-08-01
Human tauopathies represent a heterogeneous group of neurodegenerative disorders characterized by distinct clinical features, typical histopathological structures, and defined ratio(s) of three-repeat and four-repeat tau isoforms within pathological aggregates. How the optional microtubule-binding repeat of tau influences this differentiation of pathologies is understudied. We have previously generated and characterized transgenic rodent models expressing human truncated tau aa151-391 with either three (SHR24) or four microtubule-binding repeats (SHR72). Here, we compare the behavioral and neuropathological hallmarks of these two transgenic lines using a battery of tests for sensorimotor, cognitive, and neurological functions over the age range of 3.5-15 months. Progression of sensorimotor and neurological deficits was similar in both transgenic lines; however, the lifespan of transgenic line SHR72 expressing truncated four-repeat tau was markedly shorter than SHR24. Moreover, the expression of three or four-repeat tau induced distinct neurofibrillary pathology in these lines. Transgenic lines displayed different distribution of tau pathology and different type of neurofibrillary tangles. Our results suggest that three- and four-repeat isoforms of tau may display different modes of action in the diseased brain. © 2018 Wiley Periodicals, Inc.
Is the Prosthetic Homologue Necessary for Embodiment?
Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael
2016-01-01
Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.
Directory of Open Access Journals (Sweden)
Kinyui Alice Lo
Full Text Available The growing epidemic of obesity and metabolic diseases calls for a better understanding of adipocyte biology. The regulation of transcription in adipocytes is particularly important, as it is a target for several therapeutic approaches. Transcriptional outcomes are influenced by both histone modifications and transcription factor binding. Although the epigenetic states and binding sites of several important transcription factors have been profiled in the mouse 3T3-L1 cell line, such data are lacking in human adipocytes. In this study, we identified H3K56 acetylation sites in human adipocytes derived from mesenchymal stem cells. H3K56 is acetylated by CBP and p300, and deacetylated by SIRT1, all are proteins with important roles in diabetes and insulin signaling. We found that while almost half of the genome shows signs of H3K56 acetylation, the highest level of H3K56 acetylation is associated with transcription factors and proteins in the adipokine signaling and Type II Diabetes pathways. In order to discover the transcription factors that recruit acetyltransferases and deacetylases to sites of H3K56 acetylation, we analyzed DNA sequences near H3K56 acetylated regions and found that the E2F recognition sequence was enriched. Using chromatin immunoprecipitation followed by high-throughput sequencing, we confirmed that genes bound by E2F4, as well as those by HSF-1 and C/EBPα, have higher than expected levels of H3K56 acetylation, and that the transcription factor binding sites and acetylation sites are often adjacent but rarely overlap. We also discovered a significant difference between bound targets of C/EBPα in 3T3-L1 and human adipocytes, highlighting the need to construct species-specific epigenetic and transcription factor binding site maps. This is the first genome-wide profile of H3K56 acetylation, E2F4, C/EBPα and HSF-1 binding in human adipocytes, and will serve as an important resource for better understanding adipocyte
Directory of Open Access Journals (Sweden)
Ardina Grüber
2010-02-01
Full Text Available Invasion of the red blood cells (RBC by the merozoite of malaria parasites involves a large number of receptor ligand interactions. The reticulocyte binding protein homologue family (RH plays an important role in erythrocyte recognition as well as virulence. Recently, it has been shown that members of RH in addition to receptor binding may also have a role as ATP/ADP sensor. A 94 kDa region named Nucleotide-Binding Domain 94 (NBD94 of Plasmodium yoelii YM, representative of the putative nucleotide binding region of RH, has been demonstrated to bind ATP and ADP selectively. Binding of ATP or ADP induced nucleotide-dependent structural changes in the C-terminal hinge-region of NBD94, and directly impacted on the RBC binding ability of RH.In order to find the smallest structural unit, able to bind nucleotides, and its coupling module, the hinge region, three truncated domains of NBD94 have been generated, termed NBD94(444-547, NBD94(566-663 and NBD94(674-793, respectively. Using fluorescence correlation spectroscopy NBD94(444-547 has been identified to form the smallest nucleotide binding segment, sensitive for ATP and ADP, which became inhibited by 4-Chloro-7-nitrobenzofurazan. The shape of NBD94(444-547 in solution was calculated from small-angle X-ray scattering data, revealing an elongated molecule, comprised of two globular domains, connected by a spiral segment of about 73.1 A in length. The high quality of the constructs, forming the hinge-region, NBD94(566-663 and NBD94(674-793 enabled to determine the first crystallographic and solution structure, respectively. The crystal structure of NBD94(566-663 consists of two helices with 97.8 A and 48.6 A in length, linked by a loop. By comparison, the low resolution structure of NBD94(674-793 in solution represents a chair-like shape with three architectural segments.These structures give the first insight into how nucleotide binding impacts on the overall structure of RH and demonstrates the
International Nuclear Information System (INIS)
Ghazal, P.; Lubon, H.; Hennighausen, L.
1988-01-01
Repeat sequence motifs as well as unique sequences between nucleotides -150 and -22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides -91 and -65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene
Structure, dynamics and RNA binding of the multi-domain splicing factor TIA-1
Wang, Iren; Hennig, Janosch; Jagtap, Pravin Kumar Ankush; Sonntag, Miriam; Valcárcel, Juan; Sattler, Michael
2014-01-01
Alternative pre-messenger ribonucleic acid (pre-mRNA) splicing is an essential process in eukaryotic gene regulation. The T-cell intracellular antigen-1 (TIA-1) is an apoptosis-promoting factor that modulates alternative splicing of transcripts, including the pre-mRNA encoding the membrane receptor Fas. TIA-1 is a multi-domain ribonucleic acid (RNA) binding protein that recognizes poly-uridine tract RNA sequences to facilitate 5′ splice site recognition by the U1 small nuclear ribonucleoprotein (snRNP). Here, we characterize the RNA interaction and conformational dynamics of TIA-1 by nuclear magnetic resonance (NMR), isothermal titration calorimetry (ITC) and small angle X-ray scattering (SAXS). Our NMR-derived solution structure of TIA-1 RRM2–RRM3 (RRM2,3) reveals that RRM2 adopts a canonical RNA recognition motif (RRM) fold, while RRM3 is preceded by an non-canonical helix α0. NMR and SAXS data show that all three RRMs are largely independent structural modules in the absence of RNA, while RNA binding induces a compact arrangement. RRM2,3 binds to pyrimidine-rich FAS pre-mRNA or poly-uridine (U9) RNA with nanomolar affinities. RRM1 has little intrinsic RNA binding affinity and does not strongly contribute to RNA binding in the context of RRM1,2,3. Our data unravel the role of binding avidity and the contributions of the TIA-1 RRMs for recognition of pyrimidine-rich RNAs. PMID:24682828
Low nucleosome occupancy is encoded around functional human transcription factor binding sites
Directory of Open Access Journals (Sweden)
Daenen Floris
2008-07-01
Full Text Available Abstract Background Transcriptional regulation of genes in eukaryotes is achieved by the interactions of multiple transcription factors with arrays of transcription factor binding sites (TFBSs on DNA and with each other. Identification of these TFBSs is an essential step in our understanding of gene regulatory networks, but computational prediction of TFBSs with either consensus or commonly used stochastic models such as Position-Specific Scoring Matrices (PSSMs results in an unacceptably high number of hits consisting of a few true functional binding sites and numerous false non-functional binding sites. This is due to the inability of the models to incorporate higher order properties of sequences including sequences surrounding TFBSs and influencing the positioning of nucleosomes and/or the interactions that might occur between transcription factors. Results Significant improvement can be expected through the development of a new framework for the modeling and prediction of TFBSs that considers explicitly these higher order sequence properties. It would be particularly interesting to include in the new modeling framework the information present in the nucleosome positioning sequences (NPSs surrounding TFBSs, as it can be hypothesized that genomes use this information to encode the formation of stable nucleosomes over non-functional sites, while functional sites have a more open chromatin configuration. In this report we evaluate the usefulness of the latter feature by comparing the nucleosome occupancy probabilities around experimentally verified human TFBSs with the nucleosome occupancy probabilities around false positive TFBSs and in random sequences. Conclusion We present evidence that nucleosome occupancy is remarkably lower around true functional human TFBSs as compared to non-functional human TFBSs, which supports the use of this feature to improve current TFBS prediction approaches in higher eukaryotes.
Hormone response element binding proteins: novel regulators of vitamin D and estrogen signaling.
Lisse, Thomas S; Hewison, Martin; Adams, John S
2011-03-01
Insights from vitamin D-resistant New World primates and their human homologues as models of natural and pathological insensitivity to sterol/steroid action have uncovered a family of novel intracellular vitamin D and estrogen regulatory proteins involved in hormone action. The proteins, known as "vitamin D or estrogen response element-binding proteins", behave as potent cis-acting, transdominant regulators to inhibit steroid receptor binding to DNA response elements and is responsible for vitamin D and estrogen resistances. This set of interactors belongs to the heterogeneous nuclear ribonucleoprotein (hnRNP) family of previously known pre-mRNA-interacting proteins. This review provides new insights into the mechanism by which these novel regulators of signaling and metabolism can act to regulate responses to vitamin D and estrogen. In addition the review also describes other molecules that are known to influence nuclear receptor signaling through interaction with hormone response elements. Copyright © 2011 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Juan Du
Full Text Available Actin is a highly conserved protein. It plays important roles in cellular function and exists either in the monomeric (G-actin or polymeric form (F-actin. Members of the actin-depolymerizing factor (ADF/cofilin protein family bind to both G-actin and F-actin and play vital roles in actin dynamics by manipulating the rates of filament polymerization and depolymerization. It has been reported that the S6D and R98A/K100A mutants of actin-depolymerizing factor 1 (ADF1 in Arabidopsis thaliana decreased the binding affinity of ADF for the actin monomer. To investigate the binding mechanism and dynamic behavior of the ADF1-actin complex, we constructed a homology model of the AtADF1-actin complex based on the crystal structure of AtADF1 and the twinfilin C-terminal ADF-H domain in a complex with a mouse actin monomer. The model was then refined for subsequent molecular dynamics simulations. Increased binding energy of the mutated system was observed using the Molecular Mechanics Generalized Born Surface Area and Poisson-Boltzmann Surface Area (MM-GB/PBSA methods. To determine the residues that make decisive contributions to the ADF1 actin-binding affinity, per-residue decomposition and computational alanine scanning analyses were performed, which provided more detailed information on the binding mechanism. Root-mean-square fluctuation and principal component analyses confirmed that the S6D and R98A/K100A mutants induced an increased conformational flexibility. The comprehensive molecular insight gained from this study is of great importance for understanding the binding mechanism of ADF1 and G-actin.
Identification and functional analysis of a second RBF-2 binding site within the HIV-1 promoter
International Nuclear Information System (INIS)
Dahabieh, Matthew S.; Ooms, Marcel; Malcolm, Tom; Simon, Viviana; Sadowski, Ivan
2011-01-01
Transcription from the HIV-1 long terminal repeat (LTR) is mediated by numerous host transcription factors. In this study we characterized an E-box motif (RBE1) within the core promoter that was previously implicated in both transcriptional activation and repression. We show that RBE1 is a binding site for the RBF-2 transcription factor complex (USF1, USF2, and TFII-I), previously shown to bind an upstream viral element, RBE3. The RBE1 and RBE3 elements formed complexes of identical mobility and protein constituents in gel shift assays, both with Jurkat T-cell nuclear extracts and recombinant USF/TFII-I. Furthermore, both elements are regulators of HIV-1 expression; mutations in LTR-luciferase reporters and in HIV-1 molecular clones resulted in decreased transcription, virion production, and proviral expression in infected cells. Collectively, our data indicate that RBE1 is a bona fide RBF-2 binding site and that the RBE1 and RBE3 elements are necessary for mediating proper transcription from the HIV-1 LTR.
DEFF Research Database (Denmark)
Kolsum, Umme; Roy, Kay; Starkey, Cerys
2009-01-01
BACKGROUND: Many of the systemic manifestations of chronic obstructive pulmonary disease (COPD) are mediated through increased systemic levels of inflammatory proteins. We assessed the long term repeatability of interleukin-6 (IL-6), tumor necrosis factor-alpha (TNF-alpha), and C-reactive protein......(i)) and the Bland-Altman method. Pearson correlations were used to determine the relationships between the systemic markers at both visits. RESULTS: There was moderate repeatability with a very high degree of statistical significance (p...... (CRP) over one year and examined the relationships between these systemic markers in COPD. METHODS: Fifty-eight stable COPD patients completed a baseline and one-year visit. Serum IL-6, plasma CRP, and plasma TNF-alpha were measured. Repeatability was expressed by intraclass correlation coefficient (R...
DEFF Research Database (Denmark)
Kolsum, Umme; Roy, Kay; Starkey, Cerys
2009-01-01
BACKGROUND: Many of the systemic manifestations of chronic obstructive pulmonary disease (COPD) are mediated through increased systemic levels of inflammatory proteins. We assessed the long term repeatability of Interleukin-6 (IL-6), tumor necrosis factor-alpha (TNF-alpha), and C-reactive protein......(i)) and the Bland-Altman method. Pearson correlations were used to determine the relationships between the systemic markers at both visits. RESULTS: There was moderate repeatability with a very high degree of statistical significance (p...... (CRP) over one year and examined the relationships between these systemic markers in COPD. METHODS: Fifty-eight stable COPD patients completed a baseline and one-year visit. Serum IL-6, plasma CRP, and plasma TNF-alpha were measured. Repeatability was expressed by intraclass correlation coefficient (R...
Dynamic factors affecting gaseous ligand binding in an artificial oxygen transport protein.
Zhang, Lei; Andersen, Eskil M E; Khajo, Abdelahad; Magliozzo, Richard S; Koder, Ronald L
2013-01-22
We report the functional analysis of an artificial hexacoordinate oxygen transport protein, HP7, which operates via a mechanism similar to that of human neuroglobin and cytoglobin: the destabilization of one of two heme-ligating histidine residues. In the case of HP7, this is the result of the coupling of histidine side chain ligation with the burial of three charged glutamate residues on the same helix. Here we compare gaseous ligand binding, including rates, affinities, and oxyferrous state lifetimes, of both heme binding sites in HP7. We find that despite the identical sequence of helices in both binding sites, there are differences in oxygen affinity and oxyferrous state lifetime that may be the result of differences in the freedom of motion imposed by the candelabra fold on the two sites of the protein. We further examine the effect of mutational removal of the buried glutamates on function. Heme iron in the ferrous state of this mutant is rapidly oxidized when exposed to oxygen. Compared to that of HP7, the distal histidine affinity is increased by a 22-fold decrease in the histidine ligand off rate. Electron paramagnetic resonance comparison of these ferric hemoproteins demonstrates that the mutation increases the level of disorder at the heme binding site. Nuclear magnetic resonance-detected deuterium exchange demonstrates that the mutation greatly increases the degree of penetration of water into the protein core. The inability of the mutant protein to bind oxygen may be due to an increased level of water penetration, the large decrease in binding rate caused by the increase in distal histidine affinity, or a combination of the two factors. Together, these data underline the importance of the control of protein dynamics in the design of functional artificial proteins.
Europium-labeled epidermal growth factor and neurotensin: novel probes for receptor-binding studies.
Mazor, Ohad; Hillairet de Boisferon, Marc; Lombet, Alain; Gruaz-Guyon, Anne; Gayer, Batya; Skrzydelsky, Delphine; Kohen, Fortune; Forgez, Patricia; Scherz, Avigdor; Rostene, William; Salomon, Yoram
2002-02-01
We investigated the possibility of labeling two biologically active peptides, epidermal growth factor (EGF) and neurotensin (NT), with europium (Eu)-diethylenetriaminepentaacetic acid. More specifically, we tested them as probes in studying receptor binding using time-resolved fluorescence of Eu3+. The relatively simple synthesis yields ligands with acceptable binding characteristics similar to isotopically labeled derivatives. The binding affinity (Kd) of labeled Eu-EGF to human A431 epidermal carcinoid cells was 3.6 +/- 1.2 nM, similar to the reported Kd values of EGF, whereas the Kd of Eu-NT to human HT29 colon cancer cells (7.4 +/- 0.5 nM) or to Chinese hamster ovary (CHO) cells transfected with the high-affinity NT receptor (CHO-NT1) were about 10-fold higher than the Kd values of NT. The bioactivity of the Eu-labeled EGF as determined by stimulation of cultured murine D1 hematopoietic cell proliferation was nearly the same as that obtained with native EGF. The maximal stimulation of Ca2+ influx with NT and Eu-NT in CHO-NT1 cells was similar, but the respective K0.5 values were 20 pM and 1 nM, corresponding to differences in the binding affinities previously described. The results of these studies indicate that Eu labeling of peptide hormones and growth factor molecules ranging from 10(3) to 10(5) Da can be conveniently accomplished. Importantly, the Eu-labeled products are stable for approximately 2 years and are completely safe for laboratory use compared to the biohazardous radioligands. Thus, Eu-labeled peptides present an attractive alternative for commonly used radiolabeled ligands in biological studies in general and in receptor assays in particular.
Directory of Open Access Journals (Sweden)
Corbo Laura
2001-11-01
Full Text Available Abstract Background The yeast yCCR4 factor belongs to the CCR4-NOT transcriptional regulatory complex, in which it interacts, through its leucine-rich repeat (LRR motif with yPOP2. Recently, yCCR4 was shown to be a component of the major cytoplasmic mRNA deadenylase complex, and to contain a fold related to the Mg2+-dependent endonuclease core. Results Here, we report the identification of nineteen yCCR4-related proteins in eukaryotes (including yeast, plants and animals, which all contain the yCCR4 endonuclease-like fold, with highly conserved CCR4-specific residues. Phylogenetic and genomic analyses show that they form four distinct families, one of which contains the yCCR4 orthologs. The orthologs in animals possess a leucine-rich repeat domain. We show, using two-hybrid and far-Western assays, that the human member binds to the human yPOP2 homologs, i.e. hCAF1 and hPOP2, in a LRR-dependent manner. Conclusions We have identified the mammalian orthologs of yCCR4 and have shown that the human member binds to the human yPOP2 homologs, thus strongly suggesting conservation of the CCR4-NOT complex from yeast to human. All members of the four identified yCCR4-related protein families show stricking conservation of the endonuclease-like catalytic motifs of the yCCR4 C-terminal domain and therefore constitute a new family of potential deadenylases in mammals.
Hermes, Fatemah A; Cronan, John E
2013-10-01
The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.
Energy Technology Data Exchange (ETDEWEB)
MacArthur, Stewart; Li, Xiao-Yong; Li, Jingyi; Brown, James B.; Chu, Hou Cheng; Zeng, Lucy; Grondona, Brandi P.; Hechmer, Aaron; Simirenko, Lisa; Keranen, Soile V.E.; Knowles, David W.; Stapleton, Mark; Bickel, Peter; Biggin, Mark D.; Eisen, Michael B.
2009-05-15
BACKGROUND: We previously established that six sequence-specific transcription factors that initiate anterior/posterior patterning in Drosophila bind to overlapping sets of thousands of genomic regions in blastoderm embryos. While regions bound at high levels include known and probable functional targets, more poorly bound regions are preferentially associated with housekeeping genes and/or genes not transcribed in the blastoderm, and are frequently found in protein coding sequences or in less conserved non-coding DNA, suggesting that many are likely non-functional. RESULTS: Here we show that an additional 15 transcription factors that regulate other aspects of embryo patterning show a similar quantitative continuum of function and binding to thousands of genomic regions in vivo. Collectively, the 21 regulators show a surprisingly high overlap in the regions they bind given that they belong to 11 DNA binding domain families, specify distinct developmental fates, and can act via different cis-regulatory modules. We demonstrate, however, that quantitative differences in relative levels of binding to shared targets correlate with the known biological and transcriptional regulatory specificities of these factors. CONCLUSIONS: It is likely that the overlap in binding of biochemically and functionally unrelated transcription factors arises from the high concentrations of these proteins in nuclei, which, coupled with their broad DNA binding specificities, directs them to regions of open chromatin. We suggest that most animal transcription factors will be found to show a similar broad overlapping pattern of binding in vivo, with specificity achieved by modulating the amount, rather than the identity, of bound factor.
Crystal structure and DNA binding of the homeodomain of the stem cell transcription factor Nanog.
Jauch, Ralf; Ng, Calista Keow Leng; Saikatendu, Kumar Singh; Stevens, Raymond C; Kolatkar, Prasanna R
2008-02-22
The transcription factor Nanog is an upstream regulator in early mammalian development and a key determinant of pluripotency in embryonic stem cells. Nanog binds to promoter elements of hundreds of target genes and regulates their expression by an as yet unknown mechanism. Here, we report the crystal structure of the murine Nanog homeodomain (HD) and analysis of its interaction with a DNA element derived from the Tcf3 promoter. Two Nanog amino acid pairs, unique among HD sequences, appear to affect the mechanism of nonspecific DNA recognition as well as maintain the integrity of the structural scaffold. To assess selective DNA recognition by Nanog, we performed electrophoretic mobility shift assays using a panel of modified DNA binding sites and found that Nanog HD preferentially binds the TAAT(G/T)(G/T) motif. A series of rational mutagenesis experiments probing the role of six variant residues of Nanog on its DNA binding function establish their role in affecting binding affinity but not binding specificity. Together, the structural and functional evidence establish Nanog as a distant member of a Q50-type HD despite having considerable variation at the sequence level.
