WorldWideScience

Sample records for repeat-binding factor homologue

  1. The protein network surrounding the human telomere repeat binding factors TRF1, TRF2, and POT1.

    Directory of Open Access Journals (Sweden)

    Richard J Giannone

    2010-08-01

    Full Text Available Telomere integrity (including telomere length and capping is critical in overall genomic stability. Telomere repeat binding factors and their associated proteins play vital roles in telomere length regulation and end protection. In this study, we explore the protein network surrounding telomere repeat binding factors, TRF1, TRF2, and POT1 using dual-tag affinity purification in combination with multidimensional protein identification technology liquid chromatography--tandem mass spectrometry (MudPIT LC-MS/MS. After control subtraction and data filtering, we found that TRF2 and POT1 co-purified all six members of the telomere protein complex, while TRF1 identified five of six components at frequencies that lend evidence towards the currently accepted telomere architecture. Many of the known TRF1 or TRF2 interacting proteins were also identified. Moreover, putative associating partners identified for each of the three core components fell into functional categories such as DNA damage repair, ubiquitination, chromosome cohesion, chromatin modification/remodeling, DNA replication, cell cycle and transcription regulation, nucleotide metabolism, RNA processing, and nuclear transport. These putative protein-protein associations may participate in different biological processes at telomeres or, intriguingly, outside telomeres.

  2. Cloning of Ammopiptanthus mongolicus C-repeat-binding factor gene and its cold-induced tolerance in transgenic tobacco

    Directory of Open Access Journals (Sweden)

    Lijiang Gu

    2013-12-01

    Full Text Available C-repeat-binding factors (CBFs are a type of important regulon in stress-related signal transduction pathways that control plant tolerance of abiotic stress. Ammopiptanthus mongolicus is the only evergreen broadleaf shrub in the northwest desert of China. The species shows strong resistance to environmental stress, especially to cold stress. An A. mongolicus CBF1 gene (AmCBF1 was cloned and transformed into tobacco. Expression of AmCBF1 could be detected in A. mongolicus shortly after exposure to low temperature of 4°C. Analysis on ratio of electrolytic leakage, soluble sugar content, free proline content, malondialdehyde (MDA content and peroxidase (POD activity before and after cold treatment (4°C for 24 h indicated AmCBF1 conferred higher cold tolerance to AmCBF1 transgenic tobacco compared with the wild type and empty vector transformed tobacco.

  3. Transcriptome Profiling Reveals the Negative Regulation of Multiple Plant Hormone Signaling Pathways Elicited by Overexpression of C-Repeat Binding Factors

    Directory of Open Access Journals (Sweden)

    Aixin Li

    2017-09-01

    Full Text Available C-repeat binding factors (CBF are a subfamily of AP2 transcription factors that play critical roles in the regulation of plant cold tolerance and growth in low temperature. In the present work, we sought to perform a detailed investigation into global transcriptional regulation of plant hormone signaling associated genes in transgenic plants engineered with CBF genes. RNA samples from Arabidopsis thaliana plants overexpressing two CBF genes, CBF2 and CBF3, were subjected to Illumina HiSeq 2000 RNA sequencing (RNA-Seq. Our results showed that more than half of the hormone associated genes that were differentially expressed in CBF2 or CBF3 transgenic plants were related to auxin signal transduction and metabolism. Most of these alterations in gene expression could lead to repression of auxin signaling. Accordingly, the IAA content was significantly decreased in young tissues of plants overexpressing CBF2 and CBF3 compared with wild type. In addition, genes associated with the biosynthesis of Jasmonate (JA and Salicylic acid (SA, as well as the signal sensing of Brassinolide (BR and SA, were down-regulated, while genes associated with Gibberellin (GA deactivation were up-regulated. In general, overexpression of CBF2 and CBF3 negatively affects multiple plant hormone signaling pathways in Arabidopsis. The transcriptome analysis using CBF2 and CBF3 transgenic plants provides novel and integrated insights into the interaction between CBFs and plant hormones, particularly the modulation of auxin signaling, which may contribute to the improvement of crop yields under abiotic stress via molecular engineering using CBF genes.

  4. Cassava C-repeat binding factor 1 gene responds to low temperature and enhances cold tolerance when overexpressed in Arabidopsis and cassava.

    Science.gov (United States)

    An, Dong; Ma, Qiuxiang; Wang, Hongxia; Yang, Jun; Zhou, Wenzhi; Zhang, Peng

    2017-05-01

    Cassava MeCBF1 is a typical CBF transcription factor mediating cold responses but its low expression in apical buds along with a retarded response cause inefficient upregulation of downstream cold-related genes, rendering cassava chilling-sensitive. Low temperature is a major abiotic stress factor affecting survival, productivity and geographic distribution of important crops worldwide. The C-repeat/dehydration-responsive element binding transcription factors (CBF/DREB) are important regulators of abiotic stress response in plants. In this study, MeCBF1, a CBF-like gene, was identified in the tropical root crop cassava (Manihot esculenta Crantz). The MeCBF1 encodes a protein that shares strong homology with DREB1As/CBFs from Arabidopsis as well as other species. The MeCBF1 was localized to the nucleus and is mainly expressed in stem and mature leaves, but not in apical buds or stem cambium. MeCBF1 expression was not only highly responsive to cold, but also significantly induced by salt, PEG and ABA treatment. Several stress-associated cis-elements were found in its promoter region, e.g., ABRE-related, MYC recognition sites, and MYB responsive element. Compared with AtCBF1, the MeCBF1 expression induced by cold in cassava was retarded and upregulated only after 4 h, which was also confirmed by its promoter activity. Overexpression of MeCBF1 in transgenic Arabidopsis and cassava plants conferred enhanced crytolerance. The CBF regulon was smaller and not entirely co-regulated with MeCBF1 expression in overexpressed cassava. The retarded MeCBF1 expression in response to cold and attenuated CBF-regulon might lead cassava to chilling sensitivity.

  5. Low-temperature-induced expression of rice ureidoglycolate amidohydrolase is mediated by a C-repeat/dehydration-responsive element that specifically interacts with rice C-repeat-binding factor 3

    Directory of Open Access Journals (Sweden)

    Juan eLi

    2015-11-01

    Full Text Available Nitrogen recycling and redistribution are important for the environmental stress response of plants. In non nitrogen-fixing plants, ureide metabolism is crucial to nitrogen recycling from organic sources. Various studies have suggested that the rate-limiting components of ureide metabolism respond to environmental stresses. However, the underlying regulation mechanism is not well understood. In this report, rice ureidoglycolate amidohydrolase (OsUAH, which is a recently identified enzyme catalyzing the final step of ureide degradation, was identified as low-temperature- (LT but not abscisic acid- (ABA regulated. To elucidate the LT regulatory mechanism at the transcriptional level, we isolated and characterized the promoter region of OsUAH (POsUAH. Series deletions revealed that a minimal region between -522 and -420 relative to the transcriptional start site was sufficient for the cold induction of POsUAH. Detailed analyses of this 103-bp fragment indicated that a C-repeat/dehydration-responsive (CRT/DRE element localized at position -434 was essential for LT-responsive expression. A rice C-repeat-binding factors/DRE-binding proteins 1 (CBFs/DREB1s subfamily member, OsCBF3, was screened to specifically bind to the CRT/DRE element in the minimal region both in yeast one-hybrid assays and in in vitro gel-shift analysis. Moreover, the promoter could be exclusively trans-activated by the interaction between the CRT/DRE element and OsCBF3 in vivo. These findings may help to elucidate the regulation mechanism of stress-responsive ureide metabolism genes and provide an example of the member-specific manipulation of the CBF/DREB1 subfamily.

  6. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    International Nuclear Information System (INIS)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo

    2012-01-01

    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution

  7. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    Energy Technology Data Exchange (ETDEWEB)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo [Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)

    2012-08-31

    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution.

  8. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

    1988-01-01

    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  9. Enhancer of rudimentary homologue interacts with scaffold attachment factor B at the nuclear matrix to regulate SR protein phosphorylation.

    Science.gov (United States)

    Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni

    2017-08-01

    Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.

  10. OVO homologue-like 1 (Ovol1) transcription factor: a novel target of neurogenin-3 in rodent pancreas.

    Science.gov (United States)

    Vetere, A; Li, W-C; Paroni, F; Juhl, K; Guo, L; Nishimura, W; Dai, X; Bonner-Weir, S; Sharma, A

    2010-01-01

    The basic helix-loop-helix transcription factor neurogenin-3 (NGN3) commits the fates of pancreatic progenitors to endocrine cell types, but knowledge of the mechanisms regulating the choice between proliferation and differentiation of these progenitors is limited. Using a chromatin immunoprecipitation cloning approach, we searched for direct targets of NGN3 and identified a zinc-finger transcription factor, OVO homologue-like 1 (OVOL1). Transactivation experiments were carried out to elucidate the functional role of NGN3 in Ovol1 gene expression. Embryonic and adult rodents pancreases were immunostained for OVOL1, Ki67 and NGN3. We showed that NGN3 negatively regulates transcription of Ovol1 in an E-box-dependent fashion. The presence of either NGN3 or NEUROD1, but not MYOD, reduced endogenous Ovol1 mRNA. OVOL1 was detected in pancreatic tissue around embryonic day 15.5, after which OVOL1 levels dramatically increased. In embryonic pancreas, OVOL1 protein levels were low in NGN3(+) or Ki67(+) cells, but high in quiescent differentiated cells. OVOL1 presence was maintained in adult pancreas, where it was detected in islets, pancreatic ducts and some acinar cells. Additionally OVOL1 presence was lacking in proliferating ductules in regenerating pancreas and induced in cells as they began to acquire their differentiated phenotype. The timing of OVOL1 appearance in pancreas and its increased levels in differentiated cells suggest that OVOL1 promotes the transition of cells from a proliferating, less-differentiated state to a quiescent more-differentiated state. We conclude that OVOL1, a downstream target of NGN3, may play an important role in regulating the balance between proliferation and differentiation of pancreatic cells.

  11. Induction of MAP Kinase Homologues during Growth and Morphogenetic Development of Karnal Bunt (Tilletia indica) under the Influence of Host Factor(s) from Wheat Spikes

    Science.gov (United States)

    Gupta, Atul K.; Seneviratne, J. M.; Joshi, G. K.; Kumar, Anil

    2012-01-01

    Signaling pathways that activate different mitogen-activated protein kinases (MAPKs) in response to certain environmental conditions, play important role in mating type switching (Fus3) and pathogenicity (Pmk1) in many fungi. In order to determine the roles of such regulatory genes in Tilletia indica, the causal pathogen of Karnal bunt (KB) of wheat, semi-quantitative and quantitative RT-PCR was carried out to isolate and determine the expression of MAP kinase homologues during fungal growth and development under in vitro culture. Maximum expression of TiFus3 and TiPmk1 genes were observed at 14th and 21st days of culture and decreased thereafter. To investigate whether the fungus alters the expression levels of same kinases upon interaction with plants, cultures were treated with 1% of host factors (extracted from S-2 stage of wheat spikes). Such treatment induced the expression of MAPks in time dependent manner compared to the absence of host factors. These results suggest that host factor(s) provide certain signal(s) which activate TiFus3 and TiPmk1 during morphogenetic development of T. indica. The results also provides a clue about the role of host factors in enhancing the disease potential due to induction of MAP kinases involved in fungal development and pathogenecity. PMID:22547988

  12. Solution properties of the archaeal CRISPR DNA repeat-binding homeodomain protein Cbp2

    DEFF Research Database (Denmark)

    Kenchappa, Chandra; Heiðarsson, Pétur Orri; Kragelund, Birthe

    2013-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) form the basis of diverse adaptive immune systems directed primarily against invading genetic elements of archaea and bacteria. Cbp1 of the crenarchaeal thermoacidophilic order Sulfolobales, carrying three imperfect repeats, binds...... specifically to CRISPR DNA repeats and has been implicated in facilitating production of long transcripts from CRISPR loci. Here, a second related class of CRISPR DNA repeat-binding protein, denoted Cbp2, is characterized that contains two imperfect repeats and is found amongst members of the crenarchaeal...... in facilitating high affinity DNA binding of Cbp2 by tethering the two domains. Structural studies on mutant proteins provide support for Cys(7) and Cys(28) enhancing high thermal stability of Cbp2(Hb) through disulphide bridge formation. Consistent with their proposed CRISPR transcriptional regulatory role, Cbp2...

  13. Pepsin homologues in bacteria

    Directory of Open Access Journals (Sweden)

    Bateman Alex

    2009-09-01

    Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication

  14. Modulation of CRISPR locus transcription by the repeat-binding protein Cbp1 in Sulfolobus

    DEFF Research Database (Denmark)

    Deng, Ling; Kenchappa, Chandra Shekar; Peng, Xu

    2012-01-01

    CRISPR loci are essential components of the adaptive immune system of archaea and bacteria. They consist of long arrays of repeats separated by DNA spacers encoding guide RNAs (crRNA), which target foreign genetic elements. Cbp1 (CRISPR DNA repeat binding protein) binds specifically to the multiple...... direct repeats of CRISPR loci of members of the acidothermophilic, crenarchaeal order Sulfolobales. cbp1 gene deletion from Sulfolobus islandicus REY15A produced a strong reduction in pre-crRNA yields from CRISPR loci but did not inhibit the foreign DNA targeting capacity of the CRISPR/Cas system....... Conversely, overexpression of Cbp1 in S. islandicus generated an increase in pre-crRNA yields while the level of reverse strand transcripts from CRISPR loci remained unchanged. It is proposed that Cbp1 modulates production of longer pre-crRNA transcripts from CRISPR loci. A possible mechanism...

  15. E3B1, a human homologue of the mouse gene product Abi-1, sensitizes activation of Rap1 in response to epidermal growth factor

    International Nuclear Information System (INIS)

    Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim

    2005-01-01

    E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation

  16. LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy.

    Science.gov (United States)

    Zebala, John A; Mundell, Alan; Messinger, Linda; Griffin, Craig E; Schuler, Aaron D; Kahn, Stuart J

    2014-01-01

    Options are limited for patients with atopic dermatitis (AD) who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR). However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD. This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg) or twice-weekly (0.007 mg/kg) LD-aminopterin. The primary efficacy outcome was the Global Score (GS), a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01). The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo. Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

  17. LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy.

    Directory of Open Access Journals (Sweden)

    John A Zebala

    Full Text Available Options are limited for patients with atopic dermatitis (AD who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR. However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD.This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg or twice-weekly (0.007 mg/kg LD-aminopterin. The primary efficacy outcome was the Global Score (GS, a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01. The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo.Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

  18. Isolation and characterization of an AGAMOUS homologue from cocoa

    NARCIS (Netherlands)

    Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.

    2006-01-01

    We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that

  19. Macrophage migration inhibitory factor (MIF) family in arthropods: Cloning and expression analysis of two MIF and one D-dopachrome tautomerase (DDT) homologues in mud crabs, Scylla paramamosain.

    Science.gov (United States)

    Huang, Wen-Shu; Duan, Li-Peng; Huang, Bei; Wang, Ke-Jian; Zhang, Cai-Liang; Jia, Qin-Qin; Nie, Pin; Wang, Tiehui

    2016-03-01

    The macrophage migration inhibitory factor (MIF) family, consisting of MIF and D-dopachrome tautomerase (DDT) in vertebrates, is evolutionarily ancient and has been found across Kingdoms including vertebrates, invertebrates, plants and bacteria. The mammalian MIF family are chemokines at the top of the inflammatory cascade in combating infections. They also possess enzymatic activities, e.g. DDT catalysis results in the production of 5,6-dihydroxyindole (DHI), a precursor of eumelanin. MIF-like genes are widely distributed, but DDT-like genes have only been described in vertebrates and a nematode. In this report, we cloned a DDT-like gene, for the first time in arthropods, and a second MIF in mud crab. The mud crab MIF family have a three exon/two intron structure as seen in vertebrates. The identification of a DDT-like gene in mud crab and other arthropods suggests that the separation of MIF and DDT preceded the divergence of protostomes and deuterostomes. The MIF family is differentially expressed in tissues of adults and during embryonic development and early life. The high level expression of the MIF family in immune tissues, such as intestine and hepatopancreas, suggests an important role in mud crab innate immunity. Mud crab DDT is highly expressed in early embryos, in megalops and crablets and this coincides with the requirement for melanisation in egg chorion tanning and cuticular hardening in arthropods, suggesting a potential novel role of DDT in melanogenesis via its tautomerase activity to produce DHI in mud crab. The clarification of the presence of both MIF and DDT in this report paves the way for further investigation of their functional roles in immunity and in melanogenesis in mud crab and other arthropods. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. The Mycobacterium tuberculosis homologue of the Mycobacterium ...

    African Journals Online (AJOL)

    With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...

  1. Is the Prosthetic Homologue Necessary for Embodiment?

    Science.gov (United States)

    Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael

    2016-01-01

    Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.

  2. Monolayer structures of alkyl aldehydes: Odd-membered homologues

    International Nuclear Information System (INIS)

    Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.

    2011-01-01

    Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.

  3. Detection of a Yersinia pestis gene homologue in rodent samples

    Directory of Open Access Journals (Sweden)

    Timothy A. Giles

    2016-08-01

    Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.

  4. Phosphatase and tensin homologue deleted on chromosome 10 ...

    African Journals Online (AJOL)

    Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...

  5. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  6. [Intersection point rule for the retention value with mobile phase composition and boiling point of the homologues and chlorobenzenes in soil leaching column chromatography].

    Science.gov (United States)

    Xu, F; Liang, X; Lin, B; Su, F

    1999-03-01

    Based on the linear retention equation of the logarithm of the capacity factor (logk') vs. the methanol volume fraction (psi) of aqueous binary mobile phase in soil leaching column chromatography, the intersection point rule for the logk' of homologues and weak polar chlorobenzenes, with psi, as well as with boiling point, has been derived due to existence of the similar interactions among solutes of the same series, stationary phase (soil) and eluent (methanol-water). These rules were testified by experimental data of homologues (n-alkylbenzenes, methylbenzenes) and weak polar chlorobenzenes.

  7. Structural characterization and expression analysis of a beta-thymosin homologue (Tβ) in disk abalone, Haliotis discus discus.

    Science.gov (United States)

    Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee

    2013-09-15

    Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    OpenAIRE

    Apte, Manasi S.; Meller, Victoria H.

    2011-01-01

    Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will co...

  9. Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera.

    Science.gov (United States)

    Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross

    2002-12-01

    The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.

  10. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    Directory of Open Access Journals (Sweden)

    Manasi S. Apte

    2012-01-01

    Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.

  11. Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma

    Science.gov (United States)

    Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev

    2012-01-01

    Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205

  12. Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA

    Directory of Open Access Journals (Sweden)

    Goldman Gustavo H

    2010-01-01

    Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin

  13. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    Energy Technology Data Exchange (ETDEWEB)

    Singh,S.; Yamashita, A.; Gouaux, E.

    2007-01-01

    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the

  14. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    International Nuclear Information System (INIS)

    Singh, S.; Yamashita, A.; Gouaux, E.

    2007-01-01

    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational

  15. TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.

  16. A La autoantigen homologue is required for the internal ribosome entry site mediated translation of giardiavirus.

    Directory of Open Access Journals (Sweden)

    Srinivas Garlapati

    2011-03-01

    Full Text Available Translation of Giardiavirus (GLV mRNA is initiated at an internal ribosome entry site (IRES in the viral transcript. The IRES localizes to a downstream portion of 5' untranslated region (UTR and a part of the early downstream coding region of the transcript. Recent studies indicated that the IRES does not require a pre-initiation complex to initiate translation but may directly recruit the small ribosome subunit with the help of a number of trans-activating protein factors. A La autoantigen homologue in the viral host Giardia lamblia, GlLa, was proposed as one of the potential trans-activating factors based on its specific binding to GLV-IRES in vitro. In this study, we further elucidated the functional role of GlLa in GLV-IRES mediated translation in Giardia by knocking down GlLa with antisense morpholino oligo, which resulted in a reduction of GLV-IRES activity by 40%. An over-expression of GlLa in Giardia moderately stimulated GLV-IRES activity by 20%. A yeast inhibitory RNA (IRNA, known to bind mammalian and yeast La autoantigen and inhibit Poliovirus and Hepatitis C virus IRES activities in vitro and in vivo, was also found to bind to GlLa protein in vitro and inhibited GLV-IRES function in vivo. The C-terminal domain of La autoantigen interferes with the dimerization of La and inhibits its function. An over-expression of the C-terminal domain (200-348aa of GlLa in Giardia showed a dominant-negative effect on GLV-IRES activity, suggesting a potential inhibition of GlLa dimerization. HA tagged GlLa protein was detected mainly in the cytoplasm of Giardia, thus supporting a primary role of GlLa in translation initiation in Giardiavirus.

  17. From Cell Death to Metabolism: Holin-Antiholin Homologues with New Functions

    DEFF Research Database (Denmark)

    van den Esker, Marielle H.; Kovács, Ákos T.; Kuipers, Oscar P.

    2017-01-01

    , but their functions can be different, depending on the species. Using a series of biochemical and genetic approaches, in a recent article in mBio, Charbonnier et al. (mBio 8:e00976-17, 2017, https://doi.org/10.1128/mBio.00976-17) demonstrate that the antiholin homologue in Bacillus subtilis transports pyruvate...

  18. Behaviour of the homologues of Rf and Db in complexing media

    International Nuclear Information System (INIS)

    Trubert, D.; Monroy Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Servajean, V.; Constantinescu, O.; Constantinescu, M.; Ardisson, G.; Barci, V.; Weiss, B.

    1999-01-01

    In order to study the chemical behaviour of the trans-actinide elements, the chemical properties of their most probable homologues have been investigated by ion exchange methods in various complexing media. A new chromatographic method allowing the determination of distribution coefficients in the case o short-lived isotopes has been developed and successfully tested with the RACHEL device. (authors)

  19. Partial functional complementation between human and mouse cytomegalovirus chemokine receptor homologues

    DEFF Research Database (Denmark)

    Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D

    2011-01-01

    The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-m...

  20. A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue

    NARCIS (Netherlands)

    Spassieva, S; Hille, J

    Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed

  1. The actin homologue MreB organizes the bacterial cell membrane

    NARCIS (Netherlands)

    Strahl, H.; Burmann, F.; Hamoen, L.W.

    2014-01-01

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate

  2. Cloning and characterization of maize ZmSPK1, a homologue to ...

    African Journals Online (AJOL)

    hope&shola

    2006-03-15

    Mar 15, 2006 ... homologue to nonfermenting1-related protein kinase2 ... RT-PCR analysis showed that the ZmSPK1 expression was induced by mannitol, salt and ... MAPKKK in which each component is activated by .... It has been one of the main ... Protein kinase ATP-binding region signature is shown in gray box.

  3. A Hexose Transporter Homologue Controls Glucose Repression in the Methylotrophic Yeast Hansenula polymorpha

    NARCIS (Netherlands)

    Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.

    2004-01-01

    Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1

  4. Structure of HLA-A*1101 in complex with a hepatitis B peptide homologue

    DEFF Research Database (Denmark)

    Blicher, Thomas; Kastrup, Jette Sandholm; Pedersen, Lars Østergaard

    2006-01-01

    A high-resolution structure of the human MHC-I molecule HLA-A*1101 is presented in which it forms a complex with a sequence homologue of a peptide that occurs naturally in hepatitis B virus DNA polymerase. The sequence of the bound peptide is AIMPARFYPK, while that of the corresponding natural...

  5. Structural studies on a non-toxic homologue of type II RIPs from ...

    Indian Academy of Sciences (India)

    Structural studies on a non-toxic homologue of type II RIPs from bitter gourd: Molecular basis of non-toxicity, conformational selection and glycan structure. MS accepted http://www.ias.ac.in/jbiosci. THYAGESHWAR CHANDRAN, ALOK SHARMA and M VIJAYAN. J. Biosci. 40(5), October 2015, 929–941, © Indian Academy of ...

  6. Characterization of four RecQ homologues from rice (Oryza sativa L. cv. Nipponbare)

    International Nuclear Information System (INIS)

    Saotome, Ai; Kimura, Seisuke; Mori, Yoko; Uchiyama, Yukinobu; Morohashi, Kengo; Sakaguchi, Kengo

    2006-01-01

    The RecQ family of DNA helicases is conserved throughout the biological kingdoms. In this report, we have characterized four RecQ homologues clearly expressed in rice. OsRecQ1, OsRecQ886, and OsRecQsim expressions were strongly detected in meristematic tissues. Transcription of the OsRecQ homologues was differentially induced by several types of DNA-damaging agents. The expression of four OsRecQ homologues was induced by MMS and bleomycin. OsRecQ1 and OsRecQ886 were induced by H 2 O 2 , and MitomycinC strongly induced the expression of OsRecQ1. Transient expression of OsRecQ/GFP fusion proteins demonstrated that OsRecQ2 and OsRecQ886 are found in nuclei, whereas OsRecQ1 and OsRecQsim are found in plastids. Neither OsRecQ1 nor OsRecQsim are induced by light. These results indicate that four of the RecQ homologues have different and specific functions in DNA repair pathways, and that OsRecQ1 and OsRecQsim may not involve in plastid differentiation but different aspects of a plastid-specific DNA repair system

  7. Ensembles generated from crystal structures of single distant homologues solve challenging molecular-replacement cases in AMPLE.

    Science.gov (United States)

    Rigden, Daniel J; Thomas, Jens M H; Simkovic, Felix; Simpkin, Adam; Winn, Martyn D; Mayans, Olga; Keegan, Ronan M

    2018-03-01

    Molecular replacement (MR) is the predominant route to solution of the phase problem in macromolecular crystallography. Although routine in many cases, it becomes more effortful and often impossible when the available experimental structures typically used as search models are only distantly homologous to the target. Nevertheless, with current powerful MR software, relatively small core structures shared between the target and known structure, of 20-40% of the overall structure for example, can succeed as search models where they can be isolated. Manual sculpting of such small structural cores is rarely attempted and is dependent on the crystallographer's expertise and understanding of the protein family in question. Automated search-model editing has previously been performed on the basis of sequence alignment, in order to eliminate, for example, side chains or loops that are not present in the target, or on the basis of structural features (e.g. solvent accessibility) or crystallographic parameters (e.g. B factors). Here, based on recent work demonstrating a correlation between evolutionary conservation and protein rigidity/packing, novel automated ways to derive edited search models from a given distant homologue over a range of sizes are presented. A variety of structure-based metrics, many readily obtained from online webservers, can be fed to the MR pipeline AMPLE to produce search models that succeed with a set of test cases where expertly manually edited comparators, further processed in diverse ways with MrBUMP, fail. Further significant performance gains result when the structure-based distance geometry method CONCOORD is used to generate ensembles from the distant homologue. To our knowledge, this is the first such approach whereby a single structure is meaningfully transformed into an ensemble for the purposes of MR. Additional cases further demonstrate the advantages of the approach. CONCOORD is freely available and computationally inexpensive, so

  8. An initial biochemical and cell biological characterization of the mammalian homologue of a central plant developmental switch, COP1

    Directory of Open Access Journals (Sweden)

    Wang Haiyang

    2002-12-01

    Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.

  9. Valerophenone synthase-like chalcone synthase homologues in Humulus lupulus

    Czech Academy of Sciences Publication Activity Database

    Novák, Petr; Matoušek, Jaroslav; Bříza, Jindřich

    2003-01-01

    Roč. 46, - (2003), s. 375-381 ISSN 0006-3134 R&D Projects: GA ČR GA521/99/1591 Institutional research plan: CEZ:AV0Z5051902 Keywords : plant genetic Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.919, year: 2003

  10. LBP/BPI homologue in Eisenia andrei earthworms

    Czech Academy of Sciences Publication Activity Database

    Škanta, František; Procházková, Petra; Roubalová, Radka; Dvořák, Jiří; Bilej, Martin

    2016-01-01

    Roč. 54, č. 1 (2016), s. 1-6 ISSN 0145-305X R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109; GA MŠk(CZ) EE2.3.30.0003 Institutional support: RVO:61388971 Keywords : Earthworm * Eisenia * LBP/BPI Subject RIV: EC - Immunology Impact factor: 3.218, year: 2016

  11. The role of the leukemia-associated ETO homologue repressors in hematopoiesis

    OpenAIRE

    Olsson, André

    2006-01-01

    The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...

  12. Periodontal status of teeth restored with crowns and its contralateral homologue, Valdivia- Chile.

    OpenAIRE

    Israel Antonio Juárez; Sofía Larroulet; Makarena Ojeda; Cristian Rosas

    2015-01-01

    ABSTRACT Aim: To determine periodontal status of fixes single prostheses (FSP) made during the year 2013 in Austral University of Chile, and its contralateral homologue (CH).Methods: All patients with FSP made during 2013, that met the selection criteria and agreed to participate were evaluated. During the year 2014 was measured: probing depth, attachment level; bleeding on probing and dental plaque index for each FSP and CH; and consigned biological width invasion. Were measured one FSP...

  13. The actin homologue MreB organizes the bacterial cell membrane

    OpenAIRE

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.

    2014-01-01

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...

  14. Crystal structure of myotoxin-II: a myotoxic phospholipase A2 - homologue from Bothrops moojeni venom

    International Nuclear Information System (INIS)

    Azevedo, W.F.; Ward, R.J.; Lombardi, F.R.; Arni, R.K.; Soares, A.M.; Giglio, J.R.; Fontes, M.R.M.

    1997-01-01

    Full text. Phospho lipases A2 (PLA 2 ; E C 3.1.1.4, phosphatides s n-2 acyl hydrolases) hydrolysis the s n-2 ester bond of phospholipids showing enhanced activity at lamellar or membrane surfaces. Intracellular PLA 2 s are involved at phospholipid metabolism and signal transduction, whereas extracellular PLA 2 s are found in mammalian pancreatic juices, the venoms of snakes, lizards and insects. Based on their high primary sequence similarity, extracellular PLA 2 s are separated into Classes I, II and III. Class II PLA 2 s are found in snake venoms of Crotalidae an Viperidae species, and include the sub-family of Lys PLA 2 s homologue. he coordination of the Ca 2+ ion in the PLA 2 calcium-binding loop includes and aspartate at position 49. In the catalytically active PLA 2 s, this calcium ion plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The conservative substitution Asp49-Lys results in a decreased calcium affinity with a concomitant loss of catalytic activity, and naturally occurring PLA 2 s-homologues showing the same substitution are catalytically inactive. However, the Lys PLA 2 s possess cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid layers by a ca 2+ -independent mechanism for which there is no evidence of lipid hydrolysis. Lys 49 PLA 2 homologues have been isolated from several Bothrops spp. venoms including B. moojeni. Therefore, in order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ independent membrane damaging activities we have determined the crystal structure of MjTX-II, a Lys 49 homologue from the venom of B. moojeni. The model presented has been determined at 2.0 A resolution and refined to a crystallographic residual of 19.7% (R f ree=28.1%). (author)

  15. Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas

    Science.gov (United States)

    Li, Chaoqiong; Fu, Qiantang; Niu, Longjian; Luo, Li; Chen, Jianghua; Xu, Zeng-Fu

    2017-01-01

    Recent research revealed that TERMINAL FLOWER 1 (TFL1) homologues are involved in the critical developmental process of floral initiation in several plant species. In this study, the functions of three putative TFL1 homologues (JcTFL1a, JcTFL1b and JcTFL1c) in the biofuel plant Jatropha curcas were analysed using the transgenic approach. JcTFL1b and JcTFL1c, but not JcTFL1a, could complement the TFL1 function and rescue early flowering and determinate inflorescence phenotype in tfl1-14 Arabidopsis mutant, thus suggesting that JcTFL1b and JcTFL1c may be homologues of TFL1. Transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c showed late flowering, whereas only JcTFL1b and JcTFL1c overexpression delayed flowering in transgenic Arabidopsis. JcTFL1b-RNAi transgenic Jatropha consistently exhibited moderately early flowering phenotype. JcFT and JcAP1 were significantly downregulated in transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c, which suggested that the late flowering phenotype of these transgenic Jatropha may result from the repressed expression of JcFT and JcAP1. Our results indicate that these three JcTFL1 genes play redundant roles in repressing flowering in Jatropha. PMID:28225036

  16. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3) gene: a novel mammalian homologue of ACE

    OpenAIRE

    Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M

    2007-01-01

    Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...

  17. Temperature-sensitive defects of the GSP1gene, yeast Ran homologue, activate the Tel1-dependent pathway

    International Nuclear Information System (INIS)

    Hayashi, Naoyuki; Murakami, Seishi; Tsurusaki, Susumu; Nagaura, Zen-ichiro; Oki, Masaya; Nishitani, Hideo; Kobayashi, Masahiko; Shimizu, Hiroko; Yamamoto, Ken-ichi; Nishimoto, Takeharu

    2007-01-01

    RanGTPase is involved in many cellular processes. It functions in nuclear-cytosolic transport and centrosome formation. Ran also localizes to chromatin as RCC1 does, its guanine nucleotide exchange factor, but Ran's function on chromatin is not known. We found that gsp1, a temperature-sensitive mutant of GSP1, a Saccharomyces cerevisiae Ran homologue, suppressed the hydroxyurea (HU) and ultra violet (UV) sensitivities of the mec1 mutant. In UV-irradiated mec1 gsp1 cells, Rad53 was phosphorylated despite the lack of Mec1. This suppression depended on the TEL1 gene, given that the triple mutant, mec1 gsp1 tel1, was unable to grow. The gsp1 mutations also suppressed the HU sensitivity of the rad9 mutant in a Tel1-dependent manner, but not the HU sensitivity of the rad53 mutant. These results indicated that Rad53 was activated by the Tel1 pathway in mec1 gsp1 cells, suggesting that Gsp1 helps regulate the role switching the ATM family kinases Mec1 and Tel1

  18. The TFIID components human TAF(II)140 and Drosophila BIP2 (TAF(II)155) are novel metazoan homologues of yeast TAF(II)47 containing a histone fold and a PHD finger.

    Science.gov (United States)

    Gangloff, Y G; Pointud, J C; Thuault, S; Carré, L; Romier, C; Muratoglu, S; Brand, M; Tora, L; Couderc, J L; Davidson, I

    2001-08-01

    The RNA polymerase II transcription factor TFIID comprises the TATA binding protein (TBP) and a set of TBP-associated factors (TAF(II)s). TFIID has been extensively characterized for yeast, Drosophila, and humans, demonstrating a high degree of conservation of both the amino acid sequences of the constituent TAF(II)s and overall molecular organization. In recent years, it has been assumed that all the metazoan TAF(II)s have been identified, yet no metazoan homologues of yeast TAF(II)47 (yTAF(II)47) and yTAF(II)65 are known. Both of these yTAF(II)s contain a histone fold domain (HFD) which selectively heterodimerizes with that of yTAF(II)25. We have cloned a novel mouse protein, TAF(II)140, containing an HFD and a plant homeodomain (PHD) finger, which we demonstrated by immunoprecipitation to be a mammalian TFIID component. TAF(II)140 shows extensive sequence similarity to Drosophila BIP2 (dBIP2) (dTAF(II)155), which we also show to be a component of Drosophila TFIID. These proteins are metazoan homologues of yTAF(II)47 as their HFDs selectively heterodimerize with dTAF(II)24 and human TAF(II)30, metazoan homologues of yTAF(II)25. We further show that yTAF(II)65 shares two domains with the Drosophila Prodos protein, a recently described potential dTAF(II). These conserved domains are critical for yTAF(II)65 function in vivo. Our results therefore identify metazoan homologues of yTAF(II)47 and yTAF(II)65.

  19. The role of the Saccharomyces cerevisiae lipoate protein ligase homologue, Lip3, in lipoic acid synthesis.

    Science.gov (United States)

    Hermes, Fatemah A; Cronan, John E

    2013-10-01

    The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  20. Supra-optimal expression of the cold-regulated OsMyb4 transcription factor in transgenic rice changes the complexity of transcriptional network with major effects on stress tolerance and panicle development

    KAUST Repository

    Park, Myoungryoul; Yun, Kilyoung; Mohanty, Bijayalaxmi; Herath, Venura; Xu, Fuyu; Wijaya, Edward; Bajic, Vladimir B.; Yun, Songjoong; De Los Reyes, Benildo G.

    2010-01-01

    acid (JA), salicylic acid (SA), ethylene and reactive oxygen species (ROS) responsive genes. OsMyb4 network is independent of drought response element binding protein/C-repeat binding factor (DREB/CBF) and its sub-regulons operate with possible co

  1. Crystal structure of a bacterial homologue of glucose transporters GLUT1-4.

    Science.gov (United States)

    Sun, Linfeng; Zeng, Xin; Yan, Chuangye; Sun, Xiuyun; Gong, Xinqi; Rao, Yu; Yan, Nieng

    2012-10-18

    Glucose transporters are essential for metabolism of glucose in cells of diverse organisms from microbes to humans, exemplified by the disease-related human proteins GLUT1, 2, 3 and 4. Despite rigorous efforts, the structural information for GLUT1-4 or their homologues remains largely unknown. Here we report three related crystal structures of XylE, an Escherichia coli homologue of GLUT1-4, in complex with d-xylose, d-glucose and 6-bromo-6-deoxy-D-glucose, at resolutions of 2.8, 2.9 and 2.6 Å, respectively. The structure consists of a typical major facilitator superfamily fold of 12 transmembrane segments and a unique intracellular four-helix domain. XylE was captured in an outward-facing, partly occluded conformation. Most of the important amino acids responsible for recognition of D-xylose or d-glucose are invariant in GLUT1-4, suggesting functional and mechanistic conservations. Structure-based modelling of GLUT1-4 allows mapping and interpretation of disease-related mutations. The structural and biochemical information reported here constitutes an important framework for mechanistic understanding of glucose transporters and sugar porters in general.

  2. Self-assembly of diphenylalanine backbone homologues and their combination with functionalized carbon nanotubes.

    Science.gov (United States)

    Dinesh, Bhimareddy; Squillaci, Marco A; Ménard-Moyon, Cécilia; Samorì, Paolo; Bianco, Alberto

    2015-10-14

    The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to transform the nanofibers into spherical structures. Moreover, the co-assembly of β and γ peptides with carbon nanotubes covalently functionalized with the same peptide generated unique dendritic assemblies. This comparative study on self-assembly using diphenylalanine backbone homologues and of the co-assembly with CNT covalent conjugates is the first example exploring the capacity of β and γ peptides to adopt precise nanostructures, particularly in combination with carbon nanotubes. The dendritic organization obtained by mixing carbon nanotubes and peptides might find interesting applications in tissue engineering and neuronal interfacing.

  3. Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.

    Science.gov (United States)

    Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji

    2015-08-01

    Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.

  4. Identification of a candidate CD5 homologue in the amphibian Xenopus laevis.

    Science.gov (United States)

    Jürgens, J B; Gartland, L A; Du Pasquier, L; Horton, J D; Göbel, T W; Cooper, M D

    1995-11-01

    We identified a novel T cell Ag in the South African clawed toad (Xenopus laevis) by a mAb designated 2B1. This Ag is present in relatively high levels on most thymocytes, approximately 65% of splenocytes, 55% of PBL, and 65% of intestinal lymphocytes, but is rarely seen on IgM+ B cells in any of these tissues. Lymphocytes bearing the 2B1 Ag proliferate in response to stimulation with Con A or PHA, whereas the 2B1- lymphocytes are reactive to LPS. Biochemical analysis indicates that this Ag is a differentially phosphorylated glycoprotein of 71 to 82 kDa. The protein core of 64 kDa bears both N- and O-linked carbohydrate side chains. The amino-terminal protein sequence of the 2B1 Ag shares significant homology with both the macrophage scavenger receptor type 1 motif and the mammalian CD5/CD6 family. The biochemical characteristics and cellular distribution of the 2B1 Ag suggest that it represents the CD5 homologue in X. laevis. While T cells constitutively express this highly conserved molecule, Xenopus B cells acquire the CD5 homologue only when they are stimulated in the presence of T cells.

  5. The use of polynuclear aromatic hydrocarbon (PAH) alkyl homologues in determining petroleum source identification and weathering

    International Nuclear Information System (INIS)

    Brown, J.S.; Boehm, P.D.; Sauer, T.C.; Wong, W.M.C.

    1993-01-01

    Techniques utilizing double ratio plots of selected polynuclear aromatic hydrocarbon (PAH) alkyl homologues were used to identify and distinguish crude oils and refined petroleum products from each other and to distinguish petroleum sources in complex pollutant regimes. Petroleum samples were fractionated by high performance liquid chromatography (HPLC) into saturated and aromatic (PAH) hydrocarbon fractions. The saturated hydrocarbon fractions were then analyzed by gas chromatography/flame ionization detection (GC/FID) to obtain a resolved/unresolved alkane fingerprint of each oil. The aromatic fractions of the oils were analyzed by gas chromatography/mass spectrometry (GC/MS) for PAH and selected alkyl homologues. Comparisons of the saturated hydrocarbon fingerprints indicated that some oils were indistinguishable based on the alkane fingerprint alone. Another double ratio plot of the alkyl chrysenes and alkyl dibenzothiophenes was effective in establishing the weathering of oil in environmental samples which were processed using the same analytical techniques, since the dibenzothiophenes are degraded more rapidly than the chrysenes. The application of selected ratios in oil spill source identification in complex environmental samples from Suisin Bay California and Boston Harbor are discussed. The use of ratios to measure the extent of weathering in oil spill samples from Prince William Sound and the Gulf of Alaska is examined

  6. Biodegradation of diesel fuel by a microbial consortium in the presence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues

    DEFF Research Database (Denmark)

    Chrzanowski, L; Stasiewicz, M; Owsianiak, Mikolaj

    2009-01-01

    hypothesize that in the presence of diesel fuel low-water-soluble ionic liquids may become more toxic to hydrocarbon-degrading microorganisms. In this study the influence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues (side-chain length from C-3 to C-18) on biodegradation of diesel fuel...... by a bacterial consortium was investigated. Whereas test performed for the consortium cultivated on disodium succinate showed that toxicity of the investigated ionic liquids decreased with increase in side-chain length, only higher homologues (C-8-C-18) caused a decrease in diesel fuel biodegradation......, respectively. We conclude that in the presence of hydrocarbons acting as a solvent, the increased bioavailability of hydrophobic homologues is responsible for the decrease in biodegradation efficiency of diesel fuel....

  7. TOR1 and TOR2 are structurally and functionally similar but not identical phosphatidylinositol kinase homologues in yeast

    OpenAIRE

    Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.

    1994-01-01

    The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...

  8. Interactions of an Arabidopsis RanBPM homologue with LisH-CTLH domain proteins revealed high conservation of CTLH complexes in eukaryotes

    Czech Academy of Sciences Publication Activity Database

    Tomaštíková, Eva; Cenklová, Věra; Kohoutová, Lucie; Petrovská, Beáta; Váchová, Lenka; Halada, Petr; Kočárová, Gabriela; Binarová, Pavla

    2012-01-01

    Roč. 12, č. 83 (2012) ISSN 1471-2229 R&D Projects: GA ČR(CZ) GA204/07/1169; GA ČR GP204/09/P155; GA ČR GAP501/12/2333; GA MŠk(CZ) LC06034; GA MŠk LC545; GA AV ČR IAA500200719 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50200510 Keywords : Arabidopsis homologue of RanBPM * CTLH-complex * LisH-CTLH domain proteins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.354, year: 2012

  9. acn-1, a C. elegans homologue of ACE, genetically interacts with the let-7 microRNA and other heterochronic genes.

    Science.gov (United States)

    Metheetrairut, Chanatip; Ahuja, Yuri; Slack, Frank J

    2017-10-02

    The heterochronic pathway in C. elegans controls the relative timing of cell fate decisions during post-embryonic development. It includes a network of microRNAs (miRNAs), such as let-7, and protein-coding genes, such as the stemness factors, LIN-28 and LIN-41. Here we identified the acn-1 gene, a homologue of mammalian angiotensin-converting enzyme (ACE), as a new suppressor of the stem cell developmental defects of let-7 mutants. Since acn-1 null mutants die during early larval development, we used RNAi to characterize the role of acn-1 in C. elegans seam cell development, and determined its interaction with heterochronic factors, including let-7 and its downstream interactors - lin-41, hbl-1, and apl-1. We demonstrate that although RNAi knockdown of acn-1 is insufficient to cause heterochronic defects on its own, loss of acn-1 suppresses the retarded phenotypes of let-7 mutants and enhances the precocious phenotypes of hbl-1, though not lin-41, mutants. Conversely, the pattern of acn-1 expression, which oscillates during larval development, is disrupted by lin-41 mutants but not by hbl-1 mutants. Finally, we show that acn-1(RNAi) enhances the let-7-suppressing phenotypes caused by loss of apl-1, a homologue of the Alzheimer's disease-causing amyloid precursor protein (APP), while significantly disrupting the expression of apl-1 during the L4 larval stage. In conclusion, acn-1 interacts with heterochronic genes and appears to function downstream of let-7 and its target genes, including lin-41 and apl-1.

  10. Homologue Structure of the SLAC1 Anion Channel for Closing Stomata in Leaves

    Energy Technology Data Exchange (ETDEWEB)

    Y Chen; L Hu; M Punta; R Bruni; B Hillerich; B Kloss; B Rost; J Love; S Siegelbaum; W Hendrickson

    2011-12-31

    The plant SLAC1 anion channel controls turgor pressure in the aperture-defining guard cells of plant stomata, thereby regulating the exchange of water vapour and photosynthetic gases in response to environmental signals such as drought or high levels of carbon dioxide. Here we determine the crystal structure of a bacterial homologue (Haemophilus influenzae) of SLAC1 at 1.20 {angstrom} resolution, and use structure-inspired mutagenesis to analyse the conductance properties of SLAC1 channels. SLAC1 is a symmetrical trimer composed from quasi-symmetrical subunits, each having ten transmembrane helices arranged from helical hairpin pairs to form a central five-helix transmembrane pore that is gated by an extremely conserved phenylalanine residue. Conformational features indicate a mechanism for control of gating by kinase activation, and electrostatic features of the pore coupled with electrophysiological characteristics indicate that selectivity among different anions is largely a function of the energetic cost of ion dehydration.

  11. The actin homologue MreB organizes the bacterial cell membrane.

    Science.gov (United States)

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W

    2014-03-07

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes.

  12. Isolation of a cotton NADP(H oxidase homologue induced by drought stress

    Directory of Open Access Journals (Sweden)

    NEPOMUCENO ALEXANDRE LIMA

    2000-01-01

    Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.

  13. The urokinase receptor and its structural homologue C4.4A in human cancer

    DEFF Research Database (Denmark)

    Jacobsen, B; Ploug, M

    2008-01-01

    The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...

  14. Conservation of Oxidative Protein Stabilization in an Insect Homologue of Parkinsonism-Associated Protein DJ-1

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Jiusheng; Prahlad, Janani; Wilson, Mark A. (UNL)

    2012-08-21

    DJ-1 is a conserved, disease-associated protein that protects against oxidative stress and mitochondrial damage in multiple organisms. Human DJ-1 contains a functionally essential cysteine residue (Cys106) whose oxidation is important for regulating protein function by an unknown mechanism. This residue is well-conserved in other DJ-1 homologues, including two (DJ-1{alpha} and DJ-1{beta}) in Drosophila melanogaster. Because D. melanogaster is a powerful model system for studying DJ-1 function, we have determined the crystal structure and impact of cysteine oxidation on Drosophila DJ-1{beta}. The structure of D. melanogaster DJ-1{beta} is similar to that of human DJ-1, although two important residues in the human protein, Met26 and His126, are not conserved in DJ-1{beta}. His126 in human DJ-1 is substituted with a tyrosine in DJ-1{beta}, and this residue is not able to compose a putative catalytic dyad with Cys106 that was proposed to be important in the human protein. The reactive cysteine in DJ-1 is oxidized readily to the cysteine-sulfinic acid in both flies and humans, and this may regulate the cytoprotective function of the protein. We show that the oxidation of this conserved cysteine residue to its sulfinate form (Cys-SO{sub 2{sup -}}) results in considerable thermal stabilization of both Drosophila DJ-1{beta} and human DJ-1. Therefore, protein stabilization is one potential mechanism by which cysteine oxidation may regulate DJ-1 function in vivo. More generally, most close DJ-1 homologues are likely stabilized by cysteine-sulfinic acid formation but destabilized by further oxidation, suggesting that they are biphasically regulated by oxidative modification.

  15. 4-Oxalocrotonate tautomerase, its homologue YwhB, and active vinylpyruvate hydratase : Synthesis and evaluation of 2-fluoro substrate analogues

    NARCIS (Netherlands)

    Johnson, William H; Wang, Susan C; Stanley, Thanuja M; Czerwinski, Robert M; Almrud, Jeffrey J; Poelarends, Gerrit J; Murzin, Alexey G; Whitman, Christian P

    2004-01-01

    A series of 2-fluoro-4-alkene and 2-fluoro-4-alkyne substrate analogues were synthesized and examined as potential inhibitors of three enzymes: 4-oxalocrotonate tautomerase (4-OT) and vinylpyruvate hydratase (VPH) from the catechol meta-fission pathway and a closely related 4-OT homologue found in

  16. Towards structural studies of the old yellow enzyme homologue SYE4 from Shewanella oneidensis and its complexes at atomic resolution

    International Nuclear Information System (INIS)

    Elegheert, Jonathan; Hemel, Debbie van den; Dix, Ina; Stout, Jan; Van Beeumen, Jozef; Brigé, Ann; Savvides, Savvas N.

    2009-01-01

    Of the four old yellow enzyme homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. Shewanella oneidensis is an environmentally versatile Gram-negative γ-proteobacterium that is endowed with an unusually large proteome of redox proteins. Of the four old yellow enzyme (OYE) homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and were moderately pseudo-merohedrally twinned, emulating a P422 metric symmetry. The native crystals of SYE4 were of exceptional diffraction quality and provided complete data to 1.10 Å resolution using synchrotron radiation, while crystals of the reduced enzyme and of the enzyme in complex with a wide range of ligands typically led to high-quality complete data sets to 1.30–1.60 Å resolution, thus providing a rare opportunity to dissect the structure–function relationships of a good-sized enzyme (40 kDa) at true atomic resolution. Here, the attainment of a number of experimental milestones in the crystallographic studies of SYE4 and its complexes are reported, including isolation of the elusive hydride–Meisenheimer complex

  17. The monomeric orphan nuclear receptor Schistosoma mansoni Ftz-F1 dimerizes specifically and functionally with the schistosome RXR homologue, SmRXR1

    International Nuclear Information System (INIS)

    Bertin, Benjamin; Caby, Stephanie; Oger, Frederik; Sasorith, Souphatta; Wurtz, Jean-Marie; Pierce, Raymond J.

    2005-01-01

    In an attempt to understand development and differentiation processes of the parasitic blood fluke Schistosoma mansoni, several members of the nuclear receptor superfamily were cloned, including SmFtz-F1 (S. mansoni Fushi Tarazu-factor 1). The Ftz-F1 nuclear receptor subfamily only contains orphan receptors that bind to their response element as monomers. Whereas SmFtz-F1 displays these basic functional properties, we have identified an original and specific interaction between SmFtz-F1 and the schistosome RXR homologue, SmRXR1. The mammalian two-hybrid assay showed that the D, E, and F domains of SmFtz-F1 were capable of interacting specifically with the E domain of SmRXR1 but not with that of mouse RXRα. Using three-dimensional LBD homology modelling and structure-guided mutagenesis, we were able to demonstrate the essential role of exposed residues located in the dimerization interfaces of both receptors in the maintenance of the interaction. Cotransfection experiments with constructions encoding full-length nuclear receptors show that SmRXR1 potentiates the transcriptional activity of SmFtz-F1 from various promoters. Nevertheless, the lack of identification of a dimeric response element for this SmFtz-F1/SmRXR1 heterodimer seems to indicate a 'tethering' mechanism. Thus, our results suggest for the first time that a member of the Ftz-F1 family could heterodimerize functionally with a homologue of the universal heterodimerization partner of nuclear receptors. This unique property confirms that SmFtz-F1 may be involved in the development and differentiation of schistosome-specific structures

  18. An exploration of Glb1 Homologue AntibodyLevels in Children at Increased Risk for Type 1 Diabetes mellitus

    Science.gov (United States)

    Simpson, M.; Mojibian, M.; Barriga, K.; Scott, F.W.; Fasano, A.; Rewers, M.; Norris, J.M.

    2010-01-01

    Aims To determine whether Glb1 homologue antibodies are associated with islet autoimmunity (IA) in children at increased risk for type 1 diabetes (T1D), and to investigate their relation with putative environmental correlates of T1D. Methods We selected a sample from the Diabetes Autoimmunity Study in the Young (DAISY), a prospective study of children at increased risk for T1D. Cases were those who were positive for insulin, glutamic acid decarboxylase (GAD), or insulinoma-associated antigen-2 (IA-2) autoantibodies on two consecutive visits and either diagnosed with diabetes mellitus or still autoantibody positive when selected. Controls were from the same increased risk group, of similar age as the cases but negative for autoantibodies. Sera from 91 IA cases and 82 controls were analyzed in a blinded manner for immunoglobulin G (IgG) antibodies to Glb1 homologue by ELISA. Results Adjusting for family history of T1D and HLA-DR4 positivity, Glb1 homologue antibodies were not associated with IA case status (OR: 1.01, 95% CI: 0.99 – 1.03). Adjusting for age, family history of T1D, and HLA-DR4 positivity, Glb1 homologue antibody levels were inversely associated with breast-feeding duration (beta = −0.08, p = 0.001) and directly associated with current intake of foods containing gluten (beta = 0.24, p = 0.007) in IA cases but not in controls. Zonulin, a biomarker of gut permeability, was directly associated with Glb1 homologue antibody levels in cases (beta = 0.73, p = 0.003) but not in controls. Conclusion Differences in correlates of Glb1 antibodies in IA cases and controls suggest an underlying difference in mucosal immune response. PMID:19622083

  19. Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes

    International Nuclear Information System (INIS)

    Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver

    2005-01-01

    Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin

  20. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Science.gov (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  1. Equilibrium evaporation behavior of polonium and its homologue tellurium in liquid lead-bismuth eutectic

    International Nuclear Information System (INIS)

    Ohno, Shuji; Miyahara, Shinya; Kurata, Yuji; Katsura, Ryoei; Yoshida, Shigeru

    2006-01-01

    Experimental study using the transpiration method investigates equilibrium evaporation behavior of radionuclide polonium ( 210 Po) generated and accumulated in liquid lead-bismuth eutectic (LBE) cooled nuclear systems. The experiment consists of two series of tests: preliminary evaporation tests for homologue element tellurium (Te) in LBE, and evaporation tests for 210 Po-accumulated LBE in which test specimens are prepared by neutron irradiation. The evaporation tests of Te in LBE provide the suggestion that Te exists in a chemical form of PbTe as well as the information for confirming the validity of technique and conditions of Po test. From the evaporation tests of 210 Po in LBE, we obtain fundamental data and empirical equations such as 210 Po vapor concentration in the gas phase, 210 Po partial vapor pressure, thermodynamic activity coefficients, and gas-liquid equilibrium partition coefficient of 210 Po in LBE in the temperature range from 450 to 750degC. Additionally, radioactivity concentration of 210 Po and 210m Bi vapor in a cover gas region of a typical LBE-cooled nuclear system is specifically estimated based on the obtained experimental results, and the importance of 210 Po evaporation behavior is quantitatively demonstrated. (author)

  2. Crystal structure of a bacterial homologue of the bile acid sodium symporter ASBT

    Science.gov (United States)

    Hu, Nien-Jen; Iwata, So; Cameron, Alexander D.; Drew, David

    2011-01-01

    High cholesterol levels greatly increase the risk of cardiovascular disease. By its conversion into bile acids, about 50% of cholesterol is eliminated from the body. However bile acids released from the bile duct are constantly recycled, being reabsorbed in the intestine via the Apical Sodium dependent Bile acid Transporter (ASBT). It has been shown in animal models that plasma cholesterol levels are significantly lowered by specific inhibitors of ASBT1,2, thus ASBT is a target for hypercholesterolemia drugs. Here, we describe the crystal structure of a bacterial homologue of ASBT from Neisseria meningitidis (ASBTNM) at 2.2Å. ASBTNM contains two inverted structural repeats of five transmembrane helices. A Core domain of six helices harbours two sodium ions while the remaining helices form a Panel-like domain. Overall the architecture of the protein is remarkably similar to the sodium-proton antiporter NhaA3 despite no detectable sequence homology. A bile acid molecule is situated between the Core and Panel domains in a large hydrophobic cavity. Residues near to this cavity have been shown to affect the binding of specific inhibitors of human ASBT4. The position of the bile acid together with the molecular architecture suggests the rudiments of a possible transport mechanism. PMID:21976025

  3. Edge profiles in K shell photoabsorption spectra of gaseous hydrides of 3p elements and homologues

    Science.gov (United States)

    Hauko, R.; Gomilšek, J. Padežnik; Kodre, A.; Arčon, I.; Aquilanti, G.

    2017-10-01

    Photoabsorption spectra of gaseous hydrides of 3p elements (PH3, H2S, HCl) are measured in the energy region of photoexcitations pertaining to K edge. The analysis of the edge profile is extended to hydrides of 4p series (GeH4, AsH3, H2Se, HBr) from an earlier experiment, and to published spectra of 2p hydrides (CH4, NH3, H2O, HF) and noble gases Ar, Kr and Ne and SiH4. The edge profiles are modelled with a linear combination of lorentzian components, describing excitations to individual bound states and to continuum. Transition energies and probabilities are also calculated in the non-relativistic molecular model of the ORCA code, in good agreement with the experiment. Edge profiles in the heavier homologues are closely similar, the symmetry of the molecule governs the transitions to the lowest unoccupied orbitals. In 2p series the effect of the strong nuclear potential prevails. Transitions to higher, atomic-like levels remain very much the same as in free atoms.

  4. The human homologue of Dictyostelium discoideum phg1A is expressed by human metastatic melanoma cells.

    Science.gov (United States)

    Lozupone, Francesco; Perdicchio, Maurizio; Brambilla, Daria; Borghi, Martina; Meschini, Stefania; Barca, Stefano; Marino, Maria Lucia; Logozzi, Mariantonia; Federici, Cristina; Iessi, Elisabetta; de Milito, Angelo; Fais, Stefano

    2009-12-01

    Tumour cannibalism is a characteristic of malignancy and metastatic behaviour. This atypical phagocytic activity is a crucial survival option for tumours in conditions of low nutrient supply, and has some similarities to the phagocytic activity of unicellular microorganisms. In fact, Dictyostelium discoideum has been used widely as a model to study phagocytosis. Recently, phg1A has been described as a protein that is primarily involved in the phagocytic process of this microorganism. The closest human homologue to phg1A is transmembrane 9 superfamily protein member 4 (TM9SF4). Here, we report that TM9SF4 is highly expressed in human malignant melanoma cells deriving from metastatic lesions, whereas it is undetectable in healthy human tissues and cells. TM9SF4 is predominantly expressed in acidic vesicles of melanoma cells, in which it co-localizes with the early endosome antigens Rab5 and early endosome antigen 1. TM9SF4 silencing induced marked inhibition of cannibal activity, which is consistent with a derangement of intracellular pH gradients, with alkalinization of acidic vesicles and acidification of the cell cytosol. We propose TM9SF4 as a new marker of malignancy, representing a potential new target for anti-tumour strategies with a specific role in tumour cannibalism and in the establishment of a metastatic phenotype.

