WorldWideScience

Sample records for render single-stranded amplicons

  1. Post-amplification Klenow fragment treatment alleviates PCR bias caused by partially single-stranded amplicons

    NARCIS (Netherlands)

    Egert, M.G.G.; Friedrich, M.W.

    2005-01-01

    Partially single-stranded amplicons, formed during PCR amplification of single and mixed templates, are a potential source of bias in genetic diversity studies. The analysis of 16S rRNA gene diversity in mixed template samples by the fingerprinting technique terminal restriction fragment length poly

  2. Thermophoresis of single stranded DNA.

    Science.gov (United States)

    Reineck, Philipp; Wienken, Christoph J; Braun, Dieter

    2010-01-01

    The manipulation and analysis of biomolecules in native bulk solution is highly desired; however, few methods are available. In thermophoresis, the thermal analog to electrophoresis, molecules are moved along a microscopic temperature gradient. Its theoretical foundation is still under debate, but practical applications for analytics in biology show considerable potential. Here we measured the thermophoresis of highly diluted single stranded DNA using an all-optical capillary approach. Temperature gradients were created locally by an infrared laser. The thermal depletion of oligonucleotides of between 5 and 50 bases in length were investigated by fluorescence at various salt concentrations. To a good approximation, the previously tested capacitor model describes thermophoresis: the Soret coefficient linearly depends on the Debye length and is proportional to the DNA length to the power of 0.35, dictated by the conformation-based size scaling of the diffusion coefficient. The results form the basis for quantitative DNA analytics using thermophoresis.

  3. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  4. Rapid discrimination of Salmonella isolates by single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Al-Adhami, Batol H; Huby-Chilton, Florence; Blais, Burton W; Martinez-Perez, Amalia; Chilton, Neil B; Gajadhar, Alvin A

    2008-10-01

    A molecular typing technique was developed for the differentiation of Salmonella isolates based on single-strand conformation polymorphism (SSCP) analysis of amplicons generated by PCR. Amplicons from parts of the fimA (both the 5' and 3' ends), mdh, invA, and atpD genes were generated separately from a panel of Salmonella strains representing Salmonella bongori, and four subspecies and 17 serovars of Salmonella enterica. These amplicons were subjected to SSCP analysis for differentiation of the salmonellae on the basis of different conformational forms arising due to nucleotide sequence variations in the target genes. Several distinct SSCP banding patterns (a maximum of 14 each for atpD and fimA 3' end) were observed with this panel of Salmonella strains for amplicons generated from each target gene. The best discrimination of Salmonella subspecies and serovar was achieved from the SSCP analysis of a combination of at least three gene targets: atpD, invA, and either mdh or fimA 3' end. This demonstrates the applicability of SSCP analysis as an important additional method to classical typing approaches for the differentiation of foodborne Salmonella isolates. SSCP is simple to perform and should be readily transferable to food microbiology laboratories with basic PCR capability.

  5. Single-strand conformation polymorphism (SSCP) for the analysis of genetic variation.

    Science.gov (United States)

    Gasser, Robin B; Hu, Min; Chilton, Neil B; Campbell, Bronwyn E; Jex, Aaron J; Otranto, Domenico; Cafarchia, Claudia; Beveridge, Ian; Zhu, Xingquan

    2006-01-01

    The accurate analysis of genetic variation has major implications in many areas of biomedical research, including the identification of infectious agents (such as parasites), the diagnosis of infections, and the detection of unknown or known disease-causing mutations. Mutation scanning methods, including PCR-coupled single-strand conformation polymorphism (SSCP), have significant advantages over many other nucleic acid techniques for the accurate analysis of allelic and mutational sequence variation. The present protocol describes the SSCP method of analysis, including all steps from the small-scale isolation of genomic DNA and PCR amplification of target sequences, through to the gel-based separation of amplicons and scanning for mutations by SSCP (either by the analysis of radiolabeled amplicons in mutation detection enhancement (MDE) gels or by non-isotopic SSCP using precast GMA gels). The subsequent sequence analysis of polymorphic bands isolated from gels is also detailed. The SSCP protocol can readily detect point mutations for amplicon sizes of up to 450-500 bp, and usually takes 1-2 days to carry out. This user-friendly, low-cost, potentially high-throughput platform has demonstrated the utility to study a wide range of pathogens and diseases, and has the potential to be applied to any gene of any organism.

  6. Gel-based nonradioactive single-strand conformational polymorphism and mutation detection: limitations and solutions.

    Science.gov (United States)

    Gupta, Vibhuti; Arora, Reetakshi; Gochhait, Sailesh; Bairwa, Narendra K; Bamezai, Rameshwar N K

    2014-01-01

    Single-strand conformation polymorphism (SSCP) for screening mutations/single-nucleotide polymorphisms (SNPs) is a simple, cost-effective technique, saving an expensive exercise of sequencing each and every polymerase chain reaction product and assisting in choosing only the amplicons of interest with expected mutations. The principle of detection of small changes in DNA sequences is based on changes in single-strand DNA conformations. The changes in electrophoretic mobility that SSCP detects are sequence dependent. The limitations faced in SSCP range from routine polyacrylamide gel electrophoresis (PAGE) problems to the problems of resolving mutant DNA bands. Both these problems can be solved by controlling PAGE conditions and by varying physical and environmental conditions such as pH, temperature, voltage, gel type and percentage, addition of additives or denaturants, and others. Despite much upgrading of the technology for mutation detection, SSCP remains the method of choice to analyze mutations and SNPs in order to understand genomic variations, both spontaneous and induced, and the genetic basis of diseases.

  7. DNA replication of single-stranded Escherichia coli DNA phages

    NARCIS (Netherlands)

    Baas, P.D.

    1985-01-01

    Research on single-stranded DNA phages has contributed tremendously to our knowledge of several fundamental life-processes. The small size of their genomes and the fast rate at which they multiply in their host, Escherichia coil, made them attractive candidates for various studies. There are two cla

  8. Electrostatic Origin of Single-Stranded Genome Packing in Viruses

    Science.gov (United States)

    Belyi, Vladimir; Muthukumar, M.

    2006-03-01

    We develop an electrostatic model for single-stranded RNA/DNA viruses that bind their genome via highly basic semiflexible peptide arms. We show that genome-capsid binding is dominated by non-specific electrostatic interactions, rather than actual amino-acid content. Proposed model explains many universal features of the viral genome. Good agreement is found with wide range of qualified wild-type and mutant viruses.

  9. Mutability dynamics of an emergent single stranded DNA virus in a naive host.

    Directory of Open Access Journals (Sweden)

    Subir Sarker

    Full Text Available Quasispecies variants and recombination were studied longitudinally in an emergent outbreak of beak and feather disease virus (BFDV infection in the orange-bellied parrot (Neophema chrysogaster. Detailed health monitoring and the small population size (<300 individuals of this critically endangered bird provided an opportunity to longitudinally track viral replication and mutation events occurring in a circular, single-stranded DNA virus over a period of four years within a novel bottleneck population. Optimized PCR was used with different combinations of primers, primer walking, direct amplicon sequencing and sequencing of cloned amplicons to analyze BFDV genome variants. Analysis of complete viral genomes (n = 16 and Rep gene sequences (n = 35 revealed that the outbreak was associated with mutations in functionally important regions of the normally conserved Rep gene and immunogenic capsid (Cap gene with a high evolutionary rate (3.41×10(-3 subs/site/year approaching that for RNA viruses; simultaneously we observed significant evidence of recombination hotspots between two distinct progenitor genotypes within orange-bellied parrots indicating early cross-transmission of BFDV in the population. Multiple quasispecies variants were also demonstrated with at least 13 genotypic variants identified in four different individual birds, with one containing up to seven genetic variants. Preferential PCR amplification of variants was also detected. Our findings suggest that the high degree of genetic variation within the BFDV species as a whole is reflected in evolutionary dynamics within individually infected birds as quasispecies variation, particularly when BFDV jumps from one host species to another.

  10. Identification and differentiation of Cryptosporidium species by capillary electrophoresis single-strand conformation polymorphism.

    Science.gov (United States)

    Power, Michelle L; Holley, Marita; Ryan, Una M; Worden, Paul; Gillings, Michael R

    2011-01-01

    Cryptosporidium species generally lack distinguishing morphological traits, and consequently, molecular methods are commonly used for parasite identification. Various methods for Cryptosporidium identification have been proposed, each with their advantages and disadvantages. In this study, we show that capillary electrophoresis coupled with single-strand conformation polymorphism (CE-SSCP) is a rapid, simple and cost-effective method for the identification of Cryptosporidium species and genotypes. Species could be readily differentiated based on the SSCP mobility of amplified 18S rRNA gene molecules. Clones that differed by single-nucleotide polymorphisms could be distinguished on CE-SSCP mobility. Profiles of species known to have heterogenic copies of 18S rRNA gene contained multiple peaks. Cloning and sequencing of Cryptosporidium parvum, Cryptosporidium hominis, Cryptosporidium fayeri and Cryptosporidium possum genotype 18S rRNA gene amplicons confirmed that these multiple peaks represented type A and type B 18S rRNA gene copies. CE-SSCP provides a reliable and sensitive analysis for epidemiological studies, environmental detection and diversity screening.

  11. Population analyses of Amblyomma maculatum ticks and Rickettsia parkeri using single-strand conformation polymorphism.

    Science.gov (United States)

    Ferrari, Flavia A G; Goddard, Jerome; Caprio, Michael; Paddock, Christopher D; Mixson-Hayden, Tonya; Varela-Stokes, Andrea S

    2013-09-01

    Gulf Coast ticks, Amblyomma maculatum, and the zoonotic agents they transmit, Rickettsia parkeri, are expanding into areas in the United States where they were not previously reported, and are emerging threats for public and veterinary health. The dynamics of this tick-pathogen system and implications for disease transmission are still unclear. To assess genetic variation of tick and rickettsial populations, we collected adult A. maculatum from 10 sites in Mississippi, 4 in the northern, one in the central, and 5 in the southern part of the state. PCR amplicons from tick mitochondrial 16S rRNA and rickettsial ompA genes as well as 5 intergenic spacer regions were evaluated for genetic variation using single-strand conformation polymorphism analysis. Frequencies of the 4 tick 16S haplotypes were not significantly different among regions of Mississippi, but within sites there were differences in distribution that can be explained by high migration rates. Phylogenetically, one lineage of tick haplotypes was a species-poor sister group to remaining haplotypes in the species-rich sister group. No genetic variation was identified in any of the 6 selected gene targets of R. parkeri examined in the infected ticks, suggesting high levels of intermixing.

  12. Molecular dynamics simulations of a single stranded (ss) DNA

    CERN Document Server

    Chatterjee, Subhasish; Thakur, Siddarth; Burin, Alexander

    2012-01-01

    The objective of the present study was to develop an understanding of short single-stranded DNA (ssDNA) to assist the development of new DNA-based biosensors. A ssDNA model containing twelve bases was constructed from the 130-145 codon sequence of the p53 gene. Various thermodynamic macroscopic observables such as temperature, energy distributions, as well as root mean square deviation (RMSD) of the nucleic acid backbone of the ssDNA were studied using molecular dynamics (MD) simulations. The AMBER program was used for building the structural model of the ssDNA, and atomistic MD simulations in three different ensembles were carried out using the NAMD program. The microcanonical (NVE), conical (NVT) and isobaric-isothermal (NPT) ensembles were employed to compare the equilibrium characteristics of ssDNA in aqueous solutions. Our results indicate that the conformational stability of the ssDNA is dependent on the thermodynamic conditions.

  13. Single-stranded heteroduplex intermediates in λ Red homologous recombination

    Directory of Open Access Journals (Sweden)

    Zhang Youming

    2010-07-01

    Full Text Available Abstract Background The Red proteins of lambda phage mediate probably the simplest and most efficient homologous recombination reactions yet described. However the mechanism of dsDNA recombination remains undefined. Results Here we show that the Red proteins can act via full length single stranded intermediates to establish single stranded heteroduplexes at the replication fork. We created asymmetrically digestible dsDNA substrates by exploiting the fact that Redα exonuclease activity requires a 5' phosphorylated end, or is blocked by phosphothioates. Using these substrates, we found that the most efficient configuration for dsDNA recombination occurred when the strand that can prime Okazaki-like synthesis contained both homology regions on the same ssDNA molecule. Furthermore, we show that Red recombination requires replication of the target molecule. Conclusions Hence we propose a new model for dsDNA recombination, termed 'beta' recombination, based on the formation of ssDNA heteroduplexes at the replication fork. Implications of the model were tested using (i an in situ assay for recombination, which showed that recombination generated mixed wild type and recombinant colonies; and (ii the predicted asymmetries of the homology arms, which showed that recombination is more sensitive to non-homologies attached to 5' than 3' ends. Whereas beta recombination can generate deletions in target BACs of at least 50 kb at about the same efficiency as small deletions, the converse event of insertion is very sensitive to increasing size. Insertions up to 3 kb are most efficiently achieved using beta recombination, however at greater sizes, an alternative Red-mediated mechanism(s appears to be equally efficient. These findings define a new intermediate in homologous recombination, which also has practical implications for recombineering with the Red proteins.

  14. A Single-Strand Annealing Protein Clamps DNA to Detect and Secure Homology.

    OpenAIRE

    Marcel Ander; Sivaraman Subramaniam; Karim Fahmy; Francis Stewart, A.; Erik Schäffer

    2015-01-01

    Repair of DNA breaks by single-strand annealing (SSA) is a major mechanism for the maintenance of genomic integrity. SSA is promoted by proteins (single-strand-annealing proteins [SSAPs]), such as eukaryotic RAD52 and λ phage Redβ. These proteins use a short single-stranded region to find sequence identity and initiate homologous recombination. However, it is unclear how SSAPs detect homology and catalyze annealing. Using single-molecule experiments, we provide evidence that homology is recog...

  15. Is single-strand conformation polymorphism analysis of the full 5' untranslated region an adequate approach to study hepatitis C virus quasispecies distribution?

    Science.gov (United States)

    Vera-Otarola, Jorge; Barría, María Inés; León, Ursula; Carvallo, Pilar; Soza, Alejandro; López-Lastra, Marcelo

    2009-09-01

    Single-strand conformation polymorphism (SSCP) analysis is used by many laboratories to study the quasispecies distribution of the hepatitis C virus (HCV). Here we question the validity of this experimental approach, as conclusions are drawn from the analysis of the migration patterns of two ssDNA molecules and not from RNA. Using previously characterized mutants of the HCV 5' untranslated regions, we show that contrary to what has been predicted, SSCP migration patterns of DNA amplicons with differences in their nucleotide sequences generated from the full 5' UTR of HCV are not necessarily unique.

  16. Is Single-Strand Conformation Polymorphism Analysis of the Full 5′ Untranslated Region an Adequate Approach To Study Hepatitis C Virus Quasispecies Distribution? ▿

    Science.gov (United States)

    Vera-Otarola, Jorge; Barría, María Inés; León, Ursula; Carvallo, Pilar; Soza, Alejandro; López-Lastra, Marcelo

    2009-01-01

    Single-strand conformation polymorphism (SSCP) analysis is used by many laboratories to study the quasispecies distribution of the hepatitis C virus (HCV). Here we question the validity of this experimental approach, as conclusions are drawn from the analysis of the migration patterns of two ssDNA molecules and not from RNA. Using previously characterized mutants of the HCV 5′ untranslated regions, we show that contrary to what has been predicted, SSCP migration patterns of DNA amplicons with differences in their nucleotide sequences generated from the full 5′ UTR of HCV are not necessarily unique. PMID:19553315

  17. Single-stranded regions in transforming deoxyribonucleic acid after uptake by competent Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Sedgwick, B.; Setlow, J.K.

    1976-02-01

    About 15% of donor deoxyribonucleic acid (DNA) is single stranded immediately after uptake into competent Haemophilus influenzae wild-type cells, as judged by its sensitivity to S1 endonuclease. This amount decreases to 4 to 5% by 30 min after uptake. Mutants which are defective in the covalent association of recipient and donor DNA form little or no S1 endonuclease-sensitive donor. At 17 C donor DNA taken up by the wild type contains single-stranded regions although there is no observable association, either covalent or noncovalent. The single-stranded regions are at the ends of donor DNA molecules, as judged by the unchanged sedimentation velocity after S1 endonuclease digestion. The amount of single-stranded donor remains constant at 17 C for more than 60 min after uptake, suggesting that the decrease observed at 37 C is the result of association of single-stranded ends with single-stranded regions of recipient cell DNA. Three sequential steps necessary for the integration of donor DNA into recipient DNA are proposed: the synthesis of single-stranded regions in recipient DNA, the interaction of donor DNA with recipient DNA resulting in the production of single-stranded ends on donor DNA, and the stable pairing of homologous single-stranded regions. (auth)

  18. Single-strand conformation polymorphism analysis for differentiating phytoplasma strains.

    Science.gov (United States)

    Musić, Martina Seruga; Skorić, Dijana

    2013-01-01

    Single-strand conformation polymorphism (SSCP) analysis is a sensitive and rapid technique for detecting DNA polymorphisms and mutations in PCR-amplified fragments. Due to its technical simplicity, it is widely used as a screening tool in various investigations, ranging from clinical diagnosis of human hereditary diseases to the characterization of microbial communities. This method can also be used successfully on phytoplasmas as a tool for the detection of molecular variability in conserved housekeeping genes such as 16S rRNA and tuf, as well as in more variable genes, revealing the presence of polymorphisms undetected by routine RFLP analyses. The reliability of SSCP has been confirmed by multiple alignments and phylogenetic analyses of representative sequences showing different SSCP profiles. However, it is not broadly applied in phytoplasma research yet. The technique provides an inexpensive, convenient, and sensitive method for determining sequence variation and to differentiate phytoplasma strains, and is particularly suitable for epidemiological studies or as a fast screening, typing tool when dealing with a large number of field samples.

  19. PIEZOELECTRIC PROPERTIES OF SINGLE-STRAND DNA MOLECULAR BRUSH BIOLAYERS

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The paper is devoted to investigations on nanomechanical behaviors of biochips in label-free biodetections. The chip consists of Si-layer, Ti-layer, Au-layer and single-strand DNA (ssDNA) molecular brush biolayer immobilized by self-assembly technology of thiol group. Unlike previous viewpoints, such as force-bending, entropy-bending and curvature electricity effect, etc.,the piezoelectric effect of the biopolymer brush layer is viewed as the main factor that induces nanomechanical bending of biochips, and a classical macroscopic piezoelectric constitutive relation is used to describe the piezoelectric effect. A new laminated cantilever beam model with a piezoelectric biolayer in continuum mechanics, the linearized Poisson-Boltzmann equation in statistical mechanics and the scaling method in polyelectrolyte brush theory are combined to establish a relationship between the nanomechanical deflection of DNA chips and the factors such as nanoscopic structural features of ssDNA molecules, buffer salt concentration, macroscopic mechanical/piezoelectric parameters of DNA chips etc. Curve fitting of experimental data shows that the sign of the piezoelectric constant of the biolayer may control the deflection direction of DNA chips during the packaging process.

  20. Single-Stranded DNA Curtains for Studying Homologous Recombination.

    Science.gov (United States)

    Ma, C J; Steinfeld, J B; Greene, E C

    2017-01-01

    Homologous recombination is an important pathway involved in the repair of double-stranded DNA breaks. Genetic studies form the foundation of our knowledge on homologous recombination. Significant progress has also been made toward understanding the biochemical and biophysical properties of the proteins, complexes, and reaction intermediates involved in this essential DNA repair pathway. However, heterogeneous or transient recombination intermediates remain extremely difficult to assess through traditional ensemble methods, leaving an incomplete mechanistic picture of many steps that take place during homologous recombination. To help overcome some of these limitations, we have established DNA curtain methodologies as an experimental platform for studying homologous DNA recombination in real-time at the single-molecule level. Here, we present a detailed overview describing the preparation and use of single-stranded DNA curtains in applications related to the study of homologous DNA recombination with emphasis on recent work related to the study of the eukaryotic recombinase Rad51. © 2017 Elsevier Inc. All rights reserved.

  1. Dynamics of single-stranded DNA tethered to a solid

    Science.gov (United States)

    Radiom, Milad; Paul, Mark R.; Ducker, William A.

    2016-06-01

    Tethering is used to deliver specific biological and industrial functions. For example, single-stranded DNA (ssDNA) is tethered to polymerases and long sequences of double-stranded DNA (dsDNA) during replication, and to solids in DNA microarrays. However, tethering ssDNA to a large object limits not only the available ssDNA conformations, but also the range of time-scales over which the mechanical responses of ssDNA are important. In this work we examine the effect of tethering by measurement of the mechanical response of ssDNA that is tethered at each end to two separate atomic force microscope cantilevers in aqueous solution. Thermal motion of the cantilevers drives the ends of the ssDNA chain at frequencies near 2 kHz. The presence of a tethered molecule makes a large difference to the asymmetric cross-correlation of two cantilevers, which enables resolution of the mechanical properties in our experiments. By analysis of the correlated motion of the cantilevers we extract the friction and stiffness of the ssDNA. We find that the measured friction is much larger than the friction that is usually associated with the unencumbered motion of ssDNA. We also find that the measured relaxation time, ∼30 μs, is much greater than prior measurements of the free-molecule relaxation time. We attribute the difference to the loss of conformational possibilities as a result of constraining the ends of the ssDNA.

  2. Single strand conformation polymorphism is a sensitive method for screening nucleotide variations in Mycosphaerella graminicola.

    Science.gov (United States)

    Siah, A; Tisserant, B; El Chartouni, L; Deweer, C; Roisin-Fichter, C; Sanssené, J; Durand, R; Reignault, Ph; Halama, P

    2010-01-01

    Single Strand Conformation Polymorphism (SSCP) and sequencing were performed in order to assess molecular polymorphism of mating type sequences in the heterothallic ascomycete Mycosphaerella graminicola, the causal agent of Septoria tritici blotch of wheat. The screening was undertaken on mat1-1 and mat1-2 partial sequences of 341 and 657 bp, respectively, amplified with multiplex PCR from 510 French single-conidial strains plus the two reference isolates IPO323 and IPO94269 from The Netherlands. After restriction with Taq1 in order to reduce the fragment sizes, all digested amplicons were subjected to SSCP. Sequencing was then performed when a SSCP pattern deviates from the most frequently occurring profile. Among the assessed strains, 228 ones plus IPO323 were MAT1-1 and 282 ones plus IPO94269 were MAT1-2. Among the MAT1-1 strains, only a single one exhibited a SSCP profile distinct to the other MAT1-1 strains, whereas 10 MAT1-2 strains (among which 2 and 4 with same profiles, respectively) showed a SSCP profile differing to the other MAT1-2 strains. Sequencing revealed that all polymorphisms observed on SSCP gels were single nucleotide variations and all strains displaying the same SSCP profiles showed identical nucleotide sequences. Among the seven disclosed nucleotide variations, only two were non-synonymous and both were non-conservative. This study reports a high sensitivity of SSCP allowing detection of single point mutations in M. graminicola, shows a conservation of mating type idiomorphs in the fungus at both sequence and population scales, but also suggests a difference in polymorphism level between the two mating type sequences.

  3. Sulforaphane induces DNA single strand breaks in cultured human cells

    Energy Technology Data Exchange (ETDEWEB)

    Sestili, Piero, E-mail: piero.sestili@uniurb.it [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Paolillo, Marco [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Lenzi, Monia [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy); Colombo, Evelin; Vallorani, Luciana; Casadei, Lucia; Martinelli, Chiara [Dipartimento di Scienze Biomolecolari, Via Maggetti, 21, Universita degli Studi di Urbino ' Carlo Bo' , 61029 Urbino, PU (Italy); Fimognari, Carmela [Dipartimento di Farmacologia, Universita degli Studi di Bologna, Via Irnerio 48, 40126 Bologna (Italy)

    2010-07-07

    Sulforaphane (SFR), an isothiocyanate from cruciferous vegetables, possesses growth-inhibiting and apoptosis-inducing activities in cancer cell lines. Recently, SFR has been shown to promote the mitochondrial formation of reactive oxygen species (ROS) in human cancer cell lines. The present study was undertaken to see whether SFR-derived ROS might cause DNA damage in cultured human cells, namely T limphoblastoid Jurkat and human umbilical vein endothelial cells (HUVEC). 1-3 h treatments with 10-30 {mu}M SFR elicited intracellular ROS formation (as assayed with dihydrorhodamine, DHR, oxidation) as well as DNA breakage (as assessed with fast halo assay, FHA). These effects lacked cell-type specificity, since could be observed in both Jurkat and HUVEC. Differential-pH FHA analysis of damaged DNA showed that SFR causes frank DNA single strand breaks (SSBs); no DNA double strand breaks (DSBs) were found within the considered treatment times (up to 3 h). SFR-derived ROS were formed at the mitochondrial respiratory chain (MRC) level: indeed rotenone or myxothiazol (MRC Complex I and III inhibitors, respectively) abrogated ROS formation. Furthermore ROS were not formed in Jurkat cells pharmacologically depleted of respiring mitochondria (MRC-/Jurkat). Formation of ROS was causally linked to the induction of SSBs: indeed all the experimental conditions capable of preventing ROS formation also prevented the damage of nuclear DNA from SFR-intoxicated cells. As to the toxicological relevance of SSBs, we found that their prevention slightly but significantly attenuated SFR cytotoxicity, suggesting that high-dose SFR toxicity is the result of a complex series of events among which GSH depletion seems to play a pivotal role. In conclusion, the present study identifies a novel mechanism contributing to SFR toxicity which - since DNA damage is a prominent mechanism underlying the cytotoxic activity of established antineoplastic agents - might help to exploit the therapeutic value

  4. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    Science.gov (United States)

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  5. Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides.

    Science.gov (United States)

    Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B

    2017-01-01

    CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and

  6. Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides

    Science.gov (United States)

    Rivera-Torres, Natalia; Bialk, Pawel; Bloh, Kevin M.; Kmiec, Eric B.

    2017-01-01

    CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and

  7. Linear-After-The-Exponential (LATE)-PCR: Primer design criteria for high yields of specific single-stranded DNA and improved real-time detection

    Science.gov (United States)

    Pierce, Kenneth E.; Sanchez, J. Aquiles; Rice, John E.; Wangh, Lawrence J.

    2005-01-01

    Traditional asymmetric PCR uses conventional PCR primers at unequal concentrations to generate single-stranded DNA. This method, however, is difficult to optimize, often inefficient, and tends to promote nonspecific amplification. An alternative approach, Linear-After-The-Exponential (LATE)-PCR, solves these problems by using primer pairs deliberately designed for use at unequal concentrations. The present report systematically examines the primer design parameters that affect the exponential and linear phases of LATE-PCR amplification. In particular, we investigated how altering the concentration-adjusted melting temperature (Tm) of the limiting primer (TmL) relative to that of the excess primer (TmX) affects both amplification efficiency and specificity during the exponential phase of LATE-PCR. The highest reaction efficiency and specificity were observed when TmL - TmX ≥ 5°C. We also investigated how altering TmX relative to the higher Tm of the double-stranded amplicon (TmA) affects the rate and extent of linear amplification. Excess primers with TmX closer to TmA yielded higher rates of linear amplification and stronger signals from a hybridization probe. These design criteria maximize the yield of specific single-stranded DNA products and make LATE-PCR more robust and easier to implement. The conclusions were validated by using primer pairs that amplify sequences within the cystic fibrosis transmembrane regulator (CFTR) gene, mutations of which are responsible for cystic fibrosis. PMID:15937116

  8. Electron microscopy of single-stranded structures in the DNA of competent Haemophilus influenzae cells

    Energy Technology Data Exchange (ETDEWEB)

    McCarthy, D.; Kupfer, D.M.

    1987-02-01

    Chromosomal DNAs from exponential-phase and competent cells of Haemophilus influenzae were examined by electron microscopy to determine whether the chromosome undergoes structural changes during competence development. Single-stranded gaps and single-stranded tails formed in chromosomal DNA during competence development. The generation of gaps was dependent on the rec-2 function. Since the rec-2 mutant is defective in the translocation of donor DNA, it was inferred that the gaps were involved in the translocation step of transformation. The generation of single-stranded tails was independent of the rec-1 and rec-2 genes. Therefore, these structures were assumed to play no direct role in the interaction of donor and recipient DNAs during transformation. Gaps were preferentially associated with a readily denaturable, possible A + T-rich fraction of the genome. This finding raised the possibility that hot spots for transformation might be associated with A + T-rich DNA.

  9. Ferric and cupric ions requirement for DNA single-strand breakage by H2O2.

    Science.gov (United States)

    Tachon, P

    1989-01-01

    Hydrogen peroxide (H2O2), was able to nick the replicative form of the phage fd, without the addition of a reducing agent or of a metal. This DNA single-strand breakage decreased with an increase of the ionic strength, suggesting that H2O2 reacted with traces of metal bound to DNA. When cupric of ferric ions were added, the rate of DNA single-strand breakage by H2O2 greatly increased and it was 20-30 times faster with cupric than with ferric ions. The addition of EDTA at an equimolar ratio or in excess of metal prevented partially DNA single-strand cleavage by H2O2 in the presence of ferric ions and completely when cupric ions were used. Superoxide dismutase prevented DNA single-strand breakage by H2O2 and ferric ions. On the contrary, with cupric ions and H2O2, the addition of superoxide dismutase increased the rate of DNA single-strand breakage. That superoxide dismutase was acting catalytically was shown by the loss of its effects after heat inactivation of the enzyme. The results of the present study show that besides its involvement in the Fenton reaction, H2O2 is able to reduce the metal bound to DNA, generating the superoxide anion radical or/and its protonated form, the perhydroxyl radical involved in DNA nicking. On the other hand, the ability of cuprous ions unlike ferrous ions to dismutate the superoxide radical may explain some differences observed between iron and copper in the DNA single-strand breakage by H2O2.

  10. Structure of the single-strand annealing domain of human RAD52 protein

    OpenAIRE

    Singleton, Martin R.; Wentzell, Lois M.; Liu, Yilun; West, Stephen C.; Wigley, Dale B.

    2002-01-01

    In eukaryotic cells, RAD52 protein plays a central role in genetic recombination and DNA repair by (i) promoting the annealing of complementary single-stranded DNA and (ii) stimulation of the RAD51 recombinase. The single-strand annealing domain resides in the N-terminal region of the protein and is highly conserved, whereas the nonconserved RAD51-interaction domain is located in the C-terminal region. An N-terminal fragment of human RAD52 (residues 1–209) has been purified to homogeneity and...

  11. Electron attachment to DNA single strands: gas phase and aqueous solution

    Science.gov (United States)

    Gu, Jiande; Xie, Yaoming; Schaefer, Henry F.

    2007-01-01

    The 2′-deoxyguanosine-3′,5′-diphosphate, 2′-deoxyadenosine-3′,5′-diphosphate, 2′-deoxycytidine-3′,5′-diphosphate and 2′-deoxythymidine-3′,5′-diphosphate systems are the smallest units of a DNA single strand. Exploring these comprehensive subunits with reliable density functional methods enables one to approach reasonable predictions of the properties of DNA single strands. With these models, DNA single strands are found to have a strong tendency to capture low-energy electrons. The vertical attachment energies (VEAs) predicted for 3′,5′-dTDP (0.17 eV) and 3′,5′-dGDP (0.14 eV) indicate that both the thymine-rich and the guanine-rich DNA single strands have the ability to capture electrons. The adiabatic electron affinities (AEAs) of the nucleotides considered here range from 0.22 to 0.52 eV and follow the order 3′,5′-dTDP > 3′,5′-dCDP > 3′,5′-dGDP > 3′,5′-dADP. A substantial increase in the AEA is observed compared to that of the corresponding nucleic acid bases and the corresponding nucleosides. Furthermore, aqueous solution simulations dramatically increase the electron attracting properties of the DNA single strands. The present investigation illustrates that in the gas phase, the excess electron is situated both on the nucleobase and on the phosphate moiety for DNA single strands. However, the distribution of the extra negative charge is uneven. The attached electron favors the base moiety for the pyrimidine, while it prefers the 3′-phosphate subunit for the purine DNA single strands. In contrast, the attached electron is tightly bound to the base fragment for the cytidine, thymidine and adenosine nucleotides, while it almost exclusively resides in the vicinity of the 3′-phosphate group for the guanosine nucleotides due to the solvent effects. The comparatively low vertical detachment energies (VDEs) predicted for 3′,5′-dADP− (0.26 eV) and 3′,5′-dGDP− (0.32 eV) indicate that electron detachment

  12. Viscosimetric analysis of the occurrence and repair of DNA single-strand breaks in irradiated animal tissues.

    Science.gov (United States)

    Ryabchenko, N I; Ivannik, B P; Proskuryakov SYa

    1982-04-01

    The yields of immediate DNA single-strand breaks in normal tumour tissues of irradiated animals were measured by a viscosimetric method of determination of high-polymer single-strand DNA molecular weight in alkaline nuclear lysates. It has been shown that in irradiated thymus, bone marrow leukocytes, Ehrlich ascitic carcinoma and Zaidel hepatoma cells (first group by tissues) in vivo the yields of DNA single-strand breaks were characterized by 80 to 130 eV per break. In in vivo irradiated liver, lymph node, spleen, and sarcoma 180 cells (second group of tissues) the yields of DNA single-strand breaks have been characterized by 30 to 40 eV per break. DNA single-strand breaks of the first group of tissues have rejoined 1 hour after the irradiation in vivo; DNA single-strand breaks of the second group have not done so.

  13. Viscosimetric analysis of the occurrence and repair of DNA single-strand breaks in irradiated animal tissues

    Energy Technology Data Exchange (ETDEWEB)

    Ryabchenko, N.I.; Ivannik, B.P.; Proskuryakov, S.Ya. (Akademiya Meditsinskikh Nauk SSSR, Obninsk. Nauchno-Issledovatel' skij Inst. Meditsinskoj Radiologii)

    1982-04-01

    The yields of immediate DNA single-strand breaks in normal tumour tissues of ..gamma..-irradiated animals were measured by a viscosimetric method of determination of high-polymer single-strand DNA molecular weight in alkaline nuclear lysates. It has been shown that in irradiated thymus, bone marrow leukocytes, Ehrlich ascitic carcinoma and Zaidel hepatoma cells (first group of tissues) in vivo the yields of DNA single-strand breaks were characterized by 80 to 130 eV per break. In in vivo irradiated liver, lymph node, spleen, and sarcoma 180 cells (second group of tissues) the yields of DNA single-strand breaks have been characterized by 30 to 40 eV per break. DNA single-strand breaks of the first group of tissues have rejoined 1 hour after the irradiation in vivo; DNA single-strand breaks of the second group have not done so.

  14. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  15. ELECTRON MICROSCOPY OF SINGLE-STRANDED DNA: CIRCULARITY OF DNA OF BACTERIOPHAGE PHI-X174.

    Science.gov (United States)

    FREIFELDER, D; KLEINSCHMIDT, A K; SINSHEIMER, R L

    1964-10-09

    The single-stranded DNA of coliphage X174 has been examined with the electron microscope by a modification of the protein-monolayer-adsorption technique. The molecules were found to be circular with a total length of 1.77 +/- 0.13 microns.

  16. On the Formation of Thymine Photodimers in Thymine Single Strands and Calf Thymus DNA

    DEFF Research Database (Denmark)

    Baggesen, Lisbeth Munksgård; Hoffmann, S.V.; Nielsen, Steen Brøndsted

    2014-01-01

    of terminal thymines, i.e., the reaction does not occur preferentially at the extremities of the single strands as previously stated. It is even possible to form two dimers with only two bridging thymines. Finally, experiments conducted on calf thymus DNA provided a similar signature of the photodimer......, but differences are also evident....

  17. CHARACTERIZATION OF SINGLE-STRAND ORIGINS OF CRYPTIC ROLLING-CIRCLE PLASMIDS FROM BACILLUS-SUBTILIS

    NARCIS (Netherlands)

    MEIJER, WJJ; VENEMA, G; BRON, S

    1995-01-01

    In this paper we describe the isolation and characterization of single strand origins (SSOs) of several cryptic Bacillus subtilis plasmids which use the rolling-circle mechanism of replication, The plasmids used in this study involved pTA1015, pTA1020, pTA1030, pTA1040, pTA1050 and pTA1060, The SSO

  18. Phenylketonuria in The Netherlands : 93% of the mutations are detected by single-strand conformation analysis

    NARCIS (Netherlands)

    vanderSijsBos, CJM; Diepstraten, CM; Juyn, JA; Plaisier, M; Giltay, JC; vanSpronsen, FJ; Smit, GPA; Berger, R; Smeitink, JAM; PollThe, BT; vanAmstel, JKP

    1996-01-01

    Single-strand conformational analysis was used to screen for genetic defects in all thirteen exons of the phenylalanine hydroxylase gene (PAH) in phenylketonuria and hyperphenylalaninemia patients in the Netherlands. Exons that showed a bandshift were sequenced directly, In this way, we were able to

  19. Quantum rendering

    Science.gov (United States)

    Lanzagorta, Marco O.; Gomez, Richard B.; Uhlmann, Jeffrey K.

    2003-08-01

    In recent years, computer graphics has emerged as a critical component of the scientific and engineering process, and it is recognized as an important computer science research area. Computer graphics are extensively used for a variety of aerospace and defense training systems and by Hollywood's special effects companies. All these applications require the computer graphics systems to produce high quality renderings of extremely large data sets in short periods of time. Much research has been done in "classical computing" toward the development of efficient methods and techniques to reduce the rendering time required for large datasets. Quantum Computing's unique algorithmic features offer the possibility of speeding up some of the known rendering algorithms currently used in computer graphics. In this paper we discuss possible implementations of quantum rendering algorithms. In particular, we concentrate on the implementation of Grover's quantum search algorithm for Z-buffering, ray-tracing, radiosity, and scene management techniques. We also compare the theoretical performance between the classical and quantum versions of the algorithms.

  20. A novel method to perform genomic walks using a combination of single strand DNA circularization and rolling circle amplification.

    Science.gov (United States)

    Gadkar, Vijay J; Filion, Martin

    2011-10-01

    Characterization of regions flanking a known sequence within a genome, known as genome walking, is a cornerstone technique in modern genetic analysis. In the present work we have developed a new PCR-dependent, directional genome walking protocol based on the unique circularization property of a novel DNA ligase, CircLigase. In the first step, PCR based primer extension is performed using a phosphorylated primer, designed to extend from the boundary of the known sequence, into the flanking region. This linear amplification results in the generation of single-stranded (ss) DNA, which is then circularized using CircLigase. Using the hyperbranching activity of Phi29 DNA polymerase, the circular ssDNA is then linearized by rolling circle amplification, resulting in copious amounts of double stranded concatameric DNA. Nested primers are used to amplify the flanking sequence using inverse PCR. The products are resolved on an agarose gel and the bands whose mobility change due to the nested location of the primer combination used are identified, extracted, and cloned into a plasmid vector for sequencing. Empirical proof for this concept was generated on two antimicrobial biosynthetic genes in Pseudomonas sp. LBUM300. Using the hcnB and phlD genes as starting points, ca 1 kb of flanking sequences were successfully isolated. The use of locus specific primers ensured both directionality and specificity of the walks, alleviating the generation of spurious amplicons, typically observed in randomly primed walking protocols. The presented genome walking protocol could be applied to any microbial genome and requires only 100-150 bp of prior sequence information. The proposed methodology does not entail laborious testing of restriction enzymes or adaptor ligation. This is the first report of a successful application of the novel ligase enzyme, CircLigase for genomic walking purposes.

  1. Single-strand conformation polymorphism analysis using capillary array electrophoresis for large-scale mutation detection.

    Science.gov (United States)

    Larsen, Lars Allan; Jespersgaard, Cathrine; Andersen, Paal Skytt

    2007-01-01

    This protocol describes capillary array electrophoresis single-strand conformation polymorphism (CAE-SSCP), a screening method for detection of unknown and previously identified mutations. The method detects 98% of mutations in a sample material and can be applied to any organism where the goal is to determine genetic variation. This protocol describes how to screen for mutations in 192 singleplex or up to 768 multiplex samples over 3 days. The protocol is based on the principle of sequence-specific mobility of single-stranded DNA in a native polymer, and covers all stages in the procedure, from initial DNA purification to final CAE-SSCP data analysis, as follows: DNA is purified, followed by PCR amplification using fluorescent primers. After PCR amplification, double-stranded DNA is heat-denatured to separate the strands and subsequently cooled on ice to avoid reannealing. Finally, samples are analyzed by capillary electrophoresis and appropriate analysis software.

  2. Efficient Production of Single-Stranded Phage DNA as Scaffolds for DNA Origami.

    Science.gov (United States)

    Kick, Benjamin; Praetorius, Florian; Dietz, Hendrik; Weuster-Botz, Dirk

    2015-07-08

    Scaffolded DNA origami enables the fabrication of a variety of complex nanostructures that promise utility in diverse fields of application, ranging from biosensing over advanced therapeutics to metamaterials. The broad applicability of DNA origami as a material beyond the level of proof-of-concept studies critically depends, among other factors, on the availability of large amounts of pure single-stranded scaffold DNA. Here, we present a method for the efficient production of M13 bacteriophage-derived genomic DNA using high-cell-density fermentation of Escherichia coli in stirred-tank bioreactors. We achieve phage titers of up to 1.6 × 10(14) plaque-forming units per mL. Downstream processing yields up to 410 mg of high-quality single-stranded DNA per one liter reaction volume, thus upgrading DNA origami-based nanotechnology from the milligram to the gram scale.

  3. Replication protein A and more: single-stranded DNA-binding proteins in eukaryotic cells

    Institute of Scientific and Technical Information of China (English)

    Ting Liu; Jun Huang

    2016-01-01

    Single-stranded DNA-binding proteins (SSBs) play essential roles in DNA replication,recombinational repair,and maintenance of genome stability.In human,the major SSB,replication protein A (RPA),is a stable heterotrimer composed of subunits of RPA1,RPA2,and RPA3,each df which is conserved not only in mammals but also in all other eukaryotic species.In addition to RPA,other SSBs have also been identified in the human genome,including sensor of single-stranded DNA complexes 1 and 2 (SOSS1/2).In this review,we summarize our current understanding of how these SSBs contribute to the maintenance of genome stability.

  4. Efficient Production of Single-Stranded Phage DNA as Scaffolds for DNA Origami

    Science.gov (United States)

    2015-01-01

    Scaffolded DNA origami enables the fabrication of a variety of complex nanostructures that promise utility in diverse fields of application, ranging from biosensing over advanced therapeutics to metamaterials. The broad applicability of DNA origami as a material beyond the level of proof-of-concept studies critically depends, among other factors, on the availability of large amounts of pure single-stranded scaffold DNA. Here, we present a method for the efficient production of M13 bacteriophage-derived genomic DNA using high-cell-density fermentation of Escherichia coli in stirred-tank bioreactors. We achieve phage titers of up to 1.6 × 1014 plaque-forming units per mL. Downstream processing yields up to 410 mg of high-quality single-stranded DNA per one liter reaction volume, thus upgrading DNA origami-based nanotechnology from the milligram to the gram scale. PMID:26028443

  5. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification

    CERN Document Server

    Liao, Quanwen; Liu, Zhichun; Liu, Wei

    2016-01-01

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonst...

  6. DNA Single-Strand Break Repair and Spinocerebellar Ataxia with Axonal Neuropathy-1

    OpenAIRE

    Caldecott, K. W.

    2007-01-01

    DNA single-strand breaks (SSBs) are the commonest DNA lesions arising spontaneously in cells, and if not repaired may block transcription or may be converted into potentially lethal/clastogenic DNA double-strand breaks (DSBs). Recently, evidence has emerged that defects in the rapid repair of SSBs preferentially impact the nervous system. In particular, spinocerebellar ataxia with axonal neuropathy (SCAN1) is a human disease that is associated with mutation of TDP1 (tyrosyl DNA phosphodiester...

  7. DNA single-strand break repair and spinocerebellar ataxia with axonal neuropathy-1

    OpenAIRE

    El-Khamisy, S.F.; Caldecott, K. W.

    2007-01-01

    DNA single-strand breaks (SSBs) are the commonest DNA lesions arising spontaneously in cells, and if not repaired may block transcription or may be converted into potentially lethal/clastogenic DNA double-strand breaks (DSBs). Recently, evidence has emerged that defects in the rapid repair of SSBs preferentially impact the nervous system. In particular, spinocerebellar ataxia with axonal neuropathy (SCAN1) is a human disease that is associated with mutation of TDP1 (tyrosyl DNA phosphodiester...

  8. Mitochondrial DNA Variability in Populations of Alectoris rufa: A Single-Stranded Conformation Polymorphism (SSCP Approach.

    Directory of Open Access Journals (Sweden)

    Martínez-Fresno, M.

    2006-06-01

    Full Text Available A variable domain of the mitochondrial DNA of the red-legged partridge Alectoris rufa was analysed by single-stranded DNA polymorphism (SSCP, in animals of different populations. Ten mitochondrial types were detected unevenly distributed among samples. A preserved natural population in Northern Spain, Fuentes Carrionas, showed the highest degree of polymorphism. Farm bred animals seem to be less variable and show some genotypes not usually found in the natural sites, suggesting an alien origin of many breeders.

  9. A Single-Strand Annealing Protein Clamps DNA to Detect and Secure Homology.

    Directory of Open Access Journals (Sweden)

    Marcel Ander

    2015-08-01

    Full Text Available Repair of DNA breaks by single-strand annealing (SSA is a major mechanism for the maintenance of genomic integrity. SSA is promoted by proteins (single-strand-annealing proteins [SSAPs], such as eukaryotic RAD52 and λ phage Redβ. These proteins use a short single-stranded region to find sequence identity and initiate homologous recombination. However, it is unclear how SSAPs detect homology and catalyze annealing. Using single-molecule experiments, we provide evidence that homology is recognized by Redβ monomers that weakly hold single DNA strands together. Once annealing begins, dimerization of Redβ clamps the double-stranded region and nucleates nucleoprotein filament growth. In this manner, DNA clamping ensures and secures a successful detection for DNA sequence homology. The clamp is characterized by a structural change of Redβ and a remarkable stability against force up to 200 pN. Our findings not only present a detailed explanation for SSAP action but also identify the DNA clamp as a very stable, noncovalent, DNA-protein interaction.

  10. Sequence conversion by single strand oligonucleotide donors via non-homologous end joining in mammalian cells.

    Science.gov (United States)

    Liu, Jia; Majumdar, Alokes; Liu, Jilan; Thompson, Lawrence H; Seidman, Michael M

    2010-07-23

    Double strand breaks (DSBs) can be repaired by homology independent nonhomologous end joining (NHEJ) pathways involving proteins such as Ku70/80, DNAPKcs, Xrcc4/Ligase 4, and the Mre11/Rad50/Nbs1 (MRN) complex. DSBs can also be repaired by homology-dependent pathways (HDR), in which the MRN and CtIP nucleases produce single strand ends that engage homologous sequences either by strand invasion or strand annealing. The entry of ends into HDR pathways underlies protocols for genomic manipulation that combine site-specific DSBs with appropriate informational donors. Most strategies utilize long duplex donors that participate by strand invasion. Work in yeast indicates that single strand oligonucleotide (SSO) donors are also active, over considerable distance, via a single strand annealing pathway. We examined the activity of SSO donors in mammalian cells at DSBs induced either by a restriction nuclease or by a targeted interstrand cross-link. SSO donors were effective immediately adjacent to the break, but activity declined sharply beyond approximately 100 nucleotides. Overexpression of the resection nuclease CtIP increased the frequency of SSO-mediated sequence modulation distal to the break site, but had no effect on the activity of an SSO donor adjacent to the break. Genetic and in vivo competition experiments showed that sequence conversion by SSOs in the immediate vicinity of the break was not by strand invasion or strand annealing pathways. Instead these donors competed for ends that would have otherwise entered NHEJ pathways.

  11. Binding of single stranded nucleic acids to cationic ligand functionalized gold nanoparticles.

    Science.gov (United States)

    Nash, Jessica A; Tucker, Tasha L; Therriault, William; Yingling, Yaroslava G

    2016-11-11

    The interactions of nanoparticles (NPs) with single stranded nucleic acids (NAs) have important implications in gene delivery, and nanotechnological and biomedical applications. Here, the complexation of cationic ligand functionalized gold nanoparticles with single stranded deoxyribose nucleic acid (DNA) and ribonucleic acid (RNA) are examined using all atom molecular dynamics simulations. The results indicated that complexation depends mostly on charge of nanoparticle, and, to lesser extent, sequence and type of nucleic acid. For cationic nanoparticles, electrostatic interactions between charged ligands and the nucleic acid backbone dominate binding regardless of nanoparticle charge. Highly charged nanoparticles bind more tightly and cause compaction of the single-stranded NAs through disruption of intrastrand π-π stacking and hydrogen bonding. However, poly-purine strands (polyA-DNA, polyA-RNA) show less change in structure than poly-pyrimidine strands (polyT-DNA, polyU-RNA). Overall, the results show that control over ssNA structure may be achieved with cationic NPs with a charge of more than 30, but the extent of the structural changes depends on sequence.

  12. Single-strand DNA translation initiation step analyzed by Isothermal Titration Calorimetry

    Energy Technology Data Exchange (ETDEWEB)

    Damian, Luminita, E-mail: luminitadamian@microcal.eu.com [CNRS, IPBS (Institut de Pharmacologie et de Biologie Structurale), 205 route de Narbonne, F-31077 Toulouse (France); Universite de Toulouse, UPS, IPBS, F-31077 Toulouse (France); IUB, School of Engineering and Science, D-28727 Bremen (Germany); Marty-Detraves, Claire, E-mail: claire.detraves@free.fr [CNRS, IPBS (Institut de Pharmacologie et de Biologie Structurale), 205 route de Narbonne, F-31077 Toulouse (France); Universite de Toulouse, UPS, IPBS, F-31077 Toulouse (France); Winterhalter, Mathias [IUB, School of Engineering and Science, D-28727 Bremen (Germany); Fournier, Didier, E-mail: Didier.Fournier@ipbs.fr [CNRS, IPBS (Institut de Pharmacologie et de Biologie Structurale), 205 route de Narbonne, F-31077 Toulouse (France); Universite de Toulouse, UPS, IPBS, F-31077 Toulouse (France); Paquereau, Laurent, E-mail: Laurent.Paquereau@ipbs.fr [CNRS, IPBS (Institut de Pharmacologie et de Biologie Structurale), 205 route de Narbonne, F-31077 Toulouse (France); Universite de Toulouse, UPS, IPBS, F-31077 Toulouse (France)

    2009-07-31

    Is single-strand DNA translatable? Since the 60s, the question still remains whether or not DNA could be directly translated into protein. Some discrepancies in the results were reported about functional translation of single-strand DNA but all results converged on a similar behavior of RNA and ssDNA in the initiation step. Isothermal Titration Calorimetry method was used to determine thermodynamic constants of interaction between single-strand DNA and S30 extract of Escherichia coli. Our results showed that the binding was not affected by the nature of the template tested and the dissociation constants were in the same range when ssDNA (K{sub d} = 3.62 {+-} 2.1 x 10{sup -8} M) or the RNA corresponding sequence (K{sub d} = 2.7 {+-} 0.82 x 10{sup -8} M) bearing SD/ATG sequences were used. The binding specificity was confirmed by antibiotic interferences which block the initiation complex formation. These results suggest that the limiting step in translation of ssDNA is the elongation process.

  13. FTIR study of CPD photolyase with substrate in single strand DNA.

    Science.gov (United States)

    Mahaputra Wijaya, I M; Iwata, Tatsuya; Yamamoto, Junpei; Hitomi, Kenichi; Iwai, Shigenori; Getzoff, Elizabeth D; Kandori, Hideki

    2015-01-01

    Photolyases (PHRs) utilize near UV/blue light to specifically repair the major photoproducts (PPs) of UV-induced damaged DNA. The cyclobutane pyrimidine dimer (CPD)-PHR binds flavin adenine dinucleotide (FAD) as a cofactor and repairs CPD lesions in double-stranded DNA. To understand the activation and repair mechanism of CPD-PHR, we applied light-induced difference Fourier transform infrared (FTIR) spectroscopy to CPD-PHR, whose signals were identified by use of isotope-labeling. To further investigate the enzymatic function, here we study the activation and repair mechanism of CPD-PHR with the substrate in single strand DNA, and the obtained FTIR spectra are compared with those in double-stranded DNA, the natural substrate. The difference spectra of photoactivation, the fully-reduced (FADH(-)) minus semiquinone (FADH(•)) spectra, are almost identical in the presence of single strand and double-stranded DNA, except for slight spectral modification in the amide-I region. On the other hand, the difference spectra of photorepair were highly substrate dependent. Strong bands of the C=O stretch (1,720-1,690 cm(-1)) and phosphate vibrations (1,090-1,060 cm(-1)) of double-stranded DNA may have disappeared in the case of single strand DNA. However, an isotope-labeled enzyme study revealed that spectral features upon DNA repair are similar between both substrates, and the main reason for the apparent spectral difference originates from structural flexibility of DNA after repair.

  14. Conservative Repair of a Chromosomal Double-Strand Break by Single-Strand DNA through Two Steps of Annealing▿ †

    OpenAIRE

    Storici, Francesca; Snipe, Joyce R.; Chan, Godwin K.; Dmitry A Gordenin; Michael A Resnick

    2006-01-01

    The repair of chromosomal double-strand breaks (DSBs) is essential to normal cell growth, and homologous recombination is a universal process for DSB repair. We explored DSB repair mechanisms in the yeast Saccharomyces cerevisiae using single-strand oligonucleotides with homology to both sides of a DSB. Oligonucleotide-directed repair occurred exclusively via Rad52- and Rad59-mediated single-strand annealing (SSA). Even the SSA domain of human Rad52 provided partial complementation for a null...

  15. Analyses of point mutation repair and allelic heterogeneity generated by CRISPR/Cas9 and single-stranded DNA oligonucleotides

    OpenAIRE

    Pawel Bialk; Brett Sansbury; Natalia Rivera-Torres; Kevin Bloh; Dula Man; Kmiec, Eric B.

    2016-01-01

    The repair of a point mutation can be facilitated by combined activity of a single-stranded oligonucleotide and a CRISPR/Cas9 system. While the mechanism of action of combinatorial gene editing remains to be elucidated, the regulatory circuitry of nucleotide exchange executed by oligonucleotides alone has been largely defined. The presence of the appropriate CRISPR/Cas9 system leads to an enhancement in the frequency of gene editing directed by single-stranded DNA oligonucleotides. While CRIS...

  16. Analyses of point mutation repair and allelic heterogeneity generated by CRISPR/Cas9 and single-stranded DNA oligonucleotides

    OpenAIRE

    Pawel Bialk; Brett Sansbury; Natalia Rivera-Torres; Kevin Bloh; Dula Man; Kmiec, Eric B.

    2016-01-01

    The repair of a point mutation can be facilitated by combined activity of a single-stranded oligonucleotide and a CRISPR/Cas9 system. While the mechanism of action of combinatorial gene editing remains to be elucidated, the regulatory circuitry of nucleotide exchange executed by oligonucleotides alone has been largely defined. The presence of the appropriate CRISPR/Cas9 system leads to an enhancement in the frequency of gene editing directed by single-stranded DNA oligonucleotides. While CRIS...

  17. Graphitic Surface Attachment by Single-Stranded DNA and Metal Nanoparticles

    Science.gov (United States)

    Somers, Luke

    Graphene and carbon nanotubes are extreme mechanical and electronic materials which have been the subjects of intense study and development since their discoveries. While many of their intrinsic properties have been discovered, their interactions with other materials are only beginning to be explored. The noncovalent binding of single-stranded DNA oligonucleotides to carbon nanotubes and graphene has been seen to give rise to effective gas sensors. We examine similar systems to each of these in turn, imaging carbon nanotubes decorated with single-stranded DNA in Transmission Electron Microscope, and performing X-ray reflectivity of a single-stranded DNA film on graphite. The TEM study shows that the DNA bunches up along tubes but does not tend to clump on single tubes. Helical wrapping is not seen on single tubes. X-ray reflectivity shows that DNA on a graphite surface forms an inhomogeneous layer around 1.6 nm thick. The differences between the various thicknesses of few-layer graphene are substantial though often underappreciated. These differences are highlighted in the system of several-nanometer metal particles on few-layer graphene flakes. We formed such particles by evaporation and annealing, then examined them in Scanning Electron Microscope. We found that gold nanoparticles were circular and experienced limited growth, with the radius varying as the number of layers to the 1/3 power. A theoretical explanation is given for this observation, based on an electrostatic interaction. This theory is also consistent with observations for titanium and silver nanoparticles. Ytterbium nanoparticles on graphene form instead into filaments. A related theory is presented showing that the same electrostatic interaction is capable of overcoming surface tension to deform particles from circularity.

  18. Distinct Cdk1 requirements during single-strand annealing, noncrossover, and crossover recombination.

    Directory of Open Access Journals (Sweden)

    Camilla Trovesi

    2011-08-01

    Full Text Available Repair of DNA double-strand breaks (DSBs by homologous recombination (HR in haploid cells is generally restricted to S/G2 cell cycle phases, when DNA has been replicated and a sister chromatid is available as a repair template. This cell cycle specificity depends on cyclin-dependent protein kinases (Cdk1 in Saccharomyces cerevisiae, which initiate HR by promoting 5'-3' nucleolytic degradation of the DSB ends. Whether Cdk1 regulates other HR steps is unknown. Here we show that yku70Δ cells, which accumulate single-stranded DNA (ssDNA at the DSB ends independently of Cdk1 activity, are able to repair a DSB by single-strand annealing (SSA in the G1 cell cycle phase, when Cdk1 activity is low. This ability to perform SSA depends on DSB resection, because both resection and SSA are enhanced by the lack of Rad9 in yku70Δ G1 cells. Furthermore, we found that interchromosomal noncrossover recombinants are generated in yku70Δ and yku70Δ rad9Δ G1 cells, indicating that DSB resection bypasses Cdk1 requirement also for carrying out these recombination events. By contrast, yku70Δ and yku70Δ rad9Δ cells are specifically defective in interchromosomal crossover recombination when Cdk1 activity is low. Thus, Cdk1 promotes DSB repair by single-strand annealing and noncrossover recombination by acting mostly at the resection level, whereas additional events require Cdk1-dependent regulation in order to generate crossover outcomes.

  19. Adriamycin does not affect the repair of X-ray induced DNA single strand breaks

    Energy Technology Data Exchange (ETDEWEB)

    Cantoni, O.; Sestili, P.; Cattabeni, F.

    1985-06-01

    The ability of the antitumor antibiotic adriamycin (Ad) to inhibit the rejoining of DNA single strand breaks produced by X-rays was investigated in cultured cells. Chinese hamster ovary cells were given 400 rad and were allowed to repair in the presence or absence of Ad for 60 min at 37degC. The drug did not affect the ability of cells to repair DNA breaks and residual breaks found after the repair period were attributed to those induced by Ad alone. (author). 16 refs.

  20. Mutation screening in the human epsilon-globin gene using single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Papachatzopoulou, Adamantia; Menounos, Panagiotis G; Kolonelou, Christina; Patrinos, George P

    2006-02-01

    The human epsilon-globin gene is necessary for primitive human erythropoiesis in the yolk sac. Herein we report a non-radioactive single-strand conformation polymorphism (SSCP) approach to screen the human epsilon-globin gene and its regulatory regions for possible mutations and single-nucleotide polymorphisms in normal adult subjects, in order to determine those genomic regions, which are not necessary for its proper regulation and function. We identified no sequence variations apart from the expected 5'epsilon /HincII polymorphism in the fragments analyzed, suggesting that genomic alterations in the epsilon-globin gene are most likely incompatible with normal erythropoiesis and proper embryonic development.

  1. Genetic analysis of Trichinella populations by 'cold' single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Gasser, Robin B; Hu, Min; El-Osta, Youssef Abs; Zarlenga, Dante S; Pozio, Edoardo

    2005-09-05

    A non-isotopic single-strand conformation polymorphism ('cold' SSCP) technique has been assessed for the analysis of sequence variability in the expansion segment 5 (ES5) of domain IV and the D3 domain of nuclear ribosomal DNA within and/or among isolates and individual muscle (first-stage) larvae representing all currently recognized species/genotypes of Trichinella. Data are consistent with the ability of cold SSCP to identify intra-specific as well as inter-specific variability among Trichinella genotypes. The cold SSCP approach should be applicable to a range of other genetic markers for comparative studies of Trichinella populations globally.

  2. Sequence Conversion by Single Strand Oligonucleotide Donors via Non-homologous End Joining in Mammalian Cells*

    OpenAIRE

    Liu, Jia; Majumdar, Alokes; Liu, Jilan; Thompson, Lawrence H.; Seidman, Michael M.

    2010-01-01

    Double strand breaks (DSBs) can be repaired by homology independent nonhomologous end joining (NHEJ) pathways involving proteins such as Ku70/80, DNAPKcs, Xrcc4/Ligase 4, and the Mre11/Rad50/Nbs1 (MRN) complex. DSBs can also be repaired by homology-dependent pathways (HDR), in which the MRN and CtIP nucleases produce single strand ends that engage homologous sequences either by strand invasion or strand annealing. The entry of ends into HDR pathways underlies protocols for genomic manipulatio...

  3. Single-strand DNA detection using a planar photonic-crystal-waveguide-based sensor.

    Science.gov (United States)

    Toccafondo, V; García-Rupérez, J; Bañuls, M J; Griol, A; Castelló, J G; Peransi-Llopis, S; Maquieira, A

    2010-11-01

    We report an experimental demonstration of single-strand DNA (ssDNA) detection at room temperature using a photonic-crystal-waveguide-based optical sensor. The sensor surface was previously biofunctionalized with ssDNA probes to be used as specific target receptors. Our experiments showed that it is possible to detect these hybridization events using planar photonic-crystal structures, reaching an estimated detection limit as low as 19.8 nM for the detection of the complementary DNA strand.

  4. Sequence-specific Hydrolysis of Single-stranded DNA by PNA-Cerium (Ⅳ) Adduct

    Institute of Scientific and Technical Information of China (English)

    He Bai SHEN; Feng WANG; Yong Tao YANG

    2005-01-01

    A novel artificial site specific cleavage reagent, with peptide nucleic acid (PNA) as sequence-recognizing moiety and cerium (Ⅳ) ions as "scissors" for cleaving target DNA, was synthesized. Subsequently, it was employed in the cleavage of target 26-mer single-stranded DNA (ssDNA), which has 10-mer sequence complementary with PNA recognizer in the hybrids,under physiological conditions. Reversed-phase high-performance liquid chromatogram (RPHPLC) experiments indicated that the artificial site specific cleavage reagent could cleave the target DNA specifically.

  5. In vivo SELEX of single-stranded domains in the HIV-1 leader RNA.

    Science.gov (United States)

    van Bel, Nikki; Das, Atze T; Berkhout, Ben

    2014-02-01

    The 5' untranslated leader region of the human immunodeficiency virus type 1 (HIV-1) RNA genome is a strongly conserved sequence that encodes several regulatory motifs important for viral replication. Most of these motifs are exposed as hairpin structures, including the dimerization initiation signal (DIS), the major splice donor site (SD), and the packaging signal (Ψ), which are connected by short single-stranded regions. Mutational analysis revealed many functions of these hairpins, but only a few studies have focused on the single-stranded purine-rich sequences. Using the in vivo SELEX (systematic evolution of ligands by exponential enrichment) approach, we probed the sequence space in these regions that is compatible with efficient HIV-1 replication and analyzed the impact on the RNA secondary structure of the leader RNA. Our results show a strong sequence requirement for the DIS hairpin flanking regions. We postulate that these sequences are important for the binding of specific protein factors that support leader RNA-mediated functions. The sequence between the SD and Ψ hairpins seems to have a less prominent role, despite the strong conservation of the stretch of 5 A residues in natural isolates. We hypothesize that this may reflect the subtle evolutionary pressure on HIV-1 to acquire an A-rich RNA genome. In silico analyses indicate that sequences are avoided in all 3 single-stranded domains that affect the local or overall leader RNA folding. IMPORTANCE Many regulatory RNA sequences are clustered in the untranslated leader domain of the HIV-1 RNA genome. Several RNA hairpin structures in this domain have been proposed to fulfill specific roles, e.g., mediating RNA dimer formation to facilitate HIV-1 recombination. We now focus on the importance of a few well-conserved single-stranded sequences that connect these hairpins. We created libraries of HIV-1 variants in which these segments were randomized and selected the best-replicating variants. For two

  6. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA

    DEFF Research Database (Denmark)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela

    2015-01-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ss......DNA and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained...

  7. Upgrading SELEX Technology by Using Lambda Exonuclease Digestion for Single-Stranded DNA Generation

    Directory of Open Access Journals (Sweden)

    Meltem Avci-Adali

    2009-12-01

    Full Text Available The generation of single-stranded DNA (ssDNA molecules plays a key role in the SELEX (Systematic Evolution of Ligands by EXponential enrichment combinatorial chemistry process and numerous molecular biology techniques and applications, such as DNA sequencing, single-nucleotide polymorphism (SNP analysis, DNA chips, DNA single-strand conformation polymorphism (SSCP analysis and many other techniques. The purity and yield of ssDNA can affect the success of each application. This study compares the two ssDNA production methods, the strand separation by streptavidin-coated magnetic beads and alkaline denaturation and the lambda exonuclease digestion, in regard to the purity of generated ssDNA and the efficiency. Here, we demonstrate the considerable benefits of ssDNA production by lambda exonuclease digestion for in vitro selection of DNA aptamers. We believe that the generation of ssDNA aptamers using this method will greatly improve the success rate of SELEX experiments concerning the recovery of target-specific aptamers.

  8. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Directory of Open Access Journals (Sweden)

    Yusuf E Murgha

    Full Text Available Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  9. Tailoring Thermal Conductivity of Single-stranded Carbon-chain Polymers through Atomic Mass Modification.

    Science.gov (United States)

    Liao, Quanwen; Zeng, Lingping; Liu, Zhichun; Liu, Wei

    2016-10-07

    Tailoring the thermal conductivity of polymers is central to enlarge their applications in the thermal management of flexible integrated circuits. Progress has been made over the past decade by fabricating materials with various nanostructures, but a clear relationship between various functional groups and thermal properties of polymers remains to be established. Here, we numerically study the thermal conductivity of single-stranded carbon-chain polymers with multiple substituents of hydrogen atoms through atomic mass modification. We find that their thermal conductivity can be tuned by atomic mass modifications as revealed through molecular dynamics simulations. The simulation results suggest that heavy homogeneous substituents do not assist heat transport and trace amounts of heavy substituents can in fact hinder heat transport substantially. Our analysis indicates that carbon chain has the biggest contribution (over 80%) to the thermal conduction in single-stranded carbon-chain polymers. We further demonstrate that atomic mass modifications influence the phonon bands of bonding carbon atoms, and the discrepancies of phonon bands between carbon atoms are responsible for the remarkable drops in thermal conductivity and large thermal resistances in carbon chains. Our study provides fundamental insight into how to tailor the thermal conductivity of polymers through variable substituents.

  10. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  11. Human single-stranded DNA binding proteins: guardians of genome stability

    Institute of Scientific and Technical Information of China (English)

    Yuanzhong Wu; Jinping Lu; Tiebang Kang

    2016-01-01

    Single-stranded DNA-binding proteins (SSBs) are essential for maintaining the integrity of the genome in all organisms.All processes related to DNA,such as replication,excision,repair,and recombination,require the participation of SSBs whose oligonucleotideaoligosaccharide-binding (OB)-fold domain is responsible for the interaction with single-stranded DNA (ssDNA).For a long time,the heterotrimeric replication protein A (RPA) complex was believed to be the only nuclear SSB in eukanyotes to participate in ssDNA processing,while mitochondrial SSBs that are consewed with prokaryotic SSBs were shown to be essential for maintaining genome stability in eukaryotic mitochondria.In recent years,two new proteins,hSSB1 and hSSB2 (human SSBs 1/2),were identified and have better sequence similarity to bacterial and archaeal SSBs than RPA.This review summarizes the current understanding of these human SSBs in DNA damage repair and in cell-cycle checkpoint activation following DNA damage,as well as their relationships with cancer.

  12. Effect of iontophoresis on the in vitro trans-scleral transport of three single stranded oligonucleotides.

    Science.gov (United States)

    Pescina, Silvia; Antopolsky, Maxim; Santi, Patrizia; Nicoli, Sara; Murtomäki, Lasse

    2013-05-13

    Oligonucleotides represent a subject of clinical interest due to their potential ability to treat several diseases, including those affecting the posterior segment of the eye. Unfortunately, therapeutic oligonucleotides are currently administered by means of highly invasive approaches, such as intravitreal injections. The aim of the present work was to study in vitro, across isolated bovine sclera, the effect of iontophoresis on the transport of three single stranded oligonucleotides (ssDNA), 12-, 24- and 36-mer, selected as reference compounds in view of a non-invasive drug delivery to the back of the eye. All the three sequences were able to cross bovine sclera in vitro without iontophoresis. When anodal iontophoresis was applied, no change in flux was observed, while in the presence of cathodal iontophoresis the permeability coefficients increased four-fold compared to passive conditions. This behavior can be ascribed to the electrorepulsive mechanism, due to the negative charge of the nucleic acid backbone. It was also observed that the molecular weights of the three sequences did not affect trans-scleral transport, neither in passive, nor in current assisted permeation. Furthermore, increasing the current intensity from 1.75 mA to 3 mA, no effect on the trans-scleral transport of the 24-mer was noticed. Although preliminary, the results demonstrate that cathodal iontophoresis enhances trans-scleral transport of single stranded oligonucleotides and suggest its use as a novel non-invasive approach for the treatment of diseases affecting the posterior segment of the eye.

  13. Sequence-dependent elasticity and electrostatics of single-stranded DNA: signatures of base-stacking.

    Science.gov (United States)

    McIntosh, Dustin B; Duggan, Gina; Gouil, Quentin; Saleh, Omar A

    2014-02-04

    Base-stacking is a key factor in the energetics that determines nucleic acid structure. We measure the tensile response of single-stranded DNA as a function of sequence and monovalent salt concentration to examine the effects of base-stacking on the mechanical and thermodynamic properties of single-stranded DNA. By comparing the elastic response of highly stacked poly(dA) and that of a polypyrimidine sequence with minimal stacking, we find that base-stacking in poly(dA) significantly enhances the polymer's rigidity. The unstacking transition of poly(dA) at high force reveals that the intrinsic electrostatic tension on the molecule varies significantly more weakly on salt concentration than mean-field predictions. Further, we provide a model-independent estimate of the free energy difference between stacked poly(dA) and unstacked polypyrimidine, finding it to be ∼-0.25 kBT/base and nearly constant over three orders of magnitude in salt concentration.

  14. A toolbox for generating single-stranded DNA in optical tweezers experiments.

    Science.gov (United States)

    Candelli, Andrea; Hoekstra, Tjalle P; Farge, Geraldine; Gross, Peter; Peterman, Erwin J G; Wuite, Gijs J L

    2013-09-01

    Essential genomic transactions such as DNA-damage repair and DNA replication take place on single-stranded DNA (ssDNA) or require specific single-stranded/double-stranded DNA (ssDNA/dsDNA) junctions (SDSJ). A significant challenge in single-molecule studies of DNA-protein interactions using optical trapping is the design and generation of appropriate DNA templates. In contrast to dsDNA, only a limited toolbox is available for the generation of ssDNA constructs for optical tweezers experiments. Here, we present several kinds of DNA templates suitable for single-molecule experiments requiring segments of ssDNA of several kilobases in length. These different biotinylated dsDNA templates can be tethered between optically trapped microspheres and can, by the subsequent use of force-induced DNA melting, be converted into partial or complete ssDNA molecules. We systematically investigated the time scale and efficiency of force-induced melting at different ionic strengths for DNA molecules of different sequences and lengths. Furthermore, we quantified the impact of microspheres of different sizes on the lifetime of ssDNA tethers in optical tweezers experiments. Together, these experiments provide deeper insights into the variables that impact the production of ssDNA for single molecules studies and represent a starting point for further optimization of DNA templates that permit the investigation of protein binding and kinetics on ssDNA. Copyright © 2013 Wiley Periodicals, Inc.

