WorldWideScience

Sample records for relative real-time rt-pcr

  1. Quantitative real-time RT-PCR and chromogenic in situ hybridization

    DEFF Research Database (Denmark)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia G T

    2009-01-01

    . METHODS: To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. RESULTS: The concordance...

  2. Improvement of a real-time RT-PCR assay for the detection of enterovirus RNA

    Directory of Open Access Journals (Sweden)

    Bruynseels Peggy

    2009-07-01

    Full Text Available Abstract We describe an improvement of an earlier reported real-time RT-PCR assay for the detection of enterovirus RNA, based on the 5' exonuclease digestion of a dual-labeled fluorogenic probe by Taq DNA polymerase. A different extraction method, real-time RT-PCR instrument and primer set were evaluated. Our data show that the optimized assay yields a higher sensitivity and reproducibility and resulted in a significant reduced hands-on time per sample.

  3. Detection of Tomato black ring virus by real-time one-step RT-PCR.

    Science.gov (United States)

    Harper, Scott J; Delmiglio, Catia; Ward, Lisa I; Clover, Gerard R G

    2011-01-01

    A TaqMan-based real-time one-step RT-PCR assay was developed for the rapid detection of Tomato black ring virus (TBRV), a significant plant pathogen which infects a wide range of economically important crops. Primers and a probe were designed against existing genomic sequences to amplify a 72 bp fragment from RNA-2. The assay amplified all isolates of TBRV tested, but no amplification was observed from the RNA of other nepovirus species or healthy host plants. The detection limit of the assay was estimated to be around nine copies of the TBRV target region in total RNA. A comparison with conventional RT-PCR and ELISA, indicated that ELISA, the current standard test method, lacked specificity and reacted to all nepovirus species tested, while conventional RT-PCR was approximately ten-fold less sensitive than the real-time RT-PCR assay. Finally, the real-time RT-PCR assay was tested using five different RT-PCR reagent kits and was found to be robust and reliable, with no significant differences in sensitivity being found. The development of this rapid assay should aid in quarantine and post-border surveys for regulatory agencies. Copyright © 2010 Elsevier B.V. All rights reserved.

  4. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    International Nuclear Information System (INIS)

    Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

    2008-01-01

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

  5. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR) for detection of avian metapneumovirus subtype A

    OpenAIRE

    Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  6. Development and implementation of the quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network in mainland China

    Directory of Open Access Journals (Sweden)

    Wang Wei

    2011-03-01

    Full Text Available Abstract Background Reverse transcription PCR (RT-PCR and real time RT-PCR (rRT-PCR have been indispensable methods for influenza surveillance, especially for determination of avian influenza. The movement of testing beyond reference lab introduced the need of quality control, including the implementation of an evaluation system for validating personal training and sample proficiency testing. Methods We developed a panel with lysates of seasonal influenza virus (H1N1, H3N2 and B, serials of diluted H5N1 virus lysates, and in-vitro transcribed H5 hemaglutinin (HA and an artificial gene RNAs for RT-PCR and rRT-PCR quality control assessment. The validations of stability and reproducibility were performed on the panel. Additionally, the panel was implemented to assess the detection capability of Chinese human avian influenza networks. Results The panel has relatively high stability and good reproducibility demonstrated by kappa's tests. In the implementation of panel on Chinese human avian influenza networks, the results suggested that there were a relatively low number of discrepancies for both concise and reproducibility in Chinese avian influenza virus net works. Conclusions A quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network was developed. An availably statistical data, which are used to assess the detection capability of networks on avian influenza virus (H5N1, can be obtained relatively easily through implementation of the panel on networks.

  7. Relative quantification and detection of different types of infectious bursal disease virus in bursa of Fabricius and cloacal swabs using real time RT-PCR SYBR green technology

    DEFF Research Database (Denmark)

    Li, Yiping; Handberg, K.J.; Kabell, Susanne

    2007-01-01

    or F52/70 inoculation were detected as virus positive at day I post inoculation (p.i.). The D78 viral load peaked at day 4 and day 8 p.i., while the DK01 and F52/70 viral load showed relatively high levels at day 2 p.i. In cloacal swabs, viruses detectable were at day 2 p.i. for DK01 and F52/70, day 8...