Crystal Structure and DNA Binding of the Homeodomain of the Stem Cell Transcription Factor Nanog
Energy Technology Data Exchange (ETDEWEB)
Jauch, Ralf; Ng, Calista Keow Leng; Saikatendu, Kumar Singh; Stevens, Raymond C.; Kolatkar, Prasanna R. (GI-Singapore); (Scripps)
2010-02-08
The transcription factor Nanog is an upstream regulator in early mammalian development and a key determinant of pluripotency in embryonic stem cells. Nanog binds to promoter elements of hundreds of target genes and regulates their expression by an as yet unknown mechanism. Here, we report the crystal structure of the murine Nanog homeodomain (HD) and analysis of its interaction with a DNA element derived from the Tcf3 promoter. Two Nanog amino acid pairs, unique among HD sequences, appear to affect the mechanism of nonspecific DNA recognition as well as maintain the integrity of the structural scaffold. To assess selective DNA recognition by Nanog, we performed electrophoretic mobility shift assays using a panel of modified DNA binding sites and found that Nanog HD preferentially binds the TAAT(G/T)(G/T) motif. A series of rational mutagenesis experiments probing the role of six variant residues of Nanog on its DNA binding function establish their role in affecting binding affinity but not binding specificity. Together, the structural and functional evidence establish Nanog as a distant member of a Q50-type HD despite having considerable variation at the sequence level.
Directory of Open Access Journals (Sweden)
Tony Håndstad
Full Text Available BACKGROUND: Transcription factors are important controllers of gene expression and mapping transcription factor binding sites (TFBS is key to inferring transcription factor regulatory networks. Several methods for predicting TFBS exist, but there are no standard genome-wide datasets on which to assess the performance of these prediction methods. Also, it is believed that information about sequence conservation across different genomes can generally improve accuracy of motif-based predictors, but it is not clear under what circumstances use of conservation is most beneficial. RESULTS: Here we use published ChIP-seq data and an improved peak detection method to create comprehensive benchmark datasets for prediction methods which use known descriptors or binding motifs to detect TFBS in genomic sequences. We use this benchmark to assess the performance of five different prediction methods and find that the methods that use information about sequence conservation generally perform better than simpler motif-scanning methods. The difference is greater on high-affinity peaks and when using short and information-poor motifs. However, if the motifs are specific and information-rich, we find that simple motif-scanning methods can perform better than conservation-based methods. CONCLUSIONS: Our benchmark provides a comprehensive test that can be used to rank the relative performance of transcription factor binding site prediction methods. Moreover, our results show that, contrary to previous reports, sequence conservation is better suited for predicting strong than weak transcription factor binding sites.
A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue
Spassieva, S; Hille, J
Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed
Directory of Open Access Journals (Sweden)
Nadya V. Ilicheva
2018-03-01
Full Text Available Background: TRF2 (telomeric repeat binding factor 2 is an essential component of the telomere-binding protein complex shelterin. TRF2 induces the formation of a special structure of telomeric DNA and counteracts activation of DNA damage-response pathways telomeres. TRF2 has a poorly characterized linker region (udTRF2 between its homodimerization and DNA-binding domains. Some lines of evidence have shown that this region could be involved in TRF2 interaction with nuclear lamina. Results: In this study, the fragment of the TERF2 gene encoding udTRF2 domain of telomere-binding protein TRF2 was produced by PCR and cloned into the pET32a vector. The resulting plasmid pET32a-udTRF2 was used for the expression of the recombinant udTRF2 in E. coli RosettaBlue (DE3. The protein was isolated and purified using ammonium sulfate precipitation followed by ion-exchange chromatography. The purified recombinant protein udTRF2 was injected into guinea pigs to generate polyclonal antibodies. The ability of anti-udTRF2 antibodies to bind endogenous TRF2 in human skin fibroblasts was tested by western blotting and immunofluorescent staining. Conclusions: In this study, the recombinant protein udTRF2 and antibodies to it were generated. Both protein and antibodies will provide a useful tool for investigation of the functions of the udTRF2 domain and its role in the interaction between TRF2 and nuclear lamina. Keywords: Chromosomes, Molecular cloning, Nuclear lamina, Nucleoprotein complexes, Polyclonal antibodies, Recombinant polypeptide, Shelterin, Telomere-binding protein TRF2, Telomeres, Telomeric DNA, TTAGGG repeats
HOCOMOCO: a comprehensive collection of human transcription factor binding sites models
Kulakovskiy, Ivan V.; Medvedeva, Yulia A.; Schaefer, Ulf; Kasianov, Artem S.; Vorontsov, Ilya E.; Bajic, Vladimir B.; Makeev, Vsevolod J.
2013-01-01
Transcription factor (TF) binding site (TFBS) models are crucial for computational reconstruction of transcription regulatory networks. In existing repositories, a TF often has several models (also called binding profiles or motifs), obtained from different experimental data. Having a single TFBS model for a TF is more pragmatic for practical applications. We show that integration of TFBS data from various types of experiments into a single model typically results in the improved model quality probably due to partial correction of source specific technique bias. We present the Homo sapiens comprehensive model collection (HOCOMOCO, http://autosome.ru/HOCOMOCO/, http://cbrc.kaust.edu.sa/hocomoco/) containing carefully hand-curated TFBS models constructed by integration of binding sequences obtained by both low- and high-throughput methods. To construct position weight matrices to represent these TFBS models, we used ChIPMunk software in four computational modes, including newly developed periodic positional prior mode associated with DNA helix pitch. We selected only one TFBS model per TF, unless there was a clear experimental evidence for two rather distinct TFBS models. We assigned a quality rating to each model. HOCOMOCO contains 426 systematically curated TFBS models for 401 human TFs, where 172 models are based on more than one data source. PMID:23175603
HOCOMOCO: A comprehensive collection of human transcription factor binding sites models
Kulakovskiy, Ivan V.; Medvedeva, Yulia A.; Schaefer, Ulf; Kasianov, Artem S.; Vorontsov, Ilya E.; Bajic, Vladimir B.; Makeev, Vsevolod J.
2012-01-01
Transcription factor (TF) binding site (TFBS) models are crucial for computational reconstruction of transcription regulatory networks. In existing repositories, a TF often has several models (also called binding profiles or motifs), obtained from different experimental data. Having a single TFBS model for a TF is more pragmatic for practical applications. We show that integration of TFBS data from various types of experiments into a single model typically results in the improved model quality probably due to partial correction of source specific technique bias. We present the Homo sapiens comprehensive model collection (HOCOMOCO, http://autosome.ru/HOCOMOCO/, http://cbrc.kaust.edu.sa/ hocomoco/) containing carefully hand-curated TFBS models constructed by integration of binding sequences obtained by both low- and high-throughput methods. To construct position weight matrices to represent these TFBS models, we used ChIPMunk software in four computational modes, including newly developed periodic positional prior mode associated with DNA helix pitch. We selected only one TFBS model per TF, unless there was a clear experimental evidence for two rather distinct TFBS models. We assigned a quality rating to each model. HOCOMOCO contains 426 systematically curated TFBS models for 401 human TFs, where 172 models are based on more than one data source. The Author(s) 2012.
HOCOMOCO: A comprehensive collection of human transcription factor binding sites models
Kulakovskiy, Ivan V.
2012-11-21
Transcription factor (TF) binding site (TFBS) models are crucial for computational reconstruction of transcription regulatory networks. In existing repositories, a TF often has several models (also called binding profiles or motifs), obtained from different experimental data. Having a single TFBS model for a TF is more pragmatic for practical applications. We show that integration of TFBS data from various types of experiments into a single model typically results in the improved model quality probably due to partial correction of source specific technique bias. We present the Homo sapiens comprehensive model collection (HOCOMOCO, http://autosome.ru/HOCOMOCO/, http://cbrc.kaust.edu.sa/ hocomoco/) containing carefully hand-curated TFBS models constructed by integration of binding sequences obtained by both low- and high-throughput methods. To construct position weight matrices to represent these TFBS models, we used ChIPMunk software in four computational modes, including newly developed periodic positional prior mode associated with DNA helix pitch. We selected only one TFBS model per TF, unless there was a clear experimental evidence for two rather distinct TFBS models. We assigned a quality rating to each model. HOCOMOCO contains 426 systematically curated TFBS models for 401 human TFs, where 172 models are based on more than one data source. The Author(s) 2012.
International Nuclear Information System (INIS)
Cui Wei; Yin Lingling; Dong Lingyue
2012-01-01
Objective: To clarify the mechanism of immediate early response gene 5 (Ier5) transcription induced by radiation. Methods: Deletant construction, site-specific mutagenesis,electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) were used to forecast the promoter region, binding sites and transcription factors of Ier5 gene in HeLa cells. Results: The promoter region of Ier5 gene might be in the region of Ier5 -8 deletant (-408 - -238 bp). The Ier5 gene had two transcription factors of GCF and NFI, and GCF had two binding sites located in the region of -388 - -382 bp and -274 - -270 bp of Ier5 promoter. The binding site of NFI was located in -362 - -357 bp of Ier5 promoter. GCF could inhibit the expression of Ier5 gene and this inhibition was diminished when the radiation dose increased. In contrast, NFI increased the expression of Ier5. Conclusions: The most possible region of Ier5 promoter is from -408 to -238 bp which has two binding sites for the radiosensitivity transcription factors of GCF and NFI that could negatively and positively regulate the expression of Ier5 respectively. (authors)
Trigger Factor and DnaK possess overlapping substrate pools and binding specificities.
Deuerling, Elke; Patzelt, Holger; Vorderwülbecke, Sonja; Rauch, Thomas; Kramer, Günter; Schaffitzel, Elke; Mogk, Axel; Schulze-Specking, Agnes; Langen, Hanno; Bukau, Bernd
2003-03-01
Ribosome-associated Trigger Factor (TF) and the DnaK chaperone system assist the folding of newly synthesized proteins in Escherichia coli. Here, we show that DnaK and TF share a common substrate pool in vivo. In TF-deficient cells, deltatig, depleted for DnaK and DnaJ the amount of aggregated proteins increases with increasing temperature, amounting to 10% of total soluble protein (approximately 340 protein species) at 37 degrees C. A similar population of proteins aggregated in DnaK depleted tig+ cells, albeit to a much lower extent. Ninety-four aggregated proteins isolated from DnaK- and DnaJ-depleted deltatig cells were identified by mass spectrometry and found to include essential cytosolic proteins. Four potential in vivo substrates were screened for chaperone binding sites using peptide libraries. Although TF and DnaK recognize different binding motifs, 77% of TF binding peptides also associated with DnaK. In the case of the nascent polypeptides TF and DnaK competed for binding, however, with competitive advantage for TF. In vivo, the loss of TF is compensated by the induction of the heat shock response and thus enhanced levels of DnaK. In summary, our results demonstrate that the co-operation of the two mechanistically distinct chaperones in protein folding is based on their overlap in substrate specificities.
Tumor necrosis factor: specific binding and internalization in sensitive and resistant cells
International Nuclear Information System (INIS)
Tsujimoto, M.; Yip, Y.K.; Vilcek, J.
1985-01-01
Highly purified, Escherichia coli-derived recombinant human tumor necrosis factor (TNF) was labeled with 125 I and employed to determine receptor binding, internalization, and intracellular degradation in murine L929 cells (highly sensitive to the cytotoxic action of TNF) and in diploid human FS-4 cells (resistant to TNF cytotoxicity). 125 I-labeled TNF bound specifically to high-affinity receptors on both L929 and FS-4 cells. Scatchard analysis of the binding data indicated the presence of 2200 binding sites per L929 cell and 7500 binding sites per FS-4 cell. The calculated dissociation constants are 6.1 x 10 -10 M and 3.2 x 10 -10 M for L929 and FS-4 cells, respectively. In both L929 and FS-4 cells, incubation at 37 0 C resulted in a rapid internalization of the bulk of the cell-bound TNF, followed by the appearance of trichloroacetic acid-soluble 125 I radioactivity in the tissue culture medium, due to degradation of TNF. Degradation but not cellular uptake of TNF was inhibited in the presence of chloroquine (an inhibitor of lysosomal proteases) in both L929 and FS-4 cells, suggesting that degradation occurs intracellularly, probably within lysosomes. These results show that resistance of FS-4 cells to TNF cytotoxicity is not due to a lack of receptors or their inability to internalize and degrade TNF
Gorton, Davina; Norton, Robert; Layton, Ramon; Smith, Helen; Ketheesan, Natkunam
2005-03-01
The fibronectin-binding proteins (FnBPs) PrtF1 and PrtF2 are considered to be major group A streptococcal virulence factors, mediating adherence to and internalisation of host cells. The present study investigated an association between the presence of prtF1 and prtF2 genes and internalisation efficiency in group A streptococci (GAS) isolated from patients with invasive disease. Of the 80 isolates tested, 58 (73%) had prtF1 and 71 (89%) possessed prtF2. Three isolates (4%) had neither gene, seven (9%) had prtF1 only, 19 (24%) had prtF2 only and 51 isolates (64%) had both prtF1 and prtF2. prtF2-positive isolates internalised up to three times more efficiently than isolates that had prtF1 alone (Pinternalisation efficiency and presence of the prtF1 gene. Analysis of the fibronectin-binding repeat domain (FBRD) of prtF2 revealed that this gene can contain 2, 3, 4 or 5 repeat regions and that five repeat regions conferred very high internalisation efficiency in invasive GAS isolates.
Fatty-acid binding proteins modulate sleep and enhance long-term memory consolidation in Drosophila.
Directory of Open Access Journals (Sweden)
Jason R Gerstner
2011-01-01
Full Text Available Sleep is thought to be important for memory consolidation, since sleep deprivation has been shown to interfere with memory processing. However, the effects of augmenting sleep on memory formation are not well known, and testing the role of sleep in memory enhancement has been limited to pharmacological and behavioral approaches. Here we test the effect of overexpressing the brain-type fatty acid binding protein (Fabp7 on sleep and long-term memory (LTM formation in Drosophila melanogaster. Transgenic flies carrying the murine Fabp7 or the Drosophila homologue dFabp had reduced baseline sleep but normal LTM, while Fabp induction produced increases in both net sleep and LTM. We also define a post-training consolidation "window" that is sufficient for the observed Fabp-mediated memory enhancement. Since Fabp overexpression increases consolidated daytime sleep bouts, these data support a role for longer naps in improving memory and provide a novel role for lipid-binding proteins in regulating memory consolidation concurrently with changes in behavioral state.
Brand, Luise H.; Fischer, Nina M.; Harter, Klaus; Kohlbacher, Oliver; Wanke, Dierk
2013-01-01
WRKY transcription factors constitute a large protein family in plants that is involved in the regulation of developmental processes and responses to biotic or abiotic stimuli. The question arises how stimulus-specific responses are mediated given that the highly conserved WRKY DNA-binding domain (DBD) exclusively recognizes the ‘TTGACY’ W-box consensus. We speculated that the W-box consensus might be more degenerate and yet undetected differences in the W-box consensus of WRKYs of different evolutionary descent exist. The phylogenetic analysis of WRKY DBDs suggests that they evolved from an ancestral group IIc-like WRKY early in the eukaryote lineage. A direct descent of group IIc WRKYs supports a monophyletic origin of all other group II and III WRKYs from group I by loss of an N-terminal DBD. Group I WRKYs are of paraphyletic descent and evolved multiple times independently. By homology modeling, molecular dynamics simulations and in vitro DNA–protein interaction-enzyme-linked immunosorbent assay with AtWRKY50 (IIc), AtWRKY33 (I) and AtWRKY11 (IId) DBDs, we revealed differences in DNA-binding specificities. Our data imply that other components are essentially required besides the W-box-specific binding to DNA to facilitate a stimulus-specific WRKY function. PMID:23975197
Safety of Repeated Yttrium-90 Radioembolization
International Nuclear Information System (INIS)
Lam, Marnix G. E. H.; Louie, John D.; Iagaru, Andrei H.; Goris, Michael L.; Sze, Daniel Y.
2013-01-01
Purpose: Repeated radioembolization (RE) treatments carry theoretically higher risk of radiation-induced hepatic injury because of the liver’s cumulative memory of previous exposure. We performed a retrospective safety analysis on patients who underwent repeated RE. Methods: From 2004 to 2011, a total of 247 patients were treated by RE. Eight patients (5 men, 3 women, age range 51–71 years) underwent repeated treatment of a targeted territory, all with resin microspheres (SIR-Spheres; Sirtex, Lane Cove, Australia). Adverse events were graded during a standardized follow-up. In addition, the correlation between the occurrence of RE-induced liver disease (REILD) and multiple variables was investigated in univariate and multivariate analyses in all 247 patients who received RE. Results: Two patients died shortly after the second treatment (at 84 and 107 days) with signs and symptoms of REILD. Both patients underwent whole liver treatment twice (cumulative doses 3.08 and 2.66 GBq). The other 6 patients demonstrated only minor toxicities after receiving cumulative doses ranging from 2.41 to 3.88 GBq. All patients experienced objective tumor responses. In the whole population, multifactorial analysis identified three risk factors associated with REILD: repeated RE (p = 0.036), baseline serum total bilirubin (p = 0.048), and baseline serum aspartate aminotransferase (p = 0.043). Repeated RE proved to be the only independent risk factor for REILD in multivariate analysis (odds ratio 9.6; p = 0.002). Additionally, the administered activity per target volume (in GBq/L) was found to be an independent risk factor for REILD, but only in whole liver treatments (p = 0.033). Conclusion: The risk of REILD appears to be elevated for repeated RE. Objective tumor responses were observed, but establishment of safety limits will require improvement in dosimetric measurement and prediction
Safety of Repeated Yttrium-90 Radioembolization
Energy Technology Data Exchange (ETDEWEB)
Lam, Marnix G. E. H.; Louie, John D. [Stanford University School of Medicine, Division of Interventional Radiology (United States); Iagaru, Andrei H.; Goris, Michael L. [Stanford University School of Medicine, Division of Nuclear Medicine (United States); Sze, Daniel Y., E-mail: dansze@stanford.edu [Stanford University School of Medicine, Division of Interventional Radiology (United States)
2013-10-15
Purpose: Repeated radioembolization (RE) treatments carry theoretically higher risk of radiation-induced hepatic injury because of the liver's cumulative memory of previous exposure. We performed a retrospective safety analysis on patients who underwent repeated RE. Methods: From 2004 to 2011, a total of 247 patients were treated by RE. Eight patients (5 men, 3 women, age range 51-71 years) underwent repeated treatment of a targeted territory, all with resin microspheres (SIR-Spheres; Sirtex, Lane Cove, Australia). Adverse events were graded during a standardized follow-up. In addition, the correlation between the occurrence of RE-induced liver disease (REILD) and multiple variables was investigated in univariate and multivariate analyses in all 247 patients who received RE. Results: Two patients died shortly after the second treatment (at 84 and 107 days) with signs and symptoms of REILD. Both patients underwent whole liver treatment twice (cumulative doses 3.08 and 2.66 GBq). The other 6 patients demonstrated only minor toxicities after receiving cumulative doses ranging from 2.41 to 3.88 GBq. All patients experienced objective tumor responses. In the whole population, multifactorial analysis identified three risk factors associated with REILD: repeated RE (p = 0.036), baseline serum total bilirubin (p = 0.048), and baseline serum aspartate aminotransferase (p = 0.043). Repeated RE proved to be the only independent risk factor for REILD in multivariate analysis (odds ratio 9.6; p = 0.002). Additionally, the administered activity per target volume (in GBq/L) was found to be an independent risk factor for REILD, but only in whole liver treatments (p = 0.033). Conclusion: The risk of REILD appears to be elevated for repeated RE. Objective tumor responses were observed, but establishment of safety limits will require improvement in dosimetric measurement and prediction.
International Nuclear Information System (INIS)
Caesar, Joseph J. E.; Wallich, Reinhard; Kraiczy, Peter; Zipfel, Peter F.; Lea, Susan M.
2013-01-01
B. burgdorferi binds complement factor H using a dimeric surface protein, CspA (BbCRASP-1). Presented here is a new structure of CspA that suggests that there is a degree of flexibility between subunits which may have implications for complement regulator binding. Borrelia burgdorferi has evolved many mechanisms of evading the different immune systems across its range of reservoir hosts, including the capture and presentation of host complement regulators factor H and factor H-like protein-1 (FHL-1). Acquisition is mediated by a family of complement regulator-acquiring surface proteins (CRASPs), of which the atomic structure of CspA (BbCRASP-1) is known and shows the formation of a homodimeric species which is required for binding. Mutagenesis studies have mapped a putative factor H binding site to a cleft between the two subunits. Presented here is a new atomic structure of CspA which shows a degree of flexibility between the subunits which may be critical for factor H scavenging by increasing access to the binding interface and allows the possibility that the assembly can clamp around the bound complement regulators
pH modulates the binding of early growth response protein 1 transcription factor to DNA.
Mikles, David C; Bhat, Vikas; Schuchardt, Brett J; Deegan, Brian J; Seldeen, Kenneth L; McDonald, Caleb B; Farooq, Amjad
2013-08-01
The transcription factor early growth response protein (EGR)1 orchestrates a plethora of signaling cascades involved in cellular homeostasis, and its downregulation has been implicated in the development of prostate cancer. Herein, using a battery of biophysical tools, we show that the binding of EGR1 to DNA is tightly regulated by solution pH. Importantly, the binding affinity undergoes an enhancement of more than an order of magnitude with an increase in pH from 5 to 8, implying that the deprotonation of an ionizable residue accounts for such behavior. This ionizable residue is identified as His382 by virtue of the fact that its replacement by nonionizable residues abolishes the pH dependence of the binding of EGR1 to DNA. Notably, His382 inserts into the major groove of DNA, and stabilizes the EGR1-DNA interaction via both hydrogen bonding and van der Waals contacts. Remarkably, His382 is mainly conserved across other members of the EGR family, implying that histidine protonation-deprotonation may serve as a molecular switch for modulating the protein-DNA interactions that are central to this family of transcription factors. Collectively, our findings reveal an unexpected but a key step in the molecular recognition of the EGR family of transcription factors, and suggest that they may act as sensors of pH within the intracellular environment. © 2013 FEBS.
Iron-binding haemerythrin RING ubiquitin ligases regulate plant iron responses and accumulation
Kobayashi, Takanori; Nagasaka, Seiji; Senoura, Takeshi; Itai, Reiko Nakanishi; Nakanishi, Hiromi; Nishizawa, Naoko K.