  15. Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

    Science.gov (United States)

    Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M

    2016-08-02

    Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

  16. High-efficiency multiplex capillary electrophoresis single strand conformation polymorphism (multi-CE-SSCP) mutation screening of SCN5A: a rapid genetic approach to cardiac arrhythmia.

    Science.gov (United States)

    Hofman-Bang, J; Behr, E R; Hedley, P; Tfelt-Hansen, J; Kanters, J K; Haunsøe, S; McKenna, W J; Christiansen, M

    2006-06-01

    Mutations in the SCN5A gene coding for the alpha-subunit of the cardiac Na(+) ion channel cause long QT syndrome, Brugada syndrome, idiopathic ventricular fibrillation, sick sinus node syndrome, progressive conduction disease, dilated cardiomyopathy and atrial standstill. These diseases exhibit variable expressivity, and identification of gene carriers is clinically important, particularly in sudden infant and adult death syndromes. The SCN5A gene comprises 28 exons distributed over 100 kbp of genomic sequence at chromosome 3p21. Disease-causing mutations are private and scattered over the DNA sequence, making it difficult to screen for specific mutations. We developed a multiplex capillary-electrophoresis single-strand conformation polymorphism (Multi-CE-SSCP) mutation screening protocol on the ABI 3100 platform and applied it to 10 previously slab-gel SSCP identified mutations and SNPs and used it to identify one novel deletion. The method is highly efficient, with a turnover of 23 patients per 24 h and a false positive rate of 0.5% of the analyzed amplicons. Each variant has a particular elution pattern, and all 20 carriers of the H558R polymorphism out of 57 persons were correctly identified. We suggest that the method could become part of routine work-up of patients with suspicious syncope and of members of families with sudden unexplained death.

  17. Excess single-stranded DNA inhibits meiotic double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Rebecca Johnson

    2007-11-01

    Full Text Available During meiosis, self-inflicted DNA double-strand breaks (DSBs are created by the protein Spo11 and repaired by homologous recombination leading to gene conversions and crossovers. Crossover formation is vital for the segregation of homologous chromosomes during the first meiotic division and requires the RecA orthologue, Dmc1. We analyzed repair during meiosis of site-specific DSBs created by another nuclease, VMA1-derived endonuclease (VDE, in cells lacking Dmc1 strand-exchange protein. Turnover and resection of the VDE-DSBs was assessed in two different reporter cassettes that can repair using flanking direct repeat sequences, thereby obviating the need for a Dmc1-dependent DNA strand invasion step. Access of the single-strand binding complex replication protein A, which is normally used in all modes of DSB repair, was checked in chromatin immunoprecipitation experiments, using antibody against Rfa1. Repair of the VDE-DSBs was severely inhibited in dmc1Delta cells, a defect that was associated with a reduction in the long tract resection required to initiate single-strand annealing between the flanking repeat sequences. Mutants that either reduce Spo11-DSB formation or abolish resection at Spo11-DSBs rescued the repair block. We also found that a replication protein A component, Rfa1, does not accumulate to expected levels at unrepaired single-stranded DNA (ssDNA in dmc1Delta cells. The requirement of Dmc1 for VDE-DSB repair using flanking repeats appears to be caused by the accumulation of large quantities of ssDNA that accumulate at Spo11-DSBs when Dmc1 is absent. We propose that these resected DSBs sequester both resection machinery and ssDNA binding proteins, which in wild-type cells would normally be recycled as Spo11-DSBs repair. The implication is that repair proteins are in limited supply, and this could reflect an underlying mechanism for regulating DSB repair in wild-type cells, providing protection from potentially harmful effects

  18. Removing Noise From Pyrosequenced Amplicons

    Directory of Open Access Journals (Sweden)

    Davenport Russell J

    2011-01-01

    Full Text Available Abstract Background In many environmental genomics applications a homologous region of DNA from a diverse sample is first amplified by PCR and then sequenced. The next generation sequencing technology, 454 pyrosequencing, has allowed much larger read numbers from PCR amplicons than ever before. This has revolutionised the study of microbial diversity as it is now possible to sequence a substantial fraction of the 16S rRNA genes in a community. However, there is a growing realisation that because of the large read numbers and the lack of consensus sequences it is vital to distinguish noise from true sequence diversity in this data. Otherwise this leads to inflated estimates of the number of types or operational taxonomic units (OTUs present. Three sources of error are important: sequencing error, PCR single base substitutions and PCR chimeras. We present AmpliconNoise, a development of the PyroNoise algorithm that is capable of separately removing 454 sequencing errors and PCR single base errors. We also introduce a novel chimera removal program, Perseus, that exploits the sequence abundances associated with pyrosequencing data. We use data sets where samples of known diversity have been amplified and sequenced to quantify the effect of each of the sources of error on OTU inflation and to validate these algorithms. Results AmpliconNoise outperforms alternative algorithms substantially reducing per base error rates for both the GS FLX and latest Titanium protocol. All three sources of error lead to inflation of diversity estimates. In particular, chimera formation has a hitherto unrealised importance which varies according to amplification protocol. We show that AmpliconNoise allows accurate estimates of OTU number. Just as importantly AmpliconNoise generates the right OTUs even at low sequence differences. We demonstrate that Perseus has very high sensitivity, able to find 99% of chimeras, which is critical when these are present at high

  19. Hypermutability of damaged single-strand DNA formed at double-strand breaks and uncapped telomeres in yeast Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Yong Yang

    2008-11-01

    Full Text Available The major DNA repair pathways operate on damage in double-strand DNA because they use the intact strand as a template after damage removal. Therefore, lesions in transient single-strand stretches of chromosomal DNA are expected to be especially threatening to genome stability. To test this hypothesis, we designed systems in budding yeast that could generate many kilobases of persistent single-strand DNA next to double-strand breaks or uncapped telomeres. The systems allowed controlled restoration to the double-strand state after applying DNA damage. We found that lesions induced by UV-light and methyl methanesulfonate can be tolerated in long single-strand regions and are hypermutagenic. The hypermutability required PCNA monoubiquitination and was largely attributable to translesion synthesis by the error-prone DNA polymerase zeta. In support of multiple lesions in single-strand DNA being a source of hypermutability, analysis of the UV-induced mutants revealed strong strand-specific bias and unexpectedly high frequency of alleles with widely separated multiple mutations scattered over several kilobases. Hypermutability and multiple mutations associated with lesions in transient stretches of long single-strand DNA may be a source of carcinogenesis and provide selective advantage in adaptive evolution.

  20. Hypermutability of Damaged Single-Strand DNA Formed at Double-Strand Breaks and Uncapped Telomeres in Yeast Saccharomyces cerevisiae

    Science.gov (United States)

    Yang, Yong; Sterling, Joan; Storici, Francesca; Resnick, Michael A.; Gordenin, Dmitry A.

    2008-01-01

    The major DNA repair pathways operate on damage in double-strand DNA because they use the intact strand as a template after damage removal. Therefore, lesions in transient single-strand stretches of chromosomal DNA are expected to be especially threatening to genome stability. To test this hypothesis, we designed systems in budding yeast that could generate many kilobases of persistent single-strand DNA next to double-strand breaks or uncapped telomeres. The systems allowed controlled restoration to the double-strand state after applying DNA damage. We found that lesions induced by UV-light and methyl methanesulfonate can be tolerated in long single-strand regions and are hypermutagenic. The hypermutability required PCNA monoubiquitination and was largely attributable to translesion synthesis by the error-prone DNA polymerase ζ. In support of multiple lesions in single-strand DNA being a source of hypermutability, analysis of the UV-induced mutants revealed strong strand-specific bias and unexpectedly high frequency of alleles with widely separated multiple mutations scattered over several kilobases. Hypermutability and multiple mutations associated with lesions in transient stretches of long single-strand DNA may be a source of carcinogenesis and provide selective advantage in adaptive evolution. PMID:19023402

  1. Single-strand conformation polymorphism of microsatellite for rapid strain typing of Candida albicans.

    Science.gov (United States)

    Li, Juan; Bai, Feng-Yan

    2007-11-01

    Single-strand conformation polymorphisms (SSCP) of Candida albicans' microsatellite CAI were characterized. Among the 76 clinical isolates recovered from different patients (independent strains), 60 distinct CAI SSCP patterns were recognized, resulting in a discriminatory power of 0.993. The multiple isolates recovered sequentially from the same or different body locations of the same patient showed exactly the same CAI SSCP pattern. The reliability of the SSCP analysis was confirmed by GeneScan and sequence analyses. From the same set of independent strains, 59 distinct CAI genotypes were identified by GeneScan analysis. Sequence comparison showed the advantage of SSCP over GeneSan analysis in the detection of point mutations in the microsatellite. The results indicated that PCR SSCP analysis of CAI microsatellite is a powerful and economical approach for rapid strain typing of C. albicans in clinical laboratories, especially in the detection of microevolutionary changes in microsatellites and in large-scale epidemiological investigation.

  2. Analysis of population structures of viral isolates using single-strand conformation polymorphism method.

    Science.gov (United States)

    Delaunay, Agnès; Rolland, Mathieu; Jacquot, Emmanuel

    2009-01-01

    The analysis of viral populations requires the use of techniques that describe characteristics of individuals. The single-strand conformation polymorphism (SSCP) makes possible the identification of genetic differences between viral sequences and constitutes an alternative to the expensive and time-consuming cloning and sequencing strategies. Applied to small genomic regions (from 100 to 500 bases in length), SSCP patterns could describe, under appropriate experimental conditions, single nucleotide variations in the studied sequence. The different steps of a complete SSCP procedure, from sampling to pattern analysis (including nucleic acid extraction, RT-PCR amplification, double-stranded DNA quantification, polyacrylamide gel preparation, electrophoresis conditions, and staining procedures), are described using a region (500 bases) of the barley yellow dwarfvirus-PAV (BYDV-PAV, Luteovirus) genome as molecular target.

  3. Single-strand conformation polymorphism for molecular variability studies of six viroid species.

    Science.gov (United States)

    Elleuch, Amine; Hamdi, Imen; Bessaies, Nabiha; Fakhfakh, Hatem

    2013-01-01

    Molecular diversity within six viroid species and different molecular variants, in each species infecting fruit trees was first estimated by the single-strand conformation polymorphism (SSCP) technique and then by direct sequencing analysis. The different variants studied are to three Australian grapevine viroids(AGVd), four citrus dwarfing viroids (CDVd), eleven grapevine yellow speckle viroids type-1 (GYSVd-1), four hop stunt viroids (HSVd), seven peach latent mosaic viroids (PLMVd), and eight pear blister canker viroids (PBCVd). Polyacrylamide gel electrophoresis (PAGE) conditions were compared and optimized to improve the sensitivity of the existing SSCP parameters. The relationships among the various SSCP profiles observed and the variation in nucleotide sequences was studied. The results indicate that the variations of some parameters of electrophoresis for each species allowed higher resolution and hence detection of single nucleotide variations among clones initially clustered into the same group.

  4. Salt Contribution to the Flexibility of Single-stranded Nucleic Acid of Finite Length

    CERN Document Server

    Wang, Feng-Hua; Tan, Zhi-Jie

    2012-01-01

    Nucleic acids are negatively charged macromolecules and their structure properties are strongly coupled to metal ions in solutions. In this paper, the salt effects on the flexibility of single stranded (ss) nucleic acid chain ranging from 12 to 120 nucleotides are investigated systematically by the coarse grained Monte Carlo simulations where the salt ions are considered explicitly and the ss chain is modeled with the virtual bond structural model. Our calculations show that, the increase of ion concentration causes the structural collapse of ss chain and multivalent ions are much more efficient in causing such collapse, and trivalent and small divalent ions can both induce more compact state than a random relaxation state. We found that monovalent, divalent and trivalent ions can all overcharge ss chain, and the dominating source for such overcharging changes from ion exclusion volume effect to ion Coulomb correlations. In addition, the predicted Na and Mg dependent persistence length lp of ss nucleic acid a...

  5. Super-resolution mbPAINT for optical localization of single-stranded DNA.

    Science.gov (United States)

    Chen, Jixin; Bremauntz, Alberto; Kisley, Lydia; Shuang, Bo; Landes, Christy F

    2013-10-09

    We demonstrate the application of superlocalization microscopy to identify sequence-specific portions of single-stranded DNA (ssDNA) with sequence resolution of 50 nucleotides, corresponding to a spatial resolution of 30 nm. Super-resolution imaging was achieved using a variation of a single-molecule localization method, termed as "motion blur" point accumulation for imaging in nanoscale topography (mbPAINT). The target ssDNA molecules were immobilized on the substrate. Short, dye-labeled, and complementary ssDNA molecules stochastically bound to the target ssDNA, with repeated binding events allowing super-resolution. Sequence specificity was demonstrated via the use of a control, noncomplementary probe. The results support the possibility of employing relatively inexpensive short ssDNAs to identify gene sequence specificity with improved resolution in comparison to the existing methods.

  6. Crystal structure of the single-stranded RNA binding protein HutP from Geobacillus thermodenitrificans.

    Science.gov (United States)

    Thiruselvam, Viswanathan; Sivaraman, Padavattan; Kumarevel, Thirumananseri; Ponnuswamy, Mondikalipudur Nanjappagounder

    2014-04-18

    RNA binding proteins control gene expression by the attenuation/antitermination mechanism. HutP is an RNA binding antitermination protein. It regulates the expression of hut operon when it binds with RNA by modulating the secondary structure of single-stranded hut mRNA. HutP necessitates the presence of l-histidine and divalent metal ion to bind with RNA. Herein, we report the crystal structures of ternary complex (HutP-l-histidine-Mg(2+)) and EDTA (0.5 M) treated ternary complex (HutP-l-histidine-Mg(2+)), solved at 1.9 Å and 2.5 Å resolutions, respectively, from Geobacillus thermodenitrificans. The addition of 0.5 M EDTA does not affect the overall metal-ion mediated ternary complex structure and however, the metal ions at the non-specific binding sites are chelated, as evidenced from the results of structural features.

  7. Dispersion of carbon nanotubes by single-stranded DNA wrapping for advanced biomedical applications

    Energy Technology Data Exchange (ETDEWEB)

    Simon, S; Biris, A R; Lupu, D M; Misan, I [National Institute for Research and Development of Isotopic and Molecular Technologies, 65-103 Donath, 400293 Cluj-Napoca (Romania); Clichici, S; Mocan, T [University of Medicine and Pharmacy ' Iuliu Hatieganu' , Department of Physiology, 1-3 Clinicilor, 400006 Cluj-Napoca (Romania); Biris, A S, E-mail: stefania.simon@itim-cj.r [UARL Nanotechnologi Center, University of Arkansas, 2801 S University Ave, Little Rock, AR 72204 (United States)

    2009-08-01

    Carbon nanotubes (CNT) are novel materials with unique electrical, thermal, and structural proprieties, which make them attractive for applications in composites, medicine, biology, electronics, and energy management. There are more and more attempts to use CNT, especially single-walled carbon nanotubes (SWNT), in various biomedical applications, which require highly purified samples, with no contents of catalyst residual metal particles, good dispersion in an aqueous solution at relatively high concentrations. This report presents all these three main requirements as proved by Raman spectroscopy, UV-Vis-NIR spectroscopy and thermogravimetrical analysis. The maximum achieved concentration of SWNTs dispersed in water when wrapped with single-stranded DNA (ss-DNA) was of 400 mg/l.

  8. Novel Circular Single-Stranded DNA Viruses among an Asteroid, Echinoid and Holothurian (Phylum: Echinodermata)

    Science.gov (United States)

    Jackson, Elliot W.; Bistolas, Kalia S. I.; Button, Jason B.; Hewson, Ian

    2016-01-01

    Echinoderms are prone to large population fluctuations that can be mediated by pervasive disease events. For the majority of echinoderm disease events the causative pathogen is unknown. Viruses have only recently been explored as potential pathogens using culture-independent techniques though little information currently exists on echinoderm viruses. In this study, ten circular ssDNA viruses were discovered in tissues among an asteroid (Asterias forbesi), an echinoid (Strongylocentrotus droebachiensis) and a holothurian (Parastichopus californicus) using viral metagenomics. Genome architecture and sequence similarity place these viruses among the rapidly expanding circular rep-encoding single stranded (CRESS) DNA viral group. Multiple genomes from the same tissue were no more similar in sequence identity to each other than when compared to other known CRESS DNA viruses. The results from this study are the first to describe a virus from a holothurian and continue to show the ubiquity of these viruses among aquatic invertebrates. PMID:27855181

  9. Molecular recognition of single-stranded RNA: neomycin binding to poly(A).

    Science.gov (United States)

    Xi, Hongjuan; Gray, David; Kumar, Sunil; Arya, Dev P

    2009-07-01

    Poly(A) is a relevant sequence in cell biology due to its importance in mRNA stability and translation initiation. Neomycin is an aminoglycoside antibiotic that is well known for its ability to target various nucleic acid structures. Here it is reported that neomycin is capable of binding tightly to a single-stranded oligonucleotide (A(30)) with a K(d) in the micromolar range. CD melting experiments support complex formation and indicate a melting temperature of 47 degrees C. The poly(A) duplex, which melts at 44 degrees C (pH 5.5), was observed to melt at 61 degrees C in the presence of neomycin, suggesting a strong stabilization of the duplex by the neomycin.

  10. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species

    Directory of Open Access Journals (Sweden)

    Alice Jernigan

    2015-01-01

    Full Text Available Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green and eukaryotic (green and brown algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis, five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata, and one brown algae (Ectocarpus sp. were examined and CE-SSCP electropherogram “fingerprints” were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  11. Bacterial single-stranded DNA-binding proteins are phosphorylated on tyrosine

    DEFF Research Database (Denmark)

    Mijakovic, Ivan; Petranovic, Dina; Macek, B

    2006-01-01

    Single-stranded DNA-binding proteins (SSBs) are required for repair, recombination and replication in all organisms. Eukaryotic SSBs are regulated by phosphorylation on serine and threonine residues. To our knowledge, phosphorylation of SSBs in bacteria has not been reported. A systematic search...... for phosphotyrosine-containing proteins in Streptomyces griseus by immunoaffinity chromatography identified bacterial SSBs as a novel target of bacterial tyrosine kinases. Since genes encoding protein-tyrosine kinases (PTKs) have not been recognized in streptomycetes, and SSBs from Streptomyces coelicolor (Sc......SSB) and Bacillus subtilis (BsSSB) share 38.7% identity, we used a B.subtilis protein-tyrosine kinase YwqD to phosphorylate two cognate SSBs (BsSSB and YwpH) in vitro. We demonstrate that in vivo phosphorylation of B.subtilis SSB occurs on tyrosine residue 82, and this reaction is affected antagonistically...

  12. A novel single-stranded DNA detection method based on organic semiconductor heterojunction

    Science.gov (United States)

    Gu, Wen; Liu, Hongbo; Zhang, Xia; Zhang, Hao; Chen, Xiong; Wang, Jun

    2016-12-01

    We demonstrate a novel DNA detection method with low-cost and disposable advantages by utilizing F16CuPc/CuPc planar organic heterojunction device. Single-stranded DNA (ssDNA) molecules have been well immobilized on the surface of CuPc film observed by atomic force microscopy, producing an obvious electrical response of the device. The conductivity of the organic heterojunction film was significantly increased by ssDNA immobilization because ssDNA molecules brought additional positive charges at heterojunction interface. Furthermore, the thickness dependence of CuPc upper layer on the electrical response was studied to optimize the sensitivity. This study will be helpful for the development of organic heterojunction based biosensors.

  13. Capillary Electrophoresis Single-Strand Conformational Polymorphisms as a Method to Differentiate Algal Species.

    Science.gov (United States)

    Jernigan, Alice; Hestekin, Christa

    2015-01-01

    Capillary electrophoresis single-strand conformational polymorphism (CE-SSCP) was explored as a fast and inexpensive method to differentiate both prokaryotic (blue-green) and eukaryotic (green and brown) algae. A selection of two blue-green algae (Nostoc muscorum and Anabaena inaequalis), five green algae (Chlorella vulgaris, Oedogonium foveolatum, Mougeotia sp., Scenedesmus quadricauda, and Ulothrix fimbriata), and one brown algae (Ectocarpus sp.) were examined and CE-SSCP electropherogram "fingerprints" were compared to each other for two variable regions of either the 16S or 18S rDNA gene. The electropherogram patterns were remarkably stable and consistent for each particular species. The patterns were unique to each species, although some common features were observed between the different types of algae. CE-SSCP could be a useful method for monitoring changes in an algae species over time as potential shifts in species occurred.

  14. Amplification methods bias metagenomic libraries of uncultured single-stranded and double-stranded DNA viruses.

    Science.gov (United States)

    Kim, Kyoung-Ho; Bae, Jin-Woo

    2011-11-01

    Investigation of viruses in the environment often requires the amplification of viral DNA before sequencing of viral metagenomes. In this study, two of the most widely used amplification methods, the linker amplified shotgun library (LASL) and multiple displacement amplification (MDA) methods, were applied to a sample from the seawater surface. Viral DNA was extracted from viruses concentrated by tangential flow filtration and amplified by these two methods. 454 pyrosequencing was used to read the metagenomic sequences from different libraries. The resulting taxonomic classifications of the viruses, their functional assignments, and assembly patterns differed substantially depending on the amplification method. Only double-stranded DNA viruses were retrieved from the LASL, whereas most sequences in the MDA library were from single-stranded DNA viruses, and double-stranded DNA viral sequences were minorities. Thus, the two amplification methods reveal different aspects of viral diversity.

  15. Aeromonas detection and characterization using genus-specific PCR and single-strand conformation polymorphism (SSCP).

    Science.gov (United States)

    Delamare, Ana Paula Longaray; Lucena, Roberto Francisco; Thomazi, Guilherme; Ferrarini, Shana; Zacaria, Jucimar; Echeverrigaray, Sergio

    2012-10-01

    Based on sequence alignment, oligonucleotide primers targeting the Aeromonas extracellular lipase gene were developed for PCR detection of member of the genus. A pair of primers designed for conserved regions of the gene amplified a 276 bp sequence in all Aeromonas species and tested strains, but did not have a positive result with other Gram-positive and Gram-negative bacteria, showing high specificity and sensitivity. Selective enrichment in alkaline peptone water, followed by centrifugation, and direct usage of cells suspension as template, detected initial populations of 10 c.f.u. ml⁻¹. Single-strand conformation polymorphism analysis of the PCR products allowed the characterization of Aeromonas strains with a high discriminatory power (Simpson's index = 0.988). The method presented here provides a useful tool for the rapid detection of Aeromonas and the characterization of Aeromonas isolates.

  16. Single-strand recombination signal sequence nicks in vivo: evidence for a capture model of synapsis.

    Science.gov (United States)

    Curry, John D; Geier, Jamie K; Schlissel, Mark S

    2005-12-01

    Variable (diversity) joining (V(D)J) recombination is initiated by the introduction of single-strand DNA breaks (nicks) at recombination signal sequences (RSSs). The importance and fate of these RSS nicks for the regulation of the V(D)J rearrangement and their potential contribution to genomic instability are poorly understood. Using two new methodologies, we were able to detect and quantify specific RSS nicks introduced into genomic DNA by incubation with recombination-activating gene proteins in vitro. In vivo, however, we found that nicks mediated by recombination-activating gene (RAG) proteins were detectable only in gene segments associated with RSSs containing 12-base pair spacers but not in those containing 23-base pair spacers. These data support a model of capture rather than synapsis for pairwise RSS cleavage during V(D)J recombination.

  17. New insights on single-stranded versus double-stranded DNA library preparation for ancient DNA.

    Science.gov (United States)

    Wales, Nathan; Carøe, Christian; Sandoval-Velasco, Marcela; Gamba, Cristina; Barnett, Ross; Samaniego, José Alfredo; Madrigal, Jazmín Ramos; Orlando, Ludovic; Gilbert, M Thomas P

    2015-12-01

    An innovative single-stranded DNA (ssDNA) library preparation method has sparked great interest among ancient DNA (aDNA) researchers, especially after reports of endogenous DNA content increases >20-fold in some samples. To investigate the behavior of this method, we generated ssDNA and conventional double-stranded DNA (dsDNA) libraries from 23 ancient and historic plant and animal specimens. We found ssDNA library preparation substantially increased endogenous content when dsDNA libraries contained DNA, but this enrichment is less pronounced when dsDNA preparations successfully recover short endogenous DNA fragments (mean size < 70 bp). Our findings can help researchers determine when to utilize the time- and resource-intensive ssDNA library preparation method.

  18. The HSV-1 exonuclease, UL12, stimulates recombination by a single strand annealing mechanism.

    Science.gov (United States)

    Schumacher, April J; Mohni, Kareem N; Kan, Yinan; Hendrickson, Eric A; Stark, Jeremy M; Weller, Sandra K

    2012-01-01

    Production of concatemeric DNA is an essential step during HSV infection, as the packaging machinery must recognize longer-than-unit-length concatemers; however, the mechanism by which they are formed is poorly understood. Although it has been proposed that the viral genome circularizes and rolling circle replication leads to the formation of concatemers, several lines of evidence suggest that HSV DNA replication involves recombination-dependent replication reminiscent of bacteriophages λ and T4. Similar to λ, HSV-1 encodes a 5'-to-3' exonuclease (UL12) and a single strand annealing protein [SSAP (ICP8)] that interact with each other and can perform strand exchange in vitro. By analogy with λ phage, HSV may utilize viral and/or cellular recombination proteins during DNA replication. At least four double strand break repair pathways are present in eukaryotic cells, and HSV-1 is known to manipulate several components of these pathways. Chromosomally integrated reporter assays were used to measure the repair of double strand breaks in HSV-infected cells. Single strand annealing (SSA) was increased in HSV-infected cells, while homologous recombination (HR), non-homologous end joining (NHEJ) and alternative non-homologous end joining (A-NHEJ) were decreased. The increase in SSA was abolished when cells were infected with a viral mutant lacking UL12. Moreover, expression of UL12 alone caused an increase in SSA, which was completely eliminated when a UL12 mutant lacking exonuclease activity was expressed. UL12-mediated stimulation of SSA was decreased in cells lacking the cellular SSAP, Rad52, and could be restored by coexpressing the viral SSAP, ICP8, indicating that an SSAP is also required. These results demonstrate that UL12 can specifically stimulate SSA and that either ICP8 or Rad52 can function as an SSAP. We suggest that SSA is the homology-mediated repair pathway utilized during HSV infection.

  19. The HSV-1 exonuclease, UL12, stimulates recombination by a single strand annealing mechanism.

    Directory of Open Access Journals (Sweden)

    April J Schumacher

    Full Text Available Production of concatemeric DNA is an essential step during HSV infection, as the packaging machinery must recognize longer-than-unit-length concatemers; however, the mechanism by which they are formed is poorly understood. Although it has been proposed that the viral genome circularizes and rolling circle replication leads to the formation of concatemers, several lines of evidence suggest that HSV DNA replication involves recombination-dependent replication reminiscent of bacteriophages λ and T4. Similar to λ, HSV-1 encodes a 5'-to-3' exonuclease (UL12 and a single strand annealing protein [SSAP (ICP8] that interact with each other and can perform strand exchange in vitro. By analogy with λ phage, HSV may utilize viral and/or cellular recombination proteins during DNA replication. At least four double strand break repair pathways are present in eukaryotic cells, and HSV-1 is known to manipulate several components of these pathways. Chromosomally integrated reporter assays were used to measure the repair of double strand breaks in HSV-infected cells. Single strand annealing (SSA was increased in HSV-infected cells, while homologous recombination (HR, non-homologous end joining (NHEJ and alternative non-homologous end joining (A-NHEJ were decreased. The increase in SSA was abolished when cells were infected with a viral mutant lacking UL12. Moreover, expression of UL12 alone caused an increase in SSA, which was completely eliminated when a UL12 mutant lacking exonuclease activity was expressed. UL12-mediated stimulation of SSA was decreased in cells lacking the cellular SSAP, Rad52, and could be restored by coexpressing the viral SSAP, ICP8, indicating that an SSAP is also required. These results demonstrate that UL12 can specifically stimulate SSA and that either ICP8 or Rad52 can function as an SSAP. We suggest that SSA is the homology-mediated repair pathway utilized during HSV infection.

  20. Tying up the Ends: Plasticity in the Recognition of Single-Stranded DNA at Telomeres.

    Science.gov (United States)

    Lloyd, Neil R; Dickey, Thayne H; Hom, Robert A; Wuttke, Deborah S

    2016-09-27

    Telomeres terminate nearly exclusively in single-stranded DNA (ssDNA) overhangs comprised of the G-rich 3' end. This overhang varies widely in length from species to species, ranging from just a few bases to several hundred nucleotides. These overhangs are not merely a remnant of DNA replication but rather are the result of complex further processing. Proper management of the telomeric overhang is required both to deter the action of the DNA damage machinery and to present the ends properly to the replicative enzyme telomerase. This Current Topic addresses the biochemical and structural features used by the proteins that manage these variable telomeric overhangs. The Pot1 protein tightly binds the single-stranded overhang, preventing DNA damage sensors from binding. Pot1 also orchestrates the access of telomerase to that same substrate. The remarkable plasticity of the binding interface exhibited by the Schizosaccharomyces pombe Pot1 provides mechanistic insight into how these roles may be accomplished, and disease-associated mutations clustered around the DNA-binding interface in the hPOT1 highlight the importance of this function. The budding yeast Cdc13-Stn1-Ten1, a telomeric RPA complex closely associated with telomere function, also interacts with ssDNA in a fashion that allows degenerate sequences to be recognized. A related human complex composed of hCTC1, hSTN1, and hTEN1 has recently emerged with links to both telomere maintenance and general DNA replication and also exhibits mutations associated with telomere pathologies. Overall, these sequence-specific ssDNA binders exhibit a range of recognition properties that allow them to perform their unique biological functions.

  1. Accurate quantification of microRNA via single strand displacement reaction on DNA origami motif.

    Directory of Open Access Journals (Sweden)

    Jie Zhu

    Full Text Available DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs.

  2. Accurate Quantification of microRNA via Single Strand Displacement Reaction on DNA Origami Motif

    Science.gov (United States)

    Lou, Jingyu; Li, Weidong; Li, Sheng; Zhu, Hongxin; Yang, Lun; Zhang, Aiping; He, Lin; Li, Can

    2013-01-01

    DNA origami is an emerging technology that assembles hundreds of staple strands and one single-strand DNA into certain nanopattern. It has been widely used in various fields including detection of biological molecules such as DNA, RNA and proteins. MicroRNAs (miRNAs) play important roles in post-transcriptional gene repression as well as many other biological processes such as cell growth and differentiation. Alterations of miRNAs' expression contribute to many human diseases. However, it is still a challenge to quantitatively detect miRNAs by origami technology. In this study, we developed a novel approach based on streptavidin and quantum dots binding complex (STV-QDs) labeled single strand displacement reaction on DNA origami to quantitatively detect the concentration of miRNAs. We illustrated a linear relationship between the concentration of an exemplary miRNA as miRNA-133 and the STV-QDs hybridization efficiency; the results demonstrated that it is an accurate nano-scale miRNA quantifier motif. In addition, both symmetrical rectangular motif and asymmetrical China-map motif were tested. With significant linearity in both motifs, our experiments suggested that DNA Origami motif with arbitrary shape can be utilized in this method. Since this DNA origami-based method we developed owns the unique advantages of simple, time-and-material-saving, potentially multi-targets testing in one motif and relatively accurate for certain impurity samples as counted directly by atomic force microscopy rather than fluorescence signal detection, it may be widely used in quantification of miRNAs. PMID:23990889

  3. Classification of Mycoplasma synoviae strains using single-strand conformation polymorphism and high-resolution melting-curve analysis of the vlhA gene single-copy region.

    Science.gov (United States)

    Jeffery, Nathan; Gasser, Robin B; Steer, Penelope A; Noormohammadi, Amir H

    2007-08-01

    Mycoplasma synoviae is an economically important pathogen of poultry worldwide, causing respiratory infection and synovitis in chickens and turkeys. Identification of M. synoviae isolates is of critical importance, particularly in countries in which poultry flocks are vaccinated with the live attenuated M. synoviae strain MS-H. Using oligonucleotide primers complementary to the single-copy conserved 5' end of the variable lipoprotein and haemagglutinin gene (vlhA), amplicons of approximately 400 bp were generated from 35 different M. synoviae strains/isolates from chickens and subjected to mutation scanning analysis. Analysis of the amplicons by single-strand conformation polymorphism (SSCP) revealed 10 distinct profiles (A-J). Sequencing of the amplicons representing these profiles revealed that each profile related to a unique sequence, some differing from each other by only one base-pair substitution. Comparative high-resolution melting (HRM) curve analysis of the amplicons using SYTO 9 green fluorescent dye also displayed profiles which were concordant with the same 10 SSCP profiles (A-J) and their sequences. For both mutation detection methods, the Australian M. synoviae strains represented one of the A, B, C or D profiles, while the USA strains represented one of the E, F, G, H, I or J profiles. The results presented in this study show that the PCR-based SSCP or HRM curve analyses of vlhA provide high-resolution mutation detection tools for the detection and identification of M. synoviae strains. In particular, the HRM curve analysis is a rapid and effective technique which can be performed in a single test tube in less than 2 h.

  4. The single-stranded DNA-binding protein of Deinococcus radiodurans

    Directory of Open Access Journals (Sweden)

    Wood Elizabeth

    2004-01-01

    Full Text Available Abstract Background Deinococcus radiodurans R1 is one of the most radiation-resistant organisms known and is able to repair an unusually large amount of DNA damage without induced mutation. Single-stranded DNA-binding (SSB protein is an essential protein in all organisms and is involved in DNA replication, recombination and repair. The published genomic sequence from Deinococcus radiodurans includes a putative single-stranded DNA-binding protein gene (ssb; DR0100 requiring a translational frameshift for synthesis of a complete SSB protein. The apparently tripartite gene has inspired considerable speculation in the literature about potentially novel frameshifting or RNA editing mechanisms. Immediately upstream of the ssb gene is another gene (DR0099 given an ssb-like annotation, but left unexplored. Results A segment of the Deinococcus radiodurans strain R1 genome encompassing the ssb gene has been re-sequenced, and two errors involving omitted guanine nucleotides have been documented. The corrected sequence incorporates both of the open reading frames designated DR0099 and DR0100 into one contiguous ssb open reading frame (ORF. The corrected gene requires no translational frameshifts and contains two predicted oligonucleotide/oligosaccharide-binding (OB folds. The protein has been purified and its sequence is closely related to the Thermus thermophilus and Thermus aquaticus SSB proteins. Like the Thermus SSB proteins, the SSBDr functions as a homodimer. The Deinococcus radiodurans SSB homodimer stimulates Deinococcus radiodurans RecA protein and Escherichia coli RecA protein-promoted DNA three-strand exchange reactions with at least the same efficiency as the Escherichia coli SSB homotetramer. Conclusions The correct Deinococcus radiodurans ssb gene is a contiguous open reading frame that codes for the largest bacterial SSB monomer identified to date. The Deinococcus radiodurans SSB protein includes two OB folds per monomer and functions as a

  5. Single-molecule elasticity of single-stranded DNA, a model flexible polyelectrolyte

    Science.gov (United States)

    McIntosh, Dustin B.

    Understanding the structure of unfolded, flexible polyelectrolytes is important for our comprehension of basic processes in molecular biology (e.g., RNA and protein folding) and our ability to exploit the polymers in technology (e.g., in self-assembled nanostructures). Here, we investigate the structure of single single-stranded DNA molecules and their interactions with ions using magnetic tweezers. Our data reveal that single-stranded DNA is not well-described by ideal polymer models such as the Worm-Like Chain. At low force, we report the first experimental observation of a nonlinear elastic regime revealing the relevance of long-range excluded volume effects. At high force, the extension scales as a logarithm in monovalent salt. Molecular dynamics simulations indicate that this logarithmic regime is the result of ion-stabilized wrinkles at short-length scales along the polymer backbone. Addition of divalent salt to the buffer results in enhanced elasticity indicating increased wrinkling or polymer ''wrapping" around the divalent ions. Using a thermodynamic identity, we are able to count ions as they are released into the bulk upon polymer elongation. We find that ssDNA releases significantly more ions than dsDNA. We posit that the recently termed ''Snake-Like Chain" model (Ullner, J. Phys. Chem B (2003)) for flexible polyelectrolytes may explain these observations. As a first step towards characterizing biologically relevant nucleic acid structures, we measure the effects of base-stacking on ssDNA elasticity. We find that base-stacking in poly(dA) significantly enhances the rigidity of the polymer as evidenced by the low-force elasticity. The unstacking transition of poly(dA) at high force reveals that the intrinsic electrostatic tension on the molecule varies significantly more weakly on salt concentration than predictions from mean-field models. Further, we provide a model-independent estimate of the free energy difference between stacked and unstacked nucleic

  6. Distinct spatiotemporal patterns and PARP dependence of XRCC1 recruitment to single-strand break and base excision repair

    NARCIS (Netherlands)

    A. Campalans (Anna); R. Amouroux (Rachel); H. Menoni (Hervé); W. Vermeulen (Wim); J.P. Radicella (Pablo)

    2013-01-01

    textabstractSingle-strand break repair (SSBR) and base excision repair (BER) of modified bases and abasic sites share several players. Among them is XRCC1, an essential scaffold protein with no enzymatic activity, required for the coordination of both pathways. XRCC1 is recruited to SSBR by PARP-1,

  7. Markers of Decompression Stress of Mass Stranded/Live Caught and Released vs. Single Stranded Marine Mammals

    Science.gov (United States)

    2014-09-30

    1 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. Markers of Decompression Stress of Mass Stranded /Live...Caught and Released vs. Single Stranded Marine Mammals Michael Moore Biology Department Woods Hole Oceanographic Institution Woods Hole, MA 02543...analyze blood samples from captive, wild-caught, and stranded marine mammals in order to compare concentrations of Microparticles (MPs). If confirmed

  8. The binding of in vitro synthesized adenovirus DNA binding protein to single-stranded DNA is stimulated by zinc ions

    NARCIS (Netherlands)

    Vos, H.L.; Lee, F.M. van der; Sussenbach, J.S.

    1988-01-01

    We have synthesized wild type DNA binding protein (DBP) of adenovirus type 5 (Ad5) and several truncated forms of this protein by a combination of in vitro transcription and translation. The proteins obtained were tested for binding to a single-stranded DNA-cellulose column. It could be shown that f

  9. Single-stranded DNA bound to bacterial cold-shock proteins: preliminary crystallographic and Raman analysis.

    Science.gov (United States)

    Bienert, Ralf; Zeeb, Markus; Dostál, Lubomir; Feske, Anette; Magg, Christine; Max, Klaas; Welfle, Heinz; Balbach, Jochen; Heinemann, Udo

    2004-04-01

    The cold-shock response has been described for several bacterial species. It is characterized by distinct changes in intracellular protein patterns whereby a set of cold-shock-inducible proteins become abundant. The major cold-shock proteins of Bacillus subtilis (Bs-CspB) and Bacillus caldolyticus (Bc-Csp) are small oligonucleotide/oligosaccharide-binding (OB) fold proteins that have been described as binding single-stranded nucleic acids. Bs-CspB (Mr = 7365) and Bc-Csp (Mr = 7333) were crystallized in the presence of the deoxyhexanucleotide (dT)6. Crystals of (dT)6 with Bs-CspB grew in the orthorhombic space group C222(1), with unit-cell parameters a = 49.0, b = 53.2, c = 77.0 A. Crystals with Bc-Csp grew in the primitive orthorhombic space group P2(1)2(1)2, with unit-cell parameters a = 74.3, b = 64.9, c = 31.2 A. These crystals diffract to maximal resolutions of 1.78 and 1.29 A, respectively. The presence of protein and DNA in the crystals was demonstrated by Raman spectroscopy.

  10. Genetic spell-checking: gene editing using single-stranded DNA oligonucleotides.

    Science.gov (United States)

    Rivera-Torres, Natalia; Kmiec, Eric B

    2016-02-01

    Single-stranded oligonucleotides (ssODNs) can be used to direct the exchange of a single nucleotide or the repair of a single base within the coding region of a gene in a process that is known, generically, as gene editing. These molecules are composed of either all DNA residues or a mixture of RNA and DNA bases and utilize inherent metabolic functions to execute the genetic alteration within the context of a chromosome. The mechanism of action of gene editing is now being elucidated as well as an understanding of its regulatory circuitry, work that has been particularly important in establishing a foundation for designing effective gene editing strategies in plants. Double-strand DNA breakage and the activation of the DNA damage response pathway play key roles in determining the frequency with which gene editing activity takes place. Cellular regulators respond to such damage and their action impacts the success or failure of a particular nucleotide exchange reaction. A consequence of such activation is the natural slowing of replication fork progression, which naturally creates a more open chromatin configuration, thereby increasing access of the oligonucleotide to the DNA template. Herein, how critical reaction parameters influence the effectiveness of gene editing is discussed. Functional interrelationships between DNA damage, the activation of DNA response pathways and the stalling of replication forks are presented in detail as potential targets for increasing the frequency of gene editing by ssODNs in plants and plant cells.

  11. Precise gene modification mediated by TALEN and single-stranded oligodeoxynucleotides in human cells.

    Directory of Open Access Journals (Sweden)

    Xiaoling Wang

    Full Text Available The development of human embryonic stem cells (ESCs and induced pluripotent stem cells (iPSCs facilitates in vitro studies of human disease mechanisms, speeds up the process of drug screening, and raises the feasibility of using cell replacement therapy in clinics. However, the study of genotype-phenotype relationships in ESCs or iPSCs is hampered by the low efficiency of site-specific gene editing. Transcription activator-like effector nucleases (TALENs spurred interest due to the ease of assembly, high efficiency and faithful gene targeting. In this study, we optimized the TALEN design to maximize its genomic cutting efficiency. We showed that using optimized TALENs in conjunction with single-strand oligodeoxynucleotide (ssODN allowed efficient gene editing in human cells. Gene mutations and gene deletions for up to 7.8 kb can be accomplished at high efficiencies. We established human tumor cell lines and H9 ESC lines with homozygous deletion of the microRNA-21 (miR-21 gene and miR-9-2 gene. These cell lines provide a robust platform to dissect the roles these genes play during cell differentiation and tumorigenesis. We also observed that the endogenous homologous chromosome can serve as a donor template for gene editing. Overall, our studies demonstrate the versatility of using ssODN and TALEN to establish genetically modified cells for research and therapeutic application.

  12. In vitro selection of a single-stranded DNA molecular recognition element against atrazine.

    Science.gov (United States)

    Williams, Ryan M; Crihfield, Cassandra L; Gattu, Srikanth; Holland, Lisa A; Sooter, Letha J

    2014-08-18

    Widespread use of the chlorotriazine herbicide, atrazine, has led to serious environmental and human health consequences. Current methods of detecting atrazine contamination are neither rapid nor cost-effective. In this work, atrazine-specific single-stranded DNA (ssDNA) molecular recognition elements (MRE) were isolated. We utilized a stringent Systematic Evolution of Ligands by Exponential Enrichment (SELEX) methodology that placed the greatest emphasis on what the MRE should not bind to. After twelve rounds of SELEX, an atrazine-specific MRE with high affinity was obtained. The equilibrium dissociation constant (Kd) of the ssDNA sequence is 0.62 ± 0.21 nM. It also has significant selectivity for atrazine over atrazine metabolites and other pesticides found in environmentally similar locations and concentrations. Furthermore, we have detected environmentally relevant atrazine concentrations in river water using this MRE. The strong affinity and selectivity of the selected atrazine-specific ssDNA validated the stringent SELEX methodology and identified a MRE that will be useful for rapid atrazine detection in environmental samples.

  13. Single strand conformation polymorphism (SSCP detection in six genes in Portuguese indigenous sheep breed

    Directory of Open Access Journals (Sweden)

    Guedes-Pinto H.

    2001-01-01

    Full Text Available Evaluation of the genetic diversity for six genes in forty animals of the Portuguese indigenous sheep breed (Ovis aries ""Churra da Terra Quente"" was done. A non-radioactive method to allow single-strand conformation polymorphism (SSCP detection was optimised, starting from genomic DNA and PCR amplification of seven fragments: exon 1 of the alpha-lactalbumin gene; exons 10 and 11 of the alpha s1-casein gene; exon 7 of the beta-casein gene; exon 4 of the kappa-casein gene; exons 4 and 5 of the growth hormone gene and exon 6 of the growth hormone receptor gene. Polymorphisms were detected in five of the seven PCR products. Only kappa-casein and growth hormone receptor were monomorphic. Alpha-lactalbumin and alpha s1-casein exons showed three conformational patterns, beta-casein and growth hormone exon 4 showed two electrophoretic patterns and growth hormone exon 5 showed five conformational patterns. These data provide evidence that ""Churra da Terra Quente"" has a high genetic variability, which opens interesting prospects for future selection programs and also for preservation strategies. Also, our data show that PCR-SSCP is an appropriate tool for evaluating genetic variability.

  14. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism.

    Science.gov (United States)

    Srinivasa, Chandrashekar; Sharanaiah, Umesha; Shivamallu, Chandan

    2012-03-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens. Ralstonia solanacearum, Xanthomoans axonopodis pv. vesicatoria, and Xanthomonas oryzae pv. oryzae are phytopathogenic bacteria, which can infect vegetables, cause severe yield loss. PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA. The technique of PCR-SSCP is being exploited so far, only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi. Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials. In this study, we developed PCR-SSCP technique to identify phytopathogenic bacteria. The PCR product was denatured and separated on a non-denaturing polyacrylamide gel. SSCP banding patterns were detected by silver staining of nucleic acids. We tested over 56 isolates of R. solanacearum, 44 isolates of X. axonopodis pv. vesicatoria, and 20 isolates of X. oryzae pv. oryzae. With the use of universal primer 16S rRNA, we could discriminate such species at the genus and species levels. Species-specific patterns were obtained for bacteria R. solanacearum, X. axonopodis pv. vesicatoria, and X. oryzae pv. oryzae. The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  15. Plant somatic hybrid cytoplasmic DNA characterization by single-strand conformation polymorphism.

    Science.gov (United States)

    Olivares-Fuster, Oscar; Hernández-Garrido, María; Guerri, José; Navarro, Luis

    2007-06-01

    Unlike maternal inheritance in sexual hybridization, plant somatic hybridization allows transfer, mixing and recombination of cytoplasmic genomes. In addition to the use of somatic hybridization in plant breeding programs, application of this unique tool should lead to a better understanding of the roles played by the chloroplastic and mitochondrial genomes in determining agronomically important traits. The nucleotide sequences of cytoplasmic genomes are much more conserved than those of nuclear genomes. Cytoplasmic DNA composition in somatic hybrids is commonly elucidated either by length polymorphism analysis of restricted genome regions amplified with universal primers (PCR-RF) or by hybridization of total DNA using universal cytoplasmic probes. In this study, we demonstrate that single-stranded conformational polymorphism (SSCP) analysis is a powerful, quick and easy alternative method for cytoplasmic DNA characterization of somatic hybrids, especially for mitochondrial DNA. The technique allows detection of polymorphisms based on both size and sequence of amplified targets. Twenty-two species of the subfamily Aurantioideae were analyzed with eight universal primers (four from chloroplastic and four from mitochondrial regions). Differences in chloroplastic DNA composition were scored in 98% of all possible two-parent combinations, and different mitochondrial DNA profiles were found in 87% of them. Analysis by SSCP was also successfully used to characterize somatic hybrids and cybrids obtained by fusion of Citrus sinensis (L.) Osb. and C. excelsa Wester protoplasts.

  16. Screening for haplotypic variability within Oesophagostomum bifurcum (Nematoda) employing a single-strand conformation polymorphism approach.

    Science.gov (United States)

    de Gruijter, J M; Polderman, A M; Zhu, X Q; Gasser, R B

    2002-06-01

    Genetic markers in the mitochondrial genome have proven useful for population genetic studies because of their maternal inheritance and relatively high evolutionary rates. In this study, we exploited the high resolution capacity of PCR-coupled single-strand conformation polymorphism (SSCP) to screen for sequence variation in part of the cytochrome c oxidase subunit 1 gene (p cox 1) among individuals of the parasitic nematode, Oesophagostomum bifurcum from human or Mona monkey hosts from Africa. SSCP analysis revealed distinct profiles among some of the individuals, and subsequent sequence analysis of representative samples defined 10 different haplotypes. For comparative purposes, the p cox 1 sequences for representatives of four other species of Oesophagostomum from livestock were included. While there were high levels (11.5-13.7%) of sequence difference among the latter species, there was no fixed nucleotide difference between O. bifurcum individuals from humans and those from monkeys. The data support the proposal that O. bifurcum from the two primate hosts represents a single species and that the haplotypic variability in p cox 1 represents population variation. The results reinforce the usefulness of the SSCP-sequencing approach for studying genetic variation in nematode populations using mitochondrial markers.

  17. Profiling the diversity of microbial communities with single-strand conformation polymorphism (SSCP).

    Science.gov (United States)

    Schmalenberger, Achim; Tebbe, Christoph C

    2014-01-01

    Genetic fingerprinting techniques for microbial community analysis have evolved over the last decade into standard applications for efficient and fast differentiation of microbial communities based on their diversity. These techniques commonly analyze the diversity of PCR products amplified from extracted environmental DNA usually utilizing primers hybridizing to suspected conserved regions of the targeted genes. In comparison to the more commonly applied terminal restriction fragment length polymorphism (TRFLP) or denaturing gradient gel electrophoresis (DGGE) techniques, the here-described single-strand conformation polymorphism (SSCP) fingerprinting technique features some advantageous key characteristics. (1) Primers for the polymerase chain reaction (PCR) do only need minimal 5'-end alterations; (2) SSCP is adaptable to high throughput applications in automated sequencers; and (3) a second dimension in the SSCP gel electrophoresis can be implemented to obtain high resolution 2D gels. One central key requirement for SSCP gel electrophoresis is a tight temperature control. Gels that run at different temperatures will produce entirely different fingerprints. This can be exploited for an improved analysis of highly diverse communities by running the same template at different temperatures or by 2D-SSCP gel electrophoresis.

  18. Capillary electrophoresis single-strand conformation polymorphism for the monitoring of gastrointestinal microbiota of chicken flocks.

    Science.gov (United States)

    Pissavin, C; Burel, C; Gabriel, I; Beven, V; Mallet, S; Maurice, R; Queguiner, M; Lessire, M; Fravalo, P

    2012-09-01

    The objective of the present study was to evaluate the capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) to characterize poultry gut microbiota and the ability of this molecular method to detect modifications related to rearing conditions to be used as an epidemiological tool. The V3 region of the 16S rRNA gene was selected as the PCR target. Our results showed that this method provides reproducible data. The microbiota analysis of individuals showed that variability between individual fingerprints was higher for ileum and cloaca than for ceca. However, pooling the samples decreased this variability. To estimate the variability within and between farms, we compared molecular gut patterns of animals from the same hatchery reared under similar conditions and fed the same diet in 2 separate farms. Total aerobic bacteria, coliforms, and lactic acid bacteria were enumerated using conventional bacteriological methods. A significant difference was observed for coliforms present in the ceca and the cloaca depending on the farm. Ileal contents fingerprints were more closely related to those of cloacal contents than to those of ceca contents. When comparing samples from the 2 farms, a specific microbiota was highlighted for each farm. For each gut compartment, the microbiota fingerprints were joined in clusters according to the farm. Thus, this rapid and potentially high-throughput method to obtain gut flora fingerprints is sensitive enough to detect a "farm effect" on the balance of poultry gut microbiota despite the birds being fed the same regimens and reared under similar conditions.

  19. Single-strand conformation polymorphism analysis of genetic variation in Labiostrongylus longispicularis from kangaroos.

    Science.gov (United States)

    Huby-Chilton, F; Beveridge, I; Gasser, R B; Chilton, N B

    2001-06-01

    Single-strand conformation polymorphism (SSCP) analysis was employed to screen for sequence heterogeneity in the second internal transcribed spacer (ITS-2) of ribosomal (r) DNA of Labiostrongylus longispicularis, a parasitic strongylid nematode occuring in some species of kangaroo in different geographical regions of Australia. The results showed that most of the nematodes screened had different SSCP profiles, which were subsequently shown to correspond to polymorphisms and/or an indel in the ITS-2 sequence. These variable sites related mainly to unpaired regions of the predicted secondary structure of the precursor rRNA molecule. SSCP profiles could be used to distinguish L. longispicularis in Macropus robustus robustus (New South Wales) from L. longispicularis in Macropus robustus erubescens and Macropus rufus (South Australia). This difference corresponded to a transversional change in the ITS-2 sequence at alignment position 82. The study demonstrated clearly the effectiveness of SSCP analysis for future large-scale population genetic studies of L. longispicularis in order to test the hypothesis that L. longispicularis from different geographical regions represents multiple sibling species.

  20. Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism.

    Science.gov (United States)

    Souza, M T; Carvalho-Zilse, G A

    2014-07-25

    In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species.

  1. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism

    Institute of Scientific and Technical Information of China (English)

    Chandrashekar Srinivasa; Umesha Sharanaiah; Chandan Shivamallu

    2012-01-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens.Ralstonia solanacearum,Xanthomoans axonopodis pv.vesicatoria,and Xanthomonas oryzae pv.oryzae are phytopathogenic bacteria,which can infect vegetables,cause severe yield loss.PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA.The technique of PCR-SSCP is being exploited so far,only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi.Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials.In this study,we developed PCR-SSCP technique to identify phytopathogenic bacteria.The PCR product was denatured and separated on a non-denaturing polyacrylamide gel.SSCP banding patterns were detected by silver staining of nucleic acids.We tested over 56 isolates of R. solanacearum,44 isolates of X. axonopodis pv.vesicatoria,and 20 isolates of X.oryzae pv.oryzae.With the use of universal primer 16S rRNA,we could discriminate such species at the genus and species levels.Speciesspecific patterns were obtained for bacteria R.solanacearum,X.axonopodis pv.vesicatoria,and X.oryzae pv.oryzae.The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  2. AFLP and single-strand conformation polymorphism studies of recombination in the entomopathogenic fungus Nomuraea rileyi.

    Science.gov (United States)

    Devi, Uma K; Reineke, Annette; Rao, Uma C Maheswara; Reddy, Nageswara Rao N; Khan, Akbar P Ali

    2007-06-01

    In most putative asexual fungi analysed through population genetic studies, recombination has been detected. However, the mechanism by which it is achieved is still not known. A parasexual cycle is known to occur in asexual fungi but there is no evidence, as yet, of its prevalence in natural populations. This study was undertaken to investigate the possibility of a parasexual cycle mediating recombination in the mitosporic fungus Nomuraea rileyi. The genotypic diversity in isolates sampled from an epizootic population from South India was studied through AFLP. The AFLP data were subjected to analysis of molecular variance (AMOVA) and cluster analysis. Great genetic variation was observed in the population including the isolates from a single insect. To assess the occurrence of recombination in the population, single-strand conformation polymorphism (SSCP) of partial regions of two mitochondrial (mt) genes (rRNA genes of LSU and SSU) and a nuclear gene (beta tubulin) was performed. The SSCP data were analysed using MP, the tree length permutation test, and multilocus analysis. Recombination was inferred from the SSCP analysis. The occurrence of isolates with diverse genotypes in a single insect; the fact that fungi multiply as hyphal bodies (cell wall-less) in the insect haemolymph; and the inference of recombination in mitochondrial genes (suggesting cytomixis), all indicate that recombination is accomplished by fusion of hyphal bodies of different isolates infecting the insect.

  3. Single-strand conformation polymorphism analysis for the study of adenoviral diversity in urban rivers.

    Science.gov (United States)

    Lee, Cheonghoon; Kim, Sang-Jong

    2010-05-01

    The diversity of human adenoviruses (AdVs) in river waters was studied by single-strand conformational polymorphism (SSCP) analysis. Water samples were collected between 2002 and 2003 from 4 rivers in the Gyeonggi Province, South Korea. Forty-six (79.3%) of the 58 samples were positive for AdVs as determined on PCR amplification. Nine different SSCP profiles (profiles A to I) were detected in all the AdVs-positive samples by SSCP analysis, and most of the AdVs-positive samples (38 of 46 samples; 82.6%) showed the SSCP profile D. Nine different sequences were obtained in the SSCP profiles; sequence alignments and phylogenetic analysis identified 5 different sequences that were closely related to the human AdV type 41, and the 4 different sequences that were closely related to human AdV types 3, 4, 12, and 40. Two AdVs genomic variants were detected (types 3 and 41 in A, types 12 and 41 in B, and 2 genomic variants of type 41 in C) in SSCP profiles A, B, and C, respectively. SSCP analysis could be a useful technique for the identification of genetic variants of AdVs and for studying AdVs diversity in urban rivers.

  4. Application of motif-based tools on evolutionary analysis of multipartite single-stranded DNA viruses.

    Directory of Open Access Journals (Sweden)

    Hsiang-Iu Wang

    Full Text Available Multipartite viruses contain more than one distinctive genome component, and the origin of multipartite viruses has been suggested to evolve from a non-segmented wild-type virus. To explore whether recombination also plays a role in the evolution of the genomes of multipartite viruses, we developed a systematic approach that employs motif-finding tools to detect conserved motifs from divergent genomic regions and applies statistical approaches to select high-confidence motifs. The information that this approach provides helps us understand the evolution of viruses. In this study, we compared our motif-based strategy with current alignment-based recombination-detecting methods and applied our methods to the analysis of multipartite single-stranded plant DNA viruses, including bipartite begomoviruses, Banana bunchy top virus (BBTV (consisting of 6 genome components and Faba bean necrotic yellows virus (FBNYV (consisting of 8 genome components. Our analysis revealed that recombination occurred between genome components in some begomoviruses, BBTV and FBNYV. Our data also show that several unusual recombination events have contributed to the evolution of BBTV genome components. We believe that similar approaches can be applied to resolve the evolutionary history of other viruses.

  5. Enhanced gene repair mediated by methyl-CpG-modified single-stranded oligonucleotides

    Science.gov (United States)

    Bertoni, Carmen; Rustagi, Arjun; Rando, Thomas A.

    2009-01-01

    Gene editing mediated by oligonucleotides has been shown to induce stable single base alterations in genomic DNA in both prokaryotic and eukaryotic organisms. However, the low frequencies of gene repair have limited its applicability for both basic manipulation of genomic sequences and for the development of therapeutic approaches for genetic disorders. Here, we show that single-stranded oligodeoxynucleotides (ssODNs) containing a methyl-CpG modification and capable of binding to the methyl-CpG binding domain protein 4 (MBD4) are able to induce >10-fold higher levels of gene correction than ssODNs lacking the specific modification. Correction was stably inherited through cell division and was confirmed at the protein, transcript and genomic levels. Downregulation of MBD4 expression using RNAi prevented the enhancement of gene correction efficacy obtained using the methyl-CpG-modified ssODN, demonstrating the specificity of the repair mechanism being recruited. Our data demonstrate that efficient manipulation of genomic targets can be achieved and controlled by the type of ssODN used and by modulation of the repair mechanism involved in the correction process. This new generation of ssODNs represents an important technological advance that is likely to have an impact on multiple applications, especially for gene therapy where permanent correction of the genetic defect has clear advantages over viral and other nonviral approaches currently being tested. PMID:19854937

  6. Interaction with Single-stranded DNA-binding Protein Stimulates Escherichia coli Ribonuclease HI Enzymatic Activity.

    Science.gov (United States)

    Petzold, Christine; Marceau, Aimee H; Miller, Katherine H; Marqusee, Susan; Keck, James L

    2015-06-01

    Single-stranded (ss) DNA-binding proteins (SSBs) bind and protect ssDNA intermediates formed during replication, recombination, and repair reactions. SSBs also directly interact with many different genome maintenance proteins to stimulate their enzymatic activities and/or mediate their proper cellular localization. We have identified an interaction formed between Escherichia coli SSB and ribonuclease HI (RNase HI), an enzyme that hydrolyzes RNA in RNA/DNA hybrids. The RNase HI·SSB complex forms by RNase HI binding the intrinsically disordered C terminus of SSB (SSB-Ct), a mode of interaction that is shared among all SSB interaction partners examined to date. Residues that comprise the SSB-Ct binding site are conserved among bacterial RNase HI enzymes, suggesting that RNase HI·SSB complexes are present in many bacterial species and that retaining the interaction is important for its cellular function. A steady-state kinetic analysis shows that interaction with SSB stimulates RNase HI activity by lowering the reaction Km. SSB or RNase HI protein variants that disrupt complex formation nullify this effect. Collectively our findings identify a direct RNase HI/SSB interaction that could play a role in targeting RNase HI activity to RNA/DNA hybrid substrates within the genome.

  7. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against Atrazine

    Directory of Open Access Journals (Sweden)

    Ryan M. Williams

    2014-08-01

    Full Text Available Widespread use of the chlorotriazine herbicide, atrazine, has led to serious environmental and human health consequences. Current methods of detecting atrazine contamination are neither rapid nor cost-effective. In this work, atrazine-specific single-stranded DNA (ssDNA molecular recognition elements (MRE were isolated. We utilized a stringent Systematic Evolution of Ligands by Exponential Enrichment (SELEX methodology that placed the greatest emphasis on what the MRE should not bind to. After twelve rounds of SELEX, an atrazine-specific MRE with high affinity was obtained. The equilibrium dissociation constant (Kd of the ssDNA sequence is 0.62 ± 0.21 nM. It also has significant selectivity for atrazine over atrazine metabolites and other pesticides found in environmentally similar locations and concentrations. Furthermore, we have detected environmentally relevant atrazine concentrations in river water using this MRE. The strong affinity and selectivity of the selected atrazine-specific ssDNA validated the stringent SELEX methodology and identified a MRE that will be useful for rapid atrazine detection in environmental samples.

  8. Application of motif-based tools on evolutionary analysis of multipartite single-stranded DNA viruses.

    Science.gov (United States)

    Wang, Hsiang-Iu; Chang, Chih-Hung; Lin, Po-Heng; Fu, Hui-Chuan; Tang, Chuanyi; Yeh, Hsin-Hung

    2013-01-01

    Multipartite viruses contain more than one distinctive genome component, and the origin of multipartite viruses has been suggested to evolve from a non-segmented wild-type virus. To explore whether recombination also plays a role in the evolution of the genomes of multipartite viruses, we developed a systematic approach that employs motif-finding tools to detect conserved motifs from divergent genomic regions and applies statistical approaches to select high-confidence motifs. The information that this approach provides helps us understand the evolution of viruses. In this study, we compared our motif-based strategy with current alignment-based recombination-detecting methods and applied our methods to the analysis of multipartite single-stranded plant DNA viruses, including bipartite begomoviruses, Banana bunchy top virus (BBTV) (consisting of 6 genome components) and Faba bean necrotic yellows virus (FBNYV) (consisting of 8 genome components). Our analysis revealed that recombination occurred between genome components in some begomoviruses, BBTV and FBNYV. Our data also show that several unusual recombination events have contributed to the evolution of BBTV genome components. We believe that similar approaches can be applied to resolve the evolutionary history of other viruses.

  9. Prenatal diagnosis of Crigler-Najjar syndrome type I by single-strand conformation polymorphism (SSCP).

    Science.gov (United States)

    Francoual, Jeanne; Trioche, Pascale; Mokrani, Chahnez; Seboui, Hassen; Khrouf, Naïma; Chalas, Jacqueline; Clement, Marina; Capel, Liliane; Tachdjian, Gérard; Labrune, Philippe

    2002-10-01

    Crigler-Najjar syndrome type I (CN-I) is a rare and severe inherited disorder of bilirubin metabolism, caused by the total deficiency of bilirubin-UDP-glucuronosyltransferase (UGT) activity. Enzymatic diagnosis cannot be performed in chorionic villi or amniocytes as UGT is not active in these tissues. The cloning of the UGT1 gene and the identification of disease-causing mutations have led to the possibility of performing DNA-based diagnosis. Here we report DNA-based prenatal diagnosis of CN-I in two Tunisian families in whom CN-I patients were diagnosed. As we had previously shown that CN-I was, in Tunisia, associated with homozygosity for the Q357R mutation within the UGT1 gene, we were able to detect this mutation in both families and to show that it was easily recognized by single-strand conformation polymorphism (SSCP) analysis. In both cases, SSCP analysis of fetal DNA showed that the fetus was heterozygous for the Q357R mutation. In one family, the pregnancy was carried to term and a healthy baby was born, whereas, in the other family, the pregnancy is still continuing. Thus the prenatal diagnosis of CN-I is possible, provided disease-causing mutations have been identified. SSCP analysis of DNA prepared either from amniocytes or from chorionic villi is a simple, reliable and fast method for prenatal diagnosis.

  10. Single-stranded DNA-binding proteins: multiple domains for multiple functions.

    Science.gov (United States)

    Dickey, Thayne H; Altschuler, Sarah E; Wuttke, Deborah S

    2013-07-01

    The recognition of single-stranded DNA (ssDNA) is integral to myriad cellular functions. In eukaryotes, ssDNA is present stably at the ends of chromosomes and at some promoter elements. Furthermore, it is formed transiently by several cellular processes including telomere synthesis, transcription, and DNA replication, recombination, and repair. To coordinate these diverse activities, a variety of proteins have evolved to bind ssDNA in a manner specific to their function. Here, we review the recognition of ssDNA through the analysis of high-resolution structures of proteins in complex with ssDNA. This functionally diverse set of proteins arises from a limited set of structural motifs that can be modified and arranged to achieve distinct activities, including a range of ligand specificities. We also investigate the ways in which these domains interact in the context of large multidomain proteins/complexes. These comparisons reveal the structural features that define the range of functions exhibited by these proteins.

  11. Managing Single-Stranded DNA during Replication Stress in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Sarah A. Sabatinos

    2015-09-01

    Full Text Available Replication fork stalling generates a variety of responses, most of which cause an increase in single-stranded DNA. ssDNA is a primary signal of replication distress that activates cellular checkpoints. It is also a potential source of genome instability and a substrate for mutation and recombination. Therefore, managing ssDNA levels is crucial to chromosome integrity. Limited ssDNA accumulation occurs in wild-type cells under stress. In contrast, cells lacking the replication checkpoint cannot arrest forks properly and accumulate large amounts of ssDNA. This likely occurs when the replication fork polymerase and helicase units are uncoupled. Some cells with mutations in the replication helicase (mcm-ts mimic checkpoint-deficient cells, and accumulate extensive areas of ssDNA to trigger the G2-checkpoint. Another category of helicase mutant (mcm4-degron causes fork stalling in early S-phase due to immediate loss of helicase function. Intriguingly, cells realize that ssDNA is present, but fail to detect that they accumulate ssDNA, and continue to divide. Thus, the cellular response to replication stalling depends on checkpoint activity and the time that replication stress occurs in S-phase. In this review we describe the signs, signals, and symptoms of replication arrest from an ssDNA perspective. We explore the possible mechanisms for these effects. We also advise the need for caution when detecting and interpreting data related to the accumulation of ssDNA.

  12. Widespread Horizontal Gene Transfer from Circular Single-stranded DNA Viruses to Eukaryotic Genomes

    Directory of Open Access Journals (Sweden)

    Xie Jiatao

    2011-09-01

    Full Text Available Abstract Background In addition to vertical transmission, organisms can also acquire genes from other distantly related species or from their extra-chromosomal elements (plasmids and viruses via horizontal gene transfer (HGT. It has been suggested that phages represent substantial forces in prokaryotic evolution. In eukaryotes, retroviruses, which can integrate into host genome as an obligate step in their replication strategy, comprise approximately 8% of the human genome. Unlike retroviruses, few members of other virus families are known to transfer genes to host genomes. Results Here we performed a systematic search for sequences related to circular single-stranded DNA (ssDNA viruses in publicly available eukaryotic genome databases followed by comprehensive phylogenetic analysis. We conclude that the replication initiation protein (Rep-related sequences of geminiviruses, nanoviruses and circoviruses have been frequently transferred to a broad range of eukaryotic species, including plants, fungi, animals and protists. Some of the transferred viral genes were conserved and expressed, suggesting that these genes have been coopted to assume cellular functions in the host genomes. We also identified geminivirus-like and parvovirus-like transposable elements in genomes of fungi and lower animals, respectively, and thereby provide direct evidence that eukaryotic transposons could derive from ssDNA viruses. Conclusions Our discovery extends the host range of circular ssDNA viruses and sheds light on the origin and evolution of these viruses. It also suggests that ssDNA viruses act as an unforeseen source of genetic innovation in their hosts.

  13. The androgen receptor is transcriptionally suppressed by proteins that bind single-stranded DNA.

    Science.gov (United States)

    Grossmann, M E; Tindall, D J

    1995-05-01

    The androgen receptor (AR) is a nuclear transcription factor that is essential for development of the male urogenital tract. In the current work, we have characterized the mouse androgen receptor suppressor (mARS). A single, 20-base pair, region (TCCCCCCACCCACCCCC-CCT) was sufficient for suppression in chloramphenicol acetyltransferase assays. Northern analysis indicated that translational regulation is not necessary for the suppression. Analysis of the AR mRNA half-life indicated that the mARS does not affect AR RNA degradation. Gel mobility assays showed that the mARS is bound by multiple proteins that can recognize single-stranded DNA and RNA. In addition, differing proteins are expressed in distinct tissues. Purification of some of these proteins has shown that a doublet of 33 and 35 kDa binds to the G-rich strand and that a 52-kDa protein binds to the C-rich strand. Southwestern blots have confirmed that these proteins are indeed recognized by the mARS. The results of these experiments indicate that the AR 5'-untranslated region contains a suppressor element that can be bound by multiple proteins. The mARS appears to be acting either by altering transcription initiation or blocking transcription elongation. Characterization of this suppressor may provide insight into the physiological means by which the AR is regulated.

  14. Structural dynamics of a single-stranded RNA–helix junction using NMR

    Science.gov (United States)

    Eichhorn, Catherine D.; Al-Hashimi, Hashim M.

    2014-01-01

    Many regulatory RNAs contain long single strands (ssRNA) that adjoin secondary structural elements. Here, we use NMR spectroscopy to study the dynamic properties of a 12-nucleotide (nt) ssRNA tail derived from the prequeuosine riboswitch linked to the 3′ end of a 48-nt hairpin. Analysis of chemical shifts, NOE connectivity, 13C spin relaxation, and residual dipolar coupling data suggests that the first two residues (A25 and U26) in the ssRNA tail stack onto the adjacent helix and assume an ordered conformation. The following U26-A27 step marks the beginning of an A6-tract and forms an acute pivot point for substantial motions within the tail, which increase toward the terminal end. Despite substantial internal motions, the ssRNA tail adopts, on average, an A-form helical conformation that is coaxial with the helix. Our results reveal a surprising degree of structural and dynamic complexity at the ssRNA–helix junction, which involves a fine balance between order and disorder that may facilitate efficient pseudoknot formation on ligand recognition. PMID:24742933

  15. Structural Basis of Detection and Signaling of DNA Single-Strand Breaks by Human PARP-1

    Science.gov (United States)

    Eustermann, Sebastian; Wu, Wing-Fung; Langelier, Marie-France; Yang, Ji-Chun; Easton, Laura E.; Riccio, Amanda A.; Pascal, John M.; Neuhaus, David

    2015-01-01

    Summary Poly(ADP-ribose)polymerase 1 (PARP-1) is a key eukaryotic stress sensor that responds in seconds to DNA single-strand breaks (SSBs), the most frequent genomic damage. A burst of poly(ADP-ribose) synthesis initiates DNA damage response, whereas PARP-1 inhibition kills BRCA-deficient tumor cells selectively, providing the first anti-cancer therapy based on synthetic lethality. However, the mechanism underlying PARP-1’s function remained obscure; inherent dynamics of SSBs and PARP-1’s multi-domain architecture hindered structural studies. Here we reveal the structural basis of SSB detection and how multi-domain folding underlies the allosteric switch that determines PARP-1’s signaling response. Two flexibly linked N-terminal zinc fingers recognize the extreme deformability of SSBs and drive co-operative, stepwise self-assembly of remaining PARP-1 domains to control the activity of the C-terminal catalytic domain. Automodifcation in cis explains the subsequent release of monomeric PARP-1 from DNA, allowing repair and replication to proceed. Our results provide a molecular framework for understanding PARP inhibitor action and, more generally, allosteric control of dynamic, multi-domain proteins. PMID:26626479

  16. Comparison of the methods for generating single-stranded DNA in SELEX.

    Science.gov (United States)

    Liang, Chao; Li, Defang; Zhang, Guangxian; Li, Hui; Shao, Ningsheng; Liang, Zicai; Zhang, Lingqiang; Lu, Aiping; Zhang, Ge

    2015-05-21

    The generation of single-stranded DNA (ssDNA) from double-stranded PCR products is an essential step in the selection of aptamers by systematic evolution of ligands by exponential enrichment (SELEX). Magnetic separation with streptavidin-coated beads is always the most commonly used method. Recently, two size separation methods derived from unequal primers with chemical or structural modification were designed in SELEX. In this report, we made a comparison between magnetic separation and the two size separation methods for generation of ssDNA from double-stranded PCR products. Our results showed that all the methods produced ssDNA of good purity. Compared to the magnetic separation, size separation derived from unequal primers with chemical modification achieved an almost equivalent recovery rate of ssDNA, whereas size separation derived from unequal primers with structural modification showed a lower recovery rate of ssDNA. Considering the low cost, size separation derived from unequal primers with chemical modification could be a satisfactory alternative to the classic magnetic separation for the generation of ssDNA in SELEX.