  5. The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK

    Science.gov (United States)

    Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A

    2014-01-01

    A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930

  6. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

    Science.gov (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

    2007-07-01

    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  7. Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

    Energy Technology Data Exchange (ETDEWEB)

    Kurz, M. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); Iturbe-Ormaetxe, I. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Jarrott, R. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); O’Neill, S. L. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Byriel, K. A.; Martin, J. L., E-mail: j.martin@imb.uq.edu.au; Heras, B., E-mail: j.martin@imb.uq.edu.au [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia)

    2008-02-01

    The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, b = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.

  8. Stereoselectivity of the demethylation of nicotine piperidine homologues by Nicotiana plumbaginifolia cell suspension cultures.

    Science.gov (United States)

    Bartholomeusz, Trixie Ann; Molinié, Roland; Roscher, Albrecht; Felpin, François-Xavier; Gillet, Françoise; Lebreton, Jacques; Mesnard, François; Robins, Richard J

    2005-08-01

    The metabolism of (R,S)-N-methylanabasine and (R,S)-N-methylanatabine has been studied in a cell suspension culture of Nicotiana plumbaginifolia. Both substrates are effectively demethylated, anabasine or anatabine, respectively, accumulating in the medium. Similarly, there is strong stereoselectivity for the (R)-isomers of both substrates. The kinetics of metabolism of (R,S)-N-methylanabasine differ significantly from those of nicotine in that no further degradation of the initial demethylation product occurs. (R,S)-N-Methylanatabine, however, shows kinetics closer to those of nicotine, with loss of alkaloid from the system. Further more, (R,S)-N-methylanabasine does not diminish (S)-nicotine demethylation, indicating a lack of competition. However, the metabolism of (S)-nicotine is affected by the presence of (R,S)-N-methylanabasine. Hence, the demethylation of the piperidine homologues of nicotine is seen to be similar but not identical to that of the pyridine analogues. The implications of these different metabolic profiles in relation to the demethylation activity are discussed.

  9. Validating tyrosinase homologue MelA as a photoacoustic reporter gene for imaging Escherichia coli

    Science.gov (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert; Zemp, Roger

    2015-03-01

    Antibiotic drug resistance is a major worldwide issue. Development of new therapies against pathogenic bacteria requires appropriate research tools for replicating and characterizing infections. Previously fluorescence and bioluminescence modalities have been used to image infectious burden in animal models but scattering significantly limits imaging depth and resolution. We hypothesize that photoacoustic imaging, which has improved depth-toresolution ratio, could be useful for visualizing MelA-expressing bacteria since MelA is a bacterial tyrosinase homologue involved in melanin production. Using an inducible expression system, E. coli expressing MelA were visibly black in liquid culture. Phosphate buffered saline (PBS), MelA-expressing bacteria (at different dilutions in PBS), and chicken embryo blood were injected in plastic tubes which were imaged using a VisualSonics Vevo LAZR system. Photoacoustic imaging at 6 different wavelengths (680, 700, 750, 800, 850 and 900nm) enabled spectral de-mixing to distinguish melanin signals from blood. The signal to noise ratio of 9x diluted MelA bacteria was 55, suggesting that ~20 bacteria cells could be detected with our system. When MelA bacteria were injected as a 100 μL bolus into a chicken embryo, photoacoustic signals from deoxy- and oxy- hemoglobin as well as MelA-expressing bacteria could be separated and overlaid on an ultrasound image, allowing visualization of the bacterial location. Photoacoustic imaging may be a useful tool for visualizing bacterial infections and further work incorporating photoacoustic reporters into infectious bacterial strains is warranted.

  10. DNA methyltransferase homologue TRDMT1 in Plasmodium falciparum specifically methylates endogenous aspartic acid tRNA.

    Science.gov (United States)

    Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam

    2017-10-01

    In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. The ontogeny of nanos homologue expression in the oligochaete annelid Tubifex tubifex.

    Science.gov (United States)

    Mohri, Ki-Ichi; Nakamoto, Ayaki; Shimizu, Takashi

    2016-01-01

    We have cloned and characterized the expression of a nanos homologue (designated Ttu-nos) from the oligochaete annelid Tubifex tubifex. Ttu-nos mRNA is distributed broadly throughout the early cleavage stages. Ttu-nos is expressed in most if not all of the early blastomeres, in which Ttu-nos RNA associates with pole plasms. Ttu-nos transcripts are concentrated to 2d and 4d cells. Shortly after 2d(111) (derived from 2d cell) divides into a bilateral pair of NOPQ proteloblasts, Ttu-nos RNA vanishes from the embryo, which is soon followed by the resumption of Ttu-nos expression in nascent primary blast cells produced by teloblasts. The resumption of Ttu-nos expression occurs only in a subset of teloblast lineages (viz., M, N and Q). After Ttu-nos expression is retained in the germ band for a while, it disappears in anterior-to-posterior progression. At the end of embryogenesis, there is no trace of Ttu-nos expression. Thereafter, growing juveniles do not show any sign of Ttu-nos expression, either. The first sign of Ttu-nos expression is detected in oocytes in the ovary of young adults (ca 40 days after hatching), and its expression continues in growing oocytes that undergo yolk deposition and maturation in the ovisac. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Short- and medium-chain chlorinated paraffins in biota from the European Arctic -- differences in homologue group patterns.

    Science.gov (United States)

    Reth, Margot; Ciric, Anita; Christensen, Guttorm N; Heimstad, Eldbjørg S; Oehme, Michael

    2006-08-15

    Congener and homologue group patterns of chlorinated paraffins (CPs) in biota can be influenced by different processes, but these are not well studied yet. Short- (SCCPs) and medium-chain chlorinated paraffins (MCCPs) were quantified in liver from Arctic char and seabirds (little auk and kittiwake) collected at Bear Island (European Arctic) as well as in cod from Iceland and Norway. CP concentrations were between 5 and 88 ng/g wet weight (ww) for SCCPs and between 5 and 55 ng/g ww for MCCPs with one exception of 370 ng/g measured in a liver sample from little auk. The SCCP homologue group patterns were compared with those of technical mixtures and of SCCPs present in cod liver from the Baltic Sea. The latter showed a more common SCCP homologue distribution (sum of C(11) and C(12)>60%) in contrast to cod liver from the Northwest of Europe, which had a high abundance of C(10) and C(12) congeners. Seabirds from Bear Island contained an equally distributed SCCP homologue group pattern. In Arctic char, the SCCP distribution was closer to technical products, but with a high proportion (average of 18.9%) of C(10) congeners. A comparison of C(10)/C(12) ratios confirmed the higher abundance of C(10) congeners in samples from higher latitudes. For the first time, MCCPs could be detected in Arctic samples. The average proportion of C(14) congeners was 65.8%. The C(14)/C(15) abundance ratio was similar to technical mixtures. High-chlorinated CPs (Cl(>7)) were also detectable. The average chlorine content of the SCCPs was 61.9% (59.0-63.3%), and that of the MCCPs 55.8% (54.5-57.4%).

  13. Enhancer of the rudimentary gene homologue (ERH expression pattern in sporadic human breast cancer and normal breast tissue

    Directory of Open Access Journals (Sweden)

    Knüchel Ruth

    2008-05-01

    Full Text Available Abstract Background The human gene ERH (Enhancer of the Rudimentary gene Homologue has previously been identified by in silico analysis of four million ESTs as a gene differentially expressed in breast cancer. The biological function of ERH protein has not been fully elucidated, however functions in cell cycle progression, pyrimidine metabolism a possible interaction with p21(Cip1/Waf1 via the Ciz1 zinc finger protein have been suggested. The aim of the present study was a systematic characterization of ERH expression in human breast cancer in order to evaluate possible clinical applications of this molecule. Methods The expression pattern of ERH was analyzed using multiple tissue northern blots (MTN on a panel of 16 normal human tissues and two sets of malignant/normal breast and ovarian tissue samples. ERH expression was further analyzed in breast cancer and normal breast tissues and in tumorigenic as well as non-tumorigenic breast cancer cell lines, using quantitative RT-PCR and non-radioisotopic in situ hybridization (ISH. Results Among normal human tissues, ERH expression was most abundant in testis, heart, ovary, prostate, and liver. In the two MTN sets of malignant/normal breast and ovarian tissue,ERH was clearly more abundantly expressed in all tumours than in normal tissue samples. Quantitative RT-PCR analyses showed that ERH expression was significantly more abundant in tumorigenic than in non-tumorigenic breast cancer cell lines (4.5-fold; p = 0.05, two-tailed Mann-Whitney U-test; the same trend was noted in a set of 25 primary invasive breast cancers and 16 normal breast tissue samples (2.5-fold; p = 0.1. These findings were further confirmed by non-radioisotopic ISH in human breast cancer and normal breast tissue. Conclusion ERH expression is clearly up-regulated in malignant as compared with benign breast cells both in primary human breast cancer and in cell models of breast cancer. Since similar results were obtained for ovarian

  14. Species-specific flight styles of flies are reflected in the response dynamics of a homologue motion sensitive neuron

    Directory of Open Access Journals (Sweden)

    Bart eGeurten

    2012-03-01

    Full Text Available Hoverflies and blowflies have distinctly different flight styles. Yet, both species have been shown to structure their flight behaviour in a way that facilitates extraction of 3D information from the image flow on the retina (optic flow. Neuronal candidates to analyse the optic flow are the tangential cells in the third optical ganglion – the lobula complex. These neurons are directionally selective and integrate the optic flow over large parts of the visual field. Homologue tangential cells in hoverflies and blowflies have a similar morphology. Because blowflies and hoverflies have similar neuronal layout but distinctly different flight behaviours, they are an ideal substrate to pinpoint potential neuronal adaptations to the different flight styles.In this article we describe the relationship between locomotion behaviour and motion vision on three different levels:1.We compare the different flight styles based on the categorisation of flight behaviour into prototypical movements.2.We measure the species specific dynamics of the optic flow under naturalistic flight conditions. We found the translational optic flow of both species to be very different.3.We describe possible adaptations of a homologue motion sensitive neuron. We stimulate this cell in blowflies (Calliphora and hoverflies (Eristalis with naturalistic optic flow generated by both species during free flight. The characterized hoverfly tangential cell responds faster to transient changes in the optic flow than its blowfly homologue. It is discussed whether and how the different dynamical response properties aid optic flow analysis.

  15. Identification of NoxD/Pro41 as the homologue of the p22phox NADPH oxidase subunit in fungi.

    Science.gov (United States)

    Lacaze, Isabelle; Lalucque, Hervé; Siegmund, Ulrike; Silar, Philippe; Brun, Sylvain

    2015-03-01

    NADPH oxidases (Nox) are membrane complexes that produce O2(-). Researches in mammals, plants and fungi highlight the involvement of Nox-generated ROS in cell proliferation, differentiation and defense. In mammals, the core enzyme gp91(phox)/Nox2 is associated with p22(phox) forming the flavocytochrome b558 ready for activation by a cytosolic complex. Intriguingly, no homologue of the p22(phox) gene has been found in fungal genomes, questioning how the flavoenzyme forms. Using whole genome sequencing combined with phylogenetic analysis and structural studies, we identify the fungal p22(phox) homologue as being mutated in the Podospora anserina mutant IDC(509). Functional studies show that the fungal p22(phox), PaNoxD, acts along PaNox1, but not PaNox2, a second fungal gp91(phox) homologue. Finally, cytological analysis of functional tagged versions of PaNox1, PaNoxD and PaNoxR shows clear co-localization of PaNoxD and PaNox1 and unravel a dynamic assembly of the complex in the endoplasmic reticulum and in the vacuolar system. © 2014 John Wiley & Sons Ltd.

  16. Mono-, di- and trimethylated homologues of isoprenoid tetraether lipid cores in archaea and environmental samples: mass spectrometric identification and significance.

    Science.gov (United States)

    Knappy, Chris; Barillà, Daniela; Chong, James; Hodgson, Dominic; Morgan, Hugh; Suleman, Muhammad; Tan, Christine; Yao, Peng; Keely, Brendan

    2015-12-01

    Higher homologues of widely reported C(86) isoprenoid diglycerol tetraether lipid cores, containing 0-6 cyclopentyl rings, have been identified in (hyper)thermophilic archaea, representing up to 21% of total tetraether lipids in the cells. Liquid chromatography-tandem mass spectrometry confirms that the additional carbon atoms in the C(87-88) homologues are located in the etherified chains. Structures identified include dialkyl and monoalkyl ('H-shaped') tetraethers containing C(40-42) or C(81-82) hydrocarbons, respectively, many representing novel compounds. Gas chromatography-mass spectrometric analysis of hydrocarbons released from the lipid cores by ether cleavage suggests that the C(40) chains are biphytanes and the C(41) chains 13-methylbiphytanes. Multiple isomers, having different chain combinations, were recognised among the dialkyl lipids. Methylated tetraethers are produced by Methanothermobacter thermautotrophicus in varying proportions depending on growth conditions, suggesting that methylation may be an adaptive mechanism to regulate cellular function. The detection of methylated lipids in Pyrobaculum sp. AQ1.S2 and Sulfolobus acidocaldarius represents the first reported occurrences in Crenarchaeota. Soils and aquatic sediments from geographically distinct mesotemperate environments that were screened for homologues contained monomethylated tetraethers, with di- and trimethylated structures being detected occasionally. The structural diversity and range of occurrences of the C(87-89) tetraethers highlight their potential as complementary biomarkers for archaea in natural environments. Copyright © 2015 John Wiley & Sons, Ltd.

  17. Crystal structure of pira toxin-I: a calcium-independent, myotoxic phospholipase A2 - homologue from Bothrops pirajai venom

    International Nuclear Information System (INIS)

    Canduri, R.J.; Ward, R.J.; Azevedo Junior, G.W.F. de; Arni, R.K.; Soares, A.M.; Giglio, J.R.

    1997-01-01

    Full text. Phospho lipases A2 (PLA 2 ) are small enzymes that specifically hydrolysed the sn-2 ester bond of phospholipids, preferentially in lamellar or micellar aggregates at membrane surfaces. These enzymes are widely distributed in nature and have been extensively studied. Toxic proteins from venoms from Bothrops species include catalytically active PLA 2 s and calcium independent PLA 2L ys 49 homologues. The substitution of Asp49 by Lys greatly diminishes the ability of these PLA 2 to bind calcium, an ion that plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The Lys 49 PLA 2 homologues and therefore catalytically inactive yet maintain cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid bilayers by a poorly understood Ca 2+ independente mechanism. Lys49 PLA 2 homologues demonstrate a specific toxic activity against skeletal muscle, affecting only muscle fibers and leaving other tissue structure such as connective tissue, nerves and vessels essentially unharmed. In order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ -independent membrane damaging activities, we have determined the crystal structure of Pr TX-I, a Lys49 variant from the venom of B. pirajai. The model presented has been determined at 2.8 angstrom resolution and refined to a crystallographic residual of 19.7% (R free =29.7%). (author)

  18. Concentration factors for fish

    International Nuclear Information System (INIS)

    Feldt, W.; Lauer, R.; Melzer, M.; Siebert, W.

    1978-01-01

    Concentration factors are defined as operators allowing to calculate the specific activity of fish meat from a given concentration of an element in the water. This parameter depends among others from the content of stable isotopes and homologues in the different waters. If this parameter is reasonably to be used for model calculations it must be referred to water with all of its content substances, these calculations also being based on this type of 'water'. (orig.) [de

  19. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng; Zhang, Gen; Qian, Pei-Yuan

    2013-01-01

    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  20. Phagosome maturation in unicellular eukaryote Paramecium: the presence of RILP, Rab7 and LAMP-2 homologues

    Directory of Open Access Journals (Sweden)

    E Wyroba

    2009-08-01

    Full Text Available Phagosome maturation is a complex process enabling degradation of internalised particles. Our data obtained at the gene, protein and cellular level indicate that the set of components involved in this process and known up to now in mammalian cells is functioning in unicellular eukaryote. Rab7-interacting partners: homologues of its effector RILP (Rab-interacting lysosomal protein and LAMP-2 (lysosomal membrane protein 2 as well as a7 subunit of the 26S proteasome were revealed in Paramecium phagolysosomal compartment. We identified the gene/transcript fragments encoding RILP-related proteins (RILP1 and RILP2 in Paramecium by PCR/RT-PCR and sequencing. The deduced amino acid sequences of RILP1 and RILP2 show 60.5% and 58.3% similarity, respectively, to the region involved in regulating of lysosomal morphology and dynein-dynactin recruitment of human RILP. RILP colocalised with Rab7 in Paramecium lysosomes and at phagolysosomal membrane during phagocytosis of both the latex beads and bacteria. In the same compartment LAMP-2 was present and its expression during latex internalisation was 2.5-fold higher than in the control when P2 protein fractions (100 000 x g of equal load were quantified by immunoblotting. LAMP-2 crossreacting polypeptide of ~106 kDa was glycosylated as shown by fluorescent and Western analysis of the same blot preceded by PNGase F treatment. The a7 subunit of 26S proteasome was detected close to the phagosomal membrane in the small vesicles, in some of which it colocalised with Rab7. Immunoblotting confirmed presence of RILPrelated polypeptide and a7 subunit of 26S proteasome in Paramecium protein fractions. These results suggest that Rab7, RILP and LAMP-2 may be involved in phagosome maturation in Paramecium.

  1. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng

    2013-05-22

    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  2. Synthesis, electrochemistry, and electrogenerated chemiluminescence of two BODIPY-appended bipyridine homologues.

    Science.gov (United States)

    Qi, Honglan; Teesdale, Justin J; Pupillo, Rachel C; Rosenthal, Joel; Bard, Allen J

    2013-09-11

    Two new 2,2'-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5'-positions (BB3) or 6- and 6'-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry, and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993-18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e(-) oxidation and reduction waves, which consist of two closely spaced (50-70 mV) 1e(-) events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2'-bipyridine spacer of each bpy-BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ∼570 nm and is attributed to emission via an S- or T-route. The second band occurs at longer wavelengths and is centered around ∼740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather it suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process.

  3. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis.

    Directory of Open Access Journals (Sweden)

    Yanyan Lu

    2018-04-01

    Full Text Available Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST. Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a 'Solute_trans_a' domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N at the N-terminus and disordered domain (CsOST-C at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes.

  4. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis

    Science.gov (United States)

    Dai, Fuhong; Lee, Ji-Yun; Pak, Jhang Ho; Sohn, Woon-Mok

    2018-01-01

    Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST) transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST). Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a ‘Solute_trans_a’ domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N) at the N-terminus and disordered domain (CsOST-C) at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes. PMID:29702646

  5. Regulation of Metalloprotease Gene Expression in Vibrio vulnificus by a Vibrio harveyi LuxR Homologue

    Science.gov (United States)

    Shao, Chung-Ping; Hor, Lien-I

    2001-01-01

    Expression of the Vibrio vulnificus metalloprotease gene, vvp, was turned up rapidly when bacterial growth reached the late log phase. A similar pattern of expression has been found in the metalloprotease gene of Vibrio cholerae, and this has been shown to be regulated by a Vibrio harveyi LuxR-like transcriptional activator. To find out whether a LuxR homologue exists in V. vulnificus, a gene library of this organism was screened by colony hybridization using a probe derived from a sequence that is conserved in various luxR-like genes of vibrios. A gene containing a 618-bp open reading frame was identified and found to be identical to the smcR gene of V. vulnificus reported previously. An isogenic SmcR-deficient (RD) mutant was further constructed by an in vivo allelic exchange technique. This mutant exhibited an extremely low level of vvp transcription compared with that of the parent strain. On the other hand, the cytolysin gene, vvhA, was expressed at a higher level in the RD mutant than in the parent strain during the log phase of growth. These data suggested that SmcR might not only be a positive regulator of the protease gene but might also be involved in negative regulation of the cytolysin gene. Virulence of the RD mutant in either normal or iron-overloaded mice challenged by intraperitoneal injection was comparable to that of the parent strain, indicating that SmcR is not required for V. vulnificus virulence in mice. PMID:11157950

  6. Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean

    Institute of Scientific and Technical Information of China (English)

    Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair

    2014-01-01

    Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.

  7. Neurophysiological Evidence That Musical Training Influences the Recruitment of Right Hemispheric Homologues for Speech Perception

    Directory of Open Access Journals (Sweden)

    McNeel Gordon Jantzen

    2014-03-01

    Full Text Available Musicians have a more accurate temporal and tonal representation of auditory stimuli than their non-musician counterparts (Kraus & Chandrasekaran, 2010; Parbery-Clark, Skoe, & Kraus, 2009; Zendel & Alain, 2008; Musacchia, Sams, Skoe, & Kraus, 2007. Musicians who are adept at the production and perception of music are also more sensitive to key acoustic features of speech such as voice onset timing and pitch. Together, these data suggest that musical training may enhance the processing of acoustic information for speech sounds. In the current study, we sought to provide neural evidence that musicians process speech and music in a similar way. We hypothesized that for musicians, right hemisphere areas traditionally associated with music are also engaged for the processing of speech sounds. In contrast we predicted that in non-musicians processing of speech sounds would be localized to traditional left hemisphere language areas. Speech stimuli differing in voice onset time was presented using a dichotic listening paradigm. Subjects either indicated aural location for a specified speech sound or identified a specific speech sound from a directed aural location. Musical training effects and organization of acoustic features were reflected by activity in source generators of the P50. This included greater activation of right middle temporal gyrus (MTG and superior temporal gyrus (STG in musicians. The findings demonstrate recruitment of right hemisphere in musicians for discriminating speech sounds and a putative broadening of their language network. Musicians appear to have an increased sensitivity to acoustic features and enhanced selective attention to temporal features of speech that is facilitated by musical training and supported, in part, by right hemisphere homologues of established speech processing regions of the brain.

  8. Synthesis, Electrochemistry and Electrogenerated Chemiluminesce of two BODIPY-Appended Bipyridine Homologues

    Science.gov (United States)

    Qi, Honglan; Teesdale, Justin J.; Pupillo, Rachel C.

    2014-01-01

    Two new 2,2’-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5’-positions (BB3) or 6- and 6’-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993–18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e− oxidation and reduction waves, which consist of two closely spaced (50 – 70 mV) 1e− events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2’-bipyridine spacer of each bpy- BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ~570 nm and is attributed to emission via an S- or T-route. The second band, occurs at longer wavelengths and is centered around ~740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather is suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process. PMID:23980850

  9. Broad anti-HIV activity of the Oscillatoria agardhii agglutinin homologue lectin family.

    Science.gov (United States)

    Férir, Geoffrey; Huskens, Dana; Noppen, Sam; Koharudin, Leonardus M I; Gronenborn, Angela M; Schols, Dominique

    2014-10-01

    Oscillatoria agardhii agglutinin homologue (OAAH) proteins belong to a recently discovered lectin family. The founding member OAA and a designed hybrid OAAH (OPA) recognize similar but unique carbohydrate structures of Man-9, compared with other antiviral carbohydrate-binding agents (CBAs). These two newly described CBAs were evaluated for their inactivating properties on HIV replication and transmission and for their potential as microbicides. Various cellular assays were used to determine antiviral activity against wild-type and certain CBA-resistant HIV-1 strains: (i) free HIV virion infection in human T lymphoma cell lines and PBMCs; (ii) syncytium formation assay using persistently HIV-infected T cells and non-infected CD4+ T cells; (iii) DC-SIGN-mediated viral capture; and (iv) transmission to uninfected CD4+ T cells. OAA and OPA were also evaluated for their mitogenic properties and potential synergistic effects using other CBAs. OAA and OPA inhibit HIV replication, syncytium formation between HIV-1-infected and uninfected T cells, DC-SIGN-mediated HIV-1 capture and transmission to CD4+ target T cells, thereby rendering a variety of HIV-1 and HIV-2 clinical isolates non-infectious, independent of their coreceptor use. Both CBAs competitively inhibit the binding of the Manα(1-2)Man-specific 2G12 monoclonal antibody (mAb) as shown by flow cytometry and surface plasmon resonance analysis. The HIV-1 NL4.3(2G12res), NL4.3(MVNres) and IIIB(GRFTres) strains were equally inhibited as the wild-type HIV-1 strains by these CBAs. Combination studies indicate that OAA and OPA act synergistically with Hippeastrum hybrid agglutinin, 2G12 mAb and griffithsin (GRFT), with the exception of OPA/GRFT. OAA and OPA are unique CBAs with broad-spectrum anti-HIV activity; however, further optimization will be necessary for microbicidal application. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights

  10. Expression patterns of Passiflora edulis APETALA1/FRUITFULL homologues shed light onto tendril and corona identities

    Directory of Open Access Journals (Sweden)

    Livia C. T. Scorza

    2017-02-01

    Full Text Available Abstract Background Passiflora (passionflowers makes an excellent model for studying plant evolutionary development. They are mostly perennial climbers that display axillary tendrils, which are believed to be modifications of the inflorescence. Passionflowers are also recognized by their unique flower features, such as the extra whorls of floral organs composed of corona filaments and membranes enclosing the nectary. Although some work on Passiflora organ ontogeny has been done, the developmental identity of both Passiflora tendrils and the corona is still controversial. Here, we combined ultrastructural analysis and expression patterns of the flower meristem and floral organ identity genes of the MADS-box AP1/FUL clade to reveal a possible role for these genes in the generation of evolutionary novelties in Passiflora. Results We followed the development of structures arising from the axillary meristem from juvenile to adult phase in P. edulis. We further assessed the expression pattern of P. edulis AP1/FUL homologues (PeAP1 and PeFUL, by RT-qPCR and in situ hybridization in several tissues, correlating it with the developmental stages of P. edulis. PeAP1 is expressed only in the reproductive stage, and it is highly expressed in tendrils and in flower meristems from the onset of their development. PeAP1 is also expressed in sepals, petals and in corona filaments, suggesting a novel role for PeAP1 in floral organ diversification. PeFUL presented a broad expression pattern in both vegetative and reproductive tissues, and it is also expressed in fruits. Conclusions Our results provide new molecular insights into the morphological diversity in the genus Passiflora. Here, we bring new evidence that tendrils are part of the Passiflora inflorescence. This points to the convergence of similar developmental processes involving the recruitment of genes related to flower identity in the origin of tendrils in different plant families. The data obtained also

  11. Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli

    Science.gov (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger

    2015-10-01

    To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work

  12. Over-expression, purification and characterization of an Asc-1 homologue from Gloeobacter violaceus

    DEFF Research Database (Denmark)

    Wang, Xiaole; Hald, Helle; Ernst, Heidi Asschenfeldt

    2010-01-01

    The human alanine-serine-cysteine transporter 1 (Asc-1) belongs to the slc7a family of solute carrier transporters. Asc-1 mediates the uptake of D-serine in an exchanger-type fashion, coupling the process to the release of alanine and cysteine. Among the bacterial Asc-1 homologues, one transporter...... of auto-induction was crucial for obtaining high yields and purity of the transporter. The transporter was purified with yields in the range of 0.2-0.4 mg per L culture and eluted in a single peak from a size-exclusion column. The circular dichroism spectrum revealed a folded and apparently all...

  13. Effects of the deletion of the Escherichia coli frataxin homologue CyaY on the respiratory NADH:ubiquinone oxidoreductase

    Directory of Open Access Journals (Sweden)

    Grauman Peter L

    2007-07-01

    Full Text Available Abstract Background Frataxin is discussed as involved in the biogenesis of iron-sulfur clusters. Recently it was discovered that a frataxin homologue is a structural component of the respiratory NADH:ubiquinone oxidoreductase (complex I in Thermus thermophilus. It was not clear whether frataxin is in general a component of complex I from bacteria. The Escherichia coli homologue of frataxin is coined CyaY. Results We report that complex I is completely assembled to a stable and active enzyme complex equipped with all known iron-sulfur clusters in a cyaY mutant of E. coli. However, the amount of complex I is reduced by one third compared to the parental strain. Western blot analysis and live cell imaging of CyaY engineered with a GFP demonstrated that CyaY is located in the cytoplasm and not attached to the membrane as to be expected if it were a component of complex I. Conclusion CyaY plays a non-essential role in the assembly of complex I in E. coli. It is not a structural component but may transiently interact with the complex.

  14. TMBP200, a XMAP215 homologue of tobacco BY-2 cells, has an essential role in plant mitosis.

    Science.gov (United States)

    Yasuhara, Hiroki; Oe, Yuki

    2011-07-01

    TMBP200 from tobacco BY-2 cells is a member of the highly conserved family of microtubule-associated proteins that includes Xenopus XMAP215, human TOGp, and Arabidopsis MOR1/GEM1. XMAP215 homologues have an essential role in spindle assembly and function in animals and yeast, but their role in plant mitosis is not fully clarified. Here, we show by immunoblot analysis that TMBP200 levels in synchronously cultured BY-2 cells increased when the cells entered mitosis, thus indicating that TMBP200 plays an important role in mitosis in tobacco. To investigate the role of TMBP200 in mitosis, we employed inducible RNA interference to silence TMBP200 expression in BY-2 cells. The resulting depletion of TMBP200 caused severe defects in bipolar spindle formation and resulted in the appearance of multinucleated cells with variable-sized nuclei. This finding indicates that TMBP200 has an essential role in bipolar spindle formation and function.

  15. The expression of the rice (Oryza sativa L.) homologue of Snm1 is induced by DNA damages

    International Nuclear Information System (INIS)

    Kimura, Seisuke; Saotome, Ai; Uchiyama, Yukinobu; Mori, Yoko; Tahira, Yasue; Sakaguchi, Kengo

    2005-01-01

    We isolated and characterized the rice homologue of the DNA repair gene Snm1 (OsSnm1). The length of the cDNA was 1862 bp; the open reading frame encoded a predicted product of 485 amino acid residues with a molecular mass of 53.2 kDa. The OsSnm1 protein contained the conserved β-lactamase domain in its internal region. OsSnm1 was expressed in all rice organs. The expression was induced by MMS, H 2 O 2 , and mitomycin C, but not by UV. Transient expression of an OsSnm1/GFP fusion protein in onion epidermal cells revealed the localization of OsSnm1 to the nucleus. These results suggest that OsSnm1 is involved not only in the repair of DNA interstrand crosslinks, but also in various other DNA repair pathways

  16. Investigation of evaporation characteristics of polonium and its lighter homologues selenium and tellurium from liquid Pb-Bi-eutecticum

    CERN Document Server

    Neuhausen, J; Eichler, B

    2004-01-01

    The evaporation behaviour of polonium and its lighter homologues selenium and tellurium dissolved in liquid Pb-Bi-eutecticum (LBE) has been studied at various temperatures in the range from 482 K up to 1330 K under Ar/H2 and Ar/H2O-atmospheres using γ-ray spectroscopy. Polonium release in the temperature range of interest for technical applications is slow. Within short term (1h) experiments measurable amounts of polonium are evaporated only at temperatures above 973 K. Long term experiments reveal that a slow evaporation of polonium occurs at temperatures around 873 K resulting in a fractional polonium loss of the melt around 1% per day. Evaporation rates of selenium and tellurium are smaller than those of polonium. The presence of H2O does not enhance the evaporation within the error limits of our experiments. The thermodynamics and possible reaction pathways involved in polonium release from LBE are discussed.

  17. Snipper, an Eri1 homologue, affects histone mRNA abundance and is crucial for normal Drosophila melanogaster development.

    Science.gov (United States)

    Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton

    2017-07-01

    The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.

  18. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3 gene: a novel mammalian homologue of ACE

    Directory of Open Access Journals (Sweden)

    Phelan Anne

    2007-06-01

    Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.

  19. The effect of delta-like 1 homologue on the proliferation and odontoblastic differentiation in human dental pulp stem cells.

    Science.gov (United States)

    Qi, Shengcai; Yan, Yanhong; Wen, Yue; Li, Jialiang; Wang, Jing; Chen, Fubo; Tang, Xiaoshan; Shang, Guangwei; Xu, Yuanzhi; Wang, Raorao

    2017-06-01

    This study aimed to investigate the functions of delta-like homologue 1 (DLK1) in the proliferation and differentiation of human dental pulp stem cells (hDPSCs). Immunohistochemical analysis was used to determine the expression of alkaline phosphatase (ALP), dentin sialophosphoprotein (DSPP), DLK1, NOTCH1 and p-ERK1/2 in the mouse first maxillary molar. Recombinant lentivirus was constructed to overexpress DLK1 stably in hDPSCs. The cell viability and proliferation of hDPSCs were examined by CCK8 and EdU incorporation assay respectively. The odontoblastic differentiation of hDPSCs was determined by detection of ALPase activity assay, ALP and alizarin red staining and the expression of mineralization-related genes including ALP, DSPP and dental matrix protein. The mRNA and protein levels of DLK1 and p-ERK1/2 protein expression were detected. ERK inhibitor was used to test the differentiation effect of DLK1 on hDPSCs. Delta-like homologue 1 was highly expressed on the odontoblasts and dental pulp cells on the first maxillary molar; the expression of p-ERK1/2 is similar with the DLK1 in the same process. The expression level of DLK1 increased significantly after the odontoblastic induction of hDPSCs. DLK1 overexpression increased the proliferation ability of hDPSCs and inhibited odontoblastic differentiation of hDPSCs. The protein level of p-ERK1/2 significantly increased in hDPSCs/dlk1-oe group. ERK signalling pathway inhibitor reversed the odontoblastic differentiation effects of DLK1 on hDPSCs. The proliferation of hDPSCs was promoted after DLK1 overexpression. DLK1 inhibited the odontoblastic differentiation of hDPSCs, which maybe through ERK signalling pathway. © 2017 John Wiley & Sons Ltd.

  20. CORRELATIONS BETWEEN HOMOLOGUE CONCENTRATIONS OF PCDD/FS AND TOXIC EQUIVALENCY VALUES IN LABORATORY-, PACKAGE BOILER-, AND FIELD-SCALE INCINERATORS

    Science.gov (United States)

    The toxic equivalency (TEQ) values of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/Fs) are predicted with a model based on the homologue concentrations measured from a laboratory-scale reactor (124 data points), a package boiler (61 data points), and ...

  1. Identification and characterization of the ESAT-6 homologue of Mycobacterium leprae and T-cell cross-reactivity with Mycobacterium tuberculosis

    NARCIS (Netherlands)

    Geluk, Annemieke; van Meijgaarden, Krista E.; Franken, Kees L. M. C.; Subronto, Yanri W.; Wieles, Brigitte; Arend, Sandra M.; Sampaio, Elizabeth P.; de Boer, Tjitske; Faber, William R.; Naafs, Ben; Ottenhoff, Tom H. M.

    2002-01-01

    In this paper we describe identification and characterization of Mycobacterium leprae ESAT-6 (L-ESAT-6), the homologue of M. tuberculosis ESAT-6 (T-ESAT-6). T-ESAT-6 is expressed by all pathogenic strains belonging to the M. tuberculosis complex but is absent from virtually all other mycobacterial

  2. A novel role for the Bombyx Slbo homologue, BmC/EBP, in insect choriogenesis.

    Science.gov (United States)

    Sourmeli, S; Papantonis, A; Lecanidou, R

    2005-11-18

    One previously unidentified cDNA clone coding for a C/EBP factor, BmC/EBP, was isolated from Bombyx mori follicular cells. This is the first time that a C/EBP factor has been isolated and characterized in Lepidoptera. We provide information concerning structural features and developmental specificity, as well as in vitro interaction properties with chorion gene promoter modules. BmC/EBP was capable of effectively recognizing homologous binding sites from chorion gene promoters derived from flies and other moths, despite significant diversity of chorion structure, gene organization, and gene expression profiles. We propose that the relative concentration of BmC/EBP, in relation to its differential binding affinity for promoter cis-elements, results in activation or repression of silkmoth chorion gene expression.

  3. Isoflavonoids are present in Arabidopsis thaliana despite the absence of any homologue to known isoflavonoid synthases

    Czech Academy of Sciences Publication Activity Database

    Lapčík, O.; Honys, David; Koblovská, R.; Macková, Z.; Vítková, M.; Klejdus, B.

    2006-01-01

    Roč. 44, 2-3 (2006), s. 106-114 ISSN 0981-9428 R&D Projects: GA ČR GA525/03/0352; GA AV ČR KJB6038409 Institutional research plan: CEZ:AV0Z50380511 Keywords : Arabidopsis thaliana * Brassicaceae * HPLC-MS Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.847, year: 2006

  4. Synthesis and Antiradical Activity of Isoquercitrin Esters with Aromatic Acids and Their Homologues

    Czech Academy of Sciences Publication Activity Database

    Heřmánková-Vavříková, Eva; Křenková, Alena; Petrásková, Lucie; Chambers, Christopher S.; Zápal, Jakub; Kuzma, Marek; Valentová, Kateřina; Křen, Vladimír

    2017-01-01

    Roč. 18, č. 5 (2017), s. 1-14, č. článku 1074. E-ISSN 1422-0067 R&D Projects: GA ČR(CZ) GP14-14373P; GA MŠk(CZ) LD15082 Institutional support: RVO:61388971 Keywords : isoquercitrin * aromatic acid * gallic acid Subject RIV: CE - Biochemistry OBOR OECD: Microbiology Impact factor: 3.226, year: 2016

  5. The Drosophila Homologue of the Amyloid Precursor Protein Is a Conserved Modulator of Wnt PCP Signaling

    Czech Academy of Sciences Publication Activity Database

    Soldano, A.; Okray, Z.; Janovská, P.; Tmejová, K.; Reynaud, E.; Claeys, A.; Yan, J.; Atak, Z.K.; De Strooper, B.; Dura, J.M.; Bryja, Vítězslav; Hassan, B.A.

    2013-01-01

    Roč. 11, č. 5 (2013) E-ISSN 1545-7885 Grant - others:GA ČR(CZ) GA204/09/0498; GA ČR(CZ) GAP301/11/0747 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Institutional support: RVO:68081707 Keywords : PLANAR CELL POLARITY * ALZHEIMERS-DISEASE * AXONAL-TRANSPORT Subject RIV: BO - Biophysics Impact factor: 11.771, year: 2013

  6. Molecular cloning, sequence characterization and expression analysis of a CD63 homologue from the coleopteran beetle, Tenebrio molitor.

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-10-15

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  7. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Directory of Open Access Journals (Sweden)

    Yeon Soo Han

    2013-10-01

    Full Text Available CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63 was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  8. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-01-01

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157

  9. Determination of vitamin K homologues by high-performance liquid chromatography with on-line photoreactor and peroxyoxalate chemiluminescence detection

    International Nuclear Information System (INIS)

    Ahmed, Sameh; Kishikawa, Naoya; Nakashima, Kenichiro; Kuroda, Naotaka

    2007-01-01

    A sensitive and highly selective high-performance liquid chromatography (HPLC) method was developed for the determination of vitamin K homologues including phylloquinone (PK), menaquinone-4 (MK-4) and menaquinone-7 (MK-7) in human plasma using post-column peroxyoxalate chemiluminescence (PO-CL) detection following on-line ultraviolet (UV) irradiation. The method was based on ultraviolet irradiation (254 nm, 15 W) of vitamin K to produce hydrogen peroxide and a fluorescent product at the same time, which can be determined with PO-CL detection. The separation of vitamin K by HPLC was accomplished isocratically on an ODS column within 35 min. The method involves the use of 2-methyl-3-pentadecyl-1,4-naphthoquinone as an internal standard. The detection limits (signal-to-noise ratio = 3) were 32, 38 and 85 fmol for PK, MK-4 and MK-7, respectively. The recoveries of PK, MK-4 and MK-7 were greater than 82% and the inter- and intra-assay R.S.D. values were 1.9-5.4%. The sensitivity and selectivity of this method were sufficient for clinical and nutritional applications

  10. Detection and Characterization of Homologues of Human Hepatitis Viruses and Pegiviruses in Rodents and Bats in Vietnam.

    Science.gov (United States)

    Van Nguyen, Dung; Van Nguyen, Cuong; Bonsall, David; Ngo, Tue Tri; Carrique-Mas, Juan; Pham, Anh Hong; Bryant, Juliet E; Thwaites, Guy; Baker, Stephen; Woolhouse, Mark; Simmonds, Peter

    2018-02-28

    Rodents and bats are now widely recognised as important sources of zoonotic virus infections in other mammals, including humans. Numerous surveys have expanded our knowledge of diverse viruses in a range of rodent and bat species, including their origins, evolution, and range of hosts. In this study of pegivirus and human hepatitis-related viruses, liver and serum samples from Vietnamese rodents and bats were examined by PCR and sequencing. Nucleic acids homologous to human hepatitis B, C, E viruses were detected in liver samples of 2 (1.3%) of 157 bats, 38 (8.1%), and 14 (3%) of 470 rodents, respectively. Hepacivirus-like viruses were frequently detected (42.7%) in the bamboo rat, Rhizomys pruinosus , while pegivirus RNA was only evident in 2 (0.3%) of 638 rodent serum samples. Complete or near-complete genome sequences of HBV, HEV and pegivirus homologues closely resembled those previously reported from rodents and bats. However, complete coding region sequences of the rodent hepacivirus-like viruses substantially diverged from all of the currently classified variants and potentially represent a new species in the Hepacivirus genus. Of the viruses identified, their routes of transmission and potential to establish zoonoses remain to be determined.

  11. Functional analysis of three type-2 DGAT homologue genes for triacylglycerol production in the green microalga Chlamydomonas reinhardtii.

    Science.gov (United States)

    La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H

    2012-11-30

    Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. PP-O and PP-V, Monascus pigment homologues, production, and phylogenetic analysis in Penicillium purpurogenum.

    Science.gov (United States)

    Arai, Teppei; Kojima, Ryo; Motegi, Yoshiki; Kato, Jun; Kasumi, Takafumi; Ogihara, Jun

    2015-12-01

    The production of pigments as secondary metabolites by microbes is known to vary by species and by physiological conditions within a single strain. The fungus strain Penicillium purpurogenum IAM15392 has been found to produce violet pigment (PP-V) and orange pigment (PP-O),Monascus azaphilone pigment homologues, when grown under specific culture conditions. In this study, we analysed PP-V and PP-O production capability in seven strains of P. purpurogenum in addition to strain IAM15392 under specific culture conditions. The pigment production pattern of five strains cultivated in PP-V production medium was similar to that of strain IAM15392, and all violet pigments produced by these five strains were confirmed to be PP-V. Strains that did not produce pigment were also identified. In addition, two strains cultivated in PP-O production medium produced a violet pigment identified as PP-V. The ribosomal DNA (rDNA) internal transcribed spacer (ITS) region sequences from the eight P. purpurogenum strains were sequenced and used to construct a neighbor-joining phylogenetic tree. PP-O and PP-V production of P. purpurogenum was shown to be related to phylogenetic placement based on rDNA ITS sequence. Based on these results, two hypotheses for the alteration of pigment production of P. purpurogenum in evolution were proposed. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  13. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues.

    Science.gov (United States)

    Nicosia, Aldo; Bennici, Carmelo; Biondo, Girolama; Costa, Salvatore; Di Natale, Marilena; Masullo, Tiziana; Monastero, Calogera; Ragusa, Maria Antonietta; Tagliavia, Marcello; Cuttitta, Angela

    2018-01-11

    Gene family encoding translationally controlled tumour protein (TCTP) is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis . The release of the genome sequence of Acropora digitifera , Exaiptasia pallida , Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis . These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP ( AvTCTP ) after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  14. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues

    Directory of Open Access Journals (Sweden)

    Aldo Nicosia

    2018-01-01

    Full Text Available Gene family encoding translationally controlled tumour protein (TCTP is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis. The release of the genome sequence of Acropora digitifera, Exaiptasia pallida, Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis. These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP (AvTCTP after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  15. Immune responses of B. malayi thioredoxin (TRX) and venom allergen homologue (VAH) chimeric multiple antigen for lymphatic filariasis.

    Science.gov (United States)

    Anugraha, Gandhirajan; Jeyaprita, Parasurama Jawaharlal; Madhumathi, Jayaprakasam; Sheeba, Tamilvanan; Kaliraj, Perumal

    2013-12-01

    Although multiple vaccine strategy for lymphatic filariasis has provided tremendous hope, the choice of antigens used in combination has determined its success in the previous studies. Multiple antigens comprising key vaccine candidates from different life cycle stages would provide a promising strategy if the antigenic combination is chosen by careful screening. In order to analyze one such combination, we have used a chimeric construct carrying the well studied B. malayi antigens thioredoxin (BmTRX) and venom allergen homologue (BmVAH) as a fusion protein (TV) and evaluated its immune responses in mice model. The efficacy of fusion protein vaccine was explored in comparison with the single antigen vaccines and their cocktail. In mice, TV induced significantly high antibody titer of 1,28,000 compared to cocktail vaccine TRX+VAH (50,000) and single antigen vaccine TRX (16,000) or VAH (50,000). Furthermore, TV elicited higher level of cellular proliferative response together with elevated levels of IFN-γ, IL-4 and IL-5 indicating a Th1/Th2 balanced response. The isotype antibody profile showed significantly high level of IgG1 and IgG2b confirming the balanced response elicited by TV. Immunization with TV antigen induced high levels of both humoral and cellular immune responses compared to either cocktail or antigen given alone. The result suggests that TV is highly immunogenic in mice and hence the combination needs to be evaluated for its prophylactic potential.

  16. Mouse homologue of yeast Prp19 interacts with mouse SUG1, the regulatory subunit of 26S proteasome

    International Nuclear Information System (INIS)

    Sihn, Choong-Ryoul; Cho, Si Young; Lee, Jeong Ho; Lee, Tae Ryong; Kim, Sang Hoon

    2007-01-01

    Yeast Prp19 has been shown to involve in pre-mRNA splicing and DNA repair as well as being an ubiquitin ligase. Mammalian homologue of yeast Prp19 also plays on similar functional activities in cells. In the present study, we isolated mouse SUG1 (mSUG1) as binding partner of mouse Prp19 (mPrp19) by the yeast two-hybrid system. We confirmed the interaction of mPrp9 with mSUG1 by GST pull-down assay and co-immunoprecipitation assay. The N-terminus of mPrp19 including U-box domain was associated with the C-terminus of mSUG1. Although, mSUG1 is a regulatory subunit of 26S proteasome, mPrp19 was not degraded in the proteasome-dependent pathway. Interestingly, GFP-mPrp19 fusion protein was co-localized with mSUG1 protein in cytoplasm as the formation of the speckle-like structures in the presence of a proteasome inhibitor MG132. In addition, the activity of proteasome was increased in cells transfected with mPrp19. Taken together, these results suggest that mPrp19 involves the regulation of protein turnover and may transport its substrates to 26S proteasome through mSUG1 protein

  17. Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

    International Nuclear Information System (INIS)

    Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir; Mayer, Claudine

    2005-01-01

    The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02 Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry

  18. Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

    Energy Technology Data Exchange (ETDEWEB)

    Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C., E-mail: fabiola.monroy@inin.gob.m [Institut de Physique Nucleaire, F-91406 Orsay, France (France)

    2010-07-01

    Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH{sub 4}F/HClO{sub 4} medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K{sub d} obtained at different F{sup -} and H{sup +} concentrations. The anionic complexes: [Zr(Hf)F{sub 5}]{sup -}, [Zr(Hf)F{sub 6}]{sup 2-}, [Zr(Hf)F{sub 7}]{sup 3-}, [Ta(Pa)F{sub 6}]{sup -}, [Ta(Pa)F{sub 7}]{sup 2-}, [Ta(Pa)F{sub 8}]{sup 3-}, [NbOF{sub 4}]{sup -} and [NbOF{sub 5}]{sup 2-} are present as predominant species in the HF range over investigation. (Author)

  19. Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

    International Nuclear Information System (INIS)

    Monroy G, F.; Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C.

    2010-01-01

    Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH 4 F/HClO 4 medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K d obtained at different F - and H + concentrations. The anionic complexes: [Zr(Hf)F 5 ] - , [Zr(Hf)F 6 ] 2- , [Zr(Hf)F 7 ] 3- , [Ta(Pa)F 6 ] - , [Ta(Pa)F 7 ] 2- , [Ta(Pa)F 8 ] 3- , [NbOF 4 ] - and [NbOF 5 ] 2- are present as predominant species in the HF range over investigation. (Author)

  20. Homologues of CsLOB1 in citrus function as disease susceptibility genes in citrus canker.

    Science.gov (United States)

    Zhang, Junli; Huguet-Tapia, Jose Carlos; Hu, Yang; Jones, Jeffrey; Wang, Nian; Liu, Sanzhen; White, Frank F

    2017-08-01

    The lateral organ boundary domain (LBD) genes encode a group of plant-specific proteins that function as transcription factors in the regulation of plant growth and development. Citrus sinensis lateral organ boundary 1 (CsLOB1) is a member of the LBD family and functions as a disease susceptibility gene in citrus bacterial canker (CBC). Thirty-four LBD members have been identified from the Citrus sinensis genome. We assessed the potential for additional members of LBD genes in citrus to function as surrogates for CsLOB1 in CBC, and compared host gene expression on induction of different LBD genes. Using custom-designed transcription activator-like (TAL) effectors, two members of the same clade as CsLOB1, named CsLOB2 and CsLOB3, were found to be capable of functioning similarly to CsLOB1 in CBC. RNA sequencing and quantitative reverse transcription-polymerase chain reaction analyses revealed a set of cell wall metabolic genes that are associated with CsLOB1, CsLOB2 and CsLOB3 expression and may represent downstream genes involved in CBC. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  1. Study of the behaviour of transuranics and possible chemical homologues in Lake Michigan water and biota

    International Nuclear Information System (INIS)

    Wahlgren, M.A.; Alberts, J.J.; Nelson, D.M.; Orlandini, K.A.

    1976-01-01

    Concentration factors for Pu, Am and U in Lake Michigan biota are compared to those of a number of stable trace elements that have short residence times in Lake Michigan water. The relative order of uptake for these nuclides in Lake Michigan biota is Am>Pu much>U. Evidence is summarized which suggests that the predominant oxidation state of 239 , 240 Pu in Lake Michigan water is 4+. Concentrations of 239 , 240 Pu in net plankton, filterable particulate matter, sediment trap, and benthic floc samples indicate that sorption by biogenic detritus, and settling of this material, can account for the reduced concentration of 239 , 240 Pu observed in surface waters during summer stratification, but that deposition into the sediments is primarily non-biological. Concentrations of 7 Be, 144 Ce and 137 Cs in sediment trap samples show the effect of spring convective mixing and demonstrate the resuspension of mineral-rich surficial sediments during the summer months. The effect on the concentration of dissolved plutonium in the water column, of varying degrees of resuspension of sedimentary floc, is described using a simple mass-action model. A radiochemical method for the determination of americium and uranium in Lake Michigan environmental samples is also presented. (author)

  2. Collectrin, a homologue of ACE2, its transcriptional control and functional perspectives

    International Nuclear Information System (INIS)

    Zhang Yanling; Wada, Jun

    2007-01-01

    Collectrin is a type I membrane protein and shares significant homology with C-terminal domain of angiotensin-converting enzyme-2 (ACE2). However, collectrin lacks catalytic domain and it suggests the presence of uncharacterized physiological functions of collectrin. Collectrin is transcriptionally regulated by hepatocyte nuclear factor-α and -β and is highly expressed on renal proximal tubules and collecting ducts as well as pancreatic β-cells. Recent in vitro and in vivo studies demonstrated interesting physiological roles of collectrin related to insulin secretion, formation of primary cilia, renal cyst formation and amino acid transport. The common underlying molecular mechanism may be suggested by the evidence that collectrin binds to SNARE complex by interacting with snapin. Collectrin is involved in the process of vesicle transport and membrane fusion and thus it delivers insulin for exocytosis or various membrane proteins to apical plasmalemma and primary cilia. Collectrin may be the new therapeutic target for various pathological processes such as diabetes, polycystic kidney disease, hypertension and aminoaciduria

  3. Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

    Directory of Open Access Journals (Sweden)

    Jianrao HU, Mingfu CAO, Jiong Chen

    2009-10-01

    Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

  4. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Science.gov (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  5. Genetic analysis of the spindle checkpoint genes san-1, mdf-2, bub-3 and the CENP-F homologues hcp-1 and hcp-2 in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Moore Landon L

    2008-02-01

    Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.

  6. Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51.

    Science.gov (United States)

    van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C

    1997-05-01

    We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

  7. The Neurospora crassa UVS-3 epistasis group encodes homologues of the ATR/ATRIP checkpoint control system.

    Science.gov (United States)

    Kazama, Yusuke; Ishii, Chizu; Schroeder, Alice L; Shimada, Hisao; Wakabayashi, Michiyoshi; Inoue, Hirokazu

    2008-02-01

    The mutagen sensitive uvs-3 and mus-9 mutants of Neurospora show mutagen and hydroxyurea sensitivity, mutator effects and duplication instability typical of recombination repair and DNA damage checkpoint defective mutants. To determine the nature of these genes we used cosmids from a genomic library to clone the uvs-3 gene by complementation for MMS sensitivity. Mutation induction by transposon insertion and RIP defined the coding sequence. RFLP analysis confirmed that this sequence maps in the area of uvs-3 at the left telomere of LG IV. Analysis of the cDNA showed that the UVS-3 protein contains an ORF of 969 amino acids with one intron. It is homologous to UvsD of Aspergillus nidulans, a member of the ATRIP family of checkpoint proteins. It retains the N' terminal coiled-coil motif followed by four basic amino acids typical of these proteins and shows the highest homology in this region. The uvsD cDNA partially complements the defects of the uvs-3 mutation. The uvs-3 mutant shows a higher level of micronuclei in conidia and failure to halt germination and nuclear division in the presence of hydroxyurea than wild type, suggesting checkpoint defects. ATRIP proteins bind tightly to ATR PI-3 kinase (phosphatidylinositol 3-kinase) proteins. Therefore, we searched the Neurospora genome sequence for homologues of the Aspergillus nidulans ATR, UvsB. A uvsB homologous sequence was present in the right arm of chromosome I where the mus-9 gene maps. A cosmid containing this genomic DNA complemented the mus-9 mutation. The putative MUS-9 protein is 2484 amino acids long with eight introns. Homology is especially high in the C-terminal 350 amino acids that correspond to the PI-3 kinase domain. In wild type a low level of constitutive mRNA is present for both genes. It is transiently induced upon UV exposure.

  8. The SPF27 homologue Num1 connects splicing and kinesin 1-dependent cytoplasmic trafficking in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Nikola Kellner

    2014-01-01

    Full Text Available The conserved NineTeen protein complex (NTC is an integral subunit of the spliceosome and required for intron removal during pre-mRNA splicing. The complex associates with the spliceosome and participates in the regulation of conformational changes of core spliceosomal components, stabilizing RNA-RNA- as well as RNA-protein interactions. In addition, the NTC is involved in cell cycle checkpoint control, response to DNA damage, as well as formation and export of mRNP-particles. We have identified the Num1 protein as the homologue of SPF27, one of NTC core components, in the basidiomycetous fungus Ustilago maydis. Num1 is required for polarized growth of the fungal hyphae, and, in line with the described NTC functions, the num1 mutation affects the cell cycle and cell division. The num1 deletion influences splicing in U. maydis on a global scale, as RNA-Seq analysis revealed increased intron retention rates. Surprisingly, we identified in a screen for Num1 interacting proteins not only NTC core components as Prp19 and Cef1, but several proteins with putative functions during vesicle-mediated transport processes. Among others, Num1 interacts with the motor protein Kin1 in the cytoplasm. Similar phenotypes with respect to filamentous and polar growth, vacuolar morphology, as well as the motility of early endosomes corroborate the genetic interaction between Num1 and Kin1. Our data implicate a previously unidentified connection between a component of the splicing machinery and cytoplasmic transport processes. As the num1 deletion also affects cytoplasmic mRNA transport, the protein may constitute a novel functional interconnection between the two disparate processes of splicing and trafficking.

  9. Enhancer of zeste homologue 2 plays an important role in neuroblastoma cell survival independent of its histone methyltransferase activity.

    Science.gov (United States)

    Bate-Eya, Laurel T; Gierman, Hinco J; Ebus, Marli E; Koster, Jan; Caron, Huib N; Versteeg, Rogier; Dolman, M Emmy M; Molenaar, Jan J

    2017-04-01

    Neuroblastoma is predominantly characterised by chromosomal rearrangements. Next to V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma Derived Homolog (MYCN) amplification, chromosome 7 and 17q gains are frequently observed. We identified a neuroblastoma patient with a regional 7q36 gain, encompassing the enhancer of zeste homologue 2 (EZH2) gene. EZH2 is the histone methyltransferase of lysine 27 of histone H3 (H3K27me3) that forms the catalytic subunit of the polycomb repressive complex 2. H3K27me3 is commonly associated with the silencing of genes involved in cellular processes such as cell cycle regulation, cellular differentiation and cancer. High EZH2 expression correlated with poor prognosis and overall survival independent of MYCN amplification status. Unexpectedly, treatment of 3 EZH2-high expressing neuroblastoma cell lines (IMR32, CHP134 and NMB), with EZH2-specific inhibitors (GSK126 and EPZ6438) resulted in only a slight G1 arrest, despite maximum histone methyltransferase activity inhibition. Furthermore, colony formation in cell lines treated with the inhibitors was reduced only at concentrations much higher than necessary for complete inhibition of EZH2 histone methyltransferase activity. Knockdown of the complete protein with three independent shRNAs resulted in a strong apoptotic response and decreased cyclin D1 levels. This apoptotic response could be rescued by overexpressing EZH2ΔSET, a truncated form of wild-type EZH2 lacking the SET transactivation domain necessary for histone methyltransferase activity. Our findings suggest that high EZH2 expression, at least in neuroblastoma, has a survival function independent of its methyltransferase activity. This important finding highlights the need for studies on EZH2 beyond its methyltransferase function and the requirement for compounds that will target EZH2 as a complete protein. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

    Science.gov (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

    2008-01-01

    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  11. A spinach O-acetylserine(thiollyase homologue, SoCSaseLP, suppresses cysteine biosynthesis catalysed by other enzyme isoforms

    Directory of Open Access Journals (Sweden)

    Miki Noda

    2016-06-01

    Full Text Available An enzyme, O-acetylserine(thiollyase (OASTL, also known as O-acetylserine sulfhydrylase or cysteine synthase (CSase, catalyses the incorporation of sulfide into O-acetylserine and produces cysteine. We previously identified a cDNA encoding an OASTL-like protein from Spinacia oleracea, (SoCSaseLP, but a recombinant SoCSaseLP produced in Escherichia coli did not show OASTL activity. The exon-intron structure of the SoCSaseLP gene shared conserved structures with other spinach OASTL genes. The SoCSaseLP and a Beta vulgaris homologue protein, KMT13462, comprise a unique clade in the phylogenetic tree of the OASTL family. Interestingly, when the SoCSaseLP gene was expressed in tobacco plants, total OASTL activity in tobacco leaves was reduced. This reduction in total OASTL activity was most likely caused by interference by SoCSaseLP with cytosolic OASTL. To investigate the possible interaction of SoCSaseLP with a spinach cytosolic OASTL isoform SoCSaseA, a pull-down assay was carried out. The recombinant glutathione S-transferase (GST-SoCSaseLP fusion protein was expressed in E. coli together with the histidine-tagged SoCSaseA protein, and the protein extract was subjected to glutathione affinity chromatography. The histidine-tagged SoCSaseA was co-purified with the GST-SoCSaseLP fusion protein, indicating the binding of SoCSaseLP to SoCSaseA. Consistent with this interaction, the OASTL activity of the co-purified SoCSaseA was reduced compared with the activity of SoCSaseA that was purified on its own. These results strongly suggest that SoCSaseLP negatively regulates the activity of other cytosolic OASTL family members by direct interaction.

  12. Neuronal SIRT1 (Silent Information Regulator 2 Homologue 1) Regulates Glycolysis and Mediates Resveratrol-Induced Ischemic Tolerance.