2013-01-01
Iron is essential for most living organisms. Plants transcriptionally induce genes involved in iron acquisition under conditions of low iron availability, but the nature of the deficiency signal and its sensors are unknown. Here we report the identification of new iron regulators in rice, designated Oryza sativa Haemerythrin motif-containing Really Interesting New Gene (RING)- and Zinc-finger protein 1 (OsHRZ1) and OsHRZ2. OsHRZ1, OsHRZ2 and their Arabidopsis homologue BRUTUS bind iron and zinc, and possess ubiquitination activity. OsHRZ1 and OsHRZ2 are susceptible to degradation in roots irrespective of iron conditions. OsHRZ-knockdown plants exhibit substantial tolerance to iron deficiency, and accumulate more iron in their shoots and grains irrespective of soil iron conditions. The expression of iron deficiency-inducible genes involved in iron utilization is enhanced in OsHRZ-knockdown plants, mostly under iron-sufficient conditions. These results suggest that OsHRZ1 and OsHRZ2 are iron-binding sensors that negatively regulate iron acquisition under conditions of iron sufficiency. PMID:24253678
Energy Technology Data Exchange (ETDEWEB)
Schmidt, R.R.; Betz, H.; Rehm, H.
1988-02-09
The presynaptically active snake venom neurotoxin ..beta..-bungarotoxin (..beta..-Butx) is known to affect neurotransmitter release by binding to a subtype of voltage-activated K/sup +/ channels. Here the authors show that mast cell degranulating (MCD) peptide from bee venom inhibits the binding of /sup 125/I-labeled ..beta..-Butx to chick and rat brain membranes with apparent K/sub i/ values of 180 nM and 1100 nM, respectively. The mechanisms of inhibition of MCD peptide is noncompetitive, as is inhibition of /sup 125/I-..beta..-Butx binding by the protease inhibitor homologue from mamba venom, toxin I. ..beta..-Butx and its binding antagonists thus bind to different sites of the same membrane protein. Removal of Ca/sup 2 +/ by ethylene glycol bis(..beta..-aminoethyl ether)-N,N,N',N'-tetraacetic acid inhibits the binding of /sup 125/I-..beta..-Butx by lowering its affinity to brain membranes.
International Nuclear Information System (INIS)
Vetting, Matthew W.; Hegde, Subray S.; Zhang, Yong; Blanchard, John S.
2011-01-01
The pentapeptide repeat protein AlbG, provides self-resistance to the nonribosomally encoded hybrid polyketide-peptide termed albicidin. Analysis of the AlbG three-dimensional structure and the sequences of other pentapeptide repeat proteins that confer resistance to topiosomerase poisons suggests they have a similar dimer interface which may be critical to their interaction with topoisomerases. The protein AlbG is a self-resistance factor against albicidin, a nonribosomally encoded hybrid polyketide-peptide with antibiotic and phytotoxic properties produced by Xanthomonas albilineans. Primary-sequence analysis indicates that AlbG is a member of the pentapeptide-repeat family of proteins (PRP). The structure of AlbG from X. albilineans was determined at 2.0 Å resolution by SAD phasing using data collected from a single trimethyllead acetate derivative on a home source. AlbG folds into a right-handed quadrilateral β-helix composed of approximately eight semi-regular coils. The regularity of the β-helix is blemished by a large loop/deviation in the β-helix between coils 4 and 5. The C-terminus of the β-helix is capped by a dimerization module, yielding a dimer with a 110 Å semi-collinear β-helical axis. This method of dimer formation appears to be common to all PRP proteins that confer resistance to topoisomerase poisons and contrasts with most PRP proteins, which are typically monomeric
Natively Unfolded FG Repeats Stabilize the Structure of the Nuclear Pore Complex.
Onischenko, Evgeny; Tang, Jeffrey H; Andersen, Kasper R; Knockenhauer, Kevin E; Vallotton, Pascal; Derrer, Carina P; Kralt, Annemarie; Mugler, Christopher F; Chan, Leon Y; Schwartz, Thomas U; Weis, Karsten
2017-11-02
Nuclear pore complexes (NPCs) are ∼100 MDa transport channels assembled from multiple copies of ∼30 nucleoporins (Nups). One-third of these Nups contain phenylalanine-glycine (FG)-rich repeats, forming a diffusion barrier, which is selectively permeable for nuclear transport receptors that interact with these repeats. Here, we identify an additional function of FG repeats in the structure and biogenesis of the yeast NPC. We demonstrate that GLFG-containing FG repeats directly bind to multiple scaffold Nups in vitro and act as NPC-targeting determinants in vivo. Furthermore, we show that the GLFG repeats of Nup116 function in a redundant manner with Nup188, a nonessential scaffold Nup, to stabilize critical interactions within the NPC scaffold needed for late steps of NPC assembly. Our results reveal a previously unanticipated structural role for natively unfolded GLFG repeats as Velcro to link NPC subcomplexes and thus add a new layer of connections to current models of the NPC architecture. Copyright © 2017 Elsevier Inc. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Coufal, Jan; Jagelská, Eva; Liao, J.C.C.; Brázda, Václav
2013-01-01
Roč. 441, č. 1 (2013), s. 83-85 ISSN 0006-291X R&D Projects: GA ČR(CZ) GAP301/11/2076; GA ČR(CZ) GBP206/12/G151 Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : DNA-BINDING * SUPERCOILED DNA * EXPRESSION Subject RIV: BO - Biophysics Impact factor: 2.281, year: 2013
Doyle, Michael L; Tian, Shin-Shay; Miller, Stephen G; Kessler, Linda; Baker, Audrey E; Brigham-Burke, Michael R; Dillon, Susan B; Duffy, Kevin J; Keenan, Richard M; Lehr, Ruth; Rosen, Jon; Schneeweis, Lumelle A; Trill, John; Young, Peter R; Luengo, Juan I; Lamb, Peter
2003-03-14
Granulocyte colony-stimulating factor regulates neutrophil production by binding to a specific receptor, the granulocyte colony-stimulating factor receptor, expressed on cells of the granulocytic lineage. Recombinant forms of granulocyte colony-stimulating factor are used clinically to treat neutropenias. As part of an effort to develop granulocyte colony-stimulating factor mimics with the potential for oral bioavailability, we previously identified a nonpeptidyl small molecule (SB-247464) that selectively activates murine granulocyte colony-stimulating factor signal transduction pathways and promotes neutrophil formation in vivo. To elucidate the mechanism of action of SB-247464, a series of cell-based and biochemical assays were performed. The activity of SB-247464 is strictly dependent on the presence of zinc ions. Titration microcalorimetry experiments using a soluble murine granulocyte colony-stimulating factor receptor construct show that SB-247464 binds to the extracellular domain of the receptor in a zinc ion-dependent manner. Analytical ultracentrifugation studies demonstrate that SB-247464 induces self-association of the N-terminal three-domain fragment in a manner that is consistent with dimerization. SB-247464 induces internalization of granulocyte colony-stimulating factor receptor on intact cells, consistent with a mechanism involving receptor oligomerization. These data show that small nonpeptidyl compounds are capable of selectively binding and inducing productive oligomerization of cytokine receptors.
Mouse homologue of yeast Prp19 interacts with mouse SUG1, the regulatory subunit of 26S proteasome
International Nuclear Information System (INIS)
Sihn, Choong-Ryoul; Cho, Si Young; Lee, Jeong Ho; Lee, Tae Ryong; Kim, Sang Hoon
2007-01-01
Yeast Prp19 has been shown to involve in pre-mRNA splicing and DNA repair as well as being an ubiquitin ligase. Mammalian homologue of yeast Prp19 also plays on similar functional activities in cells. In the present study, we isolated mouse SUG1 (mSUG1) as binding partner of mouse Prp19 (mPrp19) by the yeast two-hybrid system. We confirmed the interaction of mPrp9 with mSUG1 by GST pull-down assay and co-immunoprecipitation assay. The N-terminus of mPrp19 including U-box domain was associated with the C-terminus of mSUG1. Although, mSUG1 is a regulatory subunit of 26S proteasome, mPrp19 was not degraded in the proteasome-dependent pathway. Interestingly, GFP-mPrp19 fusion protein was co-localized with mSUG1 protein in cytoplasm as the formation of the speckle-like structures in the presence of a proteasome inhibitor MG132. In addition, the activity of proteasome was increased in cells transfected with mPrp19. Taken together, these results suggest that mPrp19 involves the regulation of protein turnover and may transport its substrates to 26S proteasome through mSUG1 protein
DEFF Research Database (Denmark)
Nielsen, J; Christiansen, J; Lykke-Andersen, J
1999-01-01
Insulin-like growth factor II (IGF-II) is a major fetal growth factor. The IGF-II gene generates multiple mRNAs with different 5' untranslated regions (5' UTRs) that are translated in a differential manner during development. We have identified a human family of three IGF-II mRNA-binding proteins.......5 followed by a decline towards birth, and, similar to IGF-II, IMPs are especially expressed in developing epithelia, muscle, and placenta in both mouse and human embryos. The results imply that cytoplasmic 5' UTR-binding proteins control IGF-II biosynthesis during late mammalian development....... and are homologous to the Xenopus Vera and chicken zipcode-binding proteins. IMP localizes to subcytoplasmic domains in a growth-dependent and cell-specific manner and causes a dose-dependent translational repression of IGF-II leader 3 -luciferase mRNA. Mouse IMPs are produced in a burst at embryonic day 12...
Periodontal status of teeth restored with crowns and its contralateral homologue, Valdivia- Chile.
Israel Antonio Juárez; Sofía Larroulet; Makarena Ojeda; Cristian Rosas
2015-01-01
ABSTRACT Aim: To determine periodontal status of fixes single prostheses (FSP) made during the year 2013 in Austral University of Chile, and its contralateral homologue (CH).Methods: All patients with FSP made during 2013, that met the selection criteria and agreed to participate were evaluated. During the year 2014 was measured: probing depth, attachment level; bleeding on probing and dental plaque index for each FSP and CH; and consigned biological width invasion. Were measured one FSP...
Nam, Ki Hyun; Kurinov, Igor; Ke, Ailong
2011-09-02
Clustered regularly interspaced short palindromic repeats (CRISPR) and their associated protein genes (cas genes) are widespread in bacteria and archaea. They form a line of RNA-based immunity to eradicate invading bacteriophages and malicious plasmids. A key molecular event during this process is the acquisition of new spacers into the CRISPR loci to guide the selective degradation of the matching foreign genetic elements. Csn2 is a Nmeni subtype-specific cas gene required for new spacer acquisition. Here we characterize the Enterococcus faecalis Csn2 protein as a double-stranded (ds-) DNA-binding protein and report its 2.7 Å tetrameric ring structure. The inner circle of the Csn2 tetrameric ring is ∼26 Å wide and populated with conserved lysine residues poised for nonspecific interactions with ds-DNA. Each Csn2 protomer contains an α/β domain and an α-helical domain; significant hinge motion was observed between these two domains. Ca(2+) was located at strategic positions in the oligomerization interface. We further showed that removal of Ca(2+) ions altered the oligomerization state of Csn2, which in turn severely decreased its affinity for ds-DNA. In summary, our results provided the first insight into the function of the Csn2 protein in CRISPR adaptation by revealing that it is a ds-DNA-binding protein functioning at the quaternary structure level and regulated by Ca(2+) ions.
DEFF Research Database (Denmark)
Hansen, Thomas V O; Hammer, Niels A; Nielsen, Jacob
2004-01-01
Insulin-like growth factor II mRNA-binding protein 1 (IMP1) belongs to a family of RNA-binding proteins implicated in mRNA localization, turnover, and translational control. Mouse IMP1 is expressed during early development, and an increase in expression occurs around embryonic day 12.5 (E12.5). T...
Detection of growth factor binding to gelatin and heparin using a photonic crystal optical biosensor
International Nuclear Information System (INIS)
Morgan, Abby W.; Chan, Leo L.; Sendemir-Urkmez, Aylin; Cunningham, Brian T.; Jamison, Russell D.
2010-01-01
Drug-carrier interactions are important to protein controlled release systems to protect the protein from denaturation and ensure properly timed release. A novel photonic crystal biosensor was used to investigate a gelatin-protein controlled release system to determine the amount of protein bound to the carrier at physiological conditions. The Biomolecular Interaction Detection (BIND) system reflects a narrow band of wavelengths when white light is shone incident to the grating. As mass is deposited onto the surface, the peak wavelength value is shifted due to changes in the optical density of the biosensor. The BIND system was used to detect the binding of growth factors onto acidic gelatin, basic gelatin, and heparin on the sensor surface. Through a series of experiments, including functionalizing the sensor, adjusting the ionic strength of the solution, adjusting the substrate concentration, and minimizing non-specific signal, the adsorption of the gelatins and heparin on the sensor was enhanced. The binding interaction of recombinant human transforming growth factor (rhTGF)-β1 and bone morphogenetic protein (rhBMP)-2 with the two types of gelatin and heparin were investigated. The strength of the interaction between rhTGF-β1 and the substrates is in the following order: heparin > acidic gelatin > basic gelatin. RhBMP-2 bound to the substrates but with less intensity than TGF-β1: heparin > basic gelatin > acidic gelatin. This work provides support for the controlled release mechanism through degradation of the gelatin carrier.
International Nuclear Information System (INIS)
Huang, L.H.; Cheng, H.; Sweeney, W.V.; Pardi, A.; Tam, J.P.
1991-01-01
Factor IX is a blood clotting protein that contains three regions, including a γ-carboxyglutamic acid (Gla) domain, two tandemly connected epidermal growth factor like (EGF-like) domains, and a serine protease region. The protein exhibits a high-affinity calcium binding site in the first EGF0like domain, in addition to calcium binding in the Gla domain. The first EGF-like domain, factor IX (45-87), has been synthesized. Sequence-specific resonance assignment of the peptide has been made by using 2D NMR techniques, and its secondary structure has been determined. The protein is found to have two antiparallel β-sheets, and preliminary distance geometry calculations indicate that the protein has two domains, separated by Trp 28 , with the overall structure being similar to that of EGF. An NMR investigation of the calcium-bound first EGF-like domain indicates the presence and location of a calcium binding site involving residues on both strands of one of the β-sheets as well as the N-terminal region of the peptide. These results suggest that calcium binding in the first EGF-like domain could induce long-range (possibly interdomain) conformational changes in factor IX, rather than causing structural alterations in the EGF-like domain itself
PolyaPeak: Detecting Transcription Factor Binding Sites from ChIP-seq Using Peak Shape Information
Wu, Hao; Ji, Hongkai
2014-01-01
ChIP-seq is a powerful technology for detecting genomic regions where a protein of interest interacts with DNA. ChIP-seq data for mapping transcription factor binding sites (TFBSs) have a characteristic pattern: around each binding site, sequence reads aligned to the forward and reverse strands of the reference genome form two separate peaks shifted away from each other, and the true binding site is located in between these two peaks. While it has been shown previously that the accuracy and resolution of binding site detection can be improved by modeling the pattern, efficient methods are unavailable to fully utilize that information in TFBS detection procedure. We present PolyaPeak, a new method to improve TFBS detection by incorporating the peak shape information. PolyaPeak describes peak shapes using a flexible Pólya model. The shapes are automatically learnt from the data using Minorization-Maximization (MM) algorithm, then integrated with the read count information via a hierarchical model to distinguish true binding sites from background noises. Extensive real data analyses show that PolyaPeak is capable of robustly improving TFBS detection compared with existing methods. An R package is freely available. PMID:24608116
Directory of Open Access Journals (Sweden)
Bart eGeurten
2012-03-01
Full Text Available Hoverflies and blowflies have distinctly different flight styles. Yet, both species have been shown to structure their flight behaviour in a way that facilitates extraction of 3D information from the image flow on the retina (optic flow. Neuronal candidates to analyse the optic flow are the tangential cells in the third optical ganglion – the lobula complex. These neurons are directionally selective and integrate the optic flow over large parts of the visual field. Homologue tangential cells in hoverflies and blowflies have a similar morphology. Because blowflies and hoverflies have similar neuronal layout but distinctly different flight behaviours, they are an ideal substrate to pinpoint potential neuronal adaptations to the different flight styles.In this article we describe the relationship between locomotion behaviour and motion vision on three different levels:1.We compare the different flight styles based on the categorisation of flight behaviour into prototypical movements.2.We measure the species specific dynamics of the optic flow under naturalistic flight conditions. We found the translational optic flow of both species to be very different.3.We describe possible adaptations of a homologue motion sensitive neuron. We stimulate this cell in blowflies (Calliphora and hoverflies (Eristalis with naturalistic optic flow generated by both species during free flight. The characterized hoverfly tangential cell responds faster to transient changes in the optic flow than its blowfly homologue. It is discussed whether and how the different dynamical response properties aid optic flow analysis.
Nishiyama, Keita; Nakamata, Koichi; Ueno, Shintaro; Terao, Akari; Aryantini, Ni Putu Desy; Sujaya, I Nengah; Fukuda, Kenji; Urashima, Tadasu; Yamamoto, Yuji; Mukai, Takao
2015-01-01
We previously described potential probiotic Lactobacillus rhamnosus strains, isolated from fermented mare milk produced in Sumbawa Island, Indonesia, which showed high adhesion to porcine colonic mucin (PCM) and extracellular matrix (ECM) proteins. Recently, mucus-binding factor (MBF) was found in the GG strain of L. rhamnosus as a mucin-binding protein. In this study, we assessed the ability of recombinant MBF protein from the FSMM22 strain, one of the isolates of L. rhamnosus from fermented Sumbawa mare milk, to adhere to PCM and ECM proteins by overlay dot blot and Biacore assays. MBF bound to PCM, laminin, collagen IV, and fibronectin with submicromolar dissociation constants. Adhesion of the FSMM22 mbf mutant strain to PCM and ECM proteins was significantly less than that of the wild-type strain. Collectively, these results suggested that MBF contribute to L. rhamnosus host colonization via mucin and ECM protein binding.
Energy Technology Data Exchange (ETDEWEB)
Lammerts van Bueren,A.; Higgins, M.; Wang, D.; Burke, R.; Boraston, A.
2007-01-01
The ability of pathogenic bacteria to recognize host glycans is often essential to their virulence. Here we report structure-function studies of previously uncharacterized glycogen-binding modules in the surface-anchored pullulanases from Streptococcus pneumoniae (SpuA) and Streptococcus pyogenes (PulA). Multivalent binding to glycogen leads to a strong interaction with alveolar type II cells in mouse lung tissue. X-ray crystal structures of the binding modules reveal a novel fusion of tandem modules into single, bivalent functional domains. In addition to indicating a structural basis for multivalent attachment, the structure of the SpuA modules in complex with carbohydrate provides insight into the molecular basis for glycogen specificity. This report provides the first evidence that intracellular lung glycogen may be a novel target of pathogenic streptococci and thus provides a rationale for the identification of the streptococcal {alpha}-glucan-metabolizing machinery as virulence factors.
ACCA phosphopeptide recognition by the BRCT repeats of BRCA1.
Ray, Hind; Moreau, Karen; Dizin, Eva; Callebaut, Isabelle; Venezia, Nicole Dalla
2006-06-16
The tumour suppressor gene BRCA1 encodes a 220 kDa protein that participates in multiple cellular processes. The BRCA1 protein contains a tandem of two BRCT repeats at its carboxy-terminal region. The majority of disease-associated BRCA1 mutations affect this region and provide to the BRCT repeats a central role in the BRCA1 tumour suppressor function. The BRCT repeats have been shown to mediate phospho-dependant protein-protein interactions. They recognize phosphorylated peptides using a recognition groove that spans both BRCT repeats. We previously identified an interaction between the tandem of BRCA1 BRCT repeats and ACCA, which was disrupted by germ line BRCA1 mutations that affect the BRCT repeats. We recently showed that BRCA1 modulates ACCA activity through its phospho-dependent binding to ACCA. To delineate the region of ACCA that is crucial for the regulation of its activity by BRCA1, we searched for potential phosphorylation sites in the ACCA sequence that might be recognized by the BRCA1 BRCT repeats. Using sequence analysis and structure modelling, we proposed the Ser1263 residue as the most favourable candidate among six residues, for recognition by the BRCA1 BRCT repeats. Using experimental approaches, such as GST pull-down assay with Bosc cells, we clearly showed that phosphorylation of only Ser1263 was essential for the interaction of ACCA with the BRCT repeats. We finally demonstrated by immunoprecipitation of ACCA in cells, that the whole BRCA1 protein interacts with ACCA when phosphorylated on Ser1263.
Directory of Open Access Journals (Sweden)
Amy L Bauer
2010-11-01
Full Text Available An important step in understanding gene regulation is to identify the DNA binding sites recognized by each transcription factor (TF. Conventional approaches to prediction of TF binding sites involve the definition of consensus sequences or position-specific weight matrices and rely on statistical analysis of DNA sequences of known binding sites. Here, we present a method called SiteSleuth in which DNA structure prediction, computational chemistry, and machine learning are applied to develop models for TF binding sites. In this approach, binary classifiers are trained to discriminate between true and false binding sites based on the sequence-specific chemical and structural features of DNA. These features are determined via molecular dynamics calculations in which we consider each base in different local neighborhoods. For each of 54 TFs in Escherichia coli, for which at least five DNA binding sites are documented in RegulonDB, the TF binding sites and portions of the non-coding genome sequence are mapped to feature vectors and used in training. According to cross-validation analysis and a comparison of computational predictions against ChIP-chip data available for the TF Fis, SiteSleuth outperforms three conventional approaches: Match, MATRIX SEARCH, and the method of Berg and von Hippel. SiteSleuth also outperforms QPMEME, a method similar to SiteSleuth in that it involves a learning algorithm. The main advantage of SiteSleuth is a lower false positive rate.