  17. Preparation and application of triple helix forming oligonucleotides and single strand oligonucleotide donors for gene correction.

    Science.gov (United States)

    Alam, Rowshon; Thazhathveetil, Arun Kalliat; Li, Hong; Seidman, Michael M

    2014-01-01

    Strategies for site-specific modulation of genomic sequences in mammalian cells require two components. One must be capable of recognizing and activating a specific target sequence in vivo, driving that site into an exploitable repair pathway. Information is transferred to the site via participation in the pathway by the second component, a donor nucleic acid, resulting in a permanent change in the target sequence. We have developed biologically active triple helix forming oligonucleotides (TFOs) as site-specific gene targeting reagents. These TFOs, linked to DNA reactive compounds (such as a cross-linking agent), activate pathways that can engage informational donors. We have used the combination of a psoralen-TFO and single strand oligonucleotide donors to generate novel cell lines with directed sequence changes at the target site. Here we describe the synthesis and purification of bioactive psoralen-linked TFOs, their co-introduction into mammalian cells with donor nucleic acids, and the identification of cells with sequence conversion of the target site. We have emphasized details in the synthesis and purification of the oligonucleotides that are essential for preparation of reagents with optimal activity.

  18. A field guide to eukaryotic circular single-stranded DNA viruses: insights gained from metagenomics.

    Science.gov (United States)

    Rosario, Karyna; Duffy, Siobain; Breitbart, Mya

    2012-10-01

    Despite their small size and limited protein-coding capacity, the rapid evolution rates of single-stranded DNA (ssDNA) viruses have led to their emergence as serious plant and animal pathogens. Recently, metagenomics has revealed an unprecedented diversity of ssDNA viruses, expanding their known environmental distributions and host ranges. This review summarizes and contrasts the basic characteristics of known circular ssDNA viral groups, providing a resource for analyzing the wealth of ssDNA viral sequences identified through metagenomics. Since ssDNA viruses are largely identified based on conserved rolling circle replication proteins, this review highlights distinguishing motifs and catalytic residues important for replication. Genomes identified through metagenomics have demonstrated unique ssDNA viral genome architectures and revealed characteristics that blur the boundaries between previously well-defined groups. Metagenomic discovery of ssDNA viruses has created both a challenge to current taxonomic classification schemes and an opportunity to revisit hypotheses regarding the evolutionary history of these viruses.

  19. In Vitro Selection of a Single-Stranded DNA Molecular Recognition Element against Atrazine

    Science.gov (United States)

    Williams, Ryan M.; Crihfield, Cassandra L.; Gattu, Srikanth; Holland, Lisa A.; Sooter, Letha J.

    2014-01-01

    Widespread use of the chlorotriazine herbicide, atrazine, has led to serious environmental and human health consequences. Current methods of detecting atrazine contamination are neither rapid nor cost-effective. In this work, atrazine-specific single-stranded DNA (ssDNA) molecular recognition elements (MRE) were isolated. We utilized a stringent Systematic Evolution of Ligands by Exponential Enrichment (SELEX) methodology that placed the greatest emphasis on what the MRE should not bind to. After twelve rounds of SELEX, an atrazine-specific MRE with high affinity was obtained. The equilibrium dissociation constant (Kd) of the ssDNA sequence is 0.62 ± 0.21 nM. It also has significant selectivity for atrazine over atrazine metabolites and other pesticides found in environmentally similar locations and concentrations. Furthermore, we have detected environmentally relevant atrazine concentrations in river water using this MRE. The strong affinity and selectivity of the selected atrazine-specific ssDNA validated the stringent SELEX methodology and identified a MRE that will be useful for rapid atrazine detection in environmental samples. PMID:25196435

  20. Two Distinct Pathways Support Gene Correction by Single-Stranded Donors at DNA Nicks

    Directory of Open Access Journals (Sweden)

    Luther Davis

    2016-11-01

    Full Text Available Nicks are the most common form of DNA damage. The mechanisms of their repair are fundamental to genomic stability and of practical importance for genome engineering. We define two pathways that support homology-directed repair by single-stranded DNA donors. One depends upon annealing-driven strand synthesis and acts at both nicks and double-strand breaks. The other depends upon annealing-driven heteroduplex correction and acts at nicks. Homology-directed repair via these pathways, as well as mutagenic end joining, are inhibited by RAD51 at nicks but largely independent of RAD51 at double-strand breaks. Guidelines for coordinated design of targets and donors for gene correction emerge from definition of these pathways. This analysis further suggests that naturally occurring nicks may have significant recombinogenic and mutagenic potential that is normally inhibited by RAD51 loading onto DNA, thereby identifying a function for RAD51 in maintenance of genomic stability.

  1. Discovery of a novel circular single-stranded DNA virus from porcine faeces.

    Science.gov (United States)

    Sikorski, Alyssa; Argüello-Astorga, Gerardo R; Dayaram, Anisha; Dobson, Renwick C J; Varsani, Arvind

    2013-01-01

    A large number of novel single-stranded DNA (ssDNA) viruses have been characterised from various environmental sources in the last 5 years. The bulk of these have been from faecal sources, and faecal sampling is an ideal non-invasive pathogen sampling method. We characterised a novel ssDNA from a porcine faecal sample from Cass Basin of the South Island of New Zealand. The novel viral genome has two large open reading frames (ORFs), which are bidirectionally transcribed and separated by intergenic regions. The largest ORF has some degree of similarity (DNA virus (PigSCV), whereas the second-largest ORF has high similarity to the putative replication-associated protein (Rep) of ChiSCV (~50 %) and bovine stool-associated circular DNA virus (BoSCV; ~30 %). Based on genome architecture, location of putative stem-loop like elements, and maximum-likelihood phylogenetic analysis of the gene encoding the Rep protein, the novel isolate belongs to the same family of ssDNA viruses as ChiSCV and BoSCV.

  2. Atomic force microscopy reveals two phases in single stranded DNA self-assembled monolayers

    Science.gov (United States)

    Kosaka, Priscila M.; González, Sheila; Domínguez, Carmen M.; Cebollada, Alfonso; San Paulo, Alvaro; Calleja, Montserrat; Tamayo, Javier

    2013-07-01

    We have investigated the structure of single-stranded (ss) DNA self-assembled monolayers (SAMs) on gold by combining peak force tapping, Kelvin probe and phase contrast atomic force microscopy (AFM) techniques. The adhesion, surface potential and phase shift signals show heterogeneities in the DNA film structure at two levels: microscale and nanoscale; which cannot be clearly discerned in the topography. Firstly, there is multilayer aggregation covering less than 5% of the surface. The DNA multilayers seem to be ordered phases and their existence suggests that DNA end-to-end interaction can play a role in the self-assembly process. Secondly, we find the formation of two phases in the DNA monolayer, which differ both in surface energy and surface potential. We relate the two domains to differences in the packing density and in the ssDNA conformation. The discovered heterogeneities in ssDNA SAMs provide a new scenario in our vision of these relevant films that have direct consequences on their biological, chemical and physical properties.

  3. Leishmania major: genetic heterogeneity of Iranian isolates by single-strand conformation polymorphism and sequence analysis of ribosomal DNA internal transcribed spacer.

    Science.gov (United States)

    Tashakori, Mahnaz; Mahnaz, Tashakori; Kuhls, Katrin; Katrin, Kuhls; Al-Jawabreh, Amer; Amer, Al-Jawabreh; Mauricio, Isabel L; Isabel, Mauricio; Schönian, Gabriele; Gabriele, Schönian; Farajnia, Safar; Safar, Farajnia; Alimohammadian, Mohammad Hossein; Hossein, Alimohammadian Mohammad

    2006-04-01

    Protozoan parasites of Leishmania major are the causative agents of cutaneous leishmaniasis in different parts of Iran. We applied PCR-based methods to analyze L. major parasites isolated from patients with active lesions from different geographic areas in Iran in order to understand DNA polymorphisms within L. major species. Twenty-four isolates were identified as L. major by RFLP analysis of the ribosomal internal transcribed spacer 1 (ITS1) amplicons. These isolates were further studied by single-strand conformation polymorphism (SSCP) analysis and sequencing of ITS1 and ITS2. Data obtained from SSCP analysis of the ITS1 and ITS2 loci revealed three and four different patterns among all studied samples, respectively. Sequencing of ITS1 and ITS2 confirmed the results of SSCP analysis and showed the potential of the PCR-SSCP method for assessing genetic heterogeneity within L. major. Different patterns in ITS1 were due to substitution of one nucleotide, whereas in ITS2 the changes were defined by variation in the number of repeats in two polymorphic microsatellites. In total five genotypic groups LmA, LmB, LmC, LmD and LmE were identified among L. major isolates. The most frequent genotype, LmA, was detected in isolates collected from different endemic areas of cutaneous leishmaniasis in Iran. Genotypes LmC, LmD and LmE were found only in the new focus of CL in Damghan (Semnan province) and LmB was identified exclusively among isolates of Kashan focus (Isfahan province). The distribution of genetic polymorphisms suggests the existence of distinct endemic regions of L. major in Iran.

  4. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods

    Directory of Open Access Journals (Sweden)

    Bahram Nasr Isfahani

    2006-09-01

    Full Text Available Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC, 523(GGG/GGT, 526(CAC/TAC, 531(TCG/TTG, 511(CTG/TTG, and 512(AGC/TCG. This study demonstrated the high specificity (93.8% and sensitivity (95.2% of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  5. Detection of rifampin resistance patterns in Mycobacterium tuberculosis strains isolated in Iran by polymerase chain reaction-single-strand conformation polymorphism and direct sequencing methods.

    Science.gov (United States)

    Isfahani, Bahram Nasr; Tavakoli, Akbar; Salehi, Mansoor; Tazhibi, Mehdi

    2006-09-01

    Mutations in the rpoB locus confer conformational changes leading to defective binding of rifampin (RIF) to rpoB and consequently resistance in Mycobacterium tuberculosis. Polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP) was established as a rapid screening test for the detection of mutations in the rpoB gene, and direct sequencing has been unambiguously applied to characterize mutations. A total of 37 of Iranian isolates of M. tuberculosis, 16 sensitive and 21 resistant to RIF, were used in this study. A 193-bp region of the rpoB gene was amplified and PCR-SSCP patterns were determined by electrophoresis in 10% acrylamide gel and silver staining. Also, 21 samples of 193-bp rpoB amplicons with different PCR-SSCP patterns from RIFr and 10 from RIFs were sequenced. Seven distinguishable PCR-SSCP patterns were recognized in the 21 Iranian RIFr strains, while 15 out of 16 RIFs isolates demonstrated PCR-SSCP banding patterns similar to that of sensitive standard strain H37Rv. However one of the sensitive isolates demonstrated a different pattern. There were seen six different mutations in the amplified region of rpoB gene: codon 516(GAC/GTC), 523(GGG/GGT), 526(CAC/TAC), 531(TCG/TTG), 511(CTG/TTG), and 512(AGC/TCG). This study demonstrated the high specificity (93.8%) and sensitivity (95.2%) of PCR-SSCP method for detection of mutation in rpoB gene; 85.7% of RIFr strains showed a single mutation and 14.3% had no mutations. Three strains showed mutations caused polymorphism. Our data support the common notion that rifampin resistance genotypes are generally present mutations in codons 531 and 526, most frequently found in M. tuberculosis populations regardless of geographic origin.

  6. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  7. Practical Parallel Rendering

    CERN Document Server

    Chalmers, Alan

    2002-01-01

    Meeting the growing demands for speed and quality in rendering computer graphics images requires new techniques. Practical parallel rendering provides one of the most practical solutions. This book addresses the basic issues of rendering within a parallel or distributed computing environment, and considers the strengths and weaknesses of multiprocessor machines and networked render farms for graphics rendering. Case studies of working applications demonstrate, in detail, practical ways of dealing with complex issues involved in parallel processing.

  8. Screening for mutations in human alpha-globin genes by nonradioactive single-strand conformation polymorphism

    Directory of Open Access Journals (Sweden)

    Jorge S.B.

    2003-01-01

    Full Text Available Point mutations and small insertions or deletions in the human alpha-globin genes may produce alpha-chain structural variants and alpha-thalassemia. Mutations can be detected either by direct DNA sequencing or by screening methods, which select the mutated exon for sequencing. Although small (about 1 kb, 3 exons and 2 introns, the alpha-globin genes are duplicate (alpha2 and alpha1 and highy G-C rich, which makes them difficult to denature, reducing sequencing efficiency and causing frequent artifacts. We modified some conditions for PCR and electrophoresis in order to detect mutations in these genes employing nonradioactive single-strand conformation polymorphism (SSCP. Primers previously described by other authors for radioactive SSCP and phast-SSCP plus denaturing gradient gel electrophoresis were here combined and the resultant fragments (6 new besides 6 original per alpha-gene submitted to silver staining SSCP. Nine structural and one thalassemic mutations were tested, under different conditions including two electrophoretic apparatus (PhastSystem(TM and GenePhor(TM, Amersham Biosciences, different polyacrylamide gel concentrations, run temperatures and denaturing agents, and entire and restriction enzyme cut fragments. One hundred percent of sensitivity was achieved with four of the new fragments formed, using the PhastSystem(TM and 20% gels at 15ºC, without the need of restriction enzymes. This nonradioactive PCR-SSCP approach showed to be simple, rapid and sensitive, reducing the costs involved in frequent sequencing repetitions and increasing the reliability of the results. It can be especially useful for laboratories which do not have an automated sequencer.

  9. Early steps in the DNA base excision/single-strand interruption repair pathway in mammalian cells

    Institute of Scientific and Technical Information of China (English)

    Muralidhar L Hegde; Tapas K Hazra; Sankar Mitra

    2008-01-01

    Base excision repair (BER) is an evolutionarily conserved process for maintaining genomic integrity by eliminating several dozen damaged (oxidized or alkylated) or inappropriate bases that are generated endogenously or induced by genotoxicants, predominantly, reactive oxygen species (ROS). BER involves 4-5 steps starting with base excision by a DNA glycosylase, followed by a common pathway usually involving an AP-endonuclease (APE) to generate 3' OH terminus at the damage site, followed by repair synthesis with a DNA polymerase and nick sealing by a DNA ligase. This pathway is also responsible for repairing DNA single-strand breaks with blocked termini directly generated by ROS. Nearly all glycosylases, far fewer than their substrate lesions particularly for oxidized bases, have broad and overlapping substrate range, and could serve as back-up enzymes in vivo. In contrast, mammalian cells encode only one APE, APEl, unlike two APEs in lower organisms. In spite of overall similarity, BER with distinct subpathways in the mammals is more complex than in E.coli. The glycosylases form complexes with downstream proteins to carry out efficient repair via distinct subpathways one of which, responsible for repair of strand breaks with 3' phosphate ter-mini generated by the NEIL family glycosylases or by ROS, requires the phosphatase activity of polynucleotide kinase instead of APEl. Different complexes may utilize distinct DNA polymerases and ligases. Mammalian glycosylases have nonconserved extensions at one of the termini, dispensable for enzymatic activity but needed for interaction with other BER and non-BER proteins for complex formation and organelle targeting. The mammalian enzymes are sometimes covalently modified which may affect activity and complex formation. The focus of this review is on the early steps in mammalian BER for oxidized damage.

  10. Thermodynamic analysis of DNA binding by a Bacillus single stranded DNA binding protein

    Directory of Open Access Journals (Sweden)

    Biswas-Fiss Esther E

    2012-06-01

    Full Text Available Abstract Background Single-stranded DNA binding proteins (SSB are essential for DNA replication, repair, and recombination in all organisms. SSB works in concert with a variety of DNA metabolizing enzymes such as DNA polymerase. Results We have cloned and purified SSB from Bacillus anthracis (SSBBA. In the absence of DNA, at concentrations ≤100 μg/ml, SSBBA did not form a stable tetramer and appeared to resemble bacteriophage T4 gene 32 protein. Fluorescence anisotropy studies demonstrated that SSBBA bound ssDNA with high affinity comparable to other prokaryotic SSBs. Thermodynamic analysis indicated both hydrophobic and ionic contributions to ssDNA binding. FRET analysis of oligo(dT70 binding suggested that SSBBA forms a tetrameric assembly upon ssDNA binding. This report provides evidence of a bacterial SSB that utilizes a novel mechanism for DNA binding through the formation of a transient tetrameric structure. Conclusions Unlike other prokaryotic SSB proteins, SSBBA from Bacillus anthracis appeared to be monomeric at concentrations ≤100 μg/ml as determined by SE-HPLC. SSBBA retained its ability to bind ssDNA with very high affinity, comparable to SSB proteins which are tetrameric. In the presence of a long ssDNA template, SSBBA appears to form a transient tetrameric structure. Its unique structure appears to be due to the cumulative effect of multiple key amino acid changes in its sequence during evolution, leading to perturbation of stable dimer and tetramer formation. The structural features of SSBBA could promote facile assembly and disassembly of the protein-DNA complex required in processes such as DNA replication.

  11. Identification of five novel FBN1 mutations by non-radioactive single-strand conformation analysis

    Energy Technology Data Exchange (ETDEWEB)

    Liu, W.; Qian, C.; Comeau, K.; Francke, U. [Stanford Univ. Medical Center, Stanford, CA (United States)

    1994-09-01

    Marfan syndrome (MFS), one of the most common genetic disorders of connective tissue, is characterized by variable manifestations in skeletal, cardiovascular and ocular systems. Mutations in the fibrillin gene on chromosome 15 (FBN1) have been shown to cause MFS. To examine the relationship between FBN1 gene mutations, fibrillin protein function and MFS phenotypes, we screened for alternations in the fibrillin coding sequence in fibroblast derived cDNA from MFS patients. To date, abnormally migrating bands in more than 20 unrelated MFS patients have been identified by using non-radioactive single-strand conformation analysis and silver staining. Five altered bands have been directly sequenced. Two missense mutations and three splice site mutations have been identified. Both missense mutations substitute another amino acid for a cysteine residue (C1402W and C1672R) in EGF-like motifs of the fibrillin polypeptide chain. The two splice site mutations are at nucleotide positions 6994+1 (G{yields}A), and 7205-2 (A{yields}G) and result in in-frame skipping of exon 56 and 58, respectively. Skipping of exon 56 occurs in 50% of mutant transcripts. Use of a cryptic splice site 51 bp upstream of the normal donor site results in half of the mutant transcripts containing part of exon 56. Both products contain in-frame deletions. Another splice site mutation, identified by exon screening from patient genomic DNA using intron primers, is at nucleotide position 2293+2 (T{yields}A), but the predicted exon skipping has not been detected at the RT-PCR level. This may be due to instability of the mutant transcript. Including the mutations reported here, a total of 8 out of 36 published FBN1 gene mutations involve exon skipping. It may be inferred that FBN1 exon skipping plays an important pathogenic role in MFS.

  12. Structural basis for the modular recognition of single-stranded RNA by PPR proteins

    Science.gov (United States)

    Yin, Ping; Li, Quanxiu; Yan, Chuangye; Liu, Ying; Liu, Junjie; Yu, Feng; Wang, Zheng; Long, Jiafu; He, Jianhua; Wang, Hong-Wei; Wang, Jiawei; Zhu, Jian-Kang; Shi, Yigong; Yan, Nieng

    2013-12-01

    Pentatricopeptide repeat (PPR) proteins represent a large family of sequence-specific RNA-binding proteins that are involved in multiple aspects of RNA metabolism. PPR proteins, which are found in exceptionally large numbers in the mitochondria and chloroplasts of terrestrial plants, recognize single-stranded RNA (ssRNA) in a modular fashion. The maize chloroplast protein PPR10 binds to two similar RNA sequences from the ATPI-ATPH and PSAJ-RPL33 intergenic regions, referred to as ATPH and PSAJ, respectively. By protecting the target RNA elements from 5' or 3' exonucleases, PPR10 defines the corresponding 5' and 3' messenger RNA termini. Despite rigorous functional characterizations, the structural basis of sequence-specific ssRNA recognition by PPR proteins remains to be elucidated. Here we report the crystal structures of PPR10 in RNA-free and RNA-bound states at resolutions of 2.85 and 2.45Å, respectively. In the absence of RNA binding, the nineteen repeats of PPR10 are assembled into a right-handed superhelical spiral. PPR10 forms an antiparallel, intertwined homodimer and exhibits considerable conformational changes upon binding to its target ssRNA, an 18-nucleotide PSAJ element. Six nucleotides of PSAJ are specifically recognized by six corresponding PPR10 repeats following the predicted code. The molecular basis for the specific and modular recognition of RNA bases A, G and U is revealed. The structural elucidation of RNA recognition by PPR proteins provides an important framework for potential biotechnological applications of PPR proteins in RNA-related research areas.

  13. XRCC1 and DNA polymerase β in cellular protection against cytotoxic DNA single-strand breaks

    Institute of Scientific and Technical Information of China (English)

    Julie K Horton; Mary Watson; Donna F Stefanick; Daniel T Shaughnessy; Jack A Taylor; Samuel H Wilson

    2008-01-01

    Single-strand breaks (SSBs) can occur in cells either directly, or indirectly following initiation of base excision re-pair (BER). SSBs generally have blocked termini lacking the conventional 5'-phosphate and 3'-hydroxyl groups and require further processing prior to DNA synthesis and ligation. XRCC1 is devoid of any known enzymatic activity, but it can physically interact with other proteins involved in all stages of the overlapping SSB repair and BER pathways, including those that conduct the rate-limiting end-tailoring, and in many cases can stimulate their enzymatic activities. XRCC1-/- mouse fibroblasts are most hypersensitive to agents that produce DNA lesions repaired by monofunctional glycosylase-initiated BER and that result in formation of indirect SSBs. A requirement for the deoxyribose phosphate lyase activity of DNA polymerase β (polβ) is specific to this pathway, whereas pol β is implicated in gap-filling during repair of many types of SSBs. Elevated levels of strand breaks, and diminished repair, have been demonstrated in MMS-treated XRCC1-/-, and to a lesser extent in polβ-/- cell lines, compared with wild-type cells. Thus a strong correlation is observed between cellular sensitivity to MMS and the ability of cells to repair MMS-induced damage. Exposure of wild-type andpolβ-/- cells to an inhibitor of PARP activity dramatically potentiates MMS-induccd cytotoxicity. XRCC1-/- cellsare also sensitized by PARP inhibition demonstrating that PARP-mediated poly(ADP-ribosyl)ation plays a role inmodulation of cytotoxicity beyond recruitment of XRCC1 to sites of DNA damage.

  14. Single strand DNA binding proteins 1 and 2 protect newly replicated telomeres

    Institute of Scientific and Technical Information of China (English)

    Peili Gu; Wei Deng; Ming Lei; Sandy Chang

    2013-01-01

    Human single-strand (ss) DNA binding proteins 1 and 2 (hSSB1 and 2) are components of the hSSB1/2-INTS3-C9orf80 heterotrimeric protein complex shown to participate in DNA damage response and maintenance of genome stability.However,their roles at telomeres remain unknown.Here,we generated murine SSB1 conditional knockout mice and cells and found that mSSB1 plays a critical role in telomere end protection.Both mSSB1 and mSSB2 localize to a subset of telomeres and are required to repair TRF2-deficient telomeres.Deletion of mSSB1 resulted in increased chromatid-type fusions involving both leading-and lagging-strand telomeric DNA,suggesting that it is required for the protection of G-overhangs.mSSB1's interaction with INTS3 is required for its localization to damaged DNA.mSSB1 interacts with Potla,but not Potlb,and its association with telomeric ssDNA requires Potla.mSSB1△/△ mice die at birth with developmental abnormalities,while mice with the hypomorphic mSSB1F/F allele are born alive and display increased sensitivity to ionizing radiation (IR).Our results suggest that mSSB1 is required to maintain genome stability,and document a previously unrecognized role for mSSB1/2 in the protection of newly replicated leading-and lagging-strand telomeres.

  15. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    Energy Technology Data Exchange (ETDEWEB)

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  16. DNA single strand break in fibroblast from Down syndrome patients; Pojedyncze pekniecia DNA fibroblastow od osob z zespolem Downa

    Energy Technology Data Exchange (ETDEWEB)

    Rozga, B. [Lodz Univ. (Poland)

    1992-12-31

    The radiosensitivity of tree trisomic (trisomia +21) strains of human fibroblasts to gamma radiation has been investigated in vitro and the causes of induction and repair of single strand DNA breaks in these cells have been estimated. The single strand breaks in DNA of normal and trisomic cells have been found to be ameliorated with an approximately equal efficiency. Repair has been found to be three times slower in trisomic cells compared to their normal relevant, most likely due to their elevated sensitivity to ionizing radiation and the following mortality of trisomic cells, and/or the potential occurrence of a great number of chromosome aberrations in cells irradiated in vitro. (author). 28 refs, 4 figs, 1 tab.

  17. Direct Amplification of Single-Stranded DNA for Pyrosequencing using Linear-After-The-Exponential (LATE)-PCR

    Science.gov (United States)

    Salk, Jesse J.; Sanchez, J Aquiles; Pierce, Kenneth E.; Rice, John E.; Soares, Kevin C.; Wangh, Lawrence J.

    2006-01-01

    Pyrosequencing is a highly effective method for quantitatively genotyping short genetic sequences, but is currently hampered by a labor intensive sample preparation process designed to isolate single-stranded DNA from double-stranded products generated by conventional PCR. Here LATE-PCR is introduced as an efficient and potentially automatable method of directly amplifying single-stranded DNA for pyrosequencing, thus eliminating the need for solid-phase sample preparation and reducing the risk of laboratory contamination. These improvements are illustrated for SNP genotyping applications including an integrated, single cell-through-sequencing assay to detect a mutation at the globin IVS-110 site that is frequently responsible for β-Thalassemia. PMID:16540077

  18. Applications of single-strand conformation polymorphism (SSCP) to taxonomy, diagnosis, population genetics and molecular evolution of parasitic nematodes.

    Science.gov (United States)

    Gasser, R B; Chilton, N B

    2001-11-22

    The analysis of genetic variation in parasitic nematodes has important implications for studying aspects of taxonomy, diagnosis, population genetics, drug resistance and molecular evolution. This article highlights some applications of PCR-based single-strand conformation polymorphism (SSCP) for the analysis of sequence variation in individual parasites (and their populations) to address some of these areas. It also describes the principles and advantages of SSCP, and provides some examples for future applications in parasitology.

  19. Purification of DNA polymerase II stimulatory factor I, a yeast single-stranded DNA-binding protein.

    OpenAIRE

    1990-01-01

    Incidental to the purification of yeast DNA polymerase II was the observation that various chromatographic fractions contained activities that stimulated synthesis by this polymerase. In this paper we report the purification and initial characterization of one such factor, stimulatory factor I (SFI). SFI, which is associated with an apparent complex of three polypeptides of 66, 37, and 13.5 kDa, binds preferentially to single-stranded DNA, possibly explaining its ability to stimulate DNA poly...

  20. Cisplatin GG-crosslinks within single-stranded DNA: origin of the preference for left-handed helicity.

    Science.gov (United States)

    Monnet, Jordan; Kozelka, Jiří

    2012-10-01

    Molecular dynamics (MD) simulations of the single-stranded DNA trinucleotide TG*G*, with the G* guanines crosslinked by the antitumor drug cisplatin, were performed with explicit representation of the water as solvent. The purpose of the simulations was to explain previous NMR observations indicating that in single-stranded cisplatin-DNA adducts, the crosslinked guanines adopt a left-handed helical orientation, whereas in duplexes, the orientation is right-handed. The analysis of the MD trajectory of TG*G* has ascribed a crucial role to hydrogen-bonding (direct or through-water) interactions of the 5'-oriented NH(3) ligand of platinum with acceptor groups at the 5'-side of the crosslink, namely the TpG* phosphate and the terminal 5'-OH group. These interactions bring about some strain into the trinucleotide which is slightly but significantly (1-1.5 kcal.mol(-1)) higher for the right-handed orientation than for the left-handed one. During the unconstrained, 3 ns long MD simulation, left-handed conformations were ~15 times more abundant than the right-handed ones. This sampling difference agrees roughly with the calculated energy difference in strain energy. Overall, these results show that the Pt-GG crosslink within single-stranded DNA is malleable and can access different conformations at a moderate energy cost. This malleability could be of importance in interactions between the platinated DNA and cellular proteins, in which the DNA is locally unwound.

  1. Analyses of point mutation repair and allelic heterogeneity generated by CRISPR/Cas9 and single-stranded DNA oligonucleotides.

    Science.gov (United States)

    Bialk, Pawel; Sansbury, Brett; Rivera-Torres, Natalia; Bloh, Kevin; Man, Dula; Kmiec, Eric B

    2016-09-09

    The repair of a point mutation can be facilitated by combined activity of a single-stranded oligonucleotide and a CRISPR/Cas9 system. While the mechanism of action of combinatorial gene editing remains to be elucidated, the regulatory circuitry of nucleotide exchange executed by oligonucleotides alone has been largely defined. The presence of the appropriate CRISPR/Cas9 system leads to an enhancement in the frequency of gene editing directed by single-stranded DNA oligonucleotides. While CRISPR/Cas9 executes double-stranded DNA cleavage efficiently, closure of the broken chromosomes is dynamic, as varying degrees of heterogeneity of the cleavage products appear to accompany the emergence of the corrected base pair. We provide a detailed analysis of allelic variance at and surrounding the target site. In one particular case, we report sequence alteration directed by a distinct member of the same gene family. Our data suggests that single-stranded DNA molecules may influence DNA junction heterogeneity created by CRISPR/Cas9.

  2. Effect of Single-Strand Break on Branch Migration and Folding Dynamics of Holliday Junctions

    Science.gov (United States)

    Palets, Dmytro; Lushnikov, Alexander Y.; Karymov, Mikhail A.; Lyubchenko, Yuri L.

    2010-01-01

    The Holliday junction (HJ), or four-way junction, is a central intermediate state of DNA for homologous genetic recombination and other genetic processes such as replication and repair. Branch migration is the process by which the exchange of homologous DNA regions occurs, and it can be spontaneous or driven by proteins. Unfolding of the HJ is required for branch migration. Our previous single-molecule fluorescence studies led to a model according to which branch migration is a stepwise process consisting of consecutive migration and folding steps. Folding of the HJ in one of the folded conformations terminates the branch migration phase. At the same time, in the unfolded state HJ rapidly migrates over entire homology region of the HJ in one hop. This process can be affected by irregularities in the DNA double helical structure, so mismatches almost terminate a spontaneous branch migration. Single-stranded breaks or nicks are the most ubiquitous defects in the DNA helix; however, to date, their effect on the HJ branch migration has not been studied. In addition, although nicked HJs are specific substrates for a number of enzymes involved in DNA recombination and repair, the role of this substrate specificity remains unclear. Our main goal in this work was to study the effect of nicks on the efficiency of HJ branch migration and the dynamics of the HJ. To accomplish this goal, we applied two single-molecule methods: atomic force microscopy and fluorescence resonance energy transfer. The atomic force microscopy data show that the nick does not prevent branch migration, but it does decrease the probability that the HJ will pass the DNA lesion. The single-molecule fluorescence resonance energy transfer approaches were instrumental in detailing the effects of nicks. These studies reveal a dramatic change of the HJ dynamics. The nick changes the structure and conformational dynamics of the junctions, leading to conformations with geometries that are different from those

  3. Functional characterization of an alkaline exonuclease and single strand annealing protein from the SXT genetic element of Vibrio cholerae

    Directory of Open Access Journals (Sweden)

    Huang Jian-dong

    2011-04-01

    Full Text Available Abstract Background SXT is an integrating conjugative element (ICE originally isolated from Vibrio cholerae, the bacterial pathogen that causes cholera. It houses multiple antibiotic and heavy metal resistance genes on its ca. 100 kb circular double stranded DNA (dsDNA genome, and functions as an effective vehicle for the horizontal transfer of resistance genes within susceptible bacterial populations. Here, we characterize the activities of an alkaline exonuclease (S066, SXT-Exo and single strand annealing protein (S065, SXT-Bet encoded on the SXT genetic element, which share significant sequence homology with Exo and Bet from bacteriophage lambda, respectively. Results SXT-Exo has the ability to degrade both linear dsDNA and single stranded DNA (ssDNA molecules, but has no detectable endonuclease or nicking activities. Adopting a stable trimeric arrangement in solution, the exonuclease activities of SXT-Exo are optimal at pH 8.2 and essentially require Mn2+ or Mg2+ ions. Similar to lambda-Exo, SXT-Exo hydrolyzes dsDNA with 5'- to 3'-polarity in a highly processive manner, and digests DNA substrates with 5'-phosphorylated termini significantly more effectively than those lacking 5'-phosphate groups. Notably, the dsDNA exonuclease activities of both SXT-Exo and lambda-Exo are stimulated by the addition of lambda-Bet, SXT-Bet or a single strand DNA binding protein encoded on the SXT genetic element (S064, SXT-Ssb. When co-expressed in E. coli cells, SXT-Bet and SXT-Exo mediate homologous recombination between a PCR-generated dsDNA fragment and the chromosome, analogous to RecET and lambda-Bet/Exo. Conclusions The activities of the SXT-Exo protein are consistent with it having the ability to resect the ends of linearized dsDNA molecules, forming partially ssDNA substrates for the partnering SXT-Bet single strand annealing protein. As such, SXT-Exo and SXT-Bet may function together to repair or process SXT genetic elements within infected V

  4. Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems.

    Directory of Open Access Journals (Sweden)

    Pawel Bialk

    Full Text Available Single-stranded DNA oligonucleotides (ssODNs can direct the repair of a single base mutation in human genes. While the regulation of this gene editing reaction has been partially elucidated, the low frequency with which repair occurs has hampered development toward clinical application. In this work a CRISPR/Cas9 complex is employed to induce double strand DNA breakage at specific sites surrounding the nucleotide designated for exchange. The result is a significant elevation in ssODN-directed gene repair, validated by a phenotypic readout. By analysing reaction parameters, we have uncovered restrictions on gene editing activity involving CRISPR/Cas9 complexes. First, ssODNs that hybridize to the non-transcribed strand direct a higher level of gene repair than those that hybridize to the transcribed strand. Second, cleavage must be proximal to the targeted mutant base to enable higher levels of gene editing. Third, DNA cleavage enables a higher level of gene editing activity as compared to single-stranded DNA nicks, created by modified Cas9 (Nickases. Fourth, we calculated the hybridization potential and free energy levels of ssODNs that are complementary to the guide RNA sequences of CRISPRs used in this study. We find a correlation between free energy potential and the capacity of single-stranded oligonucleotides to inhibit specific DNA cleavage activity, thereby indirectly reducing gene editing activity. Our data provide novel information that might be taken into consideration in the design and usage of CRISPR/Cas9 systems with ssODNs for gene editing.

  5. Single-strand conformation polymorphism analysis of candidate genes for reliable identification of alleles by capillary array electrophoresis.

    Science.gov (United States)

    Kuhn, David N; Borrone, James; Meerow, Alan W; Motamayor, Juan C; Brown, J Steven; Schnell, Raymond J

    2005-01-01

    We investigated the reliability of capillary array electrophoresis-single strand conformation polymorphism (CAE-SSCP) to determine if it can be used to identify novel alleles of candidate genes in a germplasm collection. Both strands of three different size fragments (160, 245 and 437 bp) that differed by one or more nucleotides in sequence were analyzed at four different temperatures (18 degrees C, 25 degrees C, 30 degrees C, and 35 degrees C). Mixtures of amplified fragments of either the intron interrupting the C-terminal WRKY domain of the Tc10 locus or the NBS domain of the TcRGH1 locus of Theobroma cacao were electroinjected into all 16 capillaries of an ABI 3100 Genetic Analyzer and analyzed three times at each temperature. Multiplexing of samples of different size range is possible, as intermediate and large fragments were analyzed simultaneously in these experiments. A statistical analysis of the means of the fragment mobilities demonstrated that single-stranded conformers of the fragments could be reliably identified by their mobility at all temperatures and size classes. The order of elution of fragments was not consistent over strands or temperatures for the intermediate and large fragments. If samples are only run once at a single temperature, small fragments could be identified from a single strand at a single temperature. A combination of data from both strands of a single run was needed to identify correctly all four of the intermediate fragments and no combination of data from strands or temperatures would allow the correct identification of two large fragments that differed by only a single single-nucleotide polymorphism (SNP) from a single run. Thus, to adequately assess alleles at a candidate gene locus using SSCP on a capillary array, fragments should be strands and both temperatures, and undenatured double-stranded (ds)DNA molecular weight standards, such as ROX 2500, should be included as internal standards.

  6. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  7. Molecular typing of isolates of the fish pathogen, Flavobacterium columnare, by single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Olivares-Fuster, Oscar; Shoemaker, Craig A; Klesius, Phillip H; Arias, Covadonga R

    2007-04-01

    Flavobacterium columnare intraspecies diversity was revealed by analyzing the 16S rRNA gene and the 16S-23S internal spacer region (ISR). Standard restriction fragment length polymorphism (RFLP) of these sequences was compared with single-strand conformation polymorphism (SSCP). Diversity indexes showed that both 16S-SSCP and ISR-SSCP improved resolution (D>or=0.9) when compared with standard RFLP. ISR-SSCP offered a simpler banding pattern than 16S-SSCP while providing high discrimination between isolates. SSCP analysis of rRNA genes proved to be a simple, rapid, and cost-effective method for routine fingerprinting of F. columnare.

  8. Analysis of sequence variation in Gnathostoma spinigerum mitochondrial DNA by single-strand conformation polymorphism analysis and DNA sequence.

    Science.gov (United States)

    Ngarmamonpirat, Charinthon; Waikagul, Jitra; Petmitr, Songsak; Dekumyoy, Paron; Rojekittikhun, Wichit; Anantapruti, Malinee T

    2005-03-01

    Morphological variations were observed in the advance third stage larvae of Gnathostoma spinigerum collected from swamp eel (Fluta alba), the second intermediate host. Larvae with typical and three atypical types were chosen for partial cytochrome c oxidase subunit I (COI) gene sequence analysis. A 450 bp polymerase chain reaction product of the COI gene was amplified from mitochondrial DNA. The variations were analyzed by single-strand conformation polymorphism and DNA sequencing. The nucleotide variations of the COI gene in the four types of larvae indicated the presence of an intra-specific variation of mitochondrial DNA in the G. spinigerum population.

  9. Ligation of double-stranded and single-stranded [Oligo(dT)] DNA by vaccinia virus DNA ligase

    OpenAIRE

    1996-01-01

    Vaccinia virus DNA ligase has been expressed in Escherichia coli, purified, and biochemically characterized. The enzyme ligates double-stranded (ds) DNA substrates with either cohesive or blunt-end termini and the latter reaction is stimulated by PEG. Vaccinia virus DNA ligase can also ligate oligo(dT) when annealed to either a poly(dA) or a poly(rA) backbone and, remarkably, free oligo(dT). This ligation of a single-stranded (ss) substrate is unique among eukaryotic DNA ligases. The enzyme r...

  10. The yeast recombinational repair protein Rad59 interacts with Rad52 and stimulates single-strand annealing.

    OpenAIRE

    Davis, A P; Symington, L. S.

    2001-01-01

    The yeast RAD52 gene is essential for homology-dependent repair of DNA double-strand breaks. In vitro, Rad52 binds to single- and double-stranded DNA and promotes annealing of complementary single-stranded DNA. Genetic studies indicate that the Rad52 and Rad59 proteins act in the same recombination pathway either as a complex or through overlapping functions. Here we demonstrate physical interaction between Rad52 and Rad59 using the yeast two-hybrid system and co-immunoprecipitation from yeas...

  11. Electroporation and microinjection successfully deliver single-stranded and duplex DNA into live cells as detected by FRET measurements.

    Directory of Open Access Journals (Sweden)

    Rosemary A Bamford

    Full Text Available Förster resonance energy transfer (FRET technology relies on the close proximity of two compatible fluorophores for energy transfer. Tagged (Cy3 and Cy5 complementary DNA strands forming a stable duplex and a doubly-tagged single strand were shown to demonstrate FRET outside of a cellular environment. FRET was also observed after transfecting these DNA strands into fixed and live cells using methods such as microinjection and electroporation, but not when using lipid based transfection reagents, unless in the presence of the endosomal acidification inhibitor bafilomycin. Avoiding the endocytosis pathway is essential for efficient delivery of intact DNA probes into cells.

  12. Mechanisms Responsible for High Energy Radiation Induced Damage to Single-Stranded DNA Modified by Radiosensitizing 5-Halogenated Deoxyuridines.

    Science.gov (United States)

    Wang, Shoushan; Zhao, Peiwen; Zhang, Changzhe; Bu, Yuxiang

    2016-03-17

    Experimental studies showed that high energy radiation induced base release and DNA backbone breaks mainly occur at the neighboring 5' nucleotide when a single-stranded DNA is modified by radiosensitizing 5-halogenated deoxyuridines. However, no mechanism can be used to interpret these experimental observations. To better understand the radiosensitivity of 5-halogenated deoxyuridines, mechanisms involving hydrogen abstraction by the uracil-5-yl radical from the C2' and C3' positions of an adjacent nucleotide separately followed by the C3'-O3' or N-glycosidic bond rupture and the P-O3' bond breakage are investigated in the DNA sequence 5'-TU(•)-3' employing density functional theory calculations in the present study. It is found that hydrogen abstractions from both positions are comparable with the one from the C2' site slightly more favorable. The N-glycosidic bond cleavage in the neighboring 5' nucleotide following the internucleotide C2'-Ha abstraction is estimated to have the lowest activation free energies, indicating that the adjacent 5' base release dominates electron induced damage to single-stranded DNA incorporated by 5-halogenated deoxyuridines. Relative to the P-O3' bond breakage after the internucleotide C3'-H abstraction, the C3'-O3' bond rupture in the neighboring 5' nucleotide following the internucleotide C2'-Ha abstraction is predicted to have a lower activation free energy, implying that single-stranded DNA backbone breaks are prone to occur at the C3'-O3' bond site. The 5'-TU(•)-3' species has substantial electron affinity and can even capture a hydrated electron, forming the 5'-TU(-)-3' anion. However, the electron induced C3'-O3' bond rupture in 5'-TU(-)-3' anion via a pathway of internucleotide proton abstraction is only minor in both the gas phase and aqueous solution. The present theoretical predictions can interpret rationally experimental observations, thereby demonstrating that the mechanisms proposed here are responsible for high

  13. The crystal structure of a replicative hexameric helicase DnaC and its complex with single-stranded DNA

    OpenAIRE

    Lo, Yu-Hua; Tsai, Kuang-Lei; Sun, Yuh-Ju; Chen, Wei-Ti; Huang, Cheng-Yang; Hsiao, Chwan-Deng

    2008-01-01

    DNA helicases are motor proteins that play essential roles in DNA replication, repair and recombination. In the replicative hexameric helicase, the fundamental reaction is the unwinding of duplex DNA; however, our understanding of this function remains vague due to insufficient structural information. Here, we report two crystal structures of the DnaB-family replicative helicase from Geobacillus kaustophilus HTA426 (GkDnaC) in the apo-form and bound to single-stranded DNA (ssDNA). The GkDnaC–...

  14. Non-uniform binding of single-stranded DNA binding proteins to hybrids of single-stranded DNA and single-walled carbon nanotubes observed by atomic force microscopy in air and in liquid

    Science.gov (United States)

    Umemura, Kazuo; Ishizaka, Kei; Nii, Daisuke; Izumi, Katsuki

    2016-12-01

    Using atomic force spectroscopy (AFM), we observed hybrids of single-stranded DNA (ssDNA) and single-walled carbon nanotubes (SWNTs) with or without protein molecules in air and in an aqueous solution. This is the first report of ssDNA-SWNT hybrids with proteins in solution analyzed by AFM. In the absence of protein, the height of the ssDNA-SWNT hybrids was 1.1 ± 0.3 nm and 2.4 ± 0.6 nm in air and liquid, respectively, suggesting that the ssDNA molecules adopted a flexible structure on the SWNT surface. In the presence of single-stranded DNA binding (SSB) proteins, the heights of the hybrids in air and liquid increased to 6.4 ± 3.1 nm and 10.0 ± 4.5 nm, respectively. The AFM images clearly showed binding of the SSB proteins to the ssDNA-SWNT hybrids. The morphology of the SSB-ssDNA-SWNT hybrids was non-uniform, particularly in aqueous solution. The variance of hybrid height was quantitatively estimated by cross-section analysis along the long-axis of each hybrid. The SSB-ssDNA-SWNT hybrids showed much larger variance than the ssDNA-SWNT hybrids.

  15. Replication protein A: single-stranded DNA's first responder: dynamic DNA-interactions allow replication protein A to direct single-strand DNA intermediates into different pathways for synthesis or repair.

    Science.gov (United States)

    Chen, Ran; Wold, Marc S

    2014-12-01

    Replication protein A (RPA), the major single-stranded DNA-binding protein in eukaryotic cells, is required for processing of single-stranded DNA (ssDNA) intermediates found in replication, repair, and recombination. Recent studies have shown that RPA binding to ssDNA is highly dynamic and that more than high-affinity binding is needed for function. Analysis of DNA binding mutants identified forms of RPA with reduced affinity for ssDNA that are fully active, and other mutants with higher affinity that are inactive. Single molecule studies showed that while RPA binds ssDNA with high affinity, the RPA complex can rapidly diffuse along ssDNA and be displaced by other proteins that act on ssDNA. Finally, dynamic DNA binding allows RPA to prevent error-prone repair of double-stranded breaks and promote error-free repair. Together, these findings suggest a new paradigm where RPA acts as a first responder at sites with ssDNA, thereby actively coordinating DNA repair and DNA synthesis. © 2014 WILEY Periodicals, Inc.

  16. Msh2 blocks an alternative mechanism for non-homologous tail removal during single-strand annealing in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Glenn M Manthey

    Full Text Available Chromosomal translocations are frequently observed in cells exposed to agents that cause DNA double-strand breaks (DSBs, such as ionizing radiation and chemotherapeutic drugs, and are often associated with tumors in mammals. Recently, translocation formation in the budding yeast, Saccharomyces cerevisiae, has been found to occur at high frequencies following the creation of multiple DSBs adjacent to repetitive sequences on non-homologous chromosomes. The genetic control of translocation formation and the chromosome complements of the clones that contain translocations suggest that translocation formation occurs by single-strand annealing (SSA. Among the factors important for translocation formation by SSA is the central mismatch repair (MMR and homologous recombination (HR factor, Msh2. Here we describe the effects of several msh2 missense mutations on translocation formation that suggest that Msh2 has separable functions in stabilizing annealed single strands, and removing non-homologous sequences from their ends. Additionally, interactions between the msh2 alleles and a null allele of RAD1, which encodes a subunit of a nuclease critical for the removal of non-homologous tails suggest that Msh2 blocks an alternative mechanism for removing these sequences. These results suggest that Msh2 plays multiple roles in the formation of chromosomal translocations following acute levels of DNA damage.

  17. Size-controllable DNA nanoribbons assembled from three types of reusable brick single-strand DNA tiles.

    Science.gov (United States)

    Shi, Xiaolong; Chen, Congzhou; Li, Xin; Song, Tao; Chen, Zhihua; Zhang, Zheng; Wang, Yanfeng

    2015-11-21

    Precise control of nanostructure is a significant goal shared by supramolecular chemistry, nanotechnology and materials science. In DNA nanotechnology, methods of constructing desired DNA nanostructures using programmable DNA strands have been studied extensively and have become a promising branch of research, but developing universal and low-cost (in the sense of using fewer types of DNA strands) methods remains a challenge. In this work, we propose a novel approach to assemble size-controllable DNA nanoribbons with three types of reusable brick SSTs (single-stranded DNA tiles), where the control of ribbon size is achieved by regulating the concentration ratio between manipulative strands and packed single-stranded DNA tiles. In our method, three types of brick SSTs are sufficient in assembling DNA nanoribbons of different sizes, which is much less than the number of types of unique tile-programmable assembling strategy, thus achieving a universal and low-cost method. The assembled DNA nanoribbons are observed and analyzed by atomic force microscopy (AFM). Experimental observations strongly suggest the feasibility and reliability of our method.

  18. Packaging signals in two single-stranded RNA viruses imply a conserved assembly mechanism and geometry of the packaged genome.

    Science.gov (United States)

    Dykeman, Eric C; Stockley, Peter G; Twarock, Reidun

    2013-09-09

    The current paradigm for assembly of single-stranded RNA viruses is based on a mechanism involving non-sequence-specific packaging of genomic RNA driven by electrostatic interactions. Recent experiments, however, provide compelling evidence for sequence specificity in this process both in vitro and in vivo. The existence of multiple RNA packaging signals (PSs) within viral genomes has been proposed, which facilitates assembly by binding coat proteins in such a way that they promote the protein-protein contacts needed to build the capsid. The binding energy from these interactions enables the confinement or compaction of the genomic RNAs. Identifying the nature of such PSs is crucial for a full understanding of assembly, which is an as yet untapped potential drug target for this important class of pathogens. Here, for two related bacterial viruses, we determine the sequences and locations of their PSs using Hamiltonian paths, a concept from graph theory, in combination with bioinformatics and structural studies. Their PSs have a common secondary structure motif but distinct consensus sequences and positions within the respective genomes. Despite these differences, the distributions of PSs in both viruses imply defined conformations for the packaged RNA genomes in contact with the protein shell in the capsid, consistent with a recent asymmetric structure determination of the MS2 virion. The PS distributions identified moreover imply a preferred, evolutionarily conserved assembly pathway with respect to the RNA sequence with potentially profound implications for other single-stranded RNA viruses known to have RNA PSs, including many animal and human pathogens.

  19. Cytoplasmic and nuclear quality control and turnover of single-stranded RNA modulate post-transcriptional gene silencing in plants

    Science.gov (United States)

    Moreno, Ana Beatriz; Martínez de Alba, Angel Emilio; Bardou, Florian; Crespi, Martin D.; Vaucheret, Hervé; Maizel, Alexis; Mallory, Allison C.

    2013-01-01

    Eukaryotic RNA quality control (RQC) uses both endonucleolytic and exonucleolytic degradation to eliminate dysfunctional RNAs. In addition, endogenous and exogenous RNAs are degraded through post-transcriptional gene silencing (PTGS), which is triggered by the production of double-stranded (ds)RNAs and proceeds through short-interfering (si)RNA-directed ARGONAUTE-mediated endonucleolytic cleavage. Compromising cytoplasmic or nuclear 5′–3′ exoribonuclease function enhances sense-transgene (S)-PTGS in Arabidopsis, suggesting that these pathways compete for similar RNA substrates. Here, we show that impairing nonsense-mediated decay, deadenylation or exosome activity enhanced S-PTGS, which requires host RNA-dependent RNA polymerase 6 (RDR6/SGS2/SDE1) and SUPPRESSOR OF GENE SILENCING 3 (SGS3) for the transformation of single-stranded RNA into dsRNA to trigger PTGS. However, these RQC mutations had no effect on inverted-repeat–PTGS, which directly produces hairpin dsRNA through transcription. Moreover, we show that these RQC factors are nuclear and cytoplasmic and are found in two RNA degradation foci in the cytoplasm: siRNA-bodies and processing-bodies. We propose a model of single-stranded RNA tug-of-war between RQC and S-PTGS that ensures the correct partitioning of RNA substrates among these RNA degradation pathways. PMID:23482394

  20. Nuclear oscillations and nuclear filament formation accompany single-strand annealing repair of a dicentric chromosome in Saccharomyces cerevisiae.

    Science.gov (United States)

    Thrower, Douglas A; Stemple, Jennifer; Yeh, Elaine; Bloom, Kerry

    2003-02-01

    Dicentric chromosomes undergo breakage during mitosis as a result of the attachment of two centromeres on one sister chromatid to opposite spindle poles. Studies utilizing a conditional dicentric chromosome III in Saccharomyces cerevisiae have shown that dicentric chromosome repair occurs primarily by deletion of one centromere via a RAD52-dependent recombination pathway. We report that dicentric chromosome resolution requires RAD1, a gene involved in the single-strand annealing DNA repair pathway. We additionally show that single-strand annealing repair of a dicentric chromosome can occur in the absence of RAD52. RAD52-independent repair requires the adaptation-defective cdc5-ad allele of the yeast polo kinase and the DNA damage checkpoint gene RAD9. Dicentric chromosome breakage in cdc5-ad rad52 mutant cells is associated with a prolonged mitotic arrest, during which nuclei undergo microtubule-dependent oscillations, accompanied by dynamic changes in nuclear morphology. We further demonstrate that the frequency of spontaneous direct repeat recombination is suppressed in yeast cells treated with benomyl, a drug that perturbs microtubules. Our findings indicate that microtubule-dependent processes facilitate recombination.

  1. A distinct single-stranded DNA-binding protein encoded by the Lactococcus lactis bacteriophage bIL67.

    Science.gov (United States)

    Szczepanska, Agnieszka K; Bidnenko, Elena; Płochocka, Danuta; McGovern, Stephen; Ehrlich, S Dusko; Bardowski, Jacek; Polard, Patrice; Chopin, Marie-Christine

    2007-06-20

    Single-stranded binding proteins (SSBs) are found to participate in various processes of DNA metabolism in all known organisms. We describe here a SSB protein encoded by the Lactococcus lactis phage bIL67 orf14 gene. It is the first noted attempt at characterizing a SSB protein from a lactococcal phage. The purified Orf14(bIL67) binds unspecifically to ssDNA with the same high affinity as the canonical Bacillus subtilis SSB. Electrophoretic mobility-shift assays performed with mutagenized Orf14(bIL67) protein derivatives suggest that ssDNA-binding occurs via a putative OB-fold structure predicted by three-dimensional modeling. The native Orf14(bIL67) forms homotetramers as determined by gel filtration studies. These results allow distinguishing the first lactococcal phage protein with single-strand binding affinity, which defines a novel cluster of phage SSBs proteins. The possible role of Orf14(bIL67) in phage multiplication cycle is also discussed.

  2. Specific targeted gene repair using single-stranded DNA oligonucleotides at an endogenous locus in mammalian cells uses homologous recombination.

    Science.gov (United States)

    McLachlan, Jennifer; Fernandez, Serena; Helleday, Thomas; Bryant, Helen E

    2009-12-03

    The feasibility of introducing point mutations in vivo using single-stranded DNA oligonucleotides (ssON) has been demonstrated but the efficiency and mechanism remain elusive and potential side effects have not been fully evaluated. Understanding the mechanism behind this potential therapy may help its development. Here, we demonstrate the specific repair of an endogenous non-functional hprt gene by a ssON in mammalian cells, and show that the frequency of such an event is enhanced when cells are in S-phase of the cell cycle. A potential barrier in using ssONs as gene therapy could be non-targeted mutations or gene rearrangements triggered by the ssON. Both the non-specific mutation frequencies and the frequency of gene rearrangements were largely unaffected by ssONs. Furthermore, we find that the introduction of a mutation causing the loss of a functional endogenous hprt gene by a ssON occurred at a similarly low but statistically significant frequency in wild type cells and in cells deficient in single strand break repair, nucleotide excision repair and mismatch repair. However, this mutation was not induced in XRCC3 mutant cells deficient in homologous recombination. Thus, our data suggest ssON-mediated targeted gene repair is more efficient in S-phase and involves homologous recombination.

  3. Discovery, Prevalence, and Persistence of Novel Circular Single-Stranded DNA Viruses in the Ctenophores Mnemiopsis leidyi and Beroe ovata.

    Science.gov (United States)

    Breitbart, Mya; Benner, Bayleigh E; Jernigan, Parker E; Rosario, Karyna; Birsa, Laura M; Harbeitner, Rachel C; Fulford, Sidney; Graham, Carina; Walters, Anna; Goldsmith, Dawn B; Berger, Stella A; Nejstgaard, Jens C

    2015-01-01

    Gelatinous zooplankton, such as ctenophores and jellyfish, are important components of marine and brackish ecosystems and play critical roles in aquatic biogeochemistry. As voracious predators of plankton, ctenophores have key positions in aquatic food webs and are often successful invaders when introduced to new areas. Gelatinous zooplankton have strong impacts on ecosystem services, particularly in coastal environments. However, little is known about the factors responsible for regulating population dynamics of gelatinous organisms, including biological interactions that may contribute to bloom demise. Ctenophores are known to contain specific bacterial communities and a variety of invertebrate parasites and symbionts; however, no previous studies have examined the presence of viruses in these organisms. Building upon recent studies demonstrating a diversity of single-stranded DNA viruses that encode a replication initiator protein (Rep) in aquatic invertebrates, this study explored the presence of circular, Rep-encoding single-stranded DNA (CRESS-DNA) viruses in the ctenophores Mnemiopsis leidyi and Beroe ovata collected from the Skidaway River Estuary and Savannah River in Georgia, USA. Using rolling circle amplification followed by restriction enzyme digestion, this study provides the first evidence of viruses in ctenophores. Investigation of four CRESS-DNA viruses over an 8-month period using PCR demonstrated temporal trends in viral prevalence and indicated that some of the viruses may persist in ctenophore populations throughout the year. Although future work needs to examine the ecological roles of these ctenophore-associated viruses, this study indicates that viral infection may play a role in population dynamics of gelatinous zooplankton.

  4. Effect of Zn2+ and temperature on the conformational equilibrium of single-stranded polyA in neutral solutions.

    Science.gov (United States)

    Sorokin, V A; Valeev, V A; Usenko, E L; Andrushchenko, V V

    2013-10-01

    Effect of Zn(2+) ions on the conformation of polyA in cacodilic buffer at pH 7 was investigated by differential UV spectroscopy (DUV) and by thermal denaturation. The shapes of the DUV spectra and melting curves suggest a transition of polyA into a more ordered "metallized", possibly double-helical conformation at Zn(2+) concentrations above 3×10(-5) M. A phase diagram of polyA complexes with Zn(2+) was constructed for the temperature range from 20 °C to 95 °C and Zn(2+) concentrations between 10(-5) M and 5×10(-4) M. It was found that the transition of a single strand into the "metallized" form is possible only if the length of the disordered single-stranded region becomes larger than a certain critical value, ranging between 98% and 78% as the metal concentration increases from 3×10(-5) to 5×10(-4) M. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Video-based rendering

    CERN Document Server

    Magnor, Marcus A

    2005-01-01

    Driven by consumer-market applications that enjoy steadily increasing economic importance, graphics hardware and rendering algorithms are a central focus of computer graphics research. Video-based rendering is an approach that aims to overcome the current bottleneck in the time-consuming modeling process and has applications in areas such as computer games, special effects, and interactive TV. This book offers an in-depth introduction to video-based rendering, a rapidly developing new interdisciplinary topic employing techniques from computer graphics, computer vision, and telecommunication en

  6. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Directory of Open Access Journals (Sweden)

    Kin Chan

    Full Text Available Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA is more prone to damage than double-strand DNA (dsDNA, due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions

  7. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    Science.gov (United States)

    Chan, Kin; Sterling, Joan F; Roberts, Steven A; Bhagwat, Ashok S; Resnick, Michael A; Gordenin, Dmitry A

    2012-01-01

    Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA) is more prone to damage than double-strand DNA (dsDNA), due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions accurately.

  8. Technical note: Identification of Prototheca species from bovine milk samples by PCR-single strand conformation polymorphism.

    Science.gov (United States)

    Cremonesi, P; Pozzi, F; Ricchi, M; Castiglioni, B; Luini, M; Chessa, S

    2012-12-01

    We report the development of a PCR-single strand conformation polymorphism (SSCP) method to identify Prototheca spp. responsible for bovine mastitis: P. zopfii and P. blaschkeae. The method was set up using reference strains belonging to P. zopfii genotype 1, P. zopfii genotype 2, and P. blaschkeae as target species and P. stagnora, and P. ulmea as negative controls. The assay was applied on 50 isolates of Prototheca spp. isolated from bovine mastitic milk or bulk-tank milk samples, and all isolates were identified as P. zopfii genotype 2. We conclude that the described PCR-SSCP approach is accurate, inexpensive, and highly suitable for the identification of P. zopfii genotype 2 on field isolates but also directly on milk, if preceded by a specific DNA extraction method.

  9. Multiplex and quantitative pathogen detection with high-resolution capillary electrophoresis-based single-strand conformation polymorphism.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Chung, Boram; Na, Jeongkyeong; Jung, Gyoo Yeol

    2013-01-01

    Among the molecular diagnostic methods for bacteria-induced diseases, capillary electrophoresis-based single-strand conformation polymorphism (CE-SSCP) combined with 16S rRNA gene-specific PCR has enormous potential because it can separate sequence variants using a simple procedure. However, conventional CE-SSCP systems have limited resolution and cannot separate most 16S rRNA gene-specific markers into separate peaks. A high-resolution CE-SSCP system that uses a poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) triblock copolymer matrix was recently developed and shown to effectively separate highly similar PCR products. In this report, a protocol for the detection of 12 pathogenic bacteria is provided. Pathogen markers were amplified by PCR using universal primers and separated by CE-SSCP; each marker peak was well separated at baseline and showed a characteristic mobility, allowing the easy identification of the pathogens.

  10. Dynamic Mechanism of Single-Stranded DNA Encapsulated into Single-Wall Carbon Nanotubes: A Molecular Dynamics Simulation Study

    Science.gov (United States)

    Xing, Yan-Fei; Yang, Chuan-Lu; Mo, Yong-Fang; Wang, Mei-Shan; Ma, Xiao-Guang

    2014-02-01

    Hybrids of single-walled carbon nanotubes (SWCNTs) and biological molecules have been utilized for numerous applications in sensing, imaging, and drug delivery. By molecular dynamics simulation, we investigate the encapsulation of single-strand DNA (ssDNA) containing eight adenine bases with (17,17)-(12,12) SWCNTs. The effects of the diameter and length of SWCNTs on the encapsulation process are explored with the calculated curves of the center-of-mass distance, the van der Waals interaction between the ssDNA and SWCNT, the root-mean-square deviation of the ssDNA, and the radius of gyration of the ssDNA. The free energy of the encapsulated ssDNA for each SWCNT is also obtained via steered molecular dynamics simulation. The most suitable SWCNT for encapsulating the ssDNA is also suggested.

  11. Single-stranded DNA detection by solvent-induced assemblies of a metallo-peptide-based complex

    Science.gov (United States)

    Das, Priyadip; Reches, Meital

    2016-05-01

    DNA detection is highly important for the sensitive sensing of different pathogenic bacteria and viruses. The major challenge is to create a sensor that can selectively detect very small concentrations of DNA without the need for amplification or complicated equipment. Different technologies such as optical, electrochemical and microgravimetric approaches can detect DNA fragments. Here we show, for the first time, the use of self-assembled nanostructures generated by a metallo-peptide as an optical sensing platform for DNA detection. The system can selectively detect single stranded DNA fragments by fluorescence measurements as it can discriminate even one base mismatch and can perform in the presence of other interfering proteins. This system may be useful in lab-on-a-chip applications.DNA detection is highly important for the sensitive sensing of different pathogenic bacteria and viruses. The major challenge is to create a sensor that can selectively detect very small concentrations of DNA without the need for amplification or complicated equipment. Different technologies such as optical, electrochemical and microgravimetric approaches can detect DNA fragments. Here we show, for the first time, the use of self-assembled nanostructures generated by a metallo-peptide as an optical sensing platform for DNA detection. The system can selectively detect single stranded DNA fragments by fluorescence measurements as it can discriminate even one base mismatch and can perform in the presence of other interfering proteins. This system may be useful in lab-on-a-chip applications. Electronic supplementary information (ESI) available: Peptide and receptor synthesis, characterization of the final and intermediate products, experimental details and additional figures including SEM, TEM, DLS, XRD, UV analysis and AFM topographic analysis. See DOI: 10.1039/c5nr07714a

  12. Effect of temperature gradients on single-strand conformation polymorphism analysis in a capillary electrophoresis system using Pluronic polymer matrix.

    Science.gov (United States)

    Hwang, Hee Sung; Shin, Gi Won; Park, Han Jin; Ryu, Chang Y; Jung, Gyoo Yeol

    2013-09-02

    Capillary electrophoresis-single strand conformation polymorphism (CE-SSCP) analysis is a prominent bioseparation method based on the mobility diversity caused by sequence-induced conformational differences of single-stranded DNA. The use of Pluronic polymer matrix has opened up new opportunities for CE-SSCP, because it improved the resolution for various genetic analyses. However, there still exists a challenge in optimizing Pluronic-based CE-SSCP, because the physical properties of Pluronic solutions are sensitive to temperature, particularly near the gelation temperature, where the viscoelasticity of Pluronic F108 solutions sharply changes from that of a Newtonian fluid to a hydrogel upon heating. We have focused on a set of experiments to control the ambient temperature of the CE system with the aim of enhancing the reliability of the CE-SSCP analysis by using the Applied Biosystems ABI 3130xl genetic analyzer with Pluronic F108 solution matrix. The ambient temperature control allowed us to vary the inlet and outlet portion of the capillary column, while the temperature of the column was kept at 35°C. The resolution to separate 2 single-base-pair-differing DNA fragments was significantly enhanced by changing the temperature from 19 to 30°C. The viscoelastic properties of the F108 solution matrix upon heating were also investigated by ex situ rheological experiments with an effort to reveal how the development of gels in Pluronic solutions affects the resolution of CE-SSCP. We found that the column inlet and outlet temperatures of the capillary column have to be controlled to optimize the resolution in CE-SSCP by using the Pluronic matrix.

  13. Discovery, prevalence, and persistence of novel circular single-stranded DNA viruses in the ctenophores Mnemiopsis leidyi and Beroe ovata

    Directory of Open Access Journals (Sweden)

    Mya eBreitbart

    2015-12-01

    Full Text Available Gelatinous zooplankton, such as ctenophores and jellyfish, are important components of marine and brackish ecosystems and play critical roles in aquatic biogeochemistry. As voracious predators of plankton, ctenophores have key positions in aquatic food webs and are often successful invaders when introduced to new areas. Gelatinous zooplankton have strong impacts on ecosystem services, particularly in coastal environments. However, little is known about the factors responsible for regulating population dynamics of gelatinous organisms, including biological interactions that may contribute to bloom demise. Ctenophores are known to contain specific bacterial communities and a variety of invertebrate parasites and symbionts; however, no previous studies have examined the presence of viruses in these organisms. Building upon recent studies demonstrating a diversity of single-stranded DNA viruses that encode a replication initiator protein (Rep in aquatic invertebrates, this study explored the presence of circular, Rep-encoding single-stranded DNA (CRESS-DNA viruses in the ctenophores Mnemiopsis leidyi and Beroe ovata collected from the Skidaway River Estuary and Savannah River in Georgia, USA. Using rolling circle amplification followed by restriction enzyme digestion, this study provides the first evidence of viruses in ctenophores. Investigation of four CRESS-DNA viruses over an eight-month period using PCR demonstrated temporal trends in viral prevalence and indicated that some of the viruses may persist in ctenophore populations throughout the year. Although future work needs to examine the ecological roles of these ctenophore-associated viruses, this study indicates that viral infection may play a role in population dynamics of gelatinous zooplankton.

  14. A mechanistic study of electron transfer from the distal termini of electrode-bound, single-stranded DNAs

    Science.gov (United States)

    Uzawa, Takanori; Cheng, Ryan R.; White, Ryan J.; Makarov, Dmitrii E.; Plaxco, Kevin W

    2010-01-01

    Electrode-bound, redox-reporter-modified oligonucleotides play roles in the functioning of a number of electrochemical biosensors, and thus the question of electron transfer through or from such molecules has proven of significant interest. In response, we have experimentally characterized the rate with which electrons are transferred between a methylene blue on the distal end of a short, single-stranded polythymine DNAs to a monolayer-coated gold electrode to which the other end of the DNA is site-specifically attached. We find that this rate scales with oligonucleotide length to the −1.16±0.09 power. This weak, approximately inverse length dependence differs dramatically from the much stronger dependencies observed for the rates of end-to-end collisions in single-stranded DNA and through-oligonucleotide electron hopping. It instead coincides with the expected length dependence of a reaction-limited process in which the overall rate is proportional to the equilibrium probability that the end of the oligonucleotide chain approaches the surface. Studies of the ionic strength and viscosity dependencies of electron transfer further support this “chain-flexibility” mechanism, and studies of the electron transfer rate of methylene blue attached to the hexanethiol monolayer suggest that heterogeneous electron transfer through the monolayer is rate limiting. Thus, under the circumstances we have employed, the flexibility (i.e., the equilibrium statistical properties) of the oligonucleotide chain defines the rate with which an attached redox reporter transfers electrons to an underlying electrode, an observation that may be of utility in the design of new biosensor architectures. PMID:20964337

  15. Single Strand Conformation Polymorphism analysis of PCR-amplified rDNA to differentiate medically important Aspergillus Species

    Directory of Open Access Journals (Sweden)

    K Diba

    2008-09-01

    Full Text Available "nBackground: Aspergillus species are associated with allergic bronchopulmonary disease, mycotic keratitis, otomycosis, na­sal sinusitis and invasive infection. In this study, we developed a PCR-Single Strand Confomational Polymorphism method to identify the most common Aspergillus species and we showed some advantages of this method comparing a PCR-Restric­tion Fragment Length Polymorphism with our designed restriction enzyme. "nMethods: We selected ITS2, as a short fragment within the rDNA region (length size: 330 bp to be amplified as small size PCR product. We mixed 5 ml of the PCR product with an equal volume of loading buffer and followed by incubation for 5 min at 95º C and quenching in an ice bath. The mixture was applied to a 6%-12% Gradient Poly acryl amide gel to run in a verti­cal electrophoresis, then gel was stained with ethidium bromide and silver nitrate which followed by an ethidium bro­mide staining. "nResults: Our results of restriction digestion showed a fine identification of 7 tested Aspergillus species dur­ing 5-6 hours af­ter an overnight mycelial growth. As our results some of tested Aspergillus species: A. nidulans, A. fisheri, A. quad­ricincta, (A. fumigatus and A. niger as a group and (A. flavus, A. tereus and A. ochraceus as another group, can be dis­criminated. More­over SSCP analysis enabled us to identify above Aspergillus species within 8-12 h after an over night growth without us­ing an expensive restriction enzyme."nConclusion: It is concluded that Single Strand Conformational Polymorphism is a simple and rapid method for identifica­tion of some medically important Aspergillus.

  16. Discovery of a novel single-stranded DNA virus from a sea turtle fibropapilloma by using viral metagenomics.

    Science.gov (United States)

    Ng, Terry Fei Fan; Manire, Charles; Borrowman, Kelly; Langer, Tammy; Ehrhart, Llewellyn; Breitbart, Mya

    2009-03-01

    Viral metagenomics, consisting of viral particle purification and shotgun sequencing, is a powerful technique for discovering viruses associated with diseases with no definitive etiology, viruses that share limited homology with known viruses, or viruses that are not culturable. Here we used viral metagenomics to examine viruses associated with sea turtle fibropapillomatosis (FP), a debilitating neoplastic disease affecting sea turtles worldwide. By means of purifying and shotgun sequencing the viral community directly from the fibropapilloma of a Florida green sea turtle, a novel single-stranded DNA virus, sea turtle tornovirus 1 (STTV1), was discovered. The single-stranded, circular genome of STTV1 was approximately 1,800 nucleotides in length. STTV1 has only weak amino acid level identities (25%) to chicken anemia virus in short regions of its genome; hence, STTV1 may represent the first member of a novel virus family. A total of 35 healthy turtles and 27 turtles with FP were tested for STTV1 using PCR, and only 2 turtles severely afflicted with FP were positive. The affected turtles were systemically infected with STTV1, since STTV1 was found in blood and all major organs. STTV1 exists as a quasispecies, with several genome variants identified in the fibropapilloma of each positive turtle, suggesting rapid evolution of this virus. The STTV1 variants were identical over the majority of their genomes but contained a hypervariable region with extensive divergence. This study demonstrates the potential of viral metagenomics for discovering novel viruses directly from animal tissue, which can enhance our understanding of viral evolution and diversity.