    Science.gov (United States)

    Koronowski, Kevin B; Khoury, Nathalie; Saul, Isabel; Loris, Zachary B; Cohan, Charles H; Stradecki-Cohan, Holly M; Dave, Kunjan R; Young, Juan I; Perez-Pinzon, Miguel A

    2017-11-01

    Resveratrol, at least in part via SIRT1 (silent information regulator 2 homologue 1) activation, protects against cerebral ischemia when administered 2 days before injury. However, it remains unclear if SIRT1 activation must occur, and in which brain cell types, for the induction of neuroprotection. We hypothesized that neuronal SIRT1 is essential for resveratrol-induced ischemic tolerance and sought to characterize the metabolic pathways regulated by neuronal Sirt1 at the cellular level in the brain. We assessed infarct size and functional outcome after transient 60 minute middle cerebral artery occlusion in control and inducible, neuronal-specific SIRT1 knockout mice. Nontargeted primary metabolomics analysis identified putative SIRT1-regulated pathways in brain. Glycolytic function was evaluated in acute brain slices from adult mice and primary neuronal-enriched cultures under ischemic penumbra-like conditions. Resveratrol-induced neuroprotection from stroke was lost in neuronal Sirt1 knockout mice. Metabolomics analysis revealed alterations in glucose metabolism on deletion of neuronal Sirt1 , accompanied by transcriptional changes in glucose metabolism machinery. Furthermore, glycolytic ATP production was impaired in acute brain slices from neuronal Sirt1 knockout mice. Conversely, resveratrol increased glycolytic rate in a SIRT1-dependent manner and under ischemic penumbra-like conditions in vitro. Our data demonstrate that resveratrol requires neuronal SIRT1 to elicit ischemic tolerance and identify a novel role for SIRT1 in the regulation of glycolytic function in brain. Identification of robust neuroprotective mechanisms that underlie ischemia tolerance and the metabolic adaptations mediated by SIRT1 in brain are crucial for the translation of therapies in cerebral ischemia and other neurological disorders. © 2017 American Heart Association, Inc.

  13. Genetic link between Cabeza, a Drosophila homologue of Fused in Sarcoma (FUS), and the EGFR signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Shimamura, Mai; Kyotani, Akane [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Azuma, Yumiko [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Yoshida, Hideki; Binh Nguyen, Thanh [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Mizuta, Ikuko; Yoshida, Tomokatsu; Mizuno, Toshiki [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Nakagawa, Masanori [North Medical Center, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Tokuda, Takahiko, E-mail: ttokuda@koto.kpu-m.ac.jp [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Department of Molecular Pathobiology of Brain Diseases, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Yamaguchi, Masamitsu, E-mail: myamaguc@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan)

    2014-08-01

    Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease that causes progressive muscular weakness. Fused in Sarcoma (FUS) that has been identified in familial ALS is an RNA binding protein that is normally localized in the nucleus. However, its function in vivo is not fully understood. Drosophila has Cabeza (Caz) as a FUS homologue and specific knockdown of Caz in the eye imaginal disc and pupal retina using a GMR-GAL4 driver was here found to induce an abnormal morphology of the adult compound eyes, a rough eye phenotype. This was partially suppressed by expression of the apoptosis inhibitor P35. Knockdown of Caz exerted no apparent effect on differentiation of photoreceptor cells. However, immunostaining with an antibody to Cut that marks cone cells revealed fusion of these and ommatidia of pupal retinae. These results indicate that Caz knockdown induces apoptosis and also inhibits differentiation of cone cells, resulting in abnormal eye morphology in adults. Mutation in EGFR pathway-related genes, such as rhomboid-1, rhomboid-3 and mirror suppressed the rough eye phenotype induced by Caz knockdown. Moreover, the rhomboid-1 mutation rescued the fusion of cone cells and ommatidia observed in Caz knockdown flies. The results suggest that Caz negatively regulates the EGFR signaling pathway required for determination of cone cell fate in Drosophila. - Highlights: • Knockdown of Cabeza induced rough eye phenotype. • Knockdown of Cabeza induced fusion of cone cells in pupal retinae. • Knockdown of Cabeza induced apoptosis in pupal retinae. • Mutation in EGFR pathway-related genes suppressed the rough eye phenotype. • Cabeza may negatively regulate the EGFR pathway.

  14. Characterization of cogon grass (Imperata cylindrica) pollen extract and preliminary analysis of grass group 1, 4 and 5 homologues using monoclonal antibodies to Phleum pratense.

    Science.gov (United States)

    Kumar, L; Sridhara, S; Singh, B P; Gangal, S V

    1998-11-01

    Previous studies have established the role of Imperata cylindrica (Ic) pollen in type I allergic disorders. However, no systematic information is available on the allergen composition of Ic pollen extract. To characterize the IgE-binding proteins of Ic pollen extract and to detect the presence of grass group 1, 4 and 5 allergen homologues, if any. Pollen extract of Ic was analyzed by in vivo and in vitro procedures such as intradermal tests (ID), enzyme-linked immunosorbent assay (ELISA), ELISA-inhibition, thin-layer isoelectric focusing (TLIEF), sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. Dot blot assay was carried out to check the presence of well-known group 1, 4, and 5 allergen homologues in Ic pollen extract. Out of 303 respiratory allergies patients skin-tested, 27 showed sensitivity to Ic pollen extract. Specific IgE levels were elevated in all 15 serum samples tested. The extract prepared for this study was found to be highly potent since it required only 400 ng of homologous proteins for 50% inhibition of binding in ELISA inhibition assays. TLIEF of Ic pollen extract showed 44 silver-stained bands (pI 3.5-7.0) while SDS-PAGE resolved it into 24 Coomassie-Brilliant-Blue-stained bands (MW 100-10 kD). Immunoblotting with individual patient sera recognized 7 major IgE-binding bands (MW 85, 62, 57, 43, 40, 28 and 16 kD) in Ic pollen extract. A panel of monoclonal antibodies, specific to group 1, 4 and 5 allergens from Phleum pratense pollen extract identified group 5 and group 4 homologues in Ic pollen extract. Ic pollen extract was characterized for the protein profile by TLIEF and SDS-PAGE. IgE reactivity was determined by ELISA and immunoblot. Monoclonal antibodies to group 5 and group 4 allergens reacted weakly showing that this pollen contains group 5 and group 4 homologous allergens.

  15. HOT1 is a mammalian direct telomere repeat-binding protein contributing to telomerase recruitment

    NARCIS (Netherlands)

    Kappei, D.; Butter, F.; Benda, C.; Scheibe, M.; Draskovic, Irena; Stevense, M.; Novo, C.L.; Basquin, C.; Araki, M.; Araki, K.; Krastev, D.B.; Kittler, R.; Jessberger, R.; Londono-Vallejo, J.A.; Mann, M.; Buchholz, F.

    2013-01-01

    Telomeres are repetitive DNA structures that, together with the shelterin and the CST complex, protect the ends of chromosomes. Telomere shortening is mitigated in stem and cancer cells through the de novo addition of telomeric repeats by telomerase. Telomere elongation requires the delivery of the

  16. Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study.

    Science.gov (United States)

    García-Álvarez, Laura; Holden, Matthew T G; Lindsay, Heather; Webb, Cerian R; Brown, Derek F J; Curran, Martin D; Walpole, Enid; Brooks, Karen; Pickard, Derek J; Teale, Christopher; Parkhill, Julian; Bentley, Stephen D; Edwards, Giles F; Girvan, E Kirsty; Kearns, Angela M; Pichon, Bruno; Hill, Robert L R; Larsen, Anders Rhod; Skov, Robert L; Peacock, Sharon J; Maskell, Duncan J; Holmes, Mark A

    2011-08-01

    Animals can act as a reservoir and source for the emergence of novel meticillin-resistant Staphylococcus aureus (MRSA) clones in human beings. Here, we report the discovery of a strain of S aureus (LGA251) isolated from bulk milk that was phenotypically resistant to meticillin but tested negative for the mecA gene and a preliminary investigation of the extent to which such strains are present in bovine and human populations. Isolates of bovine MRSA were obtained from the Veterinary Laboratories Agency in the UK, and isolates of human MRSA were obtained from diagnostic or reference laboratories (two in the UK and one in Denmark). From these collections, we searched for mecA PCR-negative bovine and human S aureus isolates showing phenotypic meticillin resistance. We used whole-genome sequencing to establish the genetic basis for the observed antibiotic resistance. A divergent mecA homologue (mecA(LGA251)) was discovered in the LGA251 genome located in a novel staphylococcal cassette chromosome mec element, designated type-XI SCCmec. The mecA(LGA251) was 70% identical to S aureus mecA homologues and was initially detected in 15 S aureus isolates from dairy cattle in England. These isolates were from three different multilocus sequence type lineages (CC130, CC705, and ST425); spa type t843 (associated with CC130) was identified in 60% of bovine isolates. When human mecA-negative MRSA isolates were tested, the mecA(LGA251) homologue was identified in 12 of 16 isolates from Scotland, 15 of 26 from England, and 24 of 32 from Denmark. As in cows, t843 was the most common spa type detected in human beings. Although routine culture and antimicrobial susceptibility testing will identify S aureus isolates with this novel mecA homologue as meticillin resistant, present confirmatory methods will not identify them as MRSA. New diagnostic guidelines for the detection of MRSA should consider the inclusion of tests for mecA(LGA251). Department for Environment, Food and Rural Affairs

  17. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    OpenAIRE

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  18. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.

    OpenAIRE

    Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.

    1996-01-01

    In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...

  19. Expression of cinnamyl alcohol dehydrogenases and their putative homologues during Arabidopsis thaliana growth and development: lessons for database annotations?

    Science.gov (United States)

    Kim, Sung-Jin; Kim, Kye-Won; Cho, Man-Ho; Franceschi, Vincent R; Davin, Laurence B; Lewis, Norman G

    2007-07-01

    A major goal currently in Arabidopsis research is determination of the (biochemical) function of each of its approximately 27,000 genes. To date, however, 12% of its genes actually have known biochemical roles. In this study, we considered it instructive to identify the gene expression patterns of nine (so-called AtCAD1-9) of 17 genes originally annotated by The Arabidopsis Information Resource (TAIR) as cinnamyl alcohol dehydrogenase (CAD, EC 1.1.1.195) homologues [see Costa, M.A., Collins, R.E., Anterola, A.M., Cochrane, F.C., Davin, L.B., Lewis N.G., 2003. An in silico assessment of gene function and organization of the phenylpropanoid pathway metabolic networks in Arabidopsis thaliana and limitations thereof. Phytochemistry 64, 1097-1112.]. In agreement with our biochemical studies in vitro [Kim, S.-J., Kim, M.-R., Bedgar, D.L., Moinuddin, S.G.A., Cardenas, C.L., Davin, L.B., Kang, C.-H., Lewis, N.G., 2004. Functional reclassification of the putative cinnamyl alcohol dehydrogenase multigene family in Arabidopsis. Proc. Natl. Acad. Sci. USA 101, 1455-1460.], and analysis of a double mutant [Sibout, R., Eudes, A., Mouille, G., Pollet, B., Lapierre, C., Jouanin, L., Séguin A., 2005. Cinnamyl Alcohol Dehydrogenase-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis. Plant Cell 17, 2059-2076.], both AtCAD5 (At4g34230) and AtCAD4 (At3g19450) were found to have expression patterns consistent with development/formation of different forms of the lignified vascular apparatus, e.g. lignifying stem tissues, bases of trichomes, hydathodes, abscission zones of siliques, etc. Expression was also observed in various non-lignifying zones (e.g. root caps) indicative of, perhaps, a role in plant defense. In addition, expression patterns of the four CAD-like homologues were investigated, i.e. AtCAD2 (At2g21730), AtCAD3 (At2g21890), AtCAD7 (At4g37980) and AtCAD8 (At4g37990), each of which previously had been demonstrated to have low CAD

  20. Transforming growth factor alpha, Shope fibroma growth factor, and vaccinia growth factor can replace myxoma growth factor in the induction of myxomatosis in rabbits.

    Science.gov (United States)

    Opgenorth, A; Nation, N; Graham, K; McFadden, G

    1993-02-01

    The epidermal growth factor (EGF) homologues encoded by vaccinia virus, myxoma virus, and malignant rabbit fibroma virus have been shown to contribute to the pathogenicity of virus infection upon inoculation of susceptible hosts. However, since the primary structures of these growth factors and the disease profiles induced by different poxvirus genera vary substantially, the degree to which the various EGF homologues perform similar roles in viral pathogenesis remains unclear. In order to determine whether different EGF-like growth factors can perform qualitatively similar functions in the induction of myxomatosis in rabbits, we created recombinant myxoma virus variants in which the native growth factor, myxoma growth factor (MGF), was disrupted and replaced with either vaccinia virus growth factor, Shope fibroma growth factor, or rat transforming growth factor alpha. Unlike the control virus containing an inactivated MGF gene, which caused marked attenuation of the disease syndrome and substantially less proliferation of the epithelial cell layers in the conjunctiva and respiratory tract, the recombinant myxoma virus strains expressing heterologous growth factors produced infections which were both clinically and histopathologically indistinguishable from wild-type myxomatosis. We conclude that these poxviral and cellular EGF-like growth factors, which are diverse with respect to primary structure and origin, have similar biological functions in the context of myxoma virus pathogenesis and are mitogenic for the same target cells.

  1. Genetic and physical mapping of homologues of the virus resistance gene Rx1 and the cyst nematode resistance gene Gpa2 in potato.

    Science.gov (United States)

    Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A

    2003-05-01

    Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.

  2. Phospholipase C δ-type consists of three isozymes: bovine PLCδ2 is a homologue of human/mouse PLCδ4

    International Nuclear Information System (INIS)

    Irino, Yasuhiro; Cho, Hiroyuki; Nakamura, Yoshikazu; Nakahara, Masamichi; Furutani, Masahiro; Suh, Pann-Ghill; Takenawa, Tadaomi; Fukami, Kiyoko

    2004-01-01

    To date, 12 phospholipase C (PLC) isozymes have been identified in mammals, and they are divided into five classes, β-, γ-, δ-, ε-, and ζ-type. PLCδ-type is reported to be composed of four isozymes, PLCδ1-δ4. Here we report that a screening for mouse PLCδ2 from a BAC library with primers that amplify a specific region of bovine PLCδ2 resulted in isolation of one clone containing the mouse PLCδ4 gene. Furthermore, a database search revealed that there is only one gene corresponding to PLCδ2 and PLCδ4 in the mouse and human genomes, indicating that bovine PLCδ2 is a homologue of human and mouse PLCδ4. However, PLCδ2 Western blot analysis with a widely used commercial anti-PLCδ2 antibody showed an expression pattern distinct from that of PLCδ4 in wild-type mice. In addition, an 80-kDa band, which was recognized by antibody against PLCδ2, was smaller than an 85-kDa band detected by anti-PLCδ4 antibody, and the 80-kDa band was detectable in lysates of brain, testis, and spleen from PLCδ4-deficient mice. We also found that immunoprecipitates from brain lysates with this PLCδ2 antibody contained no PLC activity. From these data, we conclude that bovine PLCδ2 is a homologue of human and mouse PLCδ4, and that three isozymes (δ1, δ3, and δ4) exist in the PLCδ family

  3. Profiling antibody responses to infections by Chlamydia abortus enables identification of potential virulence factors and candidates for serodiagnosis.

    Science.gov (United States)

    Forsbach-Birk, Vera; Foddis, Corinna; Simnacher, Ulrike; Wilkat, Max; Longbottom, David; Walder, Gernot; Benesch, Christiane; Ganter, Martin; Sachse, Konrad; Essig, Andreas

    2013-01-01

    Enzootic abortion of ewes (EAE) due to infection with the obligate intracellular pathogen Chlamydia (C.) abortus is an important zoonosis leading to considerable economic loss to agriculture worldwide. The pathogen can be transmitted to humans and may lead to serious infection in pregnant women. Knowledge about epidemiology, clinical course and transmission to humans is hampered by the lack of reliable diagnostic tools. Immunoreactive proteins, which are expressed in infected animals and humans, may serve as novel candidates for diagnostic marker proteins and represent putative virulence factors. In order to broaden the spectrum of immunogenic C. abortus proteins we applied 2D immunoblot analysis and screening of an expression library using human and animal sera. We have identified 48 immunoreactive proteins representing potential diagnostic markers and also putative virulence factors, such as CAB080 (homologue of the "macrophage infectivity potentiator", MIP), CAB167 (homologue of the "translocated actin recruitment protein", TARP), CAB712 (homologue of the "chlamydial protease-like activity factor", CPAF), CAB776 (homologue of the "Polymorphic membrane protein D", PmpD), and the "hypothetical proteins" CAB063, CAB408 and CAB821, which are predicted to be type III secreted. We selected two putative virulence factors for further characterization, i.e. CAB080 (cMIP) and CAB063, and studied their expression profiles at transcript and protein levels. Analysis of the subcellular localization of both proteins throughout the developmental cycle revealed CAB063 being the first C. abortus protein shown to be translocated to the host cell nucleus.

  4. Profiling antibody responses to infections by Chlamydia abortus enables identification of potential virulence factors and candidates for serodiagnosis.

    Directory of Open Access Journals (Sweden)

    Vera Forsbach-Birk

    Full Text Available Enzootic abortion of ewes (EAE due to infection with the obligate intracellular pathogen Chlamydia (C. abortus is an important zoonosis leading to considerable economic loss to agriculture worldwide. The pathogen can be transmitted to humans and may lead to serious infection in pregnant women. Knowledge about epidemiology, clinical course and transmission to humans is hampered by the lack of reliable diagnostic tools. Immunoreactive proteins, which are expressed in infected animals and humans, may serve as novel candidates for diagnostic marker proteins and represent putative virulence factors. In order to broaden the spectrum of immunogenic C. abortus proteins we applied 2D immunoblot analysis and screening of an expression library using human and animal sera. We have identified 48 immunoreactive proteins representing potential diagnostic markers and also putative virulence factors, such as CAB080 (homologue of the "macrophage infectivity potentiator", MIP, CAB167 (homologue of the "translocated actin recruitment protein", TARP, CAB712 (homologue of the "chlamydial protease-like activity factor", CPAF, CAB776 (homologue of the "Polymorphic membrane protein D", PmpD, and the "hypothetical proteins" CAB063, CAB408 and CAB821, which are predicted to be type III secreted. We selected two putative virulence factors for further characterization, i.e. CAB080 (cMIP and CAB063, and studied their expression profiles at transcript and protein levels. Analysis of the subcellular localization of both proteins throughout the developmental cycle revealed CAB063 being the first C. abortus protein shown to be translocated to the host cell nucleus.

  5. A density functional theory study of magneto-electric Jones birefringence of noble gases, furan homologues, and mono-substituted benzenes

    International Nuclear Information System (INIS)

    Fahleson, Tobias; Norman, Patrick; Coriani, Sonia; Rizzo, Antonio; Rikken, Geert L. J. A.

    2013-01-01

    We report on the results of a systematic ab initio study of the Jones birefringence of noble gases, of furan homologues, and of monosubstituted benzenes, in the gas phase, with the aim of analyzing the behavior and the trends within a list of systems of varying size and complexity, and of identifying candidates for a combined experimental/theoretical study of the effect. We resort here to analytic linear and nonlinear response functions in the framework of time-dependent density functional theory. A correlation is made between the observable (the Jones constant) and the atomic radius for noble gases, or the permanent electric dipole and a structure/chemical reactivity descriptor as the para Hammett constant for substituted benzenes

  6. The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

    Energy Technology Data Exchange (ETDEWEB)

    Tsukamoto, Yuta; Katayama, Chisako [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Shinohara, Miki; Shinohara, Akira [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Maekawa, Shohei [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Miyamoto, Masaaki, E-mail: miya@kobe-u.ac.jp [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan)

    2013-11-29

    Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions.

  7. The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

    International Nuclear Information System (INIS)

    Tsukamoto, Yuta; Katayama, Chisako; Shinohara, Miki; Shinohara, Akira; Maekawa, Shohei; Miyamoto, Masaaki

    2013-01-01

    Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions

  8. The Orf virus E3L homologue is able to complement deletion of the vaccinia virus E3L gene in vitro but not in vivo

    International Nuclear Information System (INIS)

    Vijaysri, Sangeetha; Talasela, Latha; Mercer, Andrew A.; Mcinnes, Colin J.; Jacobs, Bertram L.; Langland, Jeffrey O.

    2003-01-01

    Orf virus (OV), the prototypic parapoxvirus, is resistant to the effects of interferon (IFN) and this function of OV has been mapped to the OV20.0L gene. The protein product of this gene shares 31% amino acid identity to the E3L-encoded protein of vaccinia virus (VV) that is required for the broad host range and IFN-resistant phenotype of VV in cells in culture and for virulence of the virus in vivo. In this study we investigated whether the distantly related OV E3L homologue could complement the deletion of E3L in VV. The recombinant VV (VV/ORF-E3L) expressing the OV E3L homologue in place of VV E3L was indistinguishable from wt VV in its cell-culture phenotype. But VV/ORF-E3L was over a 1000-fold less pathogenic than wt VV (LD 50 > 5 x 10 6 PFU, compared to LD 50 of wtVV = 4 x 10 3 PFU) following intranasal infection of mice. While wt VV spread to the lungs and brain and replicated to high titers in the brain of infected mice, VV/ORF-E3L could not be detected in the lungs or brain following intranasal infection. VV/ORF-E3L was at least 100,000-fold less pathogenic than wt VV on intracranial injection. Domain swap experiments demonstrate that the difference in pathogenesis maps to the C-terminal domain of these proteins. This domain has been shown to be required for the dsRNA binding function of the VV E3L

  9. The Ca{sup 2+} channel TRPML3 specifically interacts with the mammalian ATG8 homologue GATE16 to regulate autophagy

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Suzy; Kim, Hyun Jin, E-mail: kimhyunjin@skku.edu

    2014-01-03

    Highlights: •Split-ubiquitin MY2H screen identified GATE16 as an interacting protein of TRPML3. •TRPML3 specifically binds to a mammalian ATG8 homologue GATE16, not to LC3B. •The interaction of TRPML3 with GATE16 facilitates autophagosome formation. •GATE16 is expressed in both autophagosome and extra-autophagosomal compartments. -- Abstract: TRPML3 is a Ca{sup 2+} permeable cation channel expressed in multiple intracellular compartments. Although TRPML3 is implicated in autophagy, how TRPML3 can regulate autophagy is not understood. To search interacting proteins with TRPML3 in autophagy, we performed split-ubiquitin membrane yeast two-hybrid (MY2H) screening with TRPML3-loop as a bait and identified GATE16, a mammalian ATG8 homologue. GST pull-down assay revealed that TRPML3 and TRPML3-loop specifically bind to GATE16, not to LC3B. Co-immunoprecipitation (co-IP) experiments showed that TRPML3 and TRPML3-loop pull down only the lipidated form of GATE16, indicating that the interaction occurs exclusively at the organellar membrane. The interaction of TRPML3 with GATE16 and GATE16-positive vesicle formation were increased in starvation induced autophagy, suggesting that the interaction facilitates the function of GATE16 in autophagosome formation. However, GATE16 was not required for TRPML3 trafficking to autophagosomes. Experiments using dominant-negative (DN) TRPML3(D458K) showed that GATE16 is localized not only in autophagosomes but also in extra-autophagosomal compartments, by contrast with LC3B. Since GATE16 acts at a later stage of the autophagosome biogenesis, our results suggest that TRPML3 plays a role in autophagosome maturation through the interaction with GATE16, by providing Ca{sup 2+} in the fusion process.

  10. In vivo metabolism of the methyl homologues of delta-8-tetrahydrocannabinol, delta-9-tetrahydrocannabinol and abn-delta-8-tetrahydrocannabinol in the mouse.

    Science.gov (United States)

    Brown, N K; Harvey, D J

    1988-04-01

    Methyl-delta-8-tetrahydrocannabinol (methyl-delta-8-THC), methyl-delta-9-THC and abn-methyl-delta-8-THC were synthesized by condensation of orcinol and (1S)-cis-verbenol and were administered to male Charles River CD-1 mice. Extracted hepatic metabolites were isolated by chromatography on Sephadex LH-20 and examined by gas chromatography/mass spectrometry as trimethylsilyl (TMS), (2H9)TMS and methyl ester/TMS derivatives. In addition, metabolic fractions were reduced with lithium aluminium deuteride to convert carboxylic acids to alcohols for structural correlation. Metabolites from methyl-delta-8-THC were similar with respect to the positions substituted to those produced by higher homologues; the major metabolite was methyl-delta-8-THC-11-oic acid. abn-Methyl-delta-8-THC was metabolized in a different manner. The location of the aromatic methyl group at the position adjacent to ring fusion appeared to inhibit metabolism at C(11) to a considerable extent and also to reduce the amount of the resulting alcohol from being oxidized to a carboxylic acid. This caused other metabolic pathways to become dominant, with the result that a compound containing a hydroxy group at the gem-methyl position was the major metabolite. Hydroxylation at this position has not been confirmed with any other cannabinoid, although it is thought to result in trace concentrations of hydroxy metabolites from some compounds. Metabolism of methyl-delta-9-THC was also similar to that of the higher homologues, with the exception that less metabolism occurred at C(8) and a higher percentage of the total metabolic fraction was accounted for by the 11-oic acid metabolite. Minor metabolites were mainly dihydroxy compounds and hydroxylated derivatives of delta-9-THC-11-oic acid.

  11. Drosophila homologues of adenomatous polyposis coli (APC) and the formin diaphanous collaborate by a conserved mechanism to stimulate actin filament assembly.

    Science.gov (United States)

    Jaiswal, Richa; Stepanik, Vince; Rankova, Aneliya; Molinar, Olivia; Goode, Bruce L; McCartney, Brooke M

    2013-05-10

    Vertebrate APC collaborates with Dia through its Basic domain to assemble actin filaments. Despite limited sequence homology between the vertebrate and Drosophila APC Basic domains, Drosophila APC1 collaborates with Dia to stimulate actin assembly in vitro. The mechanism of actin assembly is highly conserved over evolution. APC-Dia collaborations may be crucial in a wide range of animal cells. Adenomatous polyposis coli (APC) is a large multidomain protein that regulates the cytoskeleton. Recently, it was shown that vertebrate APC through its Basic domain directly collaborates with the formin mDia1 to stimulate actin filament assembly in the presence of nucleation barriers. However, it has been unclear whether these activities extend to homologues of APC and Dia in other organisms. Drosophila APC and Dia are each required to promote actin furrow formation in the syncytial embryo, suggesting a potential collaboration in actin assembly, but low sequence homology between the Basic domains of Drosophila and vertebrate APC has left their functional and mechanistic parallels uncertain. To address this question, we purified Drosophila APC1 and Dia and determined their individual and combined effects on actin assembly using both bulk fluorescence assays and total internal reflection fluorescence microscopy. Our data show that APC1, similar to its vertebrate homologue, bound to actin monomers and nucleated and bundled filaments. Further, Drosophila Dia nucleated actin assembly and protected growing filament barbed ends from capping protein. Drosophila APC1 and Dia directly interacted and collaborated to promote actin assembly in the combined presence of profilin and capping protein. Thus, despite limited sequence homology, Drosophila and vertebrate APCs exhibit highly related activities and mechanisms and directly collaborate with formins. These results suggest that APC-Dia interactions in actin assembly are conserved and may underlie important in vivo functions in a broad

  12. A gonococcal homologue of meningococcal γ-glutamyl transpeptidase gene is a new type of bacterial pseudogene that is transcriptionally active but phenotypically silent

    Directory of Open Access Journals (Sweden)

    Watanabe Haruo

    2005-10-01

    Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.

  13. Initial characterization of a bolA homologue from Pseudomonas fluorescens indicates different roles for BolA-like proteins in P. fluorescens and Escherichia coli

    DEFF Research Database (Denmark)

    Koch, Birgit; Nybroe, Ole

    2006-01-01

    A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...

  14. The mammalian homologue of yeast Afg1 ATPase (lactation elevated 1) mediates degradation of nuclear-encoded complex IV subunits

    Czech Academy of Sciences Publication Activity Database

    Česneková, J.; Rodinová, M.; Hansíková, H.; Houštěk, Josef; Zeman, J.; Stibůrek, L.

    2016-01-01

    Roč. 473, č. 6 (2016), s. 797-804 ISSN 0264-6021 R&D Projects: GA ČR(CZ) GA13-07223S Institutional support: RVO:67985823 Keywords : complex IV * LACE1 * mitochondria * oxidative phosphorylation * YME1L Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.797, year: 2016

  15. Insertion of a specific fungal 3'-phosphoadenosine-5'-phosphatase motif into a plant homologue improves halotolerance and drought tolerance of plants.

    Science.gov (United States)

    Gašparič, Meti Buh; Lenassi, Metka; Gostinčar, Cene; Rotter, Ana; Plemenitaš, Ana; Gunde-Cimerman, Nina; Gruden, Kristina; Zel, Jana

    2013-01-01

    Soil salinity and drought are among the most serious agricultural and environmental problems of today. Therefore, investigations of plant resistance to abiotic stress have received a lot of attention in recent years. In this study, we identified the complete coding sequence of a 3'-phosphoadenosine-5'-phosphatase protein, ApHal2, from the halotolerant yeast Aureobasidium pullulans. Expression of the ApHAL2 gene in a Saccharomyces cerevisiae hal2 mutant complemented the mutant auxotrophy for methionine, and rescued the growth of the hal2 mutant in media with high NaCl concentrations. A 21-amino-acids-long region of the ApHal2 enzyme was inserted into the Arabidopsis thaliana homologue of Hal2, the SAL1 phosphatase. The inserted sequence included the META motif, which has previously been implicated in increased sodium tolerance of the Hal2 homologue from a related fungal species. Transgenic Arabidopsis plants overexpressing this modified SAL1 (mSAL1) showed improved halotolerance and drought tolerance. In a medium with an elevated salt concentration, mSAL1-expressing plants were twice as likely to have roots in a higher length category in comparison with the wild-type Arabidopsis and with plants overexpressing the native SAL1, and had 5% to 10% larger leaf surface area under moderate and severe salt stress, respectively. Similarly, after moderate drought exposure, the mSAL1-expressing plants showed 14% increased dry weight after revitalisation, with no increase in dry weight of the wild-type plants. With severe drought, plants overexpressing native SAL1 had the worst rehydration success, consistent with the recently proposed role of SAL1 in severe drought. This was not observed for plants expressing mSAL1. Therefore, the presence of this fungal META motif sequence is beneficial under conditions of increased salinity and moderate drought, and shows no drawbacks for plant survival under severe drought. This demonstrates that adaptations of extremotolerant fungi should

  16. Cloning of Interleukin-10 from African Clawed Frog (Xenopus tropicalis, with the Finding of IL-19/20 Homologue in the IL-10 Locus

    Directory of Open Access Journals (Sweden)

    Zhitao Qi

    2015-01-01

    Full Text Available Interleukin-10 (IL-10 is a pleiotropic cytokine that plays an important role in immune system. In the present study, the IL-10 gene of African clawed frog (Xenopus tropicalis was first cloned, and its expression pattern and 3D structure were also analyzed. The frog IL-10 mRNA encoded 172 amino acids which possessed several conserved features found in IL-10s from other species, including five-exon/four-intron genomic structure, conserved four cysteine residues, IL-10 family motif, and six α-helices. Real-time PCR showed that frog IL-10 mRNA was ubiquitous expressed in all examined tissues, highly in some immune related tissues including kidney, spleen, and intestine and lowly in heart, stomach, and liver. The frog IL-10 mRNA was upregulated at 24 h after LPS stimulation, indicating that it plays a part in the host immune response to bacterial infection. Another IL, termed as IL-20, was identified from the frog IL-10 locus, which might be the homologue of mammalian IL-19/20 according to the analysis results of the phylogenetic tree and the sequence identities.

  17. The CD11a partner in Sus scrofa lymphocyte function-associated antigen-1 (LFA-1: mRNA cloning, structure analysis and comparison with mammalian homologues

    Directory of Open Access Journals (Sweden)

    Thomas Anne VT

    2005-10-01

    Full Text Available Abstract Background Lymphocyte function-associated antigen-1 (LFA-1, CD11a/CD18, alphaLbeta2, the most abundant and widely expressed beta2-integrin, is required for many cellular adhesive interactions during the immune response. Many studies have shown that LFA-1 is centrally involved in the pathogenesis of several diseases caused by Repeats-in-toxin (RTX -producing bacteria. Results The porcine-LFA-1 CD11a (alpha subunit coding sequence was cloned, sequenced and compared with the available mammalian homologues in this study. Despite some focal differences, it shares all the main characteristics of these latter. Interestingly, as in sheep and humans, an allelic variant with a triplet insertion resulting in an additional Gln-744 was consistently identified, which suggests an allelic polymorphism that might be biologically relevant. Conclusion Together with the pig CD18-encoding cDNA, which has been available for a long time, the sequence data provided here will allow the successful expression of porcine CD11a, thus giving the first opportunity to express the Sus scrofa beta2-integrin LFA-1 in vitro as a tool to examine the specificities of inflammation in the porcine species.

  18. The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development

    Directory of Open Access Journals (Sweden)

    Markéta Kostrouchová

    2017-06-01

    Full Text Available The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

  19. The phocein homologue SmMOB3 is essential for vegetative cell fusion and sexual development in the filamentous ascomycete Sordaria macrospora.

    Science.gov (United States)

    Bernhards, Yasmine; Pöggeler, Stefanie

    2011-04-01

    Members of the striatin family and their highly conserved interacting protein phocein/Mob3 are key components in the regulation of cell differentiation in multicellular eukaryotes. The striatin homologue PRO11 of the filamentous ascomycete Sordaria macrospora has a crucial role in fruiting body development. Here, we functionally characterized the phocein/Mob3 orthologue SmMOB3 of S. macrospora. We isolated the gene and showed that both, pro11 and Smmob3 are expressed during early and late developmental stages. Deletion of Smmob3 resulted in a sexually sterile strain, similar to the previously characterized pro11 mutant. Fusion assays revealed that ∆Smmob3 was unable to undergo self-fusion and fusion with the pro11 strain. The essential function of the SmMOB3 N-terminus containing the conserved mob domain was demonstrated by complementation analysis of the sterile S. macrospora ∆Smmob3 strain. Downregulation of either pro11 in ∆Smmob3, or Smmob3 in pro11 mutants by means of RNA interference (RNAi) resulted in synthetic sexual defects, demonstrating for the first time the importance of a putative PRO11/SmMOB3 complex in fruiting body development.

  20. An Epichloë festucae homologue of MOB3, a component of the STRIPAK complex, is required for the establishment of a mutualistic symbiotic interaction with Lolium perenne

    Science.gov (United States)

    Green, Kimberly A.; Becker, Yvonne; Fitzsimons, Helen L.

    2016-01-01

    Summary In both Sordaria macrospora and Neurospora crassa, components of the conserved STRIPAK (striatin‐interacting phosphatase and kinase) complex regulate cell–cell fusion, hyphal network development and fruiting body formation. Interestingly, a number of Epichloë festucae genes that are required for hyphal cell–cell fusion, such as noxA, noxR, proA, mpkA and mkkA, are also required for the establishment of a mutualistic symbiotic interaction with Lolium perenne. To determine whether MobC, a homologue of the STRIPAK complex component MOB3 in S. macrospora and N. crassa, is required for E. festucae hyphal fusion and symbiosis, a mobC deletion strain was generated. The ΔmobC mutant showed reduced rates of hyphal cell–cell fusion, formed intrahyphal hyphae and exhibited enhanced conidiation. Plants infected with ΔmobC were severely stunted. Hyphae of ΔmobC showed a proliferative pattern of growth within the leaves of Lolium perenne with increased colonization of the intercellular spaces and vascular bundles. Although hyphae were still able to form expressoria, structures allowing the colonization of the leaf surface, the frequency of formation was significantly reduced. Collectively, these results show that the STRIPAK component MobC is required for the establishment of a mutualistic symbiotic association between E. festucae and L. perenne, and plays an accessory role in the regulation of hyphal cell–cell fusion and expressorium development in E. festucae. PMID:27277141

  1. MicroRNA-15a finetunes the level of Delta-like 1 homologue (DLK1) in proliferating 3T3-L1 preadipocytes

    DEFF Research Database (Denmark)

    Andersen, Ditte C; Jensen, Charlotte H; Schneider, Mikael

    2010-01-01

    Delta like 1 homologue (Dlk1) exists in both transmembrane and soluble molecular forms, and is implicated in cellular growth and plays multiple roles in development, tissue regeneration, and cancer. Thus, DLK1 levels are critical for cell function, and abnormal DLK1 expression can be lethal...... increases with cell density, and peaks at the same stage where membrane DLK1(M) and soluble DLK1(S) are found at maximum levels. Remarkably, miR-15a represses the amount of all Dlk1 variants at the mRNA level but also the level of DLK1(M) protein while it increases the amount of DLK1(S) supporting a direct...... while increasing cell numbers, scenarios that were completely rescued by addition of purified DLK1(S). Our data thus imply that miR-15a regulates cell size and proliferation by fine-tuning Dlk1 among others, and further emphasize miR-15a and DLK1 levels to play important roles in growth signaling...

  2. First report of a thioredoxin homologue in jellyfish: molecular cloning, expression and antioxidant activity of CcTrx1 from Cyanea capillata.

    Directory of Open Access Journals (Sweden)

    Zengliang Ruan

    Full Text Available Thioredoxins (Trx proteins are a family of small, highly-conserved and ubiquitous proteins that play significant roles in the resistance of oxidative damage. In this study, a homologue of Trx was identified from the cDNA library of tentacle of the jellyfish Cyanea capillata and named CcTrx1. The full-length cDNA of CcTrx1 was 479 bp with a 312 bp open reading frame encoding 104 amino acids. Bioinformatics analysis revealed that the putative CcTrx1 protein harbored the evolutionarily-conserved Trx active site 31CGPC34 and shared a high similarity with Trx1 proteins from other organisms analyzed, indicating that CcTrx1 is a new member of Trx1 sub-family. CcTrx1 mRNA was found to be constitutively expressed in tentacle, umbrella, oral arm and gonad, indicating a general role of CcTrx1 protein in various physiological processes. The recombinant CcTrx1 (rCcTrx1 protein was expressed in Escherichia coli BL21 (DE3, and then purified by affinity chromatography. The rCcTrx1 protein was demonstrated to possess the expected redox activity in enzymatic analysis and protection against oxidative damage of supercoiled DNA. These results indicate that CcTrx1 may function as an important antioxidant in C. capillata. To our knowledge, this is the first Trx protein characterized from jellyfish species.

  3. SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

    KAUST Repository

    Qiu, Jiaen; Henderson, Sam W; Tester, Mark A.; Roy, Stuart J; Gilliham, Mathew

    2016-01-01

    Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

  4. The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development.

    Science.gov (United States)

    Kostrouchová, Markéta; Kostrouch, David; Chughtai, Ahmed A; Kaššák, Filip; Novotný, Jan P; Kostrouchová, Veronika; Benda, Aleš; Krause, Michael W; Saudek, Vladimír; Kostrouchová, Marta; Kostrouch, Zdeněk

    2017-01-01

    The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

  5. Drosophila homologue of Diaphanous 1 (DIAPH1) controls the metastatic potential of colon cancer cells by regulating microtubule-dependent adhesion.

    Science.gov (United States)

    Lin, Yuan-Na; Bhuwania, Ridhirama; Gromova, Kira; Failla, Antonio Virgilio; Lange, Tobias; Riecken, Kristoffer; Linder, Stefan; Kneussel, Matthias; Izbicki, Jakob R; Windhorst, Sabine

    2015-07-30

    Drosophila homologue of Diaphanous 1 (DIAPH1) regulates actin polymerization and microtubule (MT) stabilization upon stimulation with lysophosphatidic acid (LPA). Recently, we showed strongly reduced lung metastasis of DIAPH1-depleted colon cancer cells but we found accumulations of DIAPH1-depleted cells in bone marrow. Here, we analyzed possible organ- or tissue-specific metastasis of DIAPH1-depleted HCT-116 cells. Our data confirmed that depletion of DIAPH1 strongly inhibited lung metastasis and revealed that, in contrast to control cells, DIAPH1-depleted cells did not form metastases in further organs. Detailed mechanistic analysis on cells that were not stimulated with LPA to activate the cytoskeleton-modulating activity of DIAPH1, revealed that even under basal conditions DIAPH1 was essential for cellular adhesion to collagen. In non-stimulated cells DIAPH1 did not control actin dynamics but, interestingly, was essential for stabilization of microtubules (MTs). Additionally, DIAPH1 controlled directed vesicle trafficking and with this, local clustering of the adhesion protein integrin-β1 at the plasma membrane. Therefore, we conclude that under non-stimulating conditions DIAPH1 controls cellular adhesion by stabilizing MTs required for local clustering of integrin-β1 at the plasma membrane. Thus, blockade of DIAPH1-tubulin interaction may be a promising approach to inhibit one of the earliest steps in the metastatic cascade of colon cancer.

  6. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Science.gov (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  7. Purification of the spliced leader ribonucleoprotein particle from Leptomonas collosoma revealed the existence of an Sm protein in trypanosomes. Cloning the SmE homologue.

    Science.gov (United States)

    Goncharov, I; Palfi, Z; Bindereif, A; Michaeli, S

    1999-04-30

    Trans-splicing in trypanosomes involves the addition of a common spliced leader (SL) sequence, which is derived from a small RNA, the SL RNA, to all mRNA precursors. The SL RNA is present in the cell in the form of a ribonucleoprotein, the SL RNP. Using conventional chromatography and affinity selection with 2'-O-methylated RNA oligonucleotides at high ionic strength, five proteins of 70, 16, 13, 12, and 8 kDa were co-selected with the SL RNA from Leptomonas collosoma, representing the SL RNP core particle. Under conditions of lower ionic strength, additional proteins of 28 and 20 kDa were revealed. On the basis of peptide sequences, the gene coding for a protein with a predicted molecular weight of 11.9 kDa was cloned and identified as homologue of the cis-spliceosomal SmE. The protein carries the Sm motifs 1 and 2 characteristic of Sm antigens that bind to all known cis-spliceosomal uridylic acid-rich small nuclear RNAs (U snRNAs), suggesting the existence of Sm proteins in trypanosomes. This finding is of special interest because trypanosome snRNPs are the only snRNPs examined to date that are not recognized by anti-Sm antibodies. Because of the early divergence of trypanosomes from the eukaryotic lineage, the trypanosome SmE protein represents one of the primordial Sm proteins in nature.

  8. SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

    KAUST Repository

    Qiu, Jiaen

    2016-06-23

    Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

  9. Rasputin, the Drosophila homologue of the RasGAP SH3 binding protein, functions in ras- and Rho-mediated signaling.

    Science.gov (United States)

    Pazman, C; Mayes, C A; Fanto, M; Haynes, S R; Mlodzik, M

    2000-04-01

    The small GTPase Ras plays an important role in many cellular signaling processes. Ras activity is negatively regulated by GTPase activating proteins (GAPs). It has been proposed that RasGAP may also function as an effector of Ras activity. We have identified and characterized the Drosophila homologue of the RasGAP-binding protein G3BP encoded by rasputin (rin). rin mutants are viable and display defects in photoreceptor recruitment and ommatidial polarity in the eye. Mutations in rin/G3BP genetically interact with components of the Ras signaling pathway that function at the level of Ras and above, but not with Raf/MAPK pathway components. These interactions suggest that Rin is required as an effector in Ras signaling during eye development, supporting an effector role for RasGAP. The ommatidial polarity phenotypes of rin are similar to those of RhoA and the polarity genes, e.g. fz and dsh. Although rin/G3BP interacts genetically with RhoA, affecting both photoreceptor differentiation and polarity, it does not interact with the gain-of-function genotypes of fz and dsh. These data suggest that Rin is not a general component of polarity generation, but serves a function specific to Ras and RhoA signaling pathways.

  10. Identification of the Mycobacterium marinum Apa antigen O-mannosylation sites reveals important glycosylation variability with the M. tuberculosis Apa homologue.

    Science.gov (United States)

    Coddeville, Bernadette; Wu, Sz-Wei; Fabre, Emeline; Brassart, Colette; Rombouts, Yoann; Burguière, Adeline; Kremer, Laurent; Khoo, Kay-Hooi; Elass-Rochard, Elisabeth; Guérardel, Yann

    2012-10-22

    The 45/47 kDa Apa, an immuno-dominant antigen secreted by Mycobacterium tuberculosis is O-mannosylated at multiple sites. Glycosylation of Apa plays a key role in colonization and invasion of the host cells by M. tuberculosis through interactions of Apa with the host immune system C-type lectins. Mycobacterium marinum (M.ma) a fish pathogen, phylogenetically close to M. tuberculosis, induces a granulomatous response with features similar to those described for M. tuberculosis in human. Although M.ma possesses an Apa homologue, its glycosylation status is unknown, and whether this represents a crucial element in the pathophysiology induced by M.ma remains to be addressed. To this aim, we have identified two concanavalin A-reactive 45/47 kDa proteins from M.ma, which have been further purified by a two-step anion exchange chromatography process. Advanced liquid chromatography-nanoESI mass spectrometry-based proteomic analyses of peptides, derived from either tryptic digestion alone or in combination with the Asp-N endoproteinase, established that M.ma Apa possesses up to seven distinct O-mannosylated sites with mainly single mannose substitutions, which can be further extended at the Ser/Thr/Pro rich region near the N-terminus. This opens the way to further studies focussing on the involvement and biological functions of Apa O-mannosylation using the M.ma/zebrafish model. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Co-precipitation of phosphate and iron limits mitochondrial phosphate availability in Saccharomyces cerevisiae lacking the yeast frataxin homologue (YFH1).

    Science.gov (United States)

    Seguin, Alexandra; Santos, Renata; Pain, Debkumar; Dancis, Andrew; Camadro, Jean-Michel; Lesuisse, Emmanuel

    2011-02-25

    Saccharomyces cerevisiae cells lacking the yeast frataxin homologue (Δyfh1) accumulate iron in the mitochondria in the form of nanoparticles of ferric phosphate. The phosphate content of Δyfh1 mitochondria was higher than that of wild-type mitochondria, but the proportion of mitochondrial phosphate that was soluble was much lower in Δyfh1 cells. The rates of phosphate and iron uptake in vitro by isolated mitochondria were higher for Δyfh1 than wild-type mitochondria, and a significant proportion of the phosphate and iron rapidly became insoluble in the mitochondrial matrix, suggesting co-precipitation of these species after oxidation of iron by oxygen. Increasing the amount of phosphate in the medium decreased the amount of iron accumulated by Δyfh1 cells and improved their growth in an iron-dependent manner, and this effect was mostly transcriptional. Overexpressing the major mitochondrial phosphate carrier, MIR1, slightly increased the concentration of soluble mitochondrial phosphate and significantly improved various mitochondrial functions (cytochromes, [Fe-S] clusters, and respiration) in Δyfh1 cells. We conclude that in Δyfh1 cells, soluble phosphate is limiting, due to its co-precipitation with iron.

  12. Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecA(LGA251).

    Science.gov (United States)

    Stegger, M; Andersen, P S; Kearns, A; Pichon, B; Holmes, M A; Edwards, G; Laurent, F; Teale, C; Skov, R; Larsen, A R

    2012-04-01

    The recent finding of a new mecA homologue, mecA(LGA251) , with only 70% nucleotide homology to the conventional mecA gene has brought the routine testing for mecA as a confirmatory test for methicillin-resistant Staphylococcus aureus (MRSA) into question. A multiplex PCR was designed to differentiate mecA(LGA251) from the known mecA together with detection of lukF-PV and the spa gene fragments, enabling direct spa typing by sequencing of the PCR amplicons. The PCR analysis and subsequent spa typing were validated on a large collection (n=185) of contemporary MRSA and methicillin-sensitive S. aureus isolates, including 127 isolates carrying mecA(LGA251) . The mecA(LGA251) gene was situated in staphylococcal cassette chromosome mec type XI elements, and sequence variation within a 631-bp fragment of mecA(LGA251) in 79 isolates indicated a very conserved gene sequence. Following a successful validation, the multiplex PCR strategy was implemented in the routine testing of MRSA for national surveillance. Over a 2-month period, among 203 samples tested, 12 new MRSA cases caused by isolates carrying mecA(LGA251) were identified, emphasizing the clinical importance of testing for these new MRSA isolates. © 2011 STATENS SERUM INSTITUT. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  13. Single-Crystal X-Ray Diffraction Studies of Homologues in the Series nBa(Nb,Zr)O 3+3 mNbO with n=2, 3, 4, 5 and m=1

    Science.gov (United States)

    Nilsson, G.; Svensson, G.

    2001-01-01

    Single crystals of four homologues in the series nBa(Nb,Zr)O3+3mNbO, with n:m=2:1, 3:1, 4:1, and 5:1, were found in the reduced Ba-Nb-Zr-O system. Single-crystal X-ray diffraction data were collected for all the crystals. For all homologues the space group was found to be P4/mmm. The structures can be described as intergrowths of Ba(Nb,Zr)O3 perovskite and NbO slabs. The refined cell parameters and compositions of the 2:1, 3:1, and 4:1 homologues are a=4.1768(5) Å and c=12.269(2) Å for Ba2Nb4.5(1)Zr0.5(1)O9, a=4.1769(5) Å and c=16.493(3) Å for Ba3+δNb4.8(2)-δ Zr1.2(2)O12-δ (δ=0.098(4)), and a=4.1747(6) Å and c= 20.619(4) Å for Ba4+δNb5.1(4)-δZr1.9(4)O15-δ (δ=0.270(9)). The refined cell parameters of the 5:1 homologue are a=4.1727(3) Å and c=24.804(3) Å. Zr replaces Nb only in the NbO6 octahedra found in the perovskite slabs.

  14. Short-chain chlorinated paraffins in soil, paddy seeds (Oryza sativa) and snails (Ampullariidae) in an e-waste dismantling area in China: Homologue group pattern, spatial distribution and risk assessment.

    Science.gov (United States)

    Yuan, Bo; Fu, Jianjie; Wang, Yawei; Jiang, Guibin

    2017-01-01

    Short-chain chlorinated paraffins (SCCPs) in multi-environmental matrices are studied in Taizhou, Zhejiang Province, China, which is a notorious e-waste dismantling area. The investigated matrices consist of paddy field soil, paddy seeds (Oryza sativa, separated into hulls and rice unpolished) and apple snails (Ampullariidae, inhabiting the paddy fields). The sampling area covered a 65-km radius around the contamination center. C 10 and C 11 are the two predominant homologue groups in the area, accounting for about 35.7% and 33.0% of total SCCPs, respectively. SCCPs in snails and hulls are generally higher than in soil samples (30.4-530 ng/g dw), and SCCPs in hulls are approximate five times higher than in corresponding rice samples (4.90-55.1 ng/g dw). Homologue pattern analysis indicates that paddy seeds (both hull and rice) tend to accumulate relatively high volatile SCCP homologues, especially the ones with shorter carbon chain length, while snails tend to accumulate relatively high lipophilic homologues, especially the ones with more substituted chlorines. SCCPs in both paddy seeds and snails are linearly related to those in the soil. The e-waste dismantling area, which covers a radius of approximate 20 km, shows higher pollution levels for SCCPs according to their spatial distribution in four matrices. The preliminary assessment indicates that SCCP levels in local soils pose no significant ecological risk for soil dwelling organisms, but higher risks from dietary exposure of SCCPs are suspected for people living in e-waste dismantling area. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Two mannose-binding lectin homologues and an MBL-associated serine protease are expressed in the gut epithelia of the urochordate species Ciona intestinalis

    DEFF Research Database (Denmark)

    Skjødt, Mikkel-Ole; Palarasah, Yaseelan; Rasmussen, Karina Juhl

    2010-01-01

    The lectin complement pathway has important functions in vertebrate host defence and accumulating evidence of primordial complement components trace its emergence to invertebrate phyla. We introduce two putative mannose-binding lectin homologues (CioMBLs) from the urochordate species Ciona intest...... protease in the epithelia cells lining the stomach and intestine. In conclusion we present two urochordate MBLs and identify an associated serine protease, which support the concept of an evolutionary ancient origin of the lectin complement pathway....

  16. Identification of a conserved archaeal RNA polymerase subunit contacted by the basal transcription factor TFB.

    Science.gov (United States)

    Magill, C P; Jackson, S P; Bell, S D

    2001-12-14

    Archaea possess two general transcription factors that are required to recruit RNA polymerase (RNAP) to promoters in vitro. These are TBP, the TATA-box-binding protein and TFB, the archaeal homologue of TFIIB. Thus, the archaeal and eucaryal transcription machineries are fundamentally related. In both RNAP II and archaeal transcription systems, direct contacts between TFB/TFIIB and the RNAP have been demonstrated to mediate recruitment of the polymerase to the promoter. However the subunit(s) directly contacted by these factors has not been identified. Using systematic yeast two-hybrid and biochemical analyses we have identified an interaction between the N-terminal domain of TFB and an evolutionarily conserved subunit of the RNA polymerase, RpoK. Intriguingly, homologues of RpoK are found in all three nuclear RNA polymerases (Rpb6) and also in the bacterial RNA polymerase (omega-subunit).

  17. Unique variability of tocopherol composition in various seed oils recovered from by-products of apple industry: rapid and simple determination of all four homologues (α, β, γ and δ) by RP-HPLC/FLD.

    Science.gov (United States)

    Górnaś, Paweł

    2015-04-01

    The tocochromanol profile was studied in seed oils recovered from by-products of fruit industry, five dessert and seven crab apple varieties grown in Eastern Europe (Latvia). The seed oils obtained from dessert apples were characterized by higher contents of tocopherols (191.05-379.08 mg/100g oil) when compared to seed oils recovered from crab apples (130.55-202.54 mg/100g oil). The predominant homologues of tocopherol in all the studied samples were α and β over γ and δ. However, seed oils recovered from the apple cultivars 'Antej' and 'Beforest' had a unique profile of four tocopherol homologues (α:β:γ:δ) 91.41:80.55:72.46:79.03 and 114.55:112.84:78.69:73.00 mg/100g oil, respectively. A single dilution of seed oils in 2-propanol facilitated the direct use samples in the DPPH assay as well as injection into the RP-HPLC system containing a PFP (pentafluorophenyl) column, which resulted in a rapid separation of all four tocopherol homologues with excellent repeatability and reproducibility. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Use of isotope ratio mass spectrometry to differentiate between endogenous steroids and synthetic homologues in cattle: A review

    Energy Technology Data Exchange (ETDEWEB)

    Janssens, Geert, E-mail: Geert.janssens@favv.be [Federal Agency for the Safety of the Food Chain, Directorate General Laboratories, Kruidtuinlaan 55, 1000 Brussels (Belgium); Department of Sustainable Organic Chemistry and Technology, Faculty of Bioscience Engineering, Ghent University, Coupure Links 653, 9000 Ghent (Belgium); Courtheyn, Dirk [Federal Agency for the Safety of the Food Chain, Directorate General Laboratories, Kruidtuinlaan 55, 1000 Brussels (Belgium); Mangelinckx, Sven [Department of Sustainable Organic Chemistry and Technology, Faculty of Bioscience Engineering, Ghent University, Coupure Links 653, 9000 Ghent (Belgium); Prévost, Stéphanie; Bichon, Emmanuelle; Monteau, Fabrice [LUNAM Université, Oniris, Laboratoire d’Etude des Résidus et Contaminants dans les Aliments (LABERCA), F-44307 Nantes (France); De Poorter, Geert [Federal Agency for the Safety of the Food Chain, Directorate General Laboratories, Kruidtuinlaan 55, 1000 Brussels (Belgium); De Kimpe, Norbert [Department of Sustainable Organic Chemistry and Technology, Faculty of Bioscience Engineering, Ghent University, Coupure Links 653, 9000 Ghent (Belgium); Le Bizec, Bruno [LUNAM Université, Oniris, Laboratoire d’Etude des Résidus et Contaminants dans les Aliments (LABERCA), F-44307 Nantes (France)

    2013-04-15

    Graphical abstract: Scheme: Representation of the observed isotope ratios and the relation to exogenous and endogenous natural steroids. AS stands for “amount of steroid”. Highlights: ► The difference between endogenous and exogenous steroids is thoroughly laid out. ► Factors influencing the carbon ratio and the use of Δ{sup 13}C-values are explained. ► Implementation of GC/C/IRMS to detect steroid abuse in cattle is reviewed. ► Alternative methods and upcoming techniques are discussed. ► The differences and similarities with sports doping control are highlighted. -- Abstract: Although substantial technical advances have been achieved during the past decades to extend and facilitate the analysis of growth promoters in cattle, the detection of abuse of synthetic analogs of naturally occurring hormones has remained a challenging issue. When it became clear that the exogenous origin of steroid hormones could be traced based on the {sup 13}C/{sup 12}C isotope ratio of the substances, GC/C/IRMS has been successfully implemented to this aim since the end of the past century. However, due to the costly character of the instrumental setup, the susceptibility of the equipment to errors and the complex and time consuming sample preparation, this method is up until now only applied by a limited number of laboratories. In this review, the general principles as well as the practical application of GC/C/IRMS to differentiate between endogenous steroids and exogenously synthesized homologous compounds in cattle will be discussed in detail, and will be placed next to other existing and to be developed methods based on isotope ratio mass spectrometry. Finally, the link will be made with the field of sports doping, where GC/C/IRMS has been established within the World Anti-Doping Agency (WADA) approved methods as the official technique to differentiate between exogenous and endogenous steroids over the past few years.

  19. Use of isotope ratio mass spectrometry to differentiate between endogenous steroids and synthetic homologues in cattle: A review

    International Nuclear Information System (INIS)

    Janssens, Geert; Courtheyn, Dirk; Mangelinckx, Sven; Prévost, Stéphanie; Bichon, Emmanuelle; Monteau, Fabrice; De Poorter, Geert; De Kimpe, Norbert; Le Bizec, Bruno

    2013-01-01

    Graphical abstract: Scheme: Representation of the observed isotope ratios and the relation to exogenous and endogenous natural steroids. AS stands for “amount of steroid”. Highlights: ► The difference between endogenous and exogenous steroids is thoroughly laid out. ► Factors influencing the carbon ratio and the use of Δ 13 C-values are explained. ► Implementation of GC/C/IRMS to detect steroid abuse in cattle is reviewed. ► Alternative methods and upcoming techniques are discussed. ► The differences and similarities with sports doping control are highlighted. -- Abstract: Although substantial technical advances have been achieved during the past decades to extend and facilitate the analysis of growth promoters in cattle, the detection of abuse of synthetic analogs of naturally occurring hormones has remained a challenging issue. When it became clear that the exogenous origin of steroid hormones could be traced based on the 13 C/ 12 C isotope ratio of the substances, GC/C/IRMS has been successfully implemented to this aim since the end of the past century. However, due to the costly character of the instrumental setup, the susceptibility of the equipment to errors and the complex and time consuming sample preparation, this method is up until now only applied by a limited number of laboratories. In this review, the general principles as well as the practical application of GC/C/IRMS to differentiate between endogenous steroids and exogenously synthesized homologous compounds in cattle will be discussed in detail, and will be placed next to other existing and to be developed methods based on isotope ratio mass spectrometry. Finally, the link will be made with the field of sports doping, where GC/C/IRMS has been established within the World Anti-Doping Agency (WADA) approved methods as the official technique to differentiate between exogenous and endogenous steroids over the past few years

  20. Secretory leukocyte protease inhibitor (SLPI is, like its homologue trappin-2 (pre-elafin, a transglutaminase substrate.