Composite organization of the cobalamin binding and cubilin recognition sites of intrinsic factor
DEFF Research Database (Denmark)
Fedosov, Sergey N; Fedosova, Natalya U; Berglund, Lars
2005-01-01
Intrinsic factor (IF(50)) is a cobalamin (Cbl)-transporting protein of 50 kDa, which can be cleaved into two fragments: the 30 kDa N-terminal peptide IF(30) and the 20 kDa C-terminal glycopeptide IF(20). Experiments on binding of Cbl to IF(30), IF(20), and IF(50) revealed comparable association r...
International Nuclear Information System (INIS)
Vijaysri, Sangeetha; Talasela, Latha; Mercer, Andrew A.; Mcinnes, Colin J.; Jacobs, Bertram L.; Langland, Jeffrey O.
2003-01-01
Orf virus (OV), the prototypic parapoxvirus, is resistant to the effects of interferon (IFN) and this function of OV has been mapped to the OV20.0L gene. The protein product of this gene shares 31% amino acid identity to the E3L-encoded protein of vaccinia virus (VV) that is required for the broad host range and IFN-resistant phenotype of VV in cells in culture and for virulence of the virus in vivo. In this study we investigated whether the distantly related OV E3L homologue could complement the deletion of E3L in VV. The recombinant VV (VV/ORF-E3L) expressing the OV E3L homologue in place of VV E3L was indistinguishable from wt VV in its cell-culture phenotype. But VV/ORF-E3L was over a 1000-fold less pathogenic than wt VV (LD 50 > 5 x 10 6 PFU, compared to LD 50 of wtVV = 4 x 10 3 PFU) following intranasal infection of mice. While wt VV spread to the lungs and brain and replicated to high titers in the brain of infected mice, VV/ORF-E3L could not be detected in the lungs or brain following intranasal infection. VV/ORF-E3L was at least 100,000-fold less pathogenic than wt VV on intracranial injection. Domain swap experiments demonstrate that the difference in pathogenesis maps to the C-terminal domain of these proteins. This domain has been shown to be required for the dsRNA binding function of the VV E3L
Muiño, J.M.; Bruijn, de S.A.; Vingron, Martin; Angenent, G.C.; Kaufmann, Kerstin
2015-01-01
Plant development is controlled by transcription factors (TFs) which form complex gene-regulatory networks. Genome-wide TF DNA-binding studies revealed that these TFs have several thousands of binding sites in the Arabidopsis genome, and may regulate the expression of many genes directly. Given the
International Nuclear Information System (INIS)
Ritvos, O.; Ranta, T.; Jalkanen, J.; Suikkari, A.M.; Voutilainen, R.; Bohn, H.; Rutanen, E.M.
1988-01-01
The placenta expresses genes for insulin-like growth factors (IGFs) and possesses IGF-receptors, suggesting that placental growth is regulated by IGFs in an autocrine manner. We have previously shown that human decidua, but not placenta, synthesizes and secretes a 34 K IGF-binding protein (34 K IGF-BP) called placental protein 12. We now used human choriocarcinoma JEG-3 cell monolayer cultures and recombinant (Thr59)IGF-I as a model to study whether the decidual 34 K IGF-BP is able to modulate the receptor binding and biological activity of IGFs in trophoblasts. JEG-3 cells, which possess type I IGF receptors, were unable to produce IGF-BPs. Purified 34 K IGF-BP specifically bound [125I]iodo-(Thr59)IGF-I. Multiplication-stimulating activity had 2.5% the potency of (Thr59)IGF-I, and insulin had no effect on the binding of [125I] iodo-(Thr59)IGF-I. 34 K IGF-BP inhibited the binding of [125I] iodo-(Thr59)IGF-I to JEG-3 monolayers in a concentration-dependent manner by forming with the tracer a soluble complex that could not bind to the cell surface as demonstrated by competitive binding and cross-linking experiments. After incubating the cell monolayers with [125I]iodo-(Thr59)IGF-I in the presence of purified binding protein, followed by cross-linking, no affinity labeled bands were seen on autoradiography. In contrast, an intensely labeled band at 40 K was detected when the incubation medium was analyzed, suggesting that (Thr59)IGF-I and 34 K IGF-BP formed a complex in a 1:1 molar ratio. Also, 34 K IGF-BP inhibited both basal and IGF-I-stimulated uptake of alpha-[3H]aminoisobutyric acid in JEG-3 cells. RNA analysis revealed that IGF-II is expressed in JEG-3 cells
Analysis of repeated measures data
Islam, M Ataharul
2017-01-01
This book presents a broad range of statistical techniques to address emerging needs in the field of repeated measures. It also provides a comprehensive overview of extensions of generalized linear models for the bivariate exponential family of distributions, which represent a new development in analysing repeated measures data. The demand for statistical models for correlated outcomes has grown rapidly recently, mainly due to presence of two types of underlying associations: associations between outcomes, and associations between explanatory variables and outcomes. The book systematically addresses key problems arising in the modelling of repeated measures data, bearing in mind those factors that play a major role in estimating the underlying relationships between covariates and outcome variables for correlated outcome data. In addition, it presents new approaches to addressing current challenges in the field of repeated measures and models based on conditional and joint probabilities. Markov models of first...
LTRs of Endogenous Retroviruses as a Source of Tbx6 Binding Sites.
Yasuhiko, Yukuto; Hirabayashi, Yoko; Ono, Ryuichi
2017-01-01
Retrotransposons are abundant in mammalian genomes and can modulate the gene expression of surrounding genes by disrupting endogenous binding sites for transcription factors (TFs) or providing novel TFs binding sites within retrotransposon sequences. Here, we show that a (C/T)CACACCT sequence motif in ORR1A, ORR1B, ORR1C, and ORR1D, Long Terminal Repeats (LTRs) of MaLR endogenous retrovirus (ERV), is the direct target of Tbx6, an evolutionary conserved family of T-box TFs. Moreover, by comparing gene expression between control mice (Tbx6 +/-) and Tbx6-deficient mice (Tbx6 -/-), we demonstrate that at least four genes, Twist2, Pitx2, Oscp1 , and Nfxl1 , are down-regulated with Tbx6 deficiency. These results suggest that ORR1A, ORR1B, ORR1C and ORR1D may contribute to the evolution of mammalian embryogenesis.
Crystal structure of an eIF4G-like protein from Danio rerio
Energy Technology Data Exchange (ETDEWEB)
Bae, Euiyoung; Bitto, Eduard; Bingman, Craig A.; McCoy, Jason G.; Wesenberg, Gary E.; Phillips, Jr., George N. (UW)
2012-04-18
The gene LOC 91917 Danio rerio (zebrafish) encodes a protein annotated in the UniProt knowledgebase as the middle domain of eukaryotic initiation factor 4G domain containing protein b (MIF4Gdb). Its molecular weight is 25.8 kDa, and it comprises 222 amino acid residues. BLAST searches revealed homologues of D. rerio MIF4Gdb in many eukaryotes including humans. The homologue sand MIF4Gdb were identified as members of the Pfam family, MIF4G (PF2854), which is named after the middle domain of eukaryotic initiation factor 4G (eIF4G). eIF4G is a component of eukaryotic translational initiation complex, and contains binding sites for other initiation factors, suggesting its critical role in translational initiation. The MIF4G domain also occurs in several other proteins involved in RNA metabolism, including the Nonsense-mediated mRNA decay 2 protein (NMD2/UPF2), and the nuclear cap-binding protein 80-kDa subunit (CBP80). Sequence and structure analysis of the MIF4G domains in many proteins indicate that the domain assumes an all helical fold and has tandem repeated motifs. The zebrafish protein described here has homology to domains of other proteins variously referred to as NIC-containing proteins (NMD2, eIF4G, CBP80). The biological function of D. rerio MIF4Gdb has not yet been experimentally characterized, and the annotation is based on amino acid sequence comparison. D. rerio MIF4Gdb did not share more than 25% sequence identity with any protein for which the three-dimensional structure is known and was selected as a target for structure determination by the Center for Eukaryotic Structural Genomics (CESG). Here, they report the crystal structure of D. rerio MIF4Gdb (UniGene code Dr.79360, UniProt code Q5EAQ1, CESG target number GO.79294).
Hidalgo, María A; Romero, Alex; Figueroa, Jaime; Cortés, Patricia; Concha, Ilona I; Hancke, Juan L; Burgos, Rafael A
2005-01-01
Andrographolide, the major active component from Andrographis paniculata, has shown to possess anti-inflammatory activity. Andrographolide inhibits the expression of several proinflammatory proteins that exhibit a nuclear factor kappa B (NF-κB) binding site in their gene. In the present study, we analyzed the effect of andrographolide on the activation of NF-κB induced by platelet-activating factor (PAF) and N-formyl-methionyl-leucyl-phenylalanine (fMLP) in HL-60 cells differentiated to neutrophils. PAF (100 nM) and fMLP (100 nM) induced activation of NF-κB as determined by degradation of inhibitory factor B α (IκBα) using Western blotting in cytosolic extracts and by binding to DNA using electrophoretic mobility shift assay (EMSA) in nuclear extracts. Andrographolide (5 and 50 μM) inhibited the NF-κB-luciferase activity induced by PAF. However, andrographolide did not reduce phosphorylation of p38 MAPK or ERK1/2 and did not change IκBα degradation induced by PAF and fMLP. Andrographolide reduced the DNA binding of NF-κB in whole cells and in nuclear extracts induced by PAF and fMLP. Andrographolide reduced cyclooxygenase-2 (COX-2) expression induced by PAF and fMLP in HL-60/neutrophils. It is concluded that andrographolide exerts its anti-inflammatory effects by inhibiting NF-κB binding to DNA, and thus reducing the expression of proinflammatory proteins, such as COX-2. PMID:15678086
Repeated prenatal exposure to valproic acid results in cerebellar hypoplasia and ataxia.
Main, Stacey L; Kulesza, Randy J
2017-01-06
Autism spectrum disorder (ASD) is a developmental brain disorder characterized by restricted and repetitive patterns of behavior, social and communication defects, and is commonly associated with difficulties with motor coordination. The etiology of ASD, while mostly idiopathic, has been linked to hereditary factors and teratogens, such as valproic acid (VPA). VPA is used clinically to treat epilepsy, mood disorders, and in the prevention of migraines. The use of VPA during pregnancy significantly increases the risk of ASD in the offspring. Neuropathological studies show decreased cerebellar function in patients with ASD, resulting in gait, balance and coordination impairments. Herein, we have exposed pregnant rats to a repeated oral dose of VPA on embryonic days 10 and 12 and performed a detailed investigation of the structure and function of the cerebellar vermis. We found that throughout all ten lobules of the cerebellar vermis, Purkinje cells were significantly smaller and expression of the calcium binding protein calbindin (CB) was significantly reduced. We also found that dendritic arbors of Purkinje cells were shorter and less complex. Additionally, animals exposed to a repeated dose of VPA performed significantly worse in a number of motor tasks, including beam walking and the rotarod. These results suggest that repeated embryonic exposure to VPA induces significant cerebellar dysfunction and is an effective animal model to study the cerebellar alterations in ASD. Copyright © 2016 IBRO. Published by Elsevier Ltd. All rights reserved.
2017-01-01
Post-transcriptional regulation is regarded as one of the major processes involved in the regulation of gene expression. It is mainly performed by RNA binding proteins and microRNAs, which target RNAs and typically affect their stability. Recent efforts from the scientific community have aimed at understanding post-transcriptional regulation at a global scale by using high-throughput sequencing techniques such as cross-linking and immunoprecipitation (CLIP), which facilitates identification of binding sites of these regulatory factors. However, the diversity in the experimental procedures and bioinformatics analyses has hindered the integration of multiple datasets and thus limited the development of an integrated view of post-transcriptional regulation. In this work, we have performed a comprehensive analysis of 107 CLIP datasets from 49 different RBPs in HEK293 cells to shed light on the complex interactions that govern post-transcriptional regulation. By developing a more stringent CLIP analysis pipeline we have discovered the existence of conserved regulatory AU-rich regions in the 3’UTRs where miRNAs and RBPs that regulate several processes such as polyadenylation or mRNA stability bind. Analogous to promoters, many factors have binding sites overlapping or in close proximity in these hotspots and hence the regulation of the mRNA may depend on their relative concentrations. This hypothesis is supported by RBP knockdown experiments that alter the relative concentration of RBPs in the cell. Upon AGO2 knockdown (KD), transcripts containing “free” target sites show increased expression levels compared to those containing target sites in hotspots, which suggests that target sites within hotspots are less available for miRNAs to bind. Interestingly, these hotspots appear enriched in genes with regulatory functions such as DNA binding and RNA binding. Taken together, our results suggest that hotspots are functional regulatory elements that define an extra layer
Sharma, Ranu; Rawat, Vimal; Suresh, C G
2017-12-01
The nucleotide binding site-leucine rich repeat (NBS-LRR) proteins play an important role in the defense mechanisms against pathogens. Using bioinformatics approach, we identified and annotated 104 NBS-LRR genes in chickpea. Phylogenetic analysis points to their diversification into two families namely TIR-NBS-LRR and non-TIR-NBS-LRR. Gene architecture revealed intron gain/loss events in this resistance gene family during their independent evolution into two families. Comparative genomics analysis elucidated its evolutionary relationship with other fabaceae species. Around 50% NBS-LRRs reside in macro-syntenic blocks underlining positional conservation along with sequence conservation of NBS-LRR genes in chickpea. Transcriptome sequencing data provided evidence for their transcription and tissue-specific expression. Four cis -regulatory elements namely WBOX, DRE, CBF, and GCC boxes, that commonly occur in resistance genes, were present in the promoter regions of these genes. Further, the findings will provide a strong background to use candidate disease resistance NBS-encoding genes and identify their specific roles in chickpea.
A.G.P. Schuller (Alwin); D.J. Lindenbergh-Kortleve (Dicky); T.D. Pache; E.C. Zwarthoff (Ellen); B.C.J.M. Fauser (Bart); S.L.S. Drop (Stenvert)
1993-01-01
textabstractIn order to investigate potential changes in insulin-like growth factor binding proteins (IGFBPs) during human follicle maturation, we examined the IGFBP profiles in follicular fluid from follicles in different stages of maturation. Samples were obtained from ovaries of women with
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A
1997-01-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, delet...
Liu, Sheng; Zibetti, Cristina; Wan, Jun; Wang, Guohua; Blackshaw, Seth; Qian, Jiang
2017-07-27
Computational prediction of transcription factor (TF) binding sites in different cell types is challenging. Recent technology development allows us to determine the genome-wide chromatin accessibility in various cellular and developmental contexts. The chromatin accessibility profiles provide useful information in prediction of TF binding events in various physiological conditions. Furthermore, ChIP-Seq analysis was used to determine genome-wide binding sites for a range of different TFs in multiple cell types. Integration of these two types of genomic information can improve the prediction of TF binding events. We assessed to what extent a model built upon on other TFs and/or other cell types could be used to predict the binding sites of TFs of interest. A random forest model was built using a set of cell type-independent features such as specific sequences recognized by the TFs and evolutionary conservation, as well as cell type-specific features derived from chromatin accessibility data. Our analysis suggested that the models learned from other TFs and/or cell lines performed almost as well as the model learned from the target TF in the cell type of interest. Interestingly, models based on multiple TFs performed better than single-TF models. Finally, we proposed a universal model, BPAC, which was generated using ChIP-Seq data from multiple TFs in various cell types. Integrating chromatin accessibility information with sequence information improves prediction of TF binding.The prediction of TF binding is transferable across TFs and/or cell lines suggesting there are a set of universal "rules". A computational tool was developed to predict TF binding sites based on the universal "rules".
Wohleb, Eric S; Hanke, Mark L; Corona, Angela W; Powell, Nicole D; Stiner, La'Tonia M; Bailey, Michael T; Nelson, Randy J; Godbout, Jonathan P; Sheridan, John F
2011-04-27
Psychosocial stress is associated with altered immune function and development of psychological disorders including anxiety and depression. Here we show that repeated social defeat in mice increased c-Fos staining in brain regions associated with fear and threat appraisal and promoted anxiety-like behavior in a β-adrenergic receptor-dependent manner. Repeated social defeat also significantly increased the number of CD11b(+)/CD45(high)/Ly6C(high) macrophages that trafficked to the brain. In addition, several inflammatory markers were increased on the surface of microglia (CD14, CD86, and TLR4) and macrophages (CD14 and CD86) after social defeat. Repeated social defeat also increased the presence of deramified microglia in the medial amygdala, prefrontal cortex, and hippocampus. Moreover, mRNA analysis of microglia indicated that repeated social defeat increased levels of interleukin (IL)-1β and reduced levels of glucocorticoid responsive genes [glucocorticoid-induced leucine zipper (GILZ) and FK506 binding protein-51 (FKBP51)]. The stress-dependent changes in microglia and macrophages were prevented by propranolol, a β-adrenergic receptor antagonist. Microglia isolated from socially defeated mice and cultured ex vivo produced markedly higher levels of IL-6, tumor necrosis factor-α, and monocyte chemoattractant protein-1 after stimulation with lipopolysaccharide compared with microglia from control mice. Last, repeated social defeat increased c-Fos activation in IL-1 receptor type-1-deficient mice, but did not promote anxiety-like behavior or microglia activation in the absence of functional IL-1 receptor type-1. These findings indicate that repeated social defeat-induced anxiety-like behavior and enhanced reactivity of microglia was dependent on activation of β-adrenergic and IL-1 receptors.
Gupta, Namrata; Gupta, Ankush; Kumar, Santosh; Mishra, Rajeev; Singh, Chhaya; Tripathi, Anil Kumar
2014-01-01
Azospirillum brasilense harbors two redox-sensitive Zinc-binding anti-sigma (ZAS) factors (ChrR1 and ChrR2), which negatively regulate the activity of their cognate extra-cytoplasmic function (ECF) σ factors (RpoE1 and RpoE2) by occluding their binding to the core enzyme. Both pairs of RpoE-ChrR control responses to photooxidative stress. The aim of this study was to investigate whether the two RpoE-ChrR pairs cross-talk while responding to the stress. In silico analysis showed a high sequence similarity between ChrR1 and ChrR2 proteins, but differences in redox sensitivity. Using in silico and in vitro methods of protein-protein interaction, we have shown that both ChrR1 and ChrR2 proteins physically bind to their noncognate RpoE proteins. Restoration of the phenotypes of chrR1::Tn5 and chrR2::Km mutants related to carotenoid biosynthesis and photooxidative stress tolerance by expressing chrR1 or chrR2 provided in vivo evidence for the cross-talk. In addition, up- or down-regulation of several identical proteins by expressing chrR1 or chrR2 in the chrR1::Tn5 mutant provided another in vivo evidence for the cross-talk. Although multiple redox-sensitive ZAS anti-σ factors occur in some Gram-positive bacteria, no cross-talk is reported among them. We report here, for the first time, that the two ZAS anti-σ factors of A. brasilense also interact with their noncognate σ factors and affect gene expression. The two redox-sensitive ZAS anti-σ factors in A. brasilense may interact with their cognate as well as noncognate ECF σ factors to play an important role in redox homeostasis by facilitating recovery from the oxidative stress.
Factor requirements for transcription in the Archaeon Sulfolobus shibatae.
Qureshi, S A; Bell, S D; Jackson, S P
1997-05-15
Archaea (archaebacteria) constitute a domain of life that is distinct from Bacteria (eubacteria) and Eucarya (eukaryotes). Although archaeal cells share many morphological features with eubacteria, their transcriptional apparatus is more akin to eukaryotic RNA polymerases I, II and III than it is to eubacterial transcription systems. Thus, in addition to possessing a 10 subunit RNA polymerase and a homologue of the TATA-binding protein (TBP), Archaea possess a polypeptide termed TFB that is homologous to eukaryotic TFIIB. Here, we investigate the factor requirements for transcription of several promoters of the archaeon Sulfolobus shibatae and its associated virus SSV. Through in vitro transcription and immunodepletion, we demonstrate that S. shibatae TBP, TFB and RNA polymerase are not complexed tightly with one another and that each is required for efficient transcription of all promoters tested. Furthermore, full transcription is restored by supplementing respective depleted extracts with recombinant TBP or TFB, indicating that TBP-associated factors or TFB-associated factors are not required. Indeed, gel-filtration suggests that Sulfolobus TBP and TFB are not associated stably with other proteins. Finally, all promoters analysed are transcribed accurately and efficiently in an in vitro system comprising recombinant TBP and TFB, together with essentially homogeneous preparation of RNA polymerase. Transcription in Archaea is therefore fundamentally homologous to that in eukaryotes, although factor requirements appear to be much less complex.
A Common Structural Motif in the Binding of Virulence Factors to Bacterial Secretion Chaperones
International Nuclear Information System (INIS)
Lilic, M.; Vujanac, M.; Stebbins, C.
2006-01-01
Salmonella invasion protein A (SipA) is translocated into host cells by a type III secretion system (T3SS) and comprises two regions: one domain binds its cognate type III secretion chaperone, InvB, in the bacterium to facilitate translocation, while a second domain functions in the host cell, contributing to bacterial uptake by polymerizing actin. We present here the crystal structures of the SipA chaperone binding domain (CBD) alone and in complex with InvB. The SipA CBD is found to consist of a nonglobular polypeptide as well as a large globular domain, both of which are necessary for binding to InvB. We also identify a structural motif that may direct virulence factors to their cognate chaperones in a diverse range of pathogenic bacteria. Disruption of this structural motif leads to a destabilization of several chaperone-substrate complexes from different species, as well as an impairment of secretion in Salmonella
A novel method for improved accuracy of transcription factor binding site prediction
Khamis, Abdullah M.; Motwalli, Olaa Amin; Oliva, Romina; Jankovic, Boris R.; Medvedeva, Yulia; Ashoor, Haitham; Essack, Magbubah; Gao, Xin; Bajic, Vladimir B.