  17. Characterization of exceptionally thermostable single-stranded DNA-binding proteins from Thermotoga maritima and Thermotoga neapolitana

    Directory of Open Access Journals (Sweden)

    Mickiewicz Małgorzata

    2010-10-01

    Full Text Available Abstract Background In recent years, there has been an increasing interest in SSBs because they find numerous applications in diverse molecular biology and analytical methods. Results We report the characterization of single-stranded DNA binding proteins (SSBs from the thermophilic bacteria Thermotoga maritima (TmaSSB and Thermotoga neapolitana (TneSSB. They are the smallest known bacterial SSB proteins, consisting of 141 and 142 amino acid residues with a calculated molecular mass of 16.30 and 16.58 kDa, respectively. The similarity between amino acid sequences of these proteins is very high: 90% identity and 95% similarity. Surprisingly, both TmaSSB and TneSSB possess a quite low sequence similarity to Escherichia coli SSB (36 and 35% identity, 55 and 56% similarity, respectively. They are functional as homotetramers containing one single-stranded DNA binding domain (OB-fold in each monomer. Agarose mobility assays indicated that the ssDNA-binding site for both proteins is salt independent, and fluorescence spectroscopy resulted in a size of 68 ± 2 nucleotides. The half-lives of TmaSSB and TneSSB were 10 h and 12 h at 100°C, respectively. When analysed by differential scanning microcalorimetry (DSC the melting temperature (Tm was 109.3°C and 112.5°C for TmaSSB and TneSSB, respectively. Conclusion The results showed that TmaSSB and TneSSB are the most thermostable SSB proteins identified to date, offering an attractive alternative to TaqSSB and TthSSB in molecular biology applications, especially with using high temperature e. g. polymerase chain reaction (PCR.

  18. Single strand annealing and ATP-independent strand exchange activities of yeast and human DNA2: possible role in Okazaki fragment maturation.

    Science.gov (United States)

    Masuda-Sasa, Taro; Polaczek, Piotr; Campbell, Judith L

    2006-12-15

    The Dna2 protein is a multifunctional enzyme with 5'-3' DNA helicase, DNA-dependent ATPase, 3' exo/endonuclease, and 5' exo/endonuclease. The enzyme is highly specific for structures containing single-stranded flaps adjacent to duplex regions. We report here two novel activities of both the yeast and human Dna2 helicase/nuclease protein: single strand annealing and ATP-independent strand exchange on short duplexes. These activities are independent of ATPase/helicase and nuclease activities in that mutations eliminating either nuclease or ATPase/helicase do not inhibit strand annealing or strand exchange. ATP inhibits strand exchange. A model rationalizing the multiple catalytic functions of Dna2 and leading to its coordination with other enzymes in processing single-stranded flaps during DNA replication and repair is presented.

  19. Salt Dependence of the Radius of Gyration and Flexibility of Single-stranded DNA in Solution probed by Small-angle X-ray Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Sim, Adelene Y.L.; Lipfert, Jan; Herschlag, Daniel; Doniach, Sebastian

    2012-07-06

    Short single-stranded nucleic acids are ubiquitous in biological processes and understanding their physical properties provides insights to nucleic acid folding and dynamics. We used small angle x-ray scattering to study 8-100 residue homopolymeric single-stranded DNAs in solution, without external forces or labeling probes. Poly-T's structural ensemble changes with increasing ionic strength in a manner consistent with a polyelectrolyte persistence length theory that accounts for molecular flexibility. For any number of residues, poly-A is consistently more elongated than poly-T, likely due to the tendency of A residues to form stronger base-stacking interactions than T residues.

  20. Similar diversity of Alphaproteobacteria and nitrogenase gene amplicons on two related Sphagnum mosses

    Directory of Open Access Journals (Sweden)

    Anastasia eBragina

    2012-01-01

    Full Text Available Sphagnum mosses represent a main component in ombrotrophic wetlands. They harbor a specific and diverse microbial community with essential functions for the host. To understand extend and degree of host specificity, Sphagnum fallax and S. angustifolium, two phylogenetically closely related species, which show distinct habitat preference with respect to the nutrient level, were analyzed by a multifaceted approach. Microbial fingerprints obtained by PCR-SSCP (single-strand conformation polymorphism using universal, group-specific and functional primers were highly similar. Similarity was confirmed for colonization patterns obtained by fluorescence in situ hybridization (FISH coupled with confocal laser scanning microscopy (CLSM: Alphaproteobacteria were the main colonizers inside the hyaline cells of Sphagnum leaves. A deeper survey of Alphaproteobacteria by 16S rRNA gene amplicon sequencing reveals a high diversity with Acidocella, Acidisphaera, Rhodopila and Phenylobacterium as major genera for both mosses. Pathogen defense and nitrogen fixation are important functions of Sphagnum-associated bacteria, which are fulfilled by microbial communities of both Sphagna in a similar way. NifH libraries of Sphagnum-associated microbial communities were characterized by high diversity and abundance of Alphaproteobacteria but contained also diverse amplicons of other taxa, e.g. Cyanobacteria, Geobacter and Spirochaeta. Statistically significant differences between the microbial communities of both Sphagnum species could not be discovered in any of the experimental approach. Our results show that the same close relationship, which exists between the physical, morphological and chemical characteristics of Sphagnum mosses and the ecology and function of bog ecosystems, also connects moss plantlets with their associated bacterial communities.

  1. Changes in the infrared microspectroscopic characteristics of DNA caused by cationic elements, different base richness and single-stranded form.

    Directory of Open Access Journals (Sweden)

    Maria Luiza S Mello

    Full Text Available BACKGROUND: The infrared (IR analysis of dried samples of DNA and DNA-polypeptide complexes is still scarce. Here we have studied the FT-IR profiles of these components to further the understanding of the FT-IR signatures of chromatin and cell nuclei. METHODOLOGY/PRINCIPAL FINDINGS: Calf thymus and salmon testis DNA, and complexes of histone H1, protamine, poly-L-lysine and poly-L-arginine (histone-mimic macromolecules with DNA were analyzed in an IR microspectroscope equipped with an attenuated total reflection diamond objective and Grams software. Conditions including polypeptides bound to the DNA, DNA base composition, and single-stranded form were found to differently affect the vibrational characteristics of the chemical groups (especially, PO(2(- in the nucleic acid. The antisymmetric stretching (ν(as of the DNA PO(2(- was greater than the symmetric stretching (ν(s of these groups and increased in the polypeptide-DNA complexes. A shift of the ν(as of the DNA PO(2(- to a lower frequency and an increased intensity of this vibration were induced especially by lysine-rich histones. Lysine richness additionally contributed to an increase in the vibrational stretching of the amide I group. Even in simple molecules such as inorganic phosphates, the vibrational characteristics of the phosphate anions were differently affected by different cations. As a result of the optimization of the DNA conformation by binding to arginine-rich polypeptides, enhancements of the vibrational characteristics in the FT-IR fingerprint could be detected. Although different profiles were obtained for the DNA with different base compositions, this situation was no longer verified in the polypeptide-DNA complexes and most likely in isolated chromatin or cell nuclei. However, the ν(as PO(2(-/ν(s PO(2(- ratio could discriminate DNA with different base compositions and DNA in a single-stranded form. CONCLUSIONS/SIGNIFICANCE: FT-IR spectral profiles are a valuable tool

  2. Synergistic decrease of DNA single-strand break repair rates in mouse neural cells lacking both Tdp1 and aprataxin

    Science.gov (United States)

    El-Khamisy, Sherif F.; Katyal, Sachin; Patel, Poorvi; Ju, Limei; McKinnon, Peter J.; Caldecott, Keith W.

    2009-01-01

    Ataxia oculomotor apraxia-1 (AOA1) is an autosomal recessive neurodegenerative disease that results from mutations of aprataxin (APTX). APTX associates with the DNA single- and double-strand break repair machinery and is able to remove AMP from 5′-termini at DNA strand breaks in vitro. However, attempts to establish a DNA strand break repair defect in APTX-defective cells have proved conflicting and unclear. We reasoned that this may reflect that DNA strand breaks with 5′-AMP represent only a minor subset of breaks induced in cells, and/or the availability of alternative mechanisms for removing AMP from 5′-termini. Here, we have attempted to increase the dependency of chromosomal single- and double-strand break repair on aprataxin activity by slowing the rate of repair of 3′-termini in aprataxin-defective neural cells, thereby increasing the likelihood that the 5′-termini at such breaks become adenylated and/or block alternative repair mechanisms. To do this, we generated a mouse model in which APTX is deleted together with tyrosyl DNA phosphodiesterase (TDP1), an enzyme that repairs 3′-termini at a subset of single-strand breaks (SSBs), including those with 3′-topoisomerase-1 (Top1) peptide. Notably, the global rate of repair of oxidative and alkylation-induced SSBs was significantly slower in Tdp1−/−/Aptx−/− double knockout quiescent mouse astrocytes compared with Tdp1−/− or Aptx−/− single knockouts. In contrast, camptothecin-induced Top1-SSBs accumulated to similar levels in Tdp1−/− and Tdp1−/−/Aptx−/− double knockout astrocytes. Finally, we failed to identify a measurable defect in double-strand break repair in Tdp1−/−, Aptx−/− or Tdp1−/−/Aptx−/− astrocytes. These data provide direct evidence for a requirement for aprataxin during chromosomal single-strand break repair in primary neural cells lacking Tdp1. PMID:19303373

  3. Spectroscopic characterization of the interaction of phenosafranin and safranin O with double stranded, heat denatured and single stranded calf thymus DNA.

    Science.gov (United States)

    Saha, Ishita; Kumar, Gopinatha Suresh

    2011-01-01

    Interaction of phenosafranin and safranin O with double stranded, heat denatured and single stranded calf thymus DNA has been studied by fluorescence, absorbance and circular dichroic techniques. Binding to the double stranded and heat denatured DNA conformations induced strong quenching in the fluorescence spectra of both dyes. Linear Scatchard plots indicated the binding to be of one type and the affinity evaluated to be of the order of 10(5) M(-1) with double stranded and heat denatured DNAs. Fluorescence quenching was much weaker with the single stranded DNA and the binding affinity was one order lower. Ferrocyanide quenching studies revealed that the fluorescence emission of the dye molecules bound to the double stranded and heat denatured DNAs was quenched much less compared to that bound to the single stranded DNA. Further, there was significant emission polarization for the bound dyes and strong energy transfer from the DNA base pairs to the dye molecules indicating intercalative binding. Salt dependence of the binding phenomenon revealed that electrostatic forces have significant role in the binding process. The intercalation of these molecules to double stranded and heat denatured DNA and simple stacking to single strands was proved by these fluorescence techniques. Support to the fluorescence results have been derived from absorption and circular dichroic results. Phenosafranin was revealed to be a stronger binding species compared to safranin O.

  4. Novel function of the poly(c)-binding protein α-CP2 as a transcriptional activator that binds to single-stranded DNA sequences.

    Science.gov (United States)

    Kang, Duk-Hee; Song, Kyu Young; Wei, Li-Na; Law, Ping-Yee; Loh, Horace H; Choi, Hack Sun

    2013-11-01

    α-complex protein 2 (α-CP2) is known as an RNA-binding protein that interacts in a sequence-specific manner with single-stranded polycytosine [poly(C)]. This protein is involved in various post-transcriptional regulations, such as mRNA stabilization and translational regulation. In this study, the full-length mouse α-CP2 gene was expressed in an insoluble form with an N-terminal histidine tag in Escherichia coli and purified for homogeneity using affinity column chromatography. Its identity was confirmed using matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. Recombinant α-CP2 was expressed and refolded. The protein folding conditions for denatured α-CP2 were optimized. DNA and RNA electrophoretic mobility shift assays demonstrated that the recombinant α-CP2 is capable of binding to both single-stranded DNA and RNA poly(C) sequences. Furthermore, plasmids expressing α-CP2 activated the expression of a luciferase reporter when co-transfected with a single-stranded (pGL-SS) construct containing a poly(C) sequence. To our knowledge, this study demonstrates for the first time that α-CP2 functions as a transcriptional activator by binding to a single-stranded poly(C) sequence.

  5. Rendering the Topological Spines

    Energy Technology Data Exchange (ETDEWEB)

    Nieves-Rivera, D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2015-05-05

    Many tools to analyze and represent high dimensional data already exits yet most of them are not flexible, informative and intuitive enough to help the scientists make the corresponding analysis and predictions, understand the structure and complexity of scientific data, get a complete picture of it and explore a greater number of hypotheses. With this in mind, N-Dimensional Data Analysis and Visualization (ND²AV) is being developed to serve as an interactive visual analysis platform with the purpose of coupling together a number of these existing tools that range from statistics, machine learning, and data mining, with new techniques, in particular with new visualization approaches. My task is to create the rendering and implementation of a new concept called topological spines in order to extend ND²AV's scope. Other existing visualization tools create a representation preserving either the topological properties or the structural (geometric) ones because it is challenging to preserve them both simultaneously. Overcoming such challenge by creating a balance in between them, the topological spines are introduced as a new approach that aims to preserve them both. Its render using OpenGL and C++ and is currently being tested to further on be implemented on ND²AV. In this paper I will present what are the Topological Spines and how they are rendered.

  6. Interaction of bacteriophage T4 and T7 single-stranded DNA-binding proteins with DNA

    Science.gov (United States)

    Shokri, Leila; Rouzina, Ioulia; Williams, Mark C.

    2009-06-01

    Bacteriophages T4 and T7 are well-studied model replication systems, which have allowed researchers to determine the roles of many proteins central to DNA replication, recombination and repair. Here we summarize and discuss the results from two recently developed single-molecule methods to determine the salt-dependent DNA-binding kinetics and thermodynamics of the single-stranded DNA (ssDNA)-binding proteins (SSBs) from these systems. We use these methods to characterize both the equilibrium double-stranded DNA (dsDNA) and ssDNA binding of the SSBs T4 gene 32 protein (gp32) and T7 gene 2.5 protein (gp2.5). Despite the overall two-orders-of-magnitude weaker binding of gp2.5 to both forms of DNA, we find that both proteins exhibit four-orders-of-magnitude preferential binding to ssDNA relative to dsDNA. This strong preferential ssDNA binding as well as the weak dsDNA binding is essential for the ability of both proteins to search dsDNA in one dimension to find available ssDNA-binding sites at the replication fork.

  7. The application of single strand conformation polymorphism (SSCP) analysis in determining Hepatitis E virus intra-host diversity.

    Science.gov (United States)

    Černi, S; Prpić, J; Jemeršić, L; Škorić, D

    2015-09-01

    Genetic heterogeneity of RNA populations influences virus pathogenesis, epidemiology and evolution. Therefore, accurate information regarding virus genetic structure is highly important for both diagnostic and scientific purposes. For the Hepatitis E virus (HEV), the causal agent of hepatitis in humans, the intra-host population structure has been poorly investigated, mainly using the less sensitive RFLP-based approach. The objective of this study was to assess the suitability and the accuracy of single strand conformation polymorphism (SSCP) analysis, a well-established tool in genetic variation research, for the characterization of HEV quasispecies. The analysis was conducted on 50 clones of five swine isolates and 30 clones of three human HEV isolates. To identify and quantify the sequence variants present in each HEV isolate, 348bp long fragments of the amplified conserved ORF2 region were separated by cloning. Ten clones per isolate were subjected to SSCP and sequenced in a parallel experiment. The results show a high correlation of SSCP haplotype profiling with the sequencing results, confirming the sensitivity and reliability of this simple, rapid and low cost approach in the characterization of HEV quasispecies.

  8. Single nucleotide polymorphisms in the ovine casein genes detected by polymerase chain reaction-single strand conformation polymorphism.

    Science.gov (United States)

    Ceriotti, G; Chessa, S; Bolla, P; Budelli, E; Bianchi, L; Duranti, E; Caroli, A

    2004-08-01

    Casein genetic polymorphisms are important and well known due to their effects on quantitative traits and technological properties of milk. At the DNA level, polymerase chain reaction (PCR)-single-strand conformation polymorphism (SSCP) allows for the simultaneous typing of several alleles at casein loci, as well as the detection of unknown polymorphisms. Here we describe the usefulness of the PCR-SSCP technique for casein typing in sheep. In particular, three single-nucleotide polymorphisms (SNP) are described at CSN1S1, CSN2, and CSN3, all resulting in amino acid exchanges. At CSN1S1, a transition T-->C was found, resulting in the deduced amino acid exchange Ile186-->Thr186. A transition A-->G resulting in the deduced amino acid exchange Met183-->Val183 was identified at CSN2. The 2 SNP showed a rather high frequency (ranging from 0.12 to 0.26) in 3 Italian breeds (Sarda, Comisana, Sopravissana). Another transition C-->T (Ser104-->Leu104) was found at CSN3 in one heterozygous animal.

  9. Capillary electrophoresis-single strand conformation polymorphism for the detection of multiple mutations leading to tuberculosis drug resistance.

    Science.gov (United States)

    Krothapalli, Sowmya; May, Michael K; Hestekin, Christa N

    2012-10-01

    Drug resistant tuberculosis (TB) is a major health problem in both developed and developing countries. Mutations in the Mycobacterium (M.) tuberculosis bacterial genome, such as those to the rpoB gene and mabA-inhA promoter region, have been linked to TB drug resistance in against rifampicin and isoniazid, respectively. The rapid, accurate, and inexpensive identification of these and other mutations leading to TB drug resistance is an essential tool for improving human health. Capillary electrophoresis (CE) single strand conformation polymorphism (SSCP) can be a highly sensitive technique for the detection of genetic mutation that has not been previously explored for drug resistance mutations in M. tuberculosis. This work explores the potential of CE-SSCP through the optimization of variables such as polymer separation matrix concentration, capillary wall coating, electric field strength, and temperature on resolution of mutation detection. The successful detection of an rpoB gene mutation and two mabA-inhA promoter region mutations while simultaneously differentiating a TB-causing mycobacteria from a non-TB bacteria was accomplished using the optimum conditions of 4.5% (w/v) PDMA in a PDMA coated capillary at 20°C using a separation voltage of 278 V/cm. This multiplexed analysis that can be completed in a few hours demonstrates the potential of CE-SSCP to be an inexpensive and rapid analysis method.

  10. Microbial community structure in different wastewater treatment processes characterized by single-strand conformation polymorphism (SSCP) technique

    Institute of Scientific and Technical Information of China (English)

    Yangguo ZHAO; Aijie WANG; Nanqi REN; Yan ZHAO

    2008-01-01

    In order to investigate microbial community structures in different wastewater treatment processes and understand the relationship between the structures and the status of processes, the microbial community diversity, variety and distribution in five wastewater treatment processes were studied by a culture-independent genetic fingerprinting technique single-strand conformation poly-morphism (SSCP). The five processes included denitrifying and phosphate-removal system (diminished N), Chinese traditional medicine wastewater treatment system (P), beer wastewater treatment system (W), fermentative biohydrogen-producing system (H), and sulfate-reduction system (S). The results indicated that the microbial community profiles in the wastewater bioreactors with the uniform status were very similar. The diversity of microbial populations was correlated with the complexity of organic contaminants in wastewater. Chinese traditional medicine wastewater contained more complex organic components; hence, the population diversity was higher than that of simple nutrient bioreactors fed with molasses wastewater. Compared with the strain bands in a simulated community, the relative proportion of some functional microbial populations in bioreactors was not dom-inant. Fermentative biohydrogen producer Ethanoligenens harbinense in the better condition bioreactor had only a 5% band density, and the Desulfovibrio sp. in the sulfate-reducing bioreactor had less than 1.5% band density. The SSCP profiles could identify the difference in microbial community structures in wastewater treatment processes, monitor some of the functional microbes in these processes, and consequently provide useful guidance for improving their efficiency.

  11. Single-strand conformation polymorphism-based analysis reveals genetic variation within Spirometra erinacei (Cestoda: Pseudophyllidea) from Australia.

    Science.gov (United States)

    Zhu, X Q; Beveridge, I; Berger, L; Barton, D; Gasser, R B

    2002-04-01

    This study examined genetic variability within Spirometra erinacei (Cestoda: Pseudophyllidea) from different host species and geographical origins in Australia using a polymerase chain reaction (PCR)-based mutation detection approach, followed by DNA sequencing. Part of the cytochrome c oxidase subunit 1 gene (p cox 1) was amplified by PCR, scanned for sequence variation by single-strand conformation polymorphism (SSCP), and representative samples from different host species were selected for DNA sequencing. While no variation in SSCP profiles was detected among S. erinacei samples from dog, fox, cat, tiger snake and python, they differed in profile from 5 specimens from the green tree frog (Litoria caerulea). This was supported by sequence data which demonstrated that p cox 1 sequences of samples from the latter host species differed at 8 of 393 (2%) nucleotide positions from those from the non-amphibian host. Using a nucleotide difference in the p cox 1 sequence, a PCR-linked restriction fragment length polymorphism (RFLP) could be employed to unequivocally delineate between samples from non-amphibian and amphibian hosts. These findings demonstrate the existence of at least two genotypes within S. erinacei, which may have important implications for studying the epidemiology, ecology and systematics of this cestode.

  12. Single strand conformation polymorphism of genomic and EST-SSRs marker and its utility in genetic evaluation of sugarcane.

    Science.gov (United States)

    Kalwade, Sachin B; Devarumath, Rachayya M

    2014-07-01

    Sugarcane is an important crop producing around 75 % of sugar in world and used as first generation biofuel. In present study, the genomic and gene based microsatellite markers were analyzed by low cost Single Strand Confirmation Polymorphism technique for genetic evaluation of 22 selected sugarcane genotypes. Total 16 genomic and 12 Expression Sequence Tag derived markers were able to amplify the selected sugarcane genotypes. Total 138 alleles were amplified of which 99 alleles (72 %) found polymorphic with an average of 4.9 alleles per locus. Microsatellite marker, VCSSR7 and VCSSR 12 showed monomorphic alleles with frequency 7.1 % over the average of 3.5 obtained for polymorphic locus. The level of Polymorphic Information Content (PIC) varied from 0.09 in VCSSR 6 to 0.88 in VCSSR 11 marker respectively with a mean of 0.49. Genomic SSRs showed more polymorphism than EST-SSRs markers on selected sugarcane genotypes whereas, the genetic similarity indices calculated by Jaccard's similarity coefficient varied from 0.55 to 0.81 indicate a high level of genetic similarity among the genotypes that was mainly attributed to intra specific diversity. Hence, the SSR-SSCP technique helped to identify the genetically diverse clones which could be used in crossing program for introgression of sugar and stress related traits in hybrid sugarcane.

  13. Characterization of the single stranded DNA binding protein SsbB encoded in the Gonoccocal Genetic Island.

    Directory of Open Access Journals (Sweden)

    Samta Jain

    Full Text Available BACKGROUND: Most strains of Neisseria gonorrhoeae carry a Gonococcal Genetic Island which encodes a type IV secretion system involved in the secretion of ssDNA. We characterize the GGI-encoded ssDNA binding protein, SsbB. Close homologs of SsbB are located within a conserved genetic cluster found in genetic islands of different proteobacteria. This cluster encodes DNA-processing enzymes such as the ParA and ParB partitioning proteins, the TopB topoisomerase, and four conserved hypothetical proteins. The SsbB homologs found in these clusters form a family separated from other ssDNA binding proteins. METHODOLOGY/PRINCIPAL FINDINGS: In contrast to most other SSBs, SsbB did not complement the Escherichia coli ssb deletion mutant. Purified SsbB forms a stable tetramer. Electrophoretic mobility shift assays and fluorescence titration assays, as well as atomic force microscopy demonstrate that SsbB binds ssDNA specifically with high affinity. SsbB binds single-stranded DNA with minimal binding frames for one or two SsbB tetramers of 15 and 70 nucleotides. The binding mode was independent of increasing Mg(2+ or NaCl concentrations. No role of SsbB in ssDNA secretion or DNA uptake could be identified, but SsbB strongly stimulated Topoisomerase I activity. CONCLUSIONS/SIGNIFICANCE: We propose that these novel SsbBs play an unknown role in the maintenance of genetic islands.

  14. Genotyping by"cold single-strand conformation polymorphism" of the UGT1A1 promoter polymorphism in Mexican mestizos.

    Science.gov (United States)

    Arámbula, Eliakym; Vaca, Gerardo

    2002-01-01

    Since no data have previously been reported concerning both the (TA) n polymorphism at the promoter of the UGT1A1 gene in the Mexican population and the use of single-strand conformation polymorphism (SSCP) for the detection of such polymorphism, genotyping by SSCP in 375 G-6-PD normal (Group A) and 81 G-6-PD-deficient (Group B) mestizos belonging to 14 states was carried out. Allele frequencies for (TA)6 and (TA)7 repeats were 0.654 and 0.334, respectively, in Group A and 0.685 and 0.315 in Group B; in the former group, the (TA)5 allele was also observed with a frequency of 0.012. The frequencies of the genotype (TA)7/(TA)7 were 10.1% (Group A) and 8.6% (Group B). The (TA)7/(TA)8 genotype was also observed in a patient with unconjugated hyperbilirubinemia. Due to the importance of its potential medical implications, the observed high frequency (10%) of the (TA)7/(TA)7 genotype is stressed. Genotyping by SSCP of the (TA) n polymorphism is an adequate methodological option.

  15. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    The majority of archaeal viral genes are of unknown function hindering our understanding of the virus life cycle and viral interactions with their host. Here, we first describe functional characterization of ORF131b (gp17) and ORF436 (gp18) of Sulfolobus islandicus rod-shaped virus 2 (SIRV2), bot...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair.......The majority of archaeal viral genes are of unknown function hindering our understanding of the virus life cycle and viral interactions with their host. Here, we first describe functional characterization of ORF131b (gp17) and ORF436 (gp18) of Sulfolobus islandicus rod-shaped virus 2 (SIRV2), both...... encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U...

  16. Structural dynamics of E. coli single-stranded DNA binding protein reveal DNA wrapping and unwrapping pathways.

    Science.gov (United States)

    Suksombat, Sukrit; Khafizov, Rustem; Kozlov, Alexander G; Lohman, Timothy M; Chemla, Yann R

    2015-08-25

    Escherichia coli single-stranded (ss)DNA binding (SSB) protein mediates genome maintenance processes by regulating access to ssDNA. This homotetrameric protein wraps ssDNA in multiple distinct binding modes that may be used selectively in different DNA processes, and whose detailed wrapping topologies remain speculative. Here, we used single-molecule force and fluorescence spectroscopy to investigate E. coli SSB binding to ssDNA. Stretching a single ssDNA-SSB complex reveals discrete states that correlate with known binding modes, the likely ssDNA conformations and diffusion dynamics in each, and the kinetic pathways by which the protein wraps ssDNA and is dissociated. The data allow us to construct an energy landscape for the ssDNA-SSB complex, revealing that unwrapping energy costs increase the more ssDNA is unraveled. Our findings provide insights into the mechanism by which proteins gain access to ssDNA bound by SSB, as demonstrated by experiments in which SSB is displaced by the E. coli recombinase RecA.

  17. Structure-spectrophotometric selectivity relationship in interactions of quercetin related flavonoids with double stranded and single stranded RNA

    Science.gov (United States)

    Piantanida, Ivo; Mašić, Lozika; Rusak, Gordana

    2009-04-01

    Interactions of five flavonoids with dsRNA and single stranded ssRNA were studied by UV/vis titrations. The results obtained supported the intercalative binding mode as a dominant interaction of studied flavonoids with dsRNA as well as major interaction with ssRNA. Furthermore, changes of the UV/vis spectra of flavonoids induced by addition of poly G or poly C, respectively, are significantly stronger than changes induced by double stranded poly G-poly C, pointing to essential role of the free poly G or poly C sequence (not hydrogen bonded in double helix). Exclusively poly G caused significant batochromic shift of the UV/vis maxima of all studied flavonoids, whereby the intensity of batochromic shift is nicely correlated to the number of OH groups of flavonoid. Unlikely to poly G, addition of poly A and poly U induced measurable changes only in the UV/vis spectra of flavonoids characterised by no OH (galangin) or three OH groups (myricetin) on the phenyl part of the molecule. Consequently, flavonoids with one- or two-OH groups on the phenyl part of the molecule (luteolin, fisetin, kaempferol) specifically differentiate between poly A, poly U (negligible changes in the UV/Vis spectra) and poly G (strong changes in the UV/Vis spectra) as well as poly C (moderate changes in the UV/Vis spectra).

  18. Genetic requirements for the single-strand annealing pathway of double-strand break repair in Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Ivanov, E.L.; Sugawara, N.; Haber, J.E. [Brandeis Univ., Waltham, MA (United States)] [and others

    1996-03-01

    HO endonuclease-induced double-strand breaks (DSBs) within a direct duplication of Escherichia coli lacZ genes are repaired either by gene conversion or by single-strand annealing (SSA), with >80% being SSA. Previously it was demonstrated that the RAD52 gene is required for DSB-induced SSA. In the present study, the effects of other genes belonging to the RAD52 epistasis group were analyzed. We show that RAD51, RAD54, RAD55, and RAD57 genes are not required for SSA irrespective of whether recombination occurred in plasmid or chromosomal DNA. In both plasmid and chromosomal constructs with homologous sequences in direct orientation, the proportion of SSA events over gene conversion was significantly elevated in the mutant strains. However, gene conversion was not affected when the two lacZ sequences were in inverted orientation. These results suggest that there is a competition between SSA and gene conversion processes that favors SSA in the absence of RAD51, RAD54, RAD55 and RAD57. Mutations in RAD50 and XRS2 genes do not prevent the completion, but markedly retard the kinetics, of DSB repair by both mechanisms in the lacZ direct repeat plasmid, a result resembling the effects of these genes during mating-type (MAT) switching. 43 refs., 8 figs., 3 tabs.

  19. Use of Synthetic Single-Stranded Oligonucleotides as Artificial Test Soiling for Validation of Surgical Instrument Cleaning Processes

    Directory of Open Access Journals (Sweden)

    Nadja Wilhelm

    2014-01-01

    Full Text Available Surgical instruments are often strongly contaminated with patients’ blood and tissues, possibly containing pathogens. The reuse of contaminated instruments without adequate cleaning and sterilization can cause postoperative inflammation and the transmission of infectious diseases from one patient to another. Thus, based on the stringent sterility requirements, the development of highly efficient, validated cleaning processes is necessary. Here, we use for the first time synthetic single-stranded DNA (ssDNA_ODN, which does not appear in nature, as a test soiling to evaluate the cleaning efficiency of routine washing processes. Stainless steel test objects were coated with a certain amount of ssDNA_ODN. After cleaning, the amount of residual ssDNA_ODN on the test objects was determined using quantitative real-time PCR. The established method is highly specific and sensitive, with a detection limit of 20 fg, and enables the determination of the cleaning efficiency of medical cleaning processes under different conditions to obtain optimal settings for the effective cleaning and sterilization of instruments. The use of this highly sensitive method for the validation of cleaning processes can prevent, to a significant extent, the insufficient cleaning of surgical instruments and thus the transmission of pathogens to patients.

  20. Negative supercoiling creates single-stranded patches of DNA that are substrates for AID-mediated mutagenesis.

    Directory of Open Access Journals (Sweden)

    Jahan-Yar Parsa

    2012-02-01

    Full Text Available Antibody diversification necessitates targeted mutation of regions within the immunoglobulin locus by activation-induced cytidine deaminase (AID. While AID is known to act on single-stranded DNA (ssDNA, the source, structure, and distribution of these substrates in vivo remain unclear. Using the technique of in situ bisulfite treatment, we characterized these substrates-which we found to be unique to actively transcribed genes-as short ssDNA regions, that are equally distributed on both DNA strands. We found that the frequencies of these ssDNA patches act as accurate predictors of AID activity at reporter genes in hypermutating and class switching B cells as well as in Escherichia coli. Importantly, these ssDNA patches rely on transcription, and we report that transcription-induced negative supercoiling enhances both ssDNA tract formation and AID mutagenesis. In addition, RNaseH1 expression does not impact the formation of these ssDNA tracts indicating that these structures are distinct from R-loops. These data emphasize the notion that these transcription-generated ssDNA tracts are one of many in vivo substrates for AID.

  1. Defective DNA Ligation during Short-Patch Single-Strand Break Repair in Ataxia Oculomotor Apraxia 1 ▿

    Science.gov (United States)

    Reynolds, John J.; El-Khamisy, Sherif F.; Katyal, Sachin; Clements, Paula; McKinnon, Peter J.; Caldecott, Keith W.

    2009-01-01

    Ataxia oculomotor apraxia 1 (AOA1) results from mutations in aprataxin, a component of DNA strand break repair that removes AMP from 5′ termini. Despite this, global rates of chromosomal strand break repair are normal in a variety of AOA1 and other aprataxin-defective cells. Here we show that short-patch single-strand break repair (SSBR) in AOA1 cell extracts bypasses the point of aprataxin action at oxidative breaks and stalls at the final step of DNA ligation, resulting in the accumulation of adenylated DNA nicks. Strikingly, this defect results from insufficient levels of nonadenylated DNA ligase, and short-patch SSBR can be restored in AOA1 extracts, independently of aprataxin, by the addition of recombinant DNA ligase. Since adenylated nicks are substrates for long-patch SSBR, we reasoned that this pathway might in part explain the apparent absence of a chromosomal SSBR defect in aprataxin-defective cells. Indeed, whereas chemical inhibition of long-patch repair did not affect SSBR rates in wild-type mouse neural astrocytes, it uncovered a significant defect in Aptx−/− neural astrocytes. These data demonstrate that aprataxin participates in chromosomal SSBR in vivo and suggest that short-patch SSBR arrests in AOA1 because of insufficient nonadenylated DNA ligase. PMID:19103743

  2. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.; Volkert, Michael R.

    2004-02-01

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair is suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.

  3. Haplotyping using a combination of polymerase chain reaction-single-strand conformational polymorphism analysis and haplotype-specific PCR amplification.

    Science.gov (United States)

    Zhou, Huitong; Li, Shaobin; Liu, Xiu; Wang, Jiqing; Luo, Yuzhu; Hickford, Jon G H

    2014-12-01

    A single nucleotide polymorphism (SNP) may have an impact on phenotype, but it may also be influenced by multiple SNPs within a gene; hence, the haplotype or phase of multiple SNPs needs to be known. Various methods for haplotyping SNPs have been proposed, but a simple and cost-effective method is currently unavailable. Here we describe a haplotyping approach using two simple techniques: polymerase chain reaction-single-strand conformational polymorphism (PCR-SSCP) and haplotype-specific PCR. In this approach, individual regions of a gene are analyzed by PCR-SSCP to identify variation that defines sub-haplotypes, and then extended haplotypes are assembled from the sub-haplotypes either directly or with the additional use of haplotype-specific PCR amplification. We demonstrate the utility of this approach by haplotyping ovine FABP4 across two variable regions that contain seven SNPs and one indel. The simplicity of this approach makes it suitable for large-scale studies and/or diagnostic screening.

  4. "ISA-Lation" of Single-Stranded Positive-Sense RNA Viruses from Non-Infectious Clinical/Animal Samples.

    Directory of Open Access Journals (Sweden)

    Fabien Aubry

    Full Text Available Isolation of viral pathogens from clinical and/or animal samples has traditionally relied on either cell cultures or laboratory animal model systems. However, virus viability is notoriously susceptible to adverse conditions that may include inappropriate procedures for sample collection, storage temperature, support media and transportation. Using our recently described ISA method, we have developed a novel procedure to isolate infectious single-stranded positive-sense RNA viruses from clinical or animal samples. This approach, that we have now called "ISA-lation", exploits the capacity of viral cDNA subgenomic fragments to re-assemble and produce infectious viral RNA in susceptible cells. Here, it was successfully used to rescue enterovirus, Chikungunya and Tick-borne encephalitis viruses from a variety of inactivated animal and human samples. ISA-lation represents an effective option to rescue infectious virus from clinical and/or animal samples that may have deteriorated during the collection and storage period, but also potentially overcomes logistic and administrative difficulties generated when complying with current health and safety and biosecurity guidelines associated with shipment of infectious viral material.

  5. Electron microscopic comparison of the sequences of single-stranded genomes of mammalian parvoviruses by heteroduplex mapping

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, P.T.; Olson, W.H.; Allison, D.P.; Bates, R.C.; Snyder, C.E.; Mitra, S.

    1983-01-01

    The sequence homologies among the linear single-stranded genomes of several mammalian parvoviruses have been studied by electron microscopic analysis of tthe heteroduplexes produced by reannealing the complementary strands of their DNAs. The genomes of Kilham rat virus, H-1, minute virus of ice and LuIII, which are antigenically distinct non-defective parvoviruses, have considerable homology: about 70% of their sequences are conserved. The homologous regions map at similar locations in the left halves (from the 3' ends) of the genomes. No sequence homology, however, is observed between the DNAs of these nondefective parvoviruses and that of bovine parvovirus, another non-defective virus, or that of defective adenoassociated virus, nor between the genomes of bovine parvovirus and adenoassociated virus. This suggests that only very short, if any, homologous regions are present. From these results, an evolutionary relationship among Kilham rat virus, H-1, minute virus of mice and LuIII is predicted. It is interesting to note that, although LuIII was originally isolated from a human cell line and is specific for human cells in vitro, its genome has sequences in common only with the rodent viruses Kilham rat virus, minute virus of mice and H-1, and not with the other two mammalian parvoviruses tested.

  6. Advanced Characterization of DNA Molecules in rAAV Vector Preparations by Single-stranded Virus Next-generation Sequencing

    Directory of Open Access Journals (Sweden)

    Emilie Lecomte

    2015-01-01

    Full Text Available Recent successful clinical trials with recombinant adeno-associated viral vectors (rAAVs have led to a renewed interest in gene therapy. However, despite extensive developments to improve vector-manufacturing processes, undesirable DNA contaminants in rAAV preparations remain a major safety concern. Indeed, the presence of DNA fragments containing antibiotic resistance genes, wild-type AAV, and packaging cell genomes has been found in previous studies using quantitative polymerase chain reaction (qPCR analyses. However, because qPCR only provides a partial view of the DNA molecules in rAAV preparations, we developed a method based on next-generation sequencing (NGS to extensively characterize single-stranded DNA virus preparations (SSV-Seq. In order to validate SSV-Seq, we analyzed three rAAV vector preparations produced by transient transfection of mammalian cells. Our data were consistent with qPCR results and showed a quasi-random distribution of contaminants originating from the packaging cells genome. Finally, we found single-nucleotide variants (SNVs along the vector genome but no evidence of large deletions. Altogether, SSV-Seq could provide a characterization of DNA contaminants and a map of the rAAV genome with unprecedented resolution and exhaustiveness. We expect SSV-Seq to pave the way for a new generation of quality controls, guiding process development toward rAAV preparations of higher potency and with improved safety profiles.

  7. APOBEC3G is a single-stranded DNA cytidine deaminase and functions independently of HIV reverse transcriptase

    Science.gov (United States)

    Suspène, Rodolphe; Sommer, Peter; Henry, Michel; Ferris, Stéphane; Guétard, Denise; Pochet, Sylvie; Chester, Ann; Navaratnam, Naveenan; Wain-Hobson, Simon; Vartanian, Jean-Pierre

    2004-01-01

    In the absence of the viral vif gene, human immunodeficiency virus (HIV) may be restricted by the APOBEC3G gene on chromosome 22. The role of the HIV Vif protein is to exclude host cell APOBEC3G from the budding virion. As APOBEC3G shows sequence homology to cytidine deaminases, it is presumed that in the absence of Vif, cytidine residues in the cDNA are deaminated yielding uracil. It is not known if additional proteins mediate APOBEC3G function or if deamination occurs in concert with reverse transcription. This report describes an in vitro assay showing that Baculovirus derived APOBEC3G alone extensively deaminates cDNA independently of reverse transcriptase. It reproduces the dinucleotide context typical of G → A hypermutants derived from a Δvif virus. By using an RNaseH– form of reverse transcriptase, it was shown that the cDNA has to be free of its RNA template to allow deamination. APOBEC3G deamination of dC or dCTP was not detected. In short, APOBEC3G is a single-stranded DNA cytidine deaminase capable of restricting retroviral replication. PMID:15121899

  8. First-In-Class Small Molecule Inhibitors of the Single-Strand DNA Cytosine Deaminase APOBEC3G

    Energy Technology Data Exchange (ETDEWEB)

    Li, Ming; Shandilya, Shivender M.D.; Carpenter, Michael A.; Rathore, Anurag; Brown, William L.; Perkins, Angela L.; Harki, Daniel A.; Solberg, Jonathan; Hook, Derek J.; Pandey, Krishan K.; Parniak, Michael A.; Johnson, Jeffrey R.; Krogan, Nevan J.; Somasundaran, Mohan; Ali, Akbar; Schiffer, Celia A.; Harris, Reuben S. (Pitt); (UMASS, MED); (SLUHSC); (UCSF); (UMM)

    2012-04-04

    APOBEC3G is a single-stranded DNA cytosine deaminase that comprises part of the innate immune response to viruses and transposons. Although APOBEC3G is the prototype for understanding the larger mammalian polynucleotide deaminase family, no specific chemical inhibitors exist to modulate its activity. High-throughput screening identified 34 compounds that inhibit APOBEC3G catalytic activity. Twenty of 34 small molecules contained catechol moieties, which are known to be sulfhydryl reactive following oxidation to the orthoquinone. Located proximal to the active site, C321 was identified as the binding site for the inhibitors by a combination of mutational screening, structural analysis, and mass spectrometry. Bulkier substitutions C321-to-L, F, Y, or W mimicked chemical inhibition. A strong specificity for APOBEC3G was evident, as most compounds failed to inhibit the related APOBEC3A enzyme or the unrelated enzymes E. coli uracil DNA glycosylase, HIV-1 RNase H, or HIV-1 integrase. Partial, but not complete, sensitivity could be conferred to APOBEC3A by introducing the entire C321 loop from APOBEC3G. Thus, a structural model is presented in which the mechanism of inhibition is both specific and competitive, by binding a pocket adjacent to the APOBEC3G active site, reacting with C321, and blocking access to substrate DNA cytosines.

  9. Characterization of gold nanoparticles modified with single-stranded DNA using analytical ultracentrifugation and dynamic light scattering.

    Science.gov (United States)

    Falabella, James B; Cho, Tae Joon; Ripple, Dean C; Hackley, Vincent A; Tarlov, Michael J

    2010-08-03

    We report the characterization of gold nanoparticles modified with thiol-terminated single stranded DNA (ssDNA) using analytical ultracentrifugation. Dynamic light scattering was used to measure the diameter of bare and ssDNA modified gold nanoparticles to corroborate the predictions of our models. Sedimentation coefficients of nominally 10 and 20 nm diameter gold nanoparticles modified with thiol-terminated thymidine homo-oligonucleotides, 5-30 bases in length, were determined with analytical ultracentrifugation. The sedimentation coefficients of gold nanoparticles modified with ssDNA were found to decrease with increasing coverage of ssDNA and increasing length of ssDNA. The sedimentation coefficients of ssDNA modified gold particles were most closely predicted when the strands were modeled as fully extended chains (FEC). Apparent particle densities of bare gold nanoparticles calculated from measured sedimentation coefficients decreased significantly below that of bulk gold with decreasing size of nanoparticles. This finding suggests that hydration layer effects are an important factor in the sedimentation behavior for both bare and short ssDNA chain modified gold particles.

  10. Enhancement of RecA-mediated self-assembly in DNA nanostructures through basepair mismatches and single-strand nicks

    Science.gov (United States)

    Corbett, Sybilla Louise; Sharma, Rajan; Davies, Alexander Giles; Wälti, Christoph

    2017-01-01

    The use of DNA as a structural material for nanometre-scale construction has grown extensively over the last decades. The development of more advanced DNA-based materials would benefit from a modular approach enabling the direct assembly of additional elements onto nanostructures after fabrication. RecA-based nucleoprotein filaments encapsulating short ssDNA have been demonstrated as a tool for highly efficient and fully programmable post-hoc patterning of duplex DNA scaffold. However, the underlying assembly process is not fully understood, in particular when patterning complex DNA topologies. Here, we report the effect of basepair-mismatched regions and single-strand nicks in the double-stranded DNA scaffold on the yield of RecA-based assembly. Significant increases in assembly yield are observed upon the introduction of unpaired basepairs directly adjacent to the assembly region. However, when the unpaired regions were introduced further from the assembly site the assembly yield initially decreased as the length of the unpaired region was increased. These results suggest that an unpaired region acts as a kinetic trap for RecA-based nucleoprotein filaments, impeding the assembly mechanism. Conversely, when the unpaired region is located directly adjacent to the assembly site, it leads to an increase in efficiency of RecA patterning owing to increased breathing of the assembly site.

  11. Defective DNA single-strand break repair is responsible for senescence and neoplastic escape of epithelial cells.

    Science.gov (United States)

    Nassour, Joe; Martien, Sébastien; Martin, Nathalie; Deruy, Emeric; Tomellini, Elisa; Malaquin, Nicolas; Bouali, Fatima; Sabatier, Laure; Wernert, Nicolas; Pinte, Sébastien; Gilson, Eric; Pourtier, Albin; Pluquet, Olivier; Abbadie, Corinne

    2016-01-29

    The main characteristic of senescence is its stability which relies on the persistence of DNA damage. We show that unlike fibroblasts, senescent epithelial cells do not activate an ATM-or ATR-dependent DNA damage response (DDR), but accumulate oxidative-stress-induced DNA single-strand breaks (SSBs). These breaks remain unrepaired because of a decrease in PARP1 expression and activity. This leads to the formation of abnormally large and persistent XRCC1 foci that engage a signalling cascade involving the p38MAPK and leading to p16 upregulation and cell cycle arrest. Importantly, the default in SSB repair also leads to the emergence of post-senescent transformed and mutated precancerous cells. In human-aged skin, XRCC1 foci accumulate in the epidermal cells in correlation with a decline of PARP1, whereas DDR foci accumulate mainly in dermal fibroblasts. These findings point SSBs as a DNA damage encountered by epithelial cells with aging which could fuel the very first steps of carcinogenesis.

  12. Relative Stability of the Scleroglucan Triple-Helix and Single Strand: an Insight from Computational and Experimental Techniques

    Science.gov (United States)

    Bocchinfuso, Gianfranco; Mazzuca, Claudia; Conflitti, Paolo; Cori, Davide; Coviello, Tommasina; Palleschi, Antonio

    2016-09-01

    Scleroglucan (Sclg) is a polysaccharide that exhibits a triple helix conformation (triplex), both in aqueous solution and in the solid state, which is lost in DMSO solution, at high temperature and at high pH values. The triplex conformation is characterized by a high rigidity, responsible of Sclg peculiar properties. Although the relative stability of triplex and single strand has already been investigated, different structural details are still missing. In the present study, we analyse the structural properties and the factors stabilizing the single chain and the triple helix of Sclg in different conditions. To this end, we simulated both systems in water and in DMSO. The triple helix has been also simulated in the presence of chemical damages on one of the three strands (to reproduce in silico the effect of sonication) or by inducing a partial unfolding of the triplex structure. The computational results have been compared with experimental evidences in which the triplex denaturation, at alkaline pH values, has been followed by monitoring the UV and CD spectra of Congo red, used as a probe molecule. Our results indicate that sonication breaks the Sclg chains without appreciably changing the stability of the other tracts of triple helix. The simulated perturbed or partially unfolded triplexes show a clear tendency to form less ordered aggregates. Finally, our simulations put in evidence an important role of the hydrophobic interactions both in the triplex stability and in the aggregation processes observed after induced denaturation.

  13. High Fidelity Haptic Rendering

    CERN Document Server

    Otaduy, Miguel A

    2006-01-01

    The human haptic system, among all senses, provides unique and bidirectional communication between humans and their physical environment. Yet, to date, most human-computer interactive systems have focused primarily on the graphical rendering of visual information and, to a lesser extent, on the display of auditory information. Extending the frontier of visual computing, haptic interfaces, or force feedback devices, have the potential to increase the quality of human-computer interaction by accommodating the sense of touch. They provide an attractive augmentation to visual display and enhance t

  14. Detection of HLA-DRB1 microchimerism using nested polymerase chain reaction and single-strand conformation polymorphism analysis.

    Science.gov (United States)

    Song, Eun Young; Chung, Hye Yoon; Joo, Shin Young; Roh, Eun Youn; Seong, Moon-Woo; Shin, Yunsu; Park, Myoung Hee

    2012-03-01

    For the detection of microchimerism, molecular methods detecting donor-specific HLA-DRB1 alleles in the recipient are most commonly used. Nested polymerase chain reaction sequence specific primer (nested PCR-SSP) methods widely used to increase the sensitivity of detection have been reported to give frequent false-positive reactions. We have developed a new method combining nested PCR with single-strand conformation polymorphism analysis (nested PCR-SSCP) and tested the 1 to 0.00001% level of microchimerism for 27 different HLA-DRB1 alleles. For most (26/27) of the HLA-DRB1 alleles tested, this method could detect 0.01 to 0.001% of microchimerism and its sensitivity was equal to or better than that of nested PCR-SSP tested in parallel. Its specificity was verified by visualizing particular DRB1-specific SSCP bands under test. Nested PCR-SSP indicated frequent false-positive reactions, mainly caused by nonspecific amplification of DRB3/B4/B5 alleles present in the major (recipient) DNAs. We have compared a real-time quantitative PCR for non-human leukocyte antigen (HLA) target (insertion/deletion marker) using a commercial kit (AlleleSEQR Chimerism assay), and its microchimerism detection sensitivity (around 0.1%) was 1 step (10 times) lower than that of nested PCR-SSP or -SSCP methods for HLA-DRB1 alleles. We validated that the newly designed nested PCR-SSCP affords good sensitivity and specificity and may be useful for studying microchimerism in clinical settings.

  15. Rapid detection of apolipoprotein E genotypes in Alzheimer's disease using polymerase chain reaction-single strand conformation polymorphism.

    Science.gov (United States)

    Kamruecha, Worawan; Chansirikarnjana, Sirintorn; Nimkulrat, Ekapot; Udommongkol, Chesda; Wongmek, Wanna; Thangnipon, Wipawan

    2006-07-01

    Apolipoprotein E (APOE) gene on chromosome 19q13.2 is encoded by three common alleles designated as epsilon2, epsilon3 and epsilon4. In Alzheimer's disease (AD) the epsilon4 allele is over-represented and is considered to be a major genetic risk factor. Several methods have been developed to determine APOE genotypes. Among them, polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) appears to be highly reliable. In this study, we improved the nonisotopic PCR-SSCP method for determining APOE genotypes in 42 cases of AD patients, 40 cases of non-AD dementia patients, and 49 cases of age-matched controls. DNA from the target sequence on APOE was amplified by PCR from peripheral blood genomic DNA. PCR products were electrophoresed in a non-denaturing polyacrylamide gel and visualized by silver staining. We found that the epsilon4 allele had a significantly high frequency of occurrence in AD patients (33.3%) compared with age-matched controls (13.3%) (chi(2) = 10.43, p = 0.001) and non-AD dementia (10%) (chi(2) = 13.02, p<0.001) whereas the epsilon3 allele was of high frequency in non-AD dementia (90%) compared with age-matched controls (85.7%) and AD patients (66.7%). APOE epsilon4 homozygotes were found only in AD groups. On the other hand, the epsilon2 allele was found only in an age-matched control. This study confirmed that the APOE psilon4 allele is a risk factor in Thai AD subjects and that the PCR-SSCP method is a rapid and useful means of detecting the APOE genotype in AD.

  16. Viral recombination blurs taxonomic lines: examination of single-stranded DNA viruses in a wastewater treatment plant

    Directory of Open Access Journals (Sweden)

    Victoria M. Pearson

    2016-10-01

    Full Text Available Understanding the structure and dynamics of microbial communities, especially those of economic concern, is of paramount importance to maintaining healthy and efficient microbial communities at agricultural sites and large industrial cultures, including bioprocessors. Wastewater treatment plants are large bioprocessors which receive water from multiple sources, becoming reservoirs for the collection of many viral families that infect a broad range of hosts. To examine this complex collection of viruses, full-length genomes of circular ssDNA viruses were isolated from a wastewater treatment facility using a combination of sucrose-gradient size selection and rolling-circle amplification and sequenced on an Illumina MiSeq. Single-stranded DNA viruses are among the least understood groups of microbial pathogens due to genomic biases and culturing difficulties, particularly compared to the larger, more often studied dsDNA viruses. However, the group contains several notable well-studied examples, including agricultural pathogens which infect both livestock and crops (Circoviridae and Geminiviridae, and model organisms for genetics and evolution studies (Microviridae. Examination of the collected viral DNA provided evidence for 83 unique genotypic groupings, which were genetically dissimilar to known viral types and exhibited broad diversity within the community. Furthermore, although these genomes express similarities to known viral families, such as Circoviridae, Geminiviridae, and Microviridae, many are so divergent that they may represent new taxonomic groups. This study demonstrated the efficacy of the protocol for separating bacteria and large viruses from the sought after ssDNA viruses and the ability to use this protocol to obtain an in-depth analysis of the diversity within this group.

  17. The interplay between neutral exciton and charge transfer states in single-strand polyadenine: a quantum dynamical investigation.

    Science.gov (United States)

    Santoro, Fabrizio; Improta, Roberto; Avila, Francisco; Segado, Mireia; Lami, Alessandro

    2013-08-01

    We investigate the quantum dynamics of the internal conversion of excitons into charge transfer (CT) states in single-strand oligomers of adenine (An) of different length (n up to 10 units) excited by a short-time laser pulse. Calculations are based on a model vibronic Hamiltonian whose parameters are fitted to accurate time-dependent density functional theory (TD-DFT) calculations, which was shown to reproduce the experimental absorption spectrum with the increase of n. As a first step, we analyze the impact of the vibrational motion on the population transfer in the dimer, highlighting that it causes loss of coherence and slows down the dynamics. For longer oligomers we resort to a simplified approach considering only electronic states and solving the equation of motion for the density matrix driven by inter-state couplings. In this way we are able also to include phenomenologically dephasing terms that mainly simulate intra-molecular effects, and lifetimes of local excitations mimicking monomer-like decay processes. Relaxation effects, whose role is to drive the system towards the thermal equilibrium allowing population exchange among states, are deliberately not considered here, since the focus is on very short-time dynamics. We consider both the cases of an instantaneous and of a finite-time (full width at half maximum 50 fs) laser pulse. According to our calculations, the photoexcited oligomers exhibit a complex dynamics and CT population rises on a 20-30 fs timescale and it persists even on the picosecond timescale. CT population increases with the length of the oligomer and it is only weakly dependent on the relative stability of CT and exciton states (within a range of 1500 cm(-1)). The chain length already modifies the photoexcited dynamics for A2 and A4 systems, but this effect saturates for small n so that the A10 oligomer is also representative of longer chains.

  18. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  19. Cy5 labeled single-stranded DNA-polydopamine nanoparticle conjugate-based FRET assay for reactive oxygen species detection

    Directory of Open Access Journals (Sweden)

    Lina Ma

    2015-03-01

    Full Text Available This work reports on a simple and feasible fluorescence resonance energy transfer (FRET assay for detecting reactive oxygen species (ROS both in solution and living cell using polydopamine nanoparticle (PDA NP as energy acceptor and Cy5 labeled single-stranded DNA (Cy5-ssDNA as energy donor. The Cy5-ssDNA and PDA NPs form self-assembled conjugates (Cy5-ssDNA-PDA NP conjugates via π-stacking interactions. In the presence of ROS, the PDA NP adsorbed Cy5-ssDNAs can be effectively cleaved, resulting in the release of Cy5 molecules into solution and recovery of fluorescence emission of Cy5. In order to obtain ROS solution, the glucose oxidase-catalyzed oxidation reaction of glucose with O2 is employed to generate hydrogen peroxide for Fenton-like reaction. The formation of ROS in Fenton-like reaction can be detected as low as glucose oxidase-catalyzed oxidation of 100 pM glucose by the Cy5-ssDNA-PDA NP conjugate-based FRET assay. The recovery ratio of Cy5 fluorescence intensity is increased linearly with logarithm of glucose concentration from 100 pM to 1 μM, demonstrating that the FRET assay has wide dynamic range. In particular, intracellular ROS has been successfully detected in chemical stimulated HepG-2 cells by the Cy5-ssDNA-PDA NP conjugate-based FRET assay with a fluorescence microscopy, indicating that this approach has great potential to monitor ROS in living cells.

  20. Isolation of Single-Stranded DNA Aptamers That Distinguish Influenza Virus Hemagglutinin Subtype H1 from H5

    Science.gov (United States)

    Yim, Sanggyu; Jeong, Yong-Joo

    2015-01-01

    Surface protein hemagglutinin (HA) mediates the binding of influenza virus to host cell receptors containing sialic acid, facilitating the entry of the virus into host cells. Therefore, the HA protein is regarded as a suitable target for the development of influenza virus detection devices. In this study, we isolated single-stranded DNA (ssDNA) aptamers binding to the HA1 subunit of subtype H1 (H1-HA1), but not to the HA1 subunit of subtype H5 (H5-HA1), using a counter-systematic evolution of ligands by exponential enrichment (counter-SELEX) procedure. Enzyme-linked immunosorbent assay and surface plasmon resonance studies showed that the selected aptamers bind tightly to H1-HA1 with dissociation constants in the nanomolar range. Western blot analysis demonstrated that the aptamers were binding to H1-HA1 in a concentration-dependent manner, yet were not binding to H5-HA1. Interestingly, the selected aptamers contained G-rich sequences in the central random nucleotides region. Further biophysical analysis showed that the G-rich sequences formed a G-quadruplex structure, which is a distinctive structure compared to the starting ssDNA library. Using flow cytometry analysis, we found that the aptamers did not bind to the receptor-binding site of H1-HA1. These results indicate that the selected aptamers that distinguish H1-HA1 from H5-HA1 can be developed as unique probes for the detection of the H1 subtype of influenza virus. PMID:25901739

  1. Isolation and characterization of a novel single-stranded RNA virus infecting the bloom-forming diatom Rhizosolenia setigera.

    Science.gov (United States)

    Nagasaki, Keizo; Tomaru, Yuji; Katanozaka, Noriaki; Shirai, Yoko; Nishida, Kensho; Itakura, Shigeru; Yamaguchi, Mineo

    2004-02-01

    A novel single-stranded RNA (ssRNA) virus specifically infecting the bloom-forming diatom Rhizosolenia setigera (R. setigera RNA virus [RsRNAV]) was isolated from Ariake Sea, Japan. Viral replication occurred within the cytoplasm, and the virus particle was icosahedral, lacked a tail, and was 32 nm in diameter on average. The major nucleic acid extracted from the RsRNAV particles was an ssRNA molecule 11.2 kb in length, although smaller RNA molecules (0.6, 1.2, and 1.5 kb) were occasionally observed. The major structural proteins of RsRNAV were 41.5, 41.0, and 29.5 kDa. Inter- and intraspecies host specificity tests revealed that RsRNAV is not only species specific but also strain specific and that its intraspecies host specificity is diverse among virus clones. The latent period of RsRNAV was 2 days, and the burst sizes were 3,100 and 1,010 viruses per host cell when viruses were inoculated into the host culture at the exponential and stationary growth phases, respectively, at 15 degrees C under a 12-h-12-h light-dark cycle of ca. 110 micro mol of photons m(-2) s(-1) with cool white fluorescent illumination. To our knowledge, this is the first report describing the biological properties of a virus infecting a diatom. Further studies on RsRNAV will be helpful in understanding the ecological relationship between diatoms and viruses in nature.

  2. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities.

    Science.gov (United States)

    Guo, Yang; Kragelund, Birthe B; White, Malcolm F; Peng, Xu

    2015-06-19

    The majority of archaeal viral genes are of unknown function hindering our understanding of the virus life cycle and viral interactions with their host. Here, we first describe functional characterization of ORF131b (gp17) and ORF436 (gp18) of Sulfolobus islandicus rod-shaped virus 2 (SIRV2), both encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5' → 3' ssDNA exonuclease activity, in addition to the previously demonstrated ssDNA endonuclease activity. Further, in vitro pull-down assay demonstrated interactions between gp17 and gp18 and between gp18 and gp19 with the former being mediated by the intrinsically disordered C-terminus of gp17. The strand-displacement replication mode proposed previously for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair.

  3. Development of a Single Stranded DNA Aptamer as a Molecular Probe for LNCap Cells Using Cell-SELEX.

    Science.gov (United States)

    Almasi, Faezeh; Mousavi Gargari, Seyed Latif; Bitaraf, Fatemeh; Rasoulinejad, Samaneh

    2016-01-01

    Nowadays, highly specific aptamers generated by cell SELEX technology (systematic evolution of ligands by exponential enrichment) are being applied for early detection of cancer cells. Prostate Specific Membrane Antigen (PSMA), over expressed in prostate cancer, is a highly specific marker and therefore can be used for diagnosis of the prostate cancer cells. The aim of the present study was to select single-stranded DNA aptamers against LNCap cells highly expressing PSMA, using cell-SELEX method which can be used as a diagnostic tool for the detection of prostate cancer cells. After 10 rounds of cell-SELEX, DNA aptamers were isolated against PSMA using LNCaP cells as a target and PC-3 cell lines for counter SELEX. Five DNA aptamers with more than 70% affinity were selected up on flow cytometry analysis of positive clones. Dissociation constants of two selected sequences (A12-B1) were estimated in the range of 33.78±3.77 and 57.49±2.214 pmol, respectively. Conserved secondary structures of A12 and B1 sequences suggest the necessity of these structures for binding with high affinity to native PSMA. Comparison of the secondary structures of our isolated aptamers and aptamer A10 obtained by protein SELEX showed similar stem-loop structures which could be responsible for the recognition of PSMA on LNCap cell surface. Our results indicated that selected aptamers may turn out to be ideal candidates for the development of a detection tool and also can be used in targeted drug delivery for future smart drugs.

  4. Mapping meiotic single-strand DNA reveals a new landscape of DNA double-strand breaks in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Cyril Buhler

    2007-12-01

    Full Text Available DNA double-strand breaks (DSBs, which are formed by the Spo11 protein, initiate meiotic recombination. Previous DSB-mapping studies have used rad50S or sae2Delta mutants, which are defective in break processing, to accumulate Spo11-linked DSBs, and report large (> or = 50 kb "DSB-hot" regions that are separated by "DSB-cold" domains of similar size. Substantial recombination occurs in some DSB-cold regions, suggesting that DSB patterns are not normal in rad50S or sae2Delta mutants. We therefore developed a novel method to map genome-wide, single-strand DNA (ssDNA-associated DSBs that accumulate in processing-capable, repair-defective dmc1Delta and dmc1Delta rad51Delta mutants. DSBs were observed at known hot spots, but also in most previously identified "DSB-cold" regions, including near centromeres and telomeres. Although approximately 40% of the genome is DSB-cold in rad50S mutants, analysis of meiotic ssDNA from dmc1Delta shows that most of these regions have substantial DSB activity. Southern blot assays of DSBs in selected regions in dmc1Delta, rad50S, and wild-type cells confirm these findings. Thus, DSBs are distributed much more uniformly than was previously believed. Comparisons of DSB signals in dmc1, dmc1 rad51, and dmc1 spo11 mutant strains identify Dmc1 as a critical strand-exchange activity genome-wide, and confirm previous conclusions that Spo11-induced lesions initiate all meiotic recombination.

  5. Hot topic: Bovine milk samples yielding negative or nonspecific results in bacterial culturing--the possible role of PCR-single strand conformation polymorphism in mastitis diagnosis.

    Science.gov (United States)

    Schwaiger, K; Wimmer, M; Huber-Schlenstedt, R; Fehlings, K; Hölzel, C S; Bauer, J

    2012-01-01

    A large proportion of mastitis milk samples yield negative or nonspecific results (i.e., no mastitis pathogen can be identified) in bacterial culturing. Therefore, the culture-independent PCR-single strand conformation polymorphism method was applied to the investigation of bovine mastitis milk samples. In addition to the known mastitis pathogens, the method was suitable for the detection of fastidious bacteria such as Mycoplasma spp., which are often missed by conventional culturing methods. The detection of Helcococcus ovis in 4 samples might indicate an involvement of this species in pathogenesis of bovine mastitis. In conclusion, PCR-single-strand conformation polymorphism is a promising tool for gaining new insights into the bacteriological etiology of mastitis.

  6. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing.

    Science.gov (United States)

    Mendonça, Marcos César Lima de; Ferreira, Ana Maria de Amorim; Santos, Marta Gonçalves Matos dos; Oviedo, Elva Cristina; Bello, Maria Sônia Dal; Siqueira, Marilda Mendonça; Maceira, Juan Manuel Piñeiro; von Hubinger, Maria Genoveva; Couceiro, José Nelson dos Santos Silva

    2011-06-01

    Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  7. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  8. The Telomere Binding Protein Cdc13 and the Single-Stranded DNA Binding Protein RPA Protect Telomeric DNA from Resection by Exonucleases.

    Science.gov (United States)

    Greetham, Matthew; Skordalakes, Emmanuel; Lydall, David; Connolly, Bernard A

    2015-09-25

    The telomere is present at the ends of all eukaryotic chromosomes and usually consists of repetitive TG-rich DNA that terminates in a single-stranded 3' TG extension and a 5' CA-rich recessed strand. A biochemical assay that allows the in vitro observation of exonuclease-catalyzed degradation (resection) of telomeres has been developed. The approach uses an oligodeoxynucleotide that folds to a stem-loop with a TG-rich double-stranded region and a 3' single-stranded extension, typical of telomeres. Cdc13, the major component of the telomere-specific CST complex, strongly protects the recessed strand from the 5'→3' exonuclease activity of the model exonuclease from bacteriophage λ. The isolated DNA binding domain of Cdc13 is less effective at shielding telomeres. Protection is specific, not being observed in control DNA lacking the specific TG-rich telomere sequence. RPA, the eukaryotic single-stranded DNA binding protein, also inhibits telomere resection. However, this protein is non-specific, equally hindering the degradation of non-telomere controls.

  9. ARE: Ada Rendering Engine

    Directory of Open Access Journals (Sweden)

    Stefano Penge

    2009-10-01

    Full Text Available E' ormai pratica diffusa, nello sviluppo di applicazioni web, l'utilizzo di template e di potenti template engine per automatizzare la generazione dei contenuti da presentare all'utente. Tuttavia a volte la potenza di tali engine è€ ottenuta mescolando logica e interfaccia, introducendo linguaggi diversi da quelli di descrizione della pagina, o addirittura inventando nuovi linguaggi dedicati.ARE (ADA Rendering Engine è€ pensato per gestire l'intero flusso di creazione del contenuto HTML/XHTML dinamico, la selezione del corretto template, CSS, JavaScript e la produzione dell'output separando completamente logica e interfaccia. I templates utilizzati sono puro HTML senza parti in altri linguaggi, e possono quindi essere gestiti e visualizzati autonomamente. Il codice HTML generato è€ uniforme e parametrizzato.E' composto da due moduli, CORE (Common Output Rendering Engine e ALE (ADA Layout Engine.Il primo (CORE viene utilizzato per la generazione OO degli elementi del DOM ed è pensato per aiutare lo sviluppatore nella produzione di codice valido rispetto al DTD utilizzato. CORE genera automaticamente gli elementi del DOM in base al DTD impostato nella configurazioneIl secondo (ALE viene utilizzato come template engine per selezionare automaticamente in base ad alcuni parametri (modulo, profilo utente, tipologia del nodo, del corso, preferenze di installazione il template HTML, i CSS e i file JavaScript appropriati. ALE permette di usare templates di default e microtemplates ricorsivi per semplificare il lavoro del grafico.I due moduli possono in ogni caso essere utilizzati indipendentemente l'uno dall'altro. E' possibile generare e renderizzare una pagina HTML utilizzando solo CORE oppure inviare gli oggetti CORE al template engine ALE che provvede a renderizzare la pagina HTML. Viceversa è possibile generare HTML senza utilizzare CORE ed inviarlo al template engine ALECORE è alla prima release ed è€ già utilizzato all

  10. Interaction of single-stranded DNA with curved carbon nanotube is much stronger than with flat graphite.

    Science.gov (United States)

    Iliafar, Sara; Mittal, Jeetain; Vezenov, Dmitri; Jagota, Anand

    2014-09-17

    We used single molecule force spectroscopy to measure the force required to remove single-stranded DNA (ssDNA) homopolymers from single-walled carbon nanotubes (SWCNTs) deposited on methyl-terminated self-assembled monolayers (SAMs). The peeling forces obtained from these experiments are bimodal in distribution. The cluster of low forces corresponds to peeling from the SAM surface, while the cluster of high forces corresponds to peeling from the SWCNTs. Using a simple equilibrium model of the single molecule peeling process, we calculated the free energy of binding per nucleotide. We found that the free energy of ssDNA binding to hydrophobic SAMs decreases as poly(A) > poly(G) ≈ poly(T) > poly(C) (16.9 ± 0.1; 9.7 ± 0.1; 9.5 ± 0.1; 8.7 ± 0.1 kBT, per nucleotide). The free energy of ssDNA binding to SWCNT adsorbed on this SAM also decreases in the same order poly(A) > poly(G) > poly(T) > poly(C), but its magnitude is significantly greater than that of DNA-SAM binding energy (38.1 ± 0.2; 33.9 ± 0.1; 23.3 ± 0.1; 17.1 ± 0.1 kBT, per nucleotide). An unexpected finding is that binding strength of ssDNA to the curved SWCNTs is much greater than to flat graphite, which also has a different ranking (poly(T) > poly(A) > poly(G) ≥ poly(C); 11.3 ± 0.8, 9.9 ± 0.5, 8.3 ± 0.2, and 7.5 ± 0.8 kBT, respectively, per nucleotide). Replica-exchange molecular dynamics simulations show that ssDNA binds preferentially to the curved SWCNT surface, leading us to conclude that the differences in ssDNA binding between graphite and nanotubes arise from the spontaneous curvature of ssDNA.

  11. Transient oxidative stress and inflammation after intraperitoneal administration of multiwalled carbon nanotubes functionalized with single strand DNA in rats

    Energy Technology Data Exchange (ETDEWEB)

    Clichici, Simona, E-mail: simonaclichici@yahoo.com [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania); Biris, Alexandru Radu [National R and D Institute of Isotopic and Molecular Technologies, Cluj-Napoca (Romania); Tabaran, Flaviu [University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca (Romania); Filip, Adriana [Department of Physiology, University of Medicine and Pharmacy, Cluj-Napoca (Romania)

    2012-03-15

    Multi-walled carbon nanotubes (MWCNTs) are widely used for nanotechnology. Their impact on living organisms is, however, not entirely clarified. Oxidative stress and inflammation seem to be the key mechanisms involved in MWCNTs' cytotoxicity. Until present, pulmonary and skin models were the main tested experimental designs to assess carbon nanotubes' toxicity. The systemic administration of MWCNTs is essential, with respect for future medical applications. Our research is performed on Wistar rats and is focused on the dynamics of oxidative stress parameters in blood and liver and pro-inflammatory cytokines in liver, after single dose (270 mg l{sup −1}) ip administration of MWCNTs (exterior diameter 15–25 nm, interior diameter 10–15 nm, surface 88 m{sup 2} g{sup −1}) functionalized with single strand DNA (ss-DNA). The presence of MWCNTs in blood was assessed by Raman spectroscopy, while in liver histological examination and confocal microscopy were used. It was found that ss-DNA-MWCNTs induce oxidative stress in plasma and liver, with the return of the tested parameters to normal values, 6 h after ip injection of nanotubes, with the exception of reduced glutathione in plasma. The inflammatory cytokines (TNF-α, IL-1β) had a similar pattern of evolution. We also assessed the level of ERK1/2 and the phosphorylation of p65 subunit of NF-kB in liver that had a transient increase and returned to normal at the end of the tested period. Our results demonstrate that ss-DNA-MWCNTs produce oxidative stress and inflammation, but with a transient pattern. Given the fact that antioxidants modify the profile not only for oxidative stress, but also of inflammation, the dynamics of these alterations may be of practical importance for future protective strategies. -- Highlights: ► ss-DNA-MWCNTs ip administration induce oxidative stress in plasma and liver. ► ss-DNA-MWCNTs ip administration determine liver inflammation. ► ERK1/2 and p65 phosphorylated NF

  12. Parallel hierarchical radiosity rendering

    Energy Technology Data Exchange (ETDEWEB)

    Carter, M.