    Directory of Open Access Journals (Sweden)

    Kévin Baranger

    Full Text Available Human lungs contain secretory leukocyte protease inhibitor (SLPI, elafin and its biologically active precursor trappin-2 (pre-elafin. These important low-molecular weight inhibitors are involved in controlling the potentially deleterious proteolytic activities of neutrophil serine proteases including elastase, proteinase 3 and cathepsin G. We have shown previously that trappin-2, and to a lesser extent, elafin can be linked covalently to various extracellular matrix proteins by tissue transglutaminases and remain potent protease inhibitors. SLPI is composed of two distinct domains, each of which is about 40% identical to elafin, but it lacks consensus transglutaminase sequence(s, unlike trappin-2 and elafin. We investigated the actions of type 2 tissue transglutaminase and plasma transglutaminase activated factor XIII on SLPI. It was readily covalently bound to fibronectin or elastin by both transglutaminases but did not compete with trappin-2 cross-linking. Cross-linked SLPI still inhibited its target proteases, elastase and cathepsin G. We have also identified the transglutamination sites within SLPI, elafin and trappin-2 by mass spectrometry analysis of tryptic digests of inhibitors cross-linked to mono-dansyl cadaverin or to a fibronectin-derived glutamine-rich peptide. Most of the reactive lysine and glutamine residues in SLPI are located in its first N-terminal elafin-like domain, while in trappin-2, they are located in both the N-terminal cementoin domain and the elafin moiety. We have also demonstrated that the transglutamination substrate status of the cementoin domain of trappin-2 can be transferred from one protein to another, suggesting that it may provide transglutaminase-dependent attachment properties for engineered proteins. We have thus added to the corpus of knowledge on the biology of these potential therapeutic inhibitors of airway proteases.

  1. Substrate recognition by complement convertases revealed in the C5-cobra venom factor complex

    DEFF Research Database (Denmark)

    Laursen, Nick Stub; Andersen, Kasper Røjkjær; Braren, Ingke

    2011-01-01

    with a protease subunit (Bb or C2a). We determined the crystal structures of the C3b homologue cobra venom factor (CVF) in complex with C5, and in complex with C5 and the inhibitor SSL7 at 4.3 Å resolution. The structures reveal a parallel two-point attachment between C5 and CVF, where the presence of SSL7 only...

  2. Deep mRNA sequencing of the Tritonia diomedea brain transcriptome provides access to gene homologues for neuronal excitability, synaptic transmission and peptidergic signalling.

    Directory of Open Access Journals (Sweden)

    Adriano Senatore

    Full Text Available The sea slug Tritonia diomedea (Mollusca, Gastropoda, Nudibranchia, has a simple and highly accessible nervous system, making it useful for studying neuronal and synaptic mechanisms underlying behavior. Although many important contributions have been made using Tritonia, until now, a lack of genetic information has impeded exploration at the molecular level.We performed Illumina sequencing of central nervous system mRNAs from Tritonia, generating 133.1 million 100 base pair, paired-end reads. De novo reconstruction of the RNA-Seq data yielded a total of 185,546 contigs, which partitioned into 123,154 non-redundant gene clusters (unigenes. BLAST comparison with RefSeq and Swiss-Prot protein databases, as well as mRNA data from other invertebrates (gastropod molluscs: Aplysia californica, Lymnaea stagnalis and Biomphalaria glabrata; cnidarian: Nematostella vectensis revealed that up to 76,292 unigenes in the Tritonia transcriptome have putative homologues in other databases, 18,246 of which are below a more stringent E-value cut-off of 1x10-6. In silico prediction of secreted proteins from the Tritonia transcriptome shotgun assembly (TSA produced a database of 579 unique sequences of secreted proteins, which also exhibited markedly higher expression levels compared to other genes in the TSA.Our efforts greatly expand the availability of gene sequences available for Tritonia diomedea. We were able to extract full length protein sequences for most queried genes, including those involved in electrical excitability, synaptic vesicle release and neurotransmission, thus confirming that the transcriptome will serve as a useful tool for probing the molecular correlates of behavior in this species. We also generated a neurosecretome database that will serve as a useful tool for probing peptidergic signalling systems in the Tritonia brain.

  3. Regulation of the Src Kinase-associated Phosphoprotein 55 Homologue by the Protein Tyrosine Phosphatase PTP-PEST in the Control of Cell Motility*

    Science.gov (United States)

    Ayoub, Emily; Hall, Anita; Scott, Adam M.; Chagnon, Mélanie J.; Miquel, Géraldine; Hallé, Maxime; Noda, Masaharu; Bikfalvi, Andreas; Tremblay, Michel L.

    2013-01-01

    PTP-PEST is a cytosolic ubiquitous protein tyrosine phosphatase (PTP) that contains, in addition to its catalytic domain, several protein-protein interaction domains that allow it to interface with several signaling pathways. Among others, PTP-PEST is a key regulator of cellular motility and cytoskeleton dynamics. The complexity of the PTP-PEST interactome underscores the necessity to identify its interacting partners and physiological substrates in order to further understand its role in focal adhesion complex turnover and actin organization. Using a modified yeast substrate trapping two-hybrid system, we identified a cytosolic adaptor protein named Src kinase-associated phosphoprotein 55 homologue (SKAP-Hom) as a novel substrate of PTP-PEST. To confirm PTP-PEST interaction with SKAP-Hom, in vitro pull down assays were performed demonstrating that the PTP catalytic domain and Proline-rich 1 (P1) domain are respectively binding to the SKAP-Hom Y260 and Y297 residues and its SH3 domain. Subsequently, we generated and rescued SKAP-Hom-deficient mouse embryonic fibroblasts (MEFs) with WT SKAP-Hom, SKAP-Hom tyrosine mutants (Y260F, Y260F/Y297F), or SKAP-Hom SH3 domain mutant (W335K). Given the role of PTP-PEST, wound-healing and trans-well migration assays were performed using the generated lines. Indeed, SKAP-Hom-deficient MEFs showed a defect in migration compared with WT-rescued MEFs. Interestingly, the SH3 domain mutant-rescued MEFs showed an enhanced cell migration corresponding potentially with higher tyrosine phosphorylation levels of SKAP-Hom. These findings suggest a novel role of SKAP-Hom and its phosphorylation in the regulation of cellular motility. Moreover, these results open new avenues by which PTP-PEST regulates cellular migration, a hallmark of metastasis. PMID:23897807

  4. BmajPLA2-II, a basic Lys49-phospholipase A2 homologue from Bothrops marajoensis snake venom with parasiticidal potential.

    Science.gov (United States)

    Grabner, Amy N; Alfonso, Jorge; Kayano, Anderson M; Moreira-Dill, Leandro S; Dos Santos, Ana Paula de A; Caldeira, Cleópatra A S; Sobrinho, Juliana C; Gómez, Ana; Grabner, Fernando P; Cardoso, Fabio F; Zuliani, Juliana Pavan; Fontes, Marcos R M; Pimenta, Daniel C; Gómez, Celeste Vega; Teles, Carolina B G; Soares, Andreimar M; Calderon, Leonardo A

    2017-09-01

    Snake venoms contain various proteins, especially phospholipases A 2 (PLA 2 s), which present potential applications in diverse areas of health and medicine. In this study, a new basic PLA 2 from Bothrops marajoensis with parasiticidal activity was purified and characterized biochemically and biologically. B. marajoensis venom was fractionated through cation exchange followed by reverse phase chromatographies. The isolated toxin, BmajPLA 2 -II, was structurally characterized with MALDI-TOF (Matrix-assisted laser desorption/ionization-time of flight) mass spectrometry, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by two-dimensional electrophoresis, partial amino acid sequencing, an enzymatic activity assay, circular dichroism, and dynamic light scattering assays. These structural characterization tests presented BmajPLA 2 -II as a basic Lys49 PLA 2 homologue, compatible with other basic snake venom PLA 2 s (svPLA 2 ), with a tendency to form aggregations. The in vitro anti-parasitic potential of B. marajoensis venom and of BmajPLA 2 -II was evaluated against Leishmania infantum promastigotes and Trypanosoma cruzi epimastigotes, showing significant activity at a concentration of 100μg/mL. The venom and BmajPLA 2 -II presented IC 50 of 0.14±0.08 and 6.41±0.64μg/mL, respectively, against intraerythrocytic forms of Plasmodium falciparum with CC 50 cytotoxicity values against HepG2 cells of 43.64±7.94 and >150μg/mL, respectively. The biotechnological potential of these substances in relation to leishmaniasis, Chagas disease and malaria should be more deeply investigated. Copyright © 2017. Published by Elsevier B.V.

  5. An Arabidopsis chloroplast-targeted Hsp101 homologue, APG6, has an essential role in chloroplast development as well as heat-stress response.

    Science.gov (United States)

    Myouga, Fumiyoshi; Motohashi, Reiko; Kuromori, Takashi; Nagata, Noriko; Shinozaki, Kazuo

    2006-10-01

    Analysis of albino or pale-green (apg) mutants is important for identifying nuclear genes responsible for chloroplast development and pigment synthesis. We have identified 38 apg mutants by screening 11 000 Arabidopsis Ds-tagged lines. One mutant, apg6, contains a Ds insertion in a gene encoding APG6 (ClpB3), a homologue of the heat-shock protein Hsp101 (ClpB1). We isolated somatic revertants and identified two Ds-tagged and one T-DNA-tagged mutant alleles of apg6. All three alleles gave the same pale-green phenotype. These results suggest that APG6 is important for chloroplast development. The APG6 protein contains a transit peptide and is localized in chloroplasts. The plastids of apg6 pale-green cells were smaller than those of the wild type, and contained undeveloped thylakoid membranes. APG6 mRNA accumulated in response to heat shock in various organs, but not in response to other abiotic stresses. Under normal conditions, APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. In addition, constitutive overexpression of APG6 in transgenic plants inhibited chloroplast development and resulted in a mild pale-green phenotype. The amounts of chloroplast proteins related to photosynthesis were markedly decreased in apg6 mutants. These results suggest that APG6 functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. The APG6 protein is not only involved in heat-stress response in chloroplasts, but is also essential for chloroplast development.

  6. Effect of Phosphatase and Tensin Homologue on Chromosome 10 on Angiotensin II-Mediated Proliferation, Collagen Synthesis, and Akt/P27 Signaling in Neonatal Rat Cardiac Fibroblasts

    Directory of Open Access Journals (Sweden)

    Ling Nie

    2016-01-01

    Full Text Available Cardiac fibroblasts (CFs play a key role in cardiac fibrosis by regulating the balance between extracellular matrix synthesis and breakdown. Although phosphatase and tensin homologue on chromosome 10 (PTEN has been found to play an important role in cardiovascular disease, it is not clear whether PTEN is involved in functional regulation of CFs. In the present study, PTEN was overexpressed in neonatal rat CFs via recombinant adenovirus-mediated gene transfer. The effects of PTEN overexpression on cell-cycle progression and angiotensin II- (Ang II- mediated regulation of collagen metabolism, synthesis of matrix metalloproteinases, and Akt/P27 signaling were investigated. Compared with uninfected cells and cells infected with green fluorescent protein-expressing adenovirus (Ad-GFP, cells infected with PTEN-expressing adenovirus (Ad-PTEN significantly increased PTEN protein and mRNA levels in CFs (P<0.05. The proportion of CFs in the G1/S cell-cycle phase was significantly higher for PTEN-overexpressing cells. In addition, Ad-PTEN decreased mRNA expression and the protein synthesis rate of collagen types I and III and antagonized Ang II-induced collagen synthesis. Overexpression of PTEN also decreased Ang II-induced matrix metalloproteinase-2 (MMP-2 and tissue inhibitor of metalloproteinase-1 (TIMP-1 production as well as gelatinase activity. Moreover, Ad-PTEN decreased Akt expression and increased P27 expression independent of Ang II stimulation. These results suggest that PTEN could regulate its functional effects in neonatal rat CFs partially via the Akt/P27 signaling pathway.

  7. Human CD4+ T cell responses to the dog major allergen Can f 1 and its human homologue tear lipocalin resemble each other.

    Directory of Open Access Journals (Sweden)

    Aino L K Liukko

    Full Text Available Lipocalin allergens form a notable group of proteins, as they contain most of the significant respiratory allergens from mammals. The basis for the allergenic capacity of allergens in the lipocalin family, that is, the development of T-helper type 2 immunity against them, is still unresolved. As immunogenicity has been proposed to be a decisive feature of allergens, the purpose of this work was to examine human CD4+ T cell responses to the major dog allergen Can f 1 and to compare them with those to its human homologue, tear lipocalin (TL. For this, specific T cell lines were induced in vitro from the peripheral blood mononuclear cells of Can f 1-allergic and healthy dog dust-exposed subjects with peptides containing the immunodominant T cell epitopes of Can f 1 and the corresponding TL peptides. We found that the frequency of Can f 1 and TL-specific T cells in both subject groups was low and close to each other, the difference being about two-fold. Importantly, we found that the proliferative responses of both Can f 1 and TL-specific T cell lines from allergic subjects were stronger than those from healthy subjects, but that the strength of the responses within the subject groups did not differ between these two antigens. Moreover, the phenotype of the Can f 1 and TL-specific T cell lines, determined by cytokine production and expression of cell surface markers, resembled each other. The HLA system appeared to have a minimal role in explaining the allergenicity of Can f 1, as the allergic and healthy subjects' HLA background did not differ, and HLA binding was very similar between Can f 1 and TL peptides. Along with existing data on lipocalin allergens, we conclude that strong antigenicity is not decisive for the allergenicity of Can f 1.

  8. Occurrence, homologue patterns and source apportionment of short- and medium-chain chlorinated paraffins in suburban soils of Shanghai, China.

    Science.gov (United States)

    Wang, Xue-Tong; Xu, Si-Yue; Wang, Xi-Kui; Hu, Bao-Ping; Jia, Hao-Hao

    2017-08-01

    In order to systematically investigate the spatial distribution, homologue profiles, and sources of short- and medium-chain chlorinated paraffins (SCCPs and MCCPs) in suburban soils in Shanghai, SCCPs and MCCPs in soils were analyzed using gas chromatography coupled with low resolution mass spectrometry in electron capture negative ion (ECNI) mode (GC-ECNI-MS). The CP concentrations in soils were between not detected (ND) - 697 ng g -1 with a median value of 3.52 ng g -1 for SCCPs, and ND - 666 ng g -1 with a median value of 15.3 ng g -1 for MCCPs, respectively. The concentrations of MCCPs in most soils were higher than that of SCCPs. The total CP concentrations (sum of SCCPs and MCCPs) in soils varied from ND to 964 ng g -1 with a median value of 20.5 ng g -1 . The concentration of MCCPs was higher than that of SCCPs in most soils. The levels of SCCPs and MCCPs in suburban soils in Shanghai were at the medium level when compared to other areas around the world. No significant correlation was observed between soil CP concentrations and total organic carbon contents (p > 0.05). For different use type of soils, the median concentrations of CPs in soils were found higher in greenland than that in other areas probably due to busy traffic, sewage sludge application and/or wastewater irrigation. All soils were divided into two groups by hierarchical cluster analysis (HCA) both for SCCPs and MCCPs. Three discharge sources of CPs in suburban soil of Shanghai were identified by PMF model. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Isolation and characterization of the human homologue of rig and its pseudogenes: The functional gene has features characteristic of housekeeping genes

    International Nuclear Information System (INIS)

    Shiga, Kiyoto; Yamamoto, Hiroshi; Okamoto, Hiroshi

    1990-01-01

    Rig (rat insulinoma gene) was first isolated from a cDNA library of rat insulinomas and has been found to be activated in various human tumors such as insulinomas, esophageal cancers, and colon cancers. Here the authors isolated the human homologue of rig from a genomic DNA library constructed from a human esophageal carcinoma and determined its complete nucleotide sequence. The gene is composed of about 3,000 nucleotides and divided into four exons separated by three introns: exon 3 encodes the nuclear location signal and the DNA-binding domain of the RIG protein. The transcription initiation site was located at -46 base pairs upstream from the first ATG codon. The 5'-flanking region of the gene has no apparent TATA-box or CAAT-box sequence. However, two GC boxes are found at -189 and -30 base pairs upstream from the transcription initiation site and five GC boxes are also found in introns 1 and 2. The gene is bounded in the 5' region by CpG islands, regions of DNA with a high GC content and a high frequency of CpG dinucleotides relative to the bulk genome. Furthermore, the human genome contains at least six copies of RIG pseudogenes, and four of them have the characteristics of processed pseudogenes. From these results together with the finding that RIG is expressed in a wide variety of tissues and cells, they speculate that RIG belongs to the class of housekeeping genes, whose products are necessary for the growth of all cell types

  10. GEI-8, a homologue of vertebrate nuclear receptor corepressor NCoR/SMRT, regulates gonad development and neuronal functions in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Pavol Mikoláš

    Full Text Available NCoR and SMRT are two paralogous vertebrate proteins that function as corepressors with unliganded nuclear receptors. Although C. elegans has a large number of nuclear receptors, orthologues of the corepressors NCoR and SMRT have not unambiguously been identified in Drosophila or C. elegans. Here, we identify GEI-8 as the closest homologue of NCoR and SMRT in C. elegans and demonstrate that GEI-8 is expressed as at least two isoforms throughout development in multiple tissues, including neurons, muscle and intestinal cells. We demonstrate that a homozygous deletion within the gei-8 coding region, which is predicted to encode a truncated protein lacking the predicted NR domain, results in severe mutant phenotypes with developmental defects, slow movement and growth, arrested gonadogenesis and defects in cholinergic neurotransmission. Whole genome expression analysis by microarrays identified sets of de-regulated genes consistent with both the observed mutant phenotypes and a role of GEI-8 in regulating transcription. Interestingly, the upregulated transcripts included a predicted mitochondrial sulfide:quinine reductase encoded by Y9C9A.16. This locus also contains non-coding, 21-U RNAs of the piRNA class. Inhibition of the expression of the region coding for 21-U RNAs leads to irregular gonadogenesis in the homozygous gei-8 mutants, but not in an otherwise wild-type background, suggesting that GEI-8 may function in concert with the 21-U RNAs to regulate gonadogenesis. Our results confirm that GEI-8 is the orthologue of the vertebrate NCoR/SMRT corepressors and demonstrate important roles for this putative transcriptional corepressor in development and neuronal function.

  11. MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

    Directory of Open Access Journals (Sweden)

    Hui Xu

    2010-11-01

    Full Text Available MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

  12. MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

    Science.gov (United States)

    Xu, Hui; Yan, Yaping; Williams, Mark S; Carey, Gregory B; Yang, Jingxian; Li, Hongmei; Zhang, Guang-Xian; Rostami, Abdolmohamad

    2010-11-01

    MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK) and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

  13. The human homologue of unc-93 maps to chromosome 6q27 – characterisation and analysis in sporadic epithelial ovarian cancer

    Directory of Open Access Journals (Sweden)

    Charnock F Mark L

    2002-10-01

    Full Text Available Abstract Background In sporadic ovarian cancer, we have previously reported allele loss at D6S193 (62% on chromosome 6q27, which suggested the presence of a putative tumour suppressor gene. Based on our data and that from another group, the minimal region of allele loss was between D6S264 and D6S149 (7.4 cM. To identify the putative tumour suppressor gene, we established a physical map initially with YACs and subsequently with PACs/BACs from D6S264 to D6S149. To accelerate the identification of genes, we sequenced the entire contig of approximately 1.1 Mb. Seven genes were identified within the region of allele loss between D6S264 and D6S149. Results The human homologue of unc-93 (UNC93A in C. elegans was identified to be within the interval of allele loss centromeric to D6S149. This gene is 24.5 kb and comprises of 8 exons. There are two transcripts with the shorter one due to splicing out of exon 4. It is expressed in testis, small intestine, spleen, prostate, and ovary. In a panel of 8 ovarian cancer cell lines, UNC93A expression was detected by RT-PCR which identified the two transcripts in 2/8 cell lines. The entire coding sequence was examined for mutations in a panel of ovarian tumours and ovarian cancer cell lines. Mutations were identified in exons 1, 3, 4, 5, 6 and 8. Only 3 mutations were identified specifically in the tumour. These included a c.452G>A (W151X mutation in exon 3, c.676C>T (R226X in exon 5 and c.1225G>A(V409I mutation in exon 8. However, the mutations in exon 3 and 5 were also present in 6% and 2% of the normal population respectively. The UNC93A cDNA was shown to express at the cell membrane and encodes for a protein of 60 kDa. Conclusions These results suggest that no evidence for UNC93A as a tumour suppressor gene in sporadic ovarian cancer has been identified and further research is required to evaluate its normal function and role in the pathogenesis of ovarian cancer.

  14. Plant 115-kDa actin-filament bundling protein, P-115-ABP, is a homologue of plant villin and is widely distributed in cells.

    Science.gov (United States)

    Yokota, Etsuo; Vidali, Luis; Tominaga, Motoki; Tahara, Hiroshi; Orii, Hidefumi; Morizane, Yosuke; Hepler, Peter K; Shimmen, Teruo

    2003-10-01

    In many cases, actin filaments are arranged into bundles and serve as tracks for cytoplasmic streaming in plant cells. We have isolated an actin-filament bundling protein, which is composed of 115-kDa polypeptide (P-115-ABP), from the germinating pollen of lily, Lilium longiflorum [Nakayasu et al. (1998) BIOCHEM: Biophys. Res. Commun. 249: 61]. P-115-ABP shared similar antigenicity with a plant 135-kDa actin-filament bundling protein (P-135-ABP), a plant homologue of villin. A full-length cDNA clone (ABP115; accession no. AB097407) was isolated from an expression cDNA library of lily pollen by immuno-screening using antisera against P-115-ABP and P-135-ABP. The amino acid sequence of P-115-ABP deduced from this clone showed high homology with those of P-135-ABP and four villin isoforms of Arabidopsis thaliana (AtVLN1, AtVLN2, AtVLN3 and AtVLN4), especially AtVLN4, indicating that P-115-ABP can also be classified as a plant villin. The P-115-ABP isolated biochemically from the germinating lily pollen was able to arrange F-actin filaments with uniform polarity into bundles and this bundling activity was suppressed by Ca2+-calmodulin (CaM), similar to the actin-filament bundling properties of P-135-ABP. The P-115-ABP type of plant villin was widely distributed in plant cells, from algae to land plants. In root hair cells of Hydrocharis dubia, this type of plant villin was co-localized with actin-filament bundles in the transvacuolar strands and the sub-cortical regions. Microinjection of the antiserum against P-115-ABP into living root hair cells caused the disappearance of transvaculor strands and alteration of the route of cytoplasmic streaming. In internodal cells of Chara corallina in which the P-135-ABP type of plant villin is lacking, the P-115-ABP type showed co-localization with actin-filament cables anchored on the intracellular surface of chloroplasts. These results indicated that plant villins are widely distributed and involved in the organization of actin

  15. Protein 4.1, a component of the erythrocyte membrane skeleton and its related homologue proteins forming the protein 4.1/FERM superfamily.

    Directory of Open Access Journals (Sweden)

    Aleksander F Sikorski

    2007-01-01

    Full Text Available The review is focused on the domain structure and function of protein 4.1, one of the proteins belonging to the membrane skeleton. The protein 4.1 of the red blood cells (4.1R is a multifunctional protein that localizes to the membrane skeleton and stabilizes erythrocyte shape and membrane mechanical properties, such as deformability and stability, via lateral interactions with spectrin, actin, glycophorin C and protein p55. Protein 4.1 binding is modulated through the action of kinases and/or calmodulin-Ca2+. Non-erythroid cells express the 4.1R homologues: 4.1G (general type, 4.1B (brain type, and 4.1N (neuron type, and the whole group belongs to the protein 4.1 superfamily, which is characterized by the presence of a highly conserved FERM domain at the N-terminus of the molecule. Proteins 4.1R, 4.1G, 4.1N and 4.1B are encoded by different genes. Most of the 4.1 superfamily proteins also contain an actin-binding domain. To date, more than 40 members have been identified. They can be divided into five groups: protein 4.1 molecules, ERM proteins, talin-related molecules, protein tyrosine phosphatase (PTPH proteins and NBL4 proteins. We have focused our attention on the main, well known representatives of 4.1 superfamily and tried to choose the proteins which are close to 4.1R or which have distinct functions. 4.1 family proteins are not just linkers between the plasma membrane and membrane skeleton; they also play an important role in various processes. Some, such as focal adhesion kinase (FAK, non-receptor tyrosine kinase that localizes to focal adhesions in adherent cells, play the role in cell adhesion. The other members control or take part in tumor suppression, regulation of cell cycle progression, inhibition of cell proliferation, downstream signaling of the glutamate receptors, and establishment of cell polarity; some are also involved in cell proliferation, cell motility, and/or cell-to-cell communication.

  16. Poly-dipeptides encoded by the C9orf72 repeats bind nucleoli, impede RNA biogenesis, and kill cells.

    Science.gov (United States)

    Kwon, Ilmin; Xiang, Siheng; Kato, Masato; Wu, Leeju; Theodoropoulos, Pano; Wang, Tao; Kim, Jiwoong; Yun, Jonghyun; Xie, Yang; McKnight, Steven L

    2014-09-05

    Many RNA regulatory proteins controlling pre-messenger RNA splicing contain serine:arginine (SR) repeats. Here, we found that these SR domains bound hydrogel droplets composed of fibrous polymers of the low-complexity domain of heterogeneous ribonucleoprotein A2 (hnRNPA2). Hydrogel binding was reversed upon phosphorylation of the SR domain by CDC2-like kinases 1 and 2 (CLK1/2). Mutated variants of the SR domains changing serine to glycine (SR-to-GR variants) also bound to hnRNPA2 hydrogels but were not affected by CLK1/2. When expressed in mammalian cells, these variants bound nucleoli. The translation products of the sense and antisense transcripts of the expansion repeats associated with the C9orf72 gene altered in neurodegenerative disease encode GRn and PRn repeat polypeptides. Both peptides bound to hnRNPA2 hydrogels independent of CLK1/2 activity. When applied to cultured cells, both peptides entered cells, migrated to the nucleus, bound nucleoli, and poisoned RNA biogenesis, which caused cell death. Copyright © 2014, American Association for the Advancement of Science.

  17. A pomegranate (Punica granatum L.) WD40-repeat gene is a functional homologue of Arabidopsis TTG1 and is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development.

    Science.gov (United States)

    Ben-Simhon, Zohar; Judeinstein, Sylvie; Nadler-Hassar, Talia; Trainin, Taly; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron

    2011-11-01

    Anthocyanins are the major pigments responsible for the pomegranate (Punica granatum L.) fruit skin color. The high variability in fruit external color in pomegranate cultivars reflects variations in anthocyanin composition. To identify genes involved in the regulation of anthocyanin biosynthesis pathway in the pomegranate fruit skin we have isolated, expressed and characterized the pomegranate homologue of the Arabidopsis thaliana TRANSPARENT TESTA GLABRA1 (TTG1), encoding a WD40-repeat protein. The TTG1 protein is a regulator of anthocyanins and proanthocyanidins (PAs) biosynthesis in Arabidopsis, and acts by the formation of a transcriptional regulatory complex with two other regulatory proteins: bHLH and MYB. Our results reveal that the pomegranate gene, designated PgWD40, recovered the anthocyanin, PAs, trichome and seed coat mucilage phenotype in Arabidopsis ttg1 mutant. PgWD40 expression and anthocyanin composition in the skin were analyzed during pomegranate fruit development, in two accessions that differ in skin color intensity and timing of appearance. The results indicate high positive correlation between the total cyanidin derivatives quantity (red pigments) and the expression level of PgWD40. Furthermore, strong correlation was found between the steady state levels of PgWD40 transcripts and the transcripts of pomegranate homologues of the structural genes PgDFR and PgLDOX. PgWD40, PgDFR and PgLDOX expression also correlated with the expression of pomegranate homologues of the regulatory genes PgAn1 (bHLH) and PgAn2 (MYB). On the basis of our results we propose that PgWD40 is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development and that expression of PgWD40, PgAn1 and PgAn2 in the pomegranate fruit skin is required to regulate the expression of downstream structural genes involved in the anthocyanin biosynthesis.

  18. Triiodothyronine radioimmunoassay. Comparison of the different factors between two technics

    International Nuclear Information System (INIS)

    Gehin-Fouque, F.; Etling, N.; Pradelles, P.; Bornet, H.

    1980-01-01

    Triiodothyronine concentration was determined in human serum and in thyroid extracts by two radioimmunoassay technics. Both antibodies, radioactive T 3 , stable T 3 , protein-binding-hormone inhibitors, methods used to separate the free from the bound fractions were different. Each factor from a method was substituted to the homologue of the other method. The results occasionnally showed a variation of 32% in the first method and 50% in the second one. However the results gave a correct interpretation of the triiodothyronine values measured in human serum and in thyroid extracts [fr

  19. 阴道毛滴虫Rac1蛋白的cDNA克隆和序列分析%Molecular Cloning and Characterization of a Rac1 Homologue cDNA from Trichomonas vaginalis

    Institute of Scientific and Technical Information of China (English)

    傅玉才; 章家新; 郑晓虹; 刘红

    2004-01-01

    Objective To clone and characterize a Racl homologue from Trichomonas vaginalis for studying cell cycle of the organism. Methods A cDNA library derived from T. vaginalis mRNA was constructed into λ TriplEx2 phage vector. An expression sequence tag program was launched. Sequences of cDNA clones were analyzed using NCBI BLAST algorithms, and ClustalW and Treeview programs. Results A cDNA clone with a length of 714 base pairs was isolated. The sequence analysis showed that the cDNA clone has an open reading frame with 600 bp. The deduced amino acid sequence from the open reading frame contains 200 residuals and is most homologous to Rac1 subfamily of Rho GTPases with > 60% identity. The conserved sequence elements of Rho GTPases, such as GTP-binding sites, GTPase-activating protein (GAP) interaction motifs, GTP-dissociation inhibitors (GDI) interaction motifs, guanine nucleotide exchange factor (GEF) interaction elements, etc, were detected in the amino acid sequence. The phylogenetic analysis showed that the cDNA clone is grouped in the Rac subfamily and is more closely related to Rac1 proteins of protozoa. Conclusion The cDNA clone isolated belongs to Rac subfamily of Rho GTPases and is probably a Rac1 protein of T. vaginalis.%目的获得阴道毛滴虫Rac1蛋白的cDNA克隆,研究其在细胞周期中的调解作用.方法提取阴道毛滴虫总RNA,构建cDNA表达文库,随机分离cDNA克隆并测序.用在线生物分析软件NCBI BLAST、ClustalW以及Treeview等程序进行序列分析.结果获得一株有714 bp的cDNA克隆.序列分析表明,该克隆开放阅读框具600 bp,推测肽链具200个氨基酸.该肽链与Rho家族中Rac1鸟苷三磷酸(GTP)酶同源性最高(>60%),并具多种Rho GTP酶的保守基序,如GTP结合部位、GTP酶激活蛋白作用基序、GTP分离抑制因子作用基序、鸟嘌呤核苷酸交换因子作用基序等.进化树分析显示该克隆属于Rac亚家族GTP酶,与原虫Rac1蛋白最接近.结论该克隆

  20. Profiling Antibody Responses to Infections by Chlamydia abortus Enables Identification of Potential Virulence Factors and Candidates for Serodiagnosis

    Science.gov (United States)

    Forsbach-Birk, Vera; Foddis, Corinna; Simnacher, Ulrike; Wilkat, Max; Longbottom, David; Walder, Gernot; Benesch, Christiane; Ganter, Martin; Sachse, Konrad; Essig, Andreas

    2013-01-01

    Enzootic abortion of ewes (EAE) due to infection with the obligate intracellular pathogen Chlamydia (C.) abortus is an important zoonosis leading to considerable economic loss to agriculture worldwide. The pathogen can be transmitted to humans and may lead to serious infection in pregnant women. Knowledge about epidemiology, clinical course and transmission to humans is hampered by the lack of reliable diagnostic tools. Immunoreactive proteins, which are expressed in infected animals and humans, may serve as novel candidates for diagnostic marker proteins and represent putative virulence factors. In order to broaden the spectrum of immunogenic C. abortus proteins we applied 2D immunoblot analysis and screening of an expression library using human and animal sera. We have identified 48 immunoreactive proteins representing potential diagnostic markers and also putative virulence factors, such as CAB080 (homologue of the “macrophage infectivity potentiator”, MIP), CAB167 (homologue of the “translocated actin recruitment protein”, TARP), CAB712 (homologue of the “chlamydial protease-like activity factor”, CPAF), CAB776 (homologue of the “Polymorphic membrane protein D”, PmpD), and the “hypothetical proteins” CAB063, CAB408 and CAB821, which are predicted to be type III secreted. We selected two putative virulence factors for further characterization, i.e. CAB080 (cMIP) and CAB063, and studied their expression profiles at transcript and protein levels. Analysis of the subcellular localization of both proteins throughout the developmental cycle revealed CAB063 being the first C. abortus protein shown to be translocated to the host cell nucleus. PMID:24260366

  1. Discovery of practical production processes for arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides: Beginning of a new era of “super-trifluoromethyl” arene chemistry and its industry

    Directory of Open Access Journals (Sweden)

    Teruo Umemoto

    2012-03-01

    Full Text Available Various arylsulfur pentafluorides, ArSF5, have long been desired in both academic and industrial areas, and ArSF5 compounds have attracted considerable interest in many areas such as medicines, agrochemicals, and other new materials, since the highly stable SF5 group is considered a “super-trifluoromethyl group” due to its significantly higher electronegativity and lipophilicity. This article describes the first practical method for the production of various arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides, from the corresponding diaryl disulfides or aryl thiols. The method consists of two steps: (Step 1 treatment of a diaryl disulfide or an aryl thiol with chlorine in the presence of an alkali metal fluoride, and (step 2 treatment of the resulting arylsulfur chlorotetrafluoride with a fluoride source, such as ZnF2, HF, and Sb(III/V fluorides. The intermediate arylsulfur chlorotetrafluorides were isolated by distillation or recrystallization and characterized. The aspects of these new reactions are revealed and reaction mechanisms are discussed. As the method offers considerable improvement over previous methods in cost, yield, practicality, applicability, and large-scale production, the new processes described here can be employed as the first practical methods for the economical production of various arylsulfur pentafluorides and their higher homologues, which could then open up a new era of “super-trifluoromethyl” arene chemistry and its applications in many areas.

  2. Divergent Small Tim Homologues Are Associated with TbTim17 and Critical for the Biogenesis of TbTim17 Protein Complexes in Trypanosoma brucei

    Science.gov (United States)

    Smith, Joseph T.; Singha, Ujjal K.; Misra, Smita

    2018-01-01

    ABSTRACT The small Tim proteins belong to a group of mitochondrial intermembrane space chaperones that aid in the import of mitochondrial inner membrane proteins with internal targeting signals. Trypanosoma brucei, the protozoan parasite that causes African trypanosomiasis, possesses multiple small Tim proteins that include homologues of T. brucei Tim9 (TbTim9) and Tim10 (TbTim10) and a unique small Tim that shares homology with both Tim8 and Tim13 (TbTim8/13). Here, we found that these three small TbTims are expressed as soluble mitochondrial intermembrane space proteins. Coimmunoprecipitation and mass spectrometry analysis showed that the small TbTims stably associated with each other and with TbTim17, the major component of the mitochondrial inner membrane translocase in T. brucei. Yeast two-hybrid analysis indicated direct interactions among the small TbTims; however, their interaction patterns appeared to be different from those of their counterparts in yeast and humans. Knockdown of the small TbTims reduced cell growth and decreased the steady-state level of TbTim17 and T. brucei ADP/ATP carrier (TbAAC), two polytopic mitochondrial inner membrane proteins. Knockdown of small TbTims also reduced the matured complexes of TbTim17 in mitochondria. Depletion of any of the small TbTims reduced TbTim17 import moderately but greatly hampered the stability of the TbTim17 complexes in T. brucei. Altogether, our results revealed that TbTim9, TbTim10, and TbTim8/13 interact with each other, associate with TbTim17, and play a crucial role in the integrity and maintenance of the levels of TbTim17 complexes. IMPORTANCE Trypanosoma brucei is the causative agent of African sleeping sickness. The parasite’s mitochondrion represents a useful source for potential chemotherapeutic targets. Similarly to yeast and humans, mitochondrial functions depend on the import of proteins that are encoded in the nucleus and made in the cytosol. Even though the machinery involved in this

  3. Novel nuclear-encoded proteins interacting with a plastid sigma factor, Sig1, in Arabidopsis thaliana.

    Science.gov (United States)

    Morikawa, Kazuya; Shiina, Takashi; Murakami, Shinya; Toyoshima, Yoshinori

    2002-03-13

    Sigma factor binding proteins are involved in modifying the promoter preferences of the RNA polymerase in bacteria. We found the nuclear encoded protein (SibI) that is transported into chloroplasts and interacts specifically with the region 4 of Sig1 in Arabidopsis. SibI and its homologue, T3K9.5 are novel proteins, which are not homologous to any protein of known function. The expression of sibI was tissue specific, light dependent, and developmentally timed. We suggest the transcriptional regulation by sigma factor binding proteins to function in the plastids of higher plant.

  4. CRP-ductin, the mouse homologue of gp-340/deleted in malignant brain tumors 1 (DMBT1), binds gram-positive and gram-negative bacteria and interacts with lung surfactant protein D

    DEFF Research Database (Denmark)

    Madsen, Jens; Tornøe, Ida; Nielsen, Ole

    2003-01-01

    CRP-ductin is a protein expressed mainly by mucosal epithelial cells in the mouse. Sequence homologies indicate that CRP-ductin is the mouse homologue of human gp-340, a glycoprotein that agglutinates microorganisms and binds the lung mucosal collectin surfactant protein-D (SP-D). Here we report...... that purified CRP-ductin binds human SP-D in a calcium-dependent manner and that the binding is not inhibited by maltose. The same properties have previously been observed for gp-340 binding of SP-D. CRP-ductin also showed calcium-dependent binding to both gram-positive and -negative bacteria. A polyclonal...... antibody raised against gp-340 reacted specifically with CRP-ductin in Western blots. Immunoreactivity to CRP-ductin was found in the exocrine pancreas, in epithelial cells throughout the gastrointestinal tract and in the parotid ducts. A panel of RNA preparations from mouse tissues was screened for CRP...

  5. SimCP3—An Advanced Homologue of SimCP2 as a Solution-Processed Small Molecular Host Material for Blue Phosphorescence Organic Light-Emitting Diodes

    Directory of Open Access Journals (Sweden)

    Yi-Ting Lee

    2016-09-01

    Full Text Available We have overcome the synthetic difficulty of 9,9′,9′′,9′′′,9′′′′,9′′′′′-((phenylsilanetriyltris(benzene-5,3,1-triylhexakis(9H-carbazole (SimCP3 an advanced homologue of previously known SimCP2 as a solution-processed, high triplet gap energy host material for a blue phosphorescence dopant. A series of organic light-emitting diodes based on blue phosphorescence dopant iridium (III bis(4,6-difluorophenylpyridinatopicolate, FIrpic, were fabricated and tested to demonstrate the validity of solution-processed SimCP3 in the device fabrication.

  6. Crystallization and preliminary X-ray diffraction studies of the ubiquitin-like (UbL) domain of the human homologue A of Rad23 (hHR23A) protein.

    Science.gov (United States)

    Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla

    2009-09-01

    Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.

  7. C7L family of poxvirus host range genes inhibits antiviral activities induced by type I interferons and interferon regulatory factor 1.

    Science.gov (United States)

    Meng, Xiangzhi; Schoggins, John; Rose, Lloyd; Cao, Jingxin; Ploss, Alexander; Rice, Charles M; Xiang, Yan

    2012-04-01

    Vaccinia virus (VACV) K1L and C7L function equivalently in many mammalian cells to support VACV replication and antagonize antiviral activities induced by type I interferons (IFNs). While K1L is limited to orthopoxviruses, genes that are homologous to C7L are found in diverse mammalian poxviruses. In this study, we showed that the C7L homologues from sheeppox virus and swinepox virus could rescue the replication defect of a VACV mutant deleted of both K1L and C7L (vK1L(-)C7L(-)). Interestingly, the sheeppox virus C7L homologue could rescue the replication of vK1L(-)C7L(-) in human HeLa cells but not in murine 3T3 and LA-4 cells, in contrast to all other C7L homologues. Replacing amino acids 134 and 135 of the sheeppox virus C7L homologue, however, made it functional in the two murine cell lines, suggesting that these two residues are critical for antagonizing a putative host restriction factor which has some subtle sequence variation in human and murine cells. Furthermore, the C7L family of host range genes from diverse mammalian poxviruses were all capable of antagonizing type I IFN-induced antiviral activities against VACV. Screening of a library of more than 350 IFN-stimulated genes (ISGs) identified interferon-regulated factor 1 (IRF1) as an inhibitor of vK1L(-)C7L(-) but not wild-type VACV. Expression of either K1L or C7L, however, rendered vK1L(-)C7L(-) resistant to IRF1-induced antiviral activities. Altogether, our data show that K1L and C7L antagonize IRF1-induced antiviral activities and that the host modulation function of C7L is evolutionally conserved in all poxviruses that can readily replicate in tissue-cultured mammalian cells.

  8. Splicing factor 1 modulates dietary restriction and TORC1 pathway longevity in C. elegans

    DEFF Research Database (Denmark)

    Heintz, Caroline; Doktor, Thomas K; Lanjuin, Anne

    2017-01-01

    via splicing factor 1 (SFA-1; the C. elegans homologue of SF1, also known as branchpoint binding protein, BBP). We show that SFA-1 is specifically required for lifespan extension by dietary restriction and by modulation of the TORC1 pathway components AMPK, RAGA-1 and RSKS-1/S6 kinase. We also...... homeostasis is a biomarker and predictor of life expectancy in Caenorhabditis elegans. Using transcriptomics and in-depth splicing analysis in young and old animals fed ad libitum or subjected to dietary restriction, we find defects in global pre-mRNA splicing with age that are reduced by dietary restriction...

  9. Pilot-plant cultivation of Streptomyces griseus producing homologues of nonactin by precursor-directed biosynthesis and their identification by LC/MS-ESI

    Czech Academy of Sciences Publication Activity Database

    Řezanka, Tomáš; Prell, Aleš; Spížek, Jaroslav; Sigler, Karel

    2010-01-01

    Roč. 63, č. 8 (2010), s. 524-529 ISSN 0021-8820 R&D Projects: GA MŠk 1M06011 Institutional research plan: CEZ:AV0Z50200510 Keywords : liquid chromatography/MS-ESI * pilot-plant cultivation * precursor-directed biosynthesis Subject RIV: EE - Microbiology, Virology Impact factor: 1.628, year: 2010

  10. Effect of network mesh size on the thermo-mechanical properties of epoxy nanocomposites with the heavier homologue of POSS, the inorganic butylstannoxane cages

    Czech Academy of Sciences Publication Activity Database

    Rodzen, Krzysztof; Strachota, Adam; Ribot, F.; Šlouf, Miroslav

    2014-01-01

    Roč. 57, August (2014), s. 169-181 ISSN 0014-3057 R&D Projects: GA ČR GAP108/11/2151 Institutional support: RVO:61389013 Keywords : nanocomposite * POSS * stannoxane Subject RIV: CD - Macromolecular Chemistry Impact factor: 3.005, year: 2014

  11. Proliferating cell nuclear antigen (PCNA) interacts with a meiosis-specific RecA homologues, Lim15/Dmc1, but does not stimulate its strand transfer activity

    International Nuclear Information System (INIS)

    Hamada, Fumika N.; Koshiyama, Akiyo; Namekawa, Satoshi H.; Ishii, Satomi; Iwabata, Kazuki; Sugawara, Hiroko; Nara, Takayuki Y.; Sakaguchi, Kengo; Sawado, Tomoyuki

    2007-01-01

    PCNA is a multi-functional protein that is involved in various nuclear events. Here we show that PCNA participates in events occurring during early meiotic prophase. Analysis of protein-protein interactions using surface plasmon resonance indicates that Coprinus cinereus PCNA (CoPCNA) specifically interacts with a meiotic specific RecA-like factor, C. cinereus Lim15/Dmc1 (CoLim15) in vitro. The binding efficiency increases with addition of Mg 2+ ions, while ATP inhibits the interaction. Co-immunoprecipitation experiments indicate that the CoLim15 protein interacts with the CoPCNA protein in vitro and in the cell extracts. Despite the interaction between these two factors, no enhancement of CoLim15-dependent strand transfer activity by CoPCNA was found in vitro. We propose that the interaction between Lim15/Dmc1 and PCNA mediates the recombination-associated DNA synthesis during meiosis

  12. Combination of Hypomorphic Mutations of the Drosophila Homologues of Aryl Hydrocarbon Receptor and Nucleosome Assembly Protein Family Genes Disrupts Morphogenesis, Memory and Detoxification

    OpenAIRE

    Kuzin, Boris A.; Nikitina, Ekaterina A.; Cherezov, Roman O.; Vorontsova, Julia E.; Slezinger, Mikhail S.; Zatsepina, Olga G.; Simonova, Olga B.; Enikolopov, Grigori N.; Savvateeva-Popova, Elena V.

    2014-01-01

    Aryl hydrocarbon receptor is essential for biological responses to endogenous and exogenous toxins in mammals. Its Drosophila homolog spineless plays an important role in fly morphogenesis. We have previously shown that during morphogenesis spineless genetically interacts with CG5017 gene, which encodes a nucleosome assembly factor and may affect cognitive function of the fly. We now demonstrate synergistic interactions of spineless and CG5017 in pathways controlling oxidative stress response...

  13. Pollination in Nicotiana alata stimulates synthesis and transfer to the stigmatic surface of NaStEP, a vacuolar Kunitz proteinase inhibitor homologue

    OpenAIRE

    Busot, Grethel Yanet; McClure, Bruce; Ibarra-S?nchez, Claudia Patricia; Jim?nez-Dur?n, Karina; V?zquez-Santana, Sonia; Cruz-Garc?a, Felipe

    2008-01-01

    After landing on a wet stigma, pollen grains hydrate and germination generally occurs. However, there is no certainty of the pollen tube growth through the style to reach the ovary. The pistil is a gatekeeper that evolved in many species to recognize and reject the self-pollen, avoiding endogamy and encouraging cross-pollination. However, recognition is a complex process, and specific factors are needed. Here the isolation and characterization of a stigma-specific protein from N. alata, NaStE...

  14. A STE12 homologue of the homothallic ascomycete Sordaria macrospora interacts with the MADS box protein MCM1 and is required for ascosporogenesis.

    Science.gov (United States)

    Nolting, Nicole; Pöggeler, Stefanie

    2006-11-01

    The MADS box protein MCM1 controls diverse developmental processes and is essential for fruiting body formation in the homothallic ascomycete Sordaria macrospora. MADS box proteins derive their regulatory specificity from a wide range of different protein interactions. We have recently shown that the S. macrospora MCM1 is able to interact with the alpha-domain mating-type protein SMTA-1. To further evaluate the functional roles of MCM1, we used the yeast two-hybrid approach to identify MCM1-interacting proteins. From this screen, we isolated a protein with a putative N-terminal homeodomain and C-terminal C2/H2-Zn2+ finger domains. The protein is a member of the highly conserved fungal STE12 transcription factor family of proteins and was therefore termed STE12. Furthermore, we demonstrate by means of two-hybrid and far western analysis that in addition to MCM1, the S. macrospora STE12 protein is able to interact with the mating-type protein SMTA-1. Unlike the situation in the closely related heterothallic ascomycete Neurospora crassa, deletion (Delta) of the ste12 gene in S. macrospora neither affects vegetative growth nor fruiting body formation. However, ascus and ascospore development are highly impaired by the Deltaste12 mutation. Our data provide another example of the functional divergence within the fungal STE12 transcription factor family.

  15. Aplasia Ras homologue member Ⅰ overexpression inhibits tumor growth and induces apoptosis through inhibition of PI3K/Akt survival pathways in human osteosarcoma MG-63 cells in culture.

    Science.gov (United States)

    Ye, Kaishan; Wang, Shuanke; Yang, Yong; Kang, Xuewen; Wang, Jing; Han, Hua

    2015-09-01

    Aplasia Ras homologue member Ⅰ (ARHI), an imprinted tumor-suppressor gene, is downregulated in various types of cancer. However, the expression, function and specific mechanisms of ARHI in human osteosarcoma (OS) cells remain unclear. The aim of the present study was to assess the effect of ARHI on OS cell proliferation and apoptosis and its associated mechanism. In the study, ARHI mRNA and protein levels were markedly downregulated in OS cells compared with the human osteoblast precursor cell line hFOB1.19. By generating stable transfectants, ARHI was overexpressed in OS cells that had low levels of ARHI. Overexpression of ARHI inhibited cell viability and proliferation and induced apoptosis. However, caspase‑3 activity was not changed by ARHI overexpression. In addition, phosphorylated Akt protein expression decreased in the ARHI overexpression group compared to that in the control vector group. The knockdown of ARHI also resulted in the promotion of cell proliferation and the attenuation of apoptosis in MG‑63 cells. Additionally, ARHI silencing increased the level of p‑Akt. The present results indicate that ARHI inhibits OS cell proliferation and may have a key role in the development of OS.

  16. Fisetin up-regulates the expression of adiponectin in 3T3-L1 adipocytes via the activation of silent mating type information regulation 2 homologue 1 (SIRT1)-deacetylase and peroxisome proliferator-activated receptors (PPARs).

    Science.gov (United States)

    Jin, Taewon; Kim, Oh Yoen; Shin, Min-Jeong; Choi, Eun Young; Lee, Sung Sook; Han, Ye Sun; Chung, Ji Hyung

    2014-10-29

    Adiponectin, an adipokine, has been described as showing physiological benefits against obesity-related malfunctions and vascular dysfunction. Several natural compounds that promote the expression and secretion of adipokines in adipocytes could be useful for treating metabolic disorders. This study investigated the effect of fisetin, a dietary flavonoid, on the regulation of adiponectin in adipocytes using 3T3-L1 preadipocytes. The expression and secretion of adiponectin increased in 3T3-L1 cells upon treatment with fisetin in a dose-dependent manner. Fisetin-induced adiponectin secretion was inhibited by peroxisome proliferator-activated receptor (PPAR) antagonists. It was also revealed that fisetin increased the activities of PPARs and silent mating type information regulation 2 homologue 1 (SIRT1) in a dose-dependent manner. Furthermore, the up-regulation of adiponectin and the activation of PPARs induced by fisetin were prevented by a SIRT1 inhibitor. Fisetin also promoted deacetylation of PPAR γ coactivator 1 (PGC-1) and its interaction with PPARs. SIRT knockdown by siRNA significantly decreased both adiponectin production and PPARs-PGC-1 interaction. These results provide evidence that fisetin promotes the gene expression of adiponectin through the activation of SIRT1 and PPARs in adipocytes.

  17. The Saccharomyces cerevisiae RAD30 gene, a homologue of Escherichia coli dinB and umuC, is DNA damage inducible and functions in a novel error-free postreplication repair mechanism

    Energy Technology Data Exchange (ETDEWEB)

    McDonald, J. P. [NIH, Bethesda, MD. (United States); Levine, A. S.; Woodgate, R.

    1997-12-15

    Damage-inducible mutagenesis in prokaryotes is largely dependent upon the activity of the UmuD'C-like proteins. Since many DNA repair processes are structurally and/or functionally conserved between prokaryotes and eukaryotes, we investigated the role of RAD30, a previously uncharacterized Saccharomyces cerevisiae DNA repair gene related to the Escherichia coli dinB, umuC and S. cerevisiae REV1 genes, in UV resistance and UV-induced mutagenesis. Similar to its prokaryotic homologues, RAD30 was found to be damage inducible. Like many S. cerevisiae genes involved in error-prone DNA repair, epistasis analysis clearly places RAD30 in the RAD6 group and rad30 mutants display moderate UV sensitivity reminiscent of rev mutants. However, unlike rev mutants, no defect in UV-induced reversion was seen in rad30 strains. While rad6 and rad18 are both epistatic to rad30, no epistasis was observed with rev1, rev3, rev7 or rad5, all of which are members of the RAD6 epistasis group. These findings suggest that RD30 participates in a novel error-free repair pathway dependent on RAD6 and RAD18, but independent of REV1, REV3, REV7 and RAD5. (author)

  18. Etude par génétique inverse du gène codant la protéine TARGET OF RAPAMYCIN d'Arabidopsis thaliana (AtTOR), l'homologue d'une kinase contrôlant la croissance cellulaire chez les eucaryotes

    OpenAIRE

    Menand, Benoit

    2002-01-01

    TOR (target of rapamycin) protein kinases were identified in yeast, mammals and Drosophila as central controllers of cell growth. Thu, G1 to S phases progression through the cell cycle is blocked by rapamycin, a drug which specifically inhibits TOR activity by forming a ternary complex with the peptidyl-prolyl isomerase FKBP12 (FK506 and rapamycin binding protein), and the FKBP-rapamycin binding domain (FRB) of TOR proteins. This work presents the study, the Arabidopsis homologue of yeast and...

  19. Combination of hypomorphic mutations of the Drosophila homologues of aryl hydrocarbon receptor and nucleosome assembly protein family genes disrupts morphogenesis, memory and detoxification.

    Science.gov (United States)

    Kuzin, Boris A; Nikitina, Ekaterina A; Cherezov, Roman O; Vorontsova, Julia E; Slezinger, Mikhail S; Zatsepina, Olga G; Simonova, Olga B; Enikolopov, Grigori N; Savvateeva-Popova, Elena V

    2014-01-01

    Aryl hydrocarbon receptor is essential for biological responses to endogenous and exogenous toxins in mammals. Its Drosophila homolog spineless plays an important role in fly morphogenesis. We have previously shown that during morphogenesis spineless genetically interacts with CG5017 gene, which encodes a nucleosome assembly factor and may affect cognitive function of the fly. We now demonstrate synergistic interactions of spineless and CG5017 in pathways controlling oxidative stress response and long-term memory formation in Drosophila melanogaster. Oxidative stress was induced by low doses of X-ray irradiation of flies carrying hypomorphic mutation of spineless, mutation of CG5017, and their combination. To determine the sensitivity of these mutants to pharmacological modifiers of the irradiation effect, we irradiated flies growing on standard medium supplemented by radiosensitizer furazidin and radioprotector serotonin. The effects of irradiation were investigated by analyzing leg and antenna morphological structures and by using real-time PCR to measure mRNA expression levels for spineless, Cyp6g1 and Gst-theta genes. We also examined long-term memory in these mutants using conditioned courtship suppression paradigm. Our results show that the interaction of spineless and CG5017 is important for regulation of morphogenesis, long-term memory formation, and detoxification during oxidative stress. Since spineless and CG5017 are evolutionary conserved, these results must be considered when evaluating the risk of combining similar mutations in other organisms, including humans.

  20. Combination of hypomorphic mutations of the Drosophila homologues of aryl hydrocarbon receptor and nucleosome assembly protein family genes disrupts morphogenesis, memory and detoxification.

    Directory of Open Access Journals (Sweden)

    Boris A Kuzin

    Full Text Available Aryl hydrocarbon receptor is essential for biological responses to endogenous and exogenous toxins in mammals. Its Drosophila homolog spineless plays an important role in fly morphogenesis. We have previously shown that during morphogenesis spineless genetically interacts with CG5017 gene, which encodes a nucleosome assembly factor and may affect cognitive function of the fly. We now demonstrate synergistic interactions of spineless and CG5017 in pathways controlling oxidative stress response and long-term memory formation in Drosophila melanogaster. Oxidative stress was induced by low doses of X-ray irradiation of flies carrying hypomorphic mutation of spineless, mutation of CG5017, and their combination. To determine the sensitivity of these mutants to pharmacological modifiers of the irradiation effect, we irradiated flies growing on standard medium supplemented by radiosensitizer furazidin and radioprotector serotonin. The effects of irradiation were investigated by analyzing leg and antenna morphological structures and by using real-time PCR to measure mRNA expression levels for spineless, Cyp6g1 and Gst-theta genes. We also examined long-term memory in these mutants using conditioned courtship suppression paradigm. Our results show that the interaction of spineless and CG5017 is important for regulation of morphogenesis, long-term memory formation, and detoxification during oxidative stress. Since spineless and CG5017 are evolutionary conserved, these results must be considered when evaluating the risk of combining similar mutations in other organisms, including humans.

  1. Mating type gene homologues and putative sex pheromone-sensing pathway in arbuscular mycorrhizal fungi, a presumably asexual plant root symbiont.

    Directory of Open Access Journals (Sweden)

    Sébastien Halary

    Full Text Available The fungal kingdom displays a fascinating diversity of sex-determination systems. Recent advances in genomics provide insights into the molecular mechanisms of sex, mating type determination, and evolution of sexual reproduction in many fungal species in both ancient and modern phylogenetic lineages. All major fungal groups have evolved sexual differentiation and recombination pathways. However, sexuality is unknown in arbuscular mycorrhizal fungi (AMF of the phylum Glomeromycota, an ecologically vital group of obligate plant root symbionts. AMF are commonly considered an ancient asexual lineage dating back to the Ordovician, approximately 460 M years ago. In this study, we used genomic and transcriptomic surveys of several AMF species to demonstrate the presence of conserved putative sex pheromone-sensing mitogen-activated protein (MAP kinases, comparable to those described in Ascomycota and Basidiomycota. We also find genes for high mobility group (HMG transcription factors, homologous to SexM and SexP genes in the Mucorales. The SexM genes show a remarkable sequence diversity among multiple copies in the genome, while only a single SexP sequence was detected in some isolates of Rhizophagus irregularis. In the Mucorales and Microsporidia, the sexM gene is flanked by genes for a triosephosphate transporter (TPT and a RNA helicase, but we find no evidence for synteny in the vicinity of the Sex locus in AMF. Nonetheless, our results, together with previous observations on meiotic machinery, suggest that AMF could undergo a complete sexual reproduction cycle.

  2. The Hv NAC6 transcription factor: a positive regulator of penetration resistance in barley and Arabidopsis

    DEFF Research Database (Denmark)

    Jensen, Michael Krogh; Rung, Jesper Henrik; Gregersen, Per Langkjaer

    2007-01-01

    Pathogens induce the expression of many genes encoding plant transcription factors, though specific knowledge of the biological function of individual transcription factors remains scarce. NAC transcription factors are encoded in plants by a gene family with proposed functions in both abiotic...... and biotic stress adaptation, as well as in developmental processes. In this paper, we provide convincing evidence that a barley NAC transcription factor has a direct role in regulating basal defence. The gene transcript was isolated by differential display from barley leaves infected with the biotrophic...... powdery mildew fungus, Blumeria graminis f.sp. hordei (Bgh). The full-length cDNA clone was obtained using 5'-RACE and termed HvNAC6, due to its high similarity to the rice homologue, OsNAC6. Gene silencing of HvNAC6 during Bgh inoculation compromises penetration resistance in barley epidermal cells...

  3. A soluble RecN homologue provides means for biochemical and genetic analysis of DNA double-strand break repair in Escherichia coli.