  8. Real-Time RT-PCR for the Detection of Lyssavirus Species

    Directory of Open Access Journals (Sweden)

    A. Deubelbeiss

    2014-01-01

    Full Text Available The causative agents of rabies are single-stranded, negative-sense RNA viruses in the genus Lyssavirus of Rhabdoviridae, consisting of twelve classified and three as yet unclassified species including classical rabies virus (RABV. Highly neurotropic RABV causes rapidly progressive encephalomyelitis with nearly invariable fatal outcome. Rapid and reliable diagnosis of rabies is highly relevant for public and veterinary health. Due to growing variety of the genus Lyssavirus observed, the development of suitable molecular assays for diagnosis and differentiation is challenging. This work focused on the establishment of a suitable real-time RT-PCR technique for rabies diagnosis as a complement to fluorescent antibody test and rabies tissue culture infection test as gold standard for diagnosis and confirmation. The real-time RT-PCR was adapted with the goal to detect the whole spectrum of lyssavirus species, for nine of which synthesized DNA fragments were used. For the detection of species, seven probes were developed. Serial dilutions of the rabies virus strain CVS-11 showed a 100-fold higher sensitivity of real-time PCR compared to heminested RT-PCR. Using a panel of thirty-one lyssaviruses representing four species, the suitability of the protocol could be shown. Phylogenetic analysis of the sequences obtained by heminested PCR allowed correct classification of all viruses used.

  9. Real time RT-PCR assay for detection of different serotypes of FMDV in Egypt

    Directory of Open Access Journals (Sweden)

    Laila El-Shehawy

    Full Text Available Aim: The present study indicated that rRT-PCR could be provided for the detection of FMDV in infected, contact and carrier cattle and also provide a rapid sensitive tool aiming to aid in rapid disease detection and control. Foot and Mouth disease virus serotypes O and A still existing in Egypt. In January 2012, sever outbreaks struck the animal population in most Egyptian 1 governorates. The causative virus was identified as FMDV SAT2. Material and Methods: Five samples of tongue epithelium (ET and five oesophageal-pharyngeal (OP fluid samples were collected from FMD suspected cattle in infected farm at El-Fayoum and 20 OP samples from in-contact cattle at the same farm in addition to 30 OP samples from apparently healthy cattle at three different localities in El-Fayoum governorate (12 from Fayoum; 9 from Sinoras and 9 from Edsa in order to detect carrier cattle. All of these samples were collected during November and December 2011 and January 2012. Results: All the ET and OP samples were inoculated on BHK cell culture and baby mice. The obtained results were identified using complement fixation test in addition to real-time reverse transcriptase polymerase chain reaction (rRT-PCR. In the infected farm at El-Fayoum FMDV type SAT2 was detected in cattle which are considered as the first introduction of this type while FMDV type O and SAT2 were detected in the in-contact cattle in the same farm. The sensitivity of rRT-PCR was cleared in the in-contact cattle as 13 out of 20 OP samples were positive to FMDV by rRT-PCR while 11 out of 20 OP samples were positive to FMDV by CFT. The OP samples collected from apparently healthy cattle from Fayoum, Sinoras and Edsa localities in Fayoum governorate demonstrate the circulation of the FMDV type A, O and the recent SAT2 in carrier cattle which threaten cattle population in Fayoum governorate. Also the sensitivity of real time RT-PCR over the CFT in detection of FMDV carrier cattle was clearly noticed in

  10. Ring trial 2016 for Bluetongue virus detection by real-time RT-PCR in France.

    Science.gov (United States)

    Sailleau, Corinne; Viarouge, Cyril; Breard, Emmanuel; Vitour, Damien; Zientara, Stephan

    2017-05-01

    Since the unexpected emergence of BTV-8 in Northern Europe and the incursion of BTV-8 and 1 in France in 2006-2007, molecular diagnosis has considerably evolved. Several real-time RT-PCR (rtRT-PCR) methods have been developed and published, and are currently being used in many countries across Europe for BTV detection and typing. In France, the national reference laboratory (NRL) for orbiviruses develops and validates 'ready-to-use' kits with private companies for viral RNA detection. The regional laboratories network that was set up to deal with a heavy demand for analyses has used these available kits. From 2007, ring tests were organized to monitor the performance of the French laboratories. This study presents the results of 63 regional laboratories in the ring trial organized in 2016. Blood samples were sent to the laboratories. Participants were asked to use the rtRT-PCR methods in place in their laboratory, for detection of all BTV serotypes and specifically BTV-8. The French regional laboratories are able to detect and genotype BTV in affected animals. Despite the use of several methods (i.e. RNA extraction and different commercial rtRT-PCRs), the network is homogeneous. The ring trial demonstrated that the French regional veterinary laboratories have reliable and robust BTV diagnostic tools for BTV genome detection.

  11. Detection panel for identification of twelve hemorrhagic viruses using real-time RT-PCR.

    Science.gov (United States)

    Fajfr, M; Neubauerová, V; Pajer, P; Kubíčková, P; Růžek, D

    2014-09-01

    Viral hemorrhagic fevers are caused by viruses from four viral families and develop diseases with high fatality rates. However, no commercial diagnostic assay for these pathogens is available. We developed real-time RT-PCR assays for viruses Ebola, Marburg, Lassa, Guanarito, Machupo, Junin, Sabiá, Seoul, Puumala, Hantaan, Crimean-Congo hemorrhagic fever virus and Rift Valley fever virus. The assays were optimized for identical reaction conditions and can be performed using several types of real-time PCR instruments, both capillary and plate, including a portable Ruggedized Advanced Pathogen Identification Device (R.A.P.I.D.) (Idaho Technology, Inc.). In combination with primers and probes from previously published studies, we present a simple system for rapid identification of hemorrhagic filoviruses, arenaviruses and bunyaviruses with sufficient sensitivity for first contact laboratory and diagnosis under field conditions.