    1993-07-01

    In this dissertation, the step-by-step development of a scalable parallel hierarchical radiosity renderer is documented. First, a new look is taken at the traditional radiosity equation, and a new form is presented in which the matrix of linear system coefficients is transformed into a symmetric matrix, thereby simplifying the problem and enabling a new solution technique to be applied. Next, the state-of-the-art hierarchical radiosity methods are examined for their suitability to parallel implementation, and scalability. Significant enhancements are also discovered which both improve their theoretical foundations and improve the images they generate. The resultant hierarchical radiosity algorithm is then examined for sources of parallelism, and for an architectural mapping. Several architectural mappings are discussed. A few key algorithmic changes are suggested during the process of making the algorithm parallel. Next, the performance, efficiency, and scalability of the algorithm are analyzed. The dissertation closes with a discussion of several ideas which have the potential to further enhance the hierarchical radiosity method, or provide an entirely new forum for the application of hierarchical methods.

  13. Sea modeling and rendering

    Science.gov (United States)

    Cathala, Thierry; Latger, Jean

    2010-10-01

    More and more defence and civil applications require simulation of marine synthetic environment. Currently, the "Future Anti-Surface-Guided-Weapon" (FASGW) or "anti-navire léger" (ANL) missile needs this kind of modelling. This paper presents a set of technical enhancement of the SE-Workbench that aim at better representing the sea profile and the interaction with targets. The operational scenario variability is a key criterion: the generic geographical area (e.g. Persian Gulf, coast of Somalia,...), the type of situation (e.g. peace keeping, peace enforcement, anti-piracy, drug interdiction,...)., the objectives (political, strategic, or military objectives), the description of the mission(s) (e.g. antipiracy) and operation(s) (e.g. surveillance and reconnaissance, escort, convoying) to achieve the objectives, the type of environment (Weather, Time of day, Geography [coastlines, islands, hills/mountains]). The paper insists on several points such as the dual rendering using either ray tracing [and the GP GPU optimization] or rasterization [and GPU shaders optimization], the modelling of sea-surface based on hypertextures and shaders, the wakes modelling, the buoyancy models for targets, the interaction of coast and littoral, the dielectric infrared modelling of water material.

  14. Using surface-enhanced Raman spectroscopy and electrochemically driven melting to discriminate Yersinia pestis from Y. pseudotuberculosis based on single nucleotide polymorphisms within unpurified polymerase chain reaction amplicons.

    Science.gov (United States)

    Papadopoulou, Evanthia; Goodchild, Sarah A; Cleary, David W; Weller, Simon A; Gale, Nittaya; Stubberfield, Michael R; Brown, Tom; Bartlett, Philip N

    2015-02-03

    The development of sensors for the detection of pathogen-specific DNA, including relevant species/strain level discrimination, is critical in molecular diagnostics with major impacts in areas such as bioterrorism and food safety. Herein, we use electrochemically driven denaturation assays monitored by surface-enhanced Raman spectroscopy (SERS) to target single nucleotide polymorphisms (SNPs) that distinguish DNA amplicons generated from Yersinia pestis, the causative agent of plague, from the closely related species Y. pseudotuberculosis. Two assays targeting SNPs within the groEL and metH genes of these two species have been successfully designed. Polymerase chain reaction (PCR) was used to produce Texas Red labeled single-stranded DNA (ssDNA) amplicons of 262 and 251 bases for the groEL and metH targets, respectively. These amplicons were used in an unpurified form to hybridize to immobilized probes then subjected to electrochemically driven melting. In all cases electrochemically driven melting was able to discriminate between fully homologous DNA and that containing SNPs. The metH assay was particularly challenging due to the presence of only a single base mismatch in the middle of the 251 base long PCR amplicon. However, manipulation of assay conditions (conducting the electrochemical experiments at 10 °C) resulted in greater discrimination between the complementary and mismatched DNA. Replicate data were collected and analyzed for each duplex on different days, using different batches of PCR product and different sphere segment void (SSV) substrates. Despite the variability introduced by these differences, the assays are shown to be reliable and robust providing a new platform for strain discrimination using unpurified PCR samples.

  15. Comparison of the Sequence-Dependent Fluorescence of the Cyanine Dyes Cy3, Cy5, DyLight DY547 and DyLight DY647 on Single-Stranded DNA: e85605

    National Research Council Canada - National Science Library

    Nicole Kretschy; Mark M Somoza

    2014-01-01

    ..., Förster resonance energy transfer, and labeling for microarray hybridization. Previous research has shown that the fluorescence efficiency of Cy3 and Cy5, covalently attached to the 5' end of single-stranded DNA, is strongly sequence dependent...

  16. Comparison of the sequence-dependent fluorescence of the cyanine dyes Cy3, Cy5, DyLight DY547 and DyLight DY647 on single-stranded DNA

    National Research Council Canada - National Science Library

    Kretschy, Nicole; Somoza, Mark M

    2014-01-01

    ..., Förster resonance energy transfer, and labeling for microarray hybridization. Previous research has shown that the fluorescence efficiency of Cy3 and Cy5, covalently attached to the 5' end of single-stranded DNA, is strongly sequence dependent...

  17. Cellular nucleic acid binding protein binds G-rich single-stranded nucleic acids and may function as a nucleic acid chaperone.

    Science.gov (United States)

    Armas, Pablo; Nasif, Sofía; Calcaterra, Nora B

    2008-02-15

    Cellular nucleic acid binding protein (CNBP) is a small single-stranded nucleic acid binding protein made of seven Zn knuckles and an Arg-Gly rich box. CNBP is strikingly conserved among vertebrates and was reported to play broad-spectrum functions in eukaryotic cells biology. Neither its biological function nor its mechanisms of action were elucidated yet. The main goal of this work was to gain further insights into the CNBP biochemical and molecular features. We studied Bufo arenarum CNBP (bCNBP) binding to single-stranded nucleic acid probes representing the main reported CNBP putative targets. We report that, although bCNBP is able to bind RNA and single-stranded DNA (ssDNA) probes in vitro, it binds RNA as a preformed dimer whereas both monomer and dimer are able to bind to ssDNA. A systematic analysis of variant probes shows that the preferred bCNBP targets contain unpaired guanosine-rich stretches. These data expand the knowledge about CNBP binding stoichiometry and begins to dissect the main features of CNBP nucleic acid targets. Besides, we show that bCNBP presents a highly disordered predicted structure and promotes the annealing and melting of nucleic acids in vitro. These features are typical of proteins that function as nucleic acid chaperones. Based on these data, we propose that CNBP may function as a nucleic acid chaperone through binding, remodeling, and stabilizing nucleic acids secondary structures. This novel CNBP biochemical activity broadens the field of study about its biological function and may be the basis to understand the diverse ways in which CNBP controls gene expression.

  18. Amplicon-based metagenomic analysis of mixed fungal samples using proton release amplicon sequencing.

    Directory of Open Access Journals (Sweden)

    Daniel P Tonge

    Full Text Available Next generation sequencing technology has revolutionised microbiology by allowing concurrent analysis of whole microbial communities. Here we developed and verified similar methods for the analysis of fungal communities using a proton release sequencing platform with the ability to sequence reads of up to 400 bp in length at significant depth. This read length permits the sequencing of amplicons from commonly used fungal identification regions and thereby taxonomic classification. Using the 400 bp sequencing capability, we have sequenced amplicons from the ITS1, ITS2 and LSU fungal regions to a depth of approximately 700,000 raw reads per sample. Representative operational taxonomic units (OTUs were chosen by the USEARCH algorithm, and identified taxonomically through nucleotide blast (BLASTn. Combination of this sequencing technology with the bioinformatics pipeline allowed species recognition in two controlled fungal spore populations containing members of known identity and concentration. Each species included within the two controlled populations was found to correspond to a representative OTU, and these OTUs were found to be highly accurate representations of true biological sequences. However, the absolute number of reads attributed to each OTU differed among species. The majority of species were represented by an OTU derived from all three genomic regions although in some cases, species were only represented in two of the regions due to the absence of conserved primer binding sites or due to sequence composition. It is apparent from our data that proton release sequencing technologies can deliver a qualitative assessment of the fungal members comprising a sample. The fact that some fungi cannot be amplified by specific "conserved" primer pairs confirms our recommendation that a multi-region approach be taken for other amplicon-based metagenomic studies.

  19. Use of single-strand conformation polymorphism of amplified 16S rDNA for grouping of bacteria isolated from foods.

    Science.gov (United States)

    Takahashi, Hajime; Kimura, Bon; Tanaka, Yuichiro; Mori, Mayumi; Yokoi, Asami; Fujii, Tateo

    2008-04-01

    The grouping method for isolated strains from foods using single-strand conformation polymorphism (SSCP) after PCR amplification of a portion of 16S rDNA was developed. This method was able to group the strains from various food samples based on 16S rDNA sequence. As 97.8% of the isolated strains from various foods were grouped correctly, use of the PCR-SSCP method enables the prompt and labor-saving analysis of microbial population of food-derived bacterial strains. Advantages in speed and accuracy of bacterial population identification by the PCR-SSCP method have practical application for food suppliers and testing laboratories.

  20. Comparison of specific binding sites for Escherichia coli RNA polymerase with naturally occurring hairpin regions in single-stranded DNA of coliphage M13. [Aspergillus oryzae

    Energy Technology Data Exchange (ETDEWEB)

    Niyogi, S.K.; Mitra, S.

    1978-08-25

    Escherichia coli RNA polymerase binds specifically to the single-stranded circular DNA of coliphage M13 in the presence of a saturating concentration of the bacterial DNA binding protein presumably as an essential step in the synthesis of the RNA primer required for synthesizing the complementary DNA strand in parental replicative-form DNA. The RNA polymerase-protected DNA regions were isolated after extensive digestion with pancreatic DNase, S1 endonuclease of Aspergillus oryzae, and exonuclease I of E. coli. The physicochemical properties of the RNA polymerase-protected segments (called PI and PII) were compared with those of the naturally occurring hairpin regions.

  1. Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

    OpenAIRE

    Takai, Toshiki; Nishita, Yoshinori; Iguchi-Ariga, Sanae M. M.; Ariga, Hiroyoshi

    1994-01-01

    We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Ac...

  2. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    Energy Technology Data Exchange (ETDEWEB)

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  3. Entropy, color, and color rendering.

    Science.gov (United States)

    Price, Luke L A

    2012-12-01

    The Shannon entropy [Bell Syst. Tech J.27, 379 (1948)] of spectral distributions is applied to the problem of color rendering. With this novel approach, calculations for visual white entropy, spectral entropy, and color rendering are proposed, indices that are unreliant on the subjectivity inherent in reference spectra and color samples. The indices are tested against real lamp spectra, showing a simple and robust system for color rendering assessment. The discussion considers potential roles for white entropy in several areas of color theory and psychophysics and nonextensive entropy generalizations of the entropy indices in mathematical color spaces.

  4. Cationic lipids and cationic ligands induce DNA helix denaturation: detection of single stranded regions by KMnO4 probing.

    Science.gov (United States)

    Prasad, T K; Gopal, Vijaya; Rao, N Madhusudhana

    2003-09-25

    Cationic lipids and cationic polymers are widely used in gene delivery. Using 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid, we have investigated the stability of the DNA in DOTAP:DNA complexes by probing with potassium permanganate (KMnO4). Interestingly, thymidines followed by a purine showed higher susceptibility to cationic ligand-mediated melting. Similar studies performed with other water-soluble cationic ligands such as polylysine, protamine sulfate and polyethyleneimine also demonstrated melting of the DNA but with variations. Small cations such as spermine and spermidine and a cationic detergent, cetyl trimethylammonium bromide, also rendered the DNA susceptible to modification by KMnO4. The data presented here provide direct proof for melting of DNA upon interaction with cationic lipids. Structural changes subsequent to binding of cationic lipids/ligands to DNA may lead to instability and formation of DNA bubbles in double-stranded DNA.

  5. A molecular-beacon-based asymmetric PCR assay for easy visualization of amplicons in the diagnosis of trichomoniasis.

    Science.gov (United States)

    Sonkar, Subash C; Sachdev, Divya; Mishra, Prashant K; Kumar, Anita; Mittal, Pratima; Saluja, Daman

    2016-12-15

    The currently available nucleic acid amplification tests (NAATs) for trichomoniasis are accurate, quick and confirmative with superior sensitivity than traditional culture-based microbiology assays. However, these assays are associated with problems of carry over contamination, false positive results, requirement of technical expertise for performance and detection of end product. Hence, a diagnostic assay with easy visualization of the amplified product will be profitable. An in-house, rapid, sensitive, specific molecular-beacon-based PCR assay, using primers against pfoB gene of Trichomonas vaginalis, was developed and evaluated using dry ectocervical swabs (n=392) from symptomatic females with vaginal discharge. Total DNA was isolated and used as template for the PCR assays. The performance and reproducibility of PCR assay was evaluated by composite reference standard (CRS). For easy visualization of the amplified product, molecular-beacon was designed and amplicons were visualized directly using fluorescent handheld dark reader or by Micro-Plate Reader. Molecular-beacons are single-stranded hairpin shaped nucleic acid probes composed of a stem, with fluorophore/quencher pair and a loop region complementary to the desired DNA. The beacon-based PCR assay designed in the present study is highly specific as confirmed by competition experiments and extremely sensitive with detection limit of 20fg of genomic DNA (3-4 pathogens). The minimum infrastructure requirement and ease to perform the assay makes this method highly useful for resource poor countries for better disease management. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Single-strand conformation polymorphism (SSCP) of oligodeoxyribonucleotides: an insight into solution structural dynamics of DNAs provided by gel electrophoresis and molecular dynamics simulations.

    Science.gov (United States)

    Biyani, Manish; Nishigaki, Koichi

    2005-10-01

    Studies on the solution structure dynamics of RNA/DNA are becoming crucially important. The phenomena of SSCP (single-strand conformation polymorphism), small RNA dynamics in a cell, and others can be related to the conformational changes of single-stranded (ss) RNAs/DNAs in solution. However, little is known about those dynamics. Only the intra-structural transition of ssDNAs in solution has been reported based on Watson-Crick (W-C) base-pairing. Here, we found a general feature of the SSCP phenomenon by studying the simpler molecules of ss-oligodeoxyribonucleotides. A single base substitution or a positional exchange of nucleotide in a highly homologous series of ss-dodecanucleotides led to a change in the mobility-in-gel. This was unexpected, since most of these nucleotides [such as d(A(11)G) or d(A(11)C)] have no possibility of forming W-C base-pairing. MD (molecular dynamics) experiments revealed differences in shape and size between the dynamic structures of these molecules which could affect their mobility-in-gel. In addition, a high correlation was observed between the electrophoretic mobility and the size-related parameters such as end-to-end distance obtained from MD simulations. Because the simulation was considerably shorter (nanosecond) than the experimental time-scale (second), the result must be considered conservatively; but it is nevertheless encouraging for utilizing MD simulation for structural analysis of oligonucleotides.

  7. Single-Stranded DNA-Binding Transcriptional Regulator FUBP1 Is Essential for Fetal and Adult Hematopoietic Stem Cell Self-Renewal

    Directory of Open Access Journals (Sweden)

    Uta Rabenhorst

    2015-06-01

    Full Text Available The ability of hematopoietic stem cells (HSCs to self-renew is a prerequisite for the establishment of definitive hematopoiesis and life-long blood regeneration. Here, we report the single-stranded DNA-binding transcriptional regulator far upstream element (FUSE-binding protein 1 (FUBP1 as an essential factor of HSC self-renewal. Functional inactivation of FUBP1 in two different mouse models resulted in embryonic lethal anemia at around E15.5 caused by severely diminished HSCs. Fetal and adult HSCs lacking FUBP1 revealed an HSC-intrinsic defect in their maintenance, expansion, and long-term blood reconstitution, but could differentiate into all hematopoietic lineages. FUBP1-deficient adult HSCs exhibit significant transcriptional changes, including upregulation of the cell-cycle inhibitor p21 and the pro-apoptotic Noxa molecule. These changes caused an increase in generation time and death of HSCs as determined by video-microscopy-based tracking. Our data establish FUBP1 and its recognition of single-stranded genomic DNA as an important element in the transcriptional regulation of HSC self-renewal.

  8. Isolation and characterization of a single-stranded DNA virus infecting the marine diatom Chaetoceros sp. strain SS628-11 isolated from western Japan.

    Directory of Open Access Journals (Sweden)

    Kei Kimura

    Full Text Available Diatoms are significant organisms for primary production in the earth's aquatic environment. Hence, their dynamics are an important focus area in current studies. Viruses are a great concern as potential factors of diatom mortality, along with other physical, chemical, and biological factors. We isolated and characterized a new diatom virus (Csp07DNAV that lyses the marine planktonic diatom Chaetoceros sp. strain SS628-11. This paper examines the physiological, morphological, and genomic characteristics of Csp07DNAV. The virus was isolated from a surface water sample that was collected at Hiroshima Bay, Japan. It was icosahedral, had a diameter of 34 nm, and accumulated in the nuclei of host cells. Rod-shaped virus particles also coexisted in the host nuclei. The latent period and burst size were estimated to be <12 h and 29 infectious units per host cell, respectively. Csp07DNAV had a closed circular single-stranded DNA genome (5,552 nucleotides, which included a double-stranded region and 3 open reading frames. The monophyly of Csp07DNAV and other Bacilladnavirus group single-stranded DNA viruses was supported by phylogenetic analysis that was based on the amino acid sequence of each virus protein. On the basis of these results, we considered Csp07DNAV to be a new member of the genus Bacilladnavirus.

  9. Ca2+ improves organization of single-stranded DNA bases in human Rad51 filament, explaining stimulatory effect on gene recombination.

    KAUST Repository

    Fornander, Louise H

    2012-02-22

    Human RAD51 protein (HsRad51) catalyses the DNA strand exchange reaction for homologous recombination. To clarify the molecular mechanism of the reaction in vitro being more effective in the presence of Ca(2+) than of Mg(2+), we have investigated the effect of these ions on the structure of HsRad51 filament complexes with single- and double-stranded DNA, the reaction intermediates. Flow linear dichroism spectroscopy shows that the two ionic conditions induce significantly different structures in the HsRad51/single-stranded DNA complex, while the HsRad51/double-stranded DNA complex does not demonstrate this ionic dependence. In the HsRad51/single-stranded DNA filament, the primary intermediate of the strand exchange reaction, ATP/Ca(2+) induces an ordered conformation of DNA, with preferentially perpendicular orientation of nucleobases relative to the filament axis, while the presence of ATP/Mg(2+), ADP/Mg(2+) or ADP/Ca(2+) does not. A high strand exchange activity is observed for the filament formed with ATP/Ca(2+), whereas the other filaments exhibit lower activity. Molecular modelling suggests that the structural variation is caused by the divalent cation interfering with the L2 loop close to the DNA-binding site. It is proposed that the larger Ca(2+) stabilizes the loop conformation and thereby the protein-DNA interaction. A tight binding of DNA, with bases perpendicularly oriented, could facilitate strand exchange.

  10. Structure-Based Analysis of the Interaction between the Simian Virus 40 T-Antigen Origin Binding Domain and Single-Stranded DNA

    Energy Technology Data Exchange (ETDEWEB)

    G Meinke; P Phelan; A Fradet-Turcotte; A Bohm; J Archambault; P Bullock

    2011-12-31

    The origin-binding domain (OBD) of simian virus 40 (SV40) large T-antigen (T-Ag) is essential for many of T-Ag's interactions with DNA. Nevertheless, many important issues related to DNA binding, for example, how single-stranded DNA (ssDNA) transits along the T-Ag OBD, have yet to be established. Therefore, X-ray crystallography was used to determine the costructure of the T-Ag OBD bound to DNA substrates such as the single-stranded region of a forked oligonucleotide. A second structure of the T-Ag OBD crystallized in the presence of poly(dT){sub 12} is also reported. To test the conclusions derived from these structures, residues identified as being involved in binding to ssDNA by crystallography or by an earlier nuclear magnetic resonance study were mutated, and their binding to DNA was characterized via fluorescence anisotropy. In addition, these mutations were introduced into full-length T-Ag, and these mutants were tested for their ability to support replication. When considered in terms of additional homology-based sequence alignments, our studies refine our understanding of how the T-Ag OBDs encoded by the polyomavirus family interact with ssDNA, a critical step during the initiation of DNA replication.

  11. Effect of phosphorothioate modifications on the ability of GTn oligodeoxynucleotides to specifically recognize single-stranded DNA-binding proteins and to affect human cancer cellular growth.

    Science.gov (United States)

    Morassutti, C; Scaggiante, B; Dapas, B; Xodo, L; Tell, G; Quadrifoglio, F

    1999-12-01

    We have previously identified phosphodiester oligonucleotides exclusively made of G and T bases, named GTn, that significantly inhibit human cancer cell growth and recognize specific nuclear single-stranded DNA binding proteins. We wished to examine the ability of the modified GTn oligonucleotides with different degrees of phosphorothioate modifications to bind specifically to the same nuclear proteins recognized by the GTn phosphodiester analogues and their cytotoxic effect on the human T-lymphoblastic CCRF-CEM cell line. We showed that the full phosphorothioate GTn oligonucleotide was neither able to specifically recognize those nuclear proteins, nor cytotoxic. In contrast, the 3'-phosphorothioate-protected GTn oligonucleotides can maintain the specific protein-binding activity. The end-modified phosphorothioate oligonucleotides were also able to elicit the dose-dependent cell growth inhibition effect, but a loss in the cytotoxic ability was observed increasing the extent of sulphur modification of the sequences. Our results indicate that phosphorothioate oligonucleotides directed at specific single-stranded DNA-binding proteins should contain a number of phosphorothioate end-linkages which should be related to the length of the sequence, in order to maintain the same biological activities exerted by their phosphodiester analogues.

  12. Histone H3.3 promotes IgV gene diversification by enhancing formation of AID-accessible single-stranded DNA.

    Science.gov (United States)

    Romanello, Marina; Schiavone, Davide; Frey, Alexander; Sale, Julian E

    2016-07-01

    Immunoglobulin diversification is driven by activation-induced deaminase (AID), which converts cytidine to uracil within the Ig variable (IgV) regions. Central to the recruitment of AID to the IgV genes are factors that regulate the generation of single-stranded DNA (ssDNA), the enzymatic substrate of AID Here, we report that chicken DT40 cells lacking variant histone H3.3 exhibit reduced IgV sequence diversification. We show that this results from impairment of the ability of AID to access the IgV genes due to reduced formation of ssDNA during IgV transcription. Loss of H3.3 also diminishes IgV R-loop formation. However, reducing IgV R-loops by RNase HI overexpression in wild-type cells does not affect IgV diversification, showing that these structures are not necessary intermediates for AID access. Importantly, the reduction in the formation of AID-accessible ssDNA in cells lacking H3.3 is independent of any effect on the level of transcription or the kinetics of RNAPII elongation, suggesting the presence of H3.3 in the nucleosomes of the IgV genes increases the chances of the IgV DNA becoming single-stranded, thereby creating an effective AID substrate.

  13. Structural Basis for Dimer Formation of Human Condensin Structural Maintenance of Chromosome Proteins and Its Implications for Single-stranded DNA Recognition.

    Science.gov (United States)

    Uchiyama, Susumu; Kawahara, Kazuki; Hosokawa, Yuki; Fukakusa, Shunsuke; Oki, Hiroya; Nakamura, Shota; Kojima, Yukiko; Noda, Masanori; Takino, Rie; Miyahara, Yuya; Maruno, Takahiro; Kobayashi, Yuji; Ohkubo, Tadayasu; Fukui, Kiichi

    2015-12-01

    Eukaryotic structural maintenance of chromosome proteins (SMC) are major components of cohesin and condensins that regulate chromosome structure and dynamics during cell cycle. We here determine the crystal structure of human condensin SMC hinge heterodimer with ~30 residues of coiled coils. The structure, in conjunction with the hydrogen exchange mass spectrometry analyses, revealed the structural basis for the specific heterodimer formation of eukaryotic SMC and that the coiled coils from two different hinges protrude in the same direction, providing a unique binding surface conducive for binding to single-stranded DNA. The characteristic hydrogen exchange profiles of peptides constituted regions especially across the hinge-hinge dimerization interface, further suggesting the structural alterations upon single-stranded DNA binding and the presence of a half-opened state of hinge heterodimer. This structural change potentially relates to the DNA loading mechanism of SMC, in which the hinge domain functions as an entrance gate as previously proposed for cohesin. Our results, however, indicated that this is not the case for condensins based on the fact that the coiled coils are still interacting with each other, even when DNA binding induces structural changes in the hinge region, suggesting the functional differences of SMC hinge domain between condensins and cohesin in DNA recognition.

  14. The acidic C-terminus of vaccinia virus I3 single-strand binding protein promotes proper assembly of DNA-protein complexes.

    Science.gov (United States)

    Harrison, Melissa L; Desaulniers, Megan A; Noyce, Ryan S; Evans, David H

    2016-02-01

    The vaccinia virus I3L gene encodes a single-stranded DNA binding protein (SSB) that is essential for virus DNA replication and is conserved in all Chordopoxviruses. The I3 protein contains a negatively charged C-terminal tail that is a common feature of SSBs. Such acidic tails are critical for SSB-dependent replication, recombination and repair. We cloned and purified variants of the I3 protein, along with a homolog from molluscum contagiosum virus, and tested how the acidic tail affected DNA-protein interactions. Deleting the C terminus of I3 enhanced the affinity for single-stranded DNA cellulose and gel shift analyses showed that it also altered the migration of I3-DNA complexes in agarose gels. Microinjecting an antibody against I3 into vaccinia-infected cells also selectively inhibited virus replication. We suggest that this domain promotes cooperative binding of I3 to DNA in a way that would maintain an open DNA configuration around a replication site.

  15. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  16. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  17. Exposure render: an interactive photo-realistic volume rendering framework.

    Directory of Open Access Journals (Sweden)

    Thomas Kroes

    Full Text Available The field of volume visualization has undergone rapid development during the past years, both due to advances in suitable computing hardware and due to the increasing availability of large volume datasets. Recent work has focused on increasing the visual realism in Direct Volume Rendering (DVR by integrating a number of visually plausible but often effect-specific rendering techniques, for instance modeling of light occlusion and depth of field. Besides yielding more attractive renderings, especially the more realistic lighting has a positive effect on perceptual tasks. Although these new rendering techniques yield impressive results, they exhibit limitations in terms of their exibility and their performance. Monte Carlo ray tracing (MCRT, coupled with physically based light transport, is the de-facto standard for synthesizing highly realistic images in the graphics domain, although usually not from volumetric data. Due to the stochastic sampling of MCRT algorithms, numerous effects can be achieved in a relatively straight-forward fashion. For this reason, we have developed a practical framework that applies MCRT techniques also to direct volume rendering (DVR. With this work, we demonstrate that a host of realistic effects, including physically based lighting, can be simulated in a generic and flexible fashion, leading to interactive DVR with improved realism. In the hope that this improved approach to DVR will see more use in practice, we have made available our framework under a permissive open source license.

  18. Melting of duplex DNA in the absence of ATP by NS3 helicase domain through specific interaction with a single-strand/double-strand junction

    Science.gov (United States)

    Reynolds, Kimberly A.; Cameron, Craig E.; Raney, Kevin D.

    2016-01-01

    Helicases unwind double-stranded nucleic acids, remove secondary structures from single-stranded nucleic acids, and remove proteins bound to nucleic acids. For many helicases, the mechanisms for these different functions share the ability to translocate with a directional bias as a result of ATP binding and hydrolysis. The nonstructural protein 3 (NS3) is an essential enzyme expressed by the hepatitis C virus (HCV) and is known to catalyze the unwinding of both DNA and RNA substrates in a 3′-to-5′ direction. We investigated the role of nucleic acid binding in the unwinding mechanism by examining ATP-independent unwinding. We observed that even in the absence of ATP, NS3 helicase domain (NS3h) unwound duplexes only when they contained a 3′-tail (i.e., 3′-to-5′ directionality). Blunt-ended duplexes and 5′-tailed duplexes were not melted even in the presence of a large excess concentration of the protein. NS3h was found to diffuse rapidly along single-stranded DNA at a rate of 30 nt2·s−1. Upon encountering an appropriate single-strand/double-strand (ss/ds) junction, NS3h slowly melted the duplex under conditions with excess protein concentration relative to DNA concentration. When a biotin-streptavidin block was placed into the ssDNA region, no melting of DNA was observed, suggesting that NS3h must diffuse along the ssDNA, and that the streptavidin blocked the diffusion. We conclude that the specific interaction between NS3h and the ss/dsDNA junction, coupled with diffusion allows binding energy to melt duplex DNA with a directional bias. Alternatively, we found that the full-length NS3 protein did not exhibit strict directionality and was dependent on duplex DNA length. NS3 was able to unwind the duplex even in the presence of the biotin-streptavidin block. We propose a non-canonical model of unwinding for NS3 in which the enzyme binds directly to the duplex via protein-protein interactions to melt the substrate. PMID:26091150

  19. RenderMan design principles

    Science.gov (United States)

    Apodaca, Tony; Porter, Tom

    1989-01-01

    The two worlds of interactive graphics and realistic graphics have remained separate. Fast graphics hardware runs simple algorithms and generates simple looking images. Photorealistic image synthesis software runs slowly on large expensive computers. The time has come for these two branches of computer graphics to merge. The speed and expense of graphics hardware is no longer the barrier to the wide acceptance of photorealism. There is every reason to believe that high quality image synthesis will become a standard capability of every graphics machine, from superworkstation to personal computer. The significant barrier has been the lack of a common language, an agreed-upon set of terms and conditions, for 3-D modeling systems to talk to 3-D rendering systems for computing an accurate rendition of that scene. Pixar has introduced RenderMan to serve as that common language. RenderMan, specifically the extensibility it offers in shading calculations, is discussed.

  20. Exposure Render: An Interactive Photo-Realistic Volume Rendering Framework

    NARCIS (Netherlands)

    Kroes, T.; Post, F.H.; Botha, C.P.

    2012-01-01

    The field of volume visualization has undergone rapid development during the past years, both due to advances in suitable computing hardware and due to the increasing availability of large volume datasets. Recent work has focused on increasing the visual realism in Direct Volume Rendering (DVR) by i

  1. Polymerase chain reaction-single strand conformation polymorphism analyses of nuclear and chloroplast DNA provide evidence for recombination, multiple introductions and nascent speciation in the Caulerpa taxifolia complex.

    Science.gov (United States)

    Meusnier, I; Valero, M; Destombe, C; Godé, C; Desmarais, E; Bonhomme, F; Stam, W T; Olsen, J L

    2002-11-01

    Independent lines of evidence support an Australian origin for the Mediterranean populations of the tropical alga Caulerpa taxifolia. To complement previous biogeographical studies based on nuclear rDNA internal transcribed spacer (ITS), a new chloroplast marker was developed--the cp 16S rDNA intron-2. Sequence variability for both nuclear and chloroplast markers were assessed in 110 individuals using single strand conformation polymorphism. Comparison of intrapopulation genetic diversity between invasive Mediterranean and 'native' Australian populations revealed the occurrence of two divergent and widespread clades. The first clade grouped nontropical invasive populations with inshore-mainland populations from Australia, while the second clustered all offshore-island populations studied so far. Despite our finding of nine distinct nuclear and five distinct chloroplast profiles, a single nucleocytoplasmic combination was characteristic of the invasive populations and sexual reproduction was found to be very rare. C. taxifolia is clearly a complex of genetically and ecologically differentiated sibling species or subspecies.

  2. The casein genes in goat breeds from different Continents: analysis by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP

    Directory of Open Access Journals (Sweden)

    A. Caroli

    2010-04-01

    Full Text Available A screening of casein gene variability was carried out by Polymerase Chain Reaction – Single Strand Conformation Polymorphism in 8 goat breeds from Sudan (Nubian goat, Turkey (Angora Goat Lalahan Tiftic, Angora Goat Yerkoy, Hair goat and India (Jammu, Maharashtra, Rajasthan, South Goat. A total of 16 different alleles or groups of alleles were found, showing conspicuous differences among breeds. The allele frequencies were submitted to cluster analysis in order to highlight differences between breeds, also including data from Red Sokoto, West African Dwarf Nigeria, West African Dwarf Cameroon, and Borno Goat. The tree obtained from the cluster analysis showed two main lineages. The West African goat clustered together, the Indian and Turkish breeds were in the other group. Nubian goat was found in an intermediate position.

  3. Single strand confirmation polymorphism (SSCP detection in exon I of the a-lactalbumin gene of Indian Jamunapari milk goats (Capra hircus

    Directory of Open Access Journals (Sweden)

    Dinesh Kumar

    2006-01-01

    Full Text Available The genetic diversity of Jamunapari goats (Capra hircus was investigated using an optimized non-radioactive polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP method to detect a-lactalbumin polymorphism in a sample of 50 goats. Our data show that PCR-SSCP is an appropriate tool for evaluating genetic variability in Jamunapari goats. Polymorphism was detected in the sample, indicating that Jamunapari goats have high genetic variability at loci, exon I of the a-lactalbumin gene. This result opens interesting prospects for future selection programs and conservation strategies. These a-lactalbumin variants can be sequenced and screened in the population to develop single nucleotide polymorphism (SNP markers for association studies and marker assisted selection.

  4. Differentiation of Plum pox virus isolates by single-strand conformation polymorphism and low-stringency single specific primer PCR analysis of HC-Pro genome region.

    Science.gov (United States)

    Gadiou, S; Safárová, D; Navrátil, M

    2009-01-01

    Single-strand conformation polymorphism (SSCP) and low-stringency single specific primer (LSSP)-PCR were assessed for suitability and reliability in genotyping of Plum pox virus (PPV) isolates. Examined PPV isolates included 16 PPV-D, 12 PPV-M, and 14 PPV-Rec isolates collected in Czech Republic. The analysis was performed on the helper component protease (HC-Pro) region of the PPV genome. SSCP and LSSP-PCR allowed the differentiation of PPV strain, but SSCP was not able to distinguish isolates within the same strain. The individual genotyping of each PPV isolate was obtained by LSSP-PCR. Nevertheless, both SSCP and LSSP-PCR techniques are suitable for preliminary screening of genetic variability of plant RNA viruses.

  5. A single-strand conformation polymorphism (SSCP) approach for investigating genetic interactions of Schistosoma haematobium and Schistosoma guineensis in Loum, Cameroon.

    Science.gov (United States)

    Webster, B L; Tchuem Tchuenté, L A; Southgate, V R

    2007-03-01

    Single-strand conformation polymorphism (SSCP) analysis of the second internal transcribed spacer (ITS2) of nuclear ribosomal DNA provides a molecular tool for the identification of Schistosoma haematobium, Schistosoma guineensis and the hybrids of these two species. This molecular tool was utilized to provide a detailed analysis of the interactions between S. haematobium and S. guineensis in hybrid zones of Loum, Littoral Province, Cameroon. Individual hybrid schistosomes were identified within the natural populations collected from Loum in 1990, 1999 and 2000, which would have been misidentified as S. haematobium using solely morphological and sequence criteria. This study indicates the complexities of the hybridization between S. haematobium and S. guineensis and emphasizes the importance of assessing morphological, biological and molecular data to gain insights into the interaction of these two species over time.

  6. Investigation of single-strand conformational polymorphism of the TP53 gene in women with a family history of breast cancer

    Directory of Open Access Journals (Sweden)

    R.R. Burbano

    2000-11-01

    Full Text Available Breast cancer in families with germ line mutations in the TP53 gene has been described in the medical literature. Mutation screening for susceptibility genes should allow effective prophylactic and preventive measures. Using single-strand conformational polymorphism, we screened for mutations in exons 5, 6, 7 and 8 of gene TP53 in the peripheral blood of 8 young non-affected members (17 to 36 years old of families with a history of breast cancer. Studies of this type on young patients (mean age, 25 years are very rare in the literature. The identification of these mutations would contribute to genetic counseling of members of families with predisposition to breast cancer. The results obtained did not show any polymorphism indicating mutation. In our sample, the familial tumorigenesis is probably related to other gene etiologies.

  7. Effect of temperature on the low-frequency vibrational spectrum and relative structuring of hydration water around a single-stranded DNA.

    Science.gov (United States)

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy

    2015-01-07

    Molecular dynamics simulations of the single-stranded DNA oligomer (5'-CGCGAAT TCGCG-3') in aqueous solution have been carried out at different temperatures between 160 K and 300 K. The effects of temperature on the low-frequency vibrational spectrum and local structural arrangements of water molecules hydrating the DNA strand have been explored in detail. The low-frequency density of states distributions reveal that increasingly trapped transverse water motions play a dominant role in controlling the band corresponding to O⋯O⋯O bending or transverse oscillations of hydration water at supercooled temperatures. In addition, presence of a broad band around 260 (±20) cm(-1) under supercooled conditions indicates transformation from high density liquid-like structuring of hydration water at higher temperatures to that of a low density liquid at lower temperatures. It is found that long-range correlations between the supercooled hydration water molecules arise due to such local structural transition around the DNA oligomer.

  8. Probing the Salt Concentration Dependent Nucelobase Distribution in a Single-Stranded DNA-Single-Walled Carbon Nanotube Hybrid with Molecular Dynamics.

    Science.gov (United States)

    Ghosh, Soumadwip; Patel, Nisheet; Chakrabarti, Rajarshi

    2016-01-28

    The hybrids of single-walled carbon nanotube (SWCNT) and single stranded DNA (ssDNA) are novel nanoscale materials having remarkable applications in nanotechnology. The absorption of nucleobases on the surface of a SWCNT depends strongly on the ionic strength of the medium. In this paper, using atomistic molecular dynamics we have shown that at low salt concentration ssDNA wraps on the surface of SWCNT through hydrophobic π-π stacking between the DNA bases and the sp(2)-hybridized carbon atoms of the carbon nanotube. At high salt concentration, however, the DNA molecule adopts a partially folded structure and the ssDNA-SWCNT wrapping gets weakened significantly due to the self-stacking of the DNA bases. Our study can find relevance in CNT mediated gene delivery processes where subsequent unwrapping of the gene from its carrier is anticipated across the cell membrane regulated by an existing salt concentration gradient.

  9. Classification and evolutionary history of the single-strand annealing proteins, RecT, Redβ, ERF and RAD52

    Directory of Open Access Journals (Sweden)

    Aravind L

    2002-03-01

    Full Text Available Abstract Background The DNA single-strand annealing proteins (SSAPs, such as RecT, Redβ, ERF and Rad52, function in RecA-dependent and RecA-independent DNA recombination pathways. Recently, they have been shown to form similar helical quaternary superstructures. However, despite the functional similarities between these diverse SSAPs, their actual evolutionary affinities are poorly understood. Results Using sensitive computational sequence analysis, we show that the RecT and Redβ proteins, along with several other bacterial proteins, form a distinct superfamily. The ERF and Rad52 families show no direct evolutionary relationship to these proteins and define novel superfamilies of their own. We identify several previously unknown members of each of these superfamilies and also report, for the first time, bacterial and viral homologs of Rad52. Additionally, we predict the presence of aberrant HhH modules in RAD52 that are likely to be involved in DNA-binding. Using the contextual information obtained from the analysis of gene neighborhoods, we provide evidence of the interaction of the bacterial members of each of these SSAP superfamilies with a similar set of DNA repair/recombination protein. These include different nucleases or Holliday junction resolvases, the ABC ATPase SbcC and the single-strand-binding protein. We also present evidence of independent assembly of some of the predicted operons encoding SSAPs and in situ displacement of functionally similar genes. Conclusions There are three evolutionarily distinct superfamilies of SSAPs, namely the RecT/Redβ, ERF, and RAD52, that have different sequence conservation patterns and predicted folds. All these SSAPs appear to be primarily of bacteriophage origin and have been acquired by numerous phylogenetically distant cellular genomes. They generally occur in predicted operons encoding one or more of a set of conserved DNA recombination proteins that appear to be the principal functional

  10. Epstein-Barr Virus Immediate-Early Protein Zta Co-Opts Mitochondrial Single-Stranded DNA Binding Protein To Promote Viral and Inhibit Mitochondrial DNA Replication▿

    Science.gov (United States)

    Wiedmer, Andreas; Wang, Pu; Zhou, Jing; Rennekamp, Andrew J.; Tiranti, Valeria; Zeviani, Massimo; Lieberman, Paul M.

    2008-01-01

    Disruption of cellular metabolic processes and usurpation of host proteins are hallmarks of herpesvirus lytic infection. Epstein-Barr virus (EBV) lytic replication is initiated by the immediate-early protein Zta. Zta is a multifunctional DNA binding protein that stimulates viral gene transcription, nucleates a replication complex at the viral origin of lytic replication, and inhibits cell cycle proliferation. To better understand these functions and identify cellular collaborators of Zta, we purified an epitope-tagged version of Zta in cells capable of supporting lytic replication. FLAG-tagged Zta was purified from a nuclear fraction using FLAG antibody immunopurification and peptide elution. Zta-associated proteins were isolated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and identified by mass spectrometry. The Zta-associated proteins included members of the HSP70 family and various single-stranded DNA and RNA binding proteins. The nuclear replication protein A subunits (RPA70 and RPA32) and the human mitochondrial single-stranded DNA binding protein (mtSSB) were confirmed by Western blotting to be specifically enriched in the FLAG-Zta immunopurified complex. mtSSB coimmunoprecipitated with endogenous Zta during reactivation of EBV-positive Burkitt lymphoma and lymphoblastoid cell lines. Small interfering RNA depletion of mtSSB reduced Zta-induced lytic replication of EBV but had only a modest effect on transcription activation function. A point mutation in the Zta DNA binding domain (C189S), which is known to reduce lytic cycle replication, eliminated mtSSB association with Zta. The predominantly mitochondrial localization of mtSSB was shifted to partly nuclear localization in cells expressing Zta. Mitochondrial DNA synthesis and genome copy number were reduced by Zta-induced EBV lytic replication. We conclude that Zta interaction with mtSSB serves the dual function of facilitating viral and blocking mitochondrial DNA replication. PMID:18305033

  11. Epstein-Barr virus immediate-early protein Zta co-opts mitochondrial single-stranded DNA binding protein to promote viral and inhibit mitochondrial DNA replication.

    Science.gov (United States)

    Wiedmer, Andreas; Wang, Pu; Zhou, Jing; Rennekamp, Andrew J; Tiranti, Valeria; Zeviani, Massimo; Lieberman, Paul M

    2008-05-01

    Disruption of cellular metabolic processes and usurpation of host proteins are hallmarks of herpesvirus lytic infection. Epstein-Barr virus (EBV) lytic replication is initiated by the immediate-early protein Zta. Zta is a multifunctional DNA binding protein that stimulates viral gene transcription, nucleates a replication complex at the viral origin of lytic replication, and inhibits cell cycle proliferation. To better understand these functions and identify cellular collaborators of Zta, we purified an epitope-tagged version of Zta in cells capable of supporting lytic replication. FLAG-tagged Zta was purified from a nuclear fraction using FLAG antibody immunopurification and peptide elution. Zta-associated proteins were isolated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and identified by mass spectrometry. The Zta-associated proteins included members of the HSP70 family and various single-stranded DNA and RNA binding proteins. The nuclear replication protein A subunits (RPA70 and RPA32) and the human mitochondrial single-stranded DNA binding protein (mtSSB) were confirmed by Western blotting to be specifically enriched in the FLAG-Zta immunopurified complex. mtSSB coimmunoprecipitated with endogenous Zta during reactivation of EBV-positive Burkitt lymphoma and lymphoblastoid cell lines. Small interfering RNA depletion of mtSSB reduced Zta-induced lytic replication of EBV but had only a modest effect on transcription activation function. A point mutation in the Zta DNA binding domain (C189S), which is known to reduce lytic cycle replication, eliminated mtSSB association with Zta. The predominantly mitochondrial localization of mtSSB was shifted to partly nuclear localization in cells expressing Zta. Mitochondrial DNA synthesis and genome copy number were reduced by Zta-induced EBV lytic replication. We conclude that Zta interaction with mtSSB serves the dual function of facilitating viral and blocking mitochondrial DNA replication.

  12. HIV-1 viral infectivity factor (Vif) alters processive single-stranded DNA scanning of the retroviral restriction factor APOBEC3G.

    Science.gov (United States)

    Feng, Yuqing; Love, Robin P; Chelico, Linda

    2013-03-01

    APOBEC3G is a retroviral restriction factor that can inhibit the replication of human immunodeficiency virus, type 1 (HIV-1) in the absence of the viral infectivity factor (Vif) protein. Virion-encapsidated APOBEC3G can deaminate cytosine to uracil in viral (-)DNA, which leads to hypermutation and inactivation of the provirus. APOBEC3G catalyzes these deaminations processively on single-stranded DNA using sliding and jumping movements. Vif is thought to primarily overcome APOBEC3G through an interaction that mediates APOBEC3G ubiquitination and results in its proteasomal degradation. However, Vif may also inhibit APOBEC3G mRNA translation, virion encapsidation, and deamination activity. Here we investigated the molecular mechanism of VifIIIB- and VifHXB2-mediated inhibition of APOBEC3G deamination activity. Biochemical assays using a model HIV-1 replication assay and synthetic single-stranded or partially double-stranded DNA substrates demonstrated that APOBEC3G has an altered processive mechanism in the presence of Vif. Specifically, VifHXB2 inhibited the jumping and VifIIIB inhibited the sliding movements of APOBEC3G. The absence of such an effect by Vif on degradation-resistant APOBEC3G D128K indicates that a Vif-APOBEC3G interaction mediates this effect. That the partially processive APOBEC3G was less effective at inducing mutagenesis in a model HIV-1 replication assay suggests that Vif co-encapsidation with APOBEC3G can promote sublethal mutagenesis of HIV-1 proviral DNA.

  13. PriC-mediated DNA replication restart requires PriC complex formation with the single-stranded DNA-binding protein.

    Science.gov (United States)

    Wessel, Sarah R; Marceau, Aimee H; Massoni, Shawn C; Zhou, Ruobo; Ha, Taekjip; Sandler, Steven J; Keck, James L

    2013-06-14

    Frequent collisions between cellular DNA replication complexes (replisomes) and obstacles such as damaged DNA or frozen protein complexes make DNA replication fork progression surprisingly sporadic. These collisions can lead to the ejection of replisomes prior to completion of replication, which, if left unrepaired, results in bacterial cell death. As such, bacteria have evolved DNA replication restart mechanisms that function to reload replisomes onto abandoned DNA replication forks. Here, we define a direct interaction between PriC, a key Escherichia coli DNA replication restart protein, and the single-stranded DNA-binding protein (SSB), a protein that is ubiquitously associated with DNA replication forks. PriC/SSB complex formation requires evolutionarily conserved residues from both proteins, including a pair of Arg residues from PriC and the C terminus of SSB. In vitro, disruption of the PriC/SSB interface by sequence changes in either protein blocks the first step of DNA replication restart, reloading of the replicative DnaB helicase onto an abandoned replication fork. Consistent with the critical role of PriC/SSB complex formation in DNA replication restart, PriC variants that cannot bind SSB are non-functional in vivo. Single-molecule experiments demonstrate that PriC binding to SSB alters SSB/DNA complexes, exposing single-stranded DNA and creating a platform for other proteins to bind. These data lead to a model in which PriC interaction with SSB remodels SSB/DNA structures at abandoned DNA replication forks to create a DNA structure that is competent for DnaB loading.

  14. Detection of immobilized amplicons by ELISA-like techniques.

    Science.gov (United States)

    Oroskar, A A; Rasmussen, S E; Rasmussen, H N; Rasmussen, S R; Sullivan, B M; Johansson, A

    1996-09-01

    The NucleoLink surface is a physically modified, thermostable, optically clear resin. It allows the covalent binding of 5'-phosphorylated oligonucleotides. Target DNA amplification by polymerase chain reaction (PCR) is accomplished by asymmetric amplification on the covalently immobilized primer that develops into immobilized amplicons. A DNA fragment of bovine leukemia virus is used as a model system for the detection of immobilized amplicons by ELISA-like techniques. Covalently bound oligonucleotides are also utilized as capture probe in the hybridization-based signal amplification for detection of an infectious organism.

  15. Barcoded Primers Used in Multiplex Amplicon Pyrosequencing Bias Amplification

    OpenAIRE

    2012-01-01

    “Barcode-tagged” PCR primers used for multiplex amplicon sequencing generate a thus-far-overlooked amplification bias that produces variable terminal restriction fragment length polymorphism (T-RFLP) and pyrosequencing data from the same environmental DNA template. We propose a simple two-step PCR approach that increases reproducibility and consistently recovers higher genetic diversity in pyrosequencing libraries.

  16. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Science.gov (United States)

    Ithurbide, Solenne; Bentchikou, Esma; Coste, Geneviève; Bost, Bruno; Servant, Pascale; Sommer, Suzanne

    2015-10-01

    The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA) pathway, strongly reduces the frequency of RecA- (and RecO-) independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  17. Single Strand Annealing Plays a Major Role in RecA-Independent Recombination between Repeated Sequences in the Radioresistant Deinococcus radiodurans Bacterium.

    Directory of Open Access Journals (Sweden)

    Solenne Ithurbide

    2015-10-01

    Full Text Available The bacterium Deinococcus radiodurans is one of the most radioresistant organisms known. It is able to reconstruct a functional genome from hundreds of radiation-induced chromosomal fragments. Our work aims to highlight the genes involved in recombination between 438 bp direct repeats separated by intervening sequences of various lengths ranging from 1,479 bp to 10,500 bp to restore a functional tetA gene in the presence or absence of radiation-induced DNA double strand breaks. The frequency of spontaneous deletion events between the chromosomal direct repeats were the same in recA+ and in ΔrecA, ΔrecF, and ΔrecO bacteria, whereas recombination between chromosomal and plasmid DNA was shown to be strictly dependent on the RecA and RecF proteins. The presence of mutations in one of the repeated sequence reduced, in a MutS-dependent manner, the frequency of the deletion events. The distance between the repeats did not influence the frequencies of deletion events in recA+ as well in ΔrecA bacteria. The absence of the UvrD protein stimulated the recombination between the direct repeats whereas the absence of the DdrB protein, previously shown to be involved in DNA double strand break repair through a single strand annealing (SSA pathway, strongly reduces the frequency of RecA- (and RecO- independent deletions events. The absence of the DdrB protein also increased the lethal sectoring of cells devoid of RecA or RecO protein. γ-irradiation of recA+ cells increased about 10-fold the frequencies of the deletion events, but at a lesser extend in cells devoid of the DdrB protein. Altogether, our results suggest a major role of single strand annealing in DNA repeat deletion events in bacteria devoid of the RecA protein, and also in recA+ bacteria exposed to ionizing radiation.

  18. GPU Pro advanced rendering techniques

    CERN Document Server

    Engel, Wolfgang

    2010-01-01

    This book covers essential tools and techniques for programming the graphics processing unit. Brought to you by Wolfgang Engel and the same team of editors who made the ShaderX series a success, this volume covers advanced rendering techniques, engine design, GPGPU techniques, related mathematical techniques, and game postmortems. A special emphasis is placed on handheld programming to account for the increased importance of graphics on mobile devices, especially the iPhone and iPod touch.Example programs and source code can be downloaded from the book's CRC Press web page. 

  19. Technical note: use of PCR-single-strand conformation polymorphism analysis for detection of bovine beta-casein variants A1, A2, A3, and B.

    Science.gov (United States)

    Barroso, A; Dunner, S; Cañón, J

    1999-10-01

    We have optimized the polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP) technique to screen the most frequent variants (A1, A2, A3, and B) of the bovine beta-casein gene. Five partly overlapping PCR products (233, 234, 265, 466, and 498 bp) of Exon VII of the beta-casein gene that encompass the target point mutations were heat-denatured, separated on nondenaturing polyacrylamide gels, and silver-stained. Simultaneous detection of all variants in reference samples of known genotypes (A1A2, A2A2, A1A3, A1B, and A2B) was best achieved on 17% polyacrylamide (100:1 acrylamide:bis-acrylamide ratio) gels with the PCR product of 234 bp. These results were confirmed by sequencing the allele-specific SSCP bands directly excised from polyacrylamide gels. A population of 65 anonymous samples belonging to various breeds was then analyzed twice, without discrepancies in a blind trial. Routine beta-casein genotyping using PCR-SSCP is proposed as a cost-effective, fast, and sensitive technique.

  20. Fluorescence-based Multiplex PCR-Single Strand Conformation Polymorphism (SSCP) Analysis of 16S Ribosomal DNA Using Capillary Electrophoresis

    Institute of Scientific and Technical Information of China (English)

    高鹏; 韩英; 许国旺; 赵春霞; 戴兵; 李萍; 王运铎; 温杰; 徐维家

    2004-01-01

    The rRNA genetic locus is found in all prokaryotic organisms, and is highly conservative, although its relatively stable variations are found frequently in different bacteria. The utility of this locus as a taxonomic and phylogenetic tool has been reported widely. This study, aimed at 16S rRNA gene ( 16S rDNA) and with the help of biomolecular methods, attempted to achieve the goal of rapid identification of common pathogens In this study, 333 clinical isolated pathogenic bacteria were collected。 Two pairs of primers were chosen and labeled with different fluorescent dyes and then used to amplify the genomic DNA extracted from bacteria. The PCR products were then detected by capillary electrophoresis-single strand conformation polymorphism (CE-SSCP) . In order to pursue higher resolution and peak-separation effect, a high efficient separating medium, liner polyacrylamidedel (LPA), was put to use in this study. Finally, every bacteria colony generated distinct patterns from each other, which were easily to be used for identification.These results indicated that PCR-CE-SSCP was a rapid identification method for bacterial identification, with the aspects of high efficiency and high precision. Compared with traditional method, this technology is of great utility for clinical use especially for its high sensitivity.

  1. Polymerase chain reaction-single strand conformational polymorphism analysis of rearranged during transfection proto-oncogene in Chinese familial hirschsprung's disease

    Institute of Scientific and Technical Information of China (English)

    Tao Guan; Ji-Cheng Li; Min-Ju Li; Jin-Fa Tou

    2005-01-01

    AIM: To investigate the relationship between mutations of rearranged during transfection (RET) proto-oncogene and Chinese patients with Hirschsprung's disease (HD), and to elucidate the genetic mechanism of familial HD patient at the molecular level.METHODS: Genomic DNA was extracted from venous blood of probands and their relatives in two genealogies.Polymerase chain reaction (PCR) products, which were amplified using specific primers (RET, exons 11, 13, 15and 17), were electrophoresed to analyze the single-strand conformational polymorphism (SSCP) patterns. The positive amplified products were sequenced. Forty-eight sporadic HD patients and 30 normal children were screened for mutations of RET proto-oncogene simultaneously.RESULTS: Three cases with HD in one family were found to have a G heterozygous insertion at nucleotide 18 974 in exon 13 of RET cDNA (18 974insG), which resulted in a frameshift mutation. In another family, a heterozygosity for T to G transition at nucleotide 18 888 in the same exon which resulted in a synonymous mutation of Leu at codon 745 was detected in the proband and his father. Eight RET mutations were confirmed in 48 sporadic HD patients.CONCLUSION: Mutations of RET proto-oncogene may play an important role in the pathogenesis of Chinese patients with HD. Detection of mutated RET proto-oncogene carriers may be used for genetic counseling of potential risk for HD in the affected families.

  2. Identification of anisakid nematodes with zoonotic potential from Europe and China by single-strand conformation polymorphism analysis of nuclear ribosomal DNA.

    Science.gov (United States)

    Zhu, X Q; Podolska, M; Liu, J S; Yu, H Q; Chen, H H; Lin, Z X; Luo, C B; Song, H Q; Lin, R Q

    2007-11-01

    Using genetic markers defined previously in the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA), isotopic, and non-isotopic polymerase-chain-reaction-coupled single-strand conformation polymorphism (SSCP) were utilized to identify each of three anisakid species [Anisakis simplex (s.l.), Contracaecum osculatum (s.l.), and Hysterothylacium aduncum] from different host species and geographical locations in Poland and Sweden. While subtle microheterogeneity was observed within each of Anisakis simplex (s.l.) and H. aduncum, distinct SSCP profiles were displayed for each of the three species, allowing identification and differentiation of the three taxa. Subsequent sequencing of the ITS-1 and ITS-2 rDNA revealed that A. simplex (s.l.) represented Anisakis simplex s.s. and Contracaecum osculatum (s.l.) represented C. osculatum C. Application of the non-isotopic SSCP assay of ITS-2 to larval anisakid samples from different hosts and geographical locations in China revealed three distinct SSCP profiles, one of which was consistent with that of A. simplex (s.l.), and the other two had different SSCP profiles from that of C. osculatum C and H. aduncum. Sequencing of the ITS-1 and ITS-2 rDNA for representative Chinese anisakid samples examined revealed three anisakid species in China, i.e., Anisakis typica, Anisakis pegreffii, and Hysterothylacium sp. These molecular tools will be useful for identification and investigation of the ecology of anisakid nematodes in China and elsewhere.

  3. Simultaneous Identification of 13 Foodborne Pathogens by Using Capillary Electrophoresis-Single Strand Conformation Polymorphism Coupled with Multiplex Ligation-Dependent Probe Amplification and Its Application in Foods.

    Science.gov (United States)

    Kim, So-Young; Chung, Boram; Chang, Jin-Hee; Jung, Gyoo Yeol; Kim, Hyoun Wook; Park, Beom-Young; Oh, Sang Suk; Oh, Mi-Hwa

    2016-10-01

    Capillary electrophoresis-single strand conformation polymorphism (CE-SSCP) coupled with stuffer-free multiplex ligation-dependent probe amplification (MLPA) was developed to identify 13 species of foodborne pathogens simultaneously. Species-specific MLPA probes were designed for nine of these species. These probes were targeted to the groEL, glyA, MMS, tuf, inv, ipaH, nuc, vvh, and 16S rRNA genes, which corresponded to Bacillus cereus, Campylobacter coli, Cronobacter sakazakii, Enterococcus spp., Salmonella spp., Shigella spp., Staphylococcus aureus, Vibrio vulnificus, and Yersinia enterocolitica, respectively. MLPA probes that had been previously developed by our laboratory were used for the other four species (Campylobacter jejuni, Clostridium perfringens, Escherichia coli O157:H7, and Listeria monocytogenes). The CE-SSCP method was optimized to identify all 13 foodborne microbes simultaneously in a single electrogram, in which 50-500 pg genomic DNA was detected per microbe. Twelve species were detected from animal-derived food samples (specifically, milk and sliced ham) that had been artificially inoculated with 12 of the foodborne pathogens, excluding V. vulnificus, which is not usually associated with animal foods. The method developed here could be used as an early warning system for outbreaks of foodborne diseases associated with animal-derived foods in the food industry.

  4. Experimental study of the impact of antimicrobial treatments on Campylobacter, Enterococcus and PCR-capillary electrophoresis single-strand conformation polymorphism profiles of the gut microbiota of chickens.

    Science.gov (United States)

    Mourand, Gwenaëlle; Jouy, Eric; Bougeard, Stéphanie; Dheilly, Alexandra; Kérouanton, Annaëlle; Zeitouni, Salman; Kempf, Isabelle

    2014-11-01

    An experiment was conducted to compare the impact of antimicrobial treatments on the susceptibility of Campylobacter, Enterococcus faecium and Enterococcus faecalis, and on the diversity of broiler microbiota. Specific-pathogen-free chickens were first orally inoculated with strains of Campylobacter and Enterococcus faecium. Birds were then orally treated with recommended doses of oxytetracycline, sulfadimethoxine/trimethoprim, amoxicillin or enrofloxacin. Faecal samples were collected before, during and after antimicrobial treatment. The susceptibility of Campylobacter, Enterococcus faecium and Enterococcus faecalis strains isolated on supplemented or non-supplemented media was studied and PCR-capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) profiles of the gut microbiota were analysed. Enrofloxacin-resistant Campylobacter were selected in the enrofloxacin-treated group and showed the Thr86Ile mutation in the gyrA gene. Acquisition of the tetO gene in Campylobacter coli isolates was significantly more frequent in birds given oxytetracycline. No impact of amoxicillin treatment on the susceptibility of Campylobacter could be detected. Ampicillin- and sulfadimethoxine/trimethoprim-resistant Enterococcus faecium were selected in amoxicillin-treated broilers, but no selection of the inoculated vancomycin-resistant Enterococcus faecium could be detected, although it was also resistant to tetracycline and sulfadimethoxine/trimethoprim. PCR-CE-SSCP revealed significant variations in a few peaks in treated birds as compared with non-treated chickens. In conclusion, antimicrobial treatments perturbed chicken gut microbiota, and certain antimicrobial treatments selected or co-selected resistant strains of Campylobacter and Enterococcus.

  5. Technical note: simultaneous identification of CSN1S2 A, B, C, and E alleles in goats by polymerase chain reaction-single strand conformation polymorphism.

    Science.gov (United States)

    Chessa, S; Rignanese, D; Chiatti, F; Radeghieri, A; Gigliotti, C; Caroli, A

    2008-03-01

    Most variability in goat caseins originates from the high number of genetic polymorphisms often affecting the specific protein expression, with strong effects on milk composition traits and technological properties. At least 7 alleles have been found in the goat alpha(S2)-CN gene (CSN1S2). Five of them (CSN1S2*A, CSN1S2*B, CSN1S2*C, CSN1S2*E, and CSN1S2*F) are widespread in most breeds, whereas the other 2 (CSN1S2*D and CSN1S2*0) are rarer alleles. Four different PCR-RFLP tests are needed to detect all of these variants at the DNA level. The objective of this study was to develop and validate a rapid method for typing 4 of the 5 most-common goat CSN1S2 alleles by means of PCR-single strand conformation polymorphism (SSCP). The method was validated by analyzing 37 goat samples at the protein and DNA level, respectively, by milk isoelectrofocusing and PCR-RFLP methods already described. The genotypes obtained using the PCR-SSCP approach were in full agreement with those obtained by the validation analyses. The newly developed PCR-SSCP approach provides an accurate and inexpensive assay highly suitable for genotyping goat CSN1S2.

  6. Short communication: Simultaneous identification of five kappa-casein (CSN3) alleles in domestic goat by polymerase chain reaction-single strand conformation polymorphism.

    Science.gov (United States)

    Chessa, S; Budelli, E; Gutscher, K; Caroli, A; Erhardt, G

    2003-11-01

    Until now, a total of nine polymorphic sites corresponding to six different alleles have been described at the kappa-casein (CSN3) locus in the domestic goat (Capra hircus). A protocol for the rapid and simultaneous genotyping of five goat CSN3 alleles by using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) technique was developed. Moreover, the developed test was validated by screening the CSN3 variability in four Italian breeds, Garganica, Jonica, Maltese, and Camosciata. Seven different patterns were readily identifiable. These corresponded to five known alleles and two newly identified variants. The G/A substitution at nucleotide position 471, which is not identifiable at the protein level but was found to be very frequent in the typed breeds, is easily detectable by the protocol developed. The PCR-SSCP analysis is a powerful tool for the genetic study of CSN3 variability in domestic goats, allowing both the simultaneous identification of different alleles, and the detection of new variants.

  7. Direct determination of MUC5B promoter haplotypes based on the method of single-strand conformation polymorphism and their statistical estimation.

    Science.gov (United States)

    Kamio, Koichiro; Matsushita, Ikumi; Tanaka, Goh; Ohashi, Jun; Hijikata, Minako; Nakata, Koh; Tokunaga, Katsushi; Azuma, Arata; Kudoh, Shoji; Keicho, Naoto

    2004-09-01

    Haplotype-based human genome research is important in identifying disease susceptibility genes efficiently. Although haplotype reconstruction by statistical methods is widely used, direct haplotype determination by molecular techniques has also been developed as a complementary method for statistical estimation. In this study, we demonstrate a molecular haplotyping method making use of single-strand conformation polymorphism (SSCP) gels. We identified 10 common SNPs and a dinucleotide insertion/deletion polymorphism within 2-kb region upstream of the transcription initiation site of MUC5B and determined haplotype structure, dividing the region into two DNA fragments. Real haplotypes were determined unambiguously by our SSCP-based analysis with fragments longer than 1 kb. Haplotypes reconstructed from diploid genotypes in the same region by the statistical methods including EM algorithm were also evaluated. Direct comparison between statistical estimation and direct determination of haplotypes revealed that major haplotypes containing multiple marker sites showing strong LD are estimated in great accuracy but that a variety of haplotypes reflecting weak LD are not reconstructed precisely enough. Our data can be helpful in implementing molecular haplotyping or statistical estimation, since usage of these methods may be determined depending on the haplotype structures.

  8. dbQSNP: a database of SNPs in human promoter regions with allele frequency information determined by single-strand conformation polymorphism-based methods.

    Science.gov (United States)

    Tahira, Tomoko; Baba, Shingo; Higasa, Koichiro; Kukita, Yoji; Suzuki, Yutaka; Sugano, Sumio; Hayashi, Kenshi

    2005-08-01

    We present a database, dbQSNP (http://qsnp.gen.kyushu-u.ac.jp/), that provides sequence and allele frequency information for single-nucleotide polymorphisms (SNPs) located in the promoter regions of human genes, which were defined by the 5' ends of full-length cDNA clones. We searched for the SNPs in these regions by sequencing or single-strand conformation polymorphism (SSCP) analysis. The allele frequencies of the identified SNPs in two ethnic groups were quantified by SSCP analyses of pooled DNA samples. The accuracy of our estimation is supported by strong correlations between the frequencies in our data and those in other databases for the same ethnic groups. The frequencies vary considerably between the two ethnic groups studied, suggesting the need for population-based collections and allele frequency determination of SNPs, in, e.g., association studies of diseases. We show profiles of SNP densities that are characteristic of transcription start site regions. A fraction of the SNPs revealed a significantly different allele frequency between the groups, suggesting differential selection of the genes involved.

  9. Simultaneous detection of the exon 10 polymorphism and a novel intronic single base insertion polymorphism in the XPD gene using single strand conformation polymorphism.

    Science.gov (United States)

    Kumar, Rajiv; Angelini, Sabrina; Hemminki, Kari

    2003-03-01

    We developed a new method based on the single strand conformation polymorphism (SSCP) technique for the detection of a G23591A (Asp312Asn) polymorphism in exon 10 of the XPD gene. In the process we also identified a novel polymorphism 23623C-ins (IVS10+17C-ins) in intron 10 of the same gene. With this newly developed SSCP-based method of genotyping we could detect both polymorphisms in the same assay and thus consequently determine the haplotype. In order to determine the population frequency of the novel polymorphism and the haplotype frequency, 302 healthy individuals were genotyped. The allelic frequency of the 23623C-ins intronic polymorphism was 0.16, whereas the frequency of the variant allele for the G23591A polymorphism was 0.39. Forty-three individuals (14%) were heterozygous for both polymorphisms but none carried polymorphic variants for both G23591A and 23623C-ins on the same allele. The effect of the novel intronic insertion polymorphism, which is located 16 nt downstream of the 3'-end of exon 10 of the XPD gene and involves a mononucleotide C repeat sequence, on expression remains to be determined.

  10. Denaturing gradient electrophoresis (DGE) and single-strand conformation polymorphism (SSCP) molecular fingerprintings revisited by simulation and used as a tool to measure microbial diversity.

    Science.gov (United States)

    Loisel, Patrice; Harmand, Jérôme; Zemb, Olivier; Latrille, Eric; Lobry, Claude; Delgenès, Jean-Philippe; Godon, Jean-Jacques

    2006-04-01

    The exact extent of microbial diversity remains unknowable. Nevertheless, fingerprinting patterns [denaturing gradient electrophoresis (DGE), single-strand conformation polymorphism (SSCP)] provide an image of a microbial ecosystem and contain diversity data. We generated numerical simulation fingerprinting patterns based on three types of distribution (uniform, geometric and lognormal) with a range of units from 10 to 500,000. First, simulated patterns containing a diversity of around 1000 units or more gave patterns similar to those obtained in experiments. Second, the number of bands or peaks saturated quickly to about 35 and were unrelated to the degree of diversity. Finally, assuming lognormal distribution, we used an estimator of diversity on in silico and experimental fingerprinting patterns. Results on in silico patterns corresponded to the simulation inputs. Diversity results in experimental patterns were in the same range as those obtained from the same DNA sample in molecular inventories. Thus, fingerprinting patterns contain extractable data about diversity although not on the basis of a number of bands or peaks, as is generally assumed to be the case.

  11. Employment of single-strand conformation polymorphism analysis in screening for α-1,3 glucosyltransferase gene mutation A333V in Croatian population.

    Science.gov (United States)

    Goreta, Sandra Supraha; Dabelic, Sanja; Dumic, Jerka

    2011-01-01

    Congenital disorder of glycosylation type Ic (CDG-Ic) is caused by mutations in hALG6 gene encoding α-1,3 glucosyltransferase (NP_037471.2), an enzyme that catalyzes the addition of the first glucose residue to the growing lipid-linked oligosaccharide precursor in N-glycosylation process. The most frequent mutation in hALG6 gene causing CDG-Ic is c.998C>T that results in p.A333V substitution. Up-to-date, no CDG-Ic patient has been detected in Croatia. However, as a part of the comprehensive project undertaken with the aim to estimate the frequencies of the carriers for specific mutations and polymorphisms related to particular CDGs in Croatian population, we screened genomic DNA samples obtained from 600 healthy nonconsanguineous Croatian residents to determine the frequency of the A333V mutation. For that purpose, we established the conditions for polymerase chain reaction-based single-strand conformation polymorphism analysis that is suitable for primary screening and in population studies, especially when the initial sample volume is small or DNA quantity is limited. None of the analyzed samples carried this mutation, indicating that the frequency of the patients carrying this homozygous mutation in Croatian population would be <1 in 1.4×10(6).

  12. P53 GENE MUTATIONS IN NON-SMALL CELL LUNG CANCER DETECTED BY POLYMERASE CHAIN REACTION SINGLE-STRAND CONFORMATION POLYMORPHISM ANALYSIS

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    @@ Mutations of the p53 tumor suppressor gene are the most frequent genetic alterations detected in human lung cancer. To assess the pathogenic significance of p53 gene alterations in Chinese non-small cell lung cancer(NSCLC),74 paired samples of primary lung cancer and normal lung tissue far away from the cancer were analyzed for mutations of the p53 gene(exons 5-8) using exon-specific PCR, single-strand conformation polymorphism (PCR-SSCP). p53 mutations were observed in 55.4%(41/74) of the samples. No linkages were detected between the incidence of p53 mutations and histological type, lymph node metastasis,age or sex. Significant association between p53 mutations and degree of differentiation in adenocarcinomas, not in squamous cell carcinomas, was observed. The frequency of p53 mutations in smokers(65.3%) was higher than in nonsmokers(33.3%) and reached statistical significance.We also found p53 mutations in 6/7 samples which had tissue invasion and distant metastasis.These results suggest that smoking could be an important factor in lung carcinogenesis,p53 mutation is a worse prognosis indicator in adenocarcinomas and related to high aggressive behavior of human lung cancer.

  13. Identification of a single-stranded DNA virus associated with citrus chlorotic dwarf disease, a new member in the family Geminiviridae.

    Science.gov (United States)

    Loconsole, Giuliana; Saldarelli, Pasquale; Doddapaneni, Harshavardhan; Savino, Vito; Martelli, Giovanni P; Saponari, Maria

    2012-10-10

    In the attempt to identify the causal agent of Citrus chlorotic dwarf disease (CCDD), a virus-like disorder of citrus, the small RNA fraction and total DNA from symptomatic citrus plants were subjected to high-throughput sequencing. DNA fragments deriving from an apparently new geminivirus-like agent were found and assembled by NGS to re-construct the entire viral genome. The newly identified virus has a circular single-stranded DNA genome comprising five open reading frames (ORFs) with sequence homologies with those encoded by geminiviruses. PCR and qPCR assays were successfully used for determining its presence in the CCDD-affected plants obtained by graft propagation. The larger genome size (3.64 vs. 2.5-3.0 kb) and a number of differences in its structural organization, identified this virus as a highly divergent member of the family Geminiviridae, to which the provisional name of Citrus chlorotic dwarf-associated virus (CCDaV) is assigned. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Nanosecond to submillisecond dynamics in dye-labeled single-stranded DNA, as revealed by ensemble measurements and photon statistics at single-molecule level.