    Science.gov (United States)

    Grove, Jane I; Wood, Stuart R; Briggs, Geoffrey S; Oldham, Neil J; Lloyd, Robert G

    2009-12-03

    RecN is a highly conserved, SMC-like protein in bacteria. It plays an important role in the repair of DNA double-strand breaks and is therefore a key factor in maintaining genome integrity. The insolubility of Escherichia coli RecN has limited efforts to unravel its function. We overcame this limitation by replacing the resident coding sequence with that of Haemophilus influenzae RecN. The heterologous construct expresses Haemophilus RecN from the SOS-inducible E. coli promoter. The hybrid gene is fully functional, promoting survival after I-SceI induced DNA breakage, gamma irradiation or exposure to mitomycin C as effectively as the native gene, indicating that the repair activity is conserved between these two species. H. influenzae RecN is quite soluble, even when expressed at high levels, and is readily purified. Its analysis by ionisation-mass spectrometry, gel filtration and glutaraldehyde crosslinking indicates that it is probably a dimer under physiological conditions, although a higher multimer cannot be excluded. The purified protein displays a weak ATPase activity that is essential for its DNA repair function in vivo. However, no DNA-binding activity was detected, which contrasts with RecN from Bacillus subtilis. RecN proteins from Aquifex aeolicus and Bacteriodes fragilis also proved soluble. Neither binds DNA, but the Aquifex RecN has weak ATPase activity. Our findings support studies indicating that RecN, and the SOS response in general, behave differently in E. coli and B. subtilis. The hybrid recN reported provides new opportunities to study the genetics and biochemistry of how RecN operates in E. coli.

  4. Pollination in Nicotiana alata stimulates synthesis and transfer to the stigmatic surface of NaStEP, a vacuolar Kunitz proteinase inhibitor homologue.

    Science.gov (United States)

    Busot, Grethel Yanet; McClure, Bruce; Ibarra-Sánchez, Claudia Patricia; Jiménez-Durán, Karina; Vázquez-Santana, Sonia; Cruz-García, Felipe

    2008-01-01

    After landing on a wet stigma, pollen grains hydrate and germination generally occurs. However, there is no certainty of the pollen tube growth through the style to reach the ovary. The pistil is a gatekeeper that evolved in many species to recognize and reject the self-pollen, avoiding endogamy and encouraging cross-pollination. However, recognition is a complex process, and specific factors are needed. Here the isolation and characterization of a stigma-specific protein from N. alata, NaStEP (N. alata Stigma Expressed Protein), that is homologous to Kunitz-type proteinase inhibitors, are reported. Activity gel assays showed that NaStEP is not a functional serine proteinase inhibitor. Immunohistochemical and protein blot analyses revealed that NaStEP is detectable in stigmas of self-incompatible (SI) species N. alata, N. forgetiana, and N. bonariensis, but not in self-compatible (SC) species N. tabacum, N. plumbaginifolia, N. benthamiana, N. longiflora, and N. glauca. NaStEP contains the vacuolar targeting sequence NPIVL, and immunocytochemistry experiments showed vacuolar localization in unpollinated stigmas. After self-pollination or pollination with pollen from the SC species N. tabacum or N. plumbaginifolia, NaStEP was also found in the stigmatic exudate. The synthesis and presence in the stigmatic exudate of this protein was strongly induced in N. alata following incompatible pollination with N. tabacum pollen. The transfer of NaStEP to the stigmatic exudate was accompanied by perforation of the stigmatic cell wall, which appeared to release the vacuolar contents to the apoplastic space. The increase in NaStEP synthesis after pollination and its presence in the stigmatic exudates suggest that this protein may play a role in the early pollen-stigma interactions that regulate pollen tube growth in Nicotiana.

  5. Plasmodium falciparum Hsp70-z, an Hsp110 homologue, exhibits independent chaperone activity and interacts with Hsp70-1 in a nucleotide-dependent fashion.

    Science.gov (United States)

    Zininga, Tawanda; Achilonu, Ikechukwu; Hoppe, Heinrich; Prinsloo, Earl; Dirr, Heini W; Shonhai, Addmore

    2016-05-01

    The role of molecular chaperones, among them heat shock proteins (Hsps), in the development of malaria parasites has been well documented. Hsp70s are molecular chaperones that facilitate protein folding. Hsp70 proteins are composed of an N-terminal nucleotide binding domain (NBD), which confers them with ATPase activity and a C-terminal substrate binding domain (SBD). In the ADP-bound state, Hsp70 possesses high affinity for substrate and releases the folded substrate when it is bound to ATP. The two domains are connected by a conserved linker segment. Hsp110 proteins possess an extended lid segment, a feature that distinguishes them from canonical Hsp70s. Plasmodium falciparum Hsp70-z (PfHsp70-z) is a member of the Hsp110 family of Hsp70-like proteins. PfHsp70-z is essential for survival of malaria parasites and is thought to play an important role as a molecular chaperone and nucleotide exchange factor of its cytosolic canonical Hsp70 counterpart, PfHsp70-1. Unlike PfHsp70-1 whose functions are fairly well established, the structure-function features of PfHsp70-z remain to be fully elucidated. In the current study, we established that PfHsp70-z possesses independent chaperone activity. In fact, PfHsp70-z appears to be marginally more effective in suppressing protein aggregation than its cytosol-localized partner, PfHsp70-1. Furthermore, based on coimmunoaffinity chromatography and surface plasmon resonance analyses, PfHsp70-z associated with PfHsp70-1 in a nucleotide-dependent fashion. Our findings suggest that besides serving as a molecular chaperone, PfHsp70-z could facilitate the nucleotide exchange function of PfHsp70-1. These dual functions explain why it is essential for parasite survival.

  6. Duplication in the microtubule-actin cross-linking factor 1 gene causes a novel neuromuscular condition

    DEFF Research Database (Denmark)

    Jørgensen, Louise H; Mosbech, Mai-Britt; Færgeman, Nils J

    2014-01-01

    Spectrins and plakins are important communicators linking cytoskeletal components to each other and to cellular junctions. Microtubule-actin cross-linking factor 1 (MACF1) belongs to the spectraplakin family and is involved in control of microtubule dynamics. Complete knock out of MACF1 in mice...... muscles and diminished motor skills, with heterogeneous presentation among the affected family members. To corroborate these findings we used RNA interference to knock down the VAB-10 locus containing the MACF1 homologue in C. elegans, and we could show that this also causes movement disturbances...

  7. A lumpy skin disease virus deficient of an IL-10 gene homologue provides protective immunity against virulent capripoxvirus challenge in sheep and goats.

    Science.gov (United States)

    Boshra, Hani; Truong, Thang; Nfon, Charles; Bowden, Timothy R; Gerdts, Volker; Tikoo, Suresh; Babiuk, Lorne A; Kara, Pravesh; Mather, Arshad; Wallace, David B; Babiuk, Shawn

    2015-11-01

    Sheep and goat pox continue to be important livestock diseases that pose a major threat to the livestock industry in many regions in Africa and Asia. Currently, several live attenuated vaccines are available and used in endemic countries to control these diseases. One of these is a partially attenuated strain of lumpy skin disease virus (LSDV), KS-1, which provides cross-protection against both sheep pox and goat pox. However, when used in highly stressed dairy cattle to protect against lumpy skin disease (LSD) the vaccine can cause clinical disease. In order to develop safer vaccines effective against all three diseases, a pathogenic strain of LSDV (Warmbaths [WB], South Africa) was attenuated by removing a putative virulence factor gene (IL-10-like) using gene knockout (KO) technology. This construct (LSDV WB005KO) was then evaluated as a vaccine for sheep and goats against virulent capripoxvirus challenge. Sheep and goats were vaccinated with the construct and the animals were observed for 21days. The vaccine appeared to be safe, and did not cause disease, although it induced minor inflammation at the injection site similar to that caused by other attenuated sheep and goat pox vaccines. In addition, no virus replication was detected in blood, oral or nasal swabs using real-time PCR following vaccination and low levels of neutralising antibodies were detected in both sheep and goats. Leukocytes isolated from vaccinated animals following vaccination elicited capripoxvirus-specific IFN-γ secretion, suggesting that immunity was also T-cell mediated. Following challenge with virulent capripoxvirus, vaccinated sheep and goats were found to be completely protected and exhibited no clinical disease. Furthermore, real-time PCR of blood samples at various time points suggested that viremia was absent in both groups of vaccinated animals, as opposed to capripoxvirus-related clinical disease and viremia observed in the unvaccinated animals. These findings suggest that this

  8. Molecular and functional characterization of a human ATM gene analogue at Arabidopsis thaliana; Caracterisation moleculaire et Fonctionnelle d'un Homologue du gene humain ATM chez Arabidopsis thaliana

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, V.

    2001-12-15

    The human ATM gene, whose inactivation is responsible for the human disease ataxia telangiectasia is conserved throughout the Eukaryotes and plays an important role in the cellular responses to DNA damage, in particular to DNA double-strand breaks (DSBs). Here we describe the identification of an Arabidopsis thaliana homologue of ATM (AtATM), and the molecular and cytological characterization of plants, hereafter called atm, carrying a disrupting T-DNA insertion in this gene. AtATM covers a 32 kb region on chromosome 3. The AtATM transcript has a complex structure, is 12 kb long and formed by 79 exons. The transcriptional level of AtATM is very low in all the tissues tested, and does not vary after exposure to ionizing radiations (IR). In atm plants, the protein is not detected suggesting the mutants are null. The atm mutants are partially sterile. Aberrant segregation of chromosomes during meiosis I on both male and female sides account for this sterility. However, meiotic recombination frequency is normal. Mutant plants are also hypersensitive to gamma rays and methyl methane sulfonate, but not to UV-B, pointing to a specific defect of atm mutants in the response to DNA DSBs. In plants, ionizing radiations induce a strong, rapid and transient transcriptional activation of genes involved in the cellular response to or the repair of DSBs. This transcriptional regulation of AtRAD51, AtPARP1, atGR1 and AtL1G4 is lost in the atm mutants . The absence of AtRAD51 induction associated with ionizing radiation sensitivity suggest that AtAtm play an important function in DSB repair by homologous recombination. In addition we show that homologous intra-chromosomal recombination frequency is elevated in the mutant comparing to wild-type, with or without gamma irradiation. These results show the implication of AtAtm in the genomic stability. (author)

  9. Bombyx mori nucleopolyhedrovirus nucleic acid binding proteins BRO-B and BRO-E associate with host T-cell intracellular antigen 1 homologue BmTRN-1 to influence protein synthesis during infection.

    Science.gov (United States)

    Kotani, Eiji; Muto, Sayaka; Ijiri, Hiroshi; Mori, Hajime

    2015-07-01

    Previous reports have indicated that the Bombyx mori nucleopolyhedrovirus (BmNPV) nucleic acid binding proteins BRO-B and BRO-E are expressed during the early stage of infection and that the BRO family likely supports the regulation of mRNA; however, no study has directly examined the function of BRO family proteins in virus-permissive cells. Here, we show that BRO-B and BRO-E associate with cellular T-cell intracellular antigen 1 homologue (BmTRN-1), a translational regulator, and other cellular translation-related proteins in silkworm cells during viral infection. We created BM-N cells that expressed BRO-B/E to study molecular interactions between BmTRN-1 and BRO-B/E and how they influenced protein synthesis. Fluorescent microscopy revealed that BmTRN-1 was localized in cytoplasmic foci during BmNPV infection. Immunofluorescence studies confirmed that BmTRN-1 and BRO-B/E were colocalized in the amorphous conspicuous cytoplasmic foci. Reporter gene studies revealed that co-expression of BRO-B/E synergistically led to a significant decrease in protein synthesis from a designed transcript carrying the 5'untranslated region of a cellular mRNA with no significant change of transcript abundance. Additionally, RNA interference-mediated knockdown of BmTRN-1 resulted in a marked inhibition of the ability of BRO-B/E to regulate the transcript. These results suggested that the association of BmTRN-1 with BRO-B/E is responsible for the inhibitory regulation of certain mRNAs at the post-transcriptional level and add an additional mechanism for how baculoviruses control protein synthesis during infection.

  10. The SANT2 domain of the murine tumor cell DnaJ-like protein 1 human homologue interacts with alpha1-antichymotrypsin and kinetically interferes with its serpin inhibitory activity.

    Science.gov (United States)

    Kroczynska, Barbara; Evangelista, Christina M; Samant, Shalaka S; Elguindi, Ebrahim C; Blond, Sylvie Y

    2004-03-19

    The murine tumor cell DnaJ-like protein 1 or MTJ1/ERdj1 is a membrane J-domain protein enriched in microsomal and nuclear fractions. We previously showed that its lumenal J-domain stimulates the ATPase activity of the molecular chaperone BiP/GRP78 (Chevalier, M., Rhee, H., Elguindi, E. C., and Blond, S. Y. (2000) J. Biol. Chem. 275, 19620-19627). MTJ1/ERdj1 also contains a large carboxyl-terminal cytosolic extension composed of two tryptophan-mediated repeats or SANT domains for which the function(s) is unknown. Here we describe the cloning of the human homologue HTJ1 and its interaction with alpha(1)-antichymotrypsin (ACT), a member of the serine proteinase inhibitor (serpin) family. The interaction was initially identified in a two-hybrid screening and further confirmed in vitro by dot blots, native electrophoresis, and fluorescence studies. The second SANT domain of HTJ1 (SANT2) was found to be sufficient for binding to ACT, both in yeast and in vitro. Single tryptophan-alanine substitutions at two strictly conserved residues significantly (Trp-497) or totally (Trp-520) abolished the interaction with ACT. SANT2 binds to human ACT with an intrinsic affinity equal to 0.5 nm. Preincubation of ACT with nearly stoichiometric concentrations of SANT2 wild-type but not SANT2: W520A results in an apparent loss of ACT inhibitory activity toward chymotrypsin. Kinetic analysis indicates that the formation of the covalent inhibitory complex ACT-chymotrypsin is significantly delayed in the presence of SANT2 with no change on the catalytic efficiency of the enzyme. This work demonstrates for the first time that the SANT2 domain of MTJ1/HTJ1/ERdj1 mediates stable and high affinity protein-protein interactions.

  11. Nicolas Sarkozy a recu son homologue estonien

    Index Scriptorium Estoniae

    2008-01-01

    Prantsusmaa president Nicolas Sarkozy pakkus 7. aprillil 2008 Elysée palees kohtumisel president Toomas Hendrik Ilvesega Eestile Prantsusmaa abi tuumaenergeetika küsimustes. Vabariigi President töövisiidil Pariisis 6.-8.04.2008

  12. The Zygosaccharomyces bailii transcription factor Haa1 is required for acetic acid and copper stress responses suggesting subfunctionalization of the ancestral bifunctional protein Haa1/Cup2.

    Science.gov (United States)

    Palma, Margarida; Dias, Paulo Jorge; Roque, Filipa de Canaveira; Luzia, Laura; Guerreiro, Joana Fernandes; Sá-Correia, Isabel

    2017-01-13

    The food spoilage yeast species Zygosaccharomyces bailii exhibits an extraordinary capacity to tolerate weak acids, in particular acetic acid. In Saccharomyces cerevisiae, the transcription factor Haa1 (ScHaa1) is considered the main player in genomic expression reprogramming in response to acetic acid stress, but the role of its homologue in Z. bailii (ZbHaa1) is unknown. In this study it is demonstrated that ZbHaa1 is a ScHaa1 functional homologue by rescuing the acetic acid susceptibility phenotype of S. cerevisiae haa1Δ. The disruption of ZbHAA1 in Z. bailii IST302 and the expression of an extra ZbHAA1 copy confirmed ZbHAA1 as a determinant of acetic acid tolerance. ZbHaa1 was found to be required for acetic acid stress-induced transcriptional activation of Z. bailii genes homologous to ScHaa1-target genes. An evolutionary analysis of the Haa1 homologues identified in 28 Saccharomycetaceae species genome sequences, including Z bailii, was carried out using phylogenetic and gene neighbourhood approaches. Consistent with previous studies, this analysis revealed a group containing pre-whole genome duplication species Haa1/Cup2 single orthologues, including ZbHaa1, and two groups containing either Haa1 or Cup2 orthologues from post-whole genome duplication species. S. cerevisiae Cup2 (alias Ace1) is a transcription factor involved in response and tolerance to copper stress. Taken together, these observations led us to hypothesize and demonstrate that ZbHaa1 is also involved in copper-induced transcriptional regulation and copper tolerance. The transcription factor ZbHaa1 is required for adaptive response and tolerance to both acetic acid and copper stresses. The subfunctionalization of the single ancestral Haa1/Cup2 orthologue that originated Haa1 and Cup2 paralogues after whole genome duplication is proposed.

  13. Functional characterization of viral tumor necrosis factor receptors encoded by cyprinid herpesvirus 3 (CyHV3) genome.

    Science.gov (United States)

    Yi, Yang; Qi, Hemei; Yuan, Jimin; Wang, Rui; Weng, Shaoping; He, Jianguo; Dong, Chuanfu

    2015-08-01

    Cyprinid herpesvirus 3 (CyHV3) is a large double-stranded DNA virus of Alloherpesviridae family in the order Herpesvirales. It causes significant morbidity and mortality in common carp and its ornamental koi variety, and threatens the aquaculture industries worldwide. Mimicry of cytokines and cytokine receptors is a particular strategy for large DNA viruses in modulating the host immune response. Here, we report the identification and characterization of two novel viral homologues of tumor necrosis factor receptor (TNFR) encoded by CyHV3-ORF4 and -ORF12, respectively. CyHV3-ORF4 was identified as a homologue of HVEM and CyHV3-ORF12 as a homologue of TNFRSF1. Overexpression of ORF4 and ORF12 in zebrafish embryos results in embryonic lethality, morphological defects and increased apoptosis. Although we failed to identify any interaction between the two vTNFRs and their potential ligands in zebrafish TNF superfamily by yeast two-hybrid system, the expression of some genes in TNF superfamily or TNFR superfamily were mis-regulated in ORF4 or ORF12-overexpressing embryos, especially the death receptor zHDR and its cognate ligand DL1b. Further studies showed that the apoptosis induced by the both CyHV3 vTNFRs is mainly activated through the intrinsic apoptotic pathway and requires the crosstalk between the intrinsic and extrinsic apoptotic pathway. Additionally, using RT-qPCR and Western blot assays, the expression patterns of the both vTNFRs were also analyzed during CyHV3 productive infection. Collectively, this is the first functional study of two unique vTNFRs encoded by a herpesvirus infecting non-mammalian vertebrates, which may provide novel insights into viral immune regulation mechanism and the pathogenesis of CyHV3 infection. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Risk Factors

    Science.gov (United States)

    ... cells do not invade nearby tissues or spread. Risk Factors Key Points Factors That are Known to ... chemicals . Factors That are Known to Increase the Risk of Cancer Cigarette Smoking and Tobacco Use Tobacco ...

  15. Factor requirements for transcription in the Archaeon Sulfolobus shibatae.

    Science.gov (United States)

    Qureshi, S A; Bell, S D; Jackson, S P

    1997-05-15

    Archaea (archaebacteria) constitute a domain of life that is distinct from Bacteria (eubacteria) and Eucarya (eukaryotes). Although archaeal cells share many morphological features with eubacteria, their transcriptional apparatus is more akin to eukaryotic RNA polymerases I, II and III than it is to eubacterial transcription systems. Thus, in addition to possessing a 10 subunit RNA polymerase and a homologue of the TATA-binding protein (TBP), Archaea possess a polypeptide termed TFB that is homologous to eukaryotic TFIIB. Here, we investigate the factor requirements for transcription of several promoters of the archaeon Sulfolobus shibatae and its associated virus SSV. Through in vitro transcription and immunodepletion, we demonstrate that S. shibatae TBP, TFB and RNA polymerase are not complexed tightly with one another and that each is required for efficient transcription of all promoters tested. Furthermore, full transcription is restored by supplementing respective depleted extracts with recombinant TBP or TFB, indicating that TBP-associated factors or TFB-associated factors are not required. Indeed, gel-filtration suggests that Sulfolobus TBP and TFB are not associated stably with other proteins. Finally, all promoters analysed are transcribed accurately and efficiently in an in vitro system comprising recombinant TBP and TFB, together with essentially homogeneous preparation of RNA polymerase. Transcription in Archaea is therefore fundamentally homologous to that in eukaryotes, although factor requirements appear to be much less complex.

  16. Factor XII (Hageman factor) deficiency

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000545.htm Factor XII (Hageman factor) deficiency To use the sharing features on this ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  17. Differential evolution of antiretroviral restriction factors in pteropid bats as revealed by APOBEC3 gene complexity.

    Science.gov (United States)

    Hayward, Joshua A; Tachedjian, Mary; Cui, Jie; Cheng, Adam Z; Johnson, Adam; Baker, Michelle; Harris, Reuben S; Wang, Lin-Fa; Tachedjian, Gilda

    2018-03-29

    Bats have attracted attention in recent years as important reservoirs of viruses deadly to humans and other mammals. These infections are typically nonpathogenic in bats raising questions about innate immune differences that might exist between bats and other mammals. The APOBEC3 gene family encodes antiviral DNA cytosine deaminases with important roles in the suppression of diverse viruses and genomic parasites. Here we characterize pteropid APOBEC3 genes and show that species within the genus Pteropus possess the largest and most diverse array of APOBEC3 genes identified in any mammal reported to date. Several bat APOBEC3 proteins are antiviral as demonstrated by restriction of retroviral infectivity using HIV-1 as a model, and recombinant A3Z1 subtypes possess strong DNA deaminase activity. These genes represent the first group of antiviral restriction factors identified in bats with extensive diversification relative to homologues in other mammals.

  18. Resveratrol Reactivates Latent HIV through Increasing Histone Acetylation and Activating Heat Shock Factor 1.

    Science.gov (United States)

    Zeng, Xiaoyun; Pan, Xiaoyan; Xu, Xinfeng; Lin, Jian; Que, Fuchang; Tian, Yuanxin; Li, Lin; Liu, Shuwen

    2017-06-07

    The persistence of latent HIV reservoirs presents a significant challenge to viral eradication. Effective latency reversing agents (LRAs) based on "shock and kill" strategy are urgently needed. The natural phytoalexin resveratrol has been demonstrated to enhance HIV gene expression, although its mechanism remains unclear. In this study, we demonstrated that resveratrol was able to reactivate latent HIV without global T cell activation in vitro. Mode of action studies showed resveratrol-mediated reactivation from latency did not involve the activation of silent mating type information regulation 2 homologue 1 (SIRT1), which belonged to class-3 histone deacetylase (HDAC). However, latent HIV was reactivated by resveratrol mediated through increasing histone acetylation and activation of heat shock factor 1 (HSF1). Additionally, synergistic activation of the latent HIV reservoirs was observed under cotreatment with resveratrol and conventional LRAs. Collectively, this research reveals that resveratrol is a natural LRA and shows promise for HIV therapy.

  19. Substrate recognition by complement convertases revealed in the C5-cobra venom factor complex

    DEFF Research Database (Denmark)

    Laursen, Nick Stub; Andersen, Kasper Røjkjær; Braren, Ingke

    2011-01-01

    with a protease subunit (Bb or C2a). We determined the crystal structures of the C3b homologue cobra venom factor (CVF) in complex with C5, and in complex with C5 and the inhibitor SSL7 at 4.3 Å resolution. The structures reveal a parallel two-point attachment between C5 and CVF, where the presence of SSL7 only...... slightly affects the C5-CVF interface, explaining the IgA dependence for SSL7-mediated inhibition of C5 cleavage. CVF functions as a relatively rigid binding scaffold inducing a conformational change in C5, which positions its cleavage site in proximity to the serine protease Bb. A general model...

  20. Differential Rac1 signalling by guanine nucleotide exchange factors implicates FLII in regulating Rac1-driven cell migration

    Science.gov (United States)

    Marei, Hadir; Carpy, Alejandro; Woroniuk, Anna; Vennin, Claire; White, Gavin; Timpson, Paul; Macek, Boris; Malliri, Angeliki

    2016-01-01

    The small GTPase Rac1 has been implicated in the formation and dissemination of tumours. Upon activation by guanine nucleotide exchange factors (GEFs), Rac1 associates with a variety of proteins in the cell thereby regulating various functions, including cell migration. However, activation of Rac1 can lead to opposing migratory phenotypes raising the possibility of exacerbating tumour progression when targeting Rac1 in a clinical setting. This calls for the identification of factors that influence Rac1-driven cell motility. Here we show that Tiam1 and P-Rex1, two Rac GEFs, promote Rac1 anti- and pro-migratory signalling cascades, respectively, through regulating the Rac1 interactome. In particular, we demonstrate that P-Rex1 stimulates migration through enhancing the interaction between Rac1 and the actin-remodelling protein flightless-1 homologue, to modulate cell contraction in a RhoA-ROCK-independent manner. PMID:26887924

  1. Robust factorization

    DEFF Research Database (Denmark)

    Aanæs, Henrik; Fisker, Rune; Åström, Kalle

    2002-01-01

    Factorization algorithms for recovering structure and motion from an image stream have many advantages, but they usually require a set of well-tracked features. Such a set is in generally not available in practical applications. There is thus a need for making factorization algorithms deal effect...

  2. Organizational factors

    International Nuclear Information System (INIS)

    Holy, J.

    1999-12-01

    The following organizational factors are considered with respect to the human factor and operating safety of nuclear power plants: external influences; objectives and strategy; positions and ways of management; allocation of resources; working with human resources; operators' training; coordination of work; knowledge of organization and management; proceduralization of the topic; labour organizing culture; self-improvement system; and communication. (P.A.)

  3. El factoring

    Directory of Open Access Journals (Sweden)

    Alberto Rosenthal

    1988-04-01

    Full Text Available RESUMEN El artículo  presenta, una conceptualización general de lo que es el factoring, el origen del mismo, su evolución y hace una clasificación de los distintos tipos de factoring.

  4. El factoring

    Directory of Open Access Journals (Sweden)

    Alberto Rosenthal

    2015-04-01

    Full Text Available RESUMEN Se presenta la segunda parte del artículo aparecido en  el número 6 de la revista EAN. Su contenido es complementario a lo expuesto en dicho número, en está aparecen las ventajas del factoring, conveniencias, limitaciones así como la forma  de efectuar un factor en Colombia,  su necesidad, incidencia económica, etc.

  5. Quality factors

    International Nuclear Information System (INIS)

    Kerr, G.D.

    1986-01-01

    The quality factor, Q, is a dimensionless modifier used in converting absorbed dose, expressed in rads (or grays), to dose equivalent, expressed in rems (or seiverts). The dose equivalent is used in radiation protection to account for the biological effectiveness of different kinds of radiation. The quality factor is related to both the linear energy transfer (LET) and relative biological effectiveness (RBE). The RBE's obtained from biological experiments depend in a complex way on the observed biological effect, the specific test organism, and the experimental conditions. Judgement is involved, therefore, in the choice of the quality factor. Questions regarding the adequacy of current Q values for neutrons were raised first in a 1980 statement by the National Council on Radiation Protection (NCRP) and later in a 1985 statement by the International Commission on Radiological Protection (ICRP). In 1980, the NCRP alerted the technical community to possible future increases between a factor of three and ten in the Q for neutrons, and in 1985, the ICRP suggested an increase by a factor of two in Q for neutrons. Both the ICRP and NRCP are now recommending essentially the same guidance with regard to Q for neutrons: an increase by a factor of two. The Q for neutrons is based on a large, albeit unfocused, body of experimental data. In spite of the lack of focus, the data supporting a change in the neutron quality factor are substantial. However, the proposed doubling of Q for neutrons is clouded by other issues regarding its application. 33 refs., 4 figs., 6 tabs

  6. Signature of protein adaptation to warm deep sea environments: the case of Initiation Factor 6 studied by molecular simulation and neutron scattering

    International Nuclear Information System (INIS)

    Calligari, Paolo

    2008-01-01

    The protein Initiation Factor 6 (IF6) takes part in the protein synthesis regulation of several organisms. It was also found in archeaebacteria such as Methanococcus jannaschii which lives in deep-seas near hydrothermal vents where temperature reaches 80 C and pressure is between 250 bar and 500 bar. The aim of this work was to study for the first time dynamical and structural properties of IF6 produced by M. jannaschii and comparing them with those of the IF6 homologue present in Saccharomyces cerevisiae which lives at 'normal' environmental conditions (27 C and 1 bar). Molecular simulation gave here new insights into the adaptation of these two proteins to their respective physiological conditions and showed that the latter induced similar dynamical and structural properties: in their respective 'natural' conditions, IF6s show very similar structural fluctuations and the characteristic relaxation times which define their dynamical properties shows similar changes when comparing unfavorable conditions to physiological ones. The creation of these corresponding states between the two homologues has been interpreted by the fractional Brownian dynamics model and by a novel method for the characterization of protein secondary structures. The latter is presented here in detail together with some examples of other applications. Experimental data obtained from quasi-elastic neutron scattering seemed to support the results obtained by molecular simulations. (author) [fr

  7. Temporally Regulated Neural Crest Transcription Factors Distinguish Neuroectodermal Tumors of Varying Malignancy and Differentiation

    Directory of Open Access Journals (Sweden)

    Timothy R. Gershon

    2005-06-01

    Full Text Available Neuroectodermal tumor cells, like neural crest (NC cells, are pluripotent, proliferative, and migratory. We tested the hypothesis that genetic programs essential to NC development are activated in neuroectodermal tumors. We examined the expression of transcription factors PAX3, PAX7, AP-2α, and SOX10 in human embryos and neuroectodermal tumors: neurofibroma, schwannoma, neuroblastoma, malignant nerve sheath tumor, melanoma, medulloblastoma, supratentorial primitive neuroectodermal tumor, and Ewing's sarcoma. We also examined the expression of P0, ERBB3, and STX, targets of SOX10, AP-2α, and PAX3, respectively. PAX3, AP-2α, and SOX10 were expressed sequentially in human NC development, whereas PAX7 was restricted to mesoderm. Tumors expressed PAX3, AP-2α, SOX10, and PAX7 in specific combinations. SOX10 and AP-2α were expressed in relatively differentiated neoplasms. The early NC marker, PAX3, and its homologue, PAX7, were detected in poorly differentiated tumors and tumors with malignant potential. Expression of NC transcription factors and target genes correlated. Transcription factors essential to NC development are thus present in neuroectodermal tumors. Correlation of specific NC transcription factors with phenotype, and with expression of specific downstream genes, provides evidence that these transcription factors actively influence gene expression and tumor behavior. These findings suggest that PAX3, PAX7, AP-2α, and SOX10 are potential markers of prognosis and targets for therapeutic intervention.

  8. Sequence similarities of protein kinase substrates and inhibitors with immunoglobulins and model immunoglobulin homologue: cell adhesion molecule from the living fossil sponge Geodia cydonium. Mapping of coherent database similarities and implications for evolution of CDR1 and hypermutation

    Czech Academy of Sciences Publication Activity Database

    Kubrycht, J.; Borecký, Jiří; Souček, P.; Ježek, Petr

    2004-01-01

    Roč. 49, č. 3 (2004), s. 219-246 ISSN 0015-5632 R&D Projects: GA MZd NJ6747 Institutional research plan: CEZ:AV0Z5011922 Keywords : CDR1 * immunoglobulin Subject RIV: EE - Microbiology, Virology Impact factor: 1.034, year: 2004

  9. Supra-optimal expression of the cold-regulated OsMyb4 transcription factor in transgenic rice changes the complexity of transcriptional network with major effects on stress tolerance and panicle development

    KAUST Repository

    Park, Myoungryoul

    2010-09-28

    The R2R3-type OsMyb4 transcription factor of rice has been shown to play a role in the regulation of osmotic adjustment in heterologous overexpression studies. However, the exact composition and organization of its underlying transcriptional network has not been established to be a robust tool for stress tolerance enhancement by regulon engineering. OsMyb4 network was dissected based on commonalities between the global chilling stress transcriptome and the transcriptome configured by OsMyb4 overexpression. OsMyb4 controls a hierarchical network comprised of several regulatory sub-clusters associated with cellular defense and rescue, metabolism and development. It regulates target genes either directly or indirectly through intermediary MYB, ERF, bZIP, NAC, ARF and CCAAT-HAP transcription factors. Regulatory sub-clusters have different combinations of MYB-like, GCC-box-like, ERD1-box-like, ABRE-like, G-box-like, as1/ocs/TGA-like, AuxRE-like, gibberellic acid response element (GARE)-like and JAre-like cis-elements. Cold-dependent network activity enhanced cellular antioxidant capacity through radical scavenging mechanisms and increased activities of phenylpropanoid and isoprenoid metabolic processes involving various abscisic acid (ABA), jasmonic acid (JA), salicylic acid (SA), ethylene and reactive oxygen species (ROS) responsive genes. OsMyb4 network is independent of drought response element binding protein/C-repeat binding factor (DREB/CBF) and its sub-regulons operate with possible co-regulators including nuclear factor-Y. Because of its upstream position in the network hierarchy, OsMyb4 functions quantitatively and pleiotrophically. Supra-optimal expression causes misexpression of alternative targets with costly trade-offs to panicle development. © 2010 Blackwell Publishing Ltd.

  10. Supra-optimal expression of the cold-regulated OsMyb4 transcription factor in transgenic rice changes the complexity of transcriptional network with major effects on stress tolerance and panicle development.

    Science.gov (United States)

    Park, Myoung-Ryoul; Yun, Kil-Young; Mohanty, Bijayalaxmi; Herath, Venura; Xu, Fuyu; Wijaya, Edward; Bajic, Vladimir B; Yun, Song-Joong; De Los Reyes, Benildo G

    2010-12-01

    The R2R3-type OsMyb4 transcription factor of rice has been shown to play a role in the regulation of osmotic adjustment in heterologous overexpression studies. However, the exact composition and organization of its underlying transcriptional network has not been established to be a robust tool for stress tolerance enhancement by regulon engineering. OsMyb4 network was dissected based on commonalities between the global chilling stress transcriptome and the transcriptome configured by OsMyb4 overexpression. OsMyb4 controls a hierarchical network comprised of several regulatory sub-clusters associated with cellular defense and rescue, metabolism and development. It regulates target genes either directly or indirectly through intermediary MYB, ERF, bZIP, NAC, ARF and CCAAT-HAP transcription factors. Regulatory sub-clusters have different combinations of MYB-like, GCC-box-like, ERD1-box-like, ABRE-like, G-box-like, as1/ocs/TGA-like, AuxRE-like, gibberellic acid response element (GARE)-like and JAre-like cis-elements. Cold-dependent network activity enhanced cellular antioxidant capacity through radical scavenging mechanisms and increased activities of phenylpropanoid and isoprenoid metabolic processes involving various abscisic acid (ABA), jasmonic acid (JA), salicylic acid (SA), ethylene and reactive oxygen species (ROS) responsive genes. OsMyb4 network is independent of drought response element binding protein/C-repeat binding factor (DREB/CBF) and its sub-regulons operate with possible co-regulators including nuclear factor-Y. Because of its upstream position in the network hierarchy, OsMyb4 functions quantitatively and pleiotrophically. Supra-optimal expression causes misexpression of alternative targets with costly trade-offs to panicle development. © 2010 Blackwell Publishing Ltd.

  11. Risk factors

    International Nuclear Information System (INIS)

    Dennery, M.; Dupont, M.A.

    2007-01-01

    This article deals with the development of risk management in the gas sector business: why a risk factor legal mention must precede any published financial information? Do gas companies have to face new risks? Is there specific risks bound to gas activities? Why companies want to master their risks? Is it mandatory or just a new habit? Do they expect a real benefit in return? These are the risk management questions that are analyzed in this article which is based on the public communication of 15 gas companies randomly selected over the world. The information comes from their annual reports or from documents available on their web sites. The intention of this document is not to be exhaustive or to make statistics but only to shade light on the risk factors of the gas sector. (J.S.)

  12. Organizational factors

    International Nuclear Information System (INIS)

    Wahlstroem, B.; Kettunen, J.

    2005-01-01

    The goal of this lecture is to give an overview of important concepts connected to organisational factors and to provide an understanding of mechanisms by which they can contribute to safe or unsafe behaviour of people. The lecture gives examples of ways to organise work, organisational deficiencies and good practices applied in safety oriented organisations. The lecture also gives an introduction to international work and Finnish national regulation connected to organisation and management. (orig.)

  13. Factor analysis

    CERN Document Server

    Gorsuch, Richard L

    2013-01-01

    Comprehensive and comprehensible, this classic covers the basic and advanced topics essential for using factor analysis as a scientific tool in psychology, education, sociology, and related areas. Emphasizing the usefulness of the techniques, it presents sufficient mathematical background for understanding and sufficient discussion of applications for effective use. This includes not only theory but also the empirical evaluations of the importance of mathematical distinctions for applied scientific analysis.

  14. AgeFactDB—the JenAge Ageing Factor Database—towards data integration in ageing research

    Science.gov (United States)

    Hühne, Rolf; Thalheim, Torsten; Sühnel, Jürgen

    2014-01-01

    AgeFactDB (http://agefactdb.jenage.de) is a database aimed at the collection and integration of ageing phenotype data including lifespan information. Ageing factors are considered to be genes, chemical compounds or other factors such as dietary restriction, whose action results in a changed lifespan or another ageing phenotype. Any information related to the effects of ageing factors is called an observation and is presented on observation pages. To provide concise access to the complete information for a particular ageing factor, corresponding observations are also summarized on ageing factor pages. In a first step, ageing-related data were primarily taken from existing databases such as the Ageing Gene Database—GenAge, the Lifespan Observations Database and the Dietary Restriction Gene Database—GenDR. In addition, we have started to include new ageing-related information. Based on homology data taken from the HomoloGene Database, AgeFactDB also provides observation and ageing factor pages of genes that are homologous to known ageing-related genes. These homologues are considered as candidate or putative ageing-related genes. AgeFactDB offers a variety of search and browse options, and also allows the download of ageing factor or observation lists in TSV, CSV and XML formats. PMID:24217911

  15. A novel Zea mays ssp. mexicana L. MYC-type ICE-like transcription factor gene ZmmICE1, enhances freezing tolerance in transgenic Arabidopsis thaliana.

    Science.gov (United States)

    Lu, Xiang; Yang, Lei; Yu, Mengyuan; Lai, Jianbin; Wang, Chao; McNeil, David; Zhou, Meixue; Yang, Chengwei

    2017-04-01

    The annual Zea mays ssp. mexicana L., a member of the teosinte group, is a close wild relative of maize and thus can be effectively used in maize improvement. In this study, an ICE-like gene, ZmmICE1, was isolated from a cDNA library of RNA-Seq from cold-treated seedling tissues of Zea mays ssp. mexicana L. The deduced protein of ZmmICE1 contains a highly conserved basic helix-loop-helix (bHLH) domain and C-terminal region of ICE-like proteins. The ZmmICE1 protein localizes to the nucleus and shows sumoylation when expressed in an Escherichia coli reconstitution system. In addition, yeast one hybrid assays indicated that ZmmICE1 has transactivation activities. Moreover, ectopic expression of ZmmICE1 in the Arabidopsis ice1-2 mutant increased freezing tolerance. The ZmmICE1 overexpressed plants showed lower electrolyte leakage (EL), reduced contents of malondialdehyde (MDA). The expression of downstream cold related genes of Arabidopsis C-repeat-binding factors (AtCBF1, AtCBF2 and AtCBF3), cold-responsive genes (AtCOR15A and AtCOR47), kinesin-1 member gene (AtKIN1) and responsive to desiccation gene (AtRD29A) was significantly induced when compared with wild type under low temperature treatment. Taken together, these results indicated that ZmmICE1 is the homolog of Arabidopsis inducer of CBF expression genes (AtICE1/2) and plays an important role in the regulation of freezing stress response. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  16. Human factors

    International Nuclear Information System (INIS)

    Brown, G.J.

    1991-01-01

    Recent reactor accidents have spurred the major review, described here, of the contribution of operator personnel to safety in Scottish Nuclear Power Stations. The review aims to identify factors leading to the Chernobyl accident and take preventative measures to avoid possible recurrence. Scottish Nuclear power stations aim to remove the operator from a position where failure to take correct action could lead to a safety hazard. Instead operators concentrate on routine and breakdown maintenance and measures are taken to minimize the probability of operator error. The review concluded that most safety procedures were satisfactory but safety analysis supported by good design practices may offer a significant reduction in the risk of operator error. (UK)

  17. MiT/TFE transcription factors are activated during mitophagy downstream of Parkin and Atg5.

    Science.gov (United States)

    Nezich, Catherine L; Wang, Chunxin; Fogel, Adam I; Youle, Richard J

    2015-08-03

    The kinase PINK1 and ubiquitin ligase Parkin can regulate the selective elimination of damaged mitochondria through autophagy (mitophagy). Because of the demand on lysosomal function by mitophagy, we investigated a role for the transcription factor EB (TFEB), a master regulator of lysosomal biogenesis, in this process. We show that during mitophagy TFEB translocates to the nucleus and displays transcriptional activity in a PINK1- and Parkin-dependent manner. MITF and TFE3, homologues of TFEB belonging to the same microphthalmia/transcription factor E (MiT/TFE) family, are similarly regulated during mitophagy. Unlike TFEB translocation after starvation-induced mammalian target of rapamycin complex 1 inhibition, Parkin-mediated TFEB relocalization required Atg9A and Atg5 activity. However, constitutively active Rag guanosine triphosphatases prevented TFEB translocation during mitophagy, suggesting cross talk between these two MiT/TFE activation pathways. Analysis of clustered regularly interspaced short palindromic repeats-generated TFEB/MITF/TFE3/TFEC single, double, and triple knockout cell lines revealed that these proteins partly facilitate Parkin-mediated mitochondrial clearance. These results illuminate a pathway leading to MiT/TFE transcription factor activation, distinct from starvation-induced autophagy, which occurs during mitophagy.

  18. Comparative analysis of the ternary complex factors Elk-1, SAP-1a and SAP-2 (ERP/NET).

    Science.gov (United States)

    Price, M A; Rogers, A E; Treisman, R

    1995-06-01

    A transcription factor ternary complex composed of Serum Response Factor (SRF) and Ternary Complex Factor (TCF) mediates the response of the c-fos Serum Response Element (SRE) to growth factors and mitogens. Three Ets domain proteins, Elk-1, SAP-1 and ERP/NET, have been reported to have the properties of TCF. Here we compare Elk-1 and SAP-1a with the human ERP/NET homologue SAP-2. All three TCF RNAs are ubiquitously expressed at similar relative levels. All three proteins contain conserved regions that interact with SRF and the c-fos SRE with comparable efficiency, but in vitro complex formation by SAP-2 is strongly inhibited by its C-terminal sequences. Similarly, only Elk-1 and SAP-1a efficiently bind the c-fos SRE in vivo; ternary complex formation by SAP-2 is weak and is substantially unaffected by serum stimulation or v-ras co-expression. All three TCFs contain C-terminal transcriptional activation domains that are phosphorylated following growth factor stimulation. Activation requires conserved S/T-P motifs found in all the TCF family members. Each TCF activation domain can be phosphorylated in vitro by partially purified ERK2, and ERK activation in vivo is sufficient to potentiate transcriptional activation.

  19. In human pseudouridine synthase 1 (hPus1), a C-terminal helical insert blocks tRNA from binding in the same orientation as in the Pus1 bacterial homologue TruA, consistent with their different target selectivities.

    Science.gov (United States)

    Czudnochowski, Nadine; Wang, Amy Liya; Finer-Moore, Janet; Stroud, Robert M

    2013-10-23

    Human pseudouridine (Ψ) synthase Pus1 (hPus1) modifies specific uridine residues in several non-coding RNAs: tRNA, U2 spliceosomal RNA, and steroid receptor activator RNA. We report three structures of the catalytic core domain of hPus1 from two crystal forms, at 1.8Å resolution. The structures are the first of a mammalian Ψ synthase from the set of five Ψ synthase families common to all kingdoms of life. hPus1 adopts a fold similar to bacterial Ψ synthases, with a central antiparallel β-sheet flanked by helices and loops. A flexible hinge at the base of the sheet allows the enzyme to open and close around an electropositive active-site cleft. In one crystal form, a molecule of Mes [2-(N-morpholino)ethane sulfonic acid] mimics the target uridine of an RNA substrate. A positively charged electrostatic surface extends from the active site towards the N-terminus of the catalytic domain, suggesting an extensive binding site specific for target RNAs. Two α-helices C-terminal to the core domain, but unique to hPus1, extend along the back and top of the central β-sheet and form the walls of the RNA binding surface. Docking of tRNA to hPus1 in a productive orientation requires only minor conformational changes to enzyme and tRNA. The docked tRNA is bound by the electropositive surface of the protein employing a completely different binding mode than that seen for the tRNA complex of the Escherichia coli homologue TruA. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Heart disease - risk factors

    Science.gov (United States)

    Heart disease - prevention; CVD - risk factors; Cardiovascular disease - risk factors; Coronary artery disease - risk factors; CAD - risk ... a certain health condition. Some risk factors for heart disease you cannot change, but some you can. ...

  1. Cloning and expression analysis of a partial LEAFY homologue from ...

    African Journals Online (AJOL)

    ajl yemi

    2011-11-14

    Nov 14, 2011 ... 2South Subtropical Crops Research Institute, Chinese Academy of Tropical Agricultural Science, Zhanjiang, Guangdong ... The leaves, stem and fruits of the pineapple plant ... First-strand cDNA was synthesized with M-MLV-.

  2. Some Cholón discourse particles and Quechua homologues

    NARCIS (Netherlands)

    Alexander-Bakkerus, A.; Romero-Figueroa, A.

    2011-01-01

    Cholón belongs to a small language family. It was spoken in North Peru in the valley of the Huallaga River. Cholón is an agglutinative SOV language, and it has, amongst other things, some twenty interesting, suffixed discourse particles: adverbial markers, emphasis markers, exclamation markers,

  3. Identification of Salp15 homologues in Ixodes ricinus ticks

    NARCIS (Netherlands)

    Hovius, J. W. R.; Ramamoorthi, N.; van't Veer, C.; de Groot, K. A.; Nijhof, A. M.; Jongejan, F.; van Dam, A. P.; Fikrig, E.

    2007-01-01

    The 15-kDa Ixodes scapularis salivary gland protein Salp15 protects Borrelia burgdorferi sensu stricto from antibody-mediated killing and facilitates infection of the mammalian host. In addition, Salp 15 has been shown to inhibit T-cell activation. We determined whether Ixodes ricinus, the major

  4. An effector of apple proliferation phytoplasma targets TCP transcription factors-a generalized virulence strategy of phytoplasma?

    Science.gov (United States)

    Janik, Katrin; Mithöfer, Axel; Raffeiner, Margot; Stellmach, Hagen; Hause, Bettina; Schlink, Katja

    2017-04-01

    The plant pathogen Candidatus Phytoplasma mali (P. mali) is the causative agent of apple proliferation, a disease of increasing importance in apple-growing areas within Europe. Despite its economic importance, little is known about the molecular mechanisms of disease manifestation within apple trees. In this study, we identified two TCP (TEOSINTE BRANCHED/CYCLOIDEA/PROLIFERATING CELL FACTOR) transcription factors of Malus x domestica as binding partners of the P. mali SAP11-like effector ATP_00189. Phytohormone analyses revealed an effect of P. mali infection on jasmonates, salicylic acid and abscisic acid levels, showing that P. mali affects phytohormonal levels in apple trees, which is in line with the functions of the effector assumed from its binding to TCP transcription factors. To our knowledge, this is the first characterization of the molecular targets of a P. mali effector and thus provides the basis to better understand symptom development and disease progress during apple proliferation. As SAP11 homologues are found in several Phytoplasma species infecting a broad range of different plants, SAP11-like proteins seem to be key players in phytoplasmal infection. © 2016 BSPP AND JOHN WILEY & SONS LTD.

  5. A conserved helicase processivity factor is needed for conjugation and replication of an integrative and conjugative element.

    Directory of Open Access Journals (Sweden)

    Jacob Thomas

    Full Text Available Integrative and conjugative elements (ICEs are agents of horizontal gene transfer and have major roles in evolution and acquisition of new traits, including antibiotic resistances. ICEs are found integrated in a host chromosome and can excise and transfer to recipient bacteria via conjugation. Conjugation involves nicking of the ICE origin of transfer (oriT by the ICE-encoded relaxase and transfer of the nicked single strand of ICE DNA. For ICEBs1 of Bacillus subtilis, nicking of oriT by the ICEBs1 relaxase NicK also initiates rolling circle replication. This autonomous replication of ICEBs1 is critical for stability of the excised element in growing cells. We found a conserved and previously uncharacterized ICE gene that is required for conjugation and replication of ICEBs1. Our results indicate that this gene, helP (formerly ydcP, encodes a helicase processivity factor that enables the host-encoded helicase PcrA to unwind the double-stranded ICEBs1 DNA. HelP was required for both conjugation and replication of ICEBs1, and HelP and NicK were the only ICEBs1 proteins needed for replication from ICEBs1 oriT. Using chromatin immunoprecipitation, we measured association of HelP, NicK, PcrA, and the host-encoded single-strand DNA binding protein Ssb with ICEBs1. We found that NicK was required for association of HelP and PcrA with ICEBs1 DNA. HelP was required for association of PcrA and Ssb with ICEBs1 regions distal, but not proximal, to oriT, indicating that PcrA needs HelP to progress beyond nicked oriT and unwind ICEBs1. In vitro, HelP directly stimulated the helicase activity of the PcrA homologue UvrD. Our findings demonstrate that HelP is a helicase processivity factor needed for efficient unwinding of ICEBs1 for conjugation and replication. Homologues of HelP and PcrA-type helicases are encoded on many known and putative ICEs. We propose that these factors are essential for ICE conjugation, replication, and genetic stability.

  6. A chemokine-binding domain in the tumor necrosis factor receptor from variola (smallpox) virus.

    Science.gov (United States)

    Alejo, Alí; Ruiz-Argüello, M Begoña; Ho, Yin; Smith, Vincent P; Saraiva, Margarida; Alcami, Antonio

    2006-04-11

    Variola virus (VaV) is the causative agent of smallpox, one of the most devastating diseases encountered by man, that was eradicated in 1980. The deliberate release of VaV would have catastrophic consequences on global public health. However, the mechanisms that contribute to smallpox pathogenesis are poorly understood at the molecular level. The ability of viruses to evade the host defense mechanisms is an important determinant of viral pathogenesis. Here we show that the tumor necrosis factor receptor (TNFR) homologue CrmB encoded by VaV functions not only as a soluble decoy TNFR but also as a highly specific binding protein for several chemokines that mediate recruitment of immune cells to mucosal surfaces and the skin, sites of virus entry and viral replication at late stages of smallpox. CrmB binds chemokines through its C-terminal domain, which is unrelated to TNFRs, was named smallpox virus-encoded chemokine receptor (SECRET) domain and uncovers a family of poxvirus chemokine inhibitors. An active SECRET domain was found in another viral TNFR (CrmD) and three secreted proteins encoded by orthopoxviruses. These findings identify a previously undescribed chemokine-binding and inhibitory domain unrelated to host chemokine receptors and a mechanism of immune modulation in VaV that may influence smallpox pathogenesis.

  7. High-density lipoprotein is a potential growth factor for adrenocortical cells

    International Nuclear Information System (INIS)

    Murao, Koji; Imachi, Hitomi; Cao, Wenming; Yu, Xiao; Li, Junhua; Yoshida, Kazuya; Ahmed, Rania A.M.; Matsumoto, Kensuke; Nishiuchi, Takamasa; Wong, Norman C.W.; Ishida, Toshihiko

    2006-01-01

    The entry of cholesterol contained within high-density lipoprotein (HDL) into adrenocortical cells is mediated by a human homologue of SR-BI, CD36, and LIMPII Analogous-1 (CLA-1) and thus augmenting their growth. To address the role of CLA-1, we created a mutant mCLA that lacked the C-terminal tail. HDL CE selective uptake by cells carrying the mCLA-1 receptor was fully active and equivalent to those transfected with full-length CLA-1 (fCLA-1). Expression of mCLA inhibited the proliferation of an adrenocortical cell line and the incorporation of [ 3 H]thymidine into the cells. This effect was sensitive to wortmannin, an inhibitor of phosphoinositide 3-kinase (PI3K). Our transcriptional studies revealed that the inhibitory action of mCLA required the transcriptional factor AP-1 and the effect of HDL on AP-1 activation was also abrogated by wortmannin. These findings raise the possibility that the inhibitors of the effects of HDL may be of therapeutic value for adrenocortical tumor

  8. Bombyx mori nucleopolyhedrovirus ORF79 is a per os infectivity factor associated with the PIF complex.

    Science.gov (United States)

    Dong, Zhan-Qi; Zhang, Jun; Chen, Xue-Mei; He, Qian; Cao, Ming-Ya; Wang, La; Li, Hai-Qing; Xiao, Wen-Fu; Pan, Cai-Xia; Lu, Cheng; Pan, Min-Hui

    2014-05-12

    Bombyx mori nucleopolyhedrovirus (BmNPV) ORF79 (Bm79) encodes an occlusion-derived virus (ODV)-specific envelope protein, which is a homologue of the per os infectivity factor 4 (PIF4) of Autographa californica multiple nucleopolyhedrovirus (AcMNPV). To investigate the role of ORF79 in the BmNPV life cycle, a Bm79 knockout virus (vBm(Bm79KO)) was constructed through homologous recombination in Escherichia coli. Viral DNA replication, budded virus (BV) production and polyhedra formation were unaffected by the absence of BM79. However, results of the larval bioassay demonstrated that the Bm79 deletion resulted in a complete loss of per os infection. Immunofluorescence analysis showed that BM79 localized at the innernuclear membrane of infected cells through its N-terminal sorting motif (SM). Further bimolecular fluorescence protein complementation and co-immunoprecipitation assays demonstrated the interaction of BM79 with PIF1, PIF2, PIF3 and ODV-E66. Thus, BM79 plays an important role in per os infection and is associated with the viral PIF complex of BmNPV. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Characterization of Bombyx mori mitochondrial transcription factor A, a conserved regulator of mitochondrial DNA.

    Science.gov (United States)

    Sumitani, Megumi; Kondo, Mari; Kasashima, Katsumi; Endo, Hitoshi; Nakamura, Kaoru; Misawa, Toshihiko; Tanaka, Hiromitsu; Sezutsu, Hideki

    2017-04-15

    In the present study, we initially cloned and characterized a mitochondrial transcription factor A (Tfam) homologue in the silkworm, Bombyx mori. Bombyx mori TFAM (BmTFAM) localized to mitochondria in cultured silkworm and human cells, and co-localized with mtDNA nucleoids in human HeLa cells. In an immunoprecipitation analysis, BmTFAM was found to associate with human mtDNA in mitochondria, indicating its feature as a non-specific DNA-binding protein. In spite of the low identity between BmTFAM and human TFAM (26.5%), the expression of BmTFAM rescued mtDNA copy number reductions and enlarged mtDNA nucleoids in HeLa cells, which were induced by human Tfam knockdown. Thus, BmTFAM compensates for the function of human TFAM in HeLa cells, demonstrating that the mitochondrial function of TFAM is highly conserved between silkworms and humans. BmTfam mRNA was strongly expressed in early embryos. Through double-stranded RNA (dsRNA)-based RNA interference (RNAi) in silkworm embryos, we found that the knockdown of BmTFAM reduced the amount of mtDNA and induced growth retardation at the larval stage. Collectively, these results demonstrate that BmTFAM is a highly conserved mtDNA regulator and may be a good candidate for investigating and modulating mtDNA metabolism in this model organism. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Spatial and temporal expression of the Grainyhead-like transcription factor family during murine development.

    Science.gov (United States)

    Auden, Alana; Caddy, Jacinta; Wilanowski, Tomasz; Ting, Stephen B; Cunningham, John M; Jane, Stephen M

    2006-10-01

    The Drosophila transcription factor Grainyhead (grh) is expressed in ectoderm-derived tissues where it regulates several key developmental events including cuticle formation, tracheal elongation and dorsal closure. Our laboratory has recently identified three novel mammalian homologues of the grh gene, Grainyhead-like 1, -2 and -3 (Grhl1-3) that rewrite the phylogeny of this family. Using gene targeting in mice, we have shown that Grhl3 is essential for neural tube closure, skin barrier formation and wound healing. Despite their extensive sequence homology, Grhl1 and Grhl2 are unable to compensate for loss of Grhl3 in these developmental processes. To explore this lack of redundancy, and to gain further insights into the functions of this gene family in mammalian development we have performed an extensive in situ hybridisation analysis. We demonstrate that, although all three Grhl genes are highly expressed in the developing epidermis, they display subtle differences in the timing and level of expression. Surprisingly, we also demonstrate differential expression patterns in non-ectoderm-derived tissues, including the heart, the lung, and the metanephric kidney. These findings expand our understanding of the unique role of Grhl3 in neurulation and epidermal morphogenesis, and provide a focus for further functional analysis of the Grhl genes during mouse embryogenesis.

  11. Characterization of the receptors for mycobacterial cord factor in Guinea pig.

    Directory of Open Access Journals (Sweden)

    Kenji Toyonaga

    Full Text Available Guinea pig is a widely used animal for research and development of tuberculosis vaccines, since its pathological disease process is similar to that present in humans. We have previously reported that two C-type lectin receptors, Mincle (macrophage inducible C-type lectin, also called Clec4e and MCL (macrophage C-type lectin, also called Clec4d, recognize the mycobacterial cord factor, trehalose-6,6'-dimycolate (TDM. Here, we characterized the function of the guinea pig homologue of Mincle (gpMincle and MCL (gpMCL. gpMincle directly bound to TDM and transduced an activating signal through ITAM-bearing adaptor molecule, FcRγ. Whereas, gpMCL lacked C-terminus and failed to bind to TDM. mRNA expression of gpMincle was detected in the spleen, lymph nodes and peritoneal macrophages and it was strongly up-regulated upon stimulation of zymosan and TDM. The surface expression of gpMincle was detected on activated macrophages by a newly established monoclonal antibody that also possesses a blocking activity. This antibody potently suppressed TNF production in BCG-infected macrophages. Collectively, gpMincle is the TDM receptor in the guinea pig and TDM-Mincle axis is involved in host immune responses against mycobacteria.

  12. Characterization of the receptors for mycobacterial cord factor in Guinea pig.

    Science.gov (United States)

    Toyonaga, Kenji; Miyake, Yasunobu; Yamasaki, Sho

    2014-01-01

    Guinea pig is a widely used animal for research and development of tuberculosis vaccines, since its pathological disease process is similar to that present in humans. We have previously reported that two C-type lectin receptors, Mincle (macrophage inducible C-type lectin, also called Clec4e) and MCL (macrophage C-type lectin, also called Clec4d), recognize the mycobacterial cord factor, trehalose-6,6'-dimycolate (TDM). Here, we characterized the function of the guinea pig homologue of Mincle (gpMincle) and MCL (gpMCL). gpMincle directly bound to TDM and transduced an activating signal through ITAM-bearing adaptor molecule, FcRγ. Whereas, gpMCL lacked C-terminus and failed to bind to TDM. mRNA expression of gpMincle was detected in the spleen, lymph nodes and peritoneal macrophages and it was strongly up-regulated upon stimulation of zymosan and TDM. The surface expression of gpMincle was detected on activated macrophages by a newly established monoclonal antibody that also possesses a blocking activity. This antibody potently suppressed TNF production in BCG-infected macrophages. Collectively, gpMincle is the TDM receptor in the guinea pig and TDM-Mincle axis is involved in host immune responses against mycobacteria.