  12. Real-time RT-PCR, a necessary tool to support the diagnosis and surveillance of rotavirus in Mexico.

    Science.gov (United States)

    De La Cruz Hernández, Sergio Isaac; Anaya Molina, Yazmin; Gómez Santiago, Fabián; Terán Vega, Heidi Lizbeth; Monroy Leyva, Elda; Méndez Pérez, Héctor; García Lozano, Herlinda

    2018-04-01

    Rotavirus produces diarrhea in children under 5 years old. Most of those conventional methods such as polyacrylamide gel electrophoresis (PAGE) and reverse transcription-polymerase chain reaction (RT-PCR) have been used for rotavirus detection. However, these techniques need a multi-step process to get the results. In comparison with conventional methods, the real-time RT-PCR is a highly sensitive method, which allows getting the results in only one day. In this study a real-time RT-PCR assay was tested using a panel of 440 samples from patients with acute gastroenteritis, and characterized by PAGE and RT-PCR. The results show that the real-time RT-PCR detected rotavirus from 73% of rotavirus-negative samples analyzed by PAGE and RT-PCR; thus, the percentage of rotavirus-positive samples increased to 81%. The results indicate that this real-time RT-PCR should be part of a routine analysis, and as a support of the diagnosis of rotavirus in Mexico. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Identification of genes for normalization of real-time RT-PCR data in breast carcinomas

    DEFF Research Database (Denmark)

    Lyng, Maria B; Laenkholm, Anne-Vibeke; Pallisgaard, Niels

    2008-01-01

    BACKGROUND: Quantitative real-time RT-PCR (RT-qPCR) has become a valuable molecular technique in basic and translational biomedical research, and is emerging as an equally valuable clinical tool. Correlation of inter-sample values requires data normalization, which can be accomplished by various...... means, the most common of which is normalization to internal, stably expressed, reference genes. Recently, such traditionally utilized reference genes as GAPDH and B2M have been found to be regulated in various circumstances in different tissues, emphasizing the need to identify genes independent...... of factors influencing the tissue, and that are stably expressed within the experimental milieu. In this study, we identified genes for normalization of RT-qPCR data for invasive breast cancer (IBC), with special emphasis on estrogen receptor positive (ER+) IBC, but also examined their applicability to ER...

  14. Single reaction, real time RT-PCR detection of all known avian and human metapneumoviruses.

    Science.gov (United States)

    Lemaitre, E; Allée, C; Vabret, A; Eterradossi, N; Brown, P A

    2018-01-01

    Current molecular methods for the detection of avian and human metapneumovirus (AMPV, HMPV) are specifically targeted towards each virus species or individual subgroups of these. Here a broad range SYBR Green I real time RT-PCR was developed which amplified a highly conserved fragment of sequence in the N open reading frame. This method was sufficiently efficient and specific in detecting all MPVs. Its validation according to the NF U47-600 norm for the four AMPV subgroups estimated low limits of detection between 1000 and 10copies/μL, similar with detection levels described previously for real time RT-PCRs targeting specific subgroups. RNA viruses present a challenge for the design of durable molecular diagnostic test due to the rate of change in their genome sequences which can vary substantially in different areas and over time. The fact that the regions of sequence for primer hybridization in the described method have remained sufficiently conserved since the AMPV and HMPV diverged, should give the best chance of continued detection of current subgroups and of potential unknown or future emerging MPV strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Directory of Open Access Journals (Sweden)

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  16. Comparative Evaluation Of Conventional Rt-pcr And Real-time Rt-pcr (rrt-pcr) For Detection Of Avian Metapneumovirus Subtype A [comparação Entre As Técnicas De Rt-pcr Convencional E Rt-pcr Em Tempo Real Para A Detecção Do Metapneumovírus Aviários Subtipo A

    OpenAIRE

    Ferreira H.L.; Spilki F.R.; dos Santos M.M.A.B.; de Almeida R.S.; Arns C.W.

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  17. Microdroplet sandwich real-time rt-PCR for detection of pandemic and seasonal influenza subtypes.