    Science.gov (United States)

    Kaji, Takahiro; Ito, Syoji; Iwai, Shigenori; Miyasaka, Hiroshi

    2009-10-22

    Single-molecule and ensemble time-resolved fluorescence measurements were applied for the investigation of the conformational dynamics of single-stranded DNA, ssDNA, connected with a fluorescein dye by a C6 linker, where the motions both of DNA and the C6 linker affect the geometry of the system. From the ensemble measurement of the fluorescence quenching via photoinduced electron transfer with a guanine base in the DNA sequence, three main conformations were found in aqueous solution: a conformation unaffected by the guanine base in the excited state lifetime of fluorescein, a conformation in which the fluorescence is dynamically quenched in the excited-state lifetime, and a conformation leading to rapid quenching via nonfluorescent complex. The analysis by using the parameters acquired from the ensemble measurements for interphoton time distribution histograms and FCS autocorrelations by the single-molecule measurement revealed that interconversion in these three conformations took place with two characteristic time constants of several hundreds of nanoseconds and tens of microseconds. The advantage of the combination use of the ensemble measurements with the single-molecule detections for rather complex dynamic motions is discussed by integrating the experimental results with those obtained by molecular dynamics simulation.

  15. In Vitro Selection of Single-Stranded DNA Molecular Recognition Elements against S. aureus Alpha Toxin and Sensitive Detection in Human Serum

    Directory of Open Access Journals (Sweden)

    Ka L. Hong

    2015-01-01

    Full Text Available Alpha toxin is one of the major virulence factors secreted by Staphylococcus aureus, a bacterium that is responsible for a wide variety of infections in both community and hospital settings. Due to the prevalence of S. aureus related infections and the emergence of methicillin-resistant S. aureus, rapid and accurate diagnosis of S. aureus infections is crucial in benefiting patient health outcomes. In this study, a rigorous Systematic Evolution of Ligands by Exponential Enrichment (SELEX variant previously developed by our laboratory was utilized to select a single-stranded DNA molecular recognition element (MRE targeting alpha toxin with high affinity and specificity. At the end of the 12-round selection, the selected MRE had an equilibrium dissociation constant (Kd of 93.7 ± 7.0 nM. Additionally, a modified sandwich enzyme-linked immunosorbent assay (ELISA was developed by using the selected ssDNA MRE as the toxin-capturing element and a sensitive detection of 200 nM alpha toxin in undiluted human serum samples was achieved.

  16. Zn(2+)-cyclen-based complex enable a selective detection of single-stranded thymine-rich DNA in aqueous buffer.

    Science.gov (United States)

    Zhu, Zece; Wang, Sheng; Wei, Danqing; Yang, Chuluo

    2016-11-15

    It is a big challenge to develop fluorescent probes for selective detection of DNA with specific sequences in aqueous buffers. We report a new tetraphenylethene-based Zn(2+)-cyclen complex (TPECyZn), and a chemo-sensing ensemble of the Zn complex with phenol red. TPECyZn showed significant fluorescence enhancement upon binding to thymine-rich DNA in HEPES buffers. But its selectivity was not high enough to eliminate the interference from some random DNA. By constructing the chemo-sensing ensemble of TPECyZn with phenol red, the background fluorescence was eliminated due to the energy transfer from TPECyZn to phenol red. Moreover, this chemo-sensing ensemble revealed high selectivity in detecting thymine-rich single-stranded DNA over other DNA in aqueous buffer. It can detect poly deoxythymidylic acid sequence as short as 2 nt. This detection in aqueous media makes this probe feasible in real application. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. DNA single-strand breaks, double-strand breaks, and crosslinks in rat testicular germ cells: Measurements of their formation and repair by alkaline and neutral filter elution

    Energy Technology Data Exchange (ETDEWEB)

    Bradley, M.O.; Dysart, G. (Merck Institute for Therapeutic Research, West Point, PA (USA))

    1985-06-01

    This work describes a neutral and alkaline elution method for measuring DNA single-strand breaks (SSBs), DNA double-strand breaks (DSBs), and DNA-DNA crosslinks in rat testicular germ cells after treatments in vivo or in vitro with both chemical mutagens and gamma-irradiation. The methods depend upon the isolation of testicular germ cells by collagenase and trypsin digestion, followed by filtration and centrifugation. {sup 137}Cs irradiation induced both DNA SSBs and DSBs in germ cells held on ice in vitro. Irradiation of the whole animal indicated that both types of DNA breaks are induced in vivo and can be repaired. A number of germ cell mutagens induced either DNA SSBs, DSBs, or cross-links after in vivo and in vitro dosing. These chemicals included methyl methanesulfonate, ethyl methanesulfonate, ethyl nitrosourea, dibromochlorpropane, ethylene dibromide, triethylene melamine, and mitomycin C. These results suggest that the blood-testes barrier is relatively ineffective for these mutagens, which may explain in part their in vivo mutagenic potency. This assay should be a useful screen for detecting chemical attack upon male germ-cell DNA and thus, it should help in the assessment of the mutagenic risk of chemicals. In addition, this approach can be used to study the processes of SSB, DSB, and crosslink repair in DNA of male germ cells, either from all stages or specific stages of development.

  18. Novel circular single-stranded DNA viruses identified in marine invertebrates reveal high sequence diversity and consistent predicted intrinsic disorder patterns within putative structural proteins

    Directory of Open Access Journals (Sweden)

    Karyna eRosario

    2015-07-01

    Full Text Available Viral metagenomics has recently revealed the ubiquitous and diverse nature of single-stranded DNA (ssDNA viruses that encode a conserved replication initiator protein (Rep in the marine environment. Although eukaryotic circular Rep-encoding ssDNA (CRESS-DNA viruses were originally thought to only infect plants and vertebrates, recent studies have identified these viruses in a number of invertebrates. To further explore CRESS-DNA viruses in the marine environment, this study surveyed CRESS-DNA viruses in various marine invertebrate species. A total of 27 novel CRESS-DNA genomes, with Reps that share less than 60.1% identity with previously reported viruses, were recovered from 21 invertebrate species, mainly crustaceans. Phylogenetic analysis based on the Rep revealed a novel clade of CRESS-DNA viruses that included approximately one third of the marine invertebrate associated viruses identified here and whose members may represent a novel family. Investigation of putative capsid proteins (Cap encoded within the eukaryotic CRESS-DNA viral genomes from this study and those in GenBank demonstrated conserved patterns of predicted intrinsically disordered regions (IDRs, which can be used to complement similarity-based searches to identify divergent structural proteins within novel genomes. Overall, this study expands our knowledge of CRESS-DNA viruses associated with invertebrates and explores a new tool to evaluate divergent structural proteins encoded by these viruses.

  19. Role of the external NH2 linker on the conformation of surface immobilized single strand DNA probes and their SERS detection

    Science.gov (United States)

    He, Lijie; Langlet, Michel; Stambouli, Valerie

    2017-03-01

    The conformation and topological properties of DNA single strand probe molecules attached on solid surfaces are important, notably for the performances of devices such as biosensors. Commonly, the DNA probes are tethered to the surface using external linkers such as NH2. In this study, the role and influence of this amino-linker on the immobilization way and conformation of DNA probes on Ag nanoparticle surface is emphasized using Surface Enhanced Raman Spectroscopy (SERS). We compare the SERS spectra and their reproducibility in the case of two groups of DNA polybase probes which are polyA, polyC, polyT, and polyG. In the first group, the polybases exhibit an external NH2 functional linker while in the second group the polybases are NH2-free. The results show that the reproducibility of SERS spectra is enhanced in the case of the first group. It leads us to propose two models of polybase conformation on Ag surface according to the presence or the absence of the external NH2 linker. In the presence of the NH2 external linker, the latter would act as a major anchoring point. As a result, the polybases are much ordered with a less random orientation than in the case of NH2-free polybases. Consequently, in view of further in situ hybridization for biosensing applications, it is strongly recommended to use NH2 linker functionalized DNA probes.

  20. Design of a beta-hairpin peptide-intercalator conjugate for simultaneous recognition of single stranded and double stranded regions of RNA.

    Science.gov (United States)

    Cline, Lauren L; Waters, Marcey L

    2009-11-21

    Designing receptors that bind RNA is a challenging endeavor because of the unique and sometimes complex structure of RNA. However these structural features provide regions for ligands to bind using different types of interactions. To increase specificity and binding affinity to RNA, divalent systems have been designed which incorporate more than one binding motif into one molecule. Using this approach, we have designed a two part heteroconjugate, WKWK-Int, which contains a beta-hairpin peptide covalently linked to an RNA intercalator. This heteroconjugate was designed to bind duplex RNA through intercalation and simultaneously interact with a single stranded bulge region using the side chains of the beta-hairpin peptide. We have used fluorescence anisotropy experiments to show that the heteroconjugate has an increased binding affinity over either one of the individual ligands. Additionally, RNase footprinting experiments show that the structure of the peptide is necessary for the protection of one particular base in the RNA bulge region. When tested against other RNA molecules containing a stem-bulge structure, the designed heteroconjugate was found to be specific for this RNA sequence. This work provides evidence that the covalent linkage of two weak RNA ligands can greatly increase the binding affinity and also provide specificity to the binding event.

  1. CRISPR/Cas9-based generation of knockdown mice by intronic insertion of artificial microRNA using longer single-stranded DNA.

    Science.gov (United States)

    Miura, Hiromi; Gurumurthy, Channabasavaiah B; Sato, Takehito; Sato, Masahiro; Ohtsuka, Masato

    2015-08-05

    Knockdown mouse models, where gene dosages can be modulated, provide valuable insights into gene function. Typically, such models are generated by embryonic stem (ES) cell-based targeted insertion, or pronuclear injection, of the knockdown expression cassette. However, these methods are associated with laborious and time-consuming steps, such as the generation of large constructs with elements needed for expression of a functional RNAi-cassette, ES-cell handling, or screening for mice with the desired knockdown effect. Here, we demonstrate that reliable knockdown models can be generated by targeted insertion of artificial microRNA (amiRNA) sequences into a specific locus in the genome [such as intronic regions of endogenous eukaryotic translation elongation factor 2 (eEF-2) gene] using the Clustered Regularly Interspaced Short Palindromic Repeats/Crispr associated 9 (CRISPR/Cas9) system. We used in vitro synthesized single-stranded DNAs (about 0.5-kb long) that code for amiRNA sequences as repair templates in CRISPR/Cas9 mutagenesis. Using this approach we demonstrate that amiRNA cassettes against exogenous (eGFP) or endogenous [orthodenticle homeobox 2 (Otx2)] genes can be efficiently targeted to a predetermined locus in the genome and result in knockdown of gene expression. We also provide a strategy to establish conditional knockdown models with this method.

  2. Nonhomologous end-joining promotes resistance to DNA damage in the absence of an ADP-ribosyltransferase that signals DNA single strand breaks.

    Science.gov (United States)

    Couto, C Anne-Marie; Hsu, Duen-Wei; Teo, Regina; Rakhimova, Alina; Lempidaki, Styliana; Pears, Catherine J; Lakin, Nicholas D

    2013-08-01

    ADP-ribosylation of proteins at DNA lesions by ADP-ribosyltransferases (ARTs) is an early response to DNA damage. The best defined role of ADP-ribosylation in the DNA damage response is in repair of single strand breaks (SSBs). Recently, we initiated a study of how ADP-ribosylation regulates DNA repair in Dictyostelium and found that two ARTs (Adprt1b and Adprt2) are required for tolerance of cells to SSBs, and a third ART (Adprt1a) promotes nonhomologous end-joining (NHEJ). Here we report that disruption of adprt2 results in accumulation of DNA damage throughout the cell cycle following exposure to agents that induce base damage and DNA SSBs. Although ADP-ribosylation is evident in adprt2(-) cells exposed to methylmethanesulfonate (MMS), disruption of adprt1a and adprt2 in combination abolishes this response and further sensitises cells to this agent, indicating that in the absence of Adprt2, Adprt1a signals MMS-induced DNA lesions to promote resistance of cells to DNA damage. As a consequence of defective signalling of SSBs by Adprt2, Adprt1a is required to assemble NHEJ factors in chromatin, and disruption of the NHEJ pathway in combination with adprt2 increases sensitivity of cells to MMS. Taken together, these data indicate overlapping functions of different ARTs in signalling DNA damage, and illustrate a critical requirement for NHEJ in maintaining cell viability in the absence of an effective SSB response.

  3. Polynucleotide phosphorylase exonuclease and polymerase activities on single-stranded DNA ends are modulated by RecN, SsbA and RecA proteins.

    Science.gov (United States)

    Cardenas, Paula P; Carzaniga, Thomas; Zangrossi, Sandro; Briani, Federica; Garcia-Tirado, Esther; Dehò, Gianni; Alonso, Juan C

    2011-11-01

    Bacillus subtilis pnpA gene product, polynucleotide phosphorylase (PNPase), is involved in double-strand break (DSB) repair via homologous recombination (HR) or non-homologous end-joining (NHEJ). RecN is among the first responders to localize at the DNA DSBs, with PNPase facilitating the formation of a discrete RecN focus per nucleoid. PNPase, which co-purifies with RecA and RecN, was able to degrade single-stranded (ss) DNA with a 3' → 5' polarity in the presence of Mn(2+) and low inorganic phosphate (Pi) concentration, or to extend a 3'-OH end in the presence dNDP · Mn(2+). Both PNPase activities were observed in evolutionarily distant bacteria (B. subtilis and Escherichia coli), suggesting conserved functions. The activity of PNPase was directed toward ssDNA degradation or polymerization by manipulating the Pi/dNDPs concentrations or the availability of RecA or RecN. In its dATP-bound form, RecN stimulates PNPase-mediated polymerization. ssDNA phosphorolysis catalyzed by PNPase is stimulated by RecA, but inhibited by SsbA. Our findings suggest that (i) the PNPase degradative and polymerizing activities might play a critical role in the transition from DSB sensing to end resection via HR and (ii) by blunting a 3'-tailed duplex DNA, in the absence of HR, B. subtilis PNPase might also contribute to repair via NHEJ.

  4. Single strand conformation polymorphism analysis of androgen receptor gene mutations in patients with androgen insensitivity syndromes: Application for diagnosis, genetic counseling, and therapy

    Energy Technology Data Exchange (ETDEWEB)

    Hiort, O. (Medizinische Universitaet zu Luebeck (Germany) Tufts-New England Medical Center, Boston, MA (United States)); Huang, Q. (Massachusetts Eye and Ear Infirmary, Boston, MA (United States)); Sinnecker, G.H.G.; Kruse, K. (Medizinische Universitaet zu Luebeck (Germany)); Sadeghi-Nejad, A.; Wolfe, H.J. (Tufts-New England Medical Center, Boston, MA (United States)); Yandell, D.W. (Massachusetts Eye and Ear Infirmary, Boston, MA (United States))(Harvard Medical School, Boston, MA (United States) Harvard School of Public Health, Boston, MA (United States))

    1993-07-01

    Recent studies indicate that mutations in the androgen receptor gene are associated with androgen insensitivity syndromes, a heterogeneous group of related disorders involving defective sexual differentiation in karyotypic males. In this report, the authors address the possibility of rapid mutational analysis of the androgen receptor gene for initial diagnosis, genetic counseling, and molecular subclassification of affected patients and their families. DNA from peripheral blood leukocytes of six patients from five families with various degrees of androgen insensitivity was studied. Exons 2 to 8 of the androgen receptor gene were analyzed using a combination of single strand conformation polymorphism analysis and direct DNA sequencing. Female family members were also studied to identify heterozygote carriers. Point mutations in the AR gene were identified in all six patients, and all mutations caused amino acid substitutions. One patient with incomplete androgen insensitivity was a mosaic for the mutation. Four of the five mothers, as well as a young sister of one patient, were carriers of the mutation present in the affected child. The data show that new mutations may occur in the androgen receptor gene leading to sporadic androgen insensitivity syndrome. Molecular genetic characterization of the variant allele can serve as a primary tool for diagnosis and subsequent therapy, and can provide a basis for distinguishing heterozygous carriers in familial androgen resistance. The identification of carriers is of substantial clinical importance for genetic counseling. 29 refs., 2 figs., 1 tab.

  5. Significance of enzyme linked immunosorbent assay (ELISA) for antibodies to double stranded and single stranded DNA in patients with lupus nephritis: correlation with severity of renal histology.

    Science.gov (United States)

    Okamura, M; Kanayama, Y; Amastu, K; Negoro, N; Kohda, S; Takeda, T; Inoue, T

    1993-01-01

    The correlation between renal histology and class specific (IgG and IgM) antibodies to double stranded DNA (dsDNA) and single stranded DNA (ssDNA) was studied by enzyme linked immunosorbent assay (ELISA) in 40 untreated patients with systemic lupus erythematosus (SLE). The levels of IgG antibodies to dsDNA were significantly higher in patients with World Health Organisation class IV nephritis than in those with class I, class II, or class III nephritis. IgG antibodies to ssDNA were higher in patients with class IV than in those with class II nephritis. IgG antibodies to dsDNA showed a close correlation with the histological activity score and the amount of electron dense deposit. IgG antibodies to ssDNA showed only a weak correlation with the renal histological activity score. IgM antibodies to dsDNA and IgM antibodies to ssDNA were not correlated with renal histological features. Patients with moderate to severe nephritis had a lower ratio of IgM antibodies to dsDNA to IgG antibodies to dsDNA than those with mild nephritis. These results indicate that the measurement of IgG antibodies to dsDNA is predictive in evaluating renal histological activity in patients with SLE.

  6. New Type of Papillomavirus and Novel Circular Single Stranded DNA Virus Discovered in Urban Rattus norvegicus Using Circular DNA Enrichment and Metagenomics

    Science.gov (United States)

    Hansen, Thomas Arn; Fridholm, Helena; Frøslev, Tobias Guldberg; Kjartansdóttir, Kristín Rós; Willerslev, Eske; Nielsen, Lars Peter; Hansen, Anders Johannes

    2015-01-01

    Rattus norvegicus (R. norvegicus) are ubiquitous and their presence has several effects on the human populations in our urban areas on a global scale. Both historically and presently, this close interaction has facilitated the dissemination of many pathogens to humans, making screening for potentially zoonotic and emerging viruses in rats highly relevant. We have investigated faecal samples from R. norvegicus collected from urban areas using a protocol based on metagenomic enrichment of circular DNA genomes and subsequent sequencing. We found a new type of papillomavirus, with a L1 region 82% identical to that of the known R. norvegicus Papillomavirus 2. Additionally, we found 20 different circular replication associated protein (Rep)-encoding single stranded DNA (CRESS-DNA) virus-like genomes, one of which has homology to the replication-associated gene of Beak and feather disease virus. Papillomaviruses are a group of viruses known for their carcinogenic potential, and although they are known to infect several different vertebrates, they are mainly studied and characterised in humans. CRESS-DNA viruses are found in many different environments and tissue types. Both papillomaviruses and CRESS-DNA viruses are known to have pathogenic potential and screening for novel and known viruses in R. norvegicus could help identify viruses with pathogenic potential. PMID:26559957

  7. Antiviral effects of single-stranded polynucleotide inhibitors of the influenza virion-associated transcriptase against influenza virus infection of hamsters and ferrets.

    Science.gov (United States)

    Round, E M; Stebbing, N

    1981-11-01

    Administration of a single-stranded polynucleotide copolymer containing 9% cytidine residues and 91% 4-thiouridine residues [poly(C,S4U10)], a known potent inhibitor of the virion transcriptase of influenza viruses, suppressed the amount of virus recoverable from the nasal washes of influenza virus-infected hamsters and ferrets. The incidence of sneezing and nasal discharge in infected ferrets was also reduced. In hamsters, poly(C,S4U10) was more effective than amantadine-HCl or Virazole. Polyinosinic acid in combination with poly-5-hydroxy cytidylic acid also had anti-influenza effects. Poly(C,S4U10) annealed to polyadenylic acid was not effective, nor was the double-stranded polymer (polyinosinic acid) . (polycytidylic acid) even when complexed with carboxymethylcellulose and polylysine. No toxic effects of poly(C,S4U10) were apparent in the treated hamsters and ferrets, and high doses (greater than or equal to 2.86 g/kg) administered intraperitoneally to mice produced no adverse effects.

  8. In vitro selection of single-stranded DNA molecular recognition elements against S. aureus alpha toxin and sensitive detection in human serum.

    Science.gov (United States)

    Hong, Ka L; Battistella, Luisa; Salva, Alysia D; Williams, Ryan M; Sooter, Letha J

    2015-01-27

    Alpha toxin is one of the major virulence factors secreted by Staphylococcus aureus, a bacterium that is responsible for a wide variety of infections in both community and hospital settings. Due to the prevalence of S. aureus related infections and the emergence of methicillin-resistant S. aureus, rapid and accurate diagnosis of S. aureus infections is crucial in benefiting patient health outcomes. In this study, a rigorous Systematic Evolution of Ligands by Exponential Enrichment (SELEX) variant previously developed by our laboratory was utilized to select a single-stranded DNA molecular recognition element (MRE) targeting alpha toxin with high affinity and specificity. At the end of the 12-round selection, the selected MRE had an equilibrium dissociation constant (Kd) of 93.7 ± 7.0 nM. Additionally, a modified sandwich enzyme-linked immunosorbent assay (ELISA) was developed by using the selected ssDNA MRE as the toxin-capturing element and a sensitive detection of 200 nM alpha toxin in undiluted human serum samples was achieved.

  9. Analysis of Coinfections with A/H1N1 Strain Variants among Pigs in Poland by Multitemperature Single-Strand Conformational Polymorphism

    Directory of Open Access Journals (Sweden)

    Krzysztof Lepek

    2015-01-01

    Full Text Available Monitoring and control of infections are key parts of surveillance systems and epidemiological risk prevention. In the case of influenza A viruses (IAVs, which show high variability, a wide range of hosts, and a potential of reassortment between different strains, it is essential to study not only people, but also animals living in the immediate surroundings. If understated, the animals might become a source of newly formed infectious strains with a pandemic potential. Special attention should be focused on pigs, because of the receptors specific for virus strains originating from different species, localized in their respiratory tract. Pigs are prone to mixed infections and may constitute a reservoir of potentially dangerous IAV strains resulting from genetic reassortment. It has been reported that a quadruple reassortant, A(H1N1pdm09, can be easily transmitted from humans to pigs and serve as a donor of genetic segments for new strains capable of infecting humans. Therefore, it is highly desirable to develop a simple, cost-effective, and rapid method for evaluation of IAV genetic variability. We describe a method based on multitemperature single-strand conformational polymorphism (MSSCP, using a fragment of the hemagglutinin (HA gene, for detection of coinfections and differentiation of genetic variants of the virus, difficult to identify by conventional diagnostic.

  10. Interaction between Escherichia coli DNA polymerase IV and single-stranded DNA-binding protein is required for DNA synthesis on SSB-coated DNA.

    Science.gov (United States)

    Furukohri, Asako; Nishikawa, Yoshito; Akiyama, Masahiro Tatsumi; Maki, Hisaji

    2012-07-01

    DNA polymerase IV (Pol IV) is one of three translesion polymerases in Escherichia coli. A mass spectrometry study revealed that single-stranded DNA-binding protein (SSB) in lysates prepared from exponentially-growing cells has a strong affinity for column-immobilized Pol IV. We found that purified SSB binds directly to Pol IV in a pull-down assay, whereas SSBΔC8, a mutant protein lacking the C-terminal tail, failed to interact with Pol IV. These results show that the interaction between Pol IV and SSB is mediated by the C-terminal tail of SSB. When polymerase activity was tested on an SSBΔC8-coated template, we observed a strong inhibition of Pol IV activity. Competition experiments using a synthetic peptide containing the amino acid sequence of SSB tail revealed that the chain-elongating capacity of Pol IV was greatly impaired when the interaction between Pol IV and SSB tail was inhibited. These results demonstrate that Pol IV requires the interaction with the C-terminal tail of SSB to replicate DNA efficiently when the template ssDNA is covered with SSB. We speculate that at the primer/template junction, Pol IV interacts with the tail of the nearest SSB tetramer on the template, and that this interaction allows the polymerase to travel along the template while disassembling SSB.

  11. Identification of diverse circular single-stranded DNA viruses in adult dragonflies and damselflies (Insecta: Odonata) of Arizona and Oklahoma, USA.

    Science.gov (United States)

    Dayaram, Anisha; Potter, Kristen A; Pailes, Roberta; Marinov, Milen; Rosenstein, Dana D; Varsani, Arvind

    2015-03-01

    Next generation sequencing and metagenomic approaches are commonly used for the identification of circular replication associated protein (Rep)-encoding single stranded (CRESS) DNA viruses circulating in various environments. These approaches have enabled the discovery of some CRESS DNA viruses associated with insects. In this study we identified and recovered 31 viral genomes which represent 24 distinct CRESS DNA viruses from seven dragonfly species (Rhionaeschna multicolor, Erythemis simplicicollis, Erythrodiplax fusca, Libellula quadrimaculata, Libellula saturata, Pachydiplax longipennis, and Pantala hymenaea) and two damselfly species (Ischnura posita, Ischnura ramburii) sampled in various locations in the states of Arizona and Oklahoma of the United States of America (USA). We also identified Sclerotinia sclerotiorum hypovirulence-associated DNA virus-1 (SsHADV-1) in P. hymenaea, E. simplicicollis and I. ramburii sampled in Oklahoma, which is the first report of SsHADV-1 in the New World. The genome architectures of the CRESS DNA viruses recovered vary, but they all have at least two major open reading frames (ORFs) that have either a bidirectional or unidirectional arrangement. Four of the viral genomes recovered, in addition to the three isolates of SsHADV-1, show similarities to viruses of the proposed gemycircularvirus group. Analysis of the Rep encoded by the remaining 24 viral genomes reveals that these are highly diverse and allude to the fact that they represent novel CRESS DNA viruses.

  12. Hematopoietic Lineage Transcriptome Stability and Representation in PAXgeneTM Collected Peripheral Blood Utilising SPIA Single-Stranded cDNA Probes for Microarray

    Directory of Open Access Journals (Sweden)

    Laura Kennedy

    2008-01-01

    Full Text Available Peripheral blood as a surrogate tissue for transcriptome profiling holds great promise for the discovery of diagnostic and prognostic disease biomarkers, particularly when target tissues of disease are not readily available. To maximize the reliability of gene expression data generated from clinical blood samples, both the sample collection and the microarray probe generation methods should be optimized to provide stabilized, reproducible and representative gene expression profiles faithfully representing the transcriptional profiles of the constituent blood cell types present in the circulation. Given the increasing innovation in this field in recent years, we investigated a combination of methodological advances in both RNA stabilisation and microarray probe generation with the goal of achieving robust, reliable and representative transcriptional profiles from whole blood. To assess the whole blood profiles, the transcriptomes of purified blood cell types were measured and compared with the global transcriptomes measured in whole blood. The results demonstrate that a combination of PAXgeneTM RNA stabilising technology and single-stranded cDNA probe generation afforded by the NuGEN Ovation RNA amplification system V2TM enables an approach that yields faithful representation of specific hematopoietic cell lineage transcriptomes in whole blood without the necessity for prior sample fractionation, cell enrichment or globin reduction. Storage stability assessments of the PAXgeneTM blood samples also advocate a short, fixed room temperature storage time for all PAXgeneTM blood samples collected for the purposes of global transcriptional profiling in clinical studies.

  13. Direct Binding to Replication Protein A (RPA)-coated Single-stranded DNA Allows Recruitment of the ATR Activator TopBP1 to Sites of DNA Damage.

    Science.gov (United States)

    Acevedo, Julyana; Yan, Shan; Michael, W Matthew

    2016-06-17

    A critical event for the ability of cells to tolerate DNA damage and replication stress is activation of the ATR kinase. ATR activation is dependent on the BRCT (BRCA1 C terminus) repeat-containing protein TopBP1. Previous work has shown that recruitment of TopBP1 to sites of DNA damage and stalled replication forks is necessary for downstream events in ATR activation; however, the mechanism for this recruitment was not known. Here, we use protein binding assays and functional studies in Xenopus egg extracts to show that TopBP1 makes a direct interaction, via its BRCT2 domain, with RPA-coated single-stranded DNA. We identify a point mutant that abrogates this interaction and show that this mutant fails to accumulate at sites of DNA damage and that the mutant cannot activate ATR. These data thus supply a mechanism for how the critical ATR activator, TopBP1, senses DNA damage and stalled replication forks to initiate assembly of checkpoint signaling complexes.

  14. Rapid detection of medium chain acyl-CoA dehydrogenase gene mutations by non-radioactive, single strand conformation polymorphism minigels.

    Science.gov (United States)

    Iolascon, A; Parrella, T; Perrotta, S; Guardamagna, O; Coates, P M; Sartore, M; Surrey, S; Fortina, P

    1994-07-01

    Medium chain acyl-CoA dehydrogenase (MCAD) deficiency is a common inherited metabolic disorder affecting fatty acid beta oxidation. Identification of carriers is important since the disease can be fatal and is readily treatable once diagnosed. Twelve molecular defects have been identified in the MCAD gene; however, a single highly prevalent mutation, A985G, accounts for > 90% of mutant alleles in the white population. In order to facilitate the molecular diagnosis of MCAD deficiency, oligonucleotide primers were designed to amplify the exon regions encompassing the 12 mutations enzymatically, and PCR products were then screened with a single strand conformation polymorphism (SSCP) based method. Minigels were used allowing much faster run times, and silver staining was used after gel electrophoresis to eliminate the need for radioisotopic labelling strategies. Our non-radioactive, minigel SSCP approach showed that normals can be readily distinguished from heterozygotes and homozygotes for all three of the 12 known MCAD mutations which were detected in our sampling of 48 persons. In addition, each band pattern is characteristic for a specific mutation, including those mapping in the same PCR product like A985G and T1124C. When necessary, the molecular defect was confirmed using either restriction enzyme digestion of PCR products or by direct DNA sequence analysis or both. This rapid, non-radioactive approach can become routine for molecular diagnosis of MCAD deficiency and other genetic disorders.

  15. DADA2: High resolution sample inference from Illumina amplicon data

    Science.gov (United States)

    Callahan, Benjamin J; McMurdie, Paul J; Rosen, Michael J; Han, Andrew W; Johnson, Amy Jo A; Holmes, Susan P

    2016-01-01

    We present DADA2, a software package that models and corrects Illumina-sequenced amplicon errors. DADA2 infers sample sequences exactly, without coarse-graining into OTUs, and resolves differences of as little as one nucleotide. In several mock communities DADA2 identified more real variants and output fewer spurious sequences than other methods. We applied DADA2 to vaginal samples from a cohort of pregnant women, revealing a diversity of previously undetected Lactobacillus crispatus variants. PMID:27214047

  16. Real-time graphics rendering engine

    CERN Document Server

    Bao, Hujun

    2011-01-01

    ""Real-Time Graphics Rendering Engine"" reveals the software architecture of the modern real-time 3D graphics rendering engine and the relevant technologies based on the authors' experience developing this high-performance, real-time system. The relevant knowledge about real-time graphics rendering such as the rendering pipeline, the visual appearance and shading and lighting models are also introduced. This book is intended to offer well-founded guidance for researchers and developers who are interested in building their own rendering engines. Hujun Bao is a professor at the State Key Lab of

  17. Hardware Accelerated Point Rendering of Isosurfaces

    DEFF Research Database (Denmark)

    Bærentzen, Jakob Andreas; Christensen, Niels Jørgen

    2003-01-01

    an approximate technique for point scaling using distance attenuation which makes it possible to render points stored in display lists or vertex arrays. This enables us to render points quickly using OpenGL. Our comparisons show that point generation is significantly faster than triangle generation...... and that the advantage of rendering points as opposed to triangles increases with the size and complexity of the volumes. To gauge the visual quality of future hardware accelerated point rendering schemes, we have implemented a software based point rendering method and compare the quality to both MC and our OpenGL based...

  18. Aqueous extracts of selenium-fertilized broccoli increase selenoprotein activity and inhibit DNA single-strand breaks, but decrease the activity of quinone reductase in Hepa 1c1c7 cells.

    Science.gov (United States)

    Keck, Anna-Sigrid; Finley, John W

    2006-05-01

    Depending on growth conditions, broccoli may be enriched in the isothiocyanate sulforaphane and/or the mineral selenium (Se); both compounds may play an important role in the reduction of intracellular oxidative stress and chronic disease prevention. Sulforaphane up-regulates transcription of Phase II detoxification proteins (e.g. quinone reductase [QR]), whereas Se is needed for the production of thioredoxin reductase (TR) and glutathione peroxidase-1 (GPx1), both of which exhibit antioxidant activity. The objective of the present study was to determine whether the fertilization of broccoli with Se increases the antioxidant ability of broccoli. Hydrogen peroxide-induced DNA single-strand breaks (measured by single cell electrophoresis, Comet assay) and activity of antioxidant enzymes (GPx, TR and QR) were measured in mouse hepatoma cells (Hepa 1c1c7 cells) treated with purified sulforaphane, sodium selenite or extracts of selenized broccoli. When supplied separately as chemically pure substances, sodium selenite was more effective than sulforaphane for reduction of single-strand breaks. Se-fertilized broccoli extracts were the most effective for reduction of DNA single-strand breaks, and extracts that contained 0.71 microM Se and 0.08 microM sulforaphane inhibited 94% of DNA single-strand breaks. A significant positive association (r = 0.81, p = 0.009) between GPx1 activity and inhibition of DNA single-strand breaks as well as a 24h lag time between addition of Se, sulforaphane or broccoli extract and inhibition of single-strand breaks suggests that some of the antioxidant protection is mediated through selenoproteins. Conversely, fertilization of broccoli with Se decreased the ability of broccoli extract to induce QR activity. These results demonstrate that Se and sulforaphane, alone or as a component of broccoli, may help decrease oxidative stress. They further suggest that Se is the most important for decreasing oxidative stress, but maximizing the Se content

  19. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Optimized polymerase chain reaction-based single-strand conformation polymorphism analysis of p53 gene applied to Bulgarian patients with invasive breast cancer.

    Science.gov (United States)

    Krasteva, M E; Garanina, Z; Georgieva, E I

    2003-11-01

    During the last few decades a substantial amount of evidence has accumulated proving that the abrogation of the normal p53 pathway is a critical step in the initiation and progression of tumors. Decoding the genetic mechanisms involved in carcinogenesis requires screening for consistent genetic tumor alterations, including those concerning the p53 gene. Thus, practical, efficient, and inexpensive techniques for accurate determination of p53 mutational status are needed. Polymerase chain reaction/single-strand conformation polymorphism (PCR-SSCP) analysis is considered to be a useful tool to investigate the role of the p53 gene in the development and progression of human cancers. The sensitivity of the method can be increased considerably by varying the experimental conditions. Here we demonstrate a scheme of PCR-SSCP optimization for detection of p53 gene mutations of patients with various cancers. Optimal conditions for PCRSSCP of p53 exons 4-9 are reported. Such PCR-SSCP optimization could allow an increase in the sensitivity and reproducibility of the technique and facilitates screening of large series of patients to assess the clinical significance of p53 mutations in human cancers. Using the optimized PCR-SSCP analysis we screened Bulgarian patients with invasive breast cancer for p53 gene mutations and registered a 33.33% frequency of mutations. To date, there are no data concerning the p53 status of Bulgarian breast cancer patients. Screening for p53 gene mutations enables an accurate and routine determination of the p53 status of patients with cancer and may be applied in clinical oncology to cancer diagnosis, prediction of prognosis and response to treatment.

  1. Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms.

    Science.gov (United States)

    Licciardello, G; Raspagliesi, D; Bar-Joseph, M; Catara, A

    2012-05-01

    Citrus tristeza virus (CTV) is the causal agent of tristeza disease, which is one of the most devastating diseases of citrus crops worldwide. This paper describes a method for the rapid detection and genotyping of naturally spreading CTV isolates. This method uses ELISA or dot-blot immunological tests to detect trees infected with CTV. The reaction wells or membrane spots for which there is a positive reaction are sequentially treated by (i) washing and elution of viral RNA from the trapped samples, (ii) one-step synthesis of cDNA and PCR and (iii) automated fluorescence-based capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) analysis of amplification products. Comparative CE-SSCP results are presented for CTV RNA extracted directly from infected leaves and ELISA plates or from membranes. In the analyses of all of these RNA samples, the p18, p27 and p23 CTV genes were targeted for amplification. Specific profiles of forward and reverse strands were obtained from a group of eight CTV isolates collected in Sicily, each with distinct biological characteristics, which were analyzed using the conventional two-step procedure (immunological detection followed by CE-SSCP molecular characterization after RNA isolation) or in a continuous process of ELISA/CE-SSCP or dot-blot/CE-SSCP starting from infected plant material. The combined method is simple, highly sensitive and reproducible, thus allowing the processing of numerous field samples for a variety of epidemiological needs. The sequential processing of an ELISA or dot-blot/ELISA followed by CE-SSCP is expected to allow the rapid detection of recent CTV infections along with the simultaneous characterization of the genetic diversity and structure of the population of newly invading CTV.

  2. The position of DNA cleavage by TALENs and cell synchronization influences the frequency of gene editing directed by single-stranded oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Natalia Rivera-Torres

    Full Text Available With recent technological advances that enable DNA cleavage at specific sites in the human genome, it may now be possible to reverse inborn errors, thereby correcting a mutation, at levels that could have an impact in a clinical setting. We have been developing gene editing, using single-stranded DNA oligonucleotides (ssODNs, as a tool to direct site specific single base changes. Successful application of this technique has been demonstrated in many systems ranging from bacteria to human (ES and somatic cells. While the frequency of gene editing can vary widely, it is often at a level that does not enable clinical application. As such, a number of stimulatory factors such as double-stranded breaks are known to elevate the frequency significantly. The majority of these results have been discovered using a validated HCT116 mammalian cell model system where credible genetic and biochemical readouts are available. Here, we couple TAL-Effector Nucleases (TALENs that execute specific ds DNA breaks with ssODNs, designed specifically to repair a missense mutation, in an integrated single copy eGFP gene. We find that proximal cleavage, relative to the mutant base, is key for enabling high frequencies of editing. A directionality of correction is also observed with TALEN activity upstream from the target base being more effective in promoting gene editing than activity downstream. We also find that cells progressing through S phase are more amenable to combinatorial gene editing activity. Thus, we identify novel aspects of gene editing that will help in the design of more effective protocols for genome modification and gene therapy in natural genes.

  3. Analysis of p53 gene mutations in human gliomas by polymerase chain reaction-based single-strand conformation polymorphism and DNA sequencing.

    Science.gov (United States)

    Sarkar, F H; Kupsky, W J; Li, Y W; Sreepathi, P

    1994-03-01

    Mutations in the p53 gene have been recognized in brain tumors, and clonal expansion of p53 mutant cells has been shown to be associated with glioma progression. However, studies on the p53 gene have been limited by the need for frozen tissues. We have developed a method utilizing polymerase chain reaction (PCR) for the direct analysis of p53 mutation by single-strand conformation polymorphism (SSCP) and by direct DNA sequencing of the p53 gene using a single 10-microns paraffin-embedded tissue section. We applied this method to screen for p53 gene mutations in exons 5-8 in human gliomas utilizing paraffin-embedded tissues. Twenty paraffin blocks containing tumor were selected from surgical specimens from 17 different adult patients. Tumors included six anaplastic astrocytomas (AAs), nine glioblastomas (GBs), and two mixed malignant gliomas (MMGs). The tissue section on the stained glass slide was used to guide microdissection of an unstained adjacent tissue section to ensure > 90% of the tumor cell population for p53 mutational analysis. Simultaneously, microdissection of the tissue was also carried out to obtain normal tissue from adjacent areas as a control. Mutations in the p53 gene were identified in 3 of 17 (18%) patients by PCR-SSCP analysis and subsequently confirmed by PCR-based DNA sequencing. Mutations in exon 5 resulting in amino acid substitution were found in one thalamic AA (codon 158, CGC > CTT: Arg > Leu) and one cerebral hemispheric GB (codon 151, CCG > CTG: Pro > Leu).(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Single-stranded DNA fragments of insect-specific nuclear polyhedrosis virus act as selective DNA insecticides for gypsy moth control.

    Science.gov (United States)

    Oberemok, Volodymyr V; Skorokhod, Oleksii A

    2014-07-01

    This paper focuses on the DNA insecticides as a novel preparation against gypsy moth (Lymantria dispar) based on DNA fragments of the anti-apoptotic gene of its nuclear polyhedrosis virus. It was found that the external application of a solution with two single-stranded DNA fragments from BIR and RING domains of LdMNPV (L.dispar multicapsid nuclear polyhedrosis virus) IAP-3 (inhibitor of apoptosis) gene induces a significantly higher mortality of gypsy moth caterpillars in comparison with the application of the control solutions. This effect does not depend on the infection of caterpillars with LdMNPV. The results also show that DNA insecticides based on LdMNPV IAP-3 gene fragments can be selective in action, and at least are not harmful to tobacco hornworm (Manduca sexta) and black cutworm (Agrotis ipsilon). Part of the gypsy moth genome cloned with the fragments of BIR and RING domains of LdMNPV IAP-3 gene as primers, has an overlap with the corresponding part of the LdMNPV IAP-3 gene and L.dispar IAP-1 mRNA for an inhibitor of apoptosis protein with the high cover by query, allows assuming that we cloned a part of gypsy moth anti-apoptosis gene. This finding gives the grounding that proposed here DNA insecticides might act through the blocking of the mechanisms involved in post transcriptional expression of insect anti-apoptosis genes. The results show the insecticidal potential of the viral genome fragments that can be used to create safe and relatively fast-acting DNA insecticides to control the quantity of gypsy moth populations, important task for forestry and agriculture. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Nonadditivity in the recognition of single-stranded DNA by the schizosaccharomyces pombe protection of telomeres 1 DNA-binding domain, Pot1-DBD.

    Science.gov (United States)

    Croy, Johnny E; Altschuler, Sarah E; Grimm, Nicole E; Wuttke, Deborah S

    2009-07-28

    The Schizosaccharomyces pombe protection of telomeres 1 (SpPot1) protein recognizes the 3' single-stranded ends of telomeres and provides essential protective and regulatory functions. The ssDNA-binding activity of SpPot1 is conferred by its ssDNA-binding domain, Pot1-DBD (residues 1-389), which can be further separated into two distinct domains, Pot1pN (residues 1-187) and Pot1pC (residues 188-389). Here we show that Pot1pC, like Pot1pN, can function independently of Pot1-DBD and binds specifically to a minimal nonameric oligonucleotide, d(GGTTACGGT), with a K(D) of 400 +/- 70 nM (specifically recognized nucleotides in bold). NMR chemical shift perturbation analysis indicates that the overall structures of the isolated Pot1pN and Pot1pC domains remain intact in Pot1-DBD. Furthermore, alanine scanning reveals modest differences in the ssDNA-binding contacts provided by isolated Pot1pN and within Pot1-DBD. Although the global character of both Pot1pN and Pot1pC is maintained in Pot1-DBD, chemical shift perturbation analysis highlights localized structural differences within the G1/G2 and T3/T4 binding pockets of Pot1pN in Pot1-DBD, which correlate with its distinct ssDNA-binding activity. Furthermore, we find evidence for a putative interdomain interface on Pot1pN that mediates interactions with Pot1pC that ultimately result in the altered ssDNA-binding activity of Pot1-DBD. Together, these data provide insight into the mechanisms underlying the activity and regulation of SpPot1 at the telomere.

  6. Novel positive-sense, single-stranded RNA (+ssRNA virus with di-cistronic genome from intestinal content of freshwater carp (Cyprinus carpio.

    Directory of Open Access Journals (Sweden)

    Ákos Boros

    Full Text Available A novel positive-sense, single-stranded RNA (+ssRNA virus (Halastavi árva RNA virus, HalV; JN000306 with di-cistronic genome organization was serendipitously identified in intestinal contents of freshwater carps (Cyprinus carpio fished by line-fishing from fishpond "Lőrinte halastó" located in Veszprém County, Hungary. The complete nucleotide (nt sequence of the genomic RNA is 9565 nt in length and contains two long--non-in-frame--open reading frames (ORFs, which are separated by an intergenic region. The ORF1 (replicase is preceded by an untranslated sequence of 827 nt, while an untranslated region of 139 nt follows the ORF2 (capsid proteins. The deduced amino acid (aa sequences of the ORFs showed only low (less than 32% and partial similarity to the non-structural (2C-like helicase, 3C-like cystein protease and 3D-like RNA dependent RNA polymerase and structural proteins (VP2/VP4/VP3 of virus families in Picornavirales especially to members of the viruses with dicistronic genome. Halastavi árva RNA virus is present in intestinal contents of omnivorous freshwater carps but the origin and the host species of this virus remains unknown. The unique viral sequence and the actual position indicate that Halastavi árva RNA virus seems to be the first member of a new di-cistronic ssRNA virus. Further studies are required to investigate the specific host species (and spectrum, ecology and role of Halastavi árva RNA virus in the nature.

  7. Detection of rifampin resistance by single-strand conformation polymorphism analysis of cerebrospinal fluid of patients with tuberculosis of the central nervous system.

    Science.gov (United States)

    Scarpellini, P; Braglia, S; Brambilla, A M; Dalessandro, M; Cichero, P; Gori, A; Lazzarin, A

    1997-01-01

    Mutations in a 69-bp region of the rpoB gene of Mycobacterium tuberculosis are associated with rifampin resistance (Rif[r]). These have been detected with mycobacterial DNA extracted from bacterial suspensions or respiratory specimens that were acid-fast smear positive. We experimented with a strategy for the rapid detection of Rif(r) in cerebrospinal fluid (CSF) samples. The strategy involves the amplification of the 69-bp region of rpoB by means of PCR and the identification of nucleotide mutations by single-strand conformation polymorphism (SSCP) analysis of the amplification products. Sixty-five CSF specimens collected from 29 patients (19 patients were coinfected with human immunodeficiency virus) with culture or autopsy-confirmed (22 patients) or highly probable (7 patients) tuberculosis of the central nervous system (CNS-TB) were processed. Amplified products suitable for evaluation by SSCP analysis were obtained from 37 CSF specimens from 25 subjects (86.2%). PCR-SSCP of CSF correctly identified the rifampin susceptibility phenotype of isolates from all 17 patients for whom the results of susceptibility tests carried out with strains cultured from CSF or respiratory samples were available. Moreover, this assay revealed the rifampin susceptibility genotype of isolates from the eight patients (three patients with culture-confirmed CNS-TB and five patients in whom CNS-TB was highly probable) for whom no susceptibility test results were available; the PCR-SSCP data obtained for these patients were concordant with the outcome after a standard antituberculosis treatment. The evolution of a mutation in the rpoB gene was documented in a patient during the course of treatment. PCR-SSCP analysis of CSF seems to be an efficacious method of predicting Rif(r) and would reduce the time required for susceptibility testing from approximately 4 to 8 weeks to a few days. PMID:9350737

  8. RNA- and single-stranded DNA-binding (SSB) proteins expressed during Drosophila melanogaster oogenesis: a homolog of bacterial and eukaryotic mitochondrial SSBs.

    Science.gov (United States)

    Stroumbakis, N D; Li, Z; Tolias, P P

    1994-06-10

    Little is known about the identity and involvement of single-stranded (ss) DNA-binding (SSB) and RNA-binding proteins in developmental processes that occur during oogenesis in Drosophila melanogaster (Dm). Here, we describe a molecular approach designed to identify such proteins by virtue of their ssDNA-binding activity. We have constructed a directional ovarian cDNA library and conducted expression cloning screens which identified five unique cDNAs that encode proteins capable of binding ssDNA. All five represent previously unreported sequences. The remainder of this paper focuses on one of these cDNAs which encodes a Dm protein displaying significant sequence homology to Escherichia coli ssDNA-binding protein (SSB, involved in DNA replication, repair and recombination), as well as eukaryotic SSBs isolated from the mitochondria (mt) of rats, frogs, humans and yeast. The deduced amino acid (aa) sequence of this 15.6-kDa protein, which we will refer to as Dm mtSSB, displays average identities of 38.3% with eukaryotic mtSSBs and 23.4% with bacterial SSBs. Gel retardation analysis with an affinity-purified GST fusion protein confirms that Dm mtSSB specifically binds ss, but not double stranded DNA. Dm mtSSB is encoded by a nuclear gene whose expression appears to be developmentally regulated. It is expressed as a single 600-nucleotide (nt) transcript during oogenesis and embryogenesis. A larger transcript of 1500 nt is prevalent in some later stages of Dm development.

  9. Variabilidad genética de Aedes aegypti en algunas áreas del Perú usando Single Stranded Conformational Polymorphism (SSCP

    Directory of Open Access Journals (Sweden)

    Nélida Leiva G

    2004-07-01

    Full Text Available Aedes aegypti es el vector responsable de la transmisión del virus del dengue, su distribución geográfica se ha ampliado rápidamente debido principalmente a la intervención de los seres humanos. Objetivo: Analizar la variabilidad genética de este mosquito mediante la comparación del Segundo Espaciador Transcrito Interno (ITS 2 perteneciente al ADN ribosomal (rADN. Materiales y Métodos: Se analizaron muestras de ocho localidades (Jaén, Tingo María, Iquitos, Lambayeque, el distrito de El Rimac, Sullana y Zarumilla y uno de la provincia de Huaquillas (Ecuador. El análisis de la variabilidad se determinó usando la técnica conocida como SSCP (Single Stranded Conformation Polymorphism. Resultados: El estudio muestra que existe variabilidad genética entre las poblaciones analizadas, principalmente entre las muestras localizadas en la costa del Perú (Zarumilla, El Rímac, Sullana y Huaquillas y las muestras del nororiente (Tingo María, Iquitos, Jaén y Lambayeque Conclusión: Se determinaron dos variantes genéticas entre las poblaciones de Aedes aegypti: Costeña y Nororiental, que probablemente provienen de dos ancestros diferentes y cuyo ancestro común sufrió de aislamiento por distancia. Se observó que no existe relación entre las distancias genéticas y las distancias geográficas indicando que la migración de estas poblaciones es el resultado de la intervención de los seres humanos que diseminan al vector y no por la migración activa del mosquito. Se plantea el papel de la Cordillera de los Andes en la migración y separación de las poblaciones de Aedes.

  10. Flow cytometry analysis of single-strand DNA damage in neuroblastoma cell lines using the F7-26 monoclonal antibody.

    Science.gov (United States)

    Grigoryan, Rita S; Yang, Bo; Keshelava, Nino; Barnhart, Jerry R; Reynolds, C Patrick

    2007-11-01

    The F7-26 monoclonal antibody (Mab) has been reported to be specific for single-strand DNA damage (ssDNA) and to also identify cells in apoptosis. We carriedout studies to determine if F7-26 binding measured by flow cytometry was able to specifically identify exogenous ssDNA as opposed to DNA damage from apoptosis. Neuroblastoma cells were treated with melphalan (L-PAM), fenretinide, 4-hydroperoxycyclophosphamide (4-HC)+/-pan-caspase inhibitor BOC-d-fmk, topotecan or with 10Gy gamma radiation+/-hydrogen peroxide (H2O2) and fixed immediately postradiation. Cytotoxicity was measured by DIMSCAN digital imaging fluorescence assay. The degree of ssDNA damage was analyzed by flow cytometry using Mab F7-26, with DNA visualized by propidium iodide counterstaining. Flow cytometry was used to measure apoptosis detected by terminal deoxynucleotidyltransferase (TUNEL) assay and reactive oxygen species (ROS) by carboxy-dichlorofluorescein diacetate. Irradiated and immediately fixed neuroblastoma cells showed increased ssDNA, but not apoptosis by TUNEL (TUNEL-negative). 4-HC or L-PAM+/-BOC-d-fmk increased ssDNA (F7-26-positive), but BOC-d-fmk prevented TUNEL staining. Fenretinide increased apoptosis by TUNEL but not ssDNA damage detected with F7-26. Enhanced ssDNA in neuroblastoma cells treated with radiation+H2O2 was associated with increased ROS. Topotecan increased both ssDNA and cytotoxicity in 4-HC-treated cells. These data demonstrate that Mab F7-26 recognized ssDNA due to exogenous DNA damage, rather than apoptosis. This assay should be useful to characterize the mechanism of action of antineoplastic drugs. Copyright (c) 2007 International Society for Analytical Cytology.

  11. Label-Free and Separation-Free Atomic Fluorescence Spectrometry-Based Bioassay: Sensitive Determination of Single-Strand DNA, Protein, and Double-Strand DNA.

    Science.gov (United States)

    Chen, Piaopiao; Wu, Peng; Chen, Junbo; Yang, Peng; Zhang, Xinfeng; Zheng, Chengbin; Hou, Xiandeng

    2016-02-16

    Based on selective and sensitive determination of Hg(2+) released from mercury complex by cold vapor generation (CVG) atomic fluorescence spectrometry (AFS) using SnCl2 as a reductant, a novel label-free and separation-free strategy was proposed for DNA and protein bioassay. To construct the DNA bioassay platform, an Hg(2+)-mediated molecular beacon (hairpin) without labeling but possessing several thymine (T) bases at both ends was employed as the probe. It is well-known that Hg(2+) could trigger the formation of the hairpin structure through T-Hg(2+)-T connection. In the presence of a specific target, the hairpin structure could be broken and the captured Hg(2+) was released. Interestingly, it was found that SnCl2 could selectively reduce only free Hg(2+) to Hg(0) vapor in the presence of T-Hg(2+)-T complex, which could be separated from sample matrices for sensitive AFS detection. Three different types of analyte, namely, single-strand DNA (ssDNA), protein, and double-strand DNA (dsDNA), were investigated as the target analytes. Under the optimized conditions, this bioassay provided high sensitivity for ssDNA, protein, and dsDNA determination with the limits of detection as low as 0.2, 0.08, and 0.3 nM and the linear dynamic ranges of 10-150, 5-175, and 1-250 nM, respectively. The analytical performance for these analytes compares favorably with those by previously reported methods, demonstrating the potential usefulness and versatility of this new AFS-based bioassay. Moreover, the bioassay retains advantages of simplicity, cost-effectiveness, and sensitivity compared to most of the conventional methods.

  12. Cluster parallel rendering based on encoded mesh

    Institute of Scientific and Technical Information of China (English)

    QIN Ai-hong; XIONG Hua; PENG Hao-yu; LIU Zhen; SHI Jiao-ying

    2006-01-01

    Use of compressed mesh in parallel rendering architecture is still an unexplored area, the main challenge of which is to partition and sort the encoded mesh in compression-domain. This paper presents a mesh compression scheme PRMC (Parallel Rendering based Mesh Compression) supplying encoded meshes that can be partitioned and sorted in parallel rendering system even in encoded-domain. First, we segment the mesh into submeshes and clip the submeshes' boundary into Runs, and then piecewise compress the submeshes and Runs respectively. With the help of several auxiliary index tables, compressed submeshes and Runs can serve as rendering primitives in parallel rendering system. Based on PRMC, we design and implement a parallel rendering architecture. Compared with uncompressed representation, experimental results showed that PRMC meshes applied in cluster parallel rendering system can dramatically reduce the communication requirement.

  13. Binaural Rendering in MPEG Surround

    Directory of Open Access Journals (Sweden)

    Kristofer Kjörling

    2008-04-01

    Full Text Available This paper describes novel methods for evoking a multichannel audio experience over stereo headphones. In contrast to the conventional convolution-based approach where, for example, five input channels are filtered using ten head-related transfer functions, the current approach is based on a parametric representation of the multichannel signal, along with either a parametric representation of the head-related transfer functions or a reduced set of head-related transfer functions. An audio scene with multiple virtual sound sources is represented by a mono or a stereo downmix signal of all sound source signals, accompanied by certain statistical (spatial properties. These statistical properties of the sound sources are either combined with statistical properties of head-related transfer functions to estimate “binaural parameters” that represent the perceptually relevant aspects of the auditory scene or used to create a limited set of combined head-related transfer functions that can be applied directly on the downmix signal. Subsequently, a binaural rendering stage reinstates the statistical properties of the sound sources by applying the estimated binaural parameters or the reduced set of combined head-related transfer functions directly on the downmix. If combined with parametric multichannel audio coders such as MPEG Surround, the proposed methods are advantageous over conventional methods in terms of perceived quality and computational complexity.

  14. Binaural Rendering in MPEG Surround

    Science.gov (United States)

    Breebaart, Jeroen; Villemoes, Lars; Kjörling, Kristofer

    2008-12-01

    This paper describes novel methods for evoking a multichannel audio experience over stereo headphones. In contrast to the conventional convolution-based approach where, for example, five input channels are filtered using ten head-related transfer functions, the current approach is based on a parametric representation of the multichannel signal, along with either a parametric representation of the head-related transfer functions or a reduced set of head-related transfer functions. An audio scene with multiple virtual sound sources is represented by a mono or a stereo downmix signal of all sound source signals, accompanied by certain statistical (spatial) properties. These statistical properties of the sound sources are either combined with statistical properties of head-related transfer functions to estimate "binaural parameters" that represent the perceptually relevant aspects of the auditory scene or used to create a limited set of combined head-related transfer functions that can be applied directly on the downmix signal. Subsequently, a binaural rendering stage reinstates the statistical properties of the sound sources by applying the estimated binaural parameters or the reduced set of combined head-related transfer functions directly on the downmix. If combined with parametric multichannel audio coders such as MPEG Surround, the proposed methods are advantageous over conventional methods in terms of perceived quality and computational complexity.

  15. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r...... to the presence of filamentous microorganisms was monitored weekly over 4 months. Microthrix was identified as a causative filament and suitable control measures were introduced. The level of Microthrix was reduced after 1-2 months but a number of other filamentous species were still present, with most of them...

  16. Rendering Caustics on Non-Lambertian Surfaces

    DEFF Research Database (Denmark)

    Jensen, Henrik Wann

    1997-01-01

    This paper presents a new technique for rendering caustics on non-Lambertian surfaces. The method is based on an extension of the photon map which removes previous restrictions limiting the usage to Lambertian surfaces. We add information about the incoming direction to the photons and this allow...... reduces the rendering time. We have used the method to render caustics on surfaces with reflectance functions varying from Lambertian to glossy specular....

  17. Building Interstellar's black hole: the gravitational renderer

    OpenAIRE

    James, Oliver; Dieckmann, Sylvan; Pabst, Simon; Roberts, Paul-George H.; Thorne, Kip S.

    2015-01-01

    Interstellar is the first feature film to attempt depicting a black hole as it would actually be seen by somebody nearby. A close collaboration between the production's Scientific Advisor and the Visual Effects team led to the development of a new renderer, DNGR (Double Negative Gravitational Renderer) which uses novel techniques for rendering in curved space-time. Following the completion of the movie, the code was adapted for scientific research, leading to new insights into gravitational l...

  18. Association of circulating antibodies against double-stranded and single-stranded DNA with thyroid autoantibodies in Graves' disease and Hashimoto's thyroiditis patients.

    Science.gov (United States)

    Pedro, A B P; Romaldini, J H; Americo, C; Takei, K

    2006-01-01

    The occurrence of antinuclear antibody (ANA), rheumatoid factor (RF), antibodies to double-stranded DNA (anti-dsDNA) and to single-stranded DNA (anti-ssDNA) was investigated in 51 patients with autoimmune thyroid diseases (AITD), and in 25 matched control subjects. In comparison with controls, the prevalence of anti-dsDNA was 74.5% in AITD patients (p=0.0001), 82.0% in 39 hyperthyroid Graves' disease (GD) (p=0.0001), and 50.0% in 12 euthyroid Hashimoto's thyroiditis (HT) patients (p=0.0001). The prevalence of anti-ssDNA was 90.1% in AITD (94.8% in GD and 75% in HT; p=0.001). The concentration of both anti-dsDNA and anti-ssDNA were higher (p=0.002) in AITD, in GD (p=0.001), and in HT (p=0.01) patients than in controls. Two patients with AITD were identified as positive for ANA. RF was detected in 4 AITD patients. Positive correlation was noted between anti-dsDNA with T4 (p=0.001), T3 (p=0.002), thyroid peroxidase antibody (anti-TPO) (p=0.0001), and TSH (p=0.001) values but not with thyroglobulin antibody (anti-Tg). Serum anti-ssDNA values were also correlated with T3 (p=0.0001), TSH (p=0.003), and anti-TPO (p=0.0001). However, by using a multiple regression analysis only anti-TPO remained associated with anti-dsDNA and both anti-Tg and anti-TPO with anti-ssDNA values. The predisposition to develop systemic autoimmune disorders is not influenced by thyroid hormones. The elevated prevalence of serum anti-dsDNA and anti-ssDNA in AITD patients points out that we must be aware of the risk for predisposition for the development of other systemic autoimmune diseases.

  19. Bound or free: interaction of the C-terminal domain of Escherichia coli single-stranded DNA-binding protein (SSB) with the tetrameric core of SSB.

    Science.gov (United States)

    Su, Xun-Cheng; Wang, Yao; Yagi, Hiromasa; Shishmarev, Dmitry; Mason, Claire E; Smith, Paul J; Vandevenne, Marylène; Dixon, Nicholas E; Otting, Gottfried

    2014-04-01

    Single-stranded DNA (ssDNA)-binding protein (SSB) protects ssDNA from degradation and recruits other proteins for DNA replication and repair. Escherichia coli SSB is the prototypical eubacterial SSB in a family of tetrameric SSBs. It consists of a structurally well-defined ssDNA binding domain (OB-domain) and a disordered C-terminal domain (C-domain). The eight-residue C-terminal segment of SSB (C-peptide) mediates the binding of SSB to many different SSB-binding proteins. Previously published nuclear magnetic resonance (NMR) data of the monomeric state at pH 3.4 showed that the C-peptide binds to the OB-domain at a site that overlaps with the ssDNA binding site, but investigating the protein at neutral pH is difficult because of the high molecular mass and limited solubility of the tetramer. Here we show that the C-domain is highly mobile in the SSB tetramer at neutral pH and that binding of the C-peptide to the OB-domain is so weak that most of the C-peptides are unbound even in the absence of ssDNA. We address the problem of determining intramolecular binding affinities in the situation of fast exchange between two states, one of which cannot be observed by NMR and cannot be fully populated. The results were confirmed by electron paramagnetic resonance spectroscopy and microscale thermophoresis. The C-peptide-OB-domain interaction is shown to be driven primarily by electrostatic interactions, so that binding of 1 equiv of (dT)35 releases practically all C-peptides from the OB-domain tetramer. The interaction is much more sensitive to NaCl than to potassium glutamate, which is the usual osmolyte in E. coli. As the C-peptide is predominantly in the unbound state irrespective of the presence of ssDNA, long-range electrostatic effects from the C-peptide may contribute more to regulating the activity of SSB than any engagement of the C-peptide by the OB-domain.

  20. Different mutagenic potential of HIV-1 restriction factors APOBEC3G and APOBEC3F is determined by distinct single-stranded DNA scanning mechanisms.

    Directory of Open Access Journals (Sweden)

    Anjuman Ara

    2014-03-01

    Full Text Available The APOBEC3 deoxycytidine deaminase family functions as host restriction factors that can block replication of Vif (virus infectivity factor deficient HIV-1 virions to differing degrees by deaminating cytosines to uracils in single-stranded (-HIV-1 DNA. Upon replication of the (-DNA to (+DNA, the HIV-1 reverse transcriptase incorporates adenines opposite the uracils, thereby inducing C/G→T/A mutations that can functionally inactivate HIV-1. Although both APOBEC3F and APOBEC3G are expressed in cell types HIV-1 infects and are suppressed by Vif, there has been no prior biochemical analysis of APOBEC3F, in contrast to APOBEC3G. Using synthetic DNA substrates, we characterized APOBEC3F and found that similar to APOBEC3G; it is a processive enzyme and can deaminate at least two cytosines in a single enzyme-substrate encounter. However, APOBEC3F scanning movement is distinct from APOBEC3G, and relies on jumping rather than both jumping and sliding. APOBEC3F jumping movements were also different from APOBEC3G. The lack of sliding movement from APOBEC3F is due to an ¹⁹⁰NPM¹⁹² motif, since insertion of this motif into APOBEC3G decreases its sliding movements. The APOBEC3G NPM mutant induced significantly less mutations in comparison to wild-type APOBEC3G in an in vitro model HIV-1 replication assay and single-cycle infectivity assay, indicating that differences in DNA scanning were relevant to restriction of HIV-1. Conversely, mutation of the APOBEC3F ¹⁹¹Pro to ¹⁹¹Gly enables APOBEC3F sliding movements to occur. Although APOBEC3F ¹⁹⁰NGM¹⁹² could slide, the enzyme did not induce more mutagenesis than wild-type APOBEC3F, demonstrating that the unique jumping mechanism of APOBEC3F abrogates the influence of sliding on mutagenesis. Overall, we demonstrate key differences in the impact of APOBEC3F- and APOBEC3G-induced mutagenesis on HIV-1 that supports a model in which both the processive DNA scanning mechanism and preferred

  1. RECOVIR: An application package to automatically identify some single stranded RNA viruses using capsid protein residues that uniquely distinguish among these viruses

    Directory of Open Access Journals (Sweden)

    Fox George E

    2007-10-01

    Full Text Available Abstract Background Most single stranded RNA (ssRNA viruses mutate rapidly to generate large number of strains having highly divergent capsid sequences. Accurate strain recognition in uncharacterized target capsid sequences is essential for epidemiology, diagnostics, and vaccine development. Strain recognition based on similarity scores between target sequences and sequences of homology matched reference strains is often time consuming and ambiguous. This is especially true if only partial target sequences are available or if different ssRNA virus families are jointly analyzed. In such cases, knowledge of residues that uniquely distinguish among known reference strains is critical for rapid and unambiguous strain identification. Conventional sequence comparisons are unable to identify such capsid residues due to high sequence divergence among the ssRNA virus reference strains. Consequently, automated general methods to reliably identify strains using strain distinguishing residues are not currently available. Results We present here RECOVIR ("recognize viruses", a software tool to automatically detect strains of caliciviruses and picornaviruses by comparing their capsid residues with built-in databases of residues that uniquely distinguish among known reference strains of these viruses. The databases were created by constructing partitioned phylogenetic trees of complete capsid sequences of these viruses. Strains were correctly identified for more than 300 complete and partial target sequences by comparing the database residues with the aligned residues of these sequences. It required about 5 seconds of real time to process each sequence. A Java-based user interface coupled with Perl-coded computational modules ensures high portability of the software. RECOVIR currently runs on Windows XP and Linux platforms. The software generalizes a manual method briefly outlined earlier for human caliciviruses. Conclusion This study shows implementation of

  2. Enthalpy and heat capacity changes for formation of an oligomeric DNA duplex: interpretation in terms of coupled processes of formation and association of single-stranded helices.

    Science.gov (United States)

    Holbrook, J A; Capp, M W; Saecker, R M; Record, M T

    1999-06-29

    association of single helical strands is approximately -64 kcal (mol of duplex)-1 as compared to -210 kcal (mol of duplex)-1 calculated for duplex formation from completely unstructured single strands and to the experimental ITC value of -73 kcal (mol of duplex)-1. The intrinsic heat capacity change for association of single helical strands to form the duplex is found to be small and positive [ approximately 0.1 kcal K-1 (mol of duplex)-1], in agreement with the result of a surface area analysis, which also predicts an undetectably small heat capacity change for single helix formation.

  3. [Expression and purification of a novel thermophilic bacterial single-stranded DNA-binding protein and enhancement the synthesis of DNA and cDNA].

    Science.gov (United States)

    Jia, Xiao-Wei; Zhang, Guo-Hui; Shi, Hai-Yan

    2012-12-01

    Express a novel species of single-stranded DNA-binding protein (SSB) derived from Thermococcus kodakarensis KOD1, abbreviated kod-ssb. And evaluate the effect of kod-ssb on PCR-based DNA amplification and reverse transcription. We express kod-ssb with the Transrtta (DE3), and kod-ssb was purified by affinity chromatography on a Ni2+ Sepharose column, detected by SDS-PAGE. To evaluate the effect of kod-ssb on PCR-based DNA amplification, the human beta globin gene was used as template to amplify a 5-kb, 9-kb and 13-kb. And to detect the effect of kod-ssb on reverse transcription, we used RNA from flu cell culture supernatant extraction as templates to implement qRT-PCR reaction. The plasmid pET11a-kod was transformed into Transetta (DE3) and the recombinant strain Transetta (pET11 a-kod) was obtained. The kod-ssb was highly expressed when the recombinant strain Transetta(pET11a-kod) was induced by IPTG. The specific protein was detected by SDS-PAGE. To confirm that kod-ssb can enhance target DNA synthesis and reduce PCR by-products, 5-, 9-, and 13-kb human beta globin gene fragments were used as templates for PCR. When PCR reactions did not include SSB proteins, the specific PCR product was contaminated with non-specific products. When kod -ssb was added, kod-ssb significantly enhanced amplification of the 5-, 9-and 13-kb target product and minimised the non-specific PCR products. To confirm that kod-ssb can enhance target cDNA synthesis, RNA from flu cell culture supernatant extraction was used as templates for qRT-PCR reaction. The results was that when kod-ssb was added, kod-ssb significantly enhanced the synthesis of cDNA, average Ct value is 19.42, and the average Ct value without kod-ssb is 22.15. kod-ssb may in future be used to enhance DNA and cDNA amplification.

  4. Image Based Rendering under Varying Illumination

    Institute of Scientific and Technical Information of China (English)

    Wang Chengfeng (王城峰); Hu Zhanyi

    2003-01-01

    A new approach for photorealistic rendering of a class of objects at arbitrary illumination is presented. The approach of the authors relies entirely on image based rendering techniques. A scheme is utilized for re-illumination of objects based on linear combination of low dimensional image representations. The minimum rendering condition of technique of the authors is three sample images under varying illumination of a reference object and a single input image of an interested object. Important properties of this approach are its simplicity, robustness and speediness. Experimental results validate the proposed rendering approach.

  5. RenderToolbox3: MATLAB tools that facilitate physically based stimulus rendering for vision research.

    Science.gov (United States)

    Heasly, Benjamin S; Cottaris, Nicolas P; Lichtman, Daniel P; Xiao, Bei; Brainard, David H

    2014-02-07

    RenderToolbox3 provides MATLAB utilities and prescribes a workflow that should be useful to researchers who want to employ graphics in the study of vision and perhaps in other endeavors as well. In particular, RenderToolbox3 facilitates rendering scene families in which various scene attributes and renderer behaviors are manipulated parametrically, enables spectral specification of object reflectance and illuminant spectra, enables the use of physically based material specifications, helps validate renderer output, and converts renderer output to physical units of radiance. This paper describes the design and functionality of the toolbox and discusses several examples that demonstrate its use. We have designed RenderToolbox3 to be portable across computer hardware and operating systems and to be free and open source (except for MATLAB itself). RenderToolbox3 is available at https://github.com/DavidBrainard/RenderToolbox3.

  6. Herpes simplex virus type 1-derived recombinant and amplicon vectors.

    Science.gov (United States)

    Fraefel, Cornel; Marconi, Peggy; Epstein, Alberto L

    2011-01-01

    Herpes simplex virus type 1 (HSV-1) is a human pathogen whose lifestyle is based on a long-term dual interaction with the infected host, being able to establish both lytic and latent infections. The virus genome is a 153 kbp double-stranded DNA molecule encoding more than 80 genes. The interest of HSV-1 as gene transfer vector stems from its ability to infect many different cell types, both quiescent and proliferating cells, the very high packaging capacity of the virus capsid, the outstanding neurotropic adaptations that this virus has evolved, and the fact that it never integrates into the cellular chromosomes, thus avoiding the risk of insertional mutagenesis. Two types of vectors can be derived from HSV-1, recombinant vectors and amplicon vectors, and different methodologies have been developed to prepare large stocks of each type of vector. This chapter summarizes (1) the two approaches most commonly used to prepare recombinant vectors through homologous recombination, either in eukaryotic cells or in bacteria, and (2) the two methodologies currently used to generate helper-free amplicon vectors, either using a bacterial artificial chromosome (BAC)-based approach or a Cre/loxP site-specific recombination strategy.