  13. A chemokine-binding domain in the tumor necrosis factor receptor from variola (smallpox) virus

    Science.gov (United States)

    Alejo, Alí; Ruiz-Argüello, M. Begoña; Ho, Yin; Smith, Vincent P.; Saraiva, Margarida; Alcami, Antonio

    2006-01-01

    Variola virus (VaV) is the causative agent of smallpox, one of the most devastating diseases encountered by man, that was eradicated in 1980. The deliberate release of VaV would have catastrophic consequences on global public health. However, the mechanisms that contribute to smallpox pathogenesis are poorly understood at the molecular level. The ability of viruses to evade the host defense mechanisms is an important determinant of viral pathogenesis. Here we show that the tumor necrosis factor receptor (TNFR) homologue CrmB encoded by VaV functions not only as a soluble decoy TNFR but also as a highly specific binding protein for several chemokines that mediate recruitment of immune cells to mucosal surfaces and the skin, sites of virus entry and viral replication at late stages of smallpox. CrmB binds chemokines through its C-terminal domain, which is unrelated to TNFRs, was named smallpox virus-encoded chemokine receptor (SECRET) domain and uncovers a family of poxvirus chemokine inhibitors. An active SECRET domain was found in another viral TNFR (CrmD) and three secreted proteins encoded by orthopoxviruses. These findings identify a previously undescribed chemokine-binding and inhibitory domain unrelated to host chemokine receptors and a mechanism of immune modulation in VaV that may influence smallpox pathogenesis. PMID:16581912

  14. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  15. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  16. Electroweak form factors

    International Nuclear Information System (INIS)

    Singh, S.K.

    2002-01-01

    The present status of electroweak nucleon form factors and the N - Δ transition form factors is reviewed. Particularly the determination of dipole mass M A in the axial vector form factor is discussed

  17. Risk Factors for Scleroderma

    Science.gov (United States)

    ... You are here: Home For Patients Risk Factors Risk Factors for Scleroderma The cause of scleroderma is ... what biological factors contribute to scleroderma pathogenesis. Genetic Risk Scleroderma does not tend to run in families ...

  18. Risk Factors and Prevention

    Science.gov (United States)

    ... Resources Risk Factors & Prevention Back to Patient Resources Risk Factors & Prevention Even people who look healthy and ... Blood Pressure , high cholesterol, diabetes, and thyroid disease. Risk Factors For Arrhythmias and Heart Disease The following ...

  19. XMAP215 is a microtubule nucleation factor that functions synergistically with the γ-tubulin ring complex.

    Science.gov (United States)

    Thawani, Akanksha; Kadzik, Rachel S; Petry, Sabine

    2018-05-01

    How microtubules (MTs) are generated in the cell is a major question in understanding how the cytoskeleton is assembled. For several decades, γ-tubulin has been accepted as the universal MT nucleator of the cell. Although there is evidence that γ-tubulin complexes are not the sole MT nucleators, identification of other nucleation factors has proven difficult. Here, we report that the well-characterized MT polymerase XMAP215 (chTOG/Msps/Stu2p/Alp14/Dis1 homologue) is essential for MT nucleation in Xenopus egg extracts. The concentration of XMAP215 determines the extent of MT nucleation. Even though XMAP215 and the γ-tubulin ring complex (γ-TuRC) possess minimal nucleation activity individually, together, these factors synergistically stimulate MT nucleation in vitro. The amino-terminal TOG domains 1-5 of XMAP215 bind to αβ-tubulin and promote MT polymerization, whereas the conserved carboxy terminus is required for efficient MT nucleation and directly binds to γ-tubulin. In summary, XMAP215 and γ-TuRC together function as the principal nucleation module that generates MTs in cells.

  20. The role of microbial low-molecular-weight autoregulatory factors (alkylhydroxybenzenes) in resistance of microorganisms to radiation and heat shock

    Science.gov (United States)

    El-Registan, Galina I.; Mulyukin, Andrey L.; Nikolaev, Yuri A.; Stepanenko, Irina Yu.; Kozlova, Alla N.; Martirosova, Elena I.; Shanenko, Elena F.; Strakhovskaya, Marina G.; Revina, Aleksandra A.

    Low-molecular-weight cell-to-cell communication factors are produced by various pro- and eukaryotes and involved in autoregulation of the growth and development of microbial cultures. As for some bacterial and yeast species, these factors were identified as isomers and homologues of alkylhydroxybenzenes (AHB). Depending on the concentration, they participate in controlling the transition to stationary phase, entering the resting state, and stress resistance of vegetative cells to gamma-irradiation, photooxidation (singlet oxygen), and heat shock. Chemical analogues of microbial AHB protected microbial cultures from stressful situations and exerted (1) the stabilizing activity toward macromolecules and (2) the ability to scavenge active oxygen species. The stabilizing effect of AHBs resulted from their complex formation with protected macromolecules due to intermolecular hydrogen bonds, hydrophobic and electrostatic interactions and was demonstrated on models of individual enzymes (trypsin). Particularly, AHBs protected the yeast from the action of (a) active oxygen species formed during gamma-irradiation (500 Gy, 1.96 Gy/s) or (b) singlet oxygen generated in cells photosensitized by chlorin e 6 (10 μg/L). It is important that microbial AHBs were not species-specific and defended cultured microbial and animal cells from the action of organic toxicants. The use of AHBs as protectants and adaptogens is discussed as well as perspectives of further investigations.

  1. Transforming growth factor β (CiTGF-β) gene expression is induced in the inflammatory reaction of Ciona intestinalis.

    Science.gov (United States)

    Vizzini, Aiti; Di Falco, Felicia; Parrinello, Daniela; Sanfratello, Maria Antonietta; Cammarata, Matteo

    2016-02-01

    Transforming growth factor (TGF-β) is a well-known component of a regulatory cytokines superfamily that has pleiotropic functions in a broad range of cell types and is involved, in vertebrates, in numerous physiological and pathological processes. In the current study, we report on Ciona intestinalis molecular characterisation and expression of a transforming growth factor β homologue (CiTGF-β). The gene organisation, phylogenetic tree and modelling supported the close relationship with the mammalian TGF suggesting that the C. intestinalis TGF-β gene shares a common ancestor in the chordate lineages. Functionally, real-time PCR analysis showed that CiTGF-β was transcriptionally upregulated in the inflammatory process induced by LPS inoculation, suggesting that is involved in the first phase and significant in the secondary phase of the inflammatory response in which cell differentiation occurs. In situ hybridisation assays revealed that the genes transcription was upregulated in the pharynx, the main organ of the ascidian immune system, and expressed by cluster of hemocytes inside the pharynx vessels. These data supported the view that CiTGF-β is a potential molecule in immune defence systems against bacterial infection. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Evolutionary conserved mechanisms pervade structure and transcriptional modulation of allograft inflammatory factor-1 from sea anemone Anemonia viridis.

    Science.gov (United States)

    Cuttitta, Angela; Ragusa, Maria Antonietta; Costa, Salvatore; Bennici, Carmelo; Colombo, Paolo; Mazzola, Salvatore; Gianguzza, Fabrizio; Nicosia, Aldo

    2017-08-01

    Gene family encoding allograft inflammatory factor-1 (AIF-1) is well conserved among organisms; however, there is limited knowledge in lower organisms. In this study, the first AIF-1 homologue from cnidarians was identified and characterised in the sea anemone Anemonia viridis. The full-length cDNA of AvAIF-1 was of 913 bp with a 5' -untranslated region (UTR) of 148 bp, a 3'-UTR of 315 and an open reading frame (ORF) of 450 bp encoding a polypeptide with149 amino acid residues and predicted molecular weight of about 17 kDa. The predicted protein possesses evolutionary conserved EF hand Ca 2+ binding motifs, post-transcriptional modification sites and a 3D structure which can be superimposed with human members of AIF-1 family. The AvAIF-1 transcript was constitutively expressed in all tested tissues of unchallenged sea anemone, suggesting that AvAIF-1 could serve as a general protective factor under normal physiological conditions. Moreover, we profiled the transcriptional activation of AvAIF-1 after challenges with different abiotic/biotic stresses showing induction by warming conditions, heavy metals exposure and immune stimulation. Thus, mechanisms associated to inflammation and immune challenges up-regulated AvAIF-1 mRNA levels. Our results suggest its involvement in the inflammatory processes and immune response of A. viridis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Structure of the protein core of translation initiation factor 2 in apo, GTP-bound and GDP-bound forms

    International Nuclear Information System (INIS)

    Simonetti, Angelita; Marzi, Stefano; Fabbretti, Attilio; Hazemann, Isabelle; Jenner, Lasse; Urzhumtsev, Alexandre; Gualerzi, Claudio O.; Klaholz, Bruno P.

    2013-01-01

    The crystal structures of the eubacterial translation initiation factor 2 in apo form and with bound GDP and GTP reveal conformational changes upon nucleotide binding and hydrolysis, notably of the catalytically important histidine in the switch II region. Translation initiation factor 2 (IF2) is involved in the early steps of bacterial protein synthesis. It promotes the stabilization of the initiator tRNA on the 30S initiation complex (IC) and triggers GTP hydrolysis upon ribosomal subunit joining. While the structure of an archaeal homologue (a/eIF5B) is known, there are significant sequence and functional differences in eubacterial IF2, while the trimeric eukaryotic IF2 is completely unrelated. Here, the crystal structure of the apo IF2 protein core from Thermus thermophilus has been determined by MAD phasing and the structures of GTP and GDP complexes were also obtained. The IF2–GTP complex was trapped by soaking with GTP in the cryoprotectant. The structures revealed conformational changes of the protein upon nucleotide binding, in particular in the P-loop region, which extend to the functionally relevant switch II region. The latter carries a catalytically important and conserved histidine residue which is observed in different conformations in the GTP and GDP complexes. Overall, this work provides the first crystal structure of a eubacterial IF2 and suggests that activation of GTP hydrolysis may occur by a conformational repositioning of the histidine residue

  4. Structure of the protein core of translation initiation factor 2 in apo, GTP-bound and GDP-bound forms

    Energy Technology Data Exchange (ETDEWEB)

    Simonetti, Angelita [IGBMC (Institute of Genetics and of Molecular and Cellular Biology), Centre National de la Recherche Scientifique (CNRS) UMR 7104/Institut National de la Santé de la Recherche Médicale - INSERM U964/Université de Strasbourg, 1 Rue Laurent Fries, 67404 Illkirch (France); Marzi, Stefano [Architecture et Réactivité de l’ARN, UPR 9002 CNRS, IBMC (Institute of Molecular and Cellular Biology), 15 Rue R. Descartes, 67084 Strasbourg, France, Université de Strasbourg, 67000 Strasbourg (France); Fabbretti, Attilio [University of Camerino, 62032 Camerino (Monaco) (Italy); Hazemann, Isabelle; Jenner, Lasse [IGBMC (Institute of Genetics and of Molecular and Cellular Biology), Centre National de la Recherche Scientifique (CNRS) UMR 7104/Institut National de la Santé de la Recherche Médicale -INSERM U964/Université de Strasbourg, 1 Rue Laurent Fries, 67404 Illkirch (France); Urzhumtsev, Alexandre [IGBMC (Institute of Genetics and of Molecular and Cellular Biology), Centre National de la Recherche Scientifique (CNRS) UMR 7104/Institut National de la Santé de la Recherche Médicale - INSERM U964/Université de Strasbourg, 1 Rue Laurent Fries, 67404 Illkirch (France); Université de Lorraine, 54506 Vandoeuvre-lès-Nancy (France); Gualerzi, Claudio O. [University of Camerino, 62032 Camerino (Monaco) (Italy); Klaholz, Bruno P., E-mail: klaholz@igbmc.fr [IGBMC (Institute of Genetics and of Molecular and Cellular Biology), Centre National de la Recherche Scientifique (CNRS) UMR 7104/Institut National de la Santé de la Recherche Médicale - INSERM U964/Université de Strasbourg, 1 Rue Laurent Fries, 67404 Illkirch (France)

    2013-06-01

    The crystal structures of the eubacterial translation initiation factor 2 in apo form and with bound GDP and GTP reveal conformational changes upon nucleotide binding and hydrolysis, notably of the catalytically important histidine in the switch II region. Translation initiation factor 2 (IF2) is involved in the early steps of bacterial protein synthesis. It promotes the stabilization of the initiator tRNA on the 30S initiation complex (IC) and triggers GTP hydrolysis upon ribosomal subunit joining. While the structure of an archaeal homologue (a/eIF5B) is known, there are significant sequence and functional differences in eubacterial IF2, while the trimeric eukaryotic IF2 is completely unrelated. Here, the crystal structure of the apo IF2 protein core from Thermus thermophilus has been determined by MAD phasing and the structures of GTP and GDP complexes were also obtained. The IF2–GTP complex was trapped by soaking with GTP in the cryoprotectant. The structures revealed conformational changes of the protein upon nucleotide binding, in particular in the P-loop region, which extend to the functionally relevant switch II region. The latter carries a catalytically important and conserved histidine residue which is observed in different conformations in the GTP and GDP complexes. Overall, this work provides the first crystal structure of a eubacterial IF2 and suggests that activation of GTP hydrolysis may occur by a conformational repositioning of the histidine residue.

  5. Factors and factorizations of graphs proof techniques in factor theory

    CERN Document Server

    Akiyama, Jin

    2011-01-01

    This book chronicles the development of graph factors and factorizations. It pursues a comprehensive approach, addressing most of the important results from hundreds of findings over the last century. One of the main themes is the observation that many theorems can be proved using only a few standard proof techniques. This stands in marked contrast to the seemingly countless, complex proof techniques offered by the extant body of papers and books. In addition to covering the history and development of this area, the book offers conjectures and discusses open problems. It also includes numerous explanatory figures that enable readers to progressively and intuitively understand the most important notions and proofs in the area of factors and factorization.

  6. Cyt toxin expression reveals an inverse regulation of insect and plant virulence factors of Dickeya dadantii.

    Science.gov (United States)

    Costechareyre, Denis; Dridi, Bedis; Rahbé, Yvan; Condemine, Guy

    2010-12-01

    The plant pathogenic bacteria Dickeya dadantii is also a pathogen of the pea aphid Acyrthosiphon pisum. The genome of the bacteria contains four cyt genes, encoding homologues of Bacillus thuringiensis Cyt toxins, which are involved in its pathogenicity to insects. We show here that these genes are transcribed as an operon, and we determined the conditions necessary for their expression. Their expression is induced at high temperature and at an osmolarity equivalent to that found in the plant phloem sap. The regulators of cyt genes have also been identified: their expression is repressed by H-NS and VfmE and activated by PecS. These genes are already known to regulate plant virulence factors, but in an opposite way. When tested in a virulence assay by ingestion, the pecS mutant was almost non-pathogenic while hns and vfmE mutants behaved in the same way as the wild-type strain. Mutants of other regulators of plant virulence, GacA, OmpR and PhoP, that do not control Cyt toxin production, also showed reduced pathogenicity. In an assay by injection of bacteria, the gacA strain was less pathogenic but, surprisingly, the pecS mutant was slightly more virulent. These results show that Cyt toxins are not the only virulence factors required to kill aphids, and that these factors act at different stages of the infection. Moreover, their production is controlled by general virulence regulators known for their role in plant virulence. This integration could indicate that virulence towards insects is a normal mode of life for D. dadantii. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  7. Amplification factor variable amplifier

    NARCIS (Netherlands)

    Akitsugu, Oshita; Nauta, Bram

    2007-01-01

    PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ; SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and

  8. Amplification factor variable amplifier

    NARCIS (Netherlands)

    Akitsugu, Oshita; Nauta, Bram

    2010-01-01

    PROBLEM TO BE SOLVED: To provide an amplification factor variable amplifier capable of achieving temperature compensation of an amplification factor over a wide variable amplification factor range. ;SOLUTION: A Gilbert type amplification factor variable amplifier 11 amplifies an input signal and can

  9. Foundations of factor analysis

    CERN Document Server

    Mulaik, Stanley A

    2009-01-01

    Introduction Factor Analysis and Structural Theories Brief History of Factor Analysis as a Linear Model Example of Factor AnalysisMathematical Foundations for Factor Analysis Introduction Scalar AlgebraVectorsMatrix AlgebraDeterminants Treatment of Variables as Vectors Maxima and Minima of FunctionsComposite Variables and Linear Transformations Introduction Composite Variables Unweighted Composite VariablesDifferentially Weighted Composites Matrix EquationsMulti

  10. Blood coagulation factor VIII

    Indian Academy of Sciences (India)

    Factor VIII (FVIII) functions as a co-factor in the blood coagulation cascade for the proteolytic activation of factor X by factor IXa. Deficiency of FVIII causes hemophilia A, the most commonly inherited bleeding disorder. This review highlights current knowledge on selected aspects of FVIII in which both the scientist and the ...

  11. Constructivism, Factoring, and Beliefs.

    Science.gov (United States)

    Rauff, James V.

    1994-01-01

    Discusses errors made by remedial intermediate algebra students in factoring polynomials in light of student definitions of factoring. Found certain beliefs about factoring to logically imply many of the errors made. Suggests that belief-based teaching can be successful in teaching factoring. (16 references) (Author/MKR)

  12. Factors affecting construction performance: exploratory factor analysis

    Science.gov (United States)

    Soewin, E.; Chinda, T.

    2018-04-01

    The present work attempts to develop a multidimensional performance evaluation framework for a construction company by considering all relevant measures of performance. Based on the previous studies, this study hypothesizes nine key factors, with a total of 57 associated items. The hypothesized factors, with their associated items, are then used to develop questionnaire survey to gather data. The exploratory factor analysis (EFA) was applied to the collected data which gave rise 10 factors with 57 items affecting construction performance. The findings further reveal that the items constituting ten key performance factors (KPIs) namely; 1) Time, 2) Cost, 3) Quality, 4) Safety & Health, 5) Internal Stakeholder, 6) External Stakeholder, 7) Client Satisfaction, 8) Financial Performance, 9) Environment, and 10) Information, Technology & Innovation. The analysis helps to develop multi-dimensional performance evaluation framework for an effective measurement of the construction performance. The 10 key performance factors can be broadly categorized into economic aspect, social aspect, environmental aspect, and technology aspects. It is important to understand a multi-dimension performance evaluation framework by including all key factors affecting the construction performance of a company, so that the management level can effectively plan to implement an effective performance development plan to match with the mission and vision of the company.

  13. The joy of factoring

    CERN Document Server

    Wagstaff, Samuel S

    2013-01-01

    This book is about the theory and practice of integer factorization presented in a historic perspective. It describes about twenty algorithms for factoring and a dozen other number theory algorithms that support the factoring algorithms. Most algorithms are described both in words and in pseudocode to satisfy both number theorists and computer scientists. Each of the ten chapters begins with a concise summary of its contents. The book starts with a general explanation of why factoring integers is important. The next two chapters present number theory results that are relevant to factoring. Further on there is a chapter discussing, in particular, mechanical and electronic devices for factoring, as well as factoring using quantum physics and DNA molecules. Another chapter applies factoring to breaking certain cryptographic algorithms. Yet another chapter is devoted to practical vs. theoretical aspects of factoring. The book contains more than 100 examples illustrating various algorithms and theorems. It also co...

  14. RpoH2 sigma factor controls the photooxidative stress response in a non-photosynthetic rhizobacterium, Azospirillum brasilense Sp7.

    Science.gov (United States)

    Kumar, Santosh; Rai, Ashutosh Kumar; Mishra, Mukti Nath; Shukla, Mansi; Singh, Pradhyumna Kumar; Tripathi, Anil Kumar

    2012-12-01

    Bacteria belonging to the Alphaproteobacteria normally harbour multiple copies of the heat shock sigma factor (known as σ(32), σ(H) or RpoH). Azospirillum brasilense, a non-photosynthetic rhizobacterium, harbours five copies of rpoH genes, one of which is an rpoH2 homologue. The genes around the rpoH2 locus in A. brasilense show synteny with that found in rhizobia. The rpoH2 of A. brasilense was able to complement the temperature-sensitive phenotype of the Escherichia coli rpoH mutant. Inactivation of rpoH2 in A. brasilense results in increased sensitivity to methylene blue and to triphenyl tetrazolium chloride (TTC). Exposure of A. brasilense to TTC and the singlet oxygen-generating agent methylene blue induced several-fold higher expression of rpoH2. Comparison of the proteome of A. brasilense with its rpoH2 deletion mutant and with an A. brasilense strain overexpressing rpoH2 revealed chaperone GroEL, elongation factors (Ef-Tu and EF-G), peptidyl prolyl isomerase, and peptide methionine sulfoxide reductase as the major proteins whose expression was controlled by RpoH2. Here, we show that the RpoH2 sigma factor-controlled photooxidative stress response in A. brasilense is similar to that in the photosynthetic bacterium Rhodobacter sphaeroides, but that RpoH2 is not involved in the detoxification of methylglyoxal in A. brasilense.

  15. Factor requirements for transcription in the Archaeon Sulfolobus shibatae.

    OpenAIRE

    Qureshi, S A; Bell, S D; Jackson, S P

    1997-01-01

    Archaea (archaebacteria) constitute a domain of life that is distinct from Bacteria (eubacteria) and Eucarya (eukaryotes). Although archaeal cells share many morphological features with eubacteria, their transcriptional apparatus is more akin to eukaryotic RNA polymerases I, II and III than it is to eubacterial transcription systems. Thus, in addition to possessing a 10 subunit RNA polymerase and a homologue of the TATA-binding protein (TBP), Archaea possess a polypeptide termed TFB that is h...

  16. Factor VII deficiency

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000548.htm Factor VII deficiency To use the sharing features on this page, please enable JavaScript. Factor VII (seven) deficiency is a disorder caused by a ...

  17. Annual Adjustment Factors

    Data.gov (United States)

    Department of Housing and Urban Development — The Department of Housing and Urban Development establishes the rent adjustment factors - called Annual Adjustment Factors (AAFs) - on the basis of Consumer Price...

  18. Stroke - risk factors

    Science.gov (United States)

    ... oxygen. Brain cells can die, causing lasting damage. Risk factors are things that increase your chance of ... a disease or condition. This article discusses the risk factors for stroke and things you can do ...

  19. Hydrophobic environment is a key factor for the stability of thermophilic proteins.

    Science.gov (United States)

    Gromiha, M Michael; Pathak, Manish C; Saraboji, Kadhirvel; Ortlund, Eric A; Gaucher, Eric A

    2013-04-01

    The stability of thermophilic proteins has been viewed from different perspectives and there is yet no unified principle to understand this stability. It would be valuable to reveal the most important interactions for designing thermostable proteins for such applications as industrial protein engineering. In this work, we have systematically analyzed the importance of various interactions by computing different parameters such as surrounding hydrophobicity, inter-residue interactions, ion-pairs and hydrogen bonds. The importance of each interaction has been determined by its predicted relative contribution in thermophiles versus the same contribution in mesophilic homologues based on a dataset of 373 protein families. We predict that hydrophobic environment is the major factor for the stability of thermophilic proteins and found that 80% of thermophilic proteins analyzed showed higher hydrophobicity than their mesophilic counterparts. Ion pairs, hydrogen bonds, and interaction energy are also important and favored in 68%, 50%, and 62% of thermophilic proteins, respectively. Interestingly, thermophilic proteins with decreased hydrophobic environments display a greater number of hydrogen bonds and/or ion pairs. The systematic elimination of mesophilic proteins based on surrounding hydrophobicity, interaction energy, and ion pairs/hydrogen bonds, led to correctly identifying 95% of the thermophilic proteins in our analyses. Our analysis was also applied to another, more refined set of 102 thermophilic-mesophilic pairs, which again identified hydrophobicity as a dominant property in 71% of the thermophilic proteins. Further, the notion of surrounding hydrophobicity, which characterizes the hydrophobic behavior of residues in a protein environment, has been applied to the three-dimensional structures of elongation factor-Tu proteins and we found that the thermophilic proteins are enriched with a hydrophobic environment. The results obtained in this work highlight the

  20. Placental growth factor and its potential role in diabetic retinopathy and other ocular neovascular diseases.

    Science.gov (United States)

    Nguyen, Quan Dong; De Falco, Sandro; Behar-Cohen, Francine; Lam, Wai-Ching; Li, Xuri; Reichhart, Nadine; Ricci, Federico; Pluim, Jennifer; Li, William W

    2018-02-01

    The role of vascular endothelial growth factor (VEGF), including in retinal vascular diseases, has been well studied, and pharmacological blockade of VEGF is the gold standard of treatment for neovascular age-related macular degeneration, retinal vein occlusion and diabetic macular oedema. Placental growth factor (PGF, previously known as PlGF), a homologue of VEGF, is a multifunctional peptide associated with angiogenesis-dependent pathologies in the eye and non-ocular conditions. Animal studies using genetic modification and pharmacological treatment have demonstrated a mechanistic role for PGF in pathological angiogenesis. Inhibition decreases neovascularization and microvascular abnormalities across different models, including oxygen-induced retinopathy, laser-induced choroidal neovascularization and in diabetic mice exhibiting retinopathies. High levels of PGF have been found in the vitreous of patients with diabetic retinopathy. Despite these strong animal data, the exact role of PGF in pathological angiogenesis in retinal vascular diseases remains to be defined, and the benefits of PGF-specific inhibition in humans with retinal neovascular diseases and macular oedema remain controversial. Comparative effectiveness research studies in patients with diabetic retinal disease have shown that treatment that inhibits both VEGF and PGF may provide superior outcomes in certain patients compared with treatment that inhibits only VEGF. This review summarizes current knowledge of PGF, including its relationship to VEGF and its role in pathological angiogenesis in retinal diseases, and identifies some key unanswered questions about PGF that can serve as a pathway for future basic, translational and clinical research. © 2016 The Authors. Acta Ophthalmologica published by John Wiley & Sons Ltd on behalf of Acta Ophthalmologica Scandinavica Foundation and European Association for Vision & Eye Research.

  1. Human factors in training

    International Nuclear Information System (INIS)

    Dutton, J.W.; Brown, W.R.

    1981-01-01

    The Human Factors concept is a focused effort directed at those activities which require human involvement. Training is, by its nature, an activity totally dependent on the Human Factor. This paper identifies several concerns significant to training situations and discusses how Human Factor awareness can increase the quality of learning. Psychology in the training arena is applied Human Factors. Training is a method of communication represented by sender, medium, and receiver. Two-thirds of this communications model involves the human element directly

  2. Neutron electromagnetic form factors

    International Nuclear Information System (INIS)

    Finn, J.M.; Madey, R.; Eden, T.; Markowitz, P.; Rutt, P.M.; Beard, K.; Anderson, B.D.; Baldwin, A.R.; Keane, D.; Manley, D.M.; Watson, J.W.; Zhang, W.M.; Kowalski, S.; Bertozzi, W.; Dodson, G.; Farkhondeh, M.; Dow, K.; Korsch, W.; Tieger, D.; Turchinetz, W.; Weinstein, L.; Gross, F.; Mougey, J.; Ulmer, P.; Whitney, R.; Reichelt, T.; Chang, C.C.; Kelly, J.J.; Payerle, T.; Cameron, J.; Ni, B.; Spraker, M.; Barkhuff, D.; Lourie, R.; Verst, S.V.; Hyde-Wright, C.; Jiang, W.-D.; Flanders, B.; Pella, P.; Arenhoevel, H.

    1992-01-01

    Nucleon form factors provide fundamental input for nuclear structure and quark models. Current knowledge of neutron form factors, particularly the electric form factor of the neutron, is insufficient to meet these needs. Developments of high-duty-factor accelerators and polarization-transfer techniques permit new experiments that promise results with small sensitivities to nuclear models. We review the current status of the field, our own work at the MIT/Bates linear accelerator, and future experimental efforts

  3. Disconnected electromagnetic form factors

    International Nuclear Information System (INIS)

    Wilcox, Walter

    2001-01-01

    Preliminary results of a calculation of disconnected nucleon electromagnetic factors factors on the lattice are presented. The implementation of the numerical subtraction scheme is outlined. A comparison of results for electric and magnetic disconnected form factors on two lattice sizes with those of the Kentucky group is presented. Unlike previous results, the results found in this calculation are consistent with zero in these sectors

  4. Mesonic Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Frederic D. R. Bonnet; Robert G. Edwards; George T. Fleming; Randal Lewis; David Richards

    2003-07-22

    We have started a program to compute the electromagnetic form factors of mesons. We discuss the techniques used to compute the pion form factor and present preliminary results computed with domain wall valence fermions on MILC asqtad lattices, as well as Wilson fermions on quenched lattices. These methods can easily be extended to rho-to-gamma-pi transition form factors.

  5. Transcriptomic insight into pathogenicity-associated factors of Conidiobolus obscurus, an obligate aphid-pathogenic fungus belonging to Entomopthoromycota.

    Science.gov (United States)

    Wang, Jianghong; Zhou, Xiang; Guo, Kai; Zhang, Xinqi; Lin, Haiping; Montalva, Cristian

    2018-01-16

    Conidiobolus obscurus is a widespread fungal entomopathogen with aphid biocontrol potential. This study focused on a de novo transcriptomic analysis of C. obscurus. A number of pathogenicity-associated factors were annotated for the first time from the assembled 17 231 fungal unigenes, including those encoding subtilisin-like proteolytic enzymes (Pr1s), trypsin-like proteases, metalloproteases, carboxypeptidases and endochitinases. Many of these genes were transcriptionally up-regulated by at least twofold in mycotized cadavers compared with the in vitro fungal cultures. The resultant transcriptomic database was validated by the transcript levels of three selected pathogenicity-related genes quantified from different in vivo and in vitro material in real-time quantitative polymerase chain reaction (PCR). The involvement of multiple Pr1 proteases in the first stage of fungal infection was also suggested. Interestingly, a unique cytolytic (Cyt)-like δ-endotoxin gene was highly expressed in both mycotized cadavers and fungal cultures, and was more or less distinct from its homologues in bacteria and other fungi. Our findings provide the first global insight into various pathogenicity-related genes in this obligate aphid pathogen and may help to develop novel biocontrol strategy against aphid pests. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  6. The pro1(+) gene from Sordaria macrospora encodes a C6 zinc finger transcription factor required for fruiting body development.

    Science.gov (United States)

    Masloff, S; Pöggeler, S; Kück, U

    1999-05-01

    During sexual morphogenesis, the filamentous ascomycete Sordaria macrospora differentiates into multicellular fruiting bodies called perithecia. Previously it has been shown that this developmental process is under polygenic control. To further understand the molecular mechanisms involved in fruiting body formation, we generated the protoperithecia forming mutant pro1, in which the normal development of protoperithecia into perithecia has been disrupted. We succeeded in isolating a cosmid clone from an indexed cosmid library, which was able to complement the pro1(-) mutation. Deletion analysis, followed by DNA sequencing, subsequently demonstrated that fertility was restored to the pro1 mutant by an open reading frame encoding a 689-amino-acid polypeptide, which we named PRO1. A region from this polypeptide shares significant homology with the DNA-binding domains found in fungal C6 zinc finger transcription factors, such as the GAL4 protein from yeast. However, other typical regions of C6 zinc finger proteins, such as dimerization elements, are absent in PRO1. The involvement of the pro1(+) gene in fruiting body development was further confirmed by trying to complement the mutant phenotype with in vitro mutagenized and truncated versions of the pro1 open reading frame. Southern hybridization experiments also indicated that pro1(+) homologues are present in other sexually propagating filamentous ascomycetes.

  7. Molecular cloning, characterization, and expression of human ADP-ribosylation factors: Two guanine nucleotide-dependent activators of cholera toxin

    International Nuclear Information System (INIS)

    Bobak, D.A.; Nightingale, M.S.; Murtagh, J.J.; Price, S.R.; Moss, J.; Vaughan, M.

    1989-01-01

    ADP-ribosylation factors (ARFs) are small guanine nucleotide-binding proteins that enhance the enzymatic activities of cholera toxin. Two ARF cDNAs, ARF1 and ARF3, were cloned from a human cerebellum library. Based on deduced amino acid sequences and patterns of hybridization of cDNA and oligonucleotide probes with mammalian brain poly(A) + RNA, human ARF1 is the homologue of bovine ARF1. Human ARF3, which differs from bovine ARF1 and bovine ARF2, appears to represent a newly identified third type of ARF. Hybridization patterns of human ARF cDNA and clone-specific oligonucleotides with poly(A) + RNA are consistent with the presence of at least two, and perhaps four, separate ARF messages in human brain. In vitro translation of ARF1, ARF2, and ARF3 produced proteins that behaved, by SDS/PAGE, similar to a purified soluble brain ARF. Deduced amino acid sequences of human ARF1 and ARF3 contain regions, similar to those in other G proteins, that are believed to be involved in GTP binding and hydrolysis. ARFS also exhibit a modest degree of homology with a bovine phospholipase C. The observations reported here support the conclusion that the ARFs are members of a multigene family of small guanine nucleotide-binding proteins. Definition of the regulation of ARF mRNAs and of function(s) of recombinant ARF proteins will aid in the elucidation of the physiologic role(s) of ARFs

  8. Cytokine-like factor-1, a novel soluble protein, shares homology with members of the cytokine type I receptor family.

    Science.gov (United States)

    Elson, G C; Graber, P; Losberger, C; Herren, S; Gretener, D; Menoud, L N; Wells, T N; Kosco-Vilbois, M H; Gauchat, J F

    1998-08-01

    In this report we describe the identification, cloning, and expression pattern of human cytokine-like factor 1 (hCLF-1) and the identification and cloning of its murine homologue. They were identified from expressed sequence tags using amino acid sequences from conserved regions of the cytokine type I receptor family. Human CLF-1 and murine CLF-1 shared 96% amino acid identity and significant homology with many cytokine type I receptors. CLF-1 is a secreted protein, suggesting that it is either a soluble subunit within a cytokine receptor complex, like the soluble form of the IL-6R alpha-chain, or a subunit of a multimeric cytokine, e.g., IL-12 p40. The highest levels of hCLF-1 mRNA were observed in lymph node, spleen, thymus, appendix, placenta, stomach, bone marrow, and fetal lung, with constitutive expression of CLF-1 mRNA detected in a human kidney fibroblastic cell line. In fibroblast primary cell cultures, CLF-1 mRNA was up-regulated by TNF-alpha, IL-6, and IFN-gamma. Western blot analysis of recombinant forms of hCLF-1 showed that the protein has the tendency to form covalently linked di- and tetramers. These results suggest that CLF-1 is a novel soluble cytokine receptor subunit or part of a novel cytokine complex, possibly playing a regulatory role in the immune system and during fetal development.

  9. A Staphylococcus aureus TIR domain protein virulence factor blocks TLR2-mediated NF-κB signaling.

    Science.gov (United States)

    Askarian, Fatemeh; van Sorge, Nina M; Sangvik, Maria; Beasley, Federico C; Henriksen, Jørn R; Sollid, Johanna U E; van Strijp, Jos A G; Nizet, Victor; Johannessen, Mona

    2014-01-01

    Signaling through Toll-like receptors (TLRs), crucial molecules in the induction of host defense responses, requires adaptor proteins that contain a Toll/interleukin-1 receptor (TIR) domain. The pathogen Staphylococcus aureus produces several innate immune-evasion molecules that interfere with the host's innate immune response. A database search analysis suggested the presence of a gene encoding a homologue of the human TIR domain in S. aureus MSSA476 which was named staphylococcal TIR domain protein (TirS). Ectopic expression of TirS in human embryonic kidney, macrophage and keratinocyte cell lines interfered with signaling through TLR2, including MyD88 and TIRAP, NF-κB and/or mitogen-activated protein kinase pathways. Moreover, the presence of TirS reduced the levels of cytokines MCP-1 and G-CSF secreted in response to S. aureus. The effects on NF-κB pathway were confirmed using S. aureus MSSA476 wild type, an isogenic mutant MSSA476ΔtirS, and complemented MSSA476ΔtirS +pTirS in a Transwell system where bacteria and host cells were physically separated. Finally, in a systematic mouse infection model, TirS promoted bacterial accumulation in several organs 4 days postinfection. The results of this study reveal a new S. aureus virulence factor that can interfere with PAMP-induced innate immune signaling in vitro and bacterial survival in vivo. © 2014 S. Karger AG, Basel.

  10. Characterization of a Staphylococcus aureus surface virulence factor that promotes resistance to oxidative killing and infectious endocarditis.

    Science.gov (United States)

    Malachowa, Natalia; Kohler, Petra L; Schlievert, Patrick M; Chuang, Olivia N; Dunny, Gary M; Kobayashi, Scott D; Miedzobrodzki, Jacek; Bohach, Gregory A; Seo, Keun Seok

    2011-01-01

    Staphylococcus aureus is a prominent human pathogen and a leading cause of community- and hospital-acquired bacterial infections worldwide. Herein, we describe the identification and characterization of the S. aureus 67.6-kDa hypothetical protein, named for the surface factor promoting resistance to oxidative killing (SOK) in this study. Sequence analysis showed that the SOK gene is conserved in all sequenced S. aureus strains and homologous to the myosin cross-reactive antigen of Streptococcus pyogenes. Immunoblotting and immunofluorescence analysis showed that SOK was copurified with membrane fractions and was exposed on the surface of S. aureus Newman and RN4220. Comparative analysis of wild-type S. aureus and an isogenic deletion strain indicated that SOK contributes to both resistance to killing by human neutrophils and to oxidative stress. In addition, the S. aureus sok deletion strain showed dramatically reduced aortic valve vegetation and bacterial cell number in a rabbit endocarditis model. These results, plus the suspected role of the streptococcal homologue in certain diseases such as acute rheumatic fever, suggest that SOK plays an important role in cardiovascular and other staphylococcal infections.

  11. Transcription factor DecR (YbaO) controls detoxification of L-cysteine in Escherichia coli.

    Science.gov (United States)

    Shimada, Tomohiro; Tanaka, Kan; Ishihama, Akira

    2016-09-01

    YbaO is an uncharacterized AsnC-family transcription factor of Escherichia coli. In both Salmonella enterica and Pantoea ananatis, YbaO homologues were identified to regulate the adjacent gene encoding cysteine desulfhydrase for detoxification of cysteine. Using the genomic SELEX (systematic evolution of ligands by exponential enrichment) screening system, we identified the yhaOM operon, located far from the ybaO gene on the E. coli genome, as a single regulatory target of YbaO. In both gel shift assay in vitro and reporter and Northern blot assays in vivo, YbaO was found to regulate the yhaOM promoter. The growth of mutants lacking either ybaO or its targets yhaOM was delayed in the presence of cysteine, indicating involvement of these genes in cysteine detoxification. In the major pathway of cysteine degradation, hydrogen sulfide is produced in wild-type E. coli, but its production was not observed in each of the ybaO, yhaO and yhaM mutants. The yhaOM promoter was activated in the presence of cysteine, implying the role of cysteine in activation of YbaO. Taken together, we propose that YbaO is the cysteine-sensing transcriptional activator of the yhaOM operon, which is involved in the detoxification of cysteine. We then propose the naming of ybaO as decR (regulator of detoxification of cysteine).

  12. demographic factors associated factors associated with malaria

    African Journals Online (AJOL)

    userpc

    .8%) than those in other nce of 35.4% which was actors can predispose alence of malaria in a study were significantly eveloping guidelines and more effective disease endemic areas (Bashar et therefore attempts to rmation on possible demographic factors d out in four selected geria; Major Ibrahim B. Hospital Zaria, Hajiya.

  13. [Identification of an auxin response factor-like protein cDNA from mango cotyledon section].

    Science.gov (United States)

    Xiao, Jie-Ning; Huang, Xue-Lin; Huang, Xia; Li, Xiao-Ju

    2004-01-01

    Auxin-responsive elements (AuxRE) interact with a new class of plant-specific transcription factors, auxin response factors (ARFs). Some of ARFs have been shown to repress or activate expression of genes with an AuxRE promotor element. In Arabidopsis, ARFs play important roles in early embryo development and vascular strand formation (ARF5), floral patterning (ARF3) and photo- and gravitropic responses (ARF7). Two cut surfaces (distal and proximal) of mango (Mangifera indica L. var. Zi-Hua) cotyledon showed different patterns of adventitious root formation, with only the proximal cut surface, but not the distal one, could be induced to form the roots. Thus, the mango cotyledon is a good system for studying adventitious root formation. A cDNA fragment homologous to the Arabidopsis auxin response factor-like protein and relates to adventitious root formation from the cut sections were isolated using suppressive subtractive hybridization (SSH). Two cDNA clones, designated as MiARF1 (mango auxin response factor 1 gene, GenBank accession number AY255705) and MiARF2 (mango auxin response factor 2 gene, GenBank accession number is AY300808), were identified by 3'RACE. MiARF1, 3 272bp long, contains an open reading frame (ORF) of 2 523bp, 5'UTR of 285bp and 3'UTR of 464bp, MiARF2, 1 474bp long, contains an ORF of 981bp, 5' UTR of 285bp and 3'UTR of 208bp. The deduced MiARF1 and MiARF2 are homologues of auxin response factor (ARF) family of transcriptional regulators, and show high similarity to ARF of Arabidopsis in conserved domains. The motifs of MiARF1 EL-WHACAGPL in DBD (DNA binding domain) and GDDPW in IV domain are identical to that of ARF-like protein of Arabidopsis. MiARF2 is identical to MiARF1 in a large part of DBD, but lacks a carboxyl-terminal domain containing conserved motifs III and IV. Virtual Northern blot showed that the expression of MiARF2 was high in rooting tissue of cultured cotyledon sections but low in non-rooting tissue, and the MiARF1 was

  14. Aspects of QCD factorization

    International Nuclear Information System (INIS)

    Neubert, Matthias

    2001-01-01

    The QCD factorization approach provides the theoretical basis for a systematic analysis of nonleptonic decay amplitudes of B mesons in the heavy-quark limit. After recalling the basic ideas underlying this formalism, several tests of QCD factorization in the decays B→D (*) L, B→K * γ, and B→πK, ππ are discussed. It is then illustrated how factorization can be used to obtain new constraints on the parameters of the unitarity triangle

  15. Oversimplifying quantum factoring.

    Science.gov (United States)

    Smolin, John A; Smith, Graeme; Vargo, Alexander

    2013-07-11

    Shor's quantum factoring algorithm exponentially outperforms known classical methods. Previous experimental implementations have used simplifications dependent on knowing the factors in advance. However, as we show here, all composite numbers admit simplification of the algorithm to a circuit equivalent to flipping coins. The difficulty of a particular experiment therefore depends on the level of simplification chosen, not the size of the number factored. Valid implementations should not make use of the answer sought.

  16. Radioimmunoassay of human Hageman factor (factor XII)

    International Nuclear Information System (INIS)

    Saito, H.; Ratnoff, O.D.; Pensky, J.

    1976-01-01

    A specific, sensitive, and reproducible radioimmunoassay for human Hageman factor (HF, factor XII) has been developed with purified human HF and monospecific rabbit antibody. Precise measurements of HF antigen were possible for concentrations as low as 0.1 percent of that in normal pooled plasma. A good correlation (correlation coefficient = 0.82) existed between the titers of HF measured by clot-promoting assays and radioimmunoassays among 42 normal adults. Confirming earlier studies, HF antigen was absent in Hageman trait plasma, but other congenital deficient plasmas, including those of individuals with Fletcher trait and Fitzgerald trait, contained normal amounts of HF antigen. HF antigen was reduced in the plasmas of patients with disseminated intravascular coagulation or advanced liver cirrhosis, but it was normal in those of patients with chronic renal failure or patients under treatment with warfarin. HF antigen was detected by this assay in plasmas of primates, but not detectable in plasmas of 11 nonprimate mammalian and one avian species

  17. Isoxanthohumol, a constituent of hop (Humulus lupulus L.), increases stress resistance in Caenorhabditis elegans dependent on the transcription factor DAF-16.

    Science.gov (United States)

    Büchter, Christian; Havermann, Susannah; Koch, Karoline; Wätjen, Wim

    2016-02-01

    The flavanone isoxanthohumol (IX) has gained attention as antioxidative and chemopreventive agent, but the molecular mechanism of action remains unclear. We investigated effects of this secondary plant compound in vivo using the model organism Caenorhabditis elegans. Adult C. elegans nematodes were incubated with IX, and then, the stress resistance was analysed in the SYTOX assay; lifespan was monitored by touch-provoked movement method, the amount of reactive oxygen species (ROS) was measured in the DCF assay, and the nuclear localisation of the transcription factor DAF-16 was analysed by using a transgenic strain. By the use of a DAF-16 loss-of-function strain, we analysed whether the effects are dependent on DAF-16. IX increases the resistance of the nematode against thermal stress. Additionally, a reduction in ROS in vivo was caused by IX. Since the flavanone only has a marginal radical-scavenging capacity (TEAC assay), we suggest that IX mediates its antioxidative effects indirectly via activation of DAF-16 (homologue to mammalian FOXO proteins). The nuclear translocation of this transcription factor is increased by IX. In the DAF-16-mutated strain, the IX-mediated increase in stress resistance was completely abolished; furthermore, an increased formation of ROS and a reduced lifespan was mediated by IX. IX or a bacterial metabolite of IX causes antioxidative effects as well as an increased stress resistance in C. elegans via activation of DAF-16. The homologous pathway may have implications in the molecular mechanism of IX in mammals.

  18. What Are Rare Clotting Factor Deficiencies?

    Science.gov (United States)

    ... Deficiency Factor V Deficiency Combined FV & FVIII Deficiencies Factor VII Deficiency Factor X Deficiency Factor XI Deficiency Factor ... Deficiency Factor V Deficiency Combined FV & FVIII Deficiencies Factor VII Deficiency Factor X Deficiency Factor XI Deficiency Factor ...

  19. PAYMENT CAPACITY SENSITIVITY FACTORS

    Directory of Open Access Journals (Sweden)

    Daniel BRÎNDESCU – OLARIU

    2014-11-01

    The results of the study facilitate the determination and classification of the main sensitivity factors for the payment capacity at sample level, the establishment of general benchmarks for the payment capacity (as no such benchmarks currently exist in the Romanian literature and the identification of the mechanisms through which the variation of different factors impacts the payment capacity.

  20. Respirator field performance factors

    International Nuclear Information System (INIS)

    Skaggs, B.J.; DeField, J.D.; Strandberg, S.W.; Sutcliffe, C.R.

    1985-01-01

    The Industrial Hygiene Group assisted OSHA and the NRC in measurements of respirator performance under field conditions. They reviewed problems associated with sampling aerosols within the respirator in order to determine fit factors (FFs) or field performance factor (FPF). In addition, they designed an environmental chamber study to determine the effects of temperature and humidity on a respirator wearer

  1. Factors affecting nuclear development

    International Nuclear Information System (INIS)

    Stevens, G.H.; Girouard, P.

    1995-01-01

    Among the factors affecting nuclear development, some depend more or less on public authorities, but many are out of public authorities control (foreign policies, market and deregulation, socials and environmental impacts, public opinion). As far as possible, the following study tries to identify those factors. (D.L.). 2 photos

  2. Soil Forming Factors

    Science.gov (United States)

    It! What is Soil? Chip Off the Old Block Soil Forming Factors Matters of Life and Death Underneath It All Wise Choices A World of Soils Soil Forming Factors 2 A Top to Bottom Guide 3 Making a Soil Monolith 4 Soil Orders 5 State Soil Monoliths 6 Where in the Soil World Are You? >> A Top to

  3. Transcription factor ART1 mediates starch hydrolysis and mycotoxin production in Fusarium graminearum and F. verticillioides.

    Science.gov (United States)

    Oh, Mira; Son, Hokyoung; Choi, Gyung Ja; Lee, Chanhui; Kim, Jin-Cheol; Kim, Hun; Lee, Yin-Won

    2016-06-01

    Molecular mechanisms underlying the responses to environmental factors, such as nitrogen, carbon and pH, involve components that regulate the production of secondary metabolites, including mycotoxins. In this study, we identified and characterized a gene in the FGSG_02083 locus, designated as FgArt1, which was predicted to encode a Zn(II)2 Cys6 zinc finger transcription factor. An FgArt1 deletion mutant of Fusarium graminearum exhibited impaired starch hydrolysis as a result of significantly reduced α-amylase gene expression. The deletion strain was unable to produce trichothecenes and exhibited low Tri5 and Tri6 expression levels, whereas the complemented strain showed a similar ability to produce trichothecenes as the wild-type strain. In addition, FgArt1 deletion resulted in impairment of germination in starch liquid medium and reduced pathogenicity on flowering wheat heads. To investigate the roles of the FgArt1 homologue in F. verticillioides, we deleted the FVEG_02083 gene, and the resulting strain showed defects in starch hydrolysis, similar to the FgArt1 deletion strain, and produced no detectable level of fumonisin B1 . Fum1 and Fum12 expression levels were undetectable in the deletion strain. However, when the FvArt1-deleted F. verticillioides strain was complemented with FgArt1, the resulting strain was unable to recover the production of fumonisin B1 , although FgArt1 expression and starch hydrolysis were induced. Thus, our results suggest that there are different regulatory pathways governed by each ART1 transcription factor in trichothecene and fumonisin biosynthesis. Taken together, we suggest that ART1 plays an important role in both trichothecene and fumonisin biosynthesis by the regulation of genes involved in starch hydrolysis. © 2015 BSPP AND JOHN WILEY & SONS LTD.

  4. Molecular cloning and expression analysis of fushi tarazu factor 1 in the brain of air-breathing catfish, Clarias gariepinus.

    Directory of Open Access Journals (Sweden)

    Parikipandla Sridevi

    Full Text Available BACKGROUND: Fushi tarazu factor 1 (FTZ-F1 encodes an orphan nuclear receptor belonging to the nuclear receptor family 5A (NR5A which includes adrenal 4-binding protein or steroidogenic factor-1 (Ad4BP/SF-1 and liver receptor homologue 1 (LRH-1 and plays a pivotal role in the regulation of aromatases. METHODOLOGY/PRINCIPAL FINDINGS: Present study was aimed to understand the importance of FTZ-F1 in relation to brain aromatase (cyp19a1b during development, recrudescence and after human chorionic gonadotropin (hCG induction. Initially, we cloned FTZ-F1 from the brain of air-breathing catfish, Clarias gariepinus through degenerate primer RT-PCR and RACE. Its sequence analysis revealed high homology with other NR5A1 group members Ad4BP/SF-1 and LRH-1, and also analogous to the spatial expression pattern of the latter. In order to draw functional correlation of cyp19a1b and FTZ-F1, we analyzed the expression pattern of the latter in brain during gonadal ontogeny, which revealed early expression during gonadal differentiation. The tissue distribution both at transcript and protein levels revealed its prominent expression in brain along with liver, kidney and testis. The expression pattern of brain FTZ-F1 during reproductive cycle and after hCG induction, in vivo was analogous to that of cyp19a1b shown in our earlier study indicating its involvement in recrudescence. CONCLUSIONS/SIGNIFICANCE: Based on our previous results on cyp19a1b and the present data, it is plausible to implicate potential roles for brain FTZ-F1 in ovarian differentiation and recrudescence process probably through regulation of cyp19a1b in teleosts. Nevertheless, these interactions would require primary coordinated response from ovarian aromatase and its related transcription factors.

  5. SNPs altering ammonium transport activity of human Rhesus factors characterized by a yeast-based functional assay.

    Directory of Open Access Journals (Sweden)

    Aude Deschuyteneer

    Full Text Available Proteins of the conserved Mep-Amt-Rh family, including mammalian Rhesus factors, mediate transmembrane ammonium transport. Ammonium is an important nitrogen source for the biosynthesis of amino acids but is also a metabolic waste product. Its disposal in urine plays a critical role in the regulation of the acid/base homeostasis, especially with an acid diet, a trait of Western countries. Ammonium accumulation above a certain concentration is however pathologic, the cytotoxicity causing fatal cerebral paralysis in acute cases. Alteration in ammonium transport via human Rh proteins could have clinical outcomes. We used a yeast-based expression assay to characterize human Rh variants resulting from non synonymous single nucleotide polymorphisms (nsSNPs with known or unknown clinical phenotypes and assessed their ammonium transport efficiency, protein level, localization and potential trans-dominant impact. The HsRhAG variants (I61R, F65S associated to overhydrated hereditary stomatocytosis (OHSt, a disease affecting erythrocytes, proved affected in intrinsic bidirectional ammonium transport. Moreover, this study reveals that the R202C variant of HsRhCG, the orthologue of mouse MmRhcg required for optimal urinary ammonium excretion and blood pH control, shows an impaired inherent ammonium transport activity. Urinary ammonium excretion was RHcg gene-dose dependent in mouse, highlighting MmRhcg as a limiting factor. HsRhCG(R202C may confer susceptibility to disorders leading to metabolic acidosis for instance. Finally, the analogous R211C mutation in the yeast ScMep2 homologue also impaired intrinsic activity consistent with a conserved functional role of the preserved arginine residue. The yeast expression assay used here constitutes an inexpensive, fast and easy tool to screen nsSNPs reported by high throughput sequencing or individual cases for functional alterations in Rh factors revealing potential causal variants.

  6. The Hog1p kinase regulates Aft1p transcription factor to control iron accumulation.

    Science.gov (United States)

    Martins, Telma S; Pereira, Clara; Canadell, David; Vilaça, Rita; Teixeira, Vítor; Moradas-Ferreira, Pedro; de Nadal, Eulàlia; Posas, Francesc; Costa, Vítor

    2018-01-01

    Iron acquisition systems have to be tightly regulated to assure a continuous supply of iron, since it is essential for survival, but simultaneously to prevent iron overload that is toxic to the cells. In budding yeast, the low‑iron sensing transcription factor Aft1p is a master regulator of the iron regulon. Our previous work revealed that bioactive sphingolipids modulate iron homeostasis as yeast cells lacking the sphingomyelinase Isc1p exhibit an upregulation of the iron regulon. In this study, we show that Isc1p impacts on iron accumulation and localization. Notably, Aft1p is activated in isc1Δ cells due to a decrease in its phosphorylation and an increase in its nuclear levels. Consistently, the expression of a phosphomimetic version of Aft1p-S210/S224 that favours its nuclear export abolished iron accumulation in isc1Δ cells. Notably, the Hog1p kinase, homologue of mammalian p38, interacts with and directly phosphorylates Aft1p at residues S210 and S224. However, Hog1p-Aft1p interaction decreases in isc1Δ cells, which likely contributes to Aft1p dephosphorylation and consequently to Aft1p activation and iron overload in isc1Δ cells. These results suggest that alterations in sphingolipid composition in isc1Δ cells may impact on iron homeostasis by disturbing the regulation of Aft1p by Hog1p. To our knowledge, Hog1p is the first kinase reported to directly regulate Aft1p, impacting on iron homeostasis. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. dDYRK2 and Minibrain interact with the chromatin remodelling factors SNR1 and TRX.

    Science.gov (United States)

    Kinstrie, Ross; Lochhead, Pamela A; Sibbet, Gary; Morrice, Nick; Cleghon, Vaughn

    2006-08-15

    The DYRKs (dual specificity tyrosine phosphorylation-regulated kinases) are a conserved family of protein kinases that autophosphorylate a tyrosine residue in their activation loop by an intra-molecular mechanism and phosphorylate exogenous substrates on serine/threonine residues. Little is known about the identity of true substrates for DYRK family members and their binding partners. To address this question, we used full-length dDYRK2 (Drosophila DYRK2) as bait in a yeast two-hybrid screen of a Drosophila embryo cDNA library. Of 14 independent dDYRK2 interacting clones identified, three were derived from the chromatin remodelling factor, SNR1 (Snf5-related 1), and three from the essential chromatin component, TRX (trithorax). The association of dDYRK2 with SNR1 and TRX was confirmed by co-immunoprecipitation studies. Deletion analysis showed that the C-terminus of dDYRK2 modulated the interaction with SNR1 and TRX. DYRK family member MNB (Minibrain) was also found to co-precipitate with SNR1 and TRX, associations that did not require the C-terminus of the molecule. dDYRK2 and MNB were also found to phosphorylate SNR1 at Thr102 in vitro and in vivo. This phosphorylation required the highly conserved DH-box (DYRK homology box) of dDYRK2, whereas the DH-box was not essential for phosphorylation by MNB. This is the first instance of phosphorylation of SNR1 or any of its homologues and implicates the DYRK family of kinases with a role in chromatin remodelling.

  8. Comparative Biochemical and Functional Analysis of Viral and Human Secreted Tumor Necrosis Factor (TNF) Decoy Receptors*

    Science.gov (United States)

    Pontejo, Sergio M.; Alejo, Ali; Alcami, Antonio

    2015-01-01

    The blockade of tumor necrosis factor (TNF) by etanercept, a soluble version of the human TNF receptor 2 (hTNFR2), is a well established strategy to inhibit adverse TNF-mediated inflammatory responses in the clinic. A similar strategy is employed by poxviruses, encoding four viral TNF decoy receptor homologues (vTNFRs) named cytokine response modifier B (CrmB), CrmC, CrmD, and CrmE. These vTNFRs are differentially expressed by poxviral species, suggesting distinct immunomodulatory properties. Whereas the human variola virus and mouse ectromelia virus encode one vTNFR, the broad host range cowpox virus encodes all vTNFRs. We report the first comprehensive study of the functional and binding properties of these four vTNFRs, providing an explanation for their expression profile among different poxviruses. In addition, the vTNFRs activities were compared with the hTNFR2 used in the clinic. Interestingly, CrmB from variola virus, the causative agent of smallpox, is the most potent TNFR of those tested here including hTNFR2. Furthermore, we demonstrate a new immunomodulatory activity of vTNFRs, showing that CrmB and CrmD also inhibit the activity of lymphotoxin β. Similarly, we report for the first time that the hTNFR2 blocks the biological activity of lymphotoxin β. The characterization of vTNFRs optimized during virus-host evolution to modulate the host immune response provides relevant information about their potential role in pathogenesis and may be used to improve anti-inflammatory therapies based on soluble decoy TNFRs. PMID:25940088

  9. Comparative Biochemical and Functional Analysis of Viral and Human Secreted Tumor Necrosis Factor (TNF) Decoy Receptors.

    Science.gov (United States)

    Pontejo, Sergio M; Alejo, Ali; Alcami, Antonio

    2015-06-26

    The blockade of tumor necrosis factor (TNF) by etanercept, a soluble version of the human TNF receptor 2 (hTNFR2), is a well established strategy to inhibit adverse TNF-mediated inflammatory responses in the clinic. A similar strategy is employed by poxviruses, encoding four viral TNF decoy receptor homologues (vTNFRs) named cytokine response modifier B (CrmB), CrmC, CrmD, and CrmE. These vTNFRs are differentially expressed by poxviral species, suggesting distinct immunomodulatory properties. Whereas the human variola virus and mouse ectromelia virus encode one vTNFR, the broad host range cowpox virus encodes all vTNFRs. We report the first comprehensive study of the functional and binding properties of these four vTNFRs, providing an explanation for their expression profile among different poxviruses. In addition, the vTNFRs activities were compared with the hTNFR2 used in the clinic. Interestingly, CrmB from variola virus, the causative agent of smallpox, is the most potent TNFR of those tested here including hTNFR2. Furthermore, we demonstrate a new immunomodulatory activity of vTNFRs, showing that CrmB and CrmD also inhibit the activity of lymphotoxin β. Similarly, we report for the first time that the hTNFR2 blocks the biological activity of lymphotoxin β. The characterization of vTNFRs optimized during virus-host evolution to modulate the host immune response provides relevant information about their potential role in pathogenesis and may be used to improve anti-inflammatory therapies based on soluble decoy TNFRs. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Two-factor authentication

    CERN Document Server

    Stanislav, Mark

    2015-01-01

    During the book, readers will learn about the various technical methods by which two-factor authentication is implemented, security concerns with each type of implementation, and contextual details to frame why and when these technologies should be used. Readers will also be provided with insight about the reasons that two-factor authentication is a critical security control, events in history that have been important to prove why organization and individual would want to use two factor, and core milestones in the progress of growing the market.