    Directory of Open Access Journals (Sweden)

    Stephanie L Angione

    Full Text Available As demonstrated by the recent 2012/2013 flu epidemic, the continual emergence of new viral strains highlights the need for accurate medical diagnostics in multiple community settings. If rapid, robust, and sensitive diagnostics for influenza subtyping were available, it would help identify epidemics, facilitate appropriate antiviral usage, decrease inappropriate antibiotic usage, and eliminate the extra cost of unnecessary laboratory testing and treatment. Here, we describe a droplet sandwich platform that can detect influenza subtypes using real-time reverse-transcription polymerase chain reaction (rtRT-PCR. Using clinical samples collected during the 2010/11 season, we effectively differentiate between H1N1p (swine pandemic, H1N1s (seasonal, and H3N2 with an overall assay sensitivity was 96%, with 100% specificity for each subtype. Additionally, we demonstrate the ability to detect viral loads as low as 10(4 copies/mL, which is two orders of magnitude lower than viral loads in typical infected patients. This platform performs diagnostics in a miniaturized format without sacrificing any sensitivity, and can thus be easily developed into devices which are ideal for small clinics and pharmacies.

  18. Detection of ROS1 Gene Rearrangement in Lung Adenocarcinoma: Comparison of IHC, FISH and Real-Time RT-PCR

    OpenAIRE

    Shan, Ling; Lian, Fang; Guo, Lei; Qiu, Tian; Ling, Yun; Ying, Jianming; Lin, Dongmei

    2015-01-01

    Aims To compare fluorescence in situ hybridization (FISH), immunohistochemistry (IHC) and quantitative real-time reverse transcription-PCR (qRT-PCR) assays for detection of ROS1 fusion in a large number of ROS1-positive lung adenocatcinoma (ADC) patients. Methods Using IHC analysis, sixty lung ADCs including 16 cases with ROS1 protein expression and 44 cases without ROS1 expression were selected for this study. The ROS1 fusion status was examined by FISH and qRT-PCR assay. Results Among 60 ca...

  19. Absolute estimation of initial concentrations of amplicon in a real-time RT-PCR process

    Directory of Open Access Journals (Sweden)

    Kohn Michael

    2007-10-01

    Full Text Available Abstract Background Since real time PCR was first developed, several approaches to estimating the initial quantity of template in an RT-PCR reaction have been tried. While initially only the early thermal cycles corresponding to exponential duplication were used, lately there has been an effort to use all of the cycles in a PCR. The efforts have included both fitting empirical sigmoid curves and more elaborate mechanistic models that explore the chemical reactions taking place during each cycle. The more elaborate mechanistic models require many more parameters than can be fit from a single amplification, while the empirical models provide little insight and are difficult to tailor to specific reactants. Results We directly estimate the initial amount of amplicon using a simplified mechanistic model based on chemical reactions in the annealing step of the PCR. The basic model includes the duplication of DNA with the digestion of Taqman probe and the re-annealing between previously synthesized DNA strands of opposite orientation. By modelling the amount of Taqman probe digested and matching that with the observed fluorescence, the conversion factor between the number of fluorescing dye molecules and observed fluorescent emission can be estimated, along with the absolute initial amount of amplicon and the rate parameter for re-annealing. The model is applied to several PCR reactions with known amounts of amplicon and is shown to work reasonably well. An expanded version of the model allows duplication of amplicon without release of fluorescent dye, by adding 1 more parameter to the model. The additional process is helpful in most cases where the initial primer concentration exceeds the initial probe concentration. Software for applying the algorithm to data may be downloaded at http://www.niehs.nih.gov/research/resources/software/pcranalyzer/ Conclusion We present proof of the principle that a mechanistically based model can be fit to observations

  20. Table 1. Primer sequences used for real-time qRT-PCR analysis of ...

    Indian Academy of Sciences (India)

    User

    TGTCCCAGTAAACCGCTC. GAATCCAGCACGATACCAGT. Figure 1. Expression analysis of candidate CsActin and CsFbox genes by qRT-PCR in response to 4°C treatment. The y-axis indicates Cq values, and error bars represent standard deviations of the mean values of four replicates. Rt, roots; St, stems; Le, leaves; Fl ...

  1. A novel and highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus.

    Science.gov (United States)

    Shen, Xin-Xin; Qiu, Fang-Zhou; Zhao, Huai-Long; Yang, Meng-Jie; Hong, Liu; Xu, Song-Tao; Zhou, Shuai-Feng; Li, Gui-Xia; Feng, Zhi-Shan; Ma, Xue-Jun

    2018-03-01

    The sensitivity of qRT-PCR assay is not adequate for the detection of the samples with lower viral load, particularly in the cerebrospinal fluid (CSF) of patients. Here, we present the development of a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of human enterovirus (HEV). The clinical performance of both RTN RT-PCR and qRT-PCR was also tested and compared using 140 CSF and fecal specimens. The sensitivities of RTN RT-PCR assay for EV71, Coxsackievirus A (CVA)16, CVA6 and CVA10 achieved 10 -8 dilution with a corresponding Ct value of 38.20, 36.45, 36.75, and 36.45, respectively, which is equal to traditional two-step nested RT-PCR assay and approximately 2-10-fold lower than that of qRT-PCR assay. The specificity of RTN RT-PCR assay was extensively analyzed insilico and subsequently verified using the reference isolates and clinical samples. Sixteen qRT-PCR-negative samples were detected by RTN RT-PCR and a variety of enterovirus serotypes was identified by sequencing of inner PCR products. We conclude RTN RT-PCR is more sensitive than qRT-PCR for the detection of HEV in clinical samples. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Selection of Housekeeping Genes for Transgene Expression Analysis in Eucommia ulmoides Oliver Using Real-Time RT-PCR