  7. A quantitative SMRT cell sequencing method for ribosomal amplicons.

    Science.gov (United States)

    Jones, Bethan M; Kustka, Adam B

    2017-04-01

    Advances in sequencing technologies continue to provide unprecedented opportunities to characterize microbial communities. For example, the Pacific Biosciences Single Molecule Real-Time (SMRT) platform has emerged as a unique approach harnessing DNA polymerase activity to sequence template molecules, enabling long reads at low costs. With the aim to simultaneously classify and enumerate in situ microbial populations, we developed a quantitative SMRT (qSMRT) approach that involves the addition of exogenous standards to quantify ribosomal amplicons derived from environmental samples. The V7-9 regions of 18S SSU rDNA were targeted and quantified from protistan community samples collected in the Ross Sea during the Austral summer of 2011. We used three standards of different length and optimized conditions to obtain accurate quantitative retrieval across the range of expected amplicon sizes, a necessary criterion for analyzing taxonomically diverse 18S rDNA molecules from natural environments. The ability to concurrently identify and quantify microorganisms in their natural environment makes qSMRT a powerful, rapid and cost-effective approach for defining ecosystem diversity and function.

  8. Image Based Rendering and Virtual Reality

    DEFF Research Database (Denmark)

    Livatino, Salvatore

    The Presentation concerns with an overview of Image Based Rendering approaches and their use on Virtual Reality, including Virtual Photography and Cinematography, and Mobile Robot Navigation.......The Presentation concerns with an overview of Image Based Rendering approaches and their use on Virtual Reality, including Virtual Photography and Cinematography, and Mobile Robot Navigation....

  9. Physically based rendering: from theory to implementation

    National Research Council Canada - National Science Library

    Pharr, Matt; Humphreys, Greg, Ph. D

    2010-01-01

    ... rendering algorithm variations. This book is not only a textbook for students, but also a useful reference book for practitioners in the field. The second edition has been extended with sections on Metropolis light transport, subsurface scattering, precomputed light transport, and more. Per Christensen Senior Software Developer, RenderMan Products,...

  10. Image Based Rendering and Virtual Reality

    DEFF Research Database (Denmark)

    Livatino, Salvatore

    The Presentation concerns with an overview of Image Based Rendering approaches and their use on Virtual Reality, including Virtual Photography and Cinematography, and Mobile Robot Navigation.......The Presentation concerns with an overview of Image Based Rendering approaches and their use on Virtual Reality, including Virtual Photography and Cinematography, and Mobile Robot Navigation....

  11. Moisture movements in render on brick wall

    DEFF Research Database (Denmark)

    Hansen, Kurt Kielsgaard; Munch, Thomas Astrup; Thorsen, Peter Schjørmann

    2003-01-01

    A three-layer render on brick wall used for building facades is studied in the laboratory. The vertical render surface is held in contact with water for 24 hours simulating driving rain while it is measured with non-destructive X-ray equipment every hour in order to follow the moisture front...... through the render and into the brick. The test specimen is placed between the source and the detector. The test specimens are all scanned before they are exposed to water. In that way the loss of counts from the dry scan to the wet scan qualitatively shows the presence of water. The results show nearly...... no penetration of water through the render and into the brick, and the results are independent of the start condition of the test specimens. Also drying experiments are performed. The results show a small difference in the rate of drying, in favour of the bricks without render....

  12. Physically based rendering from theory to implementation

    CERN Document Server

    Pharr, Matt

    2010-01-01

    "Physically Based Rendering, 2nd Edition" describes both the mathematical theory behind a modern photorealistic rendering system as well as its practical implementation. A method - known as 'literate programming'- combines human-readable documentation and source code into a single reference that is specifically designed to aid comprehension. The result is a stunning achievement in graphics education. Through the ideas and software in this book, you will learn to design and employ a full-featured rendering system for creating stunning imagery. This book features new sections on subsurface scattering, Metropolis light transport, precomputed light transport, multispectral rendering, and much more. It includes a companion site complete with source code for the rendering system described in the book, with support for Windows, OS X, and Linux. Code and text are tightly woven together through a unique indexing feature that lists each function, variable, and method on the page that they are first described.

  13. Optimization-Based Wearable Tactile Rendering.

    Science.gov (United States)

    Perez, Alvaro G; Lobo, Daniel; Chinello, Francesco; Cirio, Gabriel; Malvezzi, Monica; San Martin, Jose; Prattichizzo, Domenico; Otaduy, Miguel A

    2016-10-20

    Novel wearable tactile interfaces offer the possibility to simulate tactile interactions with virtual environments directly on our skin. But, unlike kinesthetic interfaces, for which haptic rendering is a well explored problem, they pose new questions about the formulation of the rendering problem. In this work, we propose a formulation of tactile rendering as an optimization problem, which is general for a large family of tactile interfaces. Based on an accurate simulation of contact between a finger model and the virtual environment, we pose tactile rendering as the optimization of the device configuration, such that the contact surface between the device and the actual finger matches as close as possible the contact surface in the virtual environment. We describe the optimization formulation in general terms, and we also demonstrate its implementation on a thimble-like wearable device. We validate the tactile rendering formulation by analyzing its force error, and we show that it outperforms other approaches.

  14. Swarm: robust and fast clustering method for amplicon-based studies

    Directory of Open Access Journals (Sweden)

    Frédéric Mahé

    2014-09-01

    Full Text Available Popular de novo amplicon clustering methods suffer from two fundamental flaws: arbitrary global clustering thresholds, and input-order dependency induced by centroid selection. Swarm was developed to address these issues by first clustering nearly identical amplicons iteratively using a local threshold, and then by using clusters’ internal structure and amplicon abundances to refine its results. This fast, scalable, and input-order independent approach reduces the influence of clustering parameters and produces robust operational taxonomic units.

  15. Quantitation and analysis of the formation of HO-endonuclease stimulated chromosomal translocations by single-strand annealing in Saccharomyces cerevisiae.

    Science.gov (United States)

    Liddell, Lauren; Manthey, Glenn; Pannunzio, Nicholas; Bailis, Adam

    2011-09-23

    Genetic variation is frequently mediated by genomic rearrangements that arise through interaction between dispersed repetitive elements present in every eukaryotic genome. This process is an important mechanism for generating diversity between and within organisms(1-3). The human genome consists of approximately 40% repetitive sequence of retrotransposon origin, including a variety of LINEs and SINEs(4). Exchange events between these repetitive elements can lead to genome rearrangements, including translocations, that can disrupt gene dosage and expression that can result in autoimmune and cardiovascular diseases(5), as well as cancer in humans(6-9). Exchange between repetitive elements occurs in a variety of ways. Exchange between sequences that share perfect (or near-perfect) homology occurs by a process called homologous recombination (HR). By contrast, non-homologous end joining (NHEJ) uses little-or-no sequence homology for exchange(10,11). The primary purpose of HR, in mitotic cells, is to repair double-strand breaks (DSBs) generated endogenously by aberrant DNA replication and oxidative lesions, or by exposure to ionizing radiation (IR), and other exogenous DNA damaging agents. In the assay described here, DSBs are simultaneously created bordering recombination substrates at two different chromosomal loci in diploid cells by a galactose-inducible HO-endonuclease (Figure 1). The repair of the broken chromosomes generates chromosomal translocations by single strand annealing (SSA), a process where homologous sequences adjacent to the chromosome ends are covalently joined subsequent to annealing. One of the substrates, his3-Δ3', contains a 3' truncated HIS3 allele and is located on one copy of chromosome XV at the native HIS3 locus. The second substrate, his3-Δ5', is located at the LEU2 locus on one copy of chromosome III, and contains a 5' truncated HIS3 allele. Both substrates are flanked by a HO endonuclease recognition site that can be targeted for

  16. 3D Rendering - Techniques and Challenges

    Directory of Open Access Journals (Sweden)

    Ekta Walia

    2010-04-01

    Full Text Available Computer generated images and animations are getting more and more common. They are used in many different contexts such as movies,mobiles, medical visualization, architectural visualization and CAD. Advanced ways of describing surface and light source properties are important to ensure that artists are able to create realistic and stylish looking images. Even when using advanced rendering algorithms such as ray tracing, time required for shading may contribute towards a large part of the image creation time. Therefore both performance and flexibility is important in a rendering system. This paper gives a comparative study of various 3D Rendering techniques and their challenges in a complete and systematic manner.

  17. The deinococcal DdrB protein is involved in an early step of DNA double strand break repair and in plasmid transformation through its single-strand annealing activity.

    Science.gov (United States)

    Bouthier de la Tour, Claire; Boisnard, Stéphanie; Norais, Cédric; Toueille, Magali; Bentchikou, Esma; Vannier, Françoise; Cox, Michael M; Sommer, Suzanne; Servant, Pascale

    2011-12-10

    The Deinococcus radiodurans bacterium exhibits an extreme resistance to ionizing radiation. Here, we investigated the in vivo role of DdrB, a radiation-induced Deinococcus specific protein that was previously shown to exhibit some in vitro properties akin to those of SSB protein from Escherichia coli but also to promote annealing of single stranded DNA. First we report that the deletion of the C-terminal motif of the DdrB protein, which is similar to the SSB C-terminal motif involved in recruitment to DNA of repair proteins, did neither affect cell radioresistance nor DNA binding properties of purified DdrB protein. We show that, in spite of their different quaternary structure, DdrB and SSB occlude the same amount of ssDNA in vitro. We also show that DdrB is recruited early and transiently after irradiation into the nucleoid to form discrete foci. Absence of DdrB increased the lag phase of the extended synthesis-dependent strand annealing (ESDSA) process, affecting neither the rate of DNA synthesis nor the efficiency of fragment reassembly, as indicated by monitoring DNA synthesis and genome reconstitution in cells exposed to a sub-lethal ionizing radiation dose. Moreover, cells devoid of DdrB were affected in the establishment of plasmid DNA during natural transformation, a process that requires pairing of internalized plasmid single stranded DNA fragments, whereas they were proficient in transformation by a chromosomal DNA marker that integrates into the host chromosome through homologous recombination. Our data are consistent with a model in which DdrB participates in an early step of DNA double strand break repair in cells exposed to very high radiation doses. DdrB might facilitate the accurate assembly of the myriad of small fragments generated by extreme radiation exposure through a single strand annealing (SSA) process to generate suitable substrates for subsequent ESDSA-promoted genome reconstitution.

  18. Chromatin Collapse during Caspase-dependent Apoptotic Cell Death Requires DNA Fragmentation Factor, 40-kDa Subunit-/Caspase-activated Deoxyribonuclease-mediated 3′-OH Single-strand DNA Breaks*

    Science.gov (United States)

    Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Sánchez-Osuna, María; Casanelles, Elisenda; García-Belinchón, Mercè; Comella, Joan X.; Yuste, Victor J.

    2013-01-01

    Apoptotic nuclear morphology and oligonucleosomal double-strand DNA fragments (also known as DNA ladder) are considered the hallmarks of apoptotic cell death. From a classic point of view, these two processes occur concomitantly. Once activated, DNA fragmentation factor, 40-kDa subunit (DFF40)/caspase-activated DNase (CAD) endonuclease hydrolyzes the DNA into oligonucleosomal-size pieces, facilitating the chromatin package. However, the dogma that the apoptotic nuclear morphology depends on DNA fragmentation has been questioned. Here, we use different cellular models, including MEF CAD−/− cells, to unravel the mechanism by which DFF40/CAD influences chromatin condensation and nuclear collapse during apoptosis. Upon apoptotic insult, SK-N-AS cells display caspase-dependent apoptotic nuclear alterations in the absence of internucleosomal DNA degradation. The overexpression of a wild-type form of DFF40/CAD endonuclease, but not of different catalytic-null mutants, restores the cellular ability to degrade the chromatin into oligonucleosomal-length fragments. We show that apoptotic nuclear collapse requires a 3′-OH endonucleolytic activity even though the internucleosomal DNA degradation is impaired. Moreover, alkaline unwinding electrophoresis and In Situ End-Labeling (ISEL)/In Situ Nick Translation (ISNT) assays reveal that the apoptotic DNA damage observed in the DNA ladder-deficient SK-N-AS cells is characterized by the presence of single-strand nicks/breaks. Apoptotic single-strand breaks can be impaired by DFF40/CAD knockdown, abrogating nuclear collapse and disassembly. In conclusion, the highest order of chromatin compaction observed in the later steps of caspase-dependent apoptosis relies on DFF40/CAD-mediated DNA damage by generating 3′-OH ends in single-strand rather than double-strand DNA nicks/breaks. PMID:23430749

  19. Saw1 Localizes to Repair Sites but is not Required for Recruitment of Rad10 to Repair Intermediates Bearing Short Non-Homologous 3′ Flaps during Single-Strand Annealing in S. cerevisiae

    OpenAIRE

    Mardirosian, Melina; Nalbandyan, Linette; Miller, Aaron D.; Phan, Claire; Kelson, Eric P.; Fischhaber, Paula L.

    2015-01-01

    SAW1 is required for efficient removal by the Rad1-Rad10 nuclease of 3′ non-homologous DNA ends (flaps) formed as intermediates during two modes of double-strand break repair in S. cerevisiae, single-strand annealing (SSA) and synthesis-dependent strand annealing (SDSA). Saw1 was shown in vitro to bind flaps with high affinity, but displayed diminished affinity when flaps were short (< 30 deoxynucleotides [nt]), consistent with it not being required for short flap cleavage. Accordingly, this ...

  20. Protective effects of pulmonary epithelial lining fluid on oxidative stress and DNA single-strand breaks caused by ultrafine carbon black, ferrous sulphate and organic extract of diesel exhaust particles

    Energy Technology Data Exchange (ETDEWEB)

    Chuang, Hsiao-Chi [School of Respiratory Therapy, College of Medicine, Taipei Medical University, Taipei, Taiwan (China); Division of Pulmonary Medicine, Department of Internal Medicine, Shuang Ho Hospital, Taipei Medical University, Taipei, Taiwan (China); Cheng, Yi-Ling; Lei, Yu-Chen [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Chang, Hui-Hsien [Institute of Environmental Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Cheng, Tsun-Jen, E-mail: tcheng@ntu.edu.tw [Institute of Occupational Medicine and Industrial Hygiene, College of Public Health, National Taiwan University, Taipei, Taiwan (China); Department of Public Health, College of Public Health, National Taiwan University, Taipei, Taiwan (China)

    2013-02-01

    Pulmonary epithelial lining fluid (ELF) is the first substance to make contact with inhaled particulate matter (PM) and interacts chemically with PM components. The objective of this study was to determine the role of ELF in oxidative stress, DNA damage and the production of proinflammatory cytokines following physicochemical exposure to PM. Ultrafine carbon black (ufCB, 15 nm; a model carbonaceous core), ferrous sulphate (FeSO{sub 4}; a model transition metal) and a diesel exhaust particle (DEP) extract (a model organic compound) were used to examine the acellular oxidative potential of synthetic ELF and non-ELF systems. We compared the effects of exposure to ufCB, FeSO{sub 4} and DEP extract on human alveolar epithelial Type II (A549) cells to determine the levels of oxidative stress, DNA single-strand breaks and interleukin-8 (IL-8) production in ELF and non-ELF systems. The effects of ufCB and FeSO{sub 4} on the acellular oxidative potential, cellular oxidative stress and DNA single-strand breakage were mitigated significantly by the addition of ELF, whereas there was no decrease following treatment with the DEP extract. There was no significant effect on IL-8 production following exposure to samples that were suspended in ELF/non-ELF systems. The results of the present study indicate that ELF plays an important role in the initial defence against PM in the pulmonary environment. Experimental components, such as ufCB and FeSO{sub 4}, induced the production of oxidative stress and led to DNA single-strand breaks, which were moderately prevented by the addition of ELF. These findings suggest that ELF plays a protective role against PM-driven oxidative stress and DNA damage. -- Highlights: ► To determine the role of ELF in ROS, DNA damage and IL-8 after exposure to PM. ► ufCB, FeSO{sub 4} and DEP extract were used to examine the protective effects of ELF. ► PM-driven oxidative stress and DNA single-strand breakage were mitigated by ELF. ► The findings

  1. FAST CROWD RENDERING IN COMPUTER GAMES

    Directory of Open Access Journals (Sweden)

    Kaya OĞUZ

    2010-06-01

    Full Text Available Computer games, with the speed advancements of graphical processors, are coming closer to the quality of cinema industry. Contrary to offline rendering of the scenes in a motion picture, computer games should be able to render at 30 frames per second. Therefore, CPU and memory performance are sought by using various techniques. This paper is about using instancing feature of contemporary graphical processors along with level of detail techniques which has been in use for a very long time. Using instancing, 15,000 instances were successfully rendered at 30 frames per second using a very low %10 CPU usage. The application can render 40,000 instances at 13 frames per second.

  2. Visibility-Aware Direct Volume Rendering

    Institute of Scientific and Technical Information of China (English)

    Wai-Ho Mak; Yingcai Wu; Ming-Yuen Chan; Huamin Qu

    2011-01-01

    Direct volume rendering (DVR) is a powerful visualization technique which allows users to effectively explore and study volumetric datasets. Different transparency settings can be flexibly assigned to different structures such that some valuable information can be revealed in direct volume rendered images (DVRIs). However, end-users often feel that some risks are always associated with DVR because they do not know whether any important information is missing from the transparent regions of DVRIs. In this paper, we investigate how to semi-automatically generate a set of DVRIs and also an animation which can reveal information missed in the original DVRIs and meanwhile satisfy some image quality criteria such as coherence. A complete framework is developed to tackle various problems related to the generation and quality evaluation of visibility-aware DVRIs and animations. Our technique can reduce the risk of using direct volume rendering and thus boost the confidence of users in volume rendering systems.

  3. ARC Code TI: SLAB Spatial Audio Renderer

    Data.gov (United States)

    National Aeronautics and Space Administration — SLAB is a software-based, real-time virtual acoustic environment rendering system being developed as a tool for the study of spatial hearing. SLAB is designed to...

  4. Layered Textures for Image-Based Rendering

    Institute of Scientific and Technical Information of China (English)

    en-Cheng Wang; ui-Yu Li; in Zheng; n-Hua Wu

    2004-01-01

    An extension to texture mapping is given in this paper for improving the efficiency of image-based rendering. For a depth image with an orthogonal displacement at each pixel, it is decomposed by the displacement into a series of layered textures (LTs) with each one having the same displacement for all its texels. Meanwhile,some texels of the layered textures are interpolated for obtaining a continuous 3D approximation of the model represented in the depth image. Thus, the plane-to-plane texture mapping can be used to map these layered textures to produce novel views and the advantages can be obtained as follows: accelerating the rendering speed,supporting the 3D surface details and view motion parallax, and avoiding the expensive task of hole-filling in the rendering stage. Experimental results show the new method can produce high-quality images and run faster than many famous image-based rendering techniques.

  5. Composed Scattering Model for Direct Volume Rendering

    Institute of Scientific and Technical Information of China (English)

    蔡文立; 石教英

    1996-01-01

    Based on the equation of transfer in transport theory of optical physics,a new volume rendering model,called composed scattering model(CSM),is presented.In calculating the scattering term of the equation,it is decomposed into volume scattering intensity and surface scattering intensity,and they are composed with the boundary detection operator as the weight function.This proposed model differs from the most current volume rendering models in the aspect that in CSM segmentation and illumination intensity calculation are taken as two coherent parts while in existing models they are regarded as two separate ones.This model has been applied to the direct volume rendering of 3D data sets obtained by CT and MRI.The resultant images show not only rich details but also clear boundary surfaces.CSM is demonstrated to be an accurate volume rendering model suitable for CT and MRI data sets.

  6. Deep amplicon sequencing reveals mixed phytoplasma infection within single grapevine plants

    DEFF Research Database (Denmark)

    Nicolaisen, Mogens; Contaldo, Nicoletta; Makarova, Olga

    2011-01-01

    The diversity of phytoplasmas within single plants has not yet been fully investigated. In this project, deep amplicon sequencing was used to generate 50,926 phytoplasma sequences from 11 phytoplasma-infected grapevine samples from a PCR amplicon in the 5' end of the 16S region. After clustering ...

  7. Deep amplicon sequencing reveals mixed phytoplasma infection within single grapevine plants

    DEFF Research Database (Denmark)

    Nicolaisen, Mogens; Contaldo, Nicoletta; Makarova, Olga

    2011-01-01

    The diversity of phytoplasmas within single plants has not yet been fully investigated. In this project, deep amplicon sequencing was used to generate 50,926 phytoplasma sequences from 11 phytoplasma-infected grapevine samples from a PCR amplicon in the 5' end of the 16S region. After clustering ...

  8. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus.

    Science.gov (United States)

    Kim, Seongman; Ahn, Byung Chul; O'Callaghan, Dennis J; Kim, Seong Kee

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  9. Synthesis of circular double-stranded DNA having single-stranded recognition sequence as molecular-physical probe for nucleic acid hybridization detection based on atomic force microscopy imaging.

    Science.gov (United States)

    Nakano, Koji; Matsunaga, Hideshi; Murata, Masaharu; Soh, Nobuaki; Imato, Toshihiko

    2009-08-01

    A new class of DNA probes having a mechanically detectable tag is reported. The DNA probe, which consists of a single-stranded recognition sequence and a double-stranded circular DNA entity, was prepared by polymerase reaction. M13mp18 single strand and a 32mer oligodeoxynucleotide whose 5'-end is decorated with the recognition sequence were used in combination as template and primer, respectively. We have successfully demonstrated that the DNA probe is useful for bioanalytical purposes: by deliberately attaching target DNA molecules onto Au(111) substrates and by mechanically reading out the tag-entity using a high-resolution microscopy including atomic force microscopy, visualization/detection of the individual target/probe DNA conjugate was possible simply yet straightforwardly. The present DNA probe can be characterized as a 100%-nucleic acid product material. It is simply available by one-pod synthesis. A surface topology parameter, image roughness, has witnessed its importance as a quantitative analysis index with particular usability in the present visualization/detection method.

  10. The early UL31 gene of equine herpesvirus 1 encodes a single-stranded DNA-binding protein that has a nuclear localization signal sequence at the C-terminus

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Seongman; Chul Ahn, Byung; O' Callaghan, Dennis J. [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States); Kim, Seong Kee, E-mail: skim1@lsuhsc.edu [Department of Microbiology and Immunology, Center for Molecular and Tumor Virology, Louisiana State University Health Sciences Center, Shreveport, LA 71130-3932 (United States)

    2012-10-25

    The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealed that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.

  11. Rendering and Compositing Infrastructure Improvements to VisIt for Insitu Rendering

    Energy Technology Data Exchange (ETDEWEB)

    Loring, Burlen [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Ruebel, Oliver [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2016-01-28

    Compared to posthoc rendering, insitu rendering often generates larger numbers of images, as a result rendering performance and scalability are critical in the insitu setting. In this work we present improvements to VisIt's rendering and compositing infrastructure that deliver increased performance and scalability in both posthoc and insitu settings. We added the capability for alpha blend compositing and use it with ordered compositing when datasets have disjoint block domain decomposition to optimize the rendering of transparent geometry. We also made improvements that increase overall efficiency by reducing communication and data movement and have addressed a number of performance issues. We structured our code to take advantage of SIMD parallelization and use threads to overlap communication and compositing. We tested our improvements on a 20 core workstation using 8 cores to render geometry generated from a $256^3$ cosmology dataset and on a Cray XC31 using 512 cores to render geometry generated from a $2000^2 \\times 800$ plasma dataset. Our results show that ordered compositing provides a speed up of up to $4 \\times$ over the current sort first strategy. The other improvements resulted in modest speed up with one notable exception where we achieve up to $40 \\times$ speed up of rendering and compositing of opaque geometry when both opaque and transparent geometry are rendered together. We also investigated the use of depth peeling, but found that the implementation provided by VTK is substantially slower,both with and without GPU acceleration, than a local camera order sort.

  12. Brain Image Representation and Rendering: A Survey

    Directory of Open Access Journals (Sweden)

    Mudassar Raza

    2012-09-01

    Full Text Available Brain image representation and rendering processes are basically used for evaluation, development and investigation consent experimental examination and formation of brain images of a variety of modalities that includes the major brain types like MEG, EEG, PET, MRI, CT or microscopy. So, there is a need to conduct a study to review the existing work in this area. This paper provides a review of different existing techniques and methods regarding the brain image representation and rendering. Image Rendering is the method of generating an image by means of a model, through computer programs. The basic purpose of brain image representation and rendering processes is to analyze the brain images precisely in order to effectively diagnose and examine the diseases and problems. The basic objective of this study is to evaluate and discuss different techniques and approaches proposed in order to handle different brain imaging types. The paper provides a short overview of different methods, in the form of advantages and limitations, presented in the prospect of brain image representation and rendering along with their sub categories proposed by different authors.

  13. Equalizer: a scalable parallel rendering framework.

    Science.gov (United States)

    Eilemann, Stefan; Makhinya, Maxim; Pajarola, Renato

    2009-01-01

    Continuing improvements in CPU and GPU performances as well as increasing multi-core processor and cluster-based parallelism demand for flexible and scalable parallel rendering solutions that can exploit multipipe hardware accelerated graphics. In fact, to achieve interactive visualization, scalable rendering systems are essential to cope with the rapid growth of data sets. However, parallel rendering systems are non-trivial to develop and often only application specific implementations have been proposed. The task of developing a scalable parallel rendering framework is even more difficult if it should be generic to support various types of data and visualization applications, and at the same time work efficiently on a cluster with distributed graphics cards. In this paper we introduce a novel system called Equalizer, a toolkit for scalable parallel rendering based on OpenGL which provides an application programming interface (API) to develop scalable graphics applications for a wide range of systems ranging from large distributed visualization clusters and multi-processor multipipe graphics systems to single-processor single-pipe desktop machines. We describe the system architecture, the basic API, discuss its advantages over previous approaches, present example configurations and usage scenarios as well as scalability results.

  14. Standardized rendering from IR surveillance motion imagery

    Science.gov (United States)

    Prokoski, F. J.

    2014-06-01

    Government agencies, including defense and law enforcement, increasingly make use of video from surveillance systems and camera phones owned by non-government entities.Making advanced and standardized motion imaging technology available to private and commercial users at cost-effective prices would benefit all parties. In particular, incorporating thermal infrared into commercial surveillance systems offers substantial benefits beyond night vision capability. Face rendering is a process to facilitate exploitation of thermal infrared surveillance imagery from the general area of a crime scene, to assist investigations with and without cooperating eyewitnesses. Face rendering automatically generates greyscale representations similar to police artist sketches for faces in surveillance imagery collected from proximate locations and times to a crime under investigation. Near-realtime generation of face renderings can provide law enforcement with an investigation tool to assess witness memory and credibility, and integrate reports from multiple eyewitnesses, Renderings can be quickly disseminated through social media to warn of a person who may pose an immediate threat, and to solicit the public's help in identifying possible suspects and witnesses. Renderings are pose-standardized so as to not divulge the presence and location of eyewitnesses and surveillance cameras. Incorporation of thermal infrared imaging into commercial surveillance systems will significantly improve system performance, and reduce manual review times, at an incremental cost that will continue to decrease. Benefits to criminal justice would include improved reliability of eyewitness testimony and improved accuracy of distinguishing among minority groups in eyewitness and surveillance identifications.

  15. Adaptive Rendering Based on Visual Acuity Equations

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    A new method of adaptable rendering for interaction in Virtual Environment(VE) through different visual acuity equations is proposed. An acuity factor equation of luminance vision is first given. Secondly, five equations which calculate the visual acuity through visual acuity factors are presented, and adaptive rendering strategy based on different visual acuity equations is given. The VE system may select one of them on the basis of the host's load, hereby select LOD for each model which would be rendered. A coarser LOD is selected where the visual acuity is lower, and a better LOD is used where it is higher. This method is tested through experiments and the experimental results show that it is effective.

  16. Rendering Falling Leaves on Graphics Hardware

    Directory of Open Access Journals (Sweden)

    Marcos Balsa

    2008-04-01

    Full Text Available There is a growing interest in simulating natural phenomena in computer graphics applications. Animating natural scenes in real time is one of the most challenging problems due to the inherent complexity of their structure, formed by millions of geometric entities, and the interactions that happen within. An example of natural scenario that is needed for games or simulation programs are forests. Forests are difficult to render because the huge amount of geometric entities and the large amount of detail to be represented. Moreover, the interactions between the objects (grass, leaves and external forces such as wind are complex to model. In this paper we concentrate in the rendering of falling leaves at low cost. We present a technique that exploits graphics hardware in order to render thousands of leaves with different falling paths in real time and low memory requirements.

  17. Construction of a cytomegalovirus-based amplicon: a vector with a unique transfer capacity.

    Science.gov (United States)

    Borst, Eva Maria; Messerle, Martin

    2003-07-01

    Cytomegalovirus (CMV) has a number of interesting properties that qualifies it as a vector for gene transfer. Especially appealing is the ability of the CMV genome to persist in hematopoietic progenitor cells and the packaging capacity of the viral capsid that accommodates a DNA genome of 230 kbp. In order to exploit the packaging capacity of the CMV capsid we investigated whether the principles of an amplicon vector can be applied to CMV. Amplicons are herpesviral vectors, which contain only the cis-active sequences required for replication and packaging of the vector genome. For construction of a CMV amplicon the sequences comprising the lytic origin of replication (orilyt) and the cleavage packaging recognition sites (pac) of human CMV were cloned onto a plasmid. A gene encoding the green fluorescent protein was used as a model transgene. The amplicon plasmid replicated in the presence of a CMV helper virus and was packaged into CMV particles, with replication and packaging being dependent on the presence of the orilyt and pac sequences. The packaged amplicon could be transferred to recipient cells and reisolated from the transduced cells. Analysis of the DNA isolated from CMV capsids revealed that the CMV amplicon was packaged as a concatemer with a size of approximately 210 kbp. The CMV amplicon vector has the potential to transfer therapeutic genes with a size of more than 200 kbp and thus provides a unique transfer capacity among viral vectors.

  18. Blender cycles lighting and rendering cookbook

    CERN Document Server

    Iraci, Bernardo

    2013-01-01

    An in-depth guide full of step-by-step recipes to explore the concepts behind the usage of Cycles. Packed with illustrations, and lots of tips and tricks; the easy-to-understand nature of the book will help the reader understand even the most complex concepts with ease.If you are a digital artist who already knows your way around Blender, and you want to learn about the new Cycles' rendering engine, this is the book for you. Even experts will be able to pick up new tips and tricks to make the most of the rendering capabilities of Cycles.

  19. Volume Rendering for Curvilinear and Unstructured Grids

    Energy Technology Data Exchange (ETDEWEB)

    Max, N; Williams, P; Silva, C; Cook, R

    2003-03-05

    We discuss two volume rendering methods developed at Lawrence Livermore National Laboratory. The first, cell projection, renders the polygons in the projection of each cell. It requires a global visibility sort in order to composite the cells in back to front order, and we discuss several different algorithms for this sort. The second method uses regularly spaced slice planes perpendicular to the X, Y, or Z axes, which slice the cells into polygons. Both methods are supplemented with anti-aliasing techniques to deal with small cells that might fall between pixel samples or slice planes, and both have been parallelized.

  20. GPU Pro 5 advanced rendering techniques

    CERN Document Server

    Engel, Wolfgang

    2014-01-01

    In GPU Pro5: Advanced Rendering Techniques, section editors Wolfgang Engel, Christopher Oat, Carsten Dachsbacher, Michal Valient, Wessam Bahnassi, and Marius Bjorge have once again assembled a high-quality collection of cutting-edge techniques for advanced graphics processing unit (GPU) programming. Divided into six sections, the book covers rendering, lighting, effects in image space, mobile devices, 3D engine design, and compute. It explores rasterization of liquids, ray tracing of art assets that would otherwise be used in a rasterized engine, physically based area lights, volumetric light

  1. Digital color acquisition, perception, coding and rendering

    CERN Document Server

    Fernandez-Maloigne, Christine; Macaire, Ludovic

    2013-01-01

    In this book the authors identify the basic concepts and recent advances in the acquisition, perception, coding and rendering of color. The fundamental aspects related to the science of colorimetry in relation to physiology (the human visual system) are addressed, as are constancy and color appearance. It also addresses the more technical aspects related to sensors and the color management screen. Particular attention is paid to the notion of color rendering in computer graphics. Beyond color, the authors also look at coding, compression, protection and quality of color images and videos.

  2. Haptic rendering for simulation of fine manipulation

    CERN Document Server

    Wang, Dangxiao; Zhang, Yuru

    2014-01-01

    This book introduces the latest progress in six degrees of freedom (6-DoF) haptic rendering with the focus on a new approach for simulating force/torque feedback in performing tasks that require dexterous manipulation skills. One of the major challenges in 6-DoF haptic rendering is to resolve the conflict between high speed and high fidelity requirements, especially in simulating a tool interacting with both rigid and deformable objects in a narrow space and with fine features. The book presents a configuration-based optimization approach to tackle this challenge. Addressing a key issue in man

  3. Improved sensitivity of circulating tumor DNA measurement using short PCR amplicons

    DEFF Research Database (Denmark)

    Andersen, Rikke Fredslund; Spindler, Karen-Lise Garm; Brandslund, Ivan

    2015-01-01

    , however, presents a number of challenges that require attention. The amount of DNA is low and highly fragmented and analyses need to be optimized accordingly. KRAS ARMS-qPCR assays with amplicon lengths of 120 and 85 base pairs, respectively, were compared using positive control material (PCR fragments......) and plasma samples from 46 colorectal cancer patients known to harbor a tumor KRAS mutation. KRAS mutated DNA was detected in significantly more clinical samples using the short amplicon assays compared to the long amplicon assays (74% vs. 61%, p=0.03). The level of mutated DNA in plasma was on average three...

  4. Integrated Microfluidic Nucleic Acid Isolation, Isothermal Amplification, and Amplicon Quantification

    Directory of Open Access Journals (Sweden)

    Michael G. Mauk

    2015-10-01

    Full Text Available Microfluidic components and systems for rapid (<60 min, low-cost, convenient, field-deployable sequence-specific nucleic acid-based amplification tests (NAATs are described. A microfluidic point-of-care (POC diagnostics test to quantify HIV viral load from blood samples serves as a representative and instructive example to discuss the technical issues and capabilities of “lab on a chip” NAAT devices. A portable, miniaturized POC NAAT with performance comparable to conventional PCR (polymerase-chain reaction-based tests in clinical laboratories can be realized with a disposable, palm-sized, plastic microfluidic chip in which: (1 nucleic acids (NAs are extracted from relatively large (~mL volume sample lysates using an embedded porous silica glass fiber or cellulose binding phase (“membrane” to capture sample NAs in a flow-through, filtration mode; (2 NAs captured on the membrane are isothermally (~65 °C amplified; (3 amplicon production is monitored by real-time fluorescence detection, such as with a smartphone CCD camera serving as a low-cost detector; and (4 paraffin-encapsulated, lyophilized reagents for temperature-activated release are pre-stored in the chip. Limits of Detection (LOD better than 103 virons/sample can be achieved. A modified chip with conduits hosting a diffusion-mode amplification process provides a simple visual indicator to readily quantify sample NA template. In addition, a companion microfluidic device for extracting plasma from whole blood without a centrifuge, generating cell-free plasma for chip-based molecular diagnostics, is described. Extensions to a myriad of related applications including, for example, food testing, cancer screening, and insect genotyping are briefly surveyed.

  5. Integrated Microfluidic Nucleic Acid Isolation, Isothermal Amplification, and Amplicon Quantification.

    Science.gov (United States)

    Mauk, Michael G; Liu, Changchun; Song, Jinzhao; Bau, Haim H

    2015-10-20

    Microfluidic components and systems for rapid (microfluidic point-of-care (POC) diagnostics test to quantify HIV viral load from blood samples serves as a representative and instructive example to discuss the technical issues and capabilities of "lab on a chip" NAAT devices. A portable, miniaturized POC NAAT with performance comparable to conventional PCR (polymerase-chain reaction)-based tests in clinical laboratories can be realized with a disposable, palm-sized, plastic microfluidic chip in which: (1) nucleic acids (NAs) are extracted from relatively large (~mL) volume sample lysates using an embedded porous silica glass fiber or cellulose binding phase ("membrane") to capture sample NAs in a flow-through, filtration mode; (2) NAs captured on the membrane are isothermally (~65 °C) amplified; (3) amplicon production is monitored by real-time fluorescence detection, such as with a smartphone CCD camera serving as a low-cost detector; and (4) paraffin-encapsulated, lyophilized reagents for temperature-activated release are pre-stored in the chip. Limits of Detection (LOD) better than 10³ virons/sample can be achieved. A modified chip with conduits hosting a diffusion-mode amplification process provides a simple visual indicator to readily quantify sample NA template. In addition, a companion microfluidic device for extracting plasma from whole blood without a centrifuge, generating cell-free plasma for chip-based molecular diagnostics, is described. Extensions to a myriad of related applications including, for example, food testing, cancer screening, and insect genotyping are briefly surveyed.

  6. 防扭钢丝绳用单股钢丝绳生产中存在的问题和对策%Problems and countermeasures in production of single strand wire rope for torsionproof wire rope

    Institute of Scientific and Technical Information of China (English)

    邵永清; 刘红芳; 许铭锋; 马水国

    2013-01-01

    To analyze the factors affecting service life of single strand wire rope for torsionproof wire rope,aiming at the problems existing in production to give out countermeasures:(1) to control steel wire tensile strength scatter difference fluctuation,adopting wet wire drawing machine to strictly control tolerance range of semi-finished steel wire and eliminate steel wire cold drawn forming residual stress; (2) to control galvanizing,adopting electro galvanizing for diameter less than 0.50 mm steel wire with more than 95% reduction of area,hot dipping galvanizing for others; outer layer steel wire in single strand rope adopt hot dipping galvanizing steel wire,inner wire is produced in electro galvanizing way; (3) to control wire rope length and linear density,in wire drawing course to control pass diameters and tolerance strictly,adopt electric meter counter to detect rope length in lay process,ensure wire rope length precision.Strengthening production process control of single strand rope for torsionproof wire rope can improve product quality,raise production efficiency,and decrease production cost.%分析影响防扭钢丝绳用单股钢丝绳使用寿命的因素,针对生产中存在的问题给出对策:(1)钢丝抗拉强度散差波动控制.拉拔过程采用水箱湿式拉拔,严格控制半成品钢丝的公差范围并消除钢丝冷拉变形的残余应力.(2)镀锌控制.水箱拉拔压缩率大于95%且出线直径小于0.50 mm的钢丝全部采用电镀锌生产,其余则用热镀锌生产;单股钢丝绳外层钢丝采用热镀锌生产,内层钢丝采用电镀锌生产.(3)钢丝绳长度和线密度的控制.严格控制拉丝工序各道次钢丝直径及公差,捻制工序采用电子计米器检测钢丝绳的长度,保证钢丝绳长度精确率.加强防扭钢丝绳用单股钢丝绳生产过程控制,可提高产品质量,提升生产效率,降低生产成本.

  7. Rendering Visible: Painting and Sexuate Subjectivity

    Science.gov (United States)

    Daley, Linda

    2015-01-01

    In this essay, I examine Luce Irigaray's aesthetic of sexual difference, which she develops by extrapolating from Paul Klee's idea that the role of painting is to render the non-visible rather than represent the visible. This idea is the premise of her analyses of phenomenology and psychoanalysis and their respective contributions to understanding…

  8. Haptic rendering for dental training system

    Institute of Scientific and Technical Information of China (English)

    WANG DangXiao; ZHANG YuRu; WANG Yong; L(U) PeiJun; ZHOU RenGe; ZHOU WanLin

    2009-01-01

    Immersion and Interaction are two key features of virtual reality systems,which are especially important for medical applications.Based on the requirement of motor skill training in dental surgery,haptic rendering method based on triangle model is investigated in this paper.Multi-rate haptic rendering architecture is proposed to solve the contradiction between fidelity and efficiency requirements.Realtime collision detection algorithm based on spatial partition and time coherence is utilized to enable fast contact determination.Proxy-based collision response algorithm is proposed to compute surface contact point.Cutting force model based on piecewise contact transition model is proposed for dental drilling simulation during tooth preparation.Velocity-driven levels of detail hapUc rendering algorithm is proposed to maintain high update rate for complex scenes with a large number of triangles.Hapticvisual collocated dental training prototype is established using half-mirror solution.Typical dental operations have been realized Including dental caries exploration,detection of boundary within dental crose-section plane,and dental drilling during tooth preparation.The haptic rendering method is a fundamental technology to improve Immersion and interaction of virtual reality training systems,which is useful not only in dental training,but also in other surgical training systems.

  9. ProteinShader: illustrative rendering of macromolecules

    Directory of Open Access Journals (Sweden)

    Weber Joseph R

    2009-03-01

    Full Text Available Abstract Background Cartoon-style illustrative renderings of proteins can help clarify structural features that are obscured by space filling or balls and sticks style models, and recent advances in programmable graphics cards offer many new opportunities for improving illustrative renderings. Results The ProteinShader program, a new tool for macromolecular visualization, uses information from Protein Data Bank files to produce illustrative renderings of proteins that approximate what an artist might create by hand using pen and ink. A combination of Hermite and spherical linear interpolation is used to draw smooth, gradually rotating three-dimensional tubes and ribbons with a repeating pattern of texture coordinates, which allows the application of texture mapping, real-time halftoning, and smooth edge lines. This free platform-independent open-source program is written primarily in Java, but also makes extensive use of the OpenGL Shading Language to modify the graphics pipeline. Conclusion By programming to the graphics processor unit, ProteinShader is able to produce high quality images and illustrative rendering effects in real-time. The main feature that distinguishes ProteinShader from other free molecular visualization tools is its use of texture mapping techniques that allow two-dimensional images to be mapped onto the curved three-dimensional surfaces of ribbons and tubes with minimum distortion of the images.

  10. Rendering Visible: Painting and Sexuate Subjectivity

    Science.gov (United States)

    Daley, Linda

    2015-01-01

    In this essay, I examine Luce Irigaray's aesthetic of sexual difference, which she develops by extrapolating from Paul Klee's idea that the role of painting is to render the non-visible rather than represent the visible. This idea is the premise of her analyses of phenomenology and psychoanalysis and their respective contributions to understanding…

  11. Chromosomal localization of mitochondrial transcription factor A (TCF6), single-stranded DNA-binding protein (SSBP), and endonuclease G (ENDOG), three human housekeeping genes involving in mitochondrial biogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Tiranti, V.; Rossi, G.; DiDonato, S. [Istituto Nazionale Neurologico, Carlo Besta (Italy)] [and others

    1995-01-20

    By using a PCR-based screening of a somatic cell hybrid panel and FISH, we have assigned the loci of mitochondrial single-stranded DNA-binding protein (SSBP), mitochondrial transcription factor A (TCF6), and mitochondrial endonuclease G (ENDOG) genes to human chromosomes 7q34, 10q21, and 9q34.1, respectively. The products of these three genes are involved in fundamental aspects of mitochondrial biogenesis, such as replication and transcription of the mitochondrial genome. The chromosomal localization of these genes is important to testing whether the corresponding proteins may play a role in the etiopathogenesis of human disorders associated with qualitative or quantitative abnormalities of mitochondrial DNA. 20 refs., 1 fig., 2 tabs.

  12. RAY TRACING RENDER MENGGUNAKAN FRAGMENT ANTI ALIASING

    Directory of Open Access Journals (Sweden)

    Febriliyan Samopa

    2008-07-01

    Full Text Available Normal 0 false false false IN X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:10.0pt; mso-para-margin-left:0cm; line-height:115%; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} Rendering is generating surface and three-dimensional effects on an object displayed on a monitor screen. Ray tracing as a rendering method that traces ray for each image pixel has a drawback, that is, aliasing (jaggies effect. There are some methods for executing anti aliasing. One of those methods is OGSS (Ordered Grid Super Sampling. OGSS is able to perform aliasing well. However, this method requires more computation time since sampling of all pixels in the image will be increased. Fragment Anti Aliasing (FAA is a new alternative method that can cope with the drawback. FAA will check the image when performing rendering to a scene. Jaggies effect is only happened at curve and gradient object. Therefore, only this part of object that will experience sampling magnification. After this sampling magnification and the pixel values are computed, then downsample is performed to retrieve the original pixel values. Experimental results show that the software can implement ray tracing well in order to form images, and it can implement FAA and OGSS technique to perform anti aliasing. In general, rendering using FAA is faster than using OGSS

  13. Automatic Image-Based Pencil Sketch Rendering

    Institute of Scientific and Technical Information of China (English)

    王进; 鲍虎军; 周伟华; 彭群生; 徐迎庆

    2002-01-01

    This paper presents an automatic image-based approach for converting greyscale images to pencil sketches, in which strokes follow the image features. The algorithm first extracts a dense direction field automatically using Logical/Linear operators which embody the drawing mechanism. Next, a reconstruction approach based on a sampling-and-interpolation scheme is introduced to generate stroke paths from the direction field. Finally, pencil strokes are rendered along the specified paths with consideration of image tone and artificial illumination.As an important application, the technique is applied to render portraits from images with little user interaction. The experimental results demonstrate that the approach can automatically achieve compelling pencil sketches from reference images.

  14. Anti-Aliased Rendering of Water Surface

    Institute of Scientific and Technical Information of China (English)

    Xue-Ying Qin; Eihachiro Nakamae; Wei Hua; Yasuo Nagai; Qun-Sheng Peng

    2004-01-01

    Water surface is one of the most important components of landscape scenes. When rendering spacious far from the viewpoint. This is because water surface consists of stochastic water waves which are usually modeled by periodic bump mapping. The incident rays on the water surface are actually scattered by the bumped waves,pattern, we estimate this solid angle of reflected rays and trace these rays. An image-based accelerating method is adopted so that the contribution of each reflected ray can be quickly obtained without elaborate intersection calculation. We also demonstrate anti-aliased shadows of sunlight and skylight on the water surface. Both the rendered images and animations show excellent effects on the water surface of a reservoir.

  15. Optimization techniques for computationally expensive rendering algorithms

    OpenAIRE

    Navarro Gil, Fernando; Gutiérrez Pérez, Diego; Serón Arbeloa, Francisco José

    2012-01-01

    Realistic rendering in computer graphics simulates the interactions of light and surfaces. While many accurate models for surface reflection and lighting, including solid surfaces and participating media have been described; most of them rely on intensive computation. Common practices such as adding constraints and assumptions can increase performance. However, they may compromise the quality of the resulting images or the variety of phenomena that can be accurately represented. In this thesi...

  16. Visualization of Medpor implants using surface rendering

    Institute of Scientific and Technical Information of China (English)

    WANG Meng; GUI Lai; LIU Xiao-jing

    2011-01-01

    Background The Medpor surgical implant is one of the easiest implants in clinical practice, especially in craniomaxillofacial surgery. It is often used as a bone substitute material for the repair of skull defects and facial deformities. The Medpor implant has several advantages but its use is limited because it is radiolucent in both direct radiography and conventional computed tomography, causing serious problems with visualization.Methods In this study, a new technique for visualizing Medpor implants was evaluated in 10 patients who had undergone facial reconstruction using the material. Continuous volume scans were made using a 16-channel tomographic scanner and 3D reconstruction software was used to create surface renderings. The threshold values for surface renderings of the implant ranged from -70 HU to -20 HU, with bone as the default.Results The shape of the implants and the spatial relationship between bone and implant could both be displayed.Conclusion Surface rendering can allow successful visualization of Medpor implants in the body.

  17. JRC GMO-Amplicons: a collection of nucleic acid sequences related to genetically modified organisms.

    Science.gov (United States)

    Petrillo, Mauro; Angers-Loustau, Alexandre; Henriksson, Peter; Bonfini, Laura; Patak, Alex; Kreysa, Joachim

    2015-01-01

    The DNA target sequence is the key element in designing detection methods for genetically modified organisms (GMOs). Unfortunately this information is frequently lacking, especially for unauthorized GMOs. In addition, patent sequences are generally poorly annotated, buried in complex and extensive documentation and hard to link to the corresponding GM event. Here, we present the JRC GMO-Amplicons, a database of amplicons collected by screening public nucleotide sequence databanks by in silico determination of PCR amplification with reference methods for GMO analysis. The European Union Reference Laboratory for Genetically Modified Food and Feed (EU-RL GMFF) provides these methods in the GMOMETHODS database to support enforcement of EU legislation and GM food/feed control. The JRC GMO-Amplicons database is composed of more than 240 000 amplicons, which can be easily accessed and screened through a web interface. To our knowledge, this is the first attempt at pooling and collecting publicly available sequences related to GMOs in food and feed. The JRC GMO-Amplicons supports control laboratories in the design and assessment of GMO methods, providing inter-alia in silico prediction of primers specificity and GM targets coverage. The new tool can assist the laboratories in the analysis of complex issues, such as the detection and identification of unauthorized GMOs. Notably, the JRC GMO-Amplicons database allows the retrieval and characterization of GMO-related sequences included in patents documentation. Finally, it can help annotating poorly described GM sequences and identifying new relevant GMO-related sequences in public databases. The JRC GMO-Amplicons is freely accessible through a web-based portal that is hosted on the EU-RL GMFF website. Database URL: http://gmo-crl.jrc.ec.europa.eu/jrcgmoamplicons/.

  18. GPU Pro 4 advanced rendering techniques

    CERN Document Server

    Engel, Wolfgang

    2013-01-01

    GPU Pro4: Advanced Rendering Techniques presents ready-to-use ideas and procedures that can help solve many of your day-to-day graphics programming challenges. Focusing on interactive media and games, the book covers up-to-date methods producing real-time graphics. Section editors Wolfgang Engel, Christopher Oat, Carsten Dachsbacher, Michal Valient, Wessam Bahnassi, and Sebastien St-Laurent have once again assembled a high-quality collection of cutting-edge techniques for advanced graphics processing unit (GPU) programming. Divided into six sections, the book begins with discussions on the abi

  19. Haptic rendering foundations, algorithms, and applications

    CERN Document Server

    Lin, Ming C

    2008-01-01

    For a long time, human beings have dreamed of a virtual world where it is possible to interact with synthetic entities as if they were real. It has been shown that the ability to touch virtual objects increases the sense of presence in virtual environments. This book provides an authoritative overview of state-of-theart haptic rendering algorithms and their applications. The authors examine various approaches and techniques for designing touch-enabled interfaces for a number of applications, including medical training, model design, and maintainability analysis for virtual prototyping, scienti

  20. GPU PRO 3 Advanced rendering techniques

    CERN Document Server

    Engel, Wolfgang

    2012-01-01

    GPU Pro3, the third volume in the GPU Pro book series, offers practical tips and techniques for creating real-time graphics that are useful to beginners and seasoned game and graphics programmers alike. Section editors Wolfgang Engel, Christopher Oat, Carsten Dachsbacher, Wessam Bahnassi, and Sebastien St-Laurent have once again brought together a high-quality collection of cutting-edge techniques for advanced GPU programming. With contributions by more than 50 experts, GPU Pro3: Advanced Rendering Techniques covers battle-tested tips and tricks for creating interesting geometry, realistic sha

  1. Defects of organization in rendering medical aid

    Directory of Open Access Journals (Sweden)

    Shavkat Islamov

    2010-09-01

    Full Text Available The defects of organization at the medical institution mean disturbance of rules, norms and order of rendering of medical aid. The number of organization defects in Uzbekistan increased from 20.42%, in 1999 to 25.46% in 2001 with gradual decrease to 19.9% in 2003 and 16.66%, in 2006 and gradual increase to 21.95% and 28.28% (P<0.05 in 2005 and 2008. Among the groups of essential defects of organization there were following: disturbance of transportation rules, lack of dispensary care, shortcomings in keeping medical documentation.

  2. Formation of linear amplicons with inverted duplications in Leishmania requires the MRE11 nuclease.

    Directory of Open Access Journals (Sweden)

    Marie-Claude N Laffitte

    2014-12-01

    Full Text Available Extrachromosomal DNA amplification is frequent in the protozoan parasite Leishmania selected for drug resistance. The extrachromosomal amplified DNA is either circular or linear, and is formed at the level of direct or inverted homologous repeated sequences that abound in the Leishmania genome. The RAD51 recombinase plays an important role in circular amplicons formation, but the mechanism by which linear amplicons are formed is unknown. We hypothesized that the Leishmania infantum DNA repair protein MRE11 is required for linear amplicons following rearrangements at the level of inverted repeats. The purified LiMRE11 protein showed both DNA binding and exonuclease activities. Inactivation of the LiMRE11 gene led to parasites with enhanced sensitivity to DNA damaging agents. The MRE11(-/- parasites had a reduced capacity to form linear amplicons after drug selection, and the reintroduction of an MRE11 allele led to parasites regaining their capacity to generate linear amplicons, but only when MRE11 had an active nuclease activity. These results highlight a novel MRE11-dependent pathway used by Leishmania to amplify portions of its genome to respond to a changing environment.

  3. A Multiresolution Image Cache for Volume Rendering

    Energy Technology Data Exchange (ETDEWEB)

    LaMar, E; Pascucci, V

    2003-02-27

    The authors discuss the techniques and implementation details of the shared-memory image caching system for volume visualization and iso-surface rendering. One of the goals of the system is to decouple image generation from image display. This is done by maintaining a set of impostors for interactive display while the production of the impostor imagery is performed by a set of parallel, background processes. The system introduces a caching basis that is free of the gap/overlap artifacts of earlier caching techniques. instead of placing impostors at fixed, pre-defined positions in world space, the technique is to adaptively place impostors relative to the camera viewpoint. The positions translate with the camera but stay aligned to the data; i.e., the positions translate, but do not rotate, with the camera. The viewing transformation is factored into a translation transformation and a rotation transformation. The impostor imagery is generated using just the translation transformation and visible impostors are displayed using just the rotation transformation. Displayed image quality is improved by increasing the number of impostors and the frequency that impostors are re-rendering is improved by decreasing the number of impostors.

  4. Rendering of 3D Dynamic Virtual Environments

    CERN Document Server

    Catanese, Salvatore; Fiumara, Giacomo; Pagano, Francesco

    2011-01-01

    In this paper we present a framework for the rendering of dynamic 3D virtual environments which can be integrated in the development of videogames. It includes methods to manage sounds and particle effects, paged static geometries, the support of a physics engine and various input systems. It has been designed with a modular structure to allow future expansions. We exploited some open-source state-of-the-art components such as OGRE, PhysX, ParticleUniverse, etc.; all of them have been properly integrated to obtain peculiar physical and environmental effects. The stand-alone version of the application is fully compatible with Direct3D and OpenGL APIs and adopts OpenAL APIs to manage audio cards. Concluding, we devised a showcase demo which reproduces a dynamic 3D environment, including some particular effects: the alternation of day and night infuencing the lighting of the scene, the rendering of terrain, water and vegetation, the reproduction of sounds and atmospheric agents.

  5. Down-regulation of increased TRAF6 expression in the peripheral mononuclear cells of patients with primary Sjögren's syndrome by an EBV-EBER1-specific synthetic single-stranded complementary DNA molecule.

    Science.gov (United States)

    Sipka, Sándor; Zilahi, Erika; Papp, Gábor; Chen, Ji-Qing; Nagy, Andrea; Hegyi, Katalin; Kónya, József; Zeher, Margit

    2017-05-01

    We described earlier a simultaneously increased that the increased expression of miRNA-146a/b was accompanied by an increase in the expression of and TRAF6 and a decrease in the expression of IRAK1 genes in the peripheral mononuclear cells (PBMCs) of patients with primary Sjogren's syndrome (pSS) patients. Recently, the expression of EBV encoded. RNA (EBER) was published in the B cells of salivary glands of in pSS. In the present study, we applied an EBV-EBER1 specific synthetic single stranded complementary DNA molecule (EBV-EBER1-cDNA) to test whether any EBER1 related effect exists also in PBMCs of pSS patients. In the PBMCs of pSS patients and healthy controls, we investigated in vitro the effects of a synthetic single stranded EBV-EBER1-cDNA molecule, synthetic double-stranded (ds)RNA polyinosinic-polycytidylic acid [poly (I:C)] and polyadenylic acid potassium salt poly-adenylic acid [poly-(A)] on the expression of TRAF6 gene tested by qRTPCR. The release of interferon -α was detected by ELISA. EBV-EBER1-cDNA resulted in a significant reduction in the expression of TRAF6 in the cells of patients, but in the healthy controls not, whereas the treatments with poly (I:C) and poly-(A) could not reduce the TRAF6 over-expression. No release of EBER1 could be observed in the culture supernatants of patients with pSS. Only the treatment with poly (I:C) resulted in a significant increase of interferon -α release, and only in the heathy controls. No release of EBER1 molecules took place during the culturing of cells. EBV-EBER- cDNA acted functionally on the cells of patients only. These findings give a further evidence of the linkage between EBV and pSS, furthermore, they show the possible role of EBV-EBER1 in the induction of increased TRAF6 expression in the peripheral B cells of Sjögren's patients. © 2017 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  6. Sex determination in beef by melting curve analysis of PCR amplicons from the amelogenin locus.

    Science.gov (United States)

    Ballin, Nicolai Z; Madsen, Knud G

    2007-11-01

    Sex determination of beef is important to meet the rules of the Commission Regulation (EC) 765/2002 that qualify for export refunds. A SYBR Green sex identification assay based on melting curve analysis of PCR amplicons from the amelogenin locus (AMELX and AMELY) was developed. The PCR amplicons of 130/130 and 130/67 base pairs produced from female and male beef, respectively, are easily distinguished by both melting curve analysis and gel electrophoresis. Results from the melting curve analysis of amplicons are ready in less than three minutes, and requires no additional work in addition to the PCR setup. Applicability of the sex determination assay was studied by analysis of 12 unknown beef samples and the results were compared to an accredited method based on gel electrophoresis. In addition, six different cattle breeds were examined. All test results were correct in respect to sex.

  7. Silencing Status Epilepticus-Induced BDNF Expression with Herpes Simplex Virus Type-1 Based Amplicon Vectors.

    Directory of Open Access Journals (Sweden)

    Chiara Falcicchia

    Full Text Available Brain-derived neurotrophic factor (BDNF has been found to produce pro- but also anti-epileptic effects. Thus, its validity as a therapeutic target must be verified using advanced tools designed to block or to enhance its signal. The aim of this study was to develop tools to silence the BDNF signal. We generated Herpes simplex virus type 1 (HSV-1 derived amplicon vectors, i.e. viral particles containing a genome of 152 kb constituted of concatameric repetitions of an expression cassette, enabling the expression of the gene of interest in multiple copies. HSV-1 based amplicon vectors are non-pathogenic and have been successfully employed in the past for gene delivery into the brain of living animals. Therefore, amplicon vectors should represent a logical choice for expressing a silencing cassette, which, in multiple copies, is expected to lead to an efficient knock-down of the target gene expression. Here, we employed two amplicon-based BDNF silencing strategies. The first, antisense, has been chosen to target and degrade the cytoplasmic mRNA pool of BDNF, whereas the second, based on the convergent transcription technology, has been chosen to repress transcription at the BDNF gene. Both these amplicon vectors proved to be effective in down-regulating BDNF expression in vitro, in BDNF-expressing mesoangioblast cells. However, only the antisense strategy was effective in vivo, after inoculation in the hippocampus in a model of status epilepticus in which BDNF mRNA levels are strongly increased. Interestingly, the knocking down of BDNF levels induced with BDNF-antisense was sufficient to produce significant behavioral effects, in spite of the fact that it was produced only in a part of a single hippocampus. In conclusion, this study demonstrates a reliable effect of amplicon vectors in knocking down gene expression in vitro and in vivo. Therefore, this approach may find broad applications in neurobiological studies.

  8. Use of AmpliWax to optimize amplicon sterilization by isopsoralen.

    Science.gov (United States)

    De la Viuda, M; Fille, M; Ruiz, J; Aslanzadeh, J

    1996-12-01

    The photochemical inactivation of amplicons by isopsoralen (IP-10) has been suggested as a possible means to prevent PCR carryover contamination. To evaluate the technique, serial dilutions of amplicons (10(11) to 10(3)) from the Borrelia burgdorferi OSP A gene were amplified in the presence of 0, 25, 50, and 100 micrograms of IP-10 per ml for 45 cycles. The PCR products were exposed to UV light for 15 min to activate IP-10 and sterilize the amplicons. One microliter of each sterilized sample was reamplified for an additional 45 cycles. The PCR products were then resolved in an agarose gel, blotted onto a nylon membrane, and probed with an alkaline phosphatase-conjugated chemiluminescent probe. Although IP-10 at concentrations of 50 and 100 micrograms/ml effectively sterilized up to 10(11) amplicons, the compound was inhibitory to PCR. IP-10 at a concentration of 25 micrograms/ml had slight inhibitory effect on PCR and did not completely sterilized all of the amplicons. Therefore, in subsequent experiments AmpliWax was substituted for mineral oil, and PCR was performed on 10(9) to 10(3) amplicons as described above. Following the amplification, the PCR tubes were cooled to solidify the AmpliWax and inoculated with various concentrations of IP-10. With this technique, PCR products produced from as many as 10(9) target amplicons were effectively sterilized with 200 micrograms of IP-10 per ml. Similarly, the addition of IP-10 (50 micrograms/ml) before and after PCR was evaluated for the detection of B. burgdorferi in 62 ticks from a region of Southern Connecticut where the organism is highly endemic. PCR performed in the presence of 50 micrograms of IP-10 per ml detected B. burgdorferi-specific DNA in 17 of 62 ticks (27%) following gel electrophoresis and in 34 of 62 ticks (55%) following Southern blot hybridization of the PCR products. In contrast, post-PCR addition of IP-10 detected borrelia-specific DNA in 31 of 62 ticks (50%) following gel electrophoresis and in

  9. Improvements of polymerase chain reaction and capillary electrophoresis single-strand conformation polymorphism methods in microbial ecology: toward a high-throughput method for microbial diversity studies in soil.

    Science.gov (United States)

    Zinger, Lucie; Gury, Jérôme; Giraud, Frédéric; Krivobok, Serge; Gielly, Ludovic; Taberlet, Pierre; Geremia, Roberto A

    2007-08-01

    The molecular signature of bacteria from soil ecosystems is an important tool for studying microbial ecology and biogeography. However, a high-throughput technology is needed for such studies. In this article, we tested the suitability of available methods ranging from soil DNA extraction to capillary electrophoresis single-strand conformation polymorphism (CE-SSCP) for high-throughput studies. Our results showed that the extraction method does not dramatically influence CE-SSCP profiles, and that DNA extraction of a 0.25 g soil sample is sufficient to observe overall bacterial diversity in soil matrices. The V3 region of the 16S rRNA gene was amplified by PCR, and the extension time was found to be critical. We have also found that proofreading DNA polymerases generate a better signal in CE-SSCP profiles. Experiments performed with different soil matrices revealed the repeatability, efficiency, and consistency of CE-SSCP. Studies on PCR and CE-SSCP using single-species genomic DNA as a matrix showed that several ribotypes may migrate at the same position, and also that single species can produce double peaks. Thus, the extrapolation between number of peaks and number of species remains difficult. Additionally, peak detection is limited by the analysis software. We conclude that the presented method, including CE-SSCP and the analyzing step, is a simple and effective technique to obtain the molecular signature of a given soil sample.

  10. Search for genetic variants in the retinoid X receptor-gamma-gene by polymerase chain reaction-single-strand conformation polymorphism in patients with resistance to thyroid hormone without mutations in thyroid hormone receptor beta gene.

    Science.gov (United States)

    Romeo, Stefano; Menzaghi, Claudia; Bruno, Rocco; Sentinelli, Federica; Fallarino, Mara; Fioretti, Francesca; Filetti, Sebastiano; Balsamo, Armando; Di Mario, Umberto; Baroni, Marco G

    2004-05-01

    Resistance to thyroid hormone (RTH) is an inherited disease characterized by reduced tissue sensitivity to thyroid hormone. Approximately 90% of subjects with RTH have mutation in the thyroid hormone receptor beta (TRbeta) gene. Approximately 10% of subjects diagnosed as having RTH do not carry mutation in the TRbeta gene. A possible linkage was reported with the retinoid X receptor-gamma (RXR-gamma) gene in two families. The aim of this study is to search for mutation within the RXR-gamma gene in unrelated subjects with diagnosed RTH without mutations in the TRbeta gene. Four subjects with RTH were studied, and sequence variants in the RXR-gamma gene were searched by polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP). Analysis of all the 10 exons of the RXR-gamma gene, including intron-exon boundaries, promoter region and 3' untranslated region (UTR) reveled two variant bands in subjects II and III. Sequencing of these variants showed two single nucleotide polymorphisms (SNPs): 447C > T in exon 3 for patients II and IVS9 + 6A > G for patient III. Both SNPs were also present at high frequency in a group of normal subjects and in nonaffected relatives of subject III. In conclusion, in patients with RTH we have found two SNPs in the RXR-gamma gene; these SNPS are common in the general population, thus excluding a role for the RXR-gamma gene in these patients.

  11. Genetic variability within Borrelia burgdorferi sensu lato genospecies established by PCR-single-strand conformation polymorphism analysis of the rrfA-rrlB intergenic spacer in ixodes ricinus ticks from the Czech Republic.

    Science.gov (United States)

    Derdáková, Markéta; Beati, Lorenza; Pet'ko, Branislav; Stanko, Michal; Fish, Durland

    2003-01-01

    In Europe the Borrelia burgdorferi sensu lato complex is represented by five distinct genospecies: Borrelia burgdorferi sensu stricto, Borrelia afzelii, Borrelia garinii, Borrelia valaisiana, and Borrelia lusitaniae. These taxonomic entities are known to differ in their specific associations with vertebrate hosts and to provoke distinct clinical manifestations in human patients. However, exceptions to these rules have often been observed, indicating that strains belonging to a single genospecies may be more heterogeneous than expected. It is, therefore, important to develop alternative identification tools which are able to distinguish Borrelia strains not only at the specific level but also at the intraspecific level. DNA from a sample of 370 Ixodes ricinus ticks collected in the Czech Republic was analyzed by PCR for the presence of a approximately 230-bp fragment of the rrfA-rrlB intergenic spacer of Borrelia spp. A total of 20.5% of the ticks were found to be positive. The infecting genospecies were identified by analyzing the amplified products by the restriction fragment length polymorphism (RFLP) method with restriction enzyme MseI and by single-strand conformation polymorphism (SSCP) analysis. The two methods were compared, and PCR-SSCP analysis appeared to be a valuable tool for rapid identification of spirochetes at the intraspecific level, particularly when large samples are examined. Furthermore, by using PCR-SSCP analysis we identified a previously unknown Borrelia genotype, genotype I-77, which would have gone unnoticed if RFLP analysis alone had been used.

  12. Interaction of meso-tetrakis(N-methylpyridinyl)porphyrin with single strand DNAs - poly(dA), poly(dT), poly(dG) and poly(dC): A photophysical study

    Indian Academy of Sciences (India)

    Sharmistha Dutta Choudhury; Jyotirmayee Mohanty; Haridas Pal; Achikanath C Bhasikuttan

    2014-07-01

    Interaction between meso-tetrakis(N-methylpyridinyl)porphyrin (TMPyP) and single strand DNA homopolymers, (dA)40, (dT)40, (dG)40 and (dC)40, has been investigated using absorption, fluorescence and circular dichroism (CD) measurements. Fluorescence intensity of TMPyP is quenched in the presence of (dG)40 due to photo-induced electron transfer from dG to the excited TMPyP dye. Changes in the CD spectra of the polynucleotides in the presence of TMPyP are found to be quite different and depend on the nature of the nucleotide bases, whether purine or pyrimidine. Excitonic induced CD spectra is observed for TMPyP in the presence of pyrimidine homopolymers while negative induced CD is observed in the presence of purine homopolymers. Based on photophysical studies and CD spectra, we propose multiple binding modes of TMPyP with polynucleotides. TMPyP can bind to oligonucleotides both in monomer form as well as in the form of short stretches of stacked aggregates along the oligonucleotide backbone.

  13. OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

    Directory of Open Access Journals (Sweden)

    Kevin M. Bradley

    2014-08-01

    Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

  14. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  15. Ex vivo gene editing of the dystrophin gene in muscle stem cells mediated by peptide nucleic acid single stranded oligodeoxynucleotides induces stable expression of dystrophin in a mouse model for Duchenne muscular dystrophy.

    Science.gov (United States)

    Nik-Ahd, Farnoosh; Bertoni, Carmen

    2014-07-01

    Duchenne muscular dystrophy (DMD) is a fatal disease caused by mutations in the dystrophin gene, which result in the complete absence of dystrophin protein throughout the body. Gene correction strategies hold promise to treating DMD. Our laboratory has previously demonstrated the ability of peptide nucleic acid single-stranded oligodeoxynucleotides (PNA-ssODNs) to permanently correct single-point mutations at the genomic level. In this study, we show that PNA-ssODNs can target and correct muscle satellite cells (SCs), a population of stem cells capable of self-renewing and differentiating into muscle fibers. When transplanted into skeletal muscles, SCs transfected with correcting PNA-ssODNs were able to engraft and to restore dystrophin expression. The number of dystrophin-positive fibers was shown to significantly increase over time. Expression was confirmed to be the result of the activation of a subpopulation of SCs that had undergone repair as demonstrated by immunofluorescence analyses of engrafted muscles using antibodies specific to full-length dystrophin transcripts and by genomic DNA analysis of dystrophin-positive fibers. Furthermore, the increase in dystrophin expression detected over time resulted in a significant improvement in muscle morphology. The ability of transplanted cells to return into quiescence and to activate upon demand was confirmed in all engrafted muscles following injury. These results demonstrate the feasibility of using gene editing strategies to target and correct SCs and further establish the therapeutic potential of this approach to permanently restore dystrophin expression into muscle of DMD patients.

  16. Comparison of the sequence-dependent fluorescence of the cyanine dyes Cy3, Cy5, DyLight DY547 and DyLight DY647 on single-stranded DNA.

    Science.gov (United States)

    Kretschy, Nicole; Somoza, Mark M

    2014-01-01

    Cyanine dyes are commonly used for fluorescent labeling of DNA and RNA oligonucleotides in applications including qPCR, sequencing, fluorescence in situ hybridization, Förster resonance energy transfer, and labeling for microarray hybridization. Previous research has shown that the fluorescence efficiency of Cy3 and Cy5, covalently attached to the 5' end of single-stranded DNA, is strongly sequence dependent. Here, we show that DY547 and DY647, two alternative cyanine dyes that are becoming widely used for nucleic acid labeling, have a similar pattern of sequence-dependence, with adjacent purines resulting in higher intensity and adjacent cytosines resulting in lower intensity. Investigated over the range of all 1024 possible DNA 5mers, the intensities of Cy3 and Cy5 drop by ∼ 50% and ∼ 65% with respect to their maxima, respectively, whereas the intensities of DY547 and DY647 fall by ∼ 45% and ∼ 40%, respectively. The reduced magnitude of change of the fluorescence intensity of the DyLight dyes, particularly of DY647 in comparison with Cy5, suggests that these dyes are less likely to introduce sequence-dependent bias into experiments based on fluorescent labeling of nucleic acids.

  17. Comparison of the sequence-dependent fluorescence of the cyanine dyes Cy3, Cy5, DyLight DY547 and DyLight DY647 on single-stranded DNA.

    Directory of Open Access Journals (Sweden)

    Nicole Kretschy

    Full Text Available Cyanine dyes are commonly used for fluorescent labeling of DNA and RNA oligonucleotides in applications including qPCR, sequencing, fluorescence in situ hybridization, Förster resonance energy transfer, and labeling for microarray hybridization. Previous research has shown that the fluorescence efficiency of Cy3 and Cy5, covalently attached to the 5' end of single-stranded DNA, is strongly sequence dependent. Here, we show that DY547 and DY647, two alternative cyanine dyes that are becoming widely used for nucleic acid labeling, have a similar pattern of sequence-dependence, with adjacent purines resulting in higher intensity and adjacent cytosines resulting in lower intensity. Investigated over the range of all 1024 possible DNA 5mers, the intensities of Cy3 and Cy5 drop by ∼ 50% and ∼ 65% with respect to their maxima, respectively, whereas the intensities of DY547 and DY647 fall by ∼ 45% and ∼ 40%, respectively. The reduced magnitude of change of the fluorescence intensity of the DyLight dyes, particularly of DY647 in comparison with Cy5, suggests that these dyes are less likely to introduce sequence-dependent bias into experiments based on fluorescent labeling of nucleic acids.