2018-01-01
Identifying transcription factor (TF) binding sites (TFBSs) is important in the computational inference of gene regulation. Widely used computational methods of TFBS prediction based on position weight matrices (PWMs) usually have high false positive rates. Moreover, computational studies of transcription regulation in eukaryotes frequently require numerous PWM models of TFBSs due to a large number of TFs involved. To overcome these problems we developed DRAF, a novel method for TFBS prediction that requires only 14 prediction models for 232 human TFs, while at the same time significantly improves prediction accuracy. DRAF models use more features than PWM models, as they combine information from TFBS sequences and physicochemical properties of TF DNA-binding domains into machine learning models. Evaluation of DRAF on 98 human ChIP-seq datasets shows on average 1.54-, 1.96- and 5.19-fold reduction of false positives at the same sensitivities compared to models from HOCOMOCO, TRANSFAC and DeepBind, respectively. This observation suggests that one can efficiently replace the PWM models for TFBS prediction by a small number of DRAF models that significantly improve prediction accuracy. The DRAF method is implemented in a web tool and in a stand-alone software freely available at http://cbrc.kaust.edu.sa/DRAF.
A novel method for improved accuracy of transcription factor binding site prediction
Khamis, Abdullah M.
2018-03-20
Identifying transcription factor (TF) binding sites (TFBSs) is important in the computational inference of gene regulation. Widely used computational methods of TFBS prediction based on position weight matrices (PWMs) usually have high false positive rates. Moreover, computational studies of transcription regulation in eukaryotes frequently require numerous PWM models of TFBSs due to a large number of TFs involved. To overcome these problems we developed DRAF, a novel method for TFBS prediction that requires only 14 prediction models for 232 human TFs, while at the same time significantly improves prediction accuracy. DRAF models use more features than PWM models, as they combine information from TFBS sequences and physicochemical properties of TF DNA-binding domains into machine learning models. Evaluation of DRAF on 98 human ChIP-seq datasets shows on average 1.54-, 1.96- and 5.19-fold reduction of false positives at the same sensitivities compared to models from HOCOMOCO, TRANSFAC and DeepBind, respectively. This observation suggests that one can efficiently replace the PWM models for TFBS prediction by a small number of DRAF models that significantly improve prediction accuracy. The DRAF method is implemented in a web tool and in a stand-alone software freely available at http://cbrc.kaust.edu.sa/DRAF.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
MiT/TFE transcription factors are activated during mitophagy downstream of Parkin and Atg5.
Nezich, Catherine L; Wang, Chunxin; Fogel, Adam I; Youle, Richard J
2015-08-03
The kinase PINK1 and ubiquitin ligase Parkin can regulate the selective elimination of damaged mitochondria through autophagy (mitophagy). Because of the demand on lysosomal function by mitophagy, we investigated a role for the transcription factor EB (TFEB), a master regulator of lysosomal biogenesis, in this process. We show that during mitophagy TFEB translocates to the nucleus and displays transcriptional activity in a PINK1- and Parkin-dependent manner. MITF and TFE3, homologues of TFEB belonging to the same microphthalmia/transcription factor E (MiT/TFE) family, are similarly regulated during mitophagy. Unlike TFEB translocation after starvation-induced mammalian target of rapamycin complex 1 inhibition, Parkin-mediated TFEB relocalization required Atg9A and Atg5 activity. However, constitutively active Rag guanosine triphosphatases prevented TFEB translocation during mitophagy, suggesting cross talk between these two MiT/TFE activation pathways. Analysis of clustered regularly interspaced short palindromic repeats-generated TFEB/MITF/TFE3/TFEC single, double, and triple knockout cell lines revealed that these proteins partly facilitate Parkin-mediated mitochondrial clearance. These results illuminate a pathway leading to MiT/TFE transcription factor activation, distinct from starvation-induced autophagy, which occurs during mitophagy.
Directory of Open Access Journals (Sweden)
Ashford Paul
2012-03-01
Full Text Available Abstract Background Protein structures provide a valuable resource for rational drug design. For a protein with no known ligand, computational tools can predict surface pockets that are of suitable size and shape to accommodate a complementary small-molecule drug. However, pocket prediction against single static structures may miss features of pockets that arise from proteins' dynamic behaviour. In particular, ligand-binding conformations can be observed as transiently populated states of the apo protein, so it is possible to gain insight into ligand-bound forms by considering conformational variation in apo proteins. This variation can be explored by considering sets of related structures: computationally generated conformers, solution NMR ensembles, multiple crystal structures, homologues or homology models. It is non-trivial to compare pockets, either from different programs or across sets of structures. For a single structure, difficulties arise in defining particular pocket's boundaries. For a set of conformationally distinct structures the challenge is how to make reasonable comparisons between them given that a perfect structural alignment is not possible. Results We have developed a computational method, Provar, that provides a consistent representation of predicted binding pockets across sets of related protein structures. The outputs are probabilities that each atom or residue of the protein borders a predicted pocket. These probabilities can be readily visualised on a protein using existing molecular graphics software. We show how Provar simplifies comparison of the outputs of different pocket prediction algorithms, of pockets across multiple simulated conformations and between homologous structures. We demonstrate the benefits of use of multiple structures for protein-ligand and protein-protein interface analysis on a set of complexes and consider three case studies in detail: i analysis of a kinase superfamily highlights the
Ashford, Paul; Moss, David S; Alex, Alexander; Yeap, Siew K; Povia, Alice; Nobeli, Irene; Williams, Mark A
2012-03-14
Protein structures provide a valuable resource for rational drug design. For a protein with no known ligand, computational tools can predict surface pockets that are of suitable size and shape to accommodate a complementary small-molecule drug. However, pocket prediction against single static structures may miss features of pockets that arise from proteins' dynamic behaviour. In particular, ligand-binding conformations can be observed as transiently populated states of the apo protein, so it is possible to gain insight into ligand-bound forms by considering conformational variation in apo proteins. This variation can be explored by considering sets of related structures: computationally generated conformers, solution NMR ensembles, multiple crystal structures, homologues or homology models. It is non-trivial to compare pockets, either from different programs or across sets of structures. For a single structure, difficulties arise in defining particular pocket's boundaries. For a set of conformationally distinct structures the challenge is how to make reasonable comparisons between them given that a perfect structural alignment is not possible. We have developed a computational method, Provar, that provides a consistent representation of predicted binding pockets across sets of related protein structures. The outputs are probabilities that each atom or residue of the protein borders a predicted pocket. These probabilities can be readily visualised on a protein using existing molecular graphics software. We show how Provar simplifies comparison of the outputs of different pocket prediction algorithms, of pockets across multiple simulated conformations and between homologous structures. We demonstrate the benefits of use of multiple structures for protein-ligand and protein-protein interface analysis on a set of complexes and consider three case studies in detail: i) analysis of a kinase superfamily highlights the conserved occurrence of surface pockets at the active
Directory of Open Access Journals (Sweden)
Ting-Ying Jiang
Full Text Available The N-terminal starch binding domain of Rhizopus oryzae glucoamylase (RoSBD has a high binding affinity for raw starch. RoSBD has two ligand-binding sites, each containing a ligand-binding clamp: a polyN clamp residing near binding site I is unique in that it is expressed in only three members of carbohydrate binding module family 21 (CBM21 members, and a Y32/F58 clamp located at binding site II is conserved in several CBMs. Here we characterized different roles of these sites in the binding of insoluble and soluble starches using an amylose-iodine complex assay, atomic force microscopy, isothermal titration calorimetry, site-directed mutagenesis, and structural bioinformatics. RoSBD induced the release of iodine from the amylose helical cavity and disrupted the helical structure of amylose type III, thereby significantly diminishing the thickness and length of the amylose type III fibrils. A point mutation in the critical ligand-binding residues of sites I and II, however, reduced both the binding affinity and amylose helix disruption. This is the first molecular model for structure disruption of the amylose helix by a non-hydrolytic CBM21 member. RoSBD apparently twists the helical amylose strands apart to expose more ligand surface for further SBD binding. Repeating the process triggers the relaxation and unwinding of amylose helices to generate thinner and shorter amylose fibrils, which are more susceptible to hydrolysis by glucoamylase. This model aids in understanding the natural roles of CBMs in protein-glycan interactions and contributes to potential molecular engineering of CBMs.
Dictyostelium cells bind a secreted autocrine factor that represses cell proliferation
Choe, Jonathan M; Bakthavatsalam, Deenadayalan; Phillips, Jonathan E; Gomer, Richard H
2009-01-01
Abstract Background Dictyostelium cells secrete the proteins AprA and CfaD. Cells lacking either AprA or CfaD proliferate faster than wild type, while AprA or CfaD overexpressor cells proliferate slowly, indicating that AprA and CfaD are autocrine factors that repress proliferation. CfaD interacts with AprA and requires the presence of AprA to slow proliferation. To determine if CfaD is necessary for the ability of AprA to slow proliferation, whether AprA binds to cells, and if so whether the...
A novel role for the Bombyx Slbo homologue, BmC/EBP, in insect choriogenesis.
Sourmeli, S; Papantonis, A; Lecanidou, R
2005-11-18
One previously unidentified cDNA clone coding for a C/EBP factor, BmC/EBP, was isolated from Bombyx mori follicular cells. This is the first time that a C/EBP factor has been isolated and characterized in Lepidoptera. We provide information concerning structural features and developmental specificity, as well as in vitro interaction properties with chorion gene promoter modules. BmC/EBP was capable of effectively recognizing homologous binding sites from chorion gene promoters derived from flies and other moths, despite significant diversity of chorion structure, gene organization, and gene expression profiles. We propose that the relative concentration of BmC/EBP, in relation to its differential binding affinity for promoter cis-elements, results in activation or repression of silkmoth chorion gene expression.
Sequential binding of calcium ions to the B-repeat domain of SdrD from Staphylococcus aureus.
Roman, Andrei Yu; Devred, François; Lobatchov, Vladimir M; Makarov, Alexander A; Peyrot, Vincent; Kubatiev, Aslan A; Tsvetkov, Philipp O
2016-02-01
Biofilms of live bacteria forming on medical devices and implants contribute significantly to bacterial blood dissemination and to the spread of nosocomial infections. Cell surface SdrD protein plays a key role in the attachment of Staphylococcus aureus to the extracellular matrix (ECM) and in the formation of biofilm. SdrD binds calcium ions using its B1-B5 region bearing EF-hand Ca-binding sites, leading to conformational changes in the structure of SdrD. This alters the distance between the bacterial surface and the ECM-interacting domain of SdrD in a spring-like fashion, participating in bacterial attachment. In this study we investigated calcium binding to EF-hand sites of SdrD using isothermal titration calorimetry and determined the impact of this process on SdrD's thermodynamic stability. This allowed us to propose a model of B1-B5 reorganization upon binding of calcium and to get new insight into the molecular mechanism of SdrD's action.
Directory of Open Access Journals (Sweden)
Isabell Lang
2018-04-01
Full Text Available Progranulin (PGRN is a secreted anti-inflammatory protein which can be processed by neutrophil proteases to various granulins. It has been reported that at least a significant portion of the anti-inflammatory effects of PGRN is due to direct high affinity binding to tumor necrosis factor receptor-1 (TNFR1 and TNFR2 and inhibition of tumor necrosis factor (TNF-induced TNFR1/2 signaling. Two studies failed to reproduce the interaction of TNFR1 and TNFR2 with PGRN, but follow up reports speculated that this was due to varying experimental circumstances and/or the use of PGRN from different sources. However, even under consideration of these speculations, there is still a striking discrepancy in the literature between the concentrations of PGRN needed to inhibit TNF signaling and the concentrations required to block TNF binding to TNFR1 and TNFR2. While signaling events induced by 0.2–2 nM of TNF have been efficiently inhibited by low, near to equimolar concentrations (0.5–2.5 nM of PGRN in various studies, the reported inhibitory effects of PGRN on TNF-binding to TNFR1/2 required a huge excess of PGRN (100–1,000-fold. Therefore, we investigated the effect of PGRN on TNF binding to TNFR1 and TNFR2 in highly sensitive cellular binding studies. Unlabeled TNF inhibited >95% of the specific binding of a Gaussia princeps luciferase (GpL fusion protein of TNF to TNFR1 and TNFR2 and blocked binding of soluble GpL fusion proteins of TNFR1 and TNFR2 to membrane TNF expressing cells to >95%, too. Purified PGRN, however, showed in both assays no effect on TNF–TNFR1/2 interaction even when applied in huge excess. To rule out that tags and purification- or storage-related effects compromise the potential ability of PGRN to bind TNF receptors, we directly co-expressed PGRN, and as control TNF, in TNFR1- and TNFR2-expressing cells and looked for binding of GpL-TNF. While expression of TNF strongly inhibited binding of GpL-TNF to TNFR1/2, co
Mir, Mohammad A; Panganiban, Antonito T
2010-09-01
Hantavirus nucleocapsid protein (N) can replace the cellular cap-binding complex, eukaryotic initiation factor 4F (eIF4F), to mediate translation initiation. Although N can augment translation initiation of nonviral mRNA, initiation of viral mRNA by N is superior. All members of the Bunyaviridae family, including the species of the hantavirus genus, express either three or four primary mRNAs from their tripartite negative-sense genomes. The 5' ends of the mRNAs contain nonviral heterologous oligonucleotides that originate from endonucleolytic cleavage of cellular mRNA during the process of cap snatching. In the hantaviruses these caps terminate with a 3' G residue followed by nucleotides arising from the viral template. Further, the 5' untranslated region (UTR) of viral mRNA uniformly contains, near the 5' end, either two or three copies of the triplet repeat sequence, UAGUAG or UAGUAGUAG. Through analysis of a panel of mutants with mutations in the viral UTR, we found that the sequence GUAGUAG is sufficient for preferential N-mediated translation initiation and for high-affinity binding of N to the UTR. This heptanucleotide sequence is present in viral mRNA containing either two or three copies of the triplet repeat.
Granulocyte colony-stimulating factor in repeated IVF failure, a randomized trial.
Aleyasin, Ashraf; Abediasl, Zhila; Nazari, Atefeh; Sheikh, Mahdi
2016-06-01
Recent studies have revealed key roles for granulocyte colony-stimulating factor (GCSF) in embryo implantation process and maintenance of pregnancy, and some studies showed promising results by using local intrauterine infusion of GCSF in patients undergoing in vitro fertilization (IVF). This multicenter, randomized, controlled trial included 112 infertile women with repeated IVF failure to evaluate the efficacy of systemic single-dose subcutaneous GCSF administration on IVF success in these women. In this study, the Long Protocol of ovarian stimulation was used for all participants. Sealed, numbered envelopes assigned 56 patients to receive subcutaneous 300 µg GCSF before implantation and 56 in the control group. The implantation (number of gestational sacs on the total number of transferred embryos), chemical pregnancy (positive serum β-HCG), and clinical pregnancy (gestational sac and fetal heart) rates were compared between the two groups. This trial is registered at www.irct.ir (IRCT201503119568N11). The successful implantation (18% vs 7.2%, P=0.007), chemical pregnancy (44.6% vs 19.6%, P=0.005), and clinical pregnancy (37.5% vs 14.3%, P=0.005) rates were significantly higher in the intervention group than in the control group. After adjustment for participants' age, endometrial thickness, good-quality oocyte counts, number of transferred embryos, and anti-Mullerian hormone levels, GCSF treatment remained significantly associated with successful implantation (OR=2.63, 95% CI=1.09-6.96), having chemical pregnancy (OR= 2.74, 95% CI=1.11-7.38) and clinical pregnancy (OR=2.94, 95% CI=1.23-8.33). In conclusion, administration of single-dose systemic subcutaneous GCSF before implantation significantly increases the IVF success, implantation, and pregnancy rates in infertile women with repeated IVF failure. © 2016 Society for Reproduction and Fertility.
Detection, characterization and evolution of internal repeats in Chitinases of known 3-D structure.
Directory of Open Access Journals (Sweden)
Manigandan Sivaji
Full Text Available Chitinase proteins have evolved and diversified almost in all organisms ranging from prokaryotes to eukaryotes. During evolution, internal repeats may appear in amino acid sequences of proteins which alter the structural and functional features. Here we deciphered the internal repeats from Chitinase and characterized the structural similarities between them. Out of 24 diverse Chitinase sequences selected, six sequences (2CJL, 2DSK, 2XVP, 2Z37, 3EBV and 3HBE did not contain any internal repeats of amino acid sequences. Ten sequences contained repeats of length <50, and the remaining 8 sequences contained repeat length between 50 and 100 residues. Two Chitinase sequences, 1ITX and 3SIM, were found to be structurally similar when analyzed using secondary structure of Chitinase from secondary and 3-Dimensional structure database of Protein Data Bank. Internal repeats of 3N17 and 1O6I were also involved in the ligand-binding site of those Chitinase proteins, respectively. Our analyses enhance our understanding towards the identification of structural characteristics of internal repeats in Chitinase proteins.
Sanders, Steven L.; Arida, Ahmad R.; Phan, Funita P.
2010-01-01
Activation of DNA damage checkpoints requires the rapid accumulation of numerous factors to sites of genomic lesions, and deciphering the mechanisms of this targeting is central to our understanding of DNA damage response. Histone modification has recently emerged as a critical element for the correct localization of damage response proteins, and one key player in this context is the fission yeast checkpoint mediator Crb2. Accumulation of Crb2 at ionizing irradiation-induced double-strand breaks (DSBs) requires two distinct histone marks, dimethylated H4 lysine 20 (H4K20me2) and phosphorylated H2AX (pH2AX). A tandem tudor motif in Crb2 directly binds H4K20me2, and this interaction is required for DSB targeting and checkpoint activation. Similarly, pH2AX is required for Crb2 localization to DSBs and checkpoint control. Crb2 can directly bind pH2AX through a pair of C-terminal BRCT repeats, but the functional significance of this binding has been unclear. Here we demonstrate that loss of its pH2AX-binding activity severely impairs the ability of Crb2 to accumulate at ionizing irradiation-induced DSBs, compromises checkpoint signaling, and disrupts checkpoint-mediated cell cycle arrest. These impairments are similar to that reported for abolition of pH2AX or mutation of the H4K20me2-binding tudor motif of Crb2. Intriguingly, a combined ablation of its two histone modification binding modules yields a strikingly additive reduction in Crb2 activity. These observations argue that binding of the Crb2 BRCT repeats to pH2AX is critical for checkpoint activity and provide new insight into the mechanisms of chromatin-mediated genome stability. PMID:20679488
Sanders, Steven L; Arida, Ahmad R; Phan, Funita P
2010-10-01
Activation of DNA damage checkpoints requires the rapid accumulation of numerous factors to sites of genomic lesions, and deciphering the mechanisms of this targeting is central to our understanding of DNA damage response. Histone modification has recently emerged as a critical element for the correct localization of damage response proteins, and one key player in this context is the fission yeast checkpoint mediator Crb2. Accumulation of Crb2 at ionizing irradiation-induced double-strand breaks (DSBs) requires two distinct histone marks, dimethylated H4 lysine 20 (H4K20me2) and phosphorylated H2AX (pH2AX). A tandem tudor motif in Crb2 directly binds H4K20me2, and this interaction is required for DSB targeting and checkpoint activation. Similarly, pH2AX is required for Crb2 localization to DSBs and checkpoint control. Crb2 can directly bind pH2AX through a pair of C-terminal BRCT repeats, but the functional significance of this binding has been unclear. Here we demonstrate that loss of its pH2AX-binding activity severely impairs the ability of Crb2 to accumulate at ionizing irradiation-induced DSBs, compromises checkpoint signaling, and disrupts checkpoint-mediated cell cycle arrest. These impairments are similar to that reported for abolition of pH2AX or mutation of the H4K20me2-binding tudor motif of Crb2. Intriguingly, a combined ablation of its two histone modification binding modules yields a strikingly additive reduction in Crb2 activity. These observations argue that binding of the Crb2 BRCT repeats to pH2AX is critical for checkpoint activity and provide new insight into the mechanisms of chromatin-mediated genome stability.
Directory of Open Access Journals (Sweden)
Orlov Yuriy
2012-06-01
Full Text Available Advances in high throughput sequencing technology have enabled the identification of transcription factor (TF binding sites in genome scale. TF binding studies are important for medical applications and stem cell research. Somatic cells can be reprogrammed to a pluripotent state by the combined introduction of factors such as Oct4, Sox2, c-Myc, Klf4. These reprogrammed cells share many characteristics with embryonic stem cells (ESCs and are known as induced pluripotent stem cells (iPSCs. The signaling requirements for maintenance of human and murine embryonic stem cells (ESCs differ considerably. Genome wide ChIP-seq TF binding maps in mouse stem cells include Oct4, Sox2, Nanog, Tbx3, Smad2 as well as group of other factors. ChIP-seq allows study of new candidate transcription factors for reprogramming. It was shown that Nr5a2 could replace Oct4 for reprogramming. Epigenetic modifications play important role in regulation of gene expression adding additional complexity to transcription network functioning. We have studied associations between different histone modification using published data together with RNA Pol II sites. We found strong associations between activation marks and TF binding sites and present it qualitatively. To meet issues of statistical analysis of genome ChIP-sequencing maps we developed computer program to filter out noise signals and find significant association between binding site affinity and number of sequence reads. The data provide new insights into the function of chromatin organization and regulation in stem cells.
Amirhaeri, S; Wohlrab, F; Wells, R D
1995-02-17
The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.
Evolving Transcription Factor Binding Site Models From Protein Binding Microarray Data
Wong, Ka-Chun; Peng, Chengbin; Li, Yue
2016-01-01
Protein binding microarray (PBM) is a high-throughput platform that can measure the DNA binding preference of a protein in a comprehensive and unbiased manner. In this paper, we describe the PBM motif model building problem. We apply several evolutionary computation methods and compare their performance with the interior point method, demonstrating their performance advantages. In addition, given the PBM domain knowledge, we propose and describe a novel method called kmerGA which makes domain-specific assumptions to exploit PBM data properties to build more accurate models than the other models built. The effectiveness and robustness of kmerGA is supported by comprehensive performance benchmarking on more than 200 datasets, time complexity analysis, convergence analysis, parameter analysis, and case studies. To demonstrate its utility further, kmerGA is applied to two real world applications: 1) PBM rotation testing and 2) ChIP-Seq peak sequence prediction. The results support the biological relevance of the models learned by kmerGA, and thus its real world applicability.