    Directory of Open Access Journals (Sweden)

    Ren Chen

    2010-01-01

    Full Text Available In order to select appropriate housekeeping genes for accurate calibration of experimental variations in real-time (RT- PCR results in transgene expression analysis, particularly with respect to the influence of transgene on stability of endogenous housekeeping gene expression in transgenic plants, we outline a reliable strategy to identify the optimal housekeeping genes from a set of candidates by combining statistical analyses of their (RT- PCR amplification efficiency, gene expression stability, and transgene influences. We used the strategy to select two genes, ACTα and EF1α, from 10 candidate housekeeping genes, as the optimal housekeeping genes to evaluate transgenic Eucommia ulmoides Oliver root lines overexpressing IPPI or FPPS1 genes, which are involved in isoprenoid biosynthesis.

  3. A Pan-Lyssavirus Taqman Real-Time RT-PCR Assay for the Detection of Highly Variable Rabies virus and Other Lyssaviruses.

    Science.gov (United States)

    Wadhwa, Ashutosh; Wilkins, Kimberly; Gao, Jinxin; Condori Condori, Rene Edgar; Gigante, Crystal M; Zhao, Hui; Ma, Xiaoyue; Ellison, James A; Greenberg, Lauren; Velasco-Villa, Andres; Orciari, Lillian; Li, Yu

    2017-01-01

    Rabies, resulting from infection by Rabies virus (RABV) and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA) test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR) based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N) coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses, its high

  4. A Pan-Lyssavirus Taqman Real-Time RT-PCR Assay for the Detection of Highly Variable Rabies virus and Other Lyssaviruses.

    Directory of Open Access Journals (Sweden)

    Ashutosh Wadhwa

    2017-01-01

    Full Text Available Rabies, resulting from infection by Rabies virus (RABV and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses

  5. Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process

    Directory of Open Access Journals (Sweden)

    Borges-Pérez Andrés

    2008-12-01

    Full Text Available Abstract Background The elucidation of gene expression patterns leads to a better understanding of biological processes. Real-time quantitative RT-PCR has become the standard method for in-depth studies of gene expression. A biologically meaningful reporting of target mRNA quantities requires accurate and reliable normalization in order to identify real gene-specific variation. The purpose of normalization is to control several variables such as different amounts and quality of starting material, variable enzymatic efficiencies of retrotranscription from RNA to cDNA, or differences between tissues or cells in overall transcriptional activity. The validity of a housekeeping gene as endogenous control relies on the stability of its expression level across the sample panel being analysed. In the present report we describe the first systematic evaluation of potential internal controls during tomato development process to identify which are the most reliable for transcript quantification by real-time RT-PCR. Results In this study, we assess the expression stability of 7 traditional and 4 novel housekeeping genes in a set of 27 samples representing different tissues and organs of tomato plants at different developmental stages. First, we designed, tested and optimized amplification primers for real-time RT-PCR. Then, expression data from each candidate gene were evaluated with three complementary approaches based on different statistical procedures. Our analysis suggests that SGN-U314153 (CAC, SGN-U321250 (TIP41, SGN-U346908 ("Expressed" and SGN-U316474 (SAND genes provide superior transcript normalization in tomato development studies. We recommend different combinations of these exceptionally stable housekeeping genes for suited normalization of different developmental series, including the complete tomato development process. Conclusion This work constitutes the first effort for the selection of optimal endogenous controls for quantitative real-time

  6. Real-time RT-PCR high-resolution melting curve analysis and multiplex RT-PCR to detect and differentiate grapevine leafroll-associated associated virus 3 variant groups I, II, III and VI

    Directory of Open Access Journals (Sweden)