  18. Distribution of the (/sup 3/H)-label from low doses of radioactive ochratoxin A ingested by rats, and evidence for DNA single-strand breaks caused in liver and kidneys

    Energy Technology Data Exchange (ETDEWEB)

    Kane, A.; Creppy, E.E.; Dirheimer, G.; Roth, A.; Roeschenthaler, R.

    1986-04-01

    The distribution of a single low dose of (/sup 3/H)-ochratoxin A (OTA) in different tissues of male Wistar rats, after administration by intubation, was investigated after 5 h, 24 h and 48 h. This dose corresponds to concentrations encountered in naturally contaminated feed (4 ppm). The distribution of (/sup 3/H)-label varied with the time elapsed after administration; at 5 h the highest specific label was found in the stomach contents and in decreasing order in: intestinal contents, lung, liver, kidney, heart, fat, intestine, testes, and the lowest in muscles, spleen and brain. With exception of brain, fat, stomach and lung, all tissues showed maximum levels at 24 h, after which time the label decreased steadily, whereas in fat it increased. After a 12-week feeding experiment, with doses of 288.8 ..mu..g/kg corresponding to an intake of 4 ppm in feed each 48 h, the DNA in liver and kidneys was investigated for damage. By the alkaline elution method combined with micro-spectrofluorimetric determinations of DNA, evidence for DNA single-strand breaks was obtained. These findings support reports on the carcinogenic action of OTA.

  19. Photon Differential Splatting for Rendering Caustics

    DEFF Research Database (Denmark)

    Frisvad, Jeppe Revall; Schjøth, Lars; Erleben, Kenny;

    2014-01-01

    We present a photon splatting technique which reduces noise and blur in the rendering of caustics. Blurring of illumination edges is an inherent problem in photon splatting, as each photon is unaware of its neighbours when being splatted. This means that the splat size is usually based...... on heuristics rather than knowledge of the local flux density. We use photon differentials to determine the size and shape of the splats such that we achieve adaptive anisotropic flux density estimation in photon splatting. As compared to previous work that uses photon differentials, we present the first method...... where no photons or beams or differentials need to be stored in a map. We also present improvements in the theory of photon differentials, which give more accurate results and a faster implementation. Our technique has good potential for GPU acceleration, and we limit the number of parameters requiring...

  20. Immersive volume rendering of blood vessels

    Science.gov (United States)

    Long, Gregory; Kim, Han Suk; Marsden, Alison; Bazilevs, Yuri; Schulze, Jürgen P.

    2012-03-01

    In this paper, we present a novel method of visualizing flow in blood vessels. Our approach reads unstructured tetrahedral data, resamples it, and uses slice based 3D texture volume rendering. Due to the sparse structure of blood vessels, we utilize an octree to efficiently store the resampled data by discarding empty regions of the volume. We use animation to convey time series data, wireframe surface to give structure, and utilize the StarCAVE, a 3D virtual reality environment, to add a fully immersive element to the visualization. Our tool has great value in interdisciplinary work, helping scientists collaborate with clinicians, by improving the understanding of blood flow simulations. Full immersion in the flow field allows for a more intuitive understanding of the flow phenomena, and can be a great help to medical experts for treatment planning.

  1. Constructing And Rendering Vectorised Photographic Images

    Directory of Open Access Journals (Sweden)

    P. J. Willis

    2013-06-01

    Full Text Available We address the problem of representing captured images in the continuous mathematical space more usually associated with certain forms of drawn ('vector' images. Such an image is resolution-independent so can be used as a master for varying resolution-specific formats. We briefly describe the main features of a vectorising codec for photographic images, whose significance is that drawing programs can access images and image components as first-class vector objects. This paper focuses on the problem of rendering from the isochromic contour form of a vectorised image and demonstrates a new fill algorithm which could also be used in drawing generally. The fill method is described in terms of level set diffusion equations for clarity. Finally we show that image warping is both simplified and enhanced in the vector form and that we can demonstrate real histogram equalisation with genuinely rectangular histograms straightforwardly.

  2. Resolution-independent surface rendering using programmable graphics hardware

    Science.gov (United States)

    Loop, Charles T.; Blinn, James Frederick

    2008-12-16

    Surfaces defined by a Bezier tetrahedron, and in particular quadric surfaces, are rendered on programmable graphics hardware. Pixels are rendered through triangular sides of the tetrahedra and locations on the shapes, as well as surface normals for lighting evaluations, are computed using pixel shader computations. Additionally, vertex shaders are used to aid interpolation over a small number of values as input to the pixel shaders. Through this, rendering of the surfaces is performed independently of viewing resolution, allowing for advanced level-of-detail management. By individually rendering tetrahedrally-defined surfaces which together form complex shapes, the complex shapes can be rendered in their entirety.

  3. Efficient and Effective Volume Visualization with Enhanced Isosurface Rendering

    CERN Document Server

    Yang, Fei; Tian, Jie

    2012-01-01

    Compared with full volume rendering, isosurface rendering has several well recognized advantages in efficiency and accuracy. However, standard isosurface rendering has some limitations in effectiveness. First, it uses a monotone colored approach and can only visualize the geometry features of an isosurface. The lack of the capability to illustrate the material property and the internal structures behind an isosurface has been a big limitation of this method in applications. Another limitation of isosurface rendering is the difficulty to reveal physically meaningful structures, which are hidden in one or multiple isosurfaces. As such, the application requirements of extract and recombine structures of interest can not be implemented effectively with isosurface rendering. In this work, we develop an enhanced isosurface rendering technique to improve the effectiveness while maintaining the performance efficiency of the standard isosurface rendering. First, an isosurface color enhancement method is proposed to il...

  4. Amplicon sequencing for the quantification of spoilage microbiota in complex foods including bacterial spores

    NARCIS (Netherlands)

    Boer, de P.; Caspers, M.; Sanders, J.W.; Kemperman, R.; Wijman, J.; Lommerse, G.; Roeselers, G.; Montijn, R.; Abee, T.; Kort, R.

    2015-01-01

    Background
    Spoilage of food products is frequently caused by bacterial spores and lactic acid bacteria. Identification of these organisms by classic cultivation methods is limited by their ability to form colonies on nutrient agar plates. In this study, we adapted and optimized 16S rRNA amplicon

  5. Surface density dependence of PCR amplicon hybridization on PNA/DNA probe layers

    DEFF Research Database (Denmark)

    Yao, Danfeng; Kim, Junyoung; Yu, Fang

    2005-01-01

    at an intermediate sodium concentration (approximately 100 mM). These effects were mainly ascribed to the electrostatic cross talk among the hybridized DNA molecules and the secondary structure of PCR amplicons. For the negatively charged DNA probes, the hybridization reaction was subjected additionally to the DNA...

  6. Genomic and expression array profiling of chromosome 20q amplicon in human colon cancer cells

    Directory of Open Access Journals (Sweden)

    Carter Jennifer

    2005-01-01

    Full Text Available Background: Gain of the q arm of chromosome 20 in human colorectal cancer has been associated with poorer survival time and has been reported to increase in frequency from adenomas to metastasis. The increasing frequency of chromosome 20q amplification during colorectal cancer progression and the presence of this amplification in carcinomas of other tissue origin has lead us to hypothesize that 20q11-13 harbors one or more genes which, when over expressed promote tumor invasion and metastasis. Aims: Generate genomic and expression profiles of the 20q amplicon in human cancer cell lines in order to identify genes with increased copy number and expression. Materials and Methods: Utilizing genomic sequencing clones and amplification mapping data from our lab and other previous studies, BAC/ PAC tiling paths spanning the 20q amplicon and genomic microarrays were generated. Array-CGH on the custom array with human cancer cell line DNAs was performed to generate genomic profiles of the amplicon. Expression array analysis with RNA from these cell lines using commercial oligo microarrays generated expression profiles of the amplicon. The data were then combined in order to identify genes with increased copy number and expression. Results: Over expressed genes in regions of increased copy number were identified and a list of potential novel genetic tumor markers was assembled based on biological functions of these genes Conclusions: Performing high-resolution genomic microarray profiling in conjunction with expression analysis is an effective approach to identify potential tumor markers.

  7. Amplicon sequencing for the quantification of spoilage microbiota in complex foods including bacterial spores

    NARCIS (Netherlands)

    Boer, de P.; Caspers, M.; Sanders, J.W.; Kemperman, R.; Wijman, J.; Lommerse, G.; Roeselers, G.; Montijn, R.; Abee, T.; Kort, R.

    2015-01-01

    Background
    Spoilage of food products is frequently caused by bacterial spores and lactic acid bacteria. Identification of these organisms by classic cultivation methods is limited by their ability to form colonies on nutrient agar plates. In this study, we adapted and optimized 16S rRNA amplicon

  8. High-throughput amplicon sequencing reveals distinct communities within a corroding concrete sewer system.

    Science.gov (United States)

    Cayford, Barry I; Dennis, Paul G; Keller, Jurg; Tyson, Gene W; Bond, Philip L

    2012-10-01

    Microbially induced concrete corrosion (MICC) is an important problem in sewers. Here, small-subunit (SSU) rRNA gene amplicon pyrosequencing was used to characterize MICC communities. Microbial community composition differed between wall- and ceiling-associated MICC layers. Acidithiobacillus spp. were present at low abundances, and the communities were dominated by other sulfur-oxidizing-associated lineages.

  9. Overexpressed Genes/ESTs and Characterization of Distinct Amplicons on 17823 in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Ayse E. Erson

    2001-01-01

    Full Text Available 17823 is a frequent site of gene amplification in breast cancer. Several lines of evidence suggest the presence of multiple amplicons on 17823. To characterize distinct amplicons on 17823 and localize putative oncogenes, we screened genes and expressed sequence tags (ESTs in existing physical and radiation hybrid maps for amplification and overexpression in breast cancer cell lines by semiquantitative duplex PCR, semiquantitative duplex RT-PCR, Southern blot, Northern blot analyses. We identified two distinct amplicons on 17823, one including TBX2 and another proximal region including RPS6KB1 (PS6K and MUL. In addition to these previously reported overexpressed genes, we also identified amplification and overexpression of additional uncharacterized genes and ESTs, some of which suggest potential oncogenic activity. In conclusion, we have further defined two distinct regions of gene amplification and overexpression on 17823 with identification of new potential oncogene candidates. Based on the amplification and overexpression patterns of known and as of yet unrecognized genes on 17823, it is likely that some of these genes mapping to the discrete amplicons function as oncogenes and contribute to tumor progression in breast cancer cells.

  10. Multiplex PCR, amplicon size and hybridization efficiency on the NanoChip electronic microarray

    DEFF Research Database (Denmark)

    Børsting, Claus; Sanchez, Juan J; Morling, Niels

    2004-01-01

    We tested the SNP typing protocol developed for the NanoChip electronic microarray by analyzing the four Y chromosome loci SRY1532, SRY8299, TAT, and 92R7. Amplicons of different lengths containing the same locus were purified and addressed to the NanoChip array and fluorescently labelled reporter...

  11. Direct volume rendering methods for cell structures.

    Science.gov (United States)

    Martišek, Dalibor; Martišek, Karel

    2012-01-01

    The study of the complicated architecture of cell space structures is an important problem in biology and medical research. Optical cuts of cells produced by confocal microscopes enable two-dimensional (2D) and three-dimensional (3D) reconstructions of observed cells. This paper discuses new possibilities for direct volume rendering of these data. We often encounter 16 or more bit images in confocal microscopy of cells. Most of the information contained in these images is unsubstantial for the human vision. Therefore, it is necessary to use mathematical algorithms for visualization of such images. Present software tools as OpenGL or DirectX run quickly in graphic station with special graphic cards, run very unsatisfactory on PC without these cards and outputs are usually poor for real data. These tools are black boxes for a common user and make it impossible to correct and improve them. With the method proposed, more parameters of the environment can be set, making it possible to apply 3D filters to set the output image sharpness in relation to the noise. The quality of the output is incomparable to the earlier described methods and is worth increasing the computing time. We would like to offer mathematical methods of 3D scalar data visualization describing new algorithms that run on standard PCs very well.

  12. Correlation of p53 over-expression and alteration in p53 gene detected by polymerase chain reaction-single strand conformation polymorphism in adenocarcinoma of gastric cancer patients from India

    Institute of Scientific and Technical Information of China (English)

    Sajjad Karim; Arif Ali

    2009-01-01

    AIM: To study the alterations in p53 gene among Indian gastric cancer patients and to correlate them with the various clinicopathological parameters.METHODS: A total of 103 gastric cancer patients were included in this study. The p53 alterations were studied by both immunohistochemical method as well as polymerase chain reaction (PCR)-single strand conformation polymorphism (SSCP) analysis. We only studied four (exon 5, 6, 7, and 8) of the 11 p53 exons. The alterations in p53 were also correlated with respect to various clinicopathological parameters.RESULTS: Among 103 cases, p53 over-expression and alteration were detected in 37 (35.92%) and 19 (18.44%) cases, respectively. Most of the p53 alterations were found at exon 5 (31.54%), followed by exon 6 (26.31%), exon 7 (21.04%) and exon 8 (21.04%). A significant correlation of p53 overexpression was found with p53 alteration ( P = 0.000).Concordance between p53 alteration (as detected by SSCP) and over-expression [as detected by immunohistochemistry (IHC)] was found in 75% cases.We found that IHC-positive/SSCP-negative cases accounted for 21% of cases and IHC-negative/SSCPpositive cases accounted for remaining 4% cases.CONCLUSION: Our results show that p53 gene mutations are significantly correlated with p53 protein over-expression, with 75% concordance in overexpression and alteration in the p53 gene, but 25% disconcordance also cautions against the assumption that p53 over-expression is always associated with a gene mutation. There may be other mechanisms responsible for stabilization and accumulation of p53 protein with no evidence of gene mutation that reflect an accumulation of a non-mutated protein, or a false negative SSCP result.

  13. The genetics of amphibian decline: population substructure and molecular differentiation in the Yosemite toad, Bufo canorus (Anura, Bufonidae) based on single-strand conformation polymorphism analysis (SSCP) and mitochondrial DNA sequence data

    Science.gov (United States)

    Shaffer, H. Bradley; Fellers, Gary M.; Magee, Allison; Voss, S. Randal

    2000-01-01

    We present a comprehensive survey of genetic variation across the range of the narrowly distributed endemic Yosemite toad Bufo canorus, a declining amphibian restricted to the Sierra Nevada of California. Based on 322 bp of mitochondrial cytochrome b sequence data, we found limited support for the monophyly of B. canorus and its closely related congener B. exsul to the exclusion of the widespread western toad B. boreas. However, B. exsul was always phylogenetically nested within B. canorus, suggesting that the latter may not be monophyletic. SSCP (single-strand conformation polymorphism) analysis of 372 individual B. canorus from 28 localities in Yosemite and Kings Canyon National Parks revealed no shared haplotypes among these two regions and lead us to interpret these two parks as distinct management units for B. canorus. Within Yosemite, we found significant genetic substructure both at the level of major drainages and among breeding ponds. Kings Canyon samples show a different pattern, with substantial variation among breeding sites, but no substructure among drainages. Across the range of B. canorus as well as among Yosemite ponds, we found an isolation-by-distance pattern suggestive of a stepping stone model of migration. However, in Kings Canyon we found no hint of such a pattern, suggesting that movement patterns of toads may be quite different in these nearby parklands. Our data imply that management for B. canorus should focus at the individual pond level, and effective management may necessitate reintroductions if local extirpations occur. A brief review of other pond-breeding anurans suggests that highly structured populations are often the case, and thus that our results for B. canorus may be general for other species of frogs and toads.

  14. Role of reciprocal exchange, one-ended invasion crossover and single-strand annealing on inverted and direct repeat recombination in yeast: Different requirements for the RAD1, RAD 10, and RAD52 genes

    Energy Technology Data Exchange (ETDEWEB)

    Prado, F.; Aguilera, A. [Universidad de Sevilla (Spain)

    1995-01-01

    We have constructed novel DNA substrates (one inverted and three direct repeats) based on the same 0.6-kb repeat sequence to study deletions and inversions in Saccharomyces cerevisiae. Spontaneous deletions occur six to eight times more frequently than inversions, irrespective of the distance between the repeats. This difference can be explained by the observation that deletion events can be mediated by a recombination mechanism that can initiate within the intervening sequence of the repeats. Spontaneous and double-strand break (DSB)-induced deletions occur as RAD52-dependent and RAD52-independent events. Those deletion events initiated through a DSB in the unique intervening sequence require the Rad1/Rad10 endonuclease only if the break is distantly located from the flanking DNA repeats. We propose that deletions can occur as three types of recombination events: the conservative RAD52-dependent reciprocal exchange and the nonconservative events, one-ended invasion crossover, and single-strand annealing (SSA). We suggest that one-ended invasion is RAD52 dependent, whereas SSA is RAD52 independent. Whereas deletions, like inversions, occur through reciprocal exchange, deletions can also occur through SSA or one-ended invasion. We propose that the contribution of reciprocal exchange and one-ended invasion crossover vs. SSA events to overall spontaneous deletions is a feature specific for each repeat system, determined by the initiation event and the availability of the Rad52 protein. We discuss the role of the Rad1/Rad10 endonuclease on the initial steps of one-ended invasion crossover and SSA as a function of the location of the initiation event relative to the repeats. We also show that the frequency of recombination between repeats is the same independent of their location (whether on circular plasmids, linear minichromosomes, or natural chromosomes) and have similar RAD52 dependence. 74 refs., 5 figs., 6 tabs.

  15. Single-stranded annealing induced by re-initiation of replication origins provides a novel and efficient mechanism for generating copy number expansion via non-allelic homologous recombination.

    Directory of Open Access Journals (Sweden)

    Kenneth J Finn

    Full Text Available Copy number expansions such as amplifications and duplications contribute to human phenotypic variation, promote molecular diversification during evolution, and drive the initiation and/or progression of various cancers. The mechanisms underlying these copy number changes are still incompletely understood, however. We recently demonstrated that transient, limited re-replication from a single origin in Saccharomyces cerevisiae efficiently induces segmental amplification of the re-replicated region. Structural analyses of such re-replication induced gene amplifications (RRIGA suggested that RRIGA could provide a new mechanism for generating copy number variation by non-allelic homologous recombination (NAHR. Here we elucidate this new mechanism and provide insight into why it is so efficient. We establish that sequence homology is both necessary and sufficient for repetitive elements to participate in RRIGA and show that their recombination occurs by a single-strand annealing (SSA mechanism. We also find that re-replication forks are prone to breakage, accounting for the widespread DNA damage associated with deregulation of replication proteins. These breaks appear to stimulate NAHR between re-replicated repeat sequences flanking a re-initiating replication origin. Our results support a RRIGA model where the expansion of a re-replication bubble beyond flanking homologous sequences followed by breakage at both forks in trans provides an ideal structural context for SSA-mediated NAHR to form a head-to-tail duplication. Given the remarkable efficiency of RRIGA, we suggest it may be an unappreciated contributor to copy number expansions in both disease and evolution.

  16. Domain Structure of the Redβ Single-Strand Annealing Protein: the C-terminal Domain is Required for Fine-Tuning DNA-binding Properties, Interaction with the Exonuclease Partner, and Recombination in vivo.

    Science.gov (United States)

    Smith, Christopher E; Bell, Charles E

    2016-02-13

    Redβ is a component of the Red recombination system of bacteriophage λ that promotes a single strand annealing (SSA) reaction to generate end-to-end concatemers of the phage genome for packaging. Redβ interacts with λ exonuclease (λexo), the other component of the Red system, to form a "synaptosome" complex that somehow integrates the end resection and annealing steps of the reaction. Previous work using limited proteolysis and chemical modification revealed that Redβ consists of an N-terminal DNA binding domain, residues 1-177, and a flexible C-terminal "tail", residues 178-261. Here, we quantitatively compare the binding of the full-length protein (Redβ(FL)) and the N-terminal domain (Redβ(177)) to different lengths of ssDNA substrate and annealed duplex product. We find that in general, Redβ(FL) binds more tightly to annealed duplex product than to ssDNA substrate, while Redβ(177) binds more tightly to ssDNA. In addition, the C-terminal region of Redβ corresponding to residues 182-261 was purified and found to fold into an α-helical domain that is required for the interaction with λexo to form the synaptosome complex. Deletion analysis of Redβ revealed that removal of just eleven residues from the C-terminus disrupts the interaction with λexo as well as ssDNA and dsDNA recombination in vivo. By contrast, the determinants for self-oligomerization of Redβ appear to reside solely within the N-terminal domain. The subtle but significant differences in the relative binding of Redβ(FL) and Redβ(177) to ssDNA substrate and annealed duplex product may be important for Redβ to function as a SSA protein in vivo.

  17. 用于MLPA技术的单链长探针制备方法研究%A novel procedure for the preparation of the downstream long single-strand DNA probes for multiplex ligation-dependent probe amplification

    Institute of Scientific and Technical Information of China (English)

    陈菲; 陈枝楠; 康林; 潘广; 叶奕优; 肖启明; 凌杏园

    2012-01-01

    依据多重连接依赖探针扩增技术(MLPA)的单链探针设计要求,将检测各基因位点的MPLA探针对的上游探针设计为短探针,采用化学法加以合成;将下游探针作为长探针,以不对称PCR方法制备。本文应用该技术制备了检测12个转基因玉米品系的MLPA下游探针;并用其中的2个长探针进行转基因玉米品系检测,结果表明制备探针完全符合转基因检测要求。该技术操作简单,成本低,应用价值高。%According to the design principles of single-stranded probe in MLPA,each upstream probe of the MLPA probe pairs for different loci are designed as short probes and synthesized chemically,however,the downstream probes are designed as long oligo-nucleotides probes and prepared with asymmetric PCR.In this study,With this novel procedure,12 such probes for 12 GMO corn lines were prepared,and were proved to be effective with 2 such long probes being practically used for GMO detection.This novel procedure has the characteristic of simple manipulation and low cost,thus has high value for practical use.

  18. Initiation of DNA double strand break repair: signaling and single-stranded resection dictate the choice between homologous recombination, non-homologous end-joining and alternative end-joining.

    Science.gov (United States)

    Grabarz, Anastazja; Barascu, Aurélia; Guirouilh-Barbat, Josée; Lopez, Bernard S

    2012-01-01

    A DNA double strand break (DSB) is a highly toxic lesion, which can generate genetic instability and profound genome rearrangements. However, DSBs are required to generate diversity during physiological processes such as meiosis or the establishment of the immune repertoire. Thus, the precise regulation of a complex network of processes is necessary for the maintenance of genomic stability, allowing genetic diversity but protecting against genetic instability and its consequences on oncogenesis. Two main strategies are employed for DSB repair: homologous recombination (HR) and non-homologous end-joining (NHEJ). HR is initiated by single-stranded DNA (ssDNA) resection and requires sequence homology with an intact partner, while NHEJ requires neither resection at initiation nor a homologous partner. Thus, resection is an pivotal step at DSB repair initiation, driving the choice of the DSB repair pathway employed. However, an alternative end-joining (A-EJ) pathway, which is highly mutagenic, has recently been described; A-EJ is initiated by ssDNA resection but does not require a homologous partner. The choice of the appropriate DSB repair system, for instance according the cell cycle stage, is essential for genome stability maintenance. In this context, controlling the initial events of DSB repair is thus an essential step that may be irreversible, and the wrong decision should lead to dramatic consequences. Here, we first present the main DSB repair mechanisms and then discuss the importance of the choice of the appropriate DSB repair pathway according to the cell cycle phase. In a third section, we present the early steps of DSB repair i.e., DSB signaling, chromatin remodeling, and the regulation of ssDNA resection. In the last part, we discuss the competition between the different DSB repair mechanisms. Finally, we conclude with the importance of the fine tuning of this network for genome stability maintenance and for tumor protection in fine.

  19. Down regulation of RNA binding motif, single-stranded interacting protein 3, along with up regulation of nuclear HIF1A correlates with poor prognosis in patients with gastric cancer

    Science.gov (United States)

    Zhao, Yingjie; Wang, Yuqi; Sun, Ruochuan; Yan, Qiang; Zhang, Shangxin; Lu, Mingdian; Zhang, Zhen; Lu, Daru; Li, Yongxiang

    2017-01-01

    Frequent loss of multiple regions in short arm of chromosome 3 is found in various tumors including gastric cancer (GC). RNA binding motif, single-stranded interacting protein 3 (RBMS3) is a tumor suppressor gene located in this region and mediates cancer angiogenesis. However, the role of RBMS3 in GC remains unclear. To evaluate whether RBMS3, together with HIF1A, another key regulator of angiogenesis, predicts GC prognosis, the levels of RBMS3 and HIF1A were first examined by quantitative PCR (qPCR) and western blot from 27 fresh frozen GC and paired normal gastric tissues and then tested by immunohistochemistry (IHC) from 191 GC and 46 normal controls. Moreover, uni- and multivariate analysis were employed to assess the correlations between their levels and microvessel density (MVD) and clinical prognosis. To further identify RBMS3 function in vitro, cell proliferation assay, clonogenic assay, flow cytometry analysis and endothelial cell tube formation assay were employed. We found that RBMS3 level was decreased, whereas HIF1A was elevated in GC. Furthermore, we demonstrated that RBMS3 was an independent prognostic factor and the levels of RBMS3 and HIF1A were associated with GC angiogenesis and histopathological differentiation: patients with lower RBMS3 level and higher nuclear HIF1A expression had poorer prognosis. Besides, gain- and loss-of-function study revealed RBMS3 regulation on G1/S progression, cell proliferation and the tube formation of human umbilical vein endothelial cells (HUVECs) in vitro. These findings implicated that RBMS3 and nuclear HIF1A could act as prognostic biomarkers and therapeutic targets for GC. PMID:27902480

  20. Yellow mosaic symptom caused by the nuclear shuttle protein gene of mungbean yellow mosaic virus is associated with single-stranded DNA accumulation and mesophyll spread of the virus.

    Science.gov (United States)

    Kuruba, B L; Buvani, A P; Veluthambi, K

    Mungbean yellow mosaic virus-[India:Vigna] (MYMV-[IN:Vig]), a blackgram isolate of MYMV, causes yellow mosaic disease in blackgram and mungbean. Two variable DNA-B components, KA22 and KA27, cause distinct symptoms in blackgram [V. mungo (L.) Hepper] with the same DNA-A component. KA22 + DNA-A-agroinoculated blackgram plants displayed yellow mosaic symptom and accumulated high levels of viral single-stranded (ss) DNA. KA27 + DNA-A-agroinoculated blackgram plants displayed severe stunting symptom and accumulated very low levels of viral ssDNA. However, in mungbean [V. radiata (L.) Wilczek], KA27 + DNA-A caused yellow mosaic symptom and a high level of viral ssDNA accumulated. Swapping of KA27 DNA-B with the nuclear shuttle protein gene (NSP) of KA22 DNA-B (KA27xKA22 NSP) caused yellow mosaic symptom in blackgram, suggesting that KA22 NSP is the determinant of yellow mosaic symptom. Interestingly, KA27xKA22 NSP-infected blackgram plants accumulated high levels of viral ssDNA, comparable to that of KA22 DNA-B infection, suggesting that the KA22 NSP is responsible for accumulation of high levels of viral ssDNA. MYMV distribution was studied in blackgram and mungbean plants by leaf tissue hybridization, which showed mesophyll spread of the virus in KA22-infected blackgram leaflets and in KA27-infected mungbean leaflets, both of which displayed yellow mosaic symptom. However, the virus did not accumulate in the mesophyll in the case of KA27-infected blackgram leaflets. Interestingly, the swapped KA27xKA22 NSP-infected blackgram leaflets showed mesophyll accumulation of the virus, suggesting that KA22 NSP determines its mesophyll spread.

  1. Single-stranded annealing induced by re-initiation of replication origins provides a novel and efficient mechanism for generating copy number expansion via non-allelic homologous recombination.

    Directory of Open Access Journals (Sweden)

    Kenneth J Finn

    Full Text Available Copy number expansions such as amplifications and duplications contribute to human phenotypic variation, promote molecular diversification during evolution, and drive the initiation and/or progression of various cancers. The mechanisms underlying these copy number changes are still incompletely understood, however. We recently demonstrated that transient, limited re-replication from a single origin in Saccharomyces cerevisiae efficiently induces segmental amplification of the re-replicated region. Structural analyses of such re-replication induced gene amplifications (RRIGA suggested that RRIGA could provide a new mechanism for generating copy number variation by non-allelic homologous recombination (NAHR. Here we elucidate this new mechanism and provide insight into why it is so efficient. We establish that sequence homology is both necessary and sufficient for repetitive elements to participate in RRIGA and show that their recombination occurs by a single-strand annealing (SSA mechanism. We also find that re-replication forks are prone to breakage, accounting for the widespread DNA damage associated with deregulation of replication proteins. These breaks appear to stimulate NAHR between re-replicated repeat sequences flanking a re-initiating replication origin. Our results support a RRIGA model where the expansion of a re-replication bubble beyond flanking homologous sequences followed by breakage at both forks in trans provides an ideal structural context for SSA-mediated NAHR to form a head-to-tail duplication. Given the remarkable efficiency of RRIGA, we suggest it may be an unappreciated contributor to copy number expansions in both disease and evolution.

  2. Models for the Binary Complex of Bacteriophage T4 Gp59 Helicase Loading Protein. GP32 Single-Stranded DNA-Binding Protein and Ternary Complex with Pseudo-Y Junction DNA

    Energy Technology Data Exchange (ETDEWEB)

    Hinerman, Jennifer M. [Univ. of Toledo, OH (United States); Dignam, J. David [Univ. of Toledo, OH (United States); Mueser, Timothy C. [Univ. of Toledo, OH (United States)

    2012-04-05

    The bacteriophage T4 gp59 helicase assembly protein (gp59) is required for loading of gp41 replicative helicase onto DNA protected by gp32 single-stranded DNA-binding protein. The gp59 protein recognizes branched DNA structures found at replication and recombination sites. Binding of gp32 protein (full-length and deletion constructs) to gp59 protein measured by isothermal titration calorimetry demonstrates that the gp32 protein C-terminal A-domain is essential for protein-protein interaction in the absence of DNA. Sedimentation velocity experiments with gp59 protein and gp32ΔB protein (an N-terminal B-domain deletion) show that these proteins are monomers but form a 1:1 complex with a dissociation constant comparable with that determined by isothermal titration calorimetry. Small angle x-ray scattering (SAXS) studies indicate that the gp59 protein is a prolate monomer, consistent with the crystal structure and hydrodynamic properties determined from sedimentation velocity experiments. SAXS experiments also demonstrate that gp32ΔB protein is a prolate monomer with an elongated A-domain protruding from the core. Moreover, fitting structures of gp59 protein and the gp32 core into the SAXS-derived molecular envelope supports a model for the gp59 protein-gp32ΔB protein complex. Our earlier work demonstrated that gp59 protein attracts full-length gp32 protein to pseudo-Y junctions. A model of the gp59 protein-DNA complex, modified to accommodate new SAXS data for the binary complex together with mutational analysis of gp59 protein, is presented in the accompanying article (Dolezal, D., Jones, C. E., Lai, X., Brister, J. R., Mueser, T. C., Nossal, N. G., and Hinton, D. M. (2012) J. Biol. Chem. 287, 18596–18607).

  3. Assessment of T-cell clonality via T-cell receptor-gamma rearrangements in cutaneous T-cell-dominant infiltrates using polymerase chain reaction and single-stranded DNA conformational polymorphism assay.

    Science.gov (United States)

    Chen, Michael; Deng, April; Crowson, A Neil; Srinivasan, Mythily; Yearsley, Kurtis H; Jewell, Scott; Morrison, Carl; Long, Susan; Werling, Robert; Magro, Cynthia

    2004-12-01

    Discerning the pathologic significance of cutaneous T-cell infiltrates can pose a diagnostic challenge for dermatopathologists. Reactive conditions such as drug-associated lymphomatoid hypersensitivity and lymphomatoid lupus erythematosus can demonstrate lymphoid atypia and a phenotype resembling cutaneous T-cell lymphoma (CTCL). Further, lymphoid dyscrasias such as pityriasis lichenoides chronica, large plaque parapsoriasis, and atypical pigmentary purpura confuse the picture because they not only mimic CTCL but also represent prelymphomatous states with inherent malignant potential. Although the emergence of a dominant clone has been considered a clue indicative of a T-cell dyscrasia, there are reports concerning the identification of monoclonality in biopsies of reactive lymphoid infiltrates. We have conducted a modified single-stranded DNA conformational polymorphism (SSCP) assay using paraffin-embedded, formalin-fixed tissue on 92 T-cell-rich biopsies to determine the relative specificity and sensitivity of this methodology. In addition, laser capture microdissection (LCM) was performed on 22 of the 92 samples to isolate the area of interest and to compare its specificity and sensitivity with those SSCP assays performed without LCM. We found that monoclonality or oligoclonality is 86% specific for preneoplastic and neoplastic states, whereas the finding of polyclonality appears to be relatively specific for a reactive process. Some cases of reversible T-cell dyscrasia produced a molecular profile mimicking lymphoma or prelymphomatous states by virtue of monoclonality or oligoclonality. Although LCM appears to improve the sensitivity for detecting preneoplastic conditions, the relative specificity appears to be the same as that encountered with routine SSCP.

  4. Interaction of Ddc1 and RPA with single-stranded/double-stranded DNA junctions in yeast whole cell extracts: Proteolytic degradation of the large subunit of replication protein A in ddc1Δ strains.

    Science.gov (United States)

    Sukhanova, Maria V; D'Herin, Claudine; Boiteux, Serge; Lavrik, Olga I

    2014-10-01

    To characterize proteins that interact with single-stranded/double-stranded (ss/ds) DNA junctions in whole cell free extracts of Saccharomyces cerevisiae, we used [(32)P]-labeled photoreactive partial DNA duplexes containing a 3'-ss/ds-junction (3'-junction) or a 5'-ss/ds-junction (5'-junction). Identification of labeled proteins was achieved by MALDI-TOF mass spectrometry peptide mass fingerprinting and genetic analysis. In wild-type extract, one of the components of the Ddc1-Rad17-Mec3 complex, Ddc1, was found to be preferentially photocrosslinked at a 3'-junction. On the other hand, RPAp70, the large subunit of the replication protein A (RPA), was the predominant crosslinking product at a 5'-junction. Interestingly, ddc1Δ extracts did not display photocrosslinking of RPAp70 at a 5'-junction. The results show that RPAp70 crosslinked to DNA with a 5'-junction is subject to limited proteolysis in ddc1Δ extracts, whereas it is stable in WT, rad17Δ, mec3Δ and mec1Δ extracts. The degradation of the RPAp70-DNA adduct in ddc1Δ extract is strongly reduced in the presence of the proteasome inhibitor MG 132. We also addressed the question of the stability of free RPA, using anti-RPA antibodies. The results show that RPAp70 is also subject to proteolysis without photocrosslinking to DNA upon incubation in ddc1Δ extract. The data point to a novel property of Ddc1, modulating the turnover of DNA binding proteins such as RPAp70 by the proteasome.

  5. The hypothetical protein 'All4779', and not the annotated 'Alr0088' and 'Alr7579' proteins, is the major typical single-stranded DNA binding protein of the cyanobacterium, Anabaena sp. PCC7120.

    Science.gov (United States)

    Kirti, Anurag; Rajaram, Hema; Apte, Shree Kumar

    2014-01-01

    Single-stranded DNA binding (SSB) proteins are essential for all DNA-dependent cellular processes. Typical SSB proteins have an N-terminal Oligonucleotide-Binding (OB) fold, a Proline/Glycine rich region, followed by a C-terminal acidic tail. In the genome of the heterocystous nitrogen-fixing cyanobacterium, Anabaena sp. strain PCC7120, alr0088 and alr7579 are annotated as coding for SSB, but are truncated and have only the OB-fold. In silico analysis of whole genome of Anabaena sp. strain PCC7120 revealed the presence of another ORF 'all4779', annotated as a hypothetical protein, but having an N-terminal OB-fold, a P/G-rich region and a C-terminal acidic tail. Biochemical characterisation of all three purified recombinant proteins revealed that they exist either as monomer or dimer and bind ssDNA, but differently. The All4779 bound ssDNA in two binding modes i.e. (All4779)35 and (All4779)66 depending on salt concentration and with a binding affinity similar to that of Escherichia coli SSB. On the other hand, Alr0088 bound in a single binding mode of 50-mer and Alr7579 only to large stretches of ssDNA, suggesting that All4779, in all likelihood, is the major typical bacterial SSB in Anabaena. Overexpression of All4779 in Anabaena sp. strain PCC7120 led to enhancement of tolerance to DNA-damaging stresses, such as γ-rays, UV-irradiation, desiccation and mitomycinC exposure. The tolerance appears to be a consequence of reduced DNA damage or efficient DNA repair due to increased availability of All4779. The ORF all4779 is proposed to be re-annotated as Anabaena ssb gene.

  6. The hypothetical protein 'All4779', and not the annotated 'Alr0088' and 'Alr7579' proteins, is the major typical single-stranded DNA binding protein of the cyanobacterium, Anabaena sp. PCC7120.

    Directory of Open Access Journals (Sweden)

    Anurag Kirti

    Full Text Available Single-stranded DNA binding (SSB proteins are essential for all DNA-dependent cellular processes. Typical SSB proteins have an N-terminal Oligonucleotide-Binding (OB fold, a Proline/Glycine rich region, followed by a C-terminal acidic tail. In the genome of the heterocystous nitrogen-fixing cyanobacterium, Anabaena sp. strain PCC7120, alr0088 and alr7579 are annotated as coding for SSB, but are truncated and have only the OB-fold. In silico analysis of whole genome of Anabaena sp. strain PCC7120 revealed the presence of another ORF 'all4779', annotated as a hypothetical protein, but having an N-terminal OB-fold, a P/G-rich region and a C-terminal acidic tail. Biochemical characterisation of all three purified recombinant proteins revealed that they exist either as monomer or dimer and bind ssDNA, but differently. The All4779 bound ssDNA in two binding modes i.e. (All477935 and (All477966 depending on salt concentration and with a binding affinity similar to that of Escherichia coli SSB. On the other hand, Alr0088 bound in a single binding mode of 50-mer and Alr7579 only to large stretches of ssDNA, suggesting that All4779, in all likelihood, is the major typical bacterial SSB in Anabaena. Overexpression of All4779 in Anabaena sp. strain PCC7120 led to enhancement of tolerance to DNA-damaging stresses, such as γ-rays, UV-irradiation, desiccation and mitomycinC exposure. The tolerance appears to be a consequence of reduced DNA damage or efficient DNA repair due to increased availability of All4779. The ORF all4779 is proposed to be re-annotated as Anabaena ssb gene.

  7. HDlive rendering images of the fetal stomach: a preliminary report.

    Science.gov (United States)

    Inubashiri, Eisuke; Abe, Kiyotaka; Watanabe, Yukio; Akutagawa, Noriyuki; Kuroki, Katumaru; Sugawara, Masaki; Maeda, Nobuhiko; Minami, Kunihiro; Nomura, Yasuhiro

    2015-01-01

    This study aimed to show reconstruction of the fetal stomach using the HDlive rendering mode in ultrasound. Seventeen healthy singleton fetuses at 18-34 weeks' gestational age were observed using the HDlive rendering mode of ultrasound in utero. In all of the fetuses, we identified specific spatial structures, including macroscopic anatomical features (e.g., the pyrous, cardia, fundus, and great curvature) of the fetal stomach, using the HDlive rendering mode. In particular, HDlive rendering images showed remarkably fine details that appeared as if they were being viewed under an endoscope, with visible rugal folds after 27 weeks' gestational age. Our study suggests that the HDlive rendering mode can be used as an additional method for evaluating the fetal stomach. The HDlive rendering mode shows detailed 3D structural images and anatomically realistic images of the fetal stomach. This technique may be effective in prenatal diagnosis for examining detailed information of fetal organs.

  8. Fast combinative volume rendering by indexed data structure

    Institute of Scientific and Technical Information of China (English)

    孙文武; 王文成; 吴恩华

    2001-01-01

    It is beneficial to study the interesting contents in a data set by combining and rendering variouscontents of the data. In this regard, an indexed data structure is proposed to facilitate the reorganization of data so that the contents of the data can be combined conveniently and only the selected contents in the data are processed for rendering. Based on the structure, the cells of different contents can be queued up easily so that the volume rendering can be conducted more accurately and quickly. Experimental results show that the indexed data structure is very efficient in improving combinative volume rendering.

  9. One-way sequencing of multiple amplicons from tandem repetitive mitochondrial DNA control region.

    Science.gov (United States)

    Xu, Jiawu; Fonseca, Dina M

    2011-10-01

    Repetitive DNA sequences not only exist abundantly in eukaryotic nuclear genomes, but also occur as tandem repeats in many animal mitochondrial DNA (mtDNA) control regions. Due to concerted evolution, these repetitive sequences are highly similar or even identical within a genome. When long repetitive regions are the targets of amplification for the purpose of sequencing, multiple amplicons may result if one primer has to be located inside the repeats. Here, we show that, without separating these amplicons by gel purification or cloning, directly sequencing the mitochondrial repeats with the primer outside repetitive region is feasible and efficient. We exemplify it by sequencing the mtDNA control region of the mosquito Aedes albopictus, which harbors typical large tandem DNA repeats. This one-way sequencing strategy is optimal for population surveys.

  10. Nitrogenase gene amplicons from global marine surface waters are dominated by genes of non-cyanobacteria

    DEFF Research Database (Denmark)

    Farnelid, Hanna; Andersson, Anders F.; Bertilsson, Stefan

    2011-01-01

    analysis of 79,090 nitrogenase (nifH) PCR amplicons encoding 7,468 unique proteins from surface samples (ten DNA samples and two RNA samples) collected at ten marine locations world-wide provides the first in-depth survey of a functional bacterial gene and yield insights into the composition and diversity...... of the nifH gene pool in marine waters. Great divergence in nifH composition was observed between sites. Cyanobacteria-like genes were most frequent among amplicons from the warmest waters, but overall the data set was dominated by nifH sequences most closely related to non-cyanobacteria. Clusters related...... to Alpha-, Beta-, Gamma-, and Delta-Proteobacteria were most common and showed distinct geographic distributions. Sequences related to anaerobic bacteria (nifH Cluster III) were generally rare, but preponderant in cold waters, especially in the Arctic. Although the two transcript samples were dominated...

  11. Characterization of FGFR1 Locus in sqNSCLC Reveals a Broad and Heterogeneous Amplicon.

    Directory of Open Access Journals (Sweden)

    Claire Rooney

    Full Text Available FGFR1 amplification occurs in ~20% of sqNSCLC and trials with FGFR inhibitors have selected FGFR1 amplified patients by FISH. Lung cancer cell lines were profiled for sensitivity to AZD4547, a potent, selective inhibitor of FGFRs 1-3. Sensitivity to FGFR inhibition was associated with but not wholly predicted by increased FGFR1 gene copy number. Additional biomarker assays evaluating expression of FGFRs and correlation between amplification and expression in clinical tissues are therefore warranted. We validated nanoString for mRNA expression analysis of 194 genes, including FGFRs, from clinical tumour tissue. In a panel of sqNSCLC tumours 14.4% (13/90 were FGFR1 amplified by FISH. Although mean FGFR1 expression was significantly higher in amplified samples, there was significant overlap in the range of expression levels between the amplified and non-amplified cohorts with several non-amplified samples expressing FGFR1 to levels equivalent to amplified samples. Statistical analysis revealed increased expression of FGFR1 neighboring genes on the 8p12 amplicon (BAG4, LSM1 and WHSC1L1 in FGFR1 amplified tumours, suggesting a broad rather than focal amplicon and raises the potential for codependencies. High resolution aCGH analysis of pre-clinical and clinical samples supported the presence of a broad and heterogeneous amplicon around the FGFR1 locus. In conclusion, the range of FGFR1 expression levels in both FGFR1 amplified and non-amplified NSCLC tissues, together with the breadth and intra-patient heterogeneity of the 8p amplicon highlights the need for gene expression analysis of clinical samples to inform the understanding of determinants of response to FGFR inhibitors. In this respect the nanoString platform provides an attractive option for RNA analysis of FFPE clinical samples.

  12. Targeted Amplicon Sequencing (TAS): A Scalable Next-Gen Approach to Multilocus, Multitaxa Phylogenetics

    OpenAIRE

    2011-01-01

    Next-gen sequencing technologies have revolutionized data collection in genetic studies and advanced genome biology to novel frontiers. However, to date, next-gen technologies have been used principally for whole genome sequencing and transcriptome sequencing. Yet many questions in population genetics and systematics rely on sequencing specific genes of known function or diversity levels. Here, we describe a targeted amplicon sequencing (TAS) approach capitalizing on next-gen capacity to sequ...

  13. Potential of pmoA amplicon pyrosequencing for methanotroph diversity studies.

    Science.gov (United States)

    Lüke, Claudia; Frenzel, Peter

    2011-09-01

    We analyzed the potential of pmoA amplicon pyrosequencing compared to that of Sanger sequencing with paddy soils as a model environment. We defined operational taxonomic unit (OTU) cutoff values of 7% and 18%, reflecting methanotrophic species and major phylogenetic pmoA lineages, respectively. Major lineages were already well covered by clone libraries; nevertheless, pyrosequencing provided a higher level of diversity at the species level.

  14. Fast, accurate and easy-to-pipeline methods for amplicon sequence processing

    Science.gov (United States)

    Antonielli, Livio; Sessitsch, Angela

    2016-04-01

    Next generation sequencing (NGS) technologies established since years as an essential resource in microbiology. While on the one hand metagenomic studies can benefit from the continuously increasing throughput of the Illumina (Solexa) technology, on the other hand the spreading of third generation sequencing technologies (PacBio, Oxford Nanopore) are getting whole genome sequencing beyond the assembly of fragmented draft genomes, making it now possible to finish bacterial genomes even without short read correction. Besides (meta)genomic analysis next-gen amplicon sequencing is still fundamental for microbial studies. Amplicon sequencing of the 16S rRNA gene and ITS (Internal Transcribed Spacer) remains a well-established widespread method for a multitude of different purposes concerning the identification and comparison of archaeal/bacterial (16S rRNA gene) and fungal (ITS) communities occurring in diverse environments. Numerous different pipelines have been developed in order to process NGS-derived amplicon sequences, among which Mothur, QIIME and USEARCH are the most well-known and cited ones. The entire process from initial raw sequence data through read error correction, paired-end read assembly, primer stripping, quality filtering, clustering, OTU taxonomic classification and BIOM table rarefaction as well as alternative "normalization" methods will be addressed. An effective and accurate strategy will be presented using the state-of-the-art bioinformatic tools and the example of a straightforward one-script pipeline for 16S rRNA gene or ITS MiSeq amplicon sequencing will be provided. Finally, instructions on how to automatically retrieve nucleotide sequences from NCBI and therefore apply the pipeline to targets other than 16S rRNA gene (Greengenes, SILVA) and ITS (UNITE) will be discussed.

  15. Evaluating sequence-derived mtDNA length heteroplasmy by amplicon size analysis

    Science.gov (United States)

    Berger, C.; Hatzer-Grubwieser, P.; Hohoff, C.; Parson, W.

    2011-01-01

    Length heteroplasmy (LH) in mitochondrial (mt)DNA is usually observed in homopolymeric tracts and manifest as mixture of various length variants. The generally used difference-coded annotation to report mtDNA haplotypes does not express the degree of LH variation present in a sample, even more so, it is sometimes difficult to establish which length variants are present and clearly distinguishable from background noise. It has therefore become routine practice for some researchers to call the dominant type, the “major molecule”, which represents the LH variant that is most abundant in a DNA extract. In the majority of cases a clear single dominant variant can be identified. However, in some samples this interpretation is difficult, i.e. when (almost) equally quantitative LH variants are present or when multiple sequencing primers result in the presentation of different dominant types. To better understand those cases we designed amplicon sizing assays for the five most relevant LH regions in the mtDNA control region (around ntps 16,189, 310, 460, 573, and the AC-repeat between 514 and 524) to determine the ratio of the LH variants by fluorescence based amplicon sizing assays. For difficult LH constellations derived by Sanger sequencing (with Big Dye terminators) these assays mostly gave clear and unambiguous results. In the vast majority of cases we found agreement between the results of the sequence and amplicon analyses and propose this alternative method in difficult cases. PMID:21067985

  16. Realistic Real-Time Outdoor Rendering in Augmented Reality

    Science.gov (United States)

    Kolivand, Hoshang; Sunar, Mohd Shahrizal

    2014-01-01

    Realistic rendering techniques of outdoor Augmented Reality (AR) has been an attractive topic since the last two decades considering the sizeable amount of publications in computer graphics. Realistic virtual objects in outdoor rendering AR systems require sophisticated effects such as: shadows, daylight and interactions between sky colours and virtual as well as real objects. A few realistic rendering techniques have been designed to overcome this obstacle, most of which are related to non real-time rendering. However, the problem still remains, especially in outdoor rendering. This paper proposed a much newer, unique technique to achieve realistic real-time outdoor rendering, while taking into account the interaction between sky colours and objects in AR systems with respect to shadows in any specific location, date and time. This approach involves three main phases, which cover different outdoor AR rendering requirements. Firstly, sky colour was generated with respect to the position of the sun. Second step involves the shadow generation algorithm, Z-Partitioning: Gaussian and Fog Shadow Maps (Z-GaF Shadow Maps). Lastly, a technique to integrate sky colours and shadows through its effects on virtual objects in the AR system, is introduced. The experimental results reveal that the proposed technique has significantly improved the realism of real-time outdoor AR rendering, thus solving the problem of realistic AR systems. PMID:25268480

  17. Realistic real-time outdoor rendering in augmented reality.

    Science.gov (United States)

    Kolivand, Hoshang; Sunar, Mohd Shahrizal

    2014-01-01

    Realistic rendering techniques of outdoor Augmented Reality (AR) has been an attractive topic since the last two decades considering the sizeable amount of publications in computer graphics. Realistic virtual objects in outdoor rendering AR systems require sophisticated effects such as: shadows, daylight and interactions between sky colours and virtual as well as real objects. A few realistic rendering techniques have been designed to overcome this obstacle, most of which are related to non real-time rendering. However, the problem still remains, especially in outdoor rendering. This paper proposed a much newer, unique technique to achieve realistic real-time outdoor rendering, while taking into account the interaction between sky colours and objects in AR systems with respect to shadows in any specific location, date and time. This approach involves three main phases, which cover different outdoor AR rendering requirements. Firstly, sky colour was generated with respect to the position of the sun. Second step involves the shadow generation algorithm, Z-Partitioning: Gaussian and Fog Shadow Maps (Z-GaF Shadow Maps). Lastly, a technique to integrate sky colours and shadows through its effects on virtual objects in the AR system, is introduced. The experimental results reveal that the proposed technique has significantly improved the realism of real-time outdoor AR rendering, thus solving the problem of realistic AR systems.

  18. Method of producing hydrogen, and rendering a contaminated biomass inert

    Science.gov (United States)

    Bingham, Dennis N [Idaho Falls, ID; Klingler, Kerry M [Idaho Falls, ID; Wilding, Bruce M [Idaho Falls, ID

    2010-02-23

    A method for rendering a contaminated biomass inert includes providing a first composition, providing a second composition, reacting the first and second compositions together to form an alkaline hydroxide, providing a contaminated biomass feedstock and reacting the alkaline hydroxide with the contaminated biomass feedstock to render the contaminated biomass feedstock inert and further producing hydrogen gas, and a byproduct that includes the first composition.

  19. Realistic real-time outdoor rendering in augmented reality.

    Directory of Open Access Journals (Sweden)

    Hoshang Kolivand

    Full Text Available Realistic rendering techniques of outdoor Augmented Reality (AR has been an attractive topic since the last two decades considering the sizeable amount of publications in computer graphics. Realistic virtual objects in outdoor rendering AR systems require sophisticated effects such as: shadows, daylight and interactions between sky colours and virtual as well as real objects. A few realistic rendering techniques have been designed to overcome this obstacle, most of which are related to non real-time rendering. However, the problem still remains, especially in outdoor rendering. This paper proposed a much newer, unique technique to achieve realistic real-time outdoor rendering, while taking into account the interaction between sky colours and objects in AR systems with respect to shadows in any specific location, date and time. This approach involves three main phases, which cover different outdoor AR rendering requirements. Firstly, sky colour was generated with respect to the position of the sun. Second step involves the shadow generation algorithm, Z-Partitioning: Gaussian and Fog Shadow Maps (Z-GaF Shadow Maps. Lastly, a technique to integrate sky colours and shadows through its effects on virtual objects in the AR system, is introduced. The experimental results reveal that the proposed technique has significantly improved the realism of real-time outdoor AR rendering, thus solving the problem of realistic AR systems.

  20. 7 CFR 54.15 - Advance information concerning service rendered.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Advance information concerning service rendered. 54.15... Service § 54.15 Advance information concerning service rendered. Upon request of any applicant, all or any... SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED)...

  1. Local and Global Illumination in the Volume Rendering Integral

    Energy Technology Data Exchange (ETDEWEB)

    Max, N; Chen, M

    2005-10-21

    This article is intended as an update of the major survey by Max [1] on optical models for direct volume rendering. It provides a brief overview of the subject scope covered by [1], and brings recent developments, such as new shadow algorithms and refraction rendering, into the perspective. In particular, we examine three fundamentals aspects of direct volume rendering, namely the volume rendering integral, local illumination models and global illumination models, in a wavelength-independent manner. We review the developments on spectral volume rendering, in which visible light are considered as a form of electromagnetic radiation, optical models are implemented in conjunction with representations of spectral power distribution. This survey can provide a basis for, and encourage, new efforts for developing and using complex illumination models to achieve better realism and perception through optical correctness.

  2. Research of global illumination algorithms rendering in glossy scene

    Institute of Scientific and Technical Information of China (English)

    BAI Shuangxue; ZHANG Qiang; ZHOU Dongsheng

    2012-01-01

    In computer graphic (CG), illumination rendering generated realistic effect at virtual scene is amazing. Not only plausible lighting effect is to show the relative position between of the objects, but also to reflect the material of visual appearance of the vir- tual objects. The diffuse-scene rendering reflectance credibility has gradually matured. Global illumination rendering method for the glossy material is still a challenge for the CG research. Because of the shiny materials is highly energy reflection between the com- plex light paths. Whether we trace glossy reflection paths, or use of one-reflection or multi-reflection approximate above complex il- lumination transmission is a difficult working. This paper we gather some commonly used global illumination algorithms recently year and its extension glossy scene improvements. And we introduce the limitation of classical algorithms rendering glossy scene and some extended solution. Finally, we will summarize the illumination rendering for specular scene, there are still some open prob- lems.

  3. Perception-based transparency optimization for direct volume rendering.

    Science.gov (United States)

    Chan, Ming-Yuen; Wu, Yingcai; Mak, Wai-Ho; Chen, Wei; Qu, Huamin

    2009-01-01

    The semi-transparent nature of direct volume rendered images is useful to depict layered structures in a volume. However, obtaining a semi-transparent result with the layers clearly revealed is difficult and may involve tedious adjustment on opacity and other rendering parameters. Furthermore, the visual quality of layers also depends on various perceptual factors. In this paper, we propose an auto-correction method for enhancing the perceived quality of the semi-transparent layers in direct volume rendered images. We introduce a suite of new measures based on psychological principles to evaluate the perceptual quality of transparent structures in the rendered images. By optimizing rendering parameters within an adaptive and intuitive user interaction process, the quality of the images is enhanced such that specific user requirements can be met. Experimental results on various datasets demonstrate the effectiveness and robustness of our method.

  4. A Volume Rendering Algorithm for Sequential 2D Medical Images

    Institute of Scientific and Technical Information of China (English)

    吕忆松; 陈亚珠

    2002-01-01

    Volume rendering of 3D data sets composed of sequential 2D medical images has become an important branch in image processing and computer graphics.To help physicians fully understand deep-seated human organs and focuses(e.g.a tumour)as 3D structures.in this paper,we present a modified volume rendering algorithm to render volumetric data,Using this method.the projection images of structures of interest from different viewing directions can be obtained satisfactorily.By rotating the light source and the observer eyepoint,this method avoids rotates the whole volumetric data in main memory and thus reduces computational complexity and rendering time.Experiments on CT images suggest that the proposed method is useful and efficient for rendering 3D data sets.

  5. Mining environmental high-throughput sequence data sets to identify divergent amplicon clusters for phylogenetic reconstruction and morphotype visualization.

    Science.gov (United States)

    Gimmler, Anna; Stoeck, Thorsten

    2015-08-01

    Environmental high-throughput sequencing (envHTS) is a very powerful tool, which in protistan ecology is predominantly used for the exploration of diversity and its geographic and local patterns. We here used a pyrosequenced V4-SSU rDNA data set from a solar saltern pond as test case to exploit such massive protistan amplicon data sets beyond this descriptive purpose. Therefore, we combined a Swarm-based blastn network including 11 579 ciliate V4 amplicons to identify divergent amplicon clusters with targeted polymerase chain reaction (PCR) primer design for full-length small subunit of the ribosomal DNA retrieval and probe design for fluorescence in situ hybridization (FISH). This powerful strategy allows to benefit from envHTS data sets to (i) reveal the phylogenetic position of the taxon behind divergent amplicons; (ii) improve phylogenetic resolution and evolutionary history of specific taxon groups; (iii) solidly assess an amplicons (species') degree of similarity to its closest described relative; (iv) visualize the morphotype behind a divergent amplicons cluster; (v) rapidly FISH screen many environmental samples for geographic/habitat distribution and abundances of the respective organism and (vi) to monitor the success of enrichment strategies in live samples for cultivation and isolation of the respective organisms.

  6. Using Amplicon Sequencing To Characterize and Monitor Bacterial Diversity in Drinking Water Distribution Systems

    Science.gov (United States)

    Shaw, Jennifer L. A.; Weyrich, Laura S.; Sawade, Emma; Drikas, Mary; Cooper, Alan J.

    2015-01-01

    Drinking water assessments use a variety of microbial, physical, and chemical indicators to evaluate water treatment efficiency and product water quality. However, these indicators do not allow the complex biological communities, which can adversely impact the performance of drinking water distribution systems (DWDSs), to be characterized. Entire bacterial communities can be studied quickly and inexpensively using targeted metagenomic amplicon sequencing. Here, amplicon sequencing of the 16S rRNA gene region was performed alongside traditional water quality measures to assess the health, quality, and efficiency of two distinct, full-scale DWDSs: (i) a linear DWDS supplied with unfiltered water subjected to basic disinfection before distribution and (ii) a complex, branching DWDS treated by a four-stage water treatment plant (WTP) prior to disinfection and distribution. In both DWDSs bacterial communities differed significantly after disinfection, demonstrating the effectiveness of both treatment regimes. However, bacterial repopulation occurred further along in the DWDSs, and some end-user samples were more similar to the source water than to the postdisinfection water. Three sample locations appeared to be nitrified, displaying elevated nitrate levels and decreased ammonia levels, and nitrifying bacterial species, such as Nitrospira, were detected. Burkholderiales were abundant in samples containing large amounts of monochloramine, indicating resistance to disinfection. Genera known to contain pathogenic and fecal-associated species were also identified in several locations. From this study, we conclude that metagenomic amplicon sequencing is an informative method to support current compliance-based methods and can be used to reveal bacterial community interactions with the chemical and physical properties of DWDSs. PMID:26162884

  7. The bias associated with amplicon sequencing does not affect the quantitative assessment of bacterial community dynamics.

    Directory of Open Access Journals (Sweden)

    Federico M Ibarbalz

    Full Text Available The performance of two sets of primers targeting variable regions of the 16S rRNA gene V1-V3 and V4 was compared in their ability to describe changes of bacterial diversity and temporal turnover in full-scale activated sludge. Duplicate sets of high-throughput amplicon sequencing data of the two 16S rRNA regions shared a collection of core taxa that were observed across a series of twelve monthly samples, although the relative abundance of each taxon was substantially different between regions. A case in point was the changes in the relative abundance of filamentous bacteria Thiothrix, which caused a large effect on diversity indices, but only in the V1-V3 data set. Yet the relative abundance of Thiothrix in the amplicon sequencing data from both regions correlated with the estimation of its abundance determined using fluorescence in situ hybridization. In nonmetric multidimensional analysis samples were distributed along the first ordination axis according to the sequenced region rather than according to sample identities. The dynamics of microbial communities indicated that V1-V3 and the V4 regions of the 16S rRNA gene yielded comparable patterns of: 1 the changes occurring within the communities along fixed time intervals, 2 the slow turnover of activated sludge communities and 3 the rate of species replacement calculated from the taxa-time relationships. The temperature was the only operational variable that showed significant correlation with the composition of bacterial communities over time for the sets of data obtained with both pairs of primers. In conclusion, we show that despite the bias introduced by amplicon sequencing, the variable regions V1-V3 and V4 can be confidently used for the quantitative assessment of bacterial community dynamics, and provide a proper qualitative account of general taxa in the community, especially when the data are obtained over a convenient time window rather than at a single time point.

  8. Using Amplicon Sequencing To Characterize and Monitor Bacterial Diversity in Drinking Water Distribution Systems.

    Science.gov (United States)

    Shaw, Jennifer L A; Monis, Paul; Weyrich, Laura S; Sawade, Emma; Drikas, Mary; Cooper, Alan J

    2015-09-01

    Drinking water assessments use a variety of microbial, physical, and chemical indicators to evaluate water treatment efficiency and product water quality. However, these indicators do not allow the complex biological communities, which can adversely impact the performance of drinking water distribution systems (DWDSs), to be characterized. Entire bacterial communities can be studied quickly and inexpensively using targeted metagenomic amplicon sequencing. Here, amplicon sequencing of the 16S rRNA gene region was performed alongside traditional water quality measures to assess the health, quality, and efficiency of two distinct, full-scale DWDSs: (i) a linear DWDS supplied with unfiltered water subjected to basic disinfection before distribution and (ii) a complex, branching DWDS treated by a four-stage water treatment plant (WTP) prior to disinfection and distribution. In both DWDSs bacterial communities differed significantly after disinfection, demonstrating the effectiveness of both treatment regimes. However, bacterial repopulation occurred further along in the DWDSs, and some end-user samples were more similar to the source water than to the postdisinfection water. Three sample locations appeared to be nitrified, displaying elevated nitrate levels and decreased ammonia levels, and nitrifying bacterial species, such as Nitrospira, were detected. Burkholderiales were abundant in samples containing large amounts of monochloramine, indicating resistance to disinfection. Genera known to contain pathogenic and fecal-associated species were also identified in several locations. From this study, we conclude that metagenomic amplicon sequencing is an informative method to support current compliance-based methods and can be used to reveal bacterial community interactions with the chemical and physical properties of DWDSs. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  9. Massively parallel amplicon sequencing reveals isotype-specific variability of antimicrobial peptide transcripts in Mytilus galloprovincialis.

    Directory of Open Access Journals (Sweden)

    Umberto Rosani

    Full Text Available BACKGROUND: Effective innate responses against potential pathogens are essential in the living world and possibly contributed to the evolutionary success of invertebrates. Taken together, antimicrobial peptide (AMP precursors of defensin, mytilin, myticin and mytimycin can represent about 40% of the hemocyte transcriptome in mussels injected with viral-like and bacterial preparations, and unique profiles of myticin C variants are expressed in single mussels. Based on amplicon pyrosequencing, we have ascertained and compared the natural and Vibrio-induced diversity of AMP transcripts in mussel hemocytes from three European regions. METHODOLOGY/PRINCIPAL FINDINGS: Hemolymph was collected from mussels farmed in the coastal regions of Palavas (France, Vigo (Spain and Venice (Italy. To represent the AMP families known in M. galloprovincialis, nine transcript sequences have been selected, amplified from hemocyte RNA and subjected to pyrosequencing. Hemolymph from farmed (offshore and wild (lagoon Venice mussels, both injected with 10(7 Vibrio cells, were similarly processed. Amplicon pyrosequencing emphasized the AMP transcript diversity, with Single Nucleotide Changes (SNC minimal for mytilin B/C and maximal for arthropod-like defensin and myticin C. Ratio of non-synonymous vs. synonymous changes also greatly differed between AMP isotypes. Overall, each amplicon revealed similar levels of nucleotidic variation across geographical regions, with two main sequence patterns confirmed for mytimycin and no substantial changes after immunostimulation. CONCLUSIONS/SIGNIFICANCE: Barcoding and bidirectional pyrosequencing allowed us to map and compare the transcript diversity of known mussel AMPs. Though most of the genuine cds variation was common to the analyzed samples we could estimate from 9 to 106 peptide variants in hemolymph pools representing 100 mussels, depending on the AMP isoform and sampling site. In this study, no prevailing SNC patterns related

  10. Viability-qPCR for detecting Legionella: Comparison of two assays based on different amplicon lengths.

    Science.gov (United States)

    Ditommaso, Savina; Giacomuzzi, Monica; Ricciardi, Elisa; Zotti, Carla M

    2015-08-01

    Two different real-time quantitative PCR (PMA-qPCR) assays were applied for quantification of Legionella spp. by targeting a long amplicon (approx 400 bp) of 16S rRNA gene and a short amplicon (approx. 100 bp) of 5S rRNA gene. Purified DNA extracts from pure cultures of Legionella spp. and from environmental water samples were quantified. Application of the two assays to quantify Legionella in artificially contaminated water achieved that both assays were able to detect Legionella over a linear range of 10 to 10(5) cells ml(-1). A statistical analysis of the standard curves showed that both assays were linear with a good correlation coefficient (R(2) = 0.99) between the Ct and the copy number. Amplification with the reference assay was the most effective for detecting low copy numbers (1 bacterium per PCR mixture). Using selective quantification of viable Legionella by the PMA-qPCR method we obtained a greater inhibition of the amplification of the 400-bp 16S gene fragment (Δlog(10) = 3.74 ± 0.39 log(10) GU ml(-1)). A complete inhibition of the PCR signal was obtained when heat-killed cells in a concentration below 1 × 10(5) cells ml(-1) were pretreated with PMA. Analysing short amplicon sizes led to only 2.08 log reductions in the Legionella dead-cell signal. When we tested environmental water samples, the two qPCR assays were in good agreement according to the kappa index (0.741). Applying qPCR combined with PMA treatment, we also obtained a good agreement (kappa index 0.615). The comparison of quantitative results shows that both assays yielded the same quantification sensitivity (mean log = 4.59 vs mean log = 4.31).

  11. Multiresolution maximum intensity volume rendering by morphological adjunction pyramids

    NARCIS (Netherlands)

    Roerdink, Jos B.T.M.

    We describe a multiresolution extension to maximum intensity projection (MIP) volume rendering, allowing progressive refinement and perfect reconstruction. The method makes use of morphological adjunction pyramids. The pyramidal analysis and synthesis operators are composed of morphological 3-D

  12. Multiresolution Maximum Intensity Volume Rendering by Morphological Adjunction Pyramids

    NARCIS (Netherlands)

    Roerdink, Jos B.T.M.

    2001-01-01

    We describe a multiresolution extension to maximum intensity projection (MIP) volume rendering, allowing progressive refinement and perfect reconstruction. The method makes use of morphological adjunction pyramids. The pyramidal analysis and synthesis operators are composed of morphological 3-D

  13. Foggy Scene Rendering Based on Transmission Map Estimation

    Directory of Open Access Journals (Sweden)

    Fan Guo

    2014-01-01

    Full Text Available Realistic rendering of foggy scene is important in game development and virtual reality. Traditional methods have many parameters to control or require a long time to compute, and they are usually limited to depicting a homogeneous fog without considering the foggy scene with heterogeneous fog. In this paper, a new rendering method based on transmission map estimation is proposed. We first generate perlin noise image as the density distribution texture of heterogeneous fog. Then we estimate the transmission map using the Markov random field (MRF model and the bilateral filter. Finally, virtual foggy scene is realistically rendered with the generated perlin noise image and the transmission map according to the atmospheric scattering model. Experimental results show that the rendered results of our approach are quite satisfactory.

  14. Comparison of Morphological Pyramids for Multiresolution MIP Volume Rendering

    NARCIS (Netherlands)

    Roerdink, Jos B.T.M.

    2002-01-01

    We recently proposed a multiresolution representation for maximum intensity projection (MIP) volume rendering based on morphological adjunction pyramids which allow progressive refinement and have the property of perfect reconstruction. In this algorithm the pyramidal analysis and synthesis

  15. Experiencing "Macbeth": From Text Rendering to Multicultural Performance.

    Science.gov (United States)

    Reisin, Gail

    1993-01-01

    Shows how one teacher used innovative methods in teaching William Shakespeare's "Macbeth." Outlines student assignments including text renderings, rewriting a scene from the play, and creating a multicultural scrapbook for the play. (HB)

  16. View compensated compression of volume rendered images for remote visualization.

    Science.gov (United States)

    Lalgudi, Hariharan G; Marcellin, Michael W; Bilgin, Ali; Oh, Han; Nadar, Mariappan S

    2009-07-01

    Remote visualization of volumetric images has gained importance over the past few years in medical and industrial applications. Volume visualization is a computationally intensive process, often requiring hardware acceleration to achieve a real time viewing experience. One remote visualization model that can accomplish this would transmit rendered images from a server, based on viewpoint requests from a client. For constrained server-client bandwidth, an efficient compression scheme is vital for transmitting high quality rendered images. In this paper, we present a new view compensation scheme that utilizes the geometric relationship between viewpoints to exploit the correlation between successive rendered images. The proposed method obviates motion estimation between rendered images, enabling significant reduction to the complexity of a compressor. Additionally, the view compensation scheme, in conjunction with JPEG2000 performs better than AVC, the state of the art video compression standard.

  17. High-quality multi-resolution volume rendering in medicine

    Institute of Scientific and Technical Information of China (English)

    XIE Kai; YANG Jie; LI Xiao-liang

    2007-01-01

    In order to perform a high-quality interactive rendering of large medical data sets on a single off-theshelf PC, a LOD selection algorithm for multi-resolution volume rendering using 3D texture mapping is presented, which uses an adaptive scheme that renders the volume in a region-of-interest at a high resolution and the volume away from this region at lower resolutions. The algorithm is based on several important criteria, and rendering is done adaptively by selecting high-resolution cells close to a center of attention and low-resolution cells away from this area. In addition, our hierarchical level-of-detail representation guarantees consistent interpolation between different resolution levels. Experiments have been applied to a number of large medical data and have produced high quality images at interactive frame rates using standard PC hardware.

  18. Factors affecting extension workers in their rendering of effective ...

    African Journals Online (AJOL)

    Factors affecting extension workers in their rendering of effective service to pre ... the objective of achieving sustainable livelihoods for the poor and commonages. ... marketing and management to adequately service the land reform programs.

  19. does knowledge influence their attitude and comfort in rendering care?

    African Journals Online (AJOL)

    kemrilib

    Physicians and AIDS care: does knowledge influence their attitude and comfort in rendering ... experience, age and being a consultant or a senior resident influenced attitude, while male ..... having or not having children, prior instructions on ...

  20. Accelerating Monte Carlo Renderers by Ray Histogram Fusion

    Directory of Open Access Journals (Sweden)

    Mauricio Delbracio

    2015-03-01

    Full Text Available This paper details the recently introduced Ray Histogram Fusion (RHF filter for accelerating Monte Carlo renderers [M. Delbracio et al., Boosting Monte Carlo Rendering by Ray Histogram Fusion, ACM Transactions on Graphics, 33 (2014]. In this filter, each pixel in the image is characterized by the colors of the rays that reach its surface. Pixels are compared using a statistical distance on the associated ray color distributions. Based on this distance, it decides whether two pixels can share their rays or not. The RHF filter is consistent: as the number of samples increases, more evidence is required to average two pixels. The algorithm provides a significant gain in PSNR, or equivalently accelerates the rendering process by using many fewer Monte Carlo samples without observable bias. Since the RHF filter depends only on the Monte Carlo samples color values, it can be naturally combined with all rendering effects.