Evolving Transcription Factor Binding Site Models From Protein Binding Microarray Data
Wong, Ka-Chun
2016-02-02
Protein binding microarray (PBM) is a high-throughput platform that can measure the DNA binding preference of a protein in a comprehensive and unbiased manner. In this paper, we describe the PBM motif model building problem. We apply several evolutionary computation methods and compare their performance with the interior point method, demonstrating their performance advantages. In addition, given the PBM domain knowledge, we propose and describe a novel method called kmerGA which makes domain-specific assumptions to exploit PBM data properties to build more accurate models than the other models built. The effectiveness and robustness of kmerGA is supported by comprehensive performance benchmarking on more than 200 datasets, time complexity analysis, convergence analysis, parameter analysis, and case studies. To demonstrate its utility further, kmerGA is applied to two real world applications: 1) PBM rotation testing and 2) ChIP-Seq peak sequence prediction. The results support the biological relevance of the models learned by kmerGA, and thus its real world applicability.
Directory of Open Access Journals (Sweden)
Eunyoung Seo
2016-08-01
Full Text Available Plants have evolved an elaborate innate immune system against invading pathogens. Within this system, intracellular nucleotide-binding leucine-rich repeat (NLR immune receptors are known play critical roles in effector-triggered immunity (ETI plant defense. We performed genome-wide identification and classification of NLR-coding sequences from the genomes of pepper, tomato, and potato using fixed criteria. We then compared genomic duplication and evolution features. We identified intact 267, 443, and 755 NLR-encoding genes in tomato, potato, and pepper genomes, respectively. Phylogenetic analyses and classification of Solanaceae NLRs revealed that the majority of NLR super family members fell into 14 subgroups, including a TIR-NLR (TNL subgroup and 13 non-TNL subgroups. Specific subgroups have expanded in each genome, with the expansion in pepper showing subgroup-specific physical clusters. Comparative analysis of duplications showed distinct duplication patterns within pepper and among Solanaceae plants suggesting subgroup- or species-specific gene duplication events after speciation, resulting in divergent evolution. Taken together, genome-wide analyses of NLR family members provide insights into their evolutionary history in Solanaceae. These findings also provide important foundational knowledge for understanding NLR evolution and will empower broader characterization of disease resistance genes to be used for crop breeding.
Knappy, Chris; Barillà, Daniela; Chong, James; Hodgson, Dominic; Morgan, Hugh; Suleman, Muhammad; Tan, Christine; Yao, Peng; Keely, Brendan
2015-12-01
Higher homologues of widely reported C(86) isoprenoid diglycerol tetraether lipid cores, containing 0-6 cyclopentyl rings, have been identified in (hyper)thermophilic archaea, representing up to 21% of total tetraether lipids in the cells. Liquid chromatography-tandem mass spectrometry confirms that the additional carbon atoms in the C(87-88) homologues are located in the etherified chains. Structures identified include dialkyl and monoalkyl ('H-shaped') tetraethers containing C(40-42) or C(81-82) hydrocarbons, respectively, many representing novel compounds. Gas chromatography-mass spectrometric analysis of hydrocarbons released from the lipid cores by ether cleavage suggests that the C(40) chains are biphytanes and the C(41) chains 13-methylbiphytanes. Multiple isomers, having different chain combinations, were recognised among the dialkyl lipids. Methylated tetraethers are produced by Methanothermobacter thermautotrophicus in varying proportions depending on growth conditions, suggesting that methylation may be an adaptive mechanism to regulate cellular function. The detection of methylated lipids in Pyrobaculum sp. AQ1.S2 and Sulfolobus acidocaldarius represents the first reported occurrences in Crenarchaeota. Soils and aquatic sediments from geographically distinct mesotemperate environments that were screened for homologues contained monomethylated tetraethers, with di- and trimethylated structures being detected occasionally. The structural diversity and range of occurrences of the C(87-89) tetraethers highlight their potential as complementary biomarkers for archaea in natural environments. Copyright © 2015 John Wiley & Sons, Ltd.
International Nuclear Information System (INIS)
Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim
2005-01-01
E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation
Jonsson, Andreas; Wållberg, Helena; Herne, Nina; Ståhl, Stefan; Frejd, Fredrik Y
2009-08-17
Affibody molecules specific for human TNF-alpha (tumour necrosis factor-alpha) were selected by phage-display technology from a library based on the 58-residue Protein A-derived Z domain. TNF-alpha is a proinflammatory cytokine involved in several inflammatory diseases and, to this day, four TNF-alpha-blocking protein pharmaceuticals have been approved for clinical use. The phage selection generated 18 unique cysteine-free affibody sequences of which 12 were chosen, after sequence cluster analysis, for characterization as proteins. Biosensor binding studies of the 12 Escherichia coli-produced and IMAC (immobilized-metal-ion affinity chromatography)-purified affibody molecules revealed three variants that demonstrated the strongest binding to human TNF-alpha. These three affibody molecules were subjected to kinetic binding analysis and also tested for their binding to mouse, rat and pig TNF-alpha. For ZTNF-alpha:185, subnanomolar affinity (KD=0.1-0.5 nM) for human TNF-alpha was demonstrated, as well as significant binding to TNF-alpha from the other species. Furthermore, the binding site was found to overlap with the binding site for the TNF-alpha receptor, since this interaction could be efficiently blocked by the ZTNF-alpha:185 affibody. When investigating six dimeric affibody constructs with different linker lengths, and one trimeric construct, it was found that the inhibition of the TNF-alpha binding to its receptor could be further improved by using dimers with extended linkers and/or a trimeric affibody construct. The potential implication of the results for the future design of affibody-based reagents for the diagnosis of inflammation is discussed.
Muiño, J.M.; Bruijn, de S.A.; Vingron, Martin; Angenent, G.C.; Kaufmann, K.
2015-01-01
Plant development is controlled by transcription factors (TFs) which form complex gene-regulatory networks. Genome-wide TF DNA-binding studies revealed that these TFs have several thousands of binding sites in the Arabidopsis genome, and may regulate the expression of many genes directly. Given the
Effects of cytosine methylation on transcription factor binding sites
Medvedeva, Yulia A
2014-03-26
Background: DNA methylation in promoters is closely linked to downstream gene repression. However, whether DNA methylation is a cause or a consequence of gene repression remains an open question. If it is a cause, then DNA methylation may affect the affinity of transcription factors (TFs) for their binding sites (TFBSs). If it is a consequence, then gene repression caused by chromatin modification may be stabilized by DNA methylation. Until now, these two possibilities have been supported only by non-systematic evidence and they have not been tested on a wide range of TFs. An average promoter methylation is usually used in studies, whereas recent results suggested that methylation of individual cytosines can also be important.Results: We found that the methylation profiles of 16.6% of cytosines and the expression profiles of neighboring transcriptional start sites (TSSs) were significantly negatively correlated. We called the CpGs corresponding to such cytosines " traffic lights" We observed a strong selection against CpG " traffic lights" within TFBSs. The negative selection was stronger for transcriptional repressors as compared with transcriptional activators or multifunctional TFs as well as for core TFBS positions as compared with flanking TFBS positions.Conclusions: Our results indicate that direct and selective methylation of certain TFBS that prevents TF binding is restricted to special cases and cannot be considered as a general regulatory mechanism of transcription. 2013 Medvedeva et al.; licensee BioMed Central Ltd.
Linke, Christian; Siemens, Nikolai; Oehmcke, Sonja; Radjainia, Mazdak; Law, Ruby H P; Whisstock, James C; Baker, Edward N; Kreikemeyer, Bernd
2012-11-02
Streptococcus pyogenes is an exclusively human pathogen. Streptococcal attachment to and entry into epithelial cells is a prerequisite for a successful infection of the human host and requires adhesins. Here, we demonstrate that the multidomain protein Epf from S. pyogenes serotype M49 is a streptococcal adhesin. An epf-deficient mutant showed significantly decreased adhesion to and internalization into human keratinocytes. Cell adhesion is mediated by the N-terminal domain of Epf (EpfN) and increased by the human plasma protein plasminogen. The crystal structure of EpfN, solved at 1.6 Å resolution, shows that it consists of two subdomains: a carbohydrate-binding module and a fibronectin type III domain. Both fold types commonly participate in ligand receptor and protein-protein interactions. EpfN is followed by 18 repeats of a domain classified as DUF1542 (domain of unknown function 1542) and a C-terminal cell wall sorting signal. The DUF1542 repeats are not involved in adhesion, but biophysical studies show they are predominantly α-helical and form a fiber-like stalk of tandem DUF1542 domains. Epf thus conforms with the widespread family of adhesins known as MSCRAMMs (microbial surface components recognizing adhesive matrix molecules), in which a cell wall-attached stalk enables long range interactions via its adhesive N-terminal domain.
Melanin-binding radiopharmaceuticals
International Nuclear Information System (INIS)
Packer, S.; Fairchild, R.G.; Watts, K.P.; Greenberg, D.; Hannon, S.J.
1980-01-01
The scope of this paper is limited to an analysis of the factors that are important to the relationship of radiopharmaceuticals to melanin. While the authors do not attempt to deal with differences between melanin-binding vs. melanoma-binding, a notable variance is assumed
Directory of Open Access Journals (Sweden)
Vera Forsbach-Birk
Full Text Available Enzootic abortion of ewes (EAE due to infection with the obligate intracellular pathogen Chlamydia (C. abortus is an important zoonosis leading to considerable economic loss to agriculture worldwide. The pathogen can be transmitted to humans and may lead to serious infection in pregnant women. Knowledge about epidemiology, clinical course and transmission to humans is hampered by the lack of reliable diagnostic tools. Immunoreactive proteins, which are expressed in infected animals and humans, may serve as novel candidates for diagnostic marker proteins and represent putative virulence factors. In order to broaden the spectrum of immunogenic C. abortus proteins we applied 2D immunoblot analysis and screening of an expression library using human and animal sera. We have identified 48 immunoreactive proteins representing potential diagnostic markers and also putative virulence factors, such as CAB080 (homologue of the "macrophage infectivity potentiator", MIP, CAB167 (homologue of the "translocated actin recruitment protein", TARP, CAB712 (homologue of the "chlamydial protease-like activity factor", CPAF, CAB776 (homologue of the "Polymorphic membrane protein D", PmpD, and the "hypothetical proteins" CAB063, CAB408 and CAB821, which are predicted to be type III secreted. We selected two putative virulence factors for further characterization, i.e. CAB080 (cMIP and CAB063, and studied their expression profiles at transcript and protein levels. Analysis of the subcellular localization of both proteins throughout the developmental cycle revealed CAB063 being the first C. abortus protein shown to be translocated to the host cell nucleus.
Forsbach-Birk, Vera; Foddis, Corinna; Simnacher, Ulrike; Wilkat, Max; Longbottom, David; Walder, Gernot; Benesch, Christiane; Ganter, Martin; Sachse, Konrad; Essig, Andreas
2013-01-01
Enzootic abortion of ewes (EAE) due to infection with the obligate intracellular pathogen Chlamydia (C.) abortus is an important zoonosis leading to considerable economic loss to agriculture worldwide. The pathogen can be transmitted to humans and may lead to serious infection in pregnant women. Knowledge about epidemiology, clinical course and transmission to humans is hampered by the lack of reliable diagnostic tools. Immunoreactive proteins, which are expressed in infected animals and humans, may serve as novel candidates for diagnostic marker proteins and represent putative virulence factors. In order to broaden the spectrum of immunogenic C. abortus proteins we applied 2D immunoblot analysis and screening of an expression library using human and animal sera. We have identified 48 immunoreactive proteins representing potential diagnostic markers and also putative virulence factors, such as CAB080 (homologue of the "macrophage infectivity potentiator", MIP), CAB167 (homologue of the "translocated actin recruitment protein", TARP), CAB712 (homologue of the "chlamydial protease-like activity factor", CPAF), CAB776 (homologue of the "Polymorphic membrane protein D", PmpD), and the "hypothetical proteins" CAB063, CAB408 and CAB821, which are predicted to be type III secreted. We selected two putative virulence factors for further characterization, i.e. CAB080 (cMIP) and CAB063, and studied their expression profiles at transcript and protein levels. Analysis of the subcellular localization of both proteins throughout the developmental cycle revealed CAB063 being the first C. abortus protein shown to be translocated to the host cell nucleus.
Energy Technology Data Exchange (ETDEWEB)
Rodriguez-Tebar, A.; Barde, Y.A.
1988-09-01
Brain-derived neurotrophic factor (BDNF), a protein known to support the survival of embryonic sensory neurons and retinal ganglion cells, was derivatized with 125I-Bolton-Hunter reagent and obtained in a biologically active, radioactive form (125I-BDNF). Using dorsal root ganglion neurons from chick embryos at 9 d of development, the basic physicochemical parameters of the binding of 125I-BDNF with its receptors were established. Two different classes of receptors were found, with dissociation constants of 1.7 x 10(-11) M (high-affinity receptors) and 1.3 x 10(-9) M (low-affinity receptors). Unlabeled BDNF competed with 125I-BDNF for binding to the high-affinity receptors with an inhibition constant essentially identical to the dissociation constant of the labeled protein: 1.2 x 10(-11) M. The association and dissociation rates from both types of receptors were also determined, and the dissociation constants calculated from these kinetic experiments were found to correspond to the results obtained from steady-state binding. The number of high-affinity receptors (a few hundred per cell soma) was 15 times lower than that of low-affinity receptors. No high-affinity receptors were found on sympathetic neurons, known not to respond to BDNF, although specific binding of 125I-BDNF to these cells was detected at a high concentration of the radioligand. These results are discussed and compared with those obtained with nerve growth factor on the same neuronal populations.
International Nuclear Information System (INIS)
Rodriguez-Tebar, A.; Barde, Y.A.
1988-01-01
Brain-derived neurotrophic factor (BDNF), a protein known to support the survival of embryonic sensory neurons and retinal ganglion cells, was derivatized with 125I-Bolton-Hunter reagent and obtained in a biologically active, radioactive form (125I-BDNF). Using dorsal root ganglion neurons from chick embryos at 9 d of development, the basic physicochemical parameters of the binding of 125I-BDNF with its receptors were established. Two different classes of receptors were found, with dissociation constants of 1.7 x 10(-11) M (high-affinity receptors) and 1.3 x 10(-9) M (low-affinity receptors). Unlabeled BDNF competed with 125I-BDNF for binding to the high-affinity receptors with an inhibition constant essentially identical to the dissociation constant of the labeled protein: 1.2 x 10(-11) M. The association and dissociation rates from both types of receptors were also determined, and the dissociation constants calculated from these kinetic experiments were found to correspond to the results obtained from steady-state binding. The number of high-affinity receptors (a few hundred per cell soma) was 15 times lower than that of low-affinity receptors. No high-affinity receptors were found on sympathetic neurons, known not to respond to BDNF, although specific binding of 125I-BDNF to these cells was detected at a high concentration of the radioligand. These results are discussed and compared with those obtained with nerve growth factor on the same neuronal populations
Rigden, Daniel J; Thomas, Jens M H; Simkovic, Felix; Simpkin, Adam; Winn, Martyn D; Mayans, Olga; Keegan, Ronan M
2018-03-01
Molecular replacement (MR) is the predominant route to solution of the phase problem in macromolecular crystallography. Although routine in many cases, it becomes more effortful and often impossible when the available experimental structures typically used as search models are only distantly homologous to the target. Nevertheless, with current powerful MR software, relatively small core structures shared between the target and known structure, of 20-40% of the overall structure for example, can succeed as search models where they can be isolated. Manual sculpting of such small structural cores is rarely attempted and is dependent on the crystallographer's expertise and understanding of the protein family in question. Automated search-model editing has previously been performed on the basis of sequence alignment, in order to eliminate, for example, side chains or loops that are not present in the target, or on the basis of structural features (e.g. solvent accessibility) or crystallographic parameters (e.g. B factors). Here, based on recent work demonstrating a correlation between evolutionary conservation and protein rigidity/packing, novel automated ways to derive edited search models from a given distant homologue over a range of sizes are presented. A variety of structure-based metrics, many readily obtained from online webservers, can be fed to the MR pipeline AMPLE to produce search models that succeed with a set of test cases where expertly manually edited comparators, further processed in diverse ways with MrBUMP, fail. Further significant performance gains result when the structure-based distance geometry method CONCOORD is used to generate ensembles from the distant homologue. To our knowledge, this is the first such approach whereby a single structure is meaningfully transformed into an ensemble for the purposes of MR. Additional cases further demonstrate the advantages of the approach. CONCOORD is freely available and computationally inexpensive, so
Environmental stress induces trinucleotide repeat mutagenesis in human cells.
Chatterjee, Nimrat; Lin, Yunfu; Santillan, Beatriz A; Yotnda, Patricia; Wilson, John H
2015-03-24
The dynamic mutability of microsatellite repeats is implicated in the modification of gene function and disease phenotype. Studies of the enhanced instability of long trinucleotide repeats (TNRs)-the cause of multiple human diseases-have revealed a remarkable complexity of mutagenic mechanisms. Here, we show that cold, heat, hypoxic, and oxidative stresses induce mutagenesis of a long CAG repeat tract in human cells. We show that stress-response factors mediate the stress-induced mutagenesis (SIM) of CAG repeats. We show further that SIM of CAG repeats does not involve mismatch repair, nucleotide excision repair, or transcription, processes that are known to promote TNR mutagenesis in other pathways of instability. Instead, we find that these stresses stimulate DNA rereplication, increasing the proportion of cells with >4 C-value (C) DNA content. Knockdown of the replication origin-licensing factor CDT1 eliminates both stress-induced rereplication and CAG repeat mutagenesis. In addition, direct induction of rereplication in the absence of stress also increases the proportion of cells with >4C DNA content and promotes repeat mutagenesis. Thus, environmental stress triggers a unique pathway for TNR mutagenesis that likely is mediated by DNA rereplication. This pathway may impact normal cells as they encounter stresses in their environment or during development or abnormal cells as they evolve metastatic potential.
Hannachi Imen, Elloumi; Nakamura, Makiko; Mie, Masayasu; Kobatake, Eiry
2009-01-01
The development of different techniques based on natural and polymeric scaffolds are useful for the design of different biomimetic materials. These approaches, however, require supplementary steps for the chemical or physical modification of the biomaterial. To avoid such steps, in the present study, we constructed a new multifunctional protein that can be easily immobilized onto hydrophobic surfaces, and at the same time helps enhance specific cell adhesion and proliferation onto collagen substrates. A collagen binding domain was fused to a previously constructed protein, which had an epidermal growth factor fused to a hydrophobic peptide that allows for cell adhesion. The new fusion protein, designated fnCBD-ERE-EGF is produced in Escherichia coli, and its abilities to bind to collagen and promote cell proliferation were investigated. fnCBD-ERE-EGF was shown to keep both collagen binding and cell growth-promoting activities comparable to those of the corresponding unfused proteins. The results obtained in this study also suggest the use of a fnCBD-ERE-EGF as an alternative for the design of multifunctional ECM-bound growth factor based materials.
The toxic equivalency (TEQ) values of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/Fs) are predicted with a model based on the homologue concentrations measured from a laboratory-scale reactor (124 data points), a package boiler (61 data points), and ...
Comprehensive mutational profiling of core binding factor acute myeloid leukemia.
Duployez, Nicolas; Marceau-Renaut, Alice; Boissel, Nicolas; Petit, Arnaud; Bucci, Maxime; Geffroy, Sandrine; Lapillonne, Hélène; Renneville, Aline; Ragu, Christine; Figeac, Martin; Celli-Lebras, Karine; Lacombe, Catherine; Micol, Jean-Baptiste; Abdel-Wahab, Omar; Cornillet, Pascale; Ifrah, Norbert; Dombret, Hervé; Leverger, Guy; Jourdan, Eric; Preudhomme, Claude
2016-05-19
Acute myeloid leukemia (AML) with t(8;21) or inv(16) have been recognized as unique entities within AML and are usually reported together as core binding factor AML (CBF-AML). However, there is considerable clinical and biological heterogeneity within this group of diseases, and relapse incidence reaches up to 40%. Moreover, translocations involving CBFs are not sufficient to induce AML on its own and the full spectrum of mutations coexisting with CBF translocations has not been elucidated. To address these issues, we performed extensive mutational analysis by high-throughput sequencing in 215 patients with CBF-AML enrolled in the Phase 3 Trial of Systematic Versus Response-adapted Timed-Sequential Induction in Patients With Core Binding Factor Acute Myeloid Leukemia and Treating Patients with Childhood Acute Myeloid Leukemia with Interleukin-2 trials (age, 1-60 years). Mutations in genes activating tyrosine kinase signaling (including KIT, N/KRAS, and FLT3) were frequent in both subtypes of CBF-AML. In contrast, mutations in genes that regulate chromatin conformation or encode members of the cohesin complex were observed with high frequencies in t(8;21) AML (42% and 18%, respectively), whereas they were nearly absent in inv(16) AML. High KIT mutant allele ratios defined a group of t(8;21) AML patients with poor prognosis, whereas high N/KRAS mutant allele ratios were associated with the lack of KIT or FLT3 mutations and a favorable outcome. In addition, mutations in epigenetic modifying or cohesin genes were associated with a poor prognosis in patients with tyrosine kinase pathway mutations, suggesting synergic cooperation between these events. These data suggest that diverse cooperating mutations may influence CBF-AML pathophysiology as well as clinical behavior and point to potential unique pathogenesis of t(8;21) vs inv(16) AML. © 2016 by The American Society of Hematology.