    Bester Rachelle

    2012-09-01

    Full Text Available Abstract Background Grapevine leafroll-associated virus 3 (GLRaV-3 is the main contributing agent of leafroll disease worldwide. Four of the six GLRaV-3 variant groups known have been found in South Africa, but their individual contribution to leafroll disease is unknown. In order to study the pathogenesis of leafroll disease, a sensitive and accurate diagnostic assay is required that can detect different variant groups of GLRaV-3. Methods In this study, a one-step real-time RT-PCR, followed by high-resolution melting (HRM curve analysis for the simultaneous detection and identification of GLRaV-3 variants of groups I, II, III and VI, was developed. A melting point confidence interval for each variant group was calculated to include at least 90% of all melting points observed. A multiplex RT-PCR protocol was developed to these four variant groups in order to assess the efficacy of the real-time RT-PCR HRM assay. Results A universal primer set for GLRaV-3 targeting the heat shock protein 70 homologue (Hsp70h gene of GLRaV-3 was designed that is able to detect GLRaV-3 variant groups I, II, III and VI and differentiate between them with high-resolution melting curve analysis. The real-time RT-PCR HRM and the multiplex RT-PCR were optimized using 121 GLRaV-3 positive samples. Due to a considerable variation in melting profile observed within each GLRaV-3 group, a confidence interval of above 90% was calculated for each variant group, based on the range and distribution of melting points. The intervals of groups I and II could not be distinguished and a 95% joint confidence interval was calculated for simultaneous detection of group I and II variants. An additional primer pair targeting GLRaV-3 ORF1a was developed that can be used in a subsequent real-time RT-PCR HRM to differentiate between variants of groups I and II. Additionally, the multiplex RT-PCR successfully validated 94.64% of the infections detected with the real-time RT-PCR HRM

  7. Development of a highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus 71 in hand, foot, and mouth disease.

    Science.gov (United States)

    Niu, Peihua; Qi, Shunxiang; Yu, Benzhang; Zhang, Chen; Wang, Ji; Li, Qi; Ma, Xuejun

    2016-11-01

    Enterovirus 71 (EV71) is one of the major causative agents of outbreaks of hand, foot, and mouth disease (HFMD). A commercial TaqMan probe-based real-time PCR assay has been widely used for the differential detection of EV71 despite its relatively high cost and failure to detect samples with a low viral load (Ct value > 35). In this study, a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of EV71 in HFMD was developed. The sensitivity and specificity of this assay were evaluated using a reference EV71 stock and a panel of controls consisting of coxsackievirus A16 (CVA16) and common respiratory viruses, respectively. The clinical performance of this assay was evaluated and compared with those of a commercial TaqMan probe-based real-time PCR (qRT-PCR) assay and a traditional two-step nested RT-PCR assay. The limit of detection for the RTN RT-PCR assay was 0.01 TCID50/ml, with a Ct value of 38.3, which was the same as that of the traditional two-step nested RT-PCR assay and approximately tenfold lower than that of the qRT-PCR assay. When testing the reference strain EV71, this assay showed favorable detection reproducibility and no obvious cross-reactivity. The testing results of 100 clinical throat swabs from HFMD-suspected patients revealed that 41 samples were positive for EV71 by both RTN RT-PCR and traditional two-step nested RT-PCR assays, whereas only 29 were EV71 positive by qRT-PCR assay.

  8. Lineage-Specific Real-Time RT-PCR for Yellow Fever Virus Outbreak Surveillance, Brazil.

    Science.gov (United States)

    Fischer, Carlo; Torres, Maria C; Patel, Pranav; Moreira-Soto, Andres; Gould, Ernest A; Charrel, Rémi N; de Lamballerie, Xavier; Nogueira, Rita Maria Ribeiro; Sequeira, Patricia C; Rodrigues, Cintia D S; Kümmerer, Beate M; Drosten, Christian; Landt, Olfert; Bispo de Filippis, Ana Maria; Drexler, Jan Felix

    2017-11-01

    The current yellow fever outbreak in Brazil prompted widespread yellow fever virus (YFV) vaccination campaigns, imposing a responsibility to distinguish between vaccine- and wild-type YFV-associated disease. We developed novel multiplex real-time reverse transcription PCRs that differentiate between vaccine and American wild-type YFV. We validated these highly specific and sensitive assays in an outbreak setting.

  9. Lineage-Specific Real-Time RT-PCR for Yellow Fever Virus Outbreak Surveillance, Brazil

    OpenAIRE

    Fischer, Carlo; Torres, Maria C.; Patel, Pranav; Moreira-Soto, Andres; Gould, Ernest A.; Charrel, Rémi N.; de Lamballerie, Xavier; Nogueira, Rita Maria Ribeiro; Sequeira, Patricia C.; Rodrigues, Cintia D.S.; Kümmerer, Beate M.; Drosten, Christian; Landt, Olfert; Bispo de Filippis, Ana Maria; Drexler, Jan Felix

    2017-01-01

    The current yellow fever outbreak in Brazil prompted widespread yellow fever virus (YFV) vaccination campaigns, imposing a responsibility to distinguish between vaccine- and wild-type YFV-associated disease. We developed novel multiplex real-time reverse transcription PCRs that differentiate between vaccine and American wild-type YFV. We validated these highly specific and sensitive assays in an outbreak setting.

  10. Development of a duplex real-time RT-PCR for the simultaneous detection and differentiation of Theiler's murine encephalomyelitis virus and rat theilovirus.