  11. Business Intelligence Success Factors

    DEFF Research Database (Denmark)

    Gaardboe, Rikke; Jonasen, Tanja Svarre

    2018-01-01

    Business intelligence (BI) is a strategically important practice in many organizations. Several studies have investigated the factors that contribute to BI success; however, an overview of the critical success factors (CSFs) involved is lacking in the extant literature. We have integrated...... 34 CSFs related to BI success. The distinct CSFs identified in the extant literature relate to project management skills (13 papers), management support (20 papers), and user involvement (11 papers). In the articles with operationalized BI success, we found several distinct factors: system quality...

  12. Human factor reliability program

    International Nuclear Information System (INIS)

    Knoblochova, L.

    2017-01-01

    The human factor's reliability program was at Slovenske elektrarne, a.s. (SE) nuclear power plants. introduced as one of the components Initiatives of Excellent Performance in 2011. The initiative's goal was to increase the reliability of both people and facilities, in response to 3 major areas of improvement - Need for improvement of the results, Troubleshooting support, Supporting the achievement of the company's goals. The human agent's reliability program is in practice included: - Tools to prevent human error; - Managerial observation and coaching; - Human factor analysis; -Quick information about the event with a human agent; -Human reliability timeline and performance indicators; - Basic, periodic and extraordinary training in human factor reliability(authors)

  13. [Human factors in medicine].

    Science.gov (United States)

    Lazarovici, M; Trentzsch, H; Prückner, S

    2017-01-01

    The concept of human factors is commonly used in the context of patient safety and medical errors, all too often ambiguously. In actual fact, the term comprises a wide range of meanings from human-machine interfaces through human performance and limitations up to the point of working process design; however, human factors prevail as a substantial cause of error in complex systems. This article presents the full range of the term human factors from the (emergency) medical perspective. Based on the so-called Swiss cheese model by Reason, we explain the different types of error, what promotes their emergence and on which level of the model error prevention can be initiated.

  14. Shell Buckling Knockdown Factors

    Data.gov (United States)

    National Aeronautics and Space Administration — The Shell Buckling Knockdown Factor (SBKF) Project, NASA Engineering and Safety Center (NESC) Assessment #: 07-010-E, was established in March of 2007 by the NESC in...

  15. Risk factors for neoplasms

    International Nuclear Information System (INIS)

    Brachner, A.; Grosche, B.

    1991-06-01

    A broad survey is given of risk factors for neoplasms. The main carcinogenic substances (including also ionizing radiation and air pollution) are listed, and are correlated with the risk factors for various cancers most frequently explained and discussed in the literature. The study is intended to serve as a basis for a general assessment of the incidence of neoplasms in children, and of cancer mortality in the entire population of Bavaria in the years 1983-1989, or 1979-1988, respectively, with the principal idea of drawing up an environment-related health survey. The study therefore takes into account not only ionizing radiation as a main risk factor, but also other risk factors detectable within the ecologic context, as e.g. industrial installations and their effects, refuse incineration plants or waste dumps, or the social status. (orig./MG) [de

  16. Factor IX assay

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003679.htm Factor IX assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  17. Factor VIII assay

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003678.htm Factor VIII assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  18. Factor II assay

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003674.htm Factor II assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  19. Factor V deficiency

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000550.htm Factor V deficiency To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  20. Rheumatoid factor (RF)

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003548.htm Rheumatoid factor (RF) To use the sharing features on this ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  1. Factor II deficiency

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000549.htm Factor II deficiency To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  2. Factor VII assay

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003676.htm Factor VII assay To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  3. Factor X deficiency

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000553.htm Factor X deficiency To use the sharing features on ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  4. New microbial growth factor

    Science.gov (United States)

    Bok, S. H.; Casida, L. E., Jr.

    1977-01-01

    A screening procedure was used to isolate from soil a Penicillium sp., two bacterial isolates, and a Streptomyces sp. that produced a previously unknown microbial growth factor. This factor was an absolute growth requirement for three soil bacteria. The Penicillium sp. and one of the bacteria requiring the factor, an Arthrobacter sp., were selected for more extensive study concerning the production and characteristics of the growth factor. It did not seem to be related to the siderochromes. It was not present in soil extract, rumen fluid, or any other medium component tested. It appears to be a glycoprotein of high molecular weight and has high specific activity. When added to the diets for a meadow-vole mammalian test system, it caused an increased consumption of diet without a concurrent increase in rate of weight gain.

  5. Human factors in aviation

    National Research Council Canada - National Science Library

    Salas, Eduardo; Maurino, Daniel E

    2010-01-01

    .... HFA offers a comprehensive overview of the topic, taking readers from the general to the specific, first covering broad issues, then the more specific topics of pilot performance, human factors...

  6. [Risk factors of schizophrenia].

    Science.gov (United States)

    Suvisaari, Jaana

    2010-01-01

    Schizophrenia is a multifactorial, neurodevelopmental disorder caused by a combination of genetic and environmental risk factors. Disturbances of brain development begin prenatally, while different environmental insults further affect postnatal brain maturation during childhood and adolescence. Genome-wide association studies (GWAS) have succeeded in identifying hundreds of new risk variants for common, multifactorial diseases. In schizophrenia research, GWAS have found several rare copy number variants that considerably increase the risk of schizophrenia, and have shown an association between schizophrenia and the major histocompatibility complex. Research on environmental risk factors in recent years has provided new information particularly on risk factors related to pregnancy and childhood rearing environment. Gene-environment interactions have become a central research topic. There is evidence that genetically susceptible children are more vulnerable to the effects of unstable childhood rearing environment and other environmental risk factors.

  7. Human Factors Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — Purpose: The purpose of the Human Factors Laboratory is to further the understanding of highway user needs so that those needs can be incorporated in roadway design,...

  8. Factors Affecting Wound Healing

    Science.gov (United States)

    Guo, S.; DiPietro, L.A.

    2010-01-01

    Wound healing, as a normal biological process in the human body, is achieved through four precisely and highly programmed phases: hemostasis, inflammation, proliferation, and remodeling. For a wound to heal successfully, all four phases must occur in the proper sequence and time frame. Many factors can interfere with one or more phases of this process, thus causing improper or impaired wound healing. This article reviews the recent literature on the most significant factors that affect cutaneous wound healing and the potential cellular and/or molecular mechanisms involved. The factors discussed include oxygenation, infection, age and sex hormones, stress, diabetes, obesity, medications, alcoholism, smoking, and nutrition. A better understanding of the influence of these factors on repair may lead to therapeutics that improve wound healing and resolve impaired wounds. PMID:20139336

  9. The stem factor challenge

    International Nuclear Information System (INIS)

    Russell, M.J.; Steele, R. Jr.; DeWall, K.G.; Watkins, J.C.; Bramwell, D.

    1994-01-01

    One of the most important challenges that still needs to be met in the effort to understand the operation of motor-operated, rising-stem valves is the ability to determine stem factor throughout the valve's load range. The stem factor represents the conversion of operator torque to stem thrust. Determining the stem factor is important because some motor-operated valves (MOVs) cannot be tested in the plant at design basis conditions. The ability of these valves to perform their design basis function (typically, to operate against specified flow and pressure loads) must be ensured by analytical methods or by extrapolating from the results of tests conducted at lower loads. Because the stem factor tends to vary in response to friction and lubrication phenomena that occur during loading and wedging, analytical methods and extrapolation methods have been difficult to develop and implement. Early investigations into variability in the stem factor tended to look only at the tip of the iceberg; they focused on what was happening at torque switch trip, which usually occurs at full wedging. In most stems, the stem factor is better (lower) in the wedging transient than before wedging, so working with torque switch trip data alone led many early researchers to false conclusions about the relationship between stem factor and load. However, research at the Idaho National Engineering Laboratory (INEL) has taken a closer look at what happens during the running portion of the closing stroke along with the wedging portion. This shift in focus is important, because functional failure of a valve typically consists of a failure to isolate flow, not a failure to achieve full wedging. Thus, the stem factor that must be determined for a valve's design basis closing requirements is the one that corresponds with the running load before wedging

  10. Factors Affecting Wound Healing

    OpenAIRE

    Guo, S.; DiPietro, L.A.

    2010-01-01

    Wound healing, as a normal biological process in the human body, is achieved through four precisely and highly programmed phases: hemostasis, inflammation, proliferation, and remodeling. For a wound to heal successfully, all four phases must occur in the proper sequence and time frame. Many factors can interfere with one or more phases of this process, thus causing improper or impaired wound healing. This article reviews the recent literature on the most significant factors that affect cutane...

  11. Los factores de riesgo

    Directory of Open Access Journals (Sweden)

    Justo Senado Dumoy

    1999-01-01

    Full Text Available Sobre el fundamento filosófico de los conceptos de la Dialéctica Materialista, se presenta un análisis en relación con el concepto e interpretación de los Factores de Riesgo.A analysis on the concept and interpretation of risk factors is presented based on the philosophical foundation of the concepts of materialist dialectics.

  12. Brain derived neurotrophic factor

    DEFF Research Database (Denmark)

    Mitchelmore, Cathy; Gede, Lene

    2014-01-01

    Brain Derived Neurotrophic Factor (BDNF) is a neurotrophin with important functions in neuronal development and neuroplasticity. Accumulating evidence suggests that alterations in BDNF expression levels underlie a variety of psychiatric and neurological disorders. Indeed, BDNF therapies are curre......Brain Derived Neurotrophic Factor (BDNF) is a neurotrophin with important functions in neuronal development and neuroplasticity. Accumulating evidence suggests that alterations in BDNF expression levels underlie a variety of psychiatric and neurological disorders. Indeed, BDNF therapies...

  13. Factors Impacting Knowledge Sharing

    DEFF Research Database (Denmark)

    Schulzmann, David; Slepniov, Dmitrij

    The purpose of this paper is to examine various factors affecting knowledge sharing at the R&D center of a Western MNE in China. The paper employs qualitative methodology and is based on the action research and case study research techniques. The findings of the paper advance our understanding...... about factors that affect knowledge sharing. The main emphasis is given to the discussion on how to improve knowledge sharing in global R&D organizations....

  14. FGF growth factor analogs

    Science.gov (United States)

    Zamora, Paul O [Gaithersburg, MD; Pena, Louis A [Poquott, NY; Lin, Xinhua [Plainview, NY; Takahashi, Kazuyuki [Germantown, MD

    2012-07-24

    The present invention provides a fibroblast growth factor heparin-binding analog of the formula: ##STR00001## where R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, X, Y and Z are as defined, pharmaceutical compositions, coating compositions and medical devices including the fibroblast growth factor heparin-binding analog of the foregoing formula, and methods and uses thereof.

  15. Factorization and pion form factor in QCD

    International Nuclear Information System (INIS)

    Efremov, A.V.; Radyushkin, A.V.

    1979-01-01

    The behaviour of the pion electromagnetic form factor (EMFF) in the framework of quantum chromodynamics (QCD) is discussed. Pion is considered to be a quark-antiquark bound state. It is proposed to use an OPE description of the bound state structure by matrix elements of certain local gauge-invariant operators. Short-distance quark interactions is proved using a direct analysis of perturbation theory in the α-parametric representation of the Feynman diagrams. It is shown that the short-distance parton picture privides a self-consistent description of the large Q 2 momentum behaviour of the pion EMFF in QCD. Pion EMFF asymptotics is expressed in terms of fu fundamental constants of the theory

  16. [Pathological gambling: risk factors].

    Science.gov (United States)

    Bouju, G; Grall-Bronnec, M; Landreat-Guillou, M; Venisse, J-L

    2011-09-01

    In France, consumption of gambling games increased by 148% between 1960 and 2005. In 2004, gamblers lost approximately 0.9% of household income, compared to 0.4% in 1960. This represents approximately 134 Euros per year and per head. In spite of this important increase, the level remains lower than the European average (1%). However, gambling practices may continue to escalate in France in the next few years, particularly with the recent announce of the legalisation of online games and sports betting. With the spread of legalised gambling, pathological gambling rates may increase in France in the next years, in response to more widely available and more attractive gambling opportunities. In this context, there is a need for better understanding of the risk factors that are implicated in the development and maintenance of pathological gambling. This paper briefly describes the major risk factors for pathological gambling by examining the recent published literature available during the first quarter of 2008. This documentary basis was collected by Inserm for the collective expert report procedure on Gambling (contexts and addictions). Seventy-two articles focusing on risk factors for pathological gambling were considered in this review. Only 47 of them were taken into account for analysis. The selection of these 47 publications was based on the guide on literature analysis established by the French National Agency for Accreditation and Assessment in Health (ANAES, 2000). Some publications from more recent literature have also been added, mostly about Internet gambling. We identify three major types of risk factors implicated in gambling problems: some of them are related to the subject (individual factors), others are related to the object of the addiction, here the gambling activity by itself (structural factors), and the last are related to environment (contextual or situational factors). Thus, the development and maintenance of pathological gambling seems to be

  17. Generalised Batho correction factor

    International Nuclear Information System (INIS)

    Siddon, R.L.

    1984-01-01

    There are various approximate algorithms available to calculate the radiation dose in the presence of a heterogeneous medium. The Webb and Fox product over layers formulation of the generalised Batho correction factor requires determination of the number of layers and the layer densities for each ray path. It has been shown that the Webb and Fox expression is inefficient for the heterogeneous medium which is expressed as regions of inhomogeneity rather than layers. The inefficiency of the layer formulation is identified as the repeated problem of determining for each ray path which inhomogeneity region corresponds to a particular layer. It has been shown that the formulation of the Batho correction factor as a product over inhomogeneity regions avoids that topological problem entirely. The formulation in terms of a product over regions simplifies the computer code and reduces the time required to calculate the Batho correction factor for the general heterogeneous medium. (U.K.)

  18. factores psicosociales asociados

    Directory of Open Access Journals (Sweden)

    María Teresa Varela Arévalo

    2007-01-01

    Full Text Available El objetivo de este trabajo fue describir el consumo de sustancias psicoactivas [SPA] ilegales en jóvenes y los factores psicosociales de riesgo y de protección asociados. Participaron 763 estudiantes (46,5% hombres y 52,4% mujeres de una universidad privada de Cali, quienes diligenciaron el cuestionario de factores de riesgo y protección para el consumo de drogas. Los resultados muestran que la marihuana fue la droga de mayor consumo; y que existe una fuerte asociación entre el consumo de las cuatro SPA ilegales (marihuana, opiáceos, cocaína y éxtasis y los factores psicosociales de riesgo y/o protección, principalmente, las habilidades de autocontrol, los preconceptos y valoración de las SPA, la relación con personas consumidoras y los comportamientos perturbadores.

  19. Multi-factor authentication

    Science.gov (United States)

    Hamlet, Jason R; Pierson, Lyndon G

    2014-10-21

    Detection and deterrence of spoofing of user authentication may be achieved by including a cryptographic fingerprint unit within a hardware device for authenticating a user of the hardware device. The cryptographic fingerprint unit includes an internal physically unclonable function ("PUF") circuit disposed in or on the hardware device, which generates a PUF value. Combining logic is coupled to receive the PUF value, combines the PUF value with one or more other authentication factors to generate a multi-factor authentication value. A key generator is coupled to generate a private key and a public key based on the multi-factor authentication value while a decryptor is coupled to receive an authentication challenge posed to the hardware device and encrypted with the public key and coupled to output a response to the authentication challenge decrypted with the private key.

  20. Human factors guides

    International Nuclear Information System (INIS)

    Penington, J.

    1995-10-01

    This document presents human factors guides, which have been developed in order to provide licensees of the AECB with advice as to how to address human factors issues within the design and assessment process. This documents presents the results of a three part study undertaken to develop three guides which are enclosed in this document as Parts B, C and D. As part of the study human factors standards, guidelines, handbooks and other texts were researched, to define those which would be most useful to the users of the guides and for the production of the guides themselves. Detailed specifications were then produced to outline the proposed contents and format of the three guides. (author). 100 refs., 3 tabs., 11 figs

  1. Human factors guides

    Energy Technology Data Exchange (ETDEWEB)

    Penington, J [PHF Services Inc., (Canada)

    1995-10-01

    This document presents human factors guides, which have been developed in order to provide licensees of the AECB with advice as to how to address human factors issues within the design and assessment process. This documents presents the results of a three part study undertaken to develop three guides which are enclosed in this document as Parts B, C and D. As part of the study human factors standards, guidelines, handbooks and other texts were researched, to define those which would be most useful to the users of the guides and for the production of the guides themselves. Detailed specifications were then produced to outline the proposed contents and format of the three guides. (author). 100 refs., 3 tabs., 11 figs.

  2. The focus factor

    DEFF Research Database (Denmark)

    Nicolaisen, Jeppe; Frandsen, Tove Faber

    2015-01-01

    Introduction. We present a new bibliometric indicator to measure journal specialisation over time, named the focus factor. This new indicator is based on bibliographic coupling and counts the percentage of re-citations given in subsequent years. Method. The applicability of the new indicator....... To validate re-citations as caused by specialisation, other possible causes were measured and correlated (obsolescence, journal self-citations and number of references). Results. The results indicate that the focus factor is capable of distinguishing between general and specialised journals and thus...... effectively measures the intended phenomenon (i.e., journal specialisation). Only weak correlations were found between journal re-citations and obsolescence, journal self-citations, and number of references. Conclusions. The focus factor successfully measures journal specialisation over time. Measures based...

  3. WRKY transcription factors

    Science.gov (United States)

    Bakshi, Madhunita; Oelmüller, Ralf

    2014-01-01

    WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469

  4. On braid monodromy factorizations

    International Nuclear Information System (INIS)

    Kharlamov, V M; Kulikov, Vik S

    2003-01-01

    We introduce and develop a language of semigroups over the braid groups to study the braid monodromy factorizations (bmf's) of plane algebraic curves and other related objects. As an application, we give a new proof of Orevkov's theorem on the realization of bmf's over a disc by algebraic curves and show that the complexity of such a realization cannot be bounded in terms of the types of factors of the bmf. We also prove that the type of a bmf distinguishes Hurwitz curves with singularities of inseparable type up to H-isotopy and J-holomorphic cuspidal curves in CP 2 up to symplectic isotopy

  5. Dose conversion factors

    International Nuclear Information System (INIS)

    Kocher, D.C.; Eckerman, K.F.

    1992-01-01

    The following is discussed in this report: concepts and quantities used in calculating radiation dose from internal and external exposure. Tabulations of dose conversion factor for internal and external exposure to radionuclides. Dose conversion factors give dose per unit intake (internal) or dose per unit concentration in environment (external). Intakes of radionuclides for internal exposure and concentrations of radionuclides in environment for external exposure are assumed to be known. Intakes and concentrations are obtained, e.g., from analyses of environmental transport and exposure pathways. differences between dosimetry methods for radionuclides and hazardous chemicals are highlighted

  6. Factors stimulating content marketing

    Directory of Open Access Journals (Sweden)

    Naser Azad

    2016-02-01

    Full Text Available This paper presents an empirical investigation to determine factors influencing on content marketing in banking industry. The study designs a questionnaire consists of 40 questions in Likert scale and distributes it among 550 randomly selected regular customers of Bank Mellat in city of Tehran, Iran and 400 properly filled questionnaires are collected. Cronbach alphas for all components of the survey are well above desirable level. Using principle component analysis with Varimax rotation, the study has determined six factors influencing the most on content marketing including organization, details, having new ideas, quality, sensitivity and power while the last component contains only two subcomponents and is removed from the study.

  7. STEREOTYPICAL FACTORS IN TOURISM

    Directory of Open Access Journals (Sweden)

    Cristina-Elena ALBU

    2013-06-01

    Full Text Available International tourism has grown rapidly nowdays, contributing to the growth of the global economy. The purpose of this essay is to identify and analyze stereotypical factors in the development of strategies concerning the offer for the tourism industry: the image of a tourist destination, brand, country of origin and customer behaviour. Documentary study was the research method used: representative articles were analysed, as recent as possible, to determine the factors mentioned above. Professionals in the industry of tourism need to understand cultural differences between tourists, as well as those of the host country, to be able to create tourist reception offers that live up to the standards expected by clients.

  8. Factor analysis and scintigraphy

    International Nuclear Information System (INIS)

    Di Paola, R.; Penel, C.; Bazin, J.P.; Berche, C.

    1976-01-01

    The goal of factor analysis is usually to achieve reduction of a large set of data, extracting essential features without previous hypothesis. Due to the development of computerized systems, the use of largest sampling, the possibility of sequential data acquisition and the increase of dynamic studies, the problem of data compression can be encountered now in routine. Thus, results obtained for compression of scintigraphic images were first presented. Then possibilities given by factor analysis for scan processing were discussed. At last, use of this analysis for multidimensional studies and specially dynamic studies were considered for compression and processing [fr

  9. The Transcription Factor Encyclopedia

    DEFF Research Database (Denmark)

    Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I

    2012-01-01

    mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written......ABSTRACT: Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130...

  10. Factorizations and physical representations

    International Nuclear Information System (INIS)

    Revzen, M; Khanna, F C; Mann, A; Zak, J

    2006-01-01

    A Hilbert space in M dimensions is shown explicitly to accommodate representations that reflect the decomposition of M into prime numbers. Representations that exhibit the factorization of M into two relatively prime numbers: the kq representation (Zak J 1970 Phys. Today 23 51), and related representations termed q 1 q 2 representations (together with their conjugates) are analysed, as well as a representation that exhibits the complete factorization of M. In this latter representation each quantum number varies in a subspace that is associated with one of the prime numbers that make up M

  11. Model Correction Factor Method

    DEFF Research Database (Denmark)

    Christensen, Claus; Randrup-Thomsen, Søren; Morsing Johannesen, Johannes

    1997-01-01

    The model correction factor method is proposed as an alternative to traditional polynomial based response surface techniques in structural reliability considering a computationally time consuming limit state procedure as a 'black box'. The class of polynomial functions is replaced by a limit...... of the model correction factor method, is that in simpler form not using gradient information on the original limit state function or only using this information once, a drastic reduction of the number of limit state evaluation is obtained together with good approximations on the reliability. Methods...

  12. [Natural factors influencing sleep].

    Science.gov (United States)

    Jurkowski, Marek K; Bobek-Billewicz, Barbara

    2007-01-01

    Sleep is a universal phenomenon of human and animal lives, although the importance of sleep for homeo-stasis is still unknown. Sleep disturbances influence many behavioral and physiologic processes, leading to health complications including death. On the other hand, sleep improvement can beneficially influence the course of healing of many disorders and can be a prognostic of health recovery. The factors influencing sleep have different biological and chemical origins. They are classical hormones, hypothalamic releasing and inhibitory hormones, neuropeptides, peptides and others as cytokines, prostaglandins, oleamid, adenosine, nitric oxide. These factors regulate most physiologic processes and are likely elements integrating sleep with physiology and physiology with sleep in health and disorders.

  13. An Epstein-Barr virus encoded inhibitor of Colony Stimulating Factor-1 signaling is an important determinant for acute and persistent EBV infection.

    Directory of Open Access Journals (Sweden)

    Makoto Ohashi

    2012-12-01

    Full Text Available Acute Epstein-Barr virus (EBV infection is the most common cause of Infectious Mononucleosis. Nearly all adult humans harbor life-long, persistent EBV infection which can lead to development of cancers including Hodgkin Lymphoma, Burkitt Lymphoma, nasopharyngeal carcinoma, gastric carcinoma, and lymphomas in immunosuppressed patients. BARF1 is an EBV replication-associated, secreted protein that blocks Colony Stimulating Factor 1 (CSF-1 signaling, an innate immunity pathway not targeted by any other virus species. To evaluate effects of BARF1 in acute and persistent infection, we mutated the BARF1 homologue in the EBV-related herpesvirus, or lymphocryptovirus (LCV, naturally infecting rhesus macaques to create a recombinant rhLCV incapable of blocking CSF-1 (ΔrhBARF1. Rhesus macaques orally challenged with ΔrhBARF1 had decreased viral load indicating that CSF-1 is important for acute virus infection. Surprisingly, ΔrhBARF1 was also associated with dramatically lower virus setpoints during persistent infection. Normal acute viral load and normal viral setpoints during persistent rhLCV infection could be restored by Simian/Human Immunodeficiency Virus-induced immunosuppression prior to oral inoculation with ΔrhBARF1 or infection of immunocompetent animals with a recombinant rhLCV where the rhBARF1 was repaired. These results indicate that BARF1 blockade of CSF-1 signaling is an important immune evasion strategy for efficient acute EBV infection and a significant determinant for virus setpoint during persistent EBV infection.

  14. The stationary phase sigma factor, RpoS, regulates the production of a carbapenem antibiotic, a bioactive prodigiosin and virulence in the enterobacterial pathogen Serratia sp. ATCC 39006.

    Science.gov (United States)

    Wilf, Nabil M; Salmond, George P C

    2012-03-01

    Serratia sp. ATCC 39006 (S39006) is a Gram-negative bacterium that is virulent in plant (potato) and invertebrate animal (Caenorhabditis elegans) models. It produces two secondary metabolite antibiotics, a prodigiosin and a carbapenem, and the exoenzymes pectate lyase and cellulase. We showed previously that deletion of the RNA chaperone Hfq abolished antibiotic production and attenuated virulence in both animal and plant hosts. Hfq and dependent small RNAs (sRNAs) are known to regulate the post-transcriptional expression of rpoS, which encodes σ(S), the stationary phase sigma factor subunit of RNA polymerase. An S39006 hfq deletion mutant showed decreased transcript levels of rpoS. Therefore, in this study we investigated whether the phenotypes regulated by Hfq were mediated through its control of rpoS. Whereas loss of Hfq abolished prodigiosin and carbapenem production and attenuated virulence in both C. elegans and potato, characterization of an S39006 rpoS mutant showed unexpectedly elevated prodigiosin and carbapenem production. Furthermore, the rpoS mutant exhibited attenuated animal pathogenesis, but not plant pathogenesis. Additionally, a homologue of the Hfq-dependent sRNA, RprA, was identified and shown to regulate prodigiosin production in a manner consistent with its role in positively regulating translation of rpoS mRNA. Combined, these results demonstrate that Hfq regulation of secondary metabolism and plant pathogenesis is independent of RpoS and establishes RpoS and RprA as regulators of antibiotic production.

  15. Stage-specific regulation of four HD-ZIP III transcription factors during polar pattern formation in Larix leptolepis somatic embryos.

    Science.gov (United States)

    Li, Shui-gen; Li, Wan-feng; Han, Su-ying; Yang, Wen-hua; Qi, Li-wang

    2013-06-15

    Polar auxin transport provides a developmental signal for cell fate specification during somatic embryogenesis. Some members of the HD-ZIP III transcription factors participate in regulation of auxin transport, but little is known about this regulation in somatic embryogenesis. Here, four HD-ZIP III homologues from Larix leptolepis were identified and designated LaHDZ31, 32, 33 and 34. The occurrence of a miR165/166 target sequence in all four cDNA sequences indicated that they might be targets of miR165/166. Identification of the cleavage products of LaHDZ31 and LaHDZ32 in vivo confirmed that they were regulated by miRNA. Their mRNA accumulation patterns during somatic embryogenesis and the effects of 1-N-naphthylphthalamic acid (NPA) on their transcript levels and somatic embryo maturation were investigated. The results showed that the four genes had higher transcript levels at mature stages than at the proliferation stage, and that NPA treatment down-regulated the mRNA abundance of LaHDZ31, 32 and 33 at cotyledonary embryo stages, but had no effect on the mRNA abundance of LaHDZ34. We concluded that these four members of Larix HD-ZIP III family might participate in polar auxin transport and the development of somatic embryos, providing new insights into the regulatory mechanisms of somatic embryogenesis. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Amplification of the Kaposi's sarcoma-associated herpesvirus/human herpesvirus 8 lytic origin of DNA replication is dependent upon a cis-acting AT-rich region and an ORF50 response element and the trans-acting factors ORF50 (K-Rta) and K8 (K-bZIP)

    International Nuclear Information System (INIS)

    AuCoin, David P.; Colletti, Kelly S.; Cei, Sylvia A.; Papouskova, Iva; Tarrant, Margaret; Pari, Gregory S.

    2004-01-01

    Kaposi's sarcoma-associated herpesvirus (KSHV), also known as human herpesvirus 8 (HHV8), has significant sequence homology to Epstein-Barr virus (EBV). In cell culture, HHV8 is primarily latent, and viral genes associated with lytic replication are not expressed. Two lytic origins of DNA replication (oriLyt) are present within the HHV8 genome and are composed of an AT-rich region adjacent to GC-rich DNA sequences. We have now identified essential cis- and trans-acting elements required for oriLyt-dependent DNA replication. The transient replication assay was used to show that two AT-rich elements, three consensus AP1 transcription factor-binding sites, an ORF50 response element (RE), and a consensus TATA box motif are essential for efficient origin-dependent DNA replication. Transient transfection of luciferase reporter constructs indicated that the downstream region of the HHV8 oriLyt responds to ORF50 and suggests that part of the oriLyt may be an enhancer/promoter. In addition, a transient cotransfection-replication assay elucidated the set of trans-acting factors required for lytic DNA replication. These factors consist of homologues to the core replication proteins: ORF6 (ssDNA binding protein), ORF9 (DNA polymerase), ORF40-41 (primase-associated factor), ORF44 (helicase), ORF56 (primase), and ORF59 (polymerase processivity factor) common to all herpesviruses along with ORF50 (K-Rta) and K8 (K-bZIP)

  17. Environmental factors and leukaemia

    Energy Technology Data Exchange (ETDEWEB)

    Brandt, L

    1985-01-01

    Investigations on the association between environmental hazards and the development of various types of leukaemia are reviewed. Regarding acute non-lymphocytic leukaemia (ANLL) exposure to ionizing radiation is a well-documented risk factor. According to several recent studies exposure to strong electromagnetic fields may be suspected to be of etiologic importance for ANLL. There is evidence that occupational handling of benzene is a risk factor and other organic solvents may also be leukaemogenic. Occupational exposure to petrol products has been proposed to be a risk factor although the hazardous substances have not yet been defined. Results of cytogenetic studies in ANLL suggest that exposure to certain environmental agents may be associated with relatively specific clonal chromosome aberrations. Exposure in utero to ionizing radiation has been proposed to be a risk factor for acute lymphocytic leukaemia (ALL) in children. Unlike ANLL there seems at present to be little evidence that ALL is related to exposure to some chemicals. Chronic myeloid leukaemia (CML) may follow exposure to high doses of ionizing radiation whereas such exposure seems to be of insignificant importance for the development of chronic lymphocytic leukaemia (CLL). According to some studies an abnormally high incidence of CLL may be found among farmers in the USA. These results have not been confirmed in Scandinavian studies. There seems to be little evidence that CML or CLL are related to occupational handling of some chemicals. 35 references.

  18. Hyperglycemia: a prothrombotic factor?

    NARCIS (Netherlands)

    Lemkes, B. A.; Hermanides, J.; DeVries, J. H.; Holleman, F.; Meijers, J. C. M.; Hoekstra, J. B. L.

    2010-01-01

    Diabetes mellitus is characterized by a high risk of atherothrombotic events. What is more, venous thrombosis has also been found to occur more frequently in this patient group. This prothrombotic condition in diabetes is underpinned by laboratory findings of elevated coagulation factors and

  19. Thermal disadvantage factor

    International Nuclear Information System (INIS)

    Abdullah, K.M.S.; Loyalka, S.K.

    1990-01-01

    A method is described where reactor cell flux and the disadvantage factor are calculated by using diffusion theory in the moderator and integral transport in the fuel. The method is efficient (noniterative) and provides results that agree well with Monte Carlo, P 5 and ABH results

  20. Threshold factorization redux

    Science.gov (United States)

    Chay, Junegone; Kim, Chul

    2018-05-01

    We reanalyze the factorization theorems for the Drell-Yan process and for deep inelastic scattering near threshold, as constructed in the framework of the soft-collinear effective theory (SCET), from a new, consistent perspective. In order to formulate the factorization near threshold in SCET, we should include an additional degree of freedom with small energy, collinear to the beam direction. The corresponding collinear-soft mode is included to describe the parton distribution function (PDF) near threshold. The soft function is modified by subtracting the contribution of the collinear-soft modes in order to avoid double counting on the overlap region. As a result, the proper soft function becomes infrared finite, and all the factorized parts are free of rapidity divergence. Furthermore, the separation of the relevant scales in each factorized part becomes manifest. We apply the same idea to the dihadron production in e+e- annihilation near threshold, and show that the resultant soft function is also free of infrared and rapidity divergences.

  1. Fibroblast growth factor 23

    African Journals Online (AJOL)

    Dr Olaleye

    Systemic phosphate homeostasis is maintained through several hormonal mechanisms which involve fibroblast growth factor 23 (FGF-23), α-klotho, vitamin D and parathyroid hormone. FGF-23 is known to be the major regulator of phosphate balance (Mirams et al., 2004). FGF-23 is a phosphaturic hormone, which is.

  2. Human factors information system

    International Nuclear Information System (INIS)

    Goodman, P.C.; DiPalo, C.A.

    1991-01-01

    Nuclear power plant safety is dependent upon human performance related to plant operations. To provide improvements in human performance, data collection and assessment play key roles. This paper reports on the Human factors Information System (HFIS) which is designed to meet the needs of the human factors specialists of the United States Nuclear Regulatory Commission. These specialists identify personnel errors and provide guidance designed to prevent such errors. HFIS is a simple and modular system designed for use on a personal computer. It is designed to contain four separate modules that provide information indicative of program or function effectiveness as well as safety-related human performance based on programmatic and performance data. These modules include the Human Factors Status module; the Regulatory Programs module; the Licensee Event Report module; and the Operator Requalification Performance module. Information form these modules can either be used separately or can be combined due to the integrated nature of the system. HFIS has the capability, therefore, to provide insights into those areas of human factors that can reduce the probability of events caused by personnel error at nuclear power plants and promote the health and safety of the public. This information system concept can be applied to other industries as well as the nuclear industry

  3. PATTERNS AND FACTORS INVOLVED

    African Journals Online (AJOL)

    Between 1*' of July 1996 and 30'h of June 2000 a total of 3583 patients were registered at the accident and emergency unit of Nnamdi. Azikiwe ... The case files of these were reviewed with a view to ascertaining the causes and factors involved in the deaths of these patients. The .... H.I.V/AIDS related complications 23 6.8.

  4. Introduction to human factors

    International Nuclear Information System (INIS)

    Winters, J.M.

    1988-03-01

    Some background is given on the field of human factors. The nature of problems with current human/computer interfaces is discussed, some costs are identified, ideal attributes of graceful system interfaces are outlined, and some reasons are indicated why it's not easy to fix the problems

  5. Prognostic factors in oligodendrogliomas

    DEFF Research Database (Denmark)

    Westergaard, L; Gjerris, F; Klinken, L

    1997-01-01

    An outcome analysis was performed on 96 patients with pure cerebral oligodendrogliomas operated in the 30-year period 1962 to 1991. The most important predictive prognostic factors were youth and no neurological deficit, demonstrated as a median survival for the group younger than 20 years of 17...

  6. Factors affecting mining costs

    International Nuclear Information System (INIS)

    Lowell, A.F.

    1977-01-01

    The subject is discussed under the following headings: investment decision-making, unit cost factors (declining ore grade, low-price contracts, ore grade/output relationship, above average cost increases). Economic, environmental, sociological and political aspects are considered. (U.K.)

  7. Human factors in network security

    OpenAIRE

    Jones, Francis B.

    1991-01-01

    Human factors, such as ethics and education, are important factors in network information security. This thesis determines which human factors have significant influence on network security. Those factors are examined in relation to current security devices and procedures. Methods are introduced to evaluate security effectiveness by incorporating the appropriate human factors into network security controls

  8. Electromagnetic form factors

    International Nuclear Information System (INIS)

    Desplanques, B.

    1987-01-01

    Electromagnetic form factors, in first approximation, are sensitive to spatial distribution of nucleons and to their current. In second approximation, more precise effects are concerned, whose role is increasing with momentum transfer and participating essentially of short range nuclei description. They concern of course the nucleon-nucleon interaction while approaching each other and keeping their free-state identity, but also mutually polarizing one the other. In this last effect, radial and orbital excitations of nucleon, the nucleon mesonic cloud modification and the nucleon antinucleon pair excitation are included. In this paper, these contributions are discussed while trying to find the important elements for a good description of form factors. Current questions are also discussed. Light nuclei are essentially concerned [fr

  9. Researching organizational factors

    International Nuclear Information System (INIS)

    Coffman, F.

    1991-01-01

    This paper discusses feedback and insights from experience (both successful and unsuccessful) with the past and the ongoing organizational factors research. That experience suggests a leading set of ingredients that appear proper for performing regulatory research on organizational processes. By keeping focused upon these proper ingredients, the research will contribute to the regulatory assessments of utility management through the use of improved methods and measures in investigations, inspections, diagnostics, performance indicators, and PRA insights. This paper is organized into (1) an introductory description of what the agency is doing to assess organizational effectiveness, (2) some insights from past and ongoing research, (3) an opinion on a leading set of ingredients to properly research organizational factors, and (4) a summary

  10. On braid monodromy factorizations

    Energy Technology Data Exchange (ETDEWEB)

    Kharlamov, V M [Institut de Recherche Matematique Avanee Universite Louis Pasteur et CNRS 7 rue Rene Descartes (France); Kulikov, Vik S [Steklov Mathematical Institute, Russian Academy of Sciences (Russian Federation)

    2003-06-30

    We introduce and develop a language of semigroups over the braid groups to study the braid monodromy factorizations (bmf's) of plane algebraic curves and other related objects. As an application, we give a new proof of Orevkov's theorem on the realization of bmf's over a disc by algebraic curves and show that the complexity of such a realization cannot be bounded in terms of the types of factors of the bmf. We also prove that the type of a bmf distinguishes Hurwitz curves with singularities of inseparable type up to H-isotopy and J-holomorphic cuspidal curves in CP{sup 2} up to symplectic isotopy.

  11. Factors in Agile Methods Adoption

    Directory of Open Access Journals (Sweden)

    Samia Abdalhamid

    2017-05-01

    Full Text Available There are many factors that can affect the process of adopting Agile methods during software developing. This paper illustrates the critical factors in Agile methods adoption in software organizations. To present the success and failure factors, an exploratory study is carried out among the critical factors of success and failure from existing studies. Dimensions and Factors are introduced utilizing success and failure dimensions. The mind map was used to clarify these factors.

  12. Factors of academic procrastination

    OpenAIRE

    Kranjec, Eva; Košir, Katja; Komidar, Luka

    2017-01-01

    This study investigated dimensions of perfectionism, anxiety, and depression as factors of academic procrastination. Our main research interest was to examine the role of specific dimensions of perfectionism as moderators in the relationship between anxiety and depression and academic procrastination. Four scales were administered on the sample of 403 students: perfectionism scale FMPS, academic procrastination scale APS-SI, depression scale CESD and anxiety scale STAI-X2. The results showed ...

  13. Prognostic factors for medulloblastoma

    International Nuclear Information System (INIS)

    Jenkin, Derek; Al Shabanah, Mohamed; Al Shail, Essam; Gray, Alan; Hassounah, Maher; Khafaga, Yasser; Kofide, Amani; Mustafa, Mahmoud; Schultz, Henrik

    2000-01-01

    Purpose: To evaluate prognostic factors for medulloblastoma. Methods and Materials: One hundred and seventy-three consecutive patients with medulloblastoma, treated at King Faisal Specialist Hospital (KFSH) from 1988-1997, were reviewed. Eighty-four percent were children less than 15 years old. From 1988-1994, treatment was at the discretion of the investigator. From 1994-1998, patients entered a single-arm best practice protocol in which, in staged patients, the surgical intent was total resection, standard radiation treatment was defined, and adjuvant chemotherapy was given to a 'high-risk' subset. Results: For 150 patients who completed surgical and radiation treatment, the 5-year survival rate was 58%, compared with 0% for 16 patients who were unable to start or complete radiation treatment. For staged patients, the 5-year survival was M0 + M1, 78% and M2 + M3, 21% (p 14 years and gross cystic/necrotic features in the primary tumor. The size of the primary tumor, the degree of hydrocephalus at diagnosis, the presence of residual tumor in the post-operative CT/MRI, and the functional status of the patient prior to radiation treatment were not significant factors. Conclusions: Stage M0 + M1 was the most powerful favorable prognostic factor. In Saudi Arabia more patients present with advanced disseminated disease, 41% M2 + M3, than in the West, and this impacts adversely on overall survival. Total resection and standard radiation treatment were not sensitive prognostic factors in a treatment environment in which 78% of patients underwent at least 90% tumor resection and 60% received standard radiation treatment. In order to improve the proportion of patients able to complete radiation treatment, consideration should be given to limiting resection when the attainment of total resection is likely to be morbid, and to delaying rather than omitting radiation treatment in the patient severely compromised postoperatively

  14. Risk factors for cancer

    International Nuclear Information System (INIS)

    Lyman, G.H.

    1992-01-01

    It is no longer reasonable to divide cancers into those that are genetic in origin and those that are environmental in origin. With rare exception, carcinogenesis involves environmental factors that directly or indirectly exert a change in the cell's genome. Virtually all causes of cancer are multifactorial, sometimes involving an inherited predisposition to the carcinogenic effects of environmental factors, which include chemicals, ionizing radiation, and oncogenic virus. Carcinogenesis is a multistep process including induction, promotion, and progression. Initiation requires an irreversible change in the cellular genome, whereas promotion is commonly associated with prolonged and reversible exposure. Tumor progression results in genotypic and phenotypic changes associated with tumor growth, invasion, and metastasis. Most information on human cancer risk is based on epidemiologic studies involving both exposed and unexposed individuals. The quality of such studies depends on their ability to assess the strength of any association of exposure and disease and careful attention to any potential bias. Few cancers are inherited in a Mendelian fashion. Several preneoplastic conditions, however, are clearly inherited and several malignancies demonstrate weak familial patterns. Environmental factors may exert their effect on DNA in a random fashion, but certain consistent changes, including specific translocations of genetic information, are often found. Currently, there is great interest in the close proximity of certain oncogenes governing growth control to the consistent chromosomal changes observed. Such changes may represent a final common pathway of action for environmental carcinogens. Sufficient laboratory and epidemiologic evidence exists to establish a causal association of several chemical agents with cancer

  15. Human factoring administrative procedures

    International Nuclear Information System (INIS)

    Grider, D.A.; Sturdivant, M.H.

    1991-01-01

    In nonnuclear business, administrative procedures bring to mind such mundane topics as filing correspondence and scheduling vacation time. In the nuclear industry, on the other hand, administrative procedures play a vital role in assuring the safe operation of a facility. For some time now, industry focus has been on improving technical procedures. Significant efforts are under way to produce technical procedure requires that a validated technical, regulatory, and administrative basis be developed and that the technical process be established for each procedure. Producing usable technical procedures requires that procedure presentation be engineered to the same human factors principles used in control room design. The vital safety role of administrative procedures requires that they be just as sound, just a rigorously formulated, and documented as technical procedures. Procedure programs at the Tennessee Valley Authority and at Boston Edison's Pilgrim Station demonstrate that human factors engineering techniques can be applied effectively to technical procedures. With a few modifications, those same techniques can be used to produce more effective administrative procedures. Efforts are under way at the US Department of Energy Nuclear Weapons Complex and at some utilities (Boston Edison, for instance) to apply human factors engineering to administrative procedures: The techniques being adapted include the following

  16. Human Factors Review Plan

    International Nuclear Information System (INIS)

    Paramore, B.; Peterson, L.R.

    1985-12-01

    ''Human Factors'' is concerned with the incorporation of human user considerations into a system in order to maximize human reliability and reduce errors. This Review Plan is intended to assist in the assessment of human factors conditions in existing DOE facilities. In addition to specifying assessment methodologies, the plan describes techniques for improving conditions which are found to not adequately support reliable human performance. The following topics are addressed: (1) selection of areas for review describes techniques for needs assessment to assist in selecting and prioritizing areas for review; (2) human factors engineering review is concerned with optimizing the interfaces between people and equipment and people and their work environment; (3) procedures review evaluates completeness and accuracy of procedures, as well as their usability and management; (4) organizational interface review is concerned with communication and coordination between all levels of an organization; and (5) training review evaluates training program criteria such as those involving: trainee selection, qualification of training staff, content and conduct of training, requalification training, and program management

  17. Human Factors Review Plan

    Energy Technology Data Exchange (ETDEWEB)

    Paramore, B.; Peterson, L.R. (eds.)

    1985-12-01

    ''Human Factors'' is concerned with the incorporation of human user considerations into a system in order to maximize human reliability and reduce errors. This Review Plan is intended to assist in the assessment of human factors conditions in existing DOE facilities. In addition to specifying assessment methodologies, the plan describes techniques for improving conditions which are found to not adequately support reliable human performance. The following topics are addressed: (1) selection of areas for review describes techniques for needs assessment to assist in selecting and prioritizing areas for review; (2) human factors engineering review is concerned with optimizing the interfaces between people and equipment and people and their work environment; (3) procedures review evaluates completeness and accuracy of procedures, as well as their usability and management; (4) organizational interface review is concerned with communication and coordination between all levels of an organization; and (5) training review evaluates training program criteria such as those involving: trainee selection, qualification of training staff, content and conduct of training, requalification training, and program management.

  18. Human and Organizational Factors

    International Nuclear Information System (INIS)

    Eshiett, P.B.S.

    2016-01-01

    The Human and Organizational Factors Approach to Industrial Safety (HOFS) consists of identifying and putting in place conditions which encourage a positive contribution from operators (individually and in a team) with regards to industrial safety. The knowledge offered by the HOFS approach makes it possible better to understand what conditions human activity and to act on the design of occupational situations and the organization, in the aim of creating the conditions for safe work. Efforts made in this area can also lead to an improvement in results in terms of the quality of production or occupational safety (incidence and seriousness rates) (Daniellou, F., et al., 2011). Research on industrial accidents shows that they rarely happen as a result of a single event, but rather emerge from the accumulation of several, often seemingly trivial, malfunctions, misunderstandings, incorrect assumptions and other issues. The nuclear community has established rigorous international safety standards and concepts to ensure the protection of people and the environment from harmful effects of ionizing radiation (IAEA, 2014). A review of major human induced disasters in a number of countries and in different industries yields insights into several of the human and organizational factors involved in their occurrence. Some of these factors relate to failures in: • Design or technology; • Training; • Decision making; • Communication; • Preparation for the unexpected; • Understanding of organizational interdependencies

  19. Molecular factors in migraine

    Science.gov (United States)

    Kowalska, Marta; Prendecki, Michał; Kozubski, Wojciech; Lianeri, Margarita; Dorszewska, Jolanta

    2016-01-01

    Migraine is a common neurological disorder that affects 11% of adults worldwide. This disease most likely has a neurovascular origin. Migraine with aura (MA) and more common form - migraine without aura (MO) – are the two main clinical subtypes of disease. The exact pathomechanism of migraine is still unknown, but it is thought that both genetic and environmental factors are involved in this pathological process. The first genetic studies of migraine were focused on the rare subtype of MA: familial hemiplegic migraine (FHM). The genes analysed in familial and sporadic migraine are: MTHFR, KCNK18, HCRTR1, SLC6A4, STX1A, GRIA1 and GRIA3. It is possible that migraine is a multifactorial disease with polygenic influence. Recent studies have shown that the pathomechanisms of migraine involves both factors responsible for immune response and oxidative stress such as: cytokines, tyrosine metabolism, homocysteine; and factors associated with pain transmission and emotions e.g.: serotonin, hypocretin-1, calcitonin gene-related peptide, glutamate. The correlations between genetic variants of the HCRTR1 gene, the polymorphism 5-HTTLPR and hypocretin-1, and serotonin were observed. It is known that serotonin inhibits the activity of hypocretin neurons and may affect the appearance of the aura during migraine attack. The understanding of the molecular mechanisms of migraine, including genotype-phenotype correlations, may contribute to finding markers important for the diagnosis and treatment of this disease. PMID:27191890

  20. Combinatorial analysis of lupulin gland transcription factors from R2R3Myb, bHLH and WDR families indicates a complex regulation of chs_H1 genes essential for prenylflavonoid biosynthesis in hop (Humulus Lupulus L.

    Directory of Open Access Journals (Sweden)

    Matoušek Jaroslav

    2012-02-01

    Full Text Available Abstract Background Lupulin glands of hop produce a specific metabolome including hop bitter acids valuable for the brewing process and prenylflavonoids with promising health-beneficial activities. The detailed analysis of the transcription factor (TF-mediated regulation of the oligofamily of one of the key enzymes, i.e., chalcone synthase CHS_H1 that efficiently catalyzes the production of naringenin chalcone, a direct precursor of prenylflavonoids in hop, constitutes an important part of the dissection of the biosynthetic pathways leading to the accumulation of these compounds. Results Homologues of flavonoid-regulating TFs HlMyb2 (M2, HlbHLH2 (B2 and HlWDR1 (W1 from hop were cloned using a lupulin gland-specific cDNA library from the hop variety Osvald's 72. Using a "combinatorial" transient GUS expression system it was shown that these unique lupulin-gland-associated TFs significantly activated the promoter (P of chs_H1 in ternary combinations of B2, W1 and either M2 or the previously characterized HlMyb3 (M3. The promoter activation was strongly dependent on the Myb-P binding box TCCTACC having a core sequence CCWACC positioned on its 5' end region and it seems that the complexity of the promoter plays an important role. M2B2W1-mediated activation significantly exceeded the strength of expression of native chs_H1 gene driven by the 35S promoter of CaMV, while M3B2W1 resulted in 30% of the 35S:chs_H1 expression level, as quantified by real-time PCR. Another newly cloned hop TF, HlMyb7, containing a transcriptional repressor-like motif pdLNLD/ELxiG/S (PDLNLELRIS, was identified as an efficient inhibitor of chs_H1-activating TFs. Comparative analyses of hop and A. thaliana TFs revealed a complex activation of Pchs_H1 and Pchs4 in combinatorial or independent manners. Conclusions This study on the sequences and functions of various lupulin gland-specific transcription factors provides insight into the complex character of the regulation of the

  1. Structuring factoring business: accounting aspects

    Directory of Open Access Journals (Sweden)

    I.M. Vygivska

    2017-08-01

    Full Text Available The article theoretically substantiates the fact that factoring belongs to the main operational activity of a factoring company, and this allowed structuring the factoring business by types of activity. The lack of a unified approach to the classification of factoring (factoring services made it possible to systematize and refine their classification as a basis for developing accounting and analytical support for risk management of factoring business. The authors single out such classification signs as: the right of the reverse claim (reverse, irretrievable, a territorial feature (international, internal, the subject of the factoring contract (real, consensual, the availability of notification of the debtor (conventional, confidential. The structuring of factoring business contributes to the identification of the risks of the economic activities of a factoring company depending on the type of factoring, the development of methodological support for the bookkeeping of factoring transactions in a risk environment, the search for risk management practices and the determination of management effectiveness in general.

  2. Transforming growth factor (TGF)-β signalling is increased in rheumatoid synovium but TGF-β blockade does not modify experimental arthritis.

    Science.gov (United States)

    Gonzalo-Gil, E; Criado, G; Santiago, B; Dotor, J; Pablos, J L; Galindo, M

    2013-11-01

    The aim of this study was to analyse the distribution of regulatory and inhibitory mothers against decapentaplegic homologue (Smad) proteins as markers of active transforming growth factor (TGF)-β signalling in rheumatoid arthritis (RA) synovial tissue and to investigate the effect of TGF-β blockade in the development and progression of collagen-induced arthritis. The expression of Smad proteins in synovial tissues from RA, osteoarthritic and healthy controls was analysed by immunohistochemistry. Arthritis was induced in DBA/1 mice by immunization with chicken type-II collagen (CII). TGF-β was blocked in vivo with the specific peptide p17 starting at the time of immunization or on the day of arthritis onset. T cell population frequencies and specific responses to CII were analysed. The expression of cytokines and transcription factors was quantified in spleen and joint samples. Statistical differences between groups were compared using the Mann-Whitney U-test or one-way analysis of variance (anova) using the Kruskal-Wallis test. p-Smad-2/3 and inhibitory Smad-7 expression were detected in RA and control tissues. In RA, most lymphoid infiltrating cells showed nuclear p-Smad-2/3 without Smad-7 expression. Treatment with TGF-β antagonist did not affect clinical severity, joint inflammation and cartilage damage in collagen-induced arthritis. Frequency of T cell subsets, mRNA levels of cytokines and transcription factors, specific proliferation to CII, serum interleukin (IL)-6 and anti-CII antibodies were comparable in p17 and phosphate-buffered saline (PBS)-treated groups. The pattern of Smad proteins expression demonstrates active TGF-β signalling in RA synovium. However, specific TGF-β blockade does not have a significant effect in the mice model of collagen-induced arthritis. © 2013 British Society for Immunology.

  3. CAPERalpha is a novel Rel-TAD-interacting factor that inhibits lymphocyte transformation by the potent Rel/NF-kappaB oncoprotein v-Rel.

    Science.gov (United States)

    Dutta, Jui; Fan, Gaofeng; Gélinas, Céline

    2008-11-01

    The Rel/NF-kappaB transcription factors are constitutively activated in many human cancers. The Rel proteins in this family are implicated in leukemia/lymphomagenesis, but the mechanism is not completely understood. Previous studies showed that the transcription activation domains (TADs) of the viral oncoprotein v-Rel and its cellular Rel/NF-kappaB homologues c-Rel and RelA are key determinants of their different transforming activities in primary lymphocytes. Substitution of a Rel TAD for that of RelA conferred a strong transforming phenotype upon RelA, which otherwise failed to transform cells. To gain insights into protein interactions that influence cell transformation by the Rel TADs, we identified factors that interact with the TAD of v-Rel, the most oncogenic member of the Rel/NF-kappaB family. We report that the coactivator for transcription factors AP-1 and estrogen receptors, CAPERalpha, interacts with the v-Rel TAD and potently synergizes v-Rel-mediated transactivation. Importantly, coexpression of CAPERalpha markedly reduced and delayed v-Rel's transforming activity in primary lymphocytes, whereas a dominant-negative mutant enhanced the kinetics of v-Rel-mediated transformation. Furthermore, small interfering RNA-mediated knockdown of CAPERalpha in v-Rel-transformed lymphocytes significantly enhanced colony formation in soft agar. Since the potency of Rel-mediated transactivation is an important determinant of lymphocyte transformation, as is Rel's ability to induce transcriptional repression, these data suggest that CAPERalpha's interaction with the Rel TAD could modulate Rel/NF-kappaB's transforming activity by facilitating expression or dampening repression of specific gene subsets important for oncogenesis. Overall, this study identifies CAPERalpha as a new transcriptional coregulator for v-Rel and reveals an important role in modulating Rel's oncogenic activity.

  4. Milestones and Impact Factors

    Directory of Open Access Journals (Sweden)

    Grandjean Philippe

    2010-07-01

    Full Text Available Abstract Environmental Health has just received its first Impact Factor by Thomson ISI. At a level of 2.48, this achievement is quite satisfactory and places Environmental Health in the top 25% of environmental science journals. When the journal was launched in 2002, it was still unclear whether the Open Access publishing model could be made into a viable commercial enterprise within the biomedical field. During the past eight years, Open Access journals have become widely available, although still covering only about 15% of journal titles. Major funding agencies and institutions, including prominent US universities, now require that researchers publish in Open Access journals. Because of the profound role of scientific journals for the sharing of results and communication between researchers, the advent of Open Access may be of as much significance as the transition from handwriting to printing via moveable type. As Environmental Health is an electronic Open Access journal, the numbers of downloads at the journal website can be retrieved. The top-20 list of articles most frequently accessed shows that all of them have been downloaded over 10,000 times. Back in 2002, the first article published was accessed only 49 times during the following month. A year later, the server had over 1,000 downloads per month, and now the total number of monthly downloads approaches 50,000. These statistics complement the Impact Factor and confirm the viability of Open Access in our field of research. The advent of digital media and its decentralized mode of distribution - the internet - have dramatically changed the control and financing of scientific information dissemination, while facilitating peer review, accelerating editorial handling, and supporting much needed transparency. Both the meaning and means of "having an impact" are therefore changing, as will the degree and way in which scientific journals remain "factors" in that impact.

  5. Factor 4 planning

    International Nuclear Information System (INIS)

    Bariol-Mathais, Brigitte; Lavoillotte, Philippine; Gall-Sorrentino, Florence; Malez, Marianne; Sanna, Daniela; Marsauche, Maud; Marquet, Sarah; Debergue, Sophie; Aminu, Olufunmi; Bernard, Helene; Marchand, Jean-Michel; Blin, Frederic; Grange, Jerome; Caillierez, Sophie; Muller, Dania; Clement, Bob; Desire, Jean-Charles; Metais, Benedicte; Lannuzel, Philippe; Pezet-Kuhn, Murielle; Pons, Anne; Rivoire-Meley, Benedicte; Tissot, Heloise

    2015-07-01

    Factor 4 is the goal of cutting our greenhouse gas emissions by 75% by 2050. Achieving this objective will necessitate radical changes in our practices, in particular concerning transport and housing; the measures currently implemented, such as positive-energy buildings, low-impact mobility and eco-neighbourhoods, will not be enough to meet this goal. These measures must be conceived in the framework of broad territorial planning that integrates environmental and energy objectives far upstream. To this end, the French Environment and Energy Management Agency (ADEME) and the French network of Urban Planning Agencies (FNAU), pursuing their missions in their respective areas of competence, have joined forces to make infrastructure and land use planning an integral part of the environmental and energy transition process. In 2013, the two organisations signed a partnership agreement and compiled an inventory of practices that are relevant to Factor 4 planning. This work was led by Epures, Saint-etienne urban planning agency, along with FNAU, drawing upon the expertise of a dozen urban planning agencies in precursor territories. This inventory describes the stakes, resources and strengths for each territory, which have led to cross-sectoral territorial planning exercises with ambitious environmental and energy objectives; the importance of evaluation in attaining these goals is emphasised. Current experience, questions and available methodological tools are summarised in this document, to encourage territories and help them design their planning policies along a trajectory to achieve Factor 4 goals. The compilation also aims to be a contribution to the COP21 climate conference

  6. Accidents and human factors

    International Nuclear Information System (INIS)

    Nishiwaki, Y.; Kawai, H.; Morishima, H.; Terano, T.; Sugeno, M.

    1984-01-01

    When the TMI accident occurred it was 4 a.m., an hour when the error potential of the operators would have been very high. The frequency of car and train accidents in Japan is also highest between 4 a.m. and 6 a.m. The error potential may be classified into five phases corresponding to the electroencephalogramic pattern (EEG). At phase 0, when the delta wave appears, a person is unconscious and in deep sleep; at phase I, when the theta wave appears, he is very tired, sleepy and subnormal; at phase II, when the alpha wave appears, he is normal, relaxed and passive; at phase III, when the beta wave appears, he is normal, clear-minded and active; at phase IV, when the strong beta or epileptic wave appears, he is hypernormal, excited and incapable of normal judgement. Should an accident occur at phase II, the brain condition may jump to phase IV. At this phase the error or accident potential is maximum. The response of the human brain to different types of noises and signals may vary somewhat for different individuals and for different groups of people. Therefore, the possibility that such differences in brain functions may influence the mental structure would be worthy of consideration in human factors and in the design of man-machine systems. Human reliability and performance would be affected by many factors: medical, physiological and psychological, etc. The uncertainty involved in human factors may not necessarily be probabilistic, but fuzzy. Therefore, it would be important to develop a theory by which both non-probabilistic uncertainties, or fuzziness, of human factors and the probabilistic properties of machines can be treated consistently. From the mathematical point of view, probabilistic measure is considered a special case of fuzzy measure. Therefore, fuzzy set theory seems to be an effective tool for analysing man-machine systems. To minimize human error and the possibility of accidents, new safety systems should not only back up man and make up for his

  7. Speeding Fermat's factoring method

    Science.gov (United States)

    McKee, James

    A factoring method is presented which, heuristically, splits composite n in O(n^{1/4+epsilon}) steps. There are two ideas: an integer approximation to sqrt(q/p) provides an O(n^{1/2+epsilon}) algorithm in which n is represented as the difference of two rational squares; observing that if a prime m divides a square, then m^2 divides that square, a heuristic speed-up to O(n^{1/4+epsilon}) steps is achieved. The method is well-suited for use with small computers: the storage required is negligible, and one never needs to work with numbers larger than n itself.