Directory of Open Access Journals (Sweden)
Saul Herranz-Martin
2017-07-01
Full Text Available Intronic GGGGCC repeat expansions in C9orf72 are the most common genetic cause of amyotrophic lateral sclerosis (ALS and frontotemporal dementia (FTD. Two major pathologies stemming from the hexanucleotide RNA expansions (HREs have been identified in postmortem tissue: intracellular RNA foci and repeat-associated non-ATG dependent (RAN dipeptides, although it is unclear how these and other hallmarks of disease contribute to the pathophysiology of neuronal injury. Here, we describe two novel lines of mice that overexpress either 10 pure or 102 interrupted GGGGCC repeats mediated by adeno-associated virus (AAV and recapitulate the relevant human pathology and disease-related behavioural phenotypes. Similar levels of intracellular RNA foci developed in both lines of mice, but only mice expressing 102 repeats generated C9orf72 RAN pathology, neuromuscular junction (NMJ abnormalities, dispersal of the hippocampal CA1, enhanced apoptosis, and deficits in gait and cognition. Neither line of mice, however, showed extensive TAR DNA-binding protein 43 (TDP-43 pathology or neurodegeneration. Our data suggest that RNA foci pathology is not a good predictor of C9orf72 RAN dipeptide formation, and that RAN dipeptides and NMJ dysfunction are drivers of C9orf72 disease pathogenesis. These AAV-mediated models of C9orf72-associated ALS/FTD will be useful tools for studying disease pathophysiology and developing new therapeutic approaches.
Photoaffinity labelling of high affinity dopamine binding proteins
International Nuclear Information System (INIS)
Ross, G.M.; McCarry, B.E.; Mishra, R.K.
1986-01-01
A photoactive analogue of the dopamine agonist 2-amino-6,7-dihydroxy-1,2,3,4-tetrahydronapthalene (ADTN) has been synthesized and used to photoaffinity label dopamine binding proteins prepared from bovine caudate nucleus. N-(3-]N'-4-azidobenzamidol]-aminopropyl)-aminopropyl)-ADTN (AzB-AP-ADTN) was incubated with caudate membranes and irradiated with UV light. Membranes were then repeatedly washed by centrifugation to remove excess photolabel. A binding assay, using ( 3 H)-SCH 23390 (a D 1 specific antagonist), was then performed to evaluate the loss of receptor density in the photolyzed preparation. AzB-AP-ADTN irreversibly blocked ( 3 H)-SCH 23390 binding in a dose-dependent manner. Scatchard analysis revealed a decrease in the B/sub max/, with no significant change in the K/sub d/, of ( 3 H)-SCH 23390 binding. Compounds which compete for D 1 receptor binding (such as dopamine, SKF 38393 or apomorphine), proteted the SCH 23390 binding site from inactivation. This data would suggest that the novel photoaffinity ligand, AzB-AP-ADTN, can covalently label the D 1 (adenylate cyclase linked) dopamine receptor
Directory of Open Access Journals (Sweden)
Salvatore Loguercio
2018-03-01
Full Text Available CCCTC-binding factor (CTCF is largely responsible for the 3D architecture of the genome, in concert with the action of cohesin, through the creation of long-range chromatin loops. Cohesin is hypothesized to be the main driver of these long-range chromatin interactions by the process of loop extrusion. Here, we performed ChIP-seq for CTCF and cohesin in two stages each of T and B cell differentiation and examined the binding pattern in all six antigen receptor (AgR loci in these lymphocyte progenitors and in mature T and B cells, ES cells, and fibroblasts. The four large AgR loci have many bound CTCF sites, most of which are only occupied in lymphocytes, while only the CTCF sites at the end of each locus near the enhancers or J genes tend to be bound in non-lymphoid cells also. However, despite the generalized lymphocyte restriction of CTCF binding in AgR loci, the Igκ locus is the only locus that also shows significant lineage-specificity (T vs. B cells and developmental stage-specificity (pre-B vs. pro-B in CTCF binding. We show that cohesin binding shows greater lineage- and stage-specificity than CTCF at most AgR loci, providing more specificity to the loops. We also show that the culture of pro-B cells in IL7, a common practice to expand the number of cells before ChIP-seq, results in a CTCF-binding pattern resembling pre-B cells, as well as other epigenetic and transcriptional characteristics of pre-B cells. Analysis of the orientation of the CTCF sites show that all sites within the large V portions of the Igh and TCRβ loci have the same orientation. This suggests either a lack of requirement for convergent CTCF sites creating loops, or indicates an absence of any loops between CTCF sites within the V region portion of those loci but only loops to the convergent sites at the D-J-enhancer end of each locus. The V region portions of the Igκ and TCRα/δ loci, by contrast, have CTCF sites in both orientations, providing many options for
International Nuclear Information System (INIS)
Gray, P.W.; Barrett, K.; Chantry, D.; Turner, M.; Feldmann, M.
1990-01-01
The cDNA for one of the receptors for human tumor necrosis factor (TNF) has been isolated. This cDNA encodes a protein of 455 amino acids that is divided into an extracellular domain of 171 residues and a cytoplasmic domain of 221 residues. The extracellular domain has been engineered for expression in mammalian cells, and this recombinant derivative binds TNFα with high affinity and inhibits its cytotoxic activity in vitro. The TNF receptor exhibits similarity with a family of cell surface proteins that includes the nerve growth factor receptor, the human B-cell surface antigen CD40, and the rat T-cell surface antigen OX40. The TNF receptor contains four cysteine-rich subdomains in the extracellular portion. Mammalian cells transfected with the entire TNF receptor cDNA bind radiolabeled TNFα with an affinity of 2.5 x 10 -9 M. This binding can be competitively inhibited with unlabeled TNFα or lymphotoxin (TNFβ)
Gray, Patrick W.; Barrett, Kathy; Chantry, David; Turner, Martin; Feldmann, Marc
1990-10-01
The cDNA for one of the receptors for human tumor necrosis factor (TNF) has been isolated. This cDNA encodes a protein of 455 amino acids that is divided into an extracellular domain of 171 residues and a cytoplasmic domain of 221 residues. The extracellular domain has been engineered for expression in mammalian cells, and this recombinant derivative binds TNFα with high affinity and inhibits its cytotoxic activity in vitro. The TNF receptor exhibits similarity with a family of cell surface proteins that includes the nerve growth factor receptor, the human B-cell surface antigen CD40, and the rat T-cell surface antigen OX40. The TNF receptor contains four cysteine-rich subdomains in the extra-cellular portion. Mammalian cells transfected with the entire TNF receptor cDNA bind radiolabeled TNFα with an affinity of 2.5 x 10-9 M. This binding can be competitively inhibited with unlabeled TNFα or lymphotoxin (TNFβ).
Taylor, Eric S; Pol-Fachin, Laercio; Lins, Roberto D; Lower, Steven K
2017-04-01
The epidermal growth factor receptor (EGFR) is an important transmembrane glycoprotein kinase involved the initiation or perpetuation of signal transduction cascades within cells. These processes occur after EGFR binds to a ligand [epidermal growth factor (EGF)], thus inducing its dimerization and tyrosine autophosphorylation. Previous publications have highlighted the importance of glycosylation and dimerization for promoting proper function of the receptor and conformation in membranes; however, the effects of these associations on the protein conformational stability have not yet been described. Molecular dynamics simulations were performed to characterize the conformational preferences of the monomeric and dimeric forms of the EGFR extracellular domain upon binding to EGF in the presence and absence of N-glycan moieties. Structural stability analyses revealed that EGF provides the most conformational stability to EGFR, followed by glycosylation and dimerization, respectively. The findings also support that EGF-EGFR binding takes place through a large-scale induced-fitting mechanism. Proteins 2017; 85:561-570. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
The effect of gamma-enhancing binaural beats on the control of feature bindings.
Colzato, Lorenza S; Steenbergen, Laura; Sellaro, Roberta
2017-07-01
Binaural beats represent the auditory experience of an oscillating sound that occurs when two sounds with neighboring frequencies are presented to one's left and right ear separately. Binaural beats have been shown to impact information processing via their putative role in increasing neural synchronization. Recent studies of feature-repetition effects demonstrated interactions between perceptual features and action-related features: repeating only some, but not all features of a perception-action episode hinders performance. These partial-repetition (or binding) costs point to the existence of temporary episodic bindings (event files) that are automatically retrieved by repeating at least one of their features. Given that neural synchronization in the gamma band has been associated with visual feature bindings, we investigated whether the impact of binaural beats extends to the top-down control of feature bindings. Healthy adults listened to gamma-frequency (40 Hz) binaural beats or to a constant tone of 340 Hz (control condition) for ten minutes before and during a feature-repetition task. While the size of visuomotor binding costs (indicating the binding of visual and action features) was unaffected by the binaural beats, the size of visual feature binding costs (which refer to the binding between the two visual features) was considerably smaller during gamma-frequency binaural beats exposure than during the control condition. Our results suggest that binaural beats enhance selectivity in updating episodic memory traces and further strengthen the hypothesis that neural activity in the gamma band is critically associated with the control of feature binding.
Peptidyl Prolyl Isomerase PIN1 Directly Binds to and Stabilizes Hypoxia-Inducible Factor-1α.
Directory of Open Access Journals (Sweden)
Hyeong-Jun Han
Full Text Available Peptidyl prolyl isomerase (PIN1 regulates the functional activity of a subset of phosphoproteins through binding to phosphorylated Ser/Thr-Pro motifs and subsequently isomerization of the phosphorylated bonds. Interestingly, PIN1 is overexpressed in many types of malignancies including breast, prostate, lung and colon cancers. However, its oncogenic functions have not been fully elucidated. Here, we report that PIN1 directly interacts with hypoxia-inducible factor (HIF-1α in human colon cancer (HCT116 cells. PIN1 binding to HIF-1α occurred in a phosphorylation-dependent manner. We also found that PIN1 interacted with HIF-1α at both exogenous and endogenous levels. Notably, PIN1 binding stabilized the HIF-1α protein, given that their levels were significantly increased under hypoxic conditions. The stabilization of HIF-1α resulted in increased transcriptional activity, consequently upregulating expression of vascular endothelial growth factor, a major contributor to angiogenesis. Silencing of PIN1 or pharmacologic inhibition of its activity abrogated the angiogenesis. By utilizing a bioluminescence imaging technique, we were able to demonstrate that PIN1 inhibition dramatically reduced the tumor volume in a subcutaneous mouse xenograft model and angiogenesis as well as hypoxia-induced transcriptional activity of HIF-1α. These results suggest that PIN1 interacting with HIF-1α is a potential cancer chemopreventive and therapeutic target.
HOT1 is a mammalian direct telomere repeat-binding protein contributing to telomerase recruitment
Kappei, D.; Butter, F.; Benda, C.; Scheibe, M.; Draskovic, Irena; Stevense, M.; Novo, C.L.; Basquin, C.; Araki, M.; Araki, K.; Krastev, D.B.; Kittler, R.; Jessberger, R.; Londono-Vallejo, J.A.; Mann, M.; Buchholz, F.
2013-01-01
Telomeres are repetitive DNA structures that, together with the shelterin and the CST complex, protect the ends of chromosomes. Telomere shortening is mitigated in stem and cancer cells through the de novo addition of telomeric repeats by telomerase. Telomere elongation requires the delivery of the
Number of active transcription factor binding sites is essential for the Hes7 oscillator
Directory of Open Access Journals (Sweden)
de Angelis Martin
2006-02-01
Full Text Available Abstract Background It is commonly accepted that embryonic segmentation of vertebrates is regulated by a segmentation clock, which is induced by the cycling genes Hes1 and Hes7. Their products form dimers that bind to the regulatory regions and thereby repress the transcription of their own encoding genes. An increase of the half-life of Hes7 protein causes irregular somite formation. This was shown in recent experiments by Hirata et al. In the same work, numerical simulations from a delay differential equations model, originally invented by Lewis, gave additional support. For a longer half-life of the Hes7 protein, these simulations exhibited strongly damped oscillations with, after few periods, severely attenuated the amplitudes. In these simulations, the Hill coefficient, a crucial model parameter, was set to 2 indicating that Hes7 has only one binding site in its promoter. On the other hand, Bessho et al. established three regulatory elements in the promoter region. Results We show that – with the same half life – the delay system is highly sensitive to changes in the Hill coefficient. A small increase changes the qualitative behaviour of the solutions drastically. There is sustained oscillation and hence the model can no longer explain the disruption of the segmentation clock. On the other hand, the Hill coefficient is correlated with the number of active binding sites, and with the way in which dimers bind to them. In this paper, we adopt response functions in order to estimate Hill coefficients for a variable number of active binding sites. It turns out that three active transcription factor binding sites increase the Hill coefficient by at least 20% as compared to one single active site. Conclusion Our findings lead to the following crucial dichotomy: either Hirata's model is correct for the Hes7 oscillator, in which case at most two binding sites are active in its promoter region; or at least three binding sites are active, in which
Directory of Open Access Journals (Sweden)
Hiroyuki Sekiguchi
2018-01-01
Full Text Available Basic fibroblast growth factor 2 (bFGF accelerates bone formation during fracture healing. Because the efficacy of bFGF decreases rapidly following its diffusion from fracture sites, however, repeated dosing is required to ensure a sustained therapeutic effect. We previously developed a fusion protein comprising bFGF, a polycystic kidney disease domain (PKD; s2b, and collagen-binding domain (CBD; s3 sourced from the Clostridium histolyticum class II collagenase, ColH, and reported that the combination of this fusion protein with a collagen-like peptide, poly(Pro-Hyp-Gly10, induced mesenchymal cell proliferation and callus formation at fracture sites. In addition, C. histolyticum produces class I collagenase (ColG with tandem CBDs (s3a and s3b at the C-terminus. We therefore hypothesized that a bFGF fusion protein containing ColG-derived tandem CBDs (s3a and s3b would show enhanced collagen-binding activity, leading to improved bone formation. Here, we examined the binding affinity of four collagen anchors derived from the two clostridial collagenases to H-Gly-Pro-Arg-Gly-(Pro-Hyp-Gly12-NH2, a collagenous peptide, by surface plasmon resonance and found that tandem CBDs (s3a-s3b have the highest affinity for the collagenous peptide. We also constructed four fusion proteins consisting of bFGF and s3 (bFGF-s3, s2b-s3b (bFGF-s2b-s3, s3b (bFGF-s3b, and s3a-s3b (bFGF-s3a-s3b and compared their biological activities to those of a previous fusion construct (bFGF-s2b-s3 using a cell proliferation assay in vitro and a mouse femoral fracture model in vivo. Among these CB-bFGFs, bFGF-s3a-s3b showed the highest capacity to induce mesenchymal cell proliferation and callus formation in the mice fracture model. The poly(Pro-Hyp-Gly10/bFGF-s3a-s3b construct may therefore have the potential to promote bone formation in clinical settings.
Guo, Wei-Li; Huang, De-Shuang
2017-08-22
Transcription factors (TFs) are DNA-binding proteins that have a central role in regulating gene expression. Identification of DNA-binding sites of TFs is a key task in understanding transcriptional regulation, cellular processes and disease. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) enables genome-wide identification of in vivo TF binding sites. However, it is still difficult to map every TF in every cell line owing to cost and biological material availability, which poses an enormous obstacle for integrated analysis of gene regulation. To address this problem, we propose a novel computational approach, TFBSImpute, for predicting additional TF binding profiles by leveraging information from available ChIP-seq TF binding data. TFBSImpute fuses the dataset to a 3-mode tensor and imputes missing TF binding signals via simultaneous completion of multiple TF binding matrices with positional consistency. We show that signals predicted by our method achieve overall similarity with experimental data and that TFBSImpute significantly outperforms baseline approaches, by assessing the performance of imputation methods against observed ChIP-seq TF binding profiles. Besides, motif analysis shows that TFBSImpute preforms better in capturing binding motifs enriched in observed data compared with baselines, indicating that the higher performance of TFBSImpute is not simply due to averaging related samples. We anticipate that our approach will constitute a useful complement to experimental mapping of TF binding, which is beneficial for further study of regulation mechanisms and disease.
International Nuclear Information System (INIS)
Koenig, R.J.; Brent, G.A.; Warne, R.L.; Larsen, P.R.; Moore, D.D.
1987-01-01
Transcription of the rat growth hormone (rGH) gene in pituitary cells is increased by addition of thyroid hormone (T3). This induction is dependent on the presence of specific sequences just upstream of the rGH promoter. The authors have partially purified T3 receptor from rat liver and examined its interaction with these rGH sequences. They show here that T3 receptor binds specifically to a site just upstream of the basal rGH promoter. This binding site includes two copies of a 7-base-pair direct repeat, the centers of which are separated by 10 base pairs. Deletions that specifically remove the T3 receptor binding site drastically reduce response to T3 in transient transfection experiments. These results demonstrate that T3 receptor can recognize specific DNA sequences and suggest that it can act directly as a positive transcriptional regulatory factor
McGlade, C J; Ellis, C; Reedijk, M; Anderson, D; Mbamalu, G; Reith, A D; Panayotou, G; End, P; Bernstein, A; Kazlauskas, A
1992-01-01
The binding of cytoplasmic signaling proteins such as phospholipase C-gamma 1 and Ras GTPase-activating protein to autophosphorylated growth factor receptors is directed by their noncatalytic Src homology region 2 (SH2) domains. The p85 alpha regulatory subunit of phosphatidylinositol (PI) 3-kinase, which associates with several receptor protein-tyrosine kinases, also contains two SH2 domains. Both p85 alpha SH2 domains, when expressed individually as fusion proteins in bacteria, bound stably to the activated beta receptor for platelet-derived growth factor (PDGF). Complex formation required PDGF stimulation and was dependent on receptor tyrosine kinase activity. The bacterial p85 alpha SH2 domains recognized activated beta PDGF receptor which had been immobilized on a filter, indicating that SH2 domains contact autophosphorylated receptors directly. Several receptor tyrosine kinases within the PDGF receptor subfamily, including the colony-stimulating factor 1 receptor and the Steel factor receptor (Kit), also associate with PI 3-kinase in vivo. Bacterially expressed SH2 domains derived from the p85 alpha subunit of PI 3-kinase bound in vitro to the activated colony-stimulating factor 1 receptor and to Kit. We infer that the SH2 domains of p85 alpha bind to high-affinity sites on these receptors, whose creation is dependent on receptor autophosphorylation. The SH2 domains of p85 are therefore primarily responsible for the binding of PI 3-kinase to activated growth factor receptors. Images PMID:1372092
DEFF Research Database (Denmark)
Troelsen, J T; Mitchelmore, C; Sjöström, H
1994-01-01
Lactase-phlorizin hydrolase (LPH) and sucrase-isomaltase (SI) are enterocyte-specific gene products. The identification of regulatory cis-elements in the promoter of these two genes has enabled us to carry out comparative studies of the corresponding intestinal-specific nuclear factors (NF-LPH1...... and SIF1-BP). Electrophoretic mobility shift assays demonstrated that the two nuclear factors compete for binding on the same cis-elements. The molecular size of the DNA binding polypeptide is estimated to be approximately 50 kDa for both factors. In the native form the factors are found as 250 k......Da oligomeric complexes. Based on these results NF-LPH1 and SIF1-BP are suggested to be either identical or closely related molecules....
Binding and internalization of nerve growth factor by PC12 cells
International Nuclear Information System (INIS)
Kasaian, M.T.
1987-01-01
The interaction of nerve growth factor (NGF) with its cell surface receptors has been studied using both fluorescent- and radio-labelled NGF. The fluorescence studies were done by flow cytometry, and gave information about the concentration dependence and time course of NGF binding to rat pheochromocytoma cells (PC12) and human melanoma cells (A875). 125 I-NGF was used to study the fate of NGF in PC12 cells following its association with cell surface receptors. Variations of the PC12 binding assay were used to distinguish ligand bound to fast and slowly dissociating receptors at the cell surface, internalized ligand, and cytoskeletally-associated NGF. Ligand uptake into each of these pools was followed in untreated cells, as well as in cells exposed to colchicine and/or cytochalasin B to disrupt the cytoskeleton. NGF degradation was also followed in these cells, and chloroquine was used to inhibit this process. In a separate project, NGF activity was assayed in samples of human amniotic fluid and cerebrospinal fluid (CSF). A range of activities was found in these samples, with the CSF samples containing somewhat more activity than the amniotic fluid samples
Directory of Open Access Journals (Sweden)
Hiroyuki Nakagawa
Full Text Available Lasp-2 binds to actin filaments and concentrates in the actin bundles of filopodia and lamellipodia in neural cells and focal adhesions in fibroblastic cells. Lasp-2 has three structural regions: a LIM domain, a nebulin-repeat region, and an SH3 domain; however, the region(s responsible for its interactions with actin filaments and focal adhesions are still unclear. In this study, we revealed that the N-terminal fragment from the LIM domain to the first nebulin-repeat module (LIM-n1 retained actin-binding activity and showed a similar subcellular localization to full-length lasp-2 in neural cells. The LIM domain fragment did not interact with actin filaments or localize to actin filament bundles. In contrast, LIM-n1 showed a clear subcellular localization to filopodial actin bundles. Although truncation of the LIM domain caused the loss of F-actin binding activity and the accumulation of filopodial actin bundles, these truncated fragments localized to focal adhesions. These results suggest that lasp-2 interactions with actin filaments are mediated through the cooperation of the LIM domain and the first nebulin-repeat module in vitro and in vivo. Actin filament binding activity may be a major contributor to the subcellular localization of lasp-2 to filopodia but is not crucial for lasp-2 recruitment to focal adhesions.