    Science.gov (United States)

    Yuan, Wen; Wang, Jing; Xu, Fengjiao; Huang, Bihong; Lian, Yuexiao; Rao, Dan; Yin, Xueqin; Wu, Miaoli; Zhu, Yujun; Zhang, Yu; Huang, Ren; Guo, Pengju

    2016-10-01

    Theiler's murine encephalomyelitis virus (TMEV) and rat theilovirus (RTV), the member of the genus Cardiovirus, are widespread in laboratory mice and rats, and are potential contaminants of biological materials. Cardioviruses infection may cause serious complications in biomedical research. To improve the efficiency of routine screening for Cardioviruses infection, a duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was developed for simultaneous detection and differentiation of TMEV and RTV. The duplex assay was specific for reference strains of TMEV and RTV, and no cross-reaction was found with seven other rodent viruses. The limits of detection of both TMEV and RTV were 4×10(1) copies RNA/reaction. Reproducibility was estimated using standard dilutions, with coefficients of variation duplex real-time RT-PCR and conventional RT-PCR. For 439 clinical samples,95 samples were positive for TMEV and 72 samples were positive for RTV using duplex real-time RT-PCR approach, whereas only 77 samples were positive for TMEV and 66 samples were positive for RTV when conventional RT-PCR was applied. Mixed infections were found in 20 samples when analyzed by conventional RT-PCR whereas 30 samples were found to be mixed infection when duplex real-time RT-PCR was applied. This duplex assay provides a useful tool for routine health monitoring and screening of contaminated biological materials of these two viruses. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Development and validation of sensitive real-time RT-PCR assay for broad detection of rabies virus.

    Science.gov (United States)

    Faye, Martin; Dacheux, Laurent; Weidmann, Manfred; Diop, Sylvie Audrey; Loucoubar, Cheikh; Bourhy, Hervé; Sall, Amadou Alpha; Faye, Ousmane

    2017-05-01

    Rabies virus (RABV) remains one of the most important global zoonotic pathogens. RABV causes rabies, an acute encephalomyelitis associated with a high rate of mortality in humans and animals and affecting different parts of the world, particularly in Asia and Africa. Confirmation of rabies diagnosis relies on laboratory diagnosis, in which molecular techniques such as detection of viral RNA by reverse transcription polymerase chain reaction (RT-PCR) are increasingly being used. In this study, two real-time quantitative RT-PCR assays were developed for large-spectrum detection of RABV, with a focus on African isolates. The primer and probe sets were targeted highly conserved regions of the nucleoprotein (N) and polymerase (L) genes. The results indicated the absence of non-specific amplification and cross-reaction with a range of other viruses belonging to the same taxonomic family, i.e. Rhabdoviridae, as well as negative brain tissues from various host species. Analytical sensitivity ranged between 100 to 10 standard RNA copies detected per reaction for N-gene and L-gene assays, respectively. Effective detection and high sensitivity of these assays on African isolates showed that they can be successfully applied in general research and used in diagnostic process and epizootic surveillance in Africa using a double-check strategy. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Relative quantification of PIK3CA gene expression level in fine-needle aspiration biopsy thyroid specimens collected from patients with papillary thyroid carcinoma and non-toxic goitre by real-time RT-PCR

    Directory of Open Access Journals (Sweden)

    Wojciechowska-Durczyńska Katarzyna

    2010-08-01

    Full Text Available Abstract Background Recent studies have shown that the phosphatidylinositol 3-kinase (PI3K signaling pathway is important regulator of many cellular events, including apoptosis, proliferation and motility. PI3K pathway alterations (PIK3CA gene mutations and/or amplification have been observed in various human tumours. In the majority of diagnosed cases, mutations are localized in one of the three "hot spots" in the gene, responsible for coding catalytic subunit α of class I PI3K (PIK3CA. Mutations and amplification of PIK3CA gene are characteristic for thyroid cancer, as well. Methods The aim of our study was to examine a gene expression level of PIK3CA in fine-needle aspiration biopsy (FNAB thyroid specimens in two types of thyroid lesions, papillary thyroid carcinoma (PTC and non-toxic goitre (NTG. Following conventional cytological examination, 42 thyroid FNAB specimens, received from patients with PTC (n = 20 and NTG (n = 22, were quantitatively evaluated regarding PIK3CA expression level by real-time PCR in the ABI PRISM® 7500 Sequence Detection System. Results Significantly higher expression level (RQ of PIK3CA in PTC group has been noted in comparison with NTG group (p Conclusion These observations may suggest role of PIK3CA alterations in PTC carcinogenesis.

  13. Development of duplex real-time RT-PCR based on Taqman technology for detecting simultaneously the genome of pan-enterovirus and enterovirus 71.