  8. Improved Balanced Incomplete Factorization

    Czech Academy of Sciences Publication Activity Database

    Bru, R.; Marín, J.; Mas, J.; Tůma, Miroslav

    2010-01-01

    Roč. 31, č. 5 (2010), s. 2431-2452 ISSN 0895-4798 R&D Projects: GA AV ČR IAA100300802 Grant - others:GA AV ČR(CZ) M100300902 Institutional research plan: CEZ:AV0Z10300504 Source of funding: I - inštitucionálna podpora na rozvoj VO Keywords : preconditioned iterative methods * sparse matrices * incomplete decompositions * approximate inverses * Sherman-Morrison formula * nonsymmetric matrices Subject RIV: BA - General Mathematics Impact factor: 1.725, year: 2010

  9. Sleep-inducing factors.

    Science.gov (United States)

    García-García, Fabio; Acosta-Peña, Eva; Venebra-Muñoz, Arturo; Murillo-Rodríguez, Eric

    2009-08-01

    Kuniomi Ishimori and Henri Piéron were the first researchers to introduce the concept and experimental evidence for a chemical factor that would presumably accumulate in the brain during waking and eventually induce sleep. This substance was named hypnotoxin. Currently, the variety of substances which have been shown to alter sleep includes peptides, cytokines, neurotransmitters and some substances of lipidic nature, many of which are well known for their involvement in other biological activities. In this chapter, we describe the sleep-inducing properties of the vasoactive intestinal peptide, prolactin, adenosine and anandamide.

  10. "Factor Analysis Using ""R"""

    Directory of Open Access Journals (Sweden)

    A. Alexander Beaujean

    2013-02-01

    Full Text Available R (R Development Core Team, 2011 is a very powerful tool to analyze data, that is gaining in popularity due to its costs (its free and flexibility (its open-source. This article gives a general introduction to using R (i.e., loading the program, using functions, importing data. Then, using data from Canivez, Konold, Collins, and Wilson (2009, this article walks the user through how to use the program to conduct factor analysis, from both an exploratory and confirmatory approach.

  11. Perinatal risk factors for strabismus

    DEFF Research Database (Denmark)

    Torp-Pedersen, Tobias; Boyd, Heather A; Poulsen, Gry

    2010-01-01

    Little is known about the aetiological factors underlying strabismus. We undertook a large cohort study to investigate perinatal risk factors for strabismus, overall and by subtype.......Little is known about the aetiological factors underlying strabismus. We undertook a large cohort study to investigate perinatal risk factors for strabismus, overall and by subtype....

  12. Activation of human factor V by factor Xa and thrombin

    International Nuclear Information System (INIS)

    Monkovic, D.D.; Tracy, P.B.

    1990-01-01

    The activation of human factor V by factor Xa and thrombin was studied by functional assessment of cofactor activity and sodium dodecyl sulfate-polycarylamide gel electrophoresis followed by either autoradiography of 125 I-labeled factor V activation products or Western blot analyses of unlabeled factor V activation products. Cofactor activity was measured by the ability of the factor V/Va peptides to support the activation of prothrombin. The factor Xa catalyzed cleavage of factor V was observed to be time, phospholipid, and calcium ion dependent, yielding a cofactor with activity equal to that of thrombin-activated factor V (factor Va). The cleavage pattern differed markedly from the one observed in the bovine system. The factor Xa activated factor V subunits expressing cofactor activity were isolated and found to consist of peptides of M r 220,000 and 105,000. Although thrombin cleaved the M r 220,000 peptide to yield peptides previously shown to be products of thrombin activation, cofactor activity did not increase. N-Terminal sequence analysis confirmed that both factor Xa and thrombin cleave factor V at the same bond to generate the M r 220,000 peptide. The factor Xa dependent functional assessment of 125 I-labeled factor V coupled with densitometric analyses of the cleavage products indicated that the cofactor activity of factor Xa activated factor V closely paralleled the appearance of the M r 220,000 peptide. The data indicate that factor Xa is as efficient an enzyme toward factor V as thrombin

  13. Telomere binding protein TRB1 is associated with promoters of translation machinery genes in vivo

    Czech Academy of Sciences Publication Activity Database

    Schrumpfová, P.; Vychodilová, I.; Hapala, J.; Schorová, Š.; Dvořáček, Vojtěch; Fajkus, Jiří

    2016-01-01

    Roč. 90, 1-2 (2016), s. 189-206 ISSN 0167-4412 R&D Projects: GA ČR(CZ) GA13-06943S Institutional support: RVO:68081707 Keywords : Telomere repeat binding * ChIP-seq * Arabidopsis thaliana Subject RIV: BO - Biophysics Impact factor: 3.356, year: 2016

  14. Resolution of telomere associations by TRF1 cleavage in mouse embryonic stem cells

    NARCIS (Netherlands)

    Lisaingo, Kathleen; Uringa, Evert-Jan; Lansdorp, Peter M.

    2014-01-01

    Telomere associations have been observed during key cellular processes such as mitosis, meiosis, and carcinogenesis and must be resolved before cell division to prevent genome instability. Here we establish that telomeric repeat-binding factor 1 (TRF1), a core component of the telomere protein

  15. Organizational factors in Korean NPPs

    International Nuclear Information System (INIS)

    Jang, D. J.; Kim, Y. I.; Jeong, C. H.; Kim, J. W.

    2003-01-01

    Organizational factors are referred to as the factors that influence the achievement of a goal of an organization. Latent problems of an organization could contribute to causing human errors in such stages as design, operation and maintenance, and furthermore, leading to an severe accident. In order to evaluate an organization from the safety viewpoint, it is necessary to identify the organizational factors in a systematic fashion. In this paper, some efforts to identify the organizational factors in Korean NPPs are presented. The study was performed in the following steps: 1) Reviewing the definitions and range of the organizational factors used by the previous 13 researches, 2) Structuring the organizational factors by screening and collating factors, 3) Analysing the organizational factors that is considered to have contributed to the trip events based on the trip report of Korean NPPs, 4) Suggesting a more reliable taxonomy of organizational factors for event analysis by applying the Onion Structure Model to the selected factors

  16. Risk Factors in Pemphigus

    Directory of Open Access Journals (Sweden)

    Gülşen Tükenmez Demirc

    2011-09-01

    Full Text Available Background and Design: There have been reports suggesting the involvement of environmental factors in the disease process of pemphigus. In this study, we aimed to find out the risk factors which could play role in the etiopathogenesis in our pemphigus patients.Material and method: A total of 42 patients (15 male and 27 female who were diagnosed as pemphigus with histopathological and direct immunoflurosence examinations in our clinic between the years 1998-2004, were interviewed for assessment of regarding with the subjects of the demographic properties, occupational groups, educational level, the number of pregnancies, stressfull life events, diet habits, smoking and alcohol consumption before the onset of the disease and the results were compared to 42 age and gender-matched controls with similar socioeconomic circumstances. Results: Working in agriculture and livestock, multi-parity, absence of smoking and stressfull life events were found to be statistically significant in pemphigus patients than in controls. Conclusion: Working in agriculture and livestock, multi-parity, absence of smoking and stressfull life events were assumed to play role in the etiopathogenesis and course of pemphigus.

  17. Activation of 125I-Factor IX and 125I-Factor X: Effect of tissue factor and Factor VII, Factor Xsub(a) and thrombin

    International Nuclear Information System (INIS)

    Oesterud, B.; Rapaport, S.I.

    Activation of Factor IX and Factor X was studied by adding 125 I-Factor IX or 125 I-Factor X to reaction mixtures and quantitating cleavage products by reduced sodium dodecylsulfate gel electrophoresis. Thrombin failed to activate Factors IX or X; Factor Xsub(a) produced insignificant amounts of cleavage products of both factors. In contrast, the reaction product of tissue factor and Factor VII cleaved large amounts of both Factor IX and Factor X in purified systems and in plasma. In incubation mixtures of plasma containing added 125 I-Factor IX or 125 I-Factor X, tissue factor and Ca 2+ ions, the percentage of total radioactivity in the heavy chain peak of 125 I-IXsub(a) and the heavy chain of 125 I-Xsub(a) increased at a similar rate. When the tissue factor was diluted, similar curves were obtained for percent cleavage of 125 I-Factor IX and percent cleavage of 125 I-Factor X plotted against tissue factor concentration. These findings support the hypothesis that activation of Factor IX by the tissue factor-Factor VII reaction product represents a physiologically significant step in normal haemostasis. (author)

  18. Psychosomatic factors in pruritus.

    Science.gov (United States)

    Tey, Hong Liang; Wallengren, Joanna; Yosipovitch, Gil

    2013-01-01

    Pruritus and psyche are intricately and reciprocally related, with psychophysiological evidence and psychopathological explanations helping us to understand their complex association. Their interaction may be conceptualized and classified into 3 groups: pruritic diseases with psychiatric sequelae, pruritic diseases aggravated by psychosocial factors, and psychiatric disorders causing pruritus. Management of chronic pruritus is directed at treating the underlying causes and adopting a multidisciplinary approach to address the dermatologic, somatosensory, cognitive, and emotional aspects. Pharmcotherapeutic agents that are useful for chronic pruritus with comorbid depression and/or anxiety comprise selective serotonin reuptake inhibitors, mirtazapine, tricyclic antidepressants (amitriptyline and doxepin), and anticonvulsants (gabapentin, pregabalin); the role of neurokinin receptor-1 antagonists awaits verification. Antipsychotics are required for treating itch and formication associated with schizophrenia and delusion of parasitosis (including Morgellons disease). Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Factorization of Observables

    Science.gov (United States)

    Eliaš, Peter; Frič, Roman

    2017-12-01

    Categorical approach to probability leads to better understanding of basic notions and constructions in generalized (fuzzy, operational, quantum) probability, where observables—dual notions to generalized random variables (statistical maps)—play a major role. First, to avoid inconsistencies, we introduce three categories L, S, and P, the objects and morphisms of which correspond to basic notions of fuzzy probability theory and operational probability theory, and describe their relationships. To illustrate the advantages of categorical approach, we show that two categorical constructions involving observables (related to the representation of generalized random variables via products, or smearing of sharp observables, respectively) can be described as factorizing a morphism into composition of two morphisms having desired properties. We close with a remark concerning products.

  20. Functional Maximum Autocorrelation Factors

    DEFF Research Database (Denmark)

    Larsen, Rasmus; Nielsen, Allan Aasbjerg

    2005-01-01

    MAF outperforms the functional PCA in concentrating the interesting' spectra/shape variation in one end of the eigenvalue spectrum and allows for easier interpretation of effects. Conclusions. Functional MAF analysis is a useful methods for extracting low dimensional models of temporally or spatially......Purpose. We aim at data where samples of an underlying function are observed in a spatial or temporal layout. Examples of underlying functions are reflectance spectra and biological shapes. We apply functional models based on smoothing splines and generalize the functional PCA in......\\verb+~+\\$\\backslash\\$cite{ramsay97} to functional maximum autocorrelation factors (MAF)\\verb+~+\\$\\backslash\\$cite{switzer85,larsen2001d}. We apply the method to biological shapes as well as reflectance spectra. {\\$\\backslash\\$bf Methods}. MAF seeks linear combination of the original variables that maximize autocorrelation between...

  1. Pion form factor

    Energy Technology Data Exchange (ETDEWEB)

    Ryong Ji, C.; Pang, A.; Szczepaniak, A. [North Carolina State Univ., Raleigh, NC (United States)

    1994-04-01

    It is pointed out that the correct criterion to define the legal PQCD contribution to the exclusive processes in the lightcone perturbative expansion should be based on the large off-shellness of the lightcone energy in the intermediate states. In the lightcone perturbative QCD calculation of the pion form factor, the authors find that the legal PQCD contribution defined by the lightcone energy cut saturates in the smaller Q{sup 2} region compared to that defined by the gluon four-momentum square cut. This is due to the contribution by the highly off-energy-shell gluons in the end point regions of the phase space, indicating that the gluon four-momentum-square cut may have cut too much to define the legal PQCD.

  2. Eukaryotic transcription factors

    DEFF Research Database (Denmark)

    Staby, Lasse; O'Shea, Charlotte; Willemoës, Martin

    2017-01-01

    Gene-specific transcription factors (TFs) are key regulatory components of signaling pathways, controlling, for example, cell growth, development, and stress responses. Their biological functions are determined by their molecular structures, as exemplified by their structured DNA-binding domains...... regions with function-related, short sequence motifs and molecular recognition features with structural propensities. This review focuses on molecular aspects of TFs, which represent paradigms of ID-related features. Through specific examples, we review how the ID-associated flexibility of TFs enables....... It is furthermore emphasized how classic biochemical concepts like allostery, conformational selection, induced fit, and feedback regulation are undergoing a revival with the appreciation of ID. The review also describes the most recent advances based on computational simulations of ID-based interaction mechanisms...

  3. Nucleon Electromagnetic Form Factors

    Energy Technology Data Exchange (ETDEWEB)

    Marc Vanderhaeghen; Charles Perdrisat; Vina Punjabi

    2007-10-01

    There has been much activity in the measurement of the elastic electromagnetic proton and neutron form factors in the last decade, and the quality of the data has greatly improved by performing double polarization experiments, in comparison with previous unpolarized data. Here we review the experimental data base in view of the new results for the proton, and neutron, obtained at JLab, MAMI, and MIT-Bates. The rapid evolution of phenomenological models triggered by these high-precision experiments will be discussed, including the recent progress in the determination of the valence quark generalized parton distributions of the nucleon, as well as the steady rate of improvements made in the lattice QCD calculations.

  4. Wave friction factor rediscovered

    Science.gov (United States)

    Le Roux, J. P.

    2012-02-01

    The wave friction factor is commonly expressed as a function of the horizontal water particle semi-excursion ( A wb) at the top of the boundary layer. A wb, in turn, is normally derived from linear wave theory by {{U_{{wb}}/T_{{w}}}}{{2π }} , where U wb is the maximum water particle velocity measured at the top of the boundary layer and T w is the wave period. However, it is shown here that A wb determined in this way deviates drastically from its real value under both linear and non-linear waves. Three equations for smooth, transitional and rough boundary conditions, respectively, are proposed to solve this problem, all three being a function of U wb, T w, and δ, the thickness of the boundary layer. Because these variables can be determined theoretically for any bottom slope and water depth using the deepwater wave conditions, there is no need to physically measure them. Although differing substantially from many modern attempts to define the wave friction factor, the results coincide with equations proposed in the 1960s for either smooth or rough boundary conditions. The findings also confirm that the long-held notion of circular water particle motion down to the bottom in deepwater conditions is erroneous, the motion in fact being circular at the surface and elliptical at depth in both deep and shallow water conditions, with only horizontal motion at the top of the boundary layer. The new equations are incorporated in an updated version (WAVECALC II) of the Excel program published earlier in this journal by Le Roux et al. Geo-Mar Lett 30(5): 549-560, (2010).

  5. [The Steel factor].

    Science.gov (United States)

    Cáceres-Cortés, J R

    1997-01-01

    Mice bearing mutations at either of two loci, dominant White spotting(W) or Steel(Sl), exhibit development defects in hematopoietic, melanocytic and germ cells. Genetics studies have shown that the SI locus encodes the Steel factor (SF), which is the ligand for the tyrosine kinase receptor c-kit, the product of the W locus. SF is synthesized in membrane-bound form and can be processed to produce a soluble form. Cell-cell interaction is important in the production of normal blood cells in vivo and in vitro and in the cellular expansion of leukemic cells. We discuss here how SF decreases the requirements in cell interaction for blast colony formation in acute myeloblastic leukemia (AML) and the presence of membrane-bound SF possibly contributes to the density-dependent growth of the AML blasts. We explain that SF is mainly a survival factor for hematopoietic cells, of little proliferative effect, which maintains CD34+ hematopoietic cells in an undifferentiated state. These properties would potentially allow the maintenance of hematopoietic cells in culture for the purpose of marrow purging or gene therapy. The activation of the c-kit signal transduction pathway may play a significant role in the development of many types of non-hematological malignancies by disrupting normal cell-cell interactions and allowing the growth of cancer cell populations. In summary, the properties of the SF indicate it has a role for survival signals during the process of normal differentiation, AML proliferation and in the maintenance of many c-kit+ tumors.

  6. Neutron quality factor

    International Nuclear Information System (INIS)

    1995-06-01

    Both the International Commission on Radiological Protection (ICRP) and the National Council on Radiation Protection and Measurements (NCRP) have recommended that the radiation quality weighting factor for neutrons (Q n , or the corresponding new modifying factor, w R ) be increased by a value of two for most radiation protection practices. This means an increase in the recommended value for Q n from a nominal value of 10 to a nominal value of 20. This increase may be interpreted to mean that the biological effectiveness of neutrons is two times greater than previously thought. A decision to increase the value of Q n will have a major impact on the regulations and radiation protection programs of Federal agencies responsible for the protection of radiation workers. Therefore, the purposes of this report are: (1) to examine the general concept of open-quotes quality factorclose quotes (Q) in radiation protection and the rationale for the selection of specific values of Q n ; and (2) to make such recommendations to the Federal agencies, as appropriate. This report is not intended to be an exhaustive review of the scientific literature on the biological effects of neutrons, with the aim of defending a particular value for Q n . Rather, the working group examined the technical issues surrounding the current recommendations of scientific advisory bodies on this matter, with the aim of determining if these recommendations should be adopted by the Federal agencies. Ultimately, the group concluded that there was no compelling basis for a change in Q n . The report was prepared by Federal scientists working under the auspices of the Science Panel of the Committee on Interagency Radiation Research and Policy Coordination (CIRRPC)

  7. Double overexpression of DREB and PIF transcription factors improves drought stress tolerance and cell elongation in transgenic plants.

    Science.gov (United States)

    Kudo, Madoka; Kidokoro, Satoshi; Yoshida, Takuya; Mizoi, Junya; Todaka, Daisuke; Fernie, Alisdair R; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2017-04-01

    Although a variety of transgenic plants that are tolerant to drought stress have been generated, many of these plants show growth retardation. To improve drought tolerance and plant growth, we applied a gene-stacking approach using two transcription factor genes: DEHYDRATION-RESPONSIVE ELEMENT-BINDING 1A (DREB1A) and rice PHYTOCHROME-INTERACTING FACTOR-LIKE 1 (OsPIL1). The overexpression of DREB1A has been reported to improve drought stress tolerance in various crops, although it also causes a severe dwarf phenotype. OsPIL1 is a rice homologue of Arabidopsis PHYTOCHROME-INTERACTING FACTOR 4 (PIF4), and it enhances cell elongation by activating cell wall-related gene expression. We found that the OsPIL1 protein was more stable than PIF4 under light conditions in Arabidopsis protoplasts. Transactivation analyses revealed that DREB1A and OsPIL1 did not negatively affect each other's transcriptional activities. The transgenic plants overexpressing both OsPIL1 and DREB1A showed the improved drought stress tolerance similar to that of DREB1A overexpressors. Furthermore, double overexpressors showed the enhanced hypocotyl elongation and floral induction compared with the DREB1A overexpressors. Metabolome analyses indicated that compatible solutes, such as sugars and amino acids, accumulated in the double overexpressors, which was similar to the observations of the DREB1A overexpressors. Transcriptome analyses showed an increased expression of abiotic stress-inducible DREB1A downstream genes and cell elongation-related OsPIL1 downstream genes in the double overexpressors, which suggests that these two transcription factors function independently in the transgenic plants despite the trade-offs required to balance plant growth and stress tolerance. Our study provides a basis for plant genetic engineering designed to overcome growth retardation in drought-tolerant transgenic plants. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology

  8. Factorization and non-factorization in diffractive hard scattering

    International Nuclear Information System (INIS)

    Berera, Arjun

    1997-01-01

    Factorization, in the sense defined for inclusive hard scattering, is discussed for diffractive hard scattering. A factorization theorem similar to its inclusive counterpart is presented for diffractive DIS. For hadron-hadron diffractive hard scattering, in contrast to its inclusive counterpart, the expected breakdown of factorization is discussed. Cross section estimates are given from a simple field theory model for non-factorizing double-pomeron-exchange (DPE) dijet production with and without account for Sudakov suppression

  9. Robust and Sparse Factor Modelling

    DEFF Research Database (Denmark)

    Croux, Christophe; Exterkate, Peter

    Factor construction methods are widely used to summarize a large panel of variables by means of a relatively small number of representative factors. We propose a novel factor construction procedure that enjoys the properties of robustness to outliers and of sparsity; that is, having relatively few...... nonzero factor loadings. Compared to the traditional factor construction method, we find that this procedure leads to a favorable forecasting performance in the presence of outliers and to better interpretable factors. We investigate the performance of the method in a Monte Carlo experiment...

  10. Identifying the important factors in simulation models with many factors

    NARCIS (Netherlands)

    Bettonvil, B.; Kleijnen, J.P.C.

    1994-01-01

    Simulation models may have many parameters and input variables (together called factors), while only a few factors are really important (parsimony principle). For such models this paper presents an effective and efficient screening technique to identify and estimate those important factors. The

  11. External Factors, Internal Factors and Self-Directed Learning Readiness

    Science.gov (United States)

    Ramli, Nurjannah; Muljono, Pudji; Afendi, Farit M.

    2018-01-01

    There are many factors which affect the level of self-directed learning readiness. This study aims to investigate the relationship between external factors, internal factors and self-directed learning readiness. This study was carried out by using a census method for fourth year students of medical program of Tadulako University. Data were…

  12. A 21.7 kb DNA segment on the left arm of yeast chromosome XIV carries WHI3, GCR2, SPX18, SPX19, an homologue to the heat shock gene SSB1 and 8 new open reading frames of unknown function.

    Science.gov (United States)

    Jonniaux, J L; Coster, F; Purnelle, B; Goffeau, A

    1994-12-01

    We report the amino acid sequence of 13 open reading frames (ORF > 299 bp) located on a 21.7 kb DNA segment from the left arm of chromosome XIV of Saccharomyces cerevisiae. Five open reading frames had been entirely or partially sequenced previously: WHI3, GCR2, SPX19, SPX18 and a heat shock gene similar to SSB1. The products of 8 other ORFs are new putative proteins among which N1394 is probably a membrane protein. N1346 contains a leucine zipper pattern and the corresponding ORF presents an HAP (global regulator of respiratory genes) upstream activating sequence in the promoting region. N1386 shares homologies with the DNA structure-specific recognition protein family SSRPs and the corresponding ORF is preceded by an MCB (MluI cell cycle box) upstream activating factor.

  13. Electromagnetic Hadronic Form-Factors

    International Nuclear Information System (INIS)

    Edwards, Robert G.

    2005-01-01

    We present a calculation of the nucleon electromagnetic form-factors as well as the pion and rho to pion transition form-factors in a hybrid calculation with domain wall valence quarks and improved staggered (Asqtad) sea quarks

  14. R-Factor for Alaska

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The rainfall-runoff erosivity factor (R-Factor) quantifies the effects of raindrop impacts and reflects the amount and rate of runoff associated with the rain. The...

  15. Air Emissions Factors and Quantification

    Science.gov (United States)

    Emissions factors are used in developing air emissions inventories for air quality management decisions and in developing emissions control strategies. This area provides technical information on and support for the use of emissions factors.

  16. Integrated Factors Correlating Undergraduate Academic ...

    African Journals Online (AJOL)

    Integrated Factors Correlating Undergraduate Academic Achievement in Bayelsa State, Nigeria. ... AFRREV IJAH: An International Journal of Arts and Humanities ... Thus, it is study investigated the integrated factors determining academic performance of students in public secondary schools in Bayelsa State, Nigeria.

  17. Human Factors in Training

    Science.gov (United States)

    Barshi, Immanuel; Byrne, Vicky; Arsintescu, Lucia; Connell, Erin

    2010-01-01

    Future space missions will be significantly longer than current shuttle missions and new systems will be more complex than current systems. Increasing communication delays between crews and Earth-based support means that astronauts need to be prepared to handle the unexpected on their own. As crews become more autonomous, their potential span of control and required expertise must grow to match their autonomy. It is not possible to train for every eventuality ahead of time on the ground, or to maintain trained skills across long intervals of disuse. To adequately prepare NASA personnel for these challenges, new training approaches, methodologies, and tools are required. This research project aims at developing these training capabilities. By researching established training principles, examining future needs, and by using current practices in space flight training as test beds, both in Flight Controller and Crew Medical domains, this research project is mitigating program risks and generating templates and requirements to meet future training needs. Training efforts in Fiscal Year 09 (FY09) strongly focused on crew medical training, but also began exploring how Space Flight Resource Management training for Mission Operations Directorate (MOD) Flight Controllers could be integrated with systems training for optimal Mission Control Center (MCC) operations. The Training Task addresses Program risks that lie at the intersection of the following three risks identified by the Project: 1) Risk associated with poor task design; 2) Risk of error due to inadequate information; and 3) Risk associated with reduced safety and efficiency due to poor human factors design.

  18. Self-shielding factors

    International Nuclear Information System (INIS)

    Kaul, D.C.

    1982-01-01

    Throughout the last two decades many efforts have been made to estimate the effect of body self-shielding on organ doses from externally incident neutrons and gamma rays. These began with the use of simple geometry phantoms and have culminated in the use of detailed anthropomorphic phantoms. In a recent effort, adjoint Monte Carlo analysis techniques have been used to determine dose and dose equivalent to the active marrow as a function of energy and angle of neutron fluence externally incident on an anthropomorphic phantom. When combined with fluences from actual nuclear devices, these dose-to-fluence factors result in marrow dose values that demonstrate great sensitivity to variations in device type, range, and body orientation. Under a state-of-the-art radiation transport analysis demonstration program for the Japanese cities, sponsored by the Defense Nuclear Agency at the request of the National Council on Radiation Protection and Measurements, the marrow dose study referred to above is being repeated to obtain spectral distributions within the marrow for externally incident neutrons and gamma rays of arbitrary energy and angle. This is intended to allow radiobiologists and epidemiologists to select and to modify numbers of merit for correlation with health effects and to permit a greater understanding of the relationship between human and laboratory subject dosimetry

  19. Research organizational factors

    International Nuclear Information System (INIS)

    Coffman, F.D. Jr.

    1990-01-01

    Organizational processes at nuclear power plants should be sufficient to prevent accidents and to protect public health and safety upon the occurrence of an accident. The role of regulatory research is to confirm that agency assessments of organization processes are on a firm technical basis and provide for improvements in the NRC [Nuclear Regulatory Commission] programs. A firm technical basis is achieved by reducing uncertainties associated with methods and measures used to assess organization processes. The general objective for regulatory research is to confirm that the agency has a coherent understanding of the organizational processes that are individually necessary and are collectively sufficient for safe operations, methods are available to reliably characterize organizational processes, and measures exist to monitor changes in the key organizational processes. The first specific objective was to develop a method to translate organizational processes into PRAs. The discussion provides feedback and insights from experience with the past and the ongoing organizational factors research. That experience suggests a set of ingredients that appear proper for performing regulatory research on organizational processes. By keeping focused upon these proper ingredients, the research will contribute to the regulatory assessments of utility management through the use of improved methods and measures in investigations, inspections, diagnostics, performance indicators, and PRA insights

  20. Global MYCN transcription factor binding analysis in neuroblastoma reveals association with distinct E-box motifs and regions of DNA hypermethylation.

    LENUS (Irish Health Repository)

    Murphy, Derek M

    2009-01-01

    BACKGROUND: Neuroblastoma, a cancer derived from precursor cells of the sympathetic nervous system, is a major cause of childhood cancer related deaths. The single most important prognostic indicator of poor clinical outcome in this disease is genomic amplification of MYCN, a member of a family of oncogenic transcription factors. METHODOLOGY: We applied MYCN chromatin immunoprecipitation to microarrays (ChIP-chip) using MYCN amplified\\/non-amplified cell lines as well as a conditional knockdown cell line to determine the distribution of MYCN binding sites within all annotated promoter regions. CONCLUSION: Assessment of E-box usage within consistently positive MYCN binding sites revealed a predominance for the CATGTG motif (p<0.0016), with significant enrichment of additional motifs CATTTG, CATCTG, CAACTG in the MYCN amplified state. For cell lines over-expressing MYCN, gene ontology analysis revealed enrichment for the binding of MYCN at promoter regions of numerous molecular functional groups including DNA helicases and mRNA transcriptional regulation. In order to evaluate MYCN binding with respect to other genomic features, we determined the methylation status of all annotated CpG islands and promoter sequences using methylated DNA immunoprecipitation (MeDIP). The integration of MYCN ChIP-chip and MeDIP data revealed a highly significant positive correlation between MYCN binding and DNA hypermethylation. This association was also detected in regions of hemizygous loss, indicating that the observed association occurs on the same homologue. In summary, these findings suggest that MYCN binding occurs more commonly at CATGTG as opposed to the classic CACGTG E-box motif, and that disease associated over expression of MYCN leads to aberrant binding to additional weaker affinity E-box motifs in neuroblastoma. The co-localization of MYCN binding and DNA hypermethylation further supports the dual role of MYCN, namely that of a classical transcription factor affecting the

  1. BASIC FACTORS OF MARKET CONCENTRATION

    OpenAIRE

    V. Fyliuk

    2013-01-01

    The paper systemizes factors which reinforce trends towards market concentration in all economic systems. These factors include factors related to the general changes in economic environment such as globalization of the world economy, state structural and taxation policies, cycle of economic development and changes in consumer demand. They also include factors related to competition (intensification of competition, companies’ desire to monopolize market and present market structure) and scien...

  2. Human Factors in Marine Casualties

    Directory of Open Access Journals (Sweden)

    Jelenko Švetak

    2002-05-01

    Full Text Available Human factors play an important role in the origin of accidents,and it is commonly claimed that between seventy andninety-five percent of industrial and transport accidents involvehuman factors, see Figure 1.Some authorities, however, claim that ultimately, all accidentsinvolve human factors.

  3. Risks factoring business: accounting measurement

    Directory of Open Access Journals (Sweden)

    Z.V. Gutsaylyuk

    2015-06-01

    Full Text Available The paper carried out the identification of risk factors for the development of possible accounting software management. Studied theoretical and methodological aspects of the risk classification of factoring operations in the part of the risk assessment factors. It is proposed to consider the risks factors as the risk that is acceptable controlled by accounting instruments and the risks that can not be taken into account in the accounting records. To minimize the risk factor, accounting-driven tools, a method of self-insurance, which is a factor in the creation of provision for factoring transactions designed to cover unexpected expenses and losses. Provision for factoring factor will establish more stable conditions of financial activity and avoid the fluctuations of profit factor in relation to the writing off of losses on factoring operatsіyam.Developed proposals allow for further research to improve the organizational and methodological basis of accounting and analysis of information as a basis for providing risk management factor, particularly in terms of improving the evaluation questions such risks and their qualitative and quantitative analysis.

  4. Investing in systematic factor premiums

    NARCIS (Netherlands)

    Koedijk, Kees G.; Slager, Alfred M. H.; Stork, P.A.

    In this paper we investigate and evaluate factor investing in the US and Europe for equities and bonds. We show that factor-based portfolios generally produce comparable or better portfolios than market indices. We expand the analysis to other asset classes and factors, work with other optimisation

  5. Sparse and Robust Factor Modelling

    NARCIS (Netherlands)

    C. Croux (Christophe); P. Exterkate (Peter)

    2011-01-01

    textabstractFactor construction methods are widely used to summarize a large panel of variables by means of a relatively small number of representative factors. We propose a novel factor construction procedure that enjoys the properties of robustness to outliers and of sparsity; that is, having

  6. Risk Factor Assessment Branch (RFAB)

    Science.gov (United States)

    The Risk Factor Assessment Branch (RFAB) focuses on the development, evaluation, and dissemination of high-quality risk factor metrics, methods, tools, technologies, and resources for use across the cancer research continuum, and the assessment of cancer-related risk factors in the population.

  7. Epidermal growth factor receptor VIII peptide vaccination is efficacious against established intracerebral tumors.

    Science.gov (United States)

    Heimberger, Amy B; Crotty, Laura E; Archer, Gary E; Hess, Kenneth R; Wikstrand, Carol J; Friedman, Allan H; Friedman, Henry S; Bigner, Darell D; Sampson, John H

    2003-09-15

    The epidermal growth factor receptor (EGFR) is often amplified and structurally rearranged in malignant gliomas and other tumors such as breast and lung, with the most common mutation being EGFRvIII. In the study described here, we tested in mouse models a vaccine consisting of a peptide encompassing the tumor-specific mutated segment of EGFRvIII (PEP-3) conjugated to keyhole limpet hemocyanin [KLH (PEP-3-KLH)]. C57BL/6J or C3H mice were vaccinated with PEP-3-KLH and subsequently challenged either s.c. or intracerebrally with a syngeneic melanoma cell line stably transfected with a murine homologue of EGFRvIII. Control mice were vaccinated with KLH. To test its effect on established tumors, C3H mice were also challenged intracerebrally and subsequently vaccinated with PEP-3-KLH. S.c. tumors developed in all of the C57BL/6J mice vaccinated with KLH in Freund's adjuvant, and there were no long-term survivors. Palpable tumors never developed in 70% of the PEP-3-KLH-vaccinated mice. In the C57BL/6J mice receiving the PEP-3-KLH vaccine, the tumors that did develop were significantly smaller than those in the control group (P PEP-3-KLH vaccination did not result in significant cytotoxic responses in standard cytotoxicity assays; however, antibody titers against PEP-3 were enhanced. The passive transfer of sera from the immunized mice to nonimmunized mice protected 31% of the mice from tumor development (P PEP-3-KLH-vaccinated mice. Peptide vaccination was also sufficiently potent to have marked efficacy against intracerebral tumors, resulting in a >173% increase in median survival time, with 80% of the C3H mice achieving long-term survival (P = 0.014). In addition, C3H mice with established intracerebral tumor that received a single treatment of PEP-3-KLH showed a 26% increase in median survival time, with 40% long-term survival (P = 0.007). Vaccination with an EGFRvIII-specific peptide is efficacious against both s.c. and established intracerebral tumors. The

  8. Geriatic Disability Related Factors

    Directory of Open Access Journals (Sweden)

    Mohsen Adib Hajbagheri

    2008-07-01

    Full Text Available Objectives: Reports are indicating of increasing trend of aging and disability in the developing countries while such disabilities are decreasing within the developed countries. This study designed to evaluate the disability and some of its related factors among the elderly population (65 and older in Kashan, Iran. Methods & Materials: A cross-sectional analytical study was conducted on a multi-stage random sample of 350 elderly people (65 year and older in Kashan. The WHO-DAS-II was used as the generic disability measure. The questionnair had 48 questions. The range of score could be between 0-144. Chi-square, t-test analysis and ANOVA were utilized to check significant differences between subgroups. Results: 61% were men and 12% were living lonely. One fourth had some type of addiction, the majority were ilitrate and two thired had not regular phisycal activity.Twenty percent of the old people had a modereate disability and 4.3% were extremely disabled. A significant relationship was found between the disability and variables such as sex, age, living style, needing help, marriage status, living location, addiction, job, level of physical activity, education, and having multiple diseases. Conclusion: In conclusion, geriatric population in Iran, has a lower levels of disability in compare to those of other developed countries. Need of geriatric cares must be be increasing, since the populationpattern of elderly people is increasing in Iran. Female and ilitrate elders were sufering of more disability. These findings indicated the nessesity to more attention to these voulnarable subgroups of population.

  9. Gut transfer factors

    International Nuclear Information System (INIS)

    1990-01-01

    A Nuclear Energy Agency (NEA) Expert Group has proposed values for the absorbed fractions (f 1 values) of radionuclides ingested in food and drinking water by members of the public. The f 1 values for adults, which are also taken to apply to children from 1 year of age, are increased from those given in ICRP Publication 30 for occupationally exposed adults for 7 elements out of the 31 considered. Since the publication of the NEA report, further information has become available that is relevant to the choice of f 1 values for polonium and thorium. These data suggest that for the present the f 1 value for polonium currently recommended by ICRP (0.1) should be retained, and that for thorium a reasonable f 1 value is 0.0005. With these exceptions, the NRPB endorses the revisions in f 1 values proposed by the NEA Expert Group for adults and children from 1 year of age. Higher f 1 values are proposed by the NEA expert Group for absorption in the first year of life. For adult values of between 0.01 and 0.5, an increase by a factor of two is assumed, and for adult values of 0.001 or less, absorption by infants is taken to be ten times greater. This approach is consistent with, and extends, that applied to the actinides in ICRP Publication 48 and represents a reasonable interpretation of current evidence. The NRPB therefore endorses the approach proposed by the NEA Expert Group for the calculation of doses to infants. (author)

  10. Acetylated Histone H3K9 is associated with meiotic recombination hotspots, and plays a role in recombination redundantly with other factors including the H3K4 methylase Set1 in fission yeast

    Science.gov (United States)

    Yamada, Shintaro; Ohta, Kunihiro; Yamada, Takatomi

    2013-01-01

    Histone modifications are associated with meiotic recombination hotspots, discrete sites with augmented recombination frequency. For example, trimethylation of histone H3 lysine4 (H3K4me3) marks most hotspots in budding yeast and mouse. Modified histones are known to regulate meiotic recombination partly by promoting DNA double-strand break (DSB) formation at hotspots, but the role and precise landscape of involved modifications remain unclear. Here, we studied hotspot-associated modifications in fission yeast and found general features: acetylation of H3 lysine9 (H3K9ac) is elevated, and H3K4me3 is not significantly enriched. Mutating H3K9 to non-acetylatable alanine mildly reduced levels of the DSB-inducing protein Rec12 (the fission yeast homologue of Spo11) and DSB at hotspots, indicating that H3K9ac may be involved in DSB formation by enhancing the interaction between Rec12 and hotspots. In addition, we found that the lack of the H3K4 methyltransferase Set1 generally increased Rec12 binding to chromatin but partially reduced DSB formation at some loci, suggesting that Set1 is also involved in DSB formation. These results suggest that meiotic DSB formation is redundantly regulated by multiple chromatin-related factors including H3K9ac and Set1 in fission yeast. PMID:23382177

  11. Phylogeny and origin of 82 zygomycetes from all 54 genera of the Mucorales and Mortierellales based on combined analysis of actin and translation elongation factor EF-1alpha genes.

    Science.gov (United States)

    Voigt, K; Wöstemeyer, J

    2001-05-30

    True fungi (Eumycota) are heterotrophic eukaryotic microorganisms encompassing ascomycetes, basidiomycetes, chytridiomycetes and zygomycetes. The natural systematics of the latter group, Zygomycota, are very poorly understood due to the lack of distinguishing morphological characters. We have determined sequences for the nuclear-encoded genes actin (act) from 82 zygomycetes representing all 54 currently recognized genera from the two zygomycetous orders Mucorales and Mortierellales. We also determined sequences for translation elongation factor EF-1alpha (tef) from 16 zygomycetes (total of 96,837 bp). Phylogenetic analysis in the context of available sequence data (total 2,062 nucleotide positions per species) revealed that current classification schemes for the mucoralean fungi are highly unnatural at the family and, to a large extent, at the genus level. The data clearly indicate a deep, ancient and distinct dichotomy of the orders Mucorales and Mortierellales, which are recognized only in some zygomycete systems. Yet at the same time the data show that two genera - Umbelopsis and Micromucor - previously placed within the Mortierellales on the basis of their weakly developed columella (a morphological structure of the sporangiophore well-developed within all Mucorales) are in fact members of the Mucorales. Phylogenetic analyses of the encoded amino acid sequences in the context of homologues from eukaryotes and archaebacterial outgroups indicate that the Eumycota studied here are a natural group but provide little or no support for the monophyly of either zygomycetes, ascomycetes or basidiomycetes. The data clearly indicate that a complete revision of zygomycete natural systematics is necessary.

  12. Factors Affecting Medical Service Quality.

    Science.gov (United States)

    Mosadeghrad, Ali Mohammad

    2014-02-01

    A better understanding of factors influencing quality of medical service can pinpoint better strategies for quality assurance in medical services. This study aimed to identify factors affecting the quality of medical services provided by Iranian physicians. Exploratory in-depth individual interviews were conducted with sixty-four physicians working in various medical institutions in Iran. Individual, organizational and environmental factors enhance or inhibit the quality of medical services. Quality of medical services depends on the personal factors of the physician and patient, and factors pertaining to the healthcare setting and the broader environment. Differences in internal and external factors such as availability of resources, patient cooperation and collaboration among providers affect the quality of medical services and patient outcomes. Supportive leadership, proper planning, education and training and effective management of resources and processes improve the quality of medical services. This article contributes to healthcare theory and practice by developing a conceptual framework for understanding factors that influence medical services quality.

  13. Prognostic factors of breast cancer

    International Nuclear Information System (INIS)

    Gonzalez Ortega, Jose Maria; Morales Wong, Mario Miguel; Lopez Cuevas, Zoraida; Diaz Valdez, Marilin

    2011-01-01

    The prognostic factors must to be differentiated of the predictive ones. A prognostic factor is any measurement used at moment of the surgery correlated with the free interval of disease or global survival in the absence of the systemic adjuvant treatment and as result is able to correlate with the natural history of the disease. In contrast, a predictive factor is any measurement associated with the response to a given treatment. Among the prognostic factors of the breast cancer are included the clinical, histological, biological, genetic and psychosocial factors. In present review of psychosocial prognostic factors has been demonstrated that the stress and the depression are negative prognostic factors in patients presenting with breast cancer. It is essential to remember that the assessment of just one prognostic parameter is a help but it is not useful to clinical and therapeutic management of the patient.(author)

  14. The population factor.

    Science.gov (United States)

    Kats, G

    1983-01-01

    Reducing population growth is essentil to Egypt's broader efforts to improve facilities, services, and the phsycial quality of life. Although a family planning program has existed since the mid-1950s, the 2.7% annual rate of population growth has not changed in 30 years. Nasser and the other "free officers" who seized power in 1952 became concerned about the adverse effects of the rapidly growing population, but perhaps out of concern with a possible religious backlash, they confined themselves to launching studies and subsidizing several dozen private family planning clinics. From 1962-72, the number of private clinics grew from 28 to 480, and family planning was introduced in government healthclinics in 1965. Such clinics are mainly located in rural areas and are staffed by doctors and other personnel who are not members of the local community and are not very effective at promoting family planning. Local girls and women called Rayadet were recruited to promote the idea to birth control in local communities. By 1970, 12.6% of Egyptians were using reliable contraception. A national survey 12 years later found 34% using contraception, buth the figure seems high. Approximately 60-65% of eligible couples would need to practice birth control for Egypt to reach a less than 1% annuel increase. The Egyptian government hopes to slow population growth to 1% by the year 2000, but major problems of motivation remain especially among the rural poor. Several factors may lead to success of the family planning effort: 1) financial and technical support from international family planning sources has grown rapidley and is likely to remain high; 2) the mortality rate has dropped from 17.8/1000 in 1952 to about half that level, while the rate of natural increase is about the same, suggesting that future reductions in the birth rate will translate to a reduced rate of natural increase, and that parents will be less reluctant to practice faimly planning if there is a greater chance

  15. A factor analysis to detect factors influencing building national brand

    Directory of Open Access Journals (Sweden)

    Naser Azad

    Full Text Available Developing a national brand is one of the most important issues for development of a brand. In this study, we present factor analysis to detect the most important factors in building a national brand. The proposed study uses factor analysis to extract the most influencing factors and the sample size has been chosen from two major auto makers in Iran called Iran Khodro and Saipa. The questionnaire was designed in Likert scale and distributed among 235 experts. Cronbach alpha is calculated as 84%, which is well above the minimum desirable limit of 0.70. The implementation of factor analysis provides six factors including “cultural image of customers”, “exciting characteristics”, “competitive pricing strategies”, “perception image” and “previous perceptions”.

  16. Risk factors for stress fractures.

    Science.gov (United States)

    Bennell, K; Matheson, G; Meeuwisse, W; Brukner, P

    1999-08-01

    Preventing stress fractures requires knowledge of the risk factors that predispose to this injury. The aetiology of stress fractures is multifactorial, but methodological limitations and expediency often lead to research study designs that evaluate individual risk factors. Intrinsic risk factors include mechanical factors such as bone density, skeletal alignment and body size and composition, physiological factors such as bone turnover rate, flexibility, and muscular strength and endurance, as well as hormonal and nutritional factors. Extrinsic risk factors include mechanical factors such as surface, footwear and external loading as well as physical training parameters. Psychological traits may also play a role in increasing stress fracture risk. Equally important to these types of analyses of individual risk factors is the integration of information to produce a composite picture of risk. The purpose of this paper is to critically appraise the existing literature by evaluating study design and quality, in order to provide a current synopsis of the known scientific information related to stress fracture risk factors. The literature is not fully complete with well conducted studies on this topic, but a great deal of information has accumulated over the past 20 years. Although stress fractures result from repeated loading, the exact contribution of training factors (volume, intensity, surface) has not been clearly established. From what we do know, menstrual disturbances, caloric restriction, lower bone density, muscle weakness and leg length differences are risk factors for stress fracture. Other time-honoured risk factors such as lower extremity alignment have not been shown to be causative even though anecdotal evidence indicates they are likely to play an important role in stress fracture pathogenesis.

  17. How do individuals cope with stress? Behavioural, physiological and neuronal differences between proactive and reactive coping styles in fish

    DEFF Research Database (Denmark)

    Vindas, Marco A; Gorissen, Marnix; Höglund, Erik

    2017-01-01

    of the 5-HT1A receptor abundance) in the proposed amygdala homologue (Dm), increased expression of the neuroplasticity marker brain derived neurotropic factor (bdnf) in both Dl and Vv (lateral septum homologue), as well as increased expression of the corticotropin releasing factor 1 (crf1) receptor...

  18. [Predictive factors of anxiety disorders].

    Science.gov (United States)

    Domschke, K

    2014-10-01

    Anxiety disorders are among the most frequent mental disorders in Europe (12-month prevalence 14%) and impose a high socioeconomic burden. The pathogenesis of anxiety disorders is complex with an interaction of biological, environmental and psychosocial factors contributing to the overall disease risk (diathesis-stress model). In this article, risk factors for anxiety disorders will be presented on several levels, e.g. genetic factors, environmental factors, gene-environment interactions, epigenetic mechanisms, neuronal networks ("brain fear circuit"), psychophysiological factors (e.g. startle response and CO2 sensitivity) and dimensional/subclinical phenotypes of anxiety (e.g. anxiety sensitivity and behavioral inhibition), and critically discussed regarding their potential predictive value. The identification of factors predictive of anxiety disorders will possibly allow for effective preventive measures or early treatment interventions, respectively, and reduce the individual patient's suffering as well as the overall socioeconomic burden of anxiety disorders.

  19. Factor of originality in advertising

    OpenAIRE

    Ešner, Rudolf

    2009-01-01

    The bachelor thesis deals with exploitation of original attitudes in advertising. The thesis solves answers, what role plays the factor of originality in advertising, when and why firms use that factor, how creators work with it, how consumers perceive the factor and what other elements it generally contains. The bachelor thesis qualifies relationship of advertising and originality, describes and probes practical situations, when originality in advertising can be used as a serious competitive...

  20. Risk factors in school shootings.

    Science.gov (United States)

    Verlinden, S; Hersen, M; Thomas, J

    2000-01-01

    Nine incidents of multiple-victim homicide in American secondary schools are examined and common risk factors are identified. The literature dealing with individual, family, social, societal, and situational risk factors for youth violence and aggression is reviewed along with existing risk assessment methods. Checklists of risk factors for serious youth violence and school violence are used in reviewing each school shooting case. Commonalties among the cases and implications for psychologists practicing in clinical and school settings are discussed.

  1. First course in factor analysis

    CERN Document Server

    Comrey, Andrew L

    2013-01-01

    The goal of this book is to foster a basic understanding of factor analytic techniques so that readers can use them in their own research and critically evaluate their use by other researchers. Both the underlying theory and correct application are emphasized. The theory is presented through the mathematical basis of the most common factor analytic models and several methods used in factor analysis. On the application side, considerable attention is given to the extraction problem, the rotation problem, and the interpretation of factor analytic results. Hence, readers are given a background of

  2. Summable series and convergence factors

    CERN Document Server

    Moore, Charles N

    1938-01-01

    Fairly early in the development of the theory of summability of divergent series, the concept of convergence factors was recognized as of fundamental importance in the subject. One of the pioneers in this field was C. N. Moore, the author of the book under review.... Moore classifies convergence factors into two types. In type I he places the factors which have only the property that they preserve convergence for a convergent series or produce convergence for a summable series. In type II he places the factors which not only maintain or produce convergence but have the additional property that

  3. Gene regulation by growth factors

    International Nuclear Information System (INIS)

    Metz, R.; Gorham, J.; Siegfried, Z.; Leonard, D.; Gizang-Ginsberg, E.; Thompson, M.A.; Lawe, D.; Kouzarides, T.; Vosatka, R.; MacGregor, D.; Jamal, S.; Greenberg, M.E.; Ziff, E.B.

    1988-01-01

    To coordinate the proliferation and differentiation of diverse cell types, cells of higher eukaryotes communicate through the release of growth factors. These peptides interact with specific transmembrane receptors of other cells and thereby generate intracellular messengers. The many changes in cellular physiology and activity that can be induced by growth factors imply that growth factor-induced signals can reach the nucleus and control gene activity. Moreover, current evidence also suggests that unregulated signaling along such pathways can induce aberrant proliferation and the formation of tumors. This paper reviews investigations of growth factor regulation of gene expression conducted by the authors' laboratory

  4. Factorization method of quadratic template

    Science.gov (United States)

    Kotyrba, Martin

    2017-07-01

    Multiplication of two numbers is a one-way function in mathematics. Any attempt to distribute the outcome to its roots is called factorization. There are many methods such as Fermat's factorization, Dixońs method or quadratic sieve and GNFS, which use sophisticated techniques fast factorization. All the above methods use the same basic formula differing only in its use. This article discusses a newly designed factorization method. Effective implementation of this method in programs is not important, it only represents and clearly defines its properties.

  5. Social networks and factor markets

    DEFF Research Database (Denmark)

    Abay, Kibrom Araya; Kahsay, Goytom Abraha; Berhane, Guush

    In the absence of well-established factor markets, the role of indigenous institutions and social networks can be substantial for mobilizing factors for agricultural production. We investigate the role of an indigenous social network in Ethiopia, the iddir, in facilitating factor market...... transactions among smallholder farmers. Using detailed longitudinal household survey data and employing a difference-in-differences approach, we find that iddir membership improves households’ access to factor markets. Specifically, we find that joining an iddir network improves households’ access to land...

  6. FACTORING- CREDIT OPPORTUNITIES IN ROMANIA

    Directory of Open Access Journals (Sweden)

    ADELA IONESCU

    2013-05-01

    Full Text Available Capital is the main factor of production, business development becomes virtually impossible without taking into account the financial market and the resources it provides to businesses. Any business, regardless of its degree of development, is involving direct contact with financial markets, namely the institutions that mediate mobilization of capital and the services they provide. Understanding the functioning of the financial system, the specific financial mechanisms through which savings are allocated to support capital investments and the costs and risks involved is essential for the development of a solid base for business. In this context, factoring operations can support economic agents, allowing a transfer of commercial receivables from their holder to a factor who commits to their recovery and guarantee such operations even if temporary or permanent insolvency of the debtor . Thus, factoring is a complex technique in at least two aspects, of the debt and the transfer of credit. . Factoring is a means of financing business, especially export-import transactions, less known in Romania. Maybe because of poor business environment popularize the term is as little known as it was a few years ago the leasing. Present in Romanian legislation since 2002, factoring appears as a contract between one party (called adherent, providing goods or service and a banking company or a financial institution specialized (called factor, which the last one shall finance debts pursuing and preservation against credit risks and adherent gives factor by way of sale, debts arising from the sale of goods or services to third parties. The article is divided into three parts. In the first part we defined the concept of factoring and international factoring, then I presented the advantages and development of factoring in Romania, and the last part conclusions.

  7. Activation of factor VII bound to tissue factor: a key early step in the tissue factor pathway of blood coagulation.

    OpenAIRE

    Rao, L V; Rapaport, S I

    1988-01-01

    Whether the factor VII/tissue factor complex that forms in tissue factor-dependent blood coagulation must be activated to factor VIIa/tissue factor before it can activate its substrates, factor X and factor IX, has been a difficult question to answer because the substrates, once activated, back-activate factor VII. Our earlier studies suggested that human factor VII/tissue factor cannot activate factor IX. Studies have now been extended to the activation of factor X. Reaction mixtures were ma...

  8. Activation of factor VII bound to tissue factor: A key early step in the tissue factor pathway of blood coagulation

    International Nuclear Information System (INIS)

    Rao, L.V.M.; Rapaport, S.I.

    1988-01-01

    Whether the factor VII/tissue factor complex that forms in tissue factor-dependent blood coagulation must be activated to factor VIIa/tissue factor before it can activate its substrates, factor X and IX, has been a difficult question to answer because the substrates, once activated, back-activate factor VII. The earlier studies suggested that human factor VII/tissue factor cannot activate factor IX. Studies have now been extended to the activation of factor X. Reaction mixtures were made with purified factor VII, X, and tissue factor; in some experiments antithrombin III and heparin were added to prevent back-activation of factor VII. Factor X was activated at similar rates in reaction mixtures containing either VII or factor VIIa after an initial 30-sec lag with factor VII. In reaction mixtures with factor VII a linear activation of factor X was established several minutes before cleavage of 125 I-labeled factor VII to the two-chain activated molecule was demonstrable on gel profiles. These data suggest that factor VII/tissue factor cannot activate measurable amounts of factor X over several minutes. Overall, the results support the hypothesis that a rapid preferential activation of factor VII bound to tissue factor by trace amounts of factor Xa is a key early step in tissue factor-dependent blood coagulation

  9. Factors of trade in Europe

    Czech Academy of Sciences Publication Activity Database

    Hanousek, Jan; Kočenda, Evžen

    2014-01-01

    Roč. 38, č. 4 (2014), s. 518-535 ISSN 0939-3625 R&D Projects: GA ČR(CZ) GAP403/12/0080 Grant - others:UK(CZ) UNCE 204005/2012 Institutional support: PRVOUK-P23 Keywords : bilateral trade * factors of trade * panel data Subject RIV: AH - Economics Impact factor: 0.649, year: 2014

  10. Quadratic prediction of factor scores

    NARCIS (Netherlands)

    Wansbeek, T

    1999-01-01

    Factor scores are naturally predicted by means of their conditional expectation given the indicators y. Under normality this expectation is linear in y but in general it is an unknown function of y. II is discussed that under nonnormality factor scores can be more precisely predicted by a quadratic

  11. Hidden Risk Factors for Women

    Science.gov (United States)

    ... A.S.T. Quiz Hidden Stroke Risk Factors for Women Updated:Nov 22,2016 Excerpted from "What Women Need To Know About The Hidden Risk Factors ... 2012) This year, more than 100,000 U.S. women under 65 will have a stroke. Stroke is ...

  12. Factor analysis of multivariate data

    Digital Repository Service at National Institute of Oceanography (India)

    Fernandes, A.A.; Mahadevan, R.

    A brief introduction to factor analysis is presented. A FORTRAN program, which can perform the Q-mode and R-mode factor analysis and the singular value decomposition of a given data matrix is presented in Appendix B. This computer program, uses...

  13. Pineal factors other than melatonin

    NARCIS (Netherlands)

    Ebels, I.

    Some sheep pineal factors other than melatonin are described. A “nonmelatonin” antigonadotropic activity has been detected by application of the inhibition of compensatory ovarian hypertrophy (COH) in unilaterally ovariectomized adult Charles River CD-1 mice. The factor has been extracted from

  14. Stroke Risk Factors and Symptoms

    Science.gov (United States)

    ... » [ pdf, 433 kb ] Order Materials » Stroke Risk Factors and Symptoms Risk Factors for a Stroke Stroke prevention is still ... it. Treatment can delay complications that increase the risk of stroke. Transient ischemic attacks (TIAs). Seek help. ...

  15. Electromagnetic form factors of hadrons

    International Nuclear Information System (INIS)

    Zidell, V.S.

    1976-01-01

    A vector meson dominance model of the electromagnetic form factors of hadrons is developed which is based on the use of unstable particle propagators. Least-square fits are made to the proton, neutron, pion and kaon form factor data in both the space and time-like regions. A good fit to the low-energy nucleon form factor data is obtained using only rho, ω, and phi dominance, and leads to a determination of the vector meson resonance parameters in good agreement with experiment. The nucleon-vector meson coupling constants obey simple sum rules indicating that there exists no hard core contribution to the form factors within theoretical uncertainties. The prediction for the electromagnetic radii of the proton is in reasonable agreement with recent experiments. The pion and kaon charge form factors as deduced from the nucleon form factors assuming vector meson universality are compared to the data. The pion form factor agrees with the data in both the space and time-like regions. The pion charge radius is in agreement with the recent Dubna result, but the isovector P-wave pion-pion phase shift calculated from the theory disagrees with experiment. A possible contribution to the form factors from a heavy rho meson is also evaluated

  16. Shell model and spectroscopic factors

    International Nuclear Information System (INIS)

    Poves, P.

    2007-01-01

    In these lectures, I introduce the notion of spectroscopic factor in the shell model context. A brief review is given of the present status of the large scale applications of the Interacting Shell Model. The spectroscopic factors and the spectroscopic strength are discussed for nuclei in the vicinity of magic closures and for deformed nuclei. (author)

  17. EAMJ Risk Factors 10.indd

    African Journals Online (AJOL)

    2010-02-02

    Feb 2, 2010 ... Several factors have been suggested as independent risk factors for their development. Identification of these ... with age, gender or haematological test. ... A meta-analysis of prospective studies on ..... The marked difference may be because monthly .... and dyslipidemia among patients taking first-line,.

  18. Factors That Shape Design Thinking

    Science.gov (United States)

    Gray, Colin M.

    2013-01-01

    A wide range of design literature discusses the role of the studio and its related pedagogy in the development of design thinking. Scholars in a variety of design disciplines pose a number of factors that potentially affect this development process, but a full understanding of these factors as experienced from a critical pedagogy or student…

  19. Kadison-Kastler stable factors

    DEFF Research Database (Denmark)

    Cameron, Jan; Christensen, Erik; Sinclair, Allan M.

    2014-01-01

    It is proven that a pair of continuous finite von Neumann algebra factors are unitarily equivalent if sufficiently close and one satisfies a certain cohomological condition.......It is proven that a pair of continuous finite von Neumann algebra factors are unitarily equivalent if sufficiently close and one satisfies a certain cohomological condition....

  20. Human factors influencing decision making

    OpenAIRE

    Jacobs, Patricia A.

    1998-01-01

    This report supplies references and comments on literature that identifies human factors influencing decision making, particularly military decision making. The literature has been classified as follows (the classes are not mutually exclusive): features of human information processing; decision making models which are not mathematical models but rather are descriptive; non- personality factors influencing decision making; national characteristics influencing decision makin...