Gemin5: A Multitasking RNA-Binding Protein Involved in Translation Control
Directory of Open Access Journals (Sweden)
David Piñeiro
2015-04-01
Full Text Available Gemin5 is a RNA-binding protein (RBP that was first identified as a peripheral component of the survival of motor neurons (SMN complex. This predominantly cytoplasmic protein recognises the small nuclear RNAs (snRNAs through its WD repeat domains, allowing assembly of the SMN complex into small nuclear ribonucleoproteins (snRNPs. Additionally, the amino-terminal end of the protein has been reported to possess cap-binding capacity and to interact with the eukaryotic initiation factor 4E (eIF4E. Gemin5 was also shown to downregulate translation, to be a substrate of the picornavirus L protease and to interact with viral internal ribosome entry site (IRES elements via a bipartite non-canonical RNA-binding site located at its carboxy-terminal end. These features link Gemin5 with translation control events. Thus, beyond its role in snRNPs biogenesis, Gemin5 appears to be a multitasking protein cooperating in various RNA-guided processes. In this review, we will summarise current knowledge of Gemin5 functions. We will discuss the involvement of the protein on translation control and propose a model to explain how the proteolysis fragments of this RBP in picornavirus-infected cells could modulate protein synthesis.
DEFF Research Database (Denmark)
Kantcheva, Adriana Krassimirova
In her PhD studies, Adriana K. Kantcheva looked into the structural perspective of a bacterial transporter – the leucine transporter from Aquifex aeolicus (LeuT) – which is a homologue to neurotransmitter sodium symporters (NSS) found in humans, such as the serotonin transporter. Two crystal...... structures of LeuT elucidated new insights regarding ion and substrate binding to this transporter. Studying members of the NSS family is important as these proteins are found in the central nervous system of humans at the synaptic cleft and are implicated in serious conditions such as Parkinson’s disease...
International Nuclear Information System (INIS)
Nakayama, Kohzo; Nagase, Kazuko; Tokutake, Yuriko; Koh, Chang-Sung; Hiratochi, Masahiro; Ohkawara, Takeshi; Nakayama, Noriko
2004-01-01
We cloned the 5'-flanking region of the mouse homolog of the Delta gene (Dll1) and demonstrated that the sequence between nucleotide position -514 and -484 in the 5'-flanking region of Dll1 played a critical role in the regulation of its tissue-specific expression in neural stem cells (NSCs). Further, we showed that multiple POU-binding motifs, located within this short sequence of 30 bp, were essential for transcriptional activation of Dll1 and also that multiple tissue-specific nuclear factors recognized these POU-binding motifs in various combinations through differentiation of NSCs. Thus, POU-binding factors may play an important role in Dll1 expression in developing NSCs
HOCOMOCO: expansion and enhancement of the collection of transcription factor binding sites models
Kulakovskiy, Ivan V.
2015-11-19
Models of transcription factor (TF) binding sites provide a basis for a wide spectrum of studies in regulatory genomics, from reconstruction of regulatory networks to functional annotation of transcripts and sequence variants. While TFs may recognize different sequence patterns in different conditions, it is pragmatic to have a single generic model for each particular TF as a baseline for practical applications. Here we present the expanded and enhanced version of HOCOMOCO (http://hocomoco.autosome.ru and http://www.cbrc.kaust.edu.sa/hocomoco10), the collection of models of DNA patterns, recognized by transcription factors. HOCOMOCO now provides position weight matrix (PWM) models for binding sites of 601 human TFs and, in addition, PWMs for 396 mouse TFs. Furthermore, we introduce the largest up to date collection of dinucleotide PWM models for 86 (52) human (mouse) TFs. The update is based on the analysis of massive ChIP-Seq and HT-SELEX datasets, with the validation of the resulting models on in vivo data. To facilitate a practical application, all HOCOMOCO models are linked to gene and protein databases (Entrez Gene, HGNC, UniProt) and accompanied by precomputed score thresholds. Finally, we provide command-line tools for PWM and diPWM threshold estimation and motif finding in nucleotide sequences.
footprintDB: a database of transcription factors with annotated cis elements and binding interfaces.
Sebastian, Alvaro; Contreras-Moreira, Bruno
2014-01-15
Traditional and high-throughput techniques for determining transcription factor (TF) binding specificities are generating large volumes of data of uneven quality, which are scattered across individual databases. FootprintDB integrates some of the most comprehensive freely available libraries of curated DNA binding sites and systematically annotates the binding interfaces of the corresponding TFs. The first release contains 2422 unique TF sequences, 10 112 DNA binding sites and 3662 DNA motifs. A survey of the included data sources, organisms and TF families was performed together with proprietary database TRANSFAC, finding that footprintDB has a similar coverage of multicellular organisms, while also containing bacterial regulatory data. A search engine has been designed that drives the prediction of DNA motifs for input TFs, or conversely of TF sequences that might recognize input regulatory sequences, by comparison with database entries. Such predictions can also be extended to a single proteome chosen by the user, and results are ranked in terms of interface similarity. Benchmark experiments with bacterial, plant and human data were performed to measure the predictive power of footprintDB searches, which were able to correctly recover 10, 55 and 90% of the tested sequences, respectively. Correctly predicted TFs had a higher interface similarity than the average, confirming its diagnostic value. Web site implemented in PHP,Perl, MySQL and Apache. Freely available from http://floresta.eead.csic.es/footprintdb.
Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma
Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev
2012-01-01
Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205
International Nuclear Information System (INIS)
Kornhuber, J.; Mack-Burkhardt, F.; Konradi, C.; Fritze, J.; Riederer, P.
1989-01-01
The effect of a number of antemortem and postmortem factors on [ 3 H]MK-801 binding was investigated under equilibrium conditions in the frontal cortex of human brains of 38 controls. Binding values transiently increased during the early postnatal period reaching a maximum at the age of about 2 years. After age 10 years [ 3 H]MK-801 binding sites disappeared at 5.7% per decade. The storage time of brain tissue had a reducing effect on these binding sites. There was no effect of gender, brain weight or postmortem time interval and the binding sites were bilaterally symmetrically distributed in the frontal cortex
Czech Academy of Sciences Publication Activity Database
Křížková, Květoslava; Chrudinová, Martina; Povalová, Anna; Selicharová, Irena; Collinsová, Michaela; Vaněk, Václav; Brzozowski, A. M.; Jiráček, Jiří; Žáková, Lenka
2016-01-01
Roč. 55, č. 21 (2016), s. 2903-2913 ISSN 0006-2960 R&D Projects: GA ČR GA15-19018S Institutional support: RVO:61388963 Keywords : alanine scanning mutagenesis * high-affinity binding * type 1 IGF receptor Subject RIV: CE - Biochemistry Impact factor: 2.938, year: 2016 http://pubs.acs.org/doi/pdf/10.1021/acs.biochem.6b00140
Nucleolin: acharan sulfate–binding protein on the surface of cancer cells
Joo, Eun Ji; ten Dam, Gerdy B.; van Kuppevelt, Toin H.; Toida, Toshihiko; Linhardt, Robert J.; Kim, Yeong Shik
2005-01-01
Glycosaminoglycans (GAGs) are complex polysaccharides that participate in the regulation of physiological processes through the interactions with a wide variety of proteins. Acharan sulfate (AS), isolated from the giant African snail Achatina fulica, primarily consists of the repeating disaccharide structure α-D-N-acetylglucosaminyl (1→4) 2-sulfoiduronic acid. Exogenous AS was injected subcutaneously near the tumor tissue in C57BL/6 mice that had been implanted with Lewis lung carcinoma cells (LLCs). The location of AS in the tumor was assessed by staining of sectioned tissues with alcian blue and periodic acid–Schiff (PAS) reagent. In vitro assays indicated binding of cells to 50 μg/ml AS (or heparin) after a 5-h incubation. Immunofluorescence assays, using anti-AS antibody, detected AS at the cell surface. The outer-surface of LLCs were next biotinylated to identify the AS-binding proteins. Biotinylated cells were lysed, and the lysates were fractionated on the AS affinity column using a stepwise salt gradient (0, 0.1, 0.3, 0.5, 0.7, 1.0, and 2.0 M). The fractions were analyzed by SDS–PAGE with silver staining and western blotting. We focused on the proteins with high affinity for AS (eluting at 1 M NaCl) and detected only two bands by western blotting. ESI Q-TOF MS analysis of one of these bands, molecular weight ~110 kDa, showed it to be nucleolin. A phosphorylated form of nucleolin on the surface of cells acts as a cell surface receptor for a variety of ligands, including growth factors (i.e., basic fibroblast growth factor) and chemokines (i.e., midkine). These results show that nucleolin is one of several AS-binding proteins and suggest that AS might demonstrate its tumor growth inhibitory activity by binding the nucleolin receptor protein on the surface of cancer cells. PMID:15329357
International Nuclear Information System (INIS)
Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan; Im, Young Jun; Kim, Mun-Kyoung; Kang, Gil Bu; Eom, Soo Hyun
2005-01-01
The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222 1 , with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V M value of 2.49 Å 3 Da −1 . The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)
Energy Technology Data Exchange (ETDEWEB)
Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan; Im, Young Jun; Kim, Mun-Kyoung; Kang, Gil Bu; Eom, Soo Hyun, E-mail: eom@gist.ac.kr [Department of Life Science, Gwangju Institute of Science and Technology, Gwangju 500-712 (Korea, Republic of)
2005-11-01
The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}. The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)
International Nuclear Information System (INIS)
Hofmann, G.E.; Siddiqi, T.A.; Rao, Ch. V.; Carman, F.R.
1988-01-01
Specific binding of 125 I-human epidermal growth factor (hEGF) to homogenates of term human placentas and fetal membranes from normal and appropriate for gestational age (N = 20), intrauterine growth retarded (N = 9), twin (N = 11), White class A/B diabetic (N = 12), and large for gestational age (N = 13) pregnancies was measured. In all pregnancy states, placentas bound approximately four times more 125 I-hEGF than did fetal membranes (P 125 I-hEGF binding to fetal membranes from the various pregnancy states (P 125 I-hEGF specific binding to placentas from intrauterine growth retarded or twin pregnancies was significantly greater compared with placentas from normal and appropriate for gestational age pregnancies (P 125 I-hEGF specific binding did not differ between placentas from intrauterine growth retarded or twin pregnancies (P 125 I-hEGF binding did not vary with fetal sex, maternal race, placental weight, or gestational age between 37 to 42 weeks (P 125 I-hEGF binding increased with increasing infant weight when appropriate for gestational age and large for gestational age infants were included (P<0.05, r = 0.38, N = 32) but not for intrauterine growth retarded, appropriate for gestational age, or large for gestational age infants alone. (author)
Vergara-Jaque, Ariela; Fenollar-Ferrer, Cristina; Kaufmann, Desirée; Forrest, Lucy R
2015-01-01
Secondary active transporters are critical for neurotransmitter clearance and recycling during synaptic transmission and uptake of nutrients. These proteins mediate the movement of solutes against their concentration gradients, by using the energy released in the movement of ions down pre-existing concentration gradients. To achieve this, transporters conform to the so-called alternating-access hypothesis, whereby the protein adopts at least two conformations in which the substrate binding sites are exposed to one or other side of the membrane, but not both simultaneously. Structures of a bacterial homolog of neuronal glutamate transporters, GltPh, in several different conformational states have revealed that the protein structure is asymmetric in the outward- and inward-open states, and that the conformational change connecting them involves a elevator-like movement of a substrate binding domain across the membrane. The structural asymmetry is created by inverted-topology repeats, i.e., structural repeats with similar overall folds whose transmembrane topologies are related to each other by two-fold pseudo-symmetry around an axis parallel to the membrane plane. Inverted repeats have been found in around three-quarters of secondary transporter folds. Moreover, the (a)symmetry of these systems has been successfully used as a bioinformatic tool, called "repeat-swap modeling" to predict structural models of a transporter in one conformation using the known structure of the transporter in the complementary conformation as a template. Here, we describe an updated repeat-swap homology modeling protocol, and calibrate the accuracy of the method using GltPh, for which both inward- and outward-facing conformations are known. We then apply this repeat-swap homology modeling procedure to a concentrative nucleoside transporter, VcCNT, which has a three-dimensional arrangement related to that of GltPh. The repeat-swapped model of VcCNT predicts that nucleoside transport also
Directory of Open Access Journals (Sweden)
Cristina eFenollar Ferrer
2015-09-01
Full Text Available Secondary active transporters are critical for neurotransmitter clearance and recycling during synaptic transmission and uptake of nutrients. These proteins mediate the movement of solutes against their concentration gradients, by using the energy released in the movement of ions down pre-existing concentration gradients. To achieve this, transporters conform to the so-called alternating-access hypothesis, whereby the protein adopts at least two conformations in which the substrate binding sites are exposed to either the outside or inside of the membrane, but not both simultaneously. Structures of a bacterial homolog of neuronal glutamate transporters, GltPh, in several different conformational states have revealed that the protein structure is asymmetric in the outward- and inward-open states, and that the conformational change connecting them involves a elevator-like movement of a substrate binding domain across the membrane. The structural asymmetry is created by inverted-topology repeats, i.e., structural repeats with similar overall folds whose transmembrane topologies are related to each other by two-fold pseudo-symmetry around an axis parallel to the membrane plane. Inverted repeats have been found in around three-quarters of secondary transporter folds. Moreover, the (asymmetry of these systems has been successfully used as a bioinformatic tool, called repeat-swap modeling to predict structural models of a transporter in one conformation using the known structure of the transporter in the complementary conformation as a template. Here, we describe an updated repeat-swap homology modeling protocol, and calibrate the accuracy of the method using GltPh, for which both inward- and outward-facing conformations are known. We then apply this repeat-swap homology modeling procedure to a concentrative nucleoside transporter, VcCNT, which has a three-dimensional arrangement related to that of GltPh. The repeat-swapped model of VcCNT predicts that
International Nuclear Information System (INIS)
Roy, L.M.; Gittinger, C.K.; Landreth, G.E.
1991-01-01
Epidermal growth factor receptor interacts with structural elements of A431 cells and remains associated with the cytoskeleton following extraction with nonionic detergents. Extraction of cells with 0.15% Triton X-100 resulted in detection of only approximately 40% of the EGF binding sites on the cytoskeleton. If the cells were exposed to EGF prior to extraction, approximately twofold higher levels of low-affinity EGF binding sites were detected. The difference in number of EGF binding sites was not a consequence of differences in numbers of EGF receptors associated with the cytoskeleton; equal amounts of 35S-labeled receptor were immunoprecipitated from the cytoskeletons of both control and EGF-treated cells. The effect of EGF pretreatment on binding activity was coincident with a change in the mobility of the receptor from a doublet of Mr approximately 160-180 kDa to a single sharp band at 180 kDa. The alteration in receptor mobility was not a simple consequence of receptor phosphorylation in that the alteration was not reversed by alkaline phosphatase treatment, nor was the shift produced by treatment of the cells with phorbol ester. The two EGF receptor species demonstrated differential susceptibility to V8 proteinase digestion. The EGF-induced 180 kDa species was preferentially digested by the proteinase relative to the 160 kDa species, indicating that EGF binding results in a conformational change in the receptor. The EGF-mediated preservation of binding activity and altered conformation may be related to receptor oligomerization
Energy Technology Data Exchange (ETDEWEB)
Nam, Ki Hyun; Kurinov, Igor; Ke, Ailong (Cornell); (NWU)
2012-05-22
Clustered regularly interspaced short palindromic repeats (CRISPR) and their associated protein genes (cas genes) are widespread in bacteria and archaea. They form a line of RNA-based immunity to eradicate invading bacteriophages and malicious plasmids. A key molecular event during this process is the acquisition of new spacers into the CRISPR loci to guide the selective degradation of the matching foreign genetic elements. Csn2 is a Nmeni subtype-specific cas gene required for new spacer acquisition. Here we characterize the Enterococcus faecalis Csn2 protein as a double-stranded (ds-) DNA-binding protein and report its 2.7 {angstrom} tetrameric ring structure. The inner circle of the Csn2 tetrameric ring is {approx}26 {angstrom} wide and populated with conserved lysine residues poised for nonspecific interactions with ds-DNA. Each Csn2 protomer contains an {alpha}/{beta} domain and an {alpha}-helical domain; significant hinge motion was observed between these two domains. Ca{sup 2+} was located at strategic positions in the oligomerization interface. We further showed that removal of Ca{sup 2+} ions altered the oligomerization state of Csn2, which in turn severely decreased its affinity for ds-DNA. In summary, our results provided the first insight into the function of the Csn2 protein in CRISPR adaptation by revealing that it is a ds-DNA-binding protein functioning at the quaternary structure level and regulated by Ca{sup 2+} ions.
Directory of Open Access Journals (Sweden)
C. Lo Passo
2018-04-01
Full Text Available Factor H binding protein (FHbp is a component of two licensed vaccines for prevention of sepsis and meningitis caused by serogroup B meningococci. FHbp binds human Factor H (FH, which contributes to evasion of host immunity and FHbp sequence variants can be classified into two sub-families. Antibodies against FHbp elicit complement-mediated killing and can inhibit recruitment of FH to the bacterial surface. We report epitope mapping studies of two murine IgG mAbs, designated JAR 31 and JAR 36, isolated from a mouse immunized with FHbp in sub-family A, which is present in ∼30–40% of invasive isolates. In the present study, we tested the reactivity of mAbs JAR 31 and JAR 36 with seven natural FHbp sequence variants from different phylogenic groups. We screened bacteriophage-displayed peptide libraries to identify amino acid residues contributing to the JAR 36 epitope. Based on the reactivities of mAbs JAR 31 and JAR 36 with the seven FHbp variants, and the frequent occurrences of aspartate (D and lysine (K residues in the JAR 36-bound phage peptides, we selected six residues in the carboxyl-terminal region of FHbp for replacement with alanine (A. The D201A and K203A substitutions respectively eliminated and decreased binding of mAbs JAR 31 and JAR 36 to FHbp. These substitutions did not affect binding of the control mAb JAR 33 or of human FH. JAR 31 or JAR 36 mediated cooperative complement-mediated bactericidal activity with other anti-FHbp mAbs. The identification of two amino acid residues involved in the epitopes recognized by these anti-FHbp mAbs may contribute to a more complete understanding of the spatial requirements for cooperative anti-FHbp mAb bactericidal activity. Keywords: Biochemistry, Immunology, Microbiology, Molecular biology
International Nuclear Information System (INIS)
Dwoskin, L.P.; Peris, J.; Yasuda, R.P.; Philpott, K.; Zahniser, N.R.
1988-01-01
Groups of rats administered cocaine-HCl (10 mg/kg, i.p.) or saline either acutely or once daily for 8 or 14 days were killed 24 hrs after the last dose. In striatal slices prelabelled with [ 3 H]DA, modulation of [ 3 H]-overflow by pergolide was used to measure D-2 autoreceptor activity. Compared to the contemporaneous control group pergolide produced a greater inhibition only in striatal slices from rats treated repeatedly with cocaine. In radioligand binding studies using striatal membranes from control rats, pergolide had a 500-fold greater affinity for the D-2, as opposed to the D-1, dopamine (DA) receptor subtype. These results indicate that repeated treatment with cocaine produces supersensitive striatal D-2 release-modulating autoreceptors consistent with a compensatory change to diminish the effect of elevated synaptic concentrations of DA produced by cocaine. In contrast, supersensitivity of D-2 receptors was not detected in [ 3 H]spiperone binding assays. 31 references, 2 figures, 1 table
International Nuclear Information System (INIS)
Littler, Dene R.; Walker, John R.; Davis, Tara; Wybenga-Groot, Leanne E.; Finerty, Patrick J. Jr; Newman, Elena; Mackenzie, Farell; Dhe-Paganon, Sirano
2010-01-01
A 1.9 Å resolution crystal structure of the isolated kinase domain from the α2 subunit of human AMPK, the first from a multicellular organism, is presented. The AMP-activated protein kinase (AMPK) is a highly conserved trimeric protein complex that is responsible for energy homeostasis in eukaryotic cells. Here, a 1.9 Å resolution crystal structure of the isolated kinase domain from the α2 subunit of human AMPK, the first from a multicellular organism, is presented. This human form adopts a catalytically inactive state with distorted ATP-binding and substrate-binding sites. The ATP site is affected by changes in the base of the activation loop, which has moved into an inhibited DFG-out conformation. The substrate-binding site is disturbed by changes within the AMPKα2 catalytic loop that further distort the enzyme from a catalytically active form. Similar structural rearrangements have been observed in a yeast AMPK homologue in response to the binding of its auto-inhibitory domain; restructuring of the kinase catalytic loop is therefore a conserved feature of the AMPK protein family and is likely to represent an inhibitory mechanism that is utilized during function
International Nuclear Information System (INIS)
Davydova, E.K.
1987-01-01
One of the proteins participating in the process of elongation of polypeptide chains - elongation factor 2 (EF-2) - can be ADP-ribosylated at a unique amino acid residue - diphthamide. Since the ADP-ribosylation of EF-2 at dipthamide leads to a loss of affinity of the factor for RNA while the presence of RNA inhibits the ADP-ribosylation reaction, it seemed probable to the authors that diphthamide participated directly in the binding of EF-2 to DNA. The experiments presented in this article showed that this was not the case: diphthamide and the RNA-binding site are situated on different domains of EF-2. Thus, ADP-ribosylation of factor EF-2 in one domain leads to a loss of the ability to bind to RNA in the other. The authors investigated the mutual arrangement of diphthamide and the RNA-binding site on the EF-2 molecule by preparing a factor from rabbit reticulocytes and subjecting it to proteolytic digestion with elastase. The factor was incubated with elastase for 15 min at 37 0 C at an enzyme:substrate ratio of 1:100 in buffer solution containing 20 mM Tris-HCl, pH 7.6, 10 mM KCl, 1 mM MgCl 2 , and 2 mM dithiothreitol. The reaction was stopped by adding para-methylsulfonyl fluoride to 50 micro-M. The authors obtained a preparation as a result of proteolysis and applied it on a column with RNA-Sepharose and separated into two fractions: RNA-binding and without affinity for RNA. The initial preparation and its fractions were subjected to exhaustive ADP-ribosylation in the presence of diphtheria toxin and [U- 14 C] nicotinaide adenine dinucleotide ([ 14 C]NAD) (296 mCi/mmole). The samples were analyzed electrophoretically in a polyacrylamide gel gradient in the presence of sodium dodecyl sulfate. For the detection of [ 14 C] ADP-ribosylated components, the gels were dried and exposed with RM-V x-ray film