    Science.gov (United States)

    Hwang, Seoyeon; Kang, Byunghak; Hong, Jiyoung; Kim, Ahyoun; Kim, Hyejin; Kim, Kisang; Cheon, Doo-Sung

    2013-07-01

    Human enterovirus (EV) 71 is the main etiological agent of hand, foot, and mouth disease (HFMD). It is associated with neurological complications, and caused fatalities during recent outbreaks in the Asia-Pacific region. Infections caused by EV71 could lead to many complications, ranging from brainstem encephalitis to pulmonary oedema, resulting in high mortality. In this study, a duplex real-time RT-PCR assay was developed in order to simultaneously detect pan-EV and EV71. EV71-specific primers and probes were designed based on the highly conserved VP1 region of EV71. Five EV71 strains were detected as positive, and no positive fluorescence signal was observed in the duplex real-time RT-PCR for other viral RNA, which showed 100% specificity for the selected panel, and no cross-reactions were observed in this duplex real-time RT-PCR. The EV71-specific duplex real-time RT-PCR was more sensitive than conventional RT-PCR, and detected viral titers that were 10-fold lower than those measured by the latter. Of the 381 HFMD clinical specimens, 196 (51.4%) cases were pan-EV-positive, of which 170 (86.7%) were EV71-positive when tested by pan-EV and EV71-specific duplex real-time RT-PCR. EV71-specific duplex real-time RT-PCR offers a rapid and sensitive method to detect EV71 from clinical specimens, and will allow quarantine measures to be taken more effectively during outbreaks. Copyright © 2013 Wiley Periodicals, Inc.

  14. Evaluation of candidate reference genes for gene expression normalization in Brassica juncea using real time quantitative RT-PCR.

    Directory of Open Access Journals (Sweden)

    Ruby Chandna

    Full Text Available The real time quantitative reverse transcription PCR (qRT-PCR is becoming increasingly important to gain insight into function of genes. Given the increased sensitivity, ease and reproducibility of qRT-PCR, the requirement of suitable reference genes for normalization has become important and stringent. It is now known that the expression of internal control genes in living organism vary considerably during developmental stages and under different experimental conditions. For economically important Brassica crops, only a couple of reference genes are reported till date. In this study, expression stability of 12 candidate reference genes including ACT2, ELFA, GAPDH, TUA, UBQ9 (traditional housekeeping genes, ACP, CAC, SNF, TIPS-41, TMD, TSB and ZNF (new candidate reference genes, in a diverse set of 49 tissue samples representing different developmental stages, stress and hormone treated conditions and cultivars of Brassica juncea has been validated. For the normalization of vegetative stages the ELFA, ACT2, CAC and TIPS-41 combination would be appropriate whereas TIPS-41 along with CAC would be suitable for normalization of reproductive stages. A combination of GAPDH, TUA, TIPS-41 and CAC were identified as the most suitable reference genes for total developmental stages. In various stress and hormone treated samples, UBQ9 and TIPS-41 had the most stable expression. Across five cultivars of B. juncea, the expression of CAC and TIPS-41 did not vary significantly and were identified as the most stably expressed reference genes. This study provides comprehensive information that the new reference genes selected herein performed better than the traditional housekeeping genes. The selection of most suitable reference genes depends on the experimental conditions, and is tissue and cultivar-specific. Further, to attain accuracy in the results more than one reference genes are necessary for normalization.

  15. A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

    Directory of Open Access Journals (Sweden)

    Qin E-de

    2010-06-01

    Full Text Available Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009 influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same as that of each single-target RT-PCR for pandemic H1N1 and even more sensitive for H5N1 with the same primers and probes. No cross reactivity of detecting other subtype influenza viruses or respiratory tract viruses was observed. Two hundred and thirty-six clinical specimens were tested by comparing with single real-time RT-PCR and result from the duplex assay was 100% consistent with the results of single real-time RT-PCR and sequence analysis.

  16. A novel method of multiple nucleic acid detection: Real-time RT-PCR coupled with probe-melting curve analysis.

    Science.gov (United States)

    Han, Yang; Hou, Shao-Yang; Ji, Shang-Zhi; Cheng, Juan; Zhang, Meng-Yue; He, Li-Juan; Ye, Xiang-Zhong; Li, Yi-Min; Zhang, Yi-Xuan

    2017-11-15

    A novel method, real-time reverse transcription PCR (real-time RT-PCR) coupled with probe-melting curve analysis, has been established to detect two kinds of samples within one fluorescence channel. Besides a conventional TaqMan probe, this method employs another specially designed melting-probe with a 5' terminus modification which meets the same label with the same fluorescent group. By using an asymmetric PCR method, the melting-probe is able to detect an extra sample in the melting stage effectively while it almost has little influence on the amplification detection. Thus, this method allows the availability of united employment of both amplification stage and melting stage for detecting samples in one reaction. The further demonstration by simultaneous detection of human immunodeficiency virus (HIV) and hepatitis C virus (HCV) in one channel as a model system is presented in this essay. The sensitivity of detection by real-time RT-PCR coupled with probe-melting analysis was proved to be equal to that detected by conventional real-time RT-PCR. Because real-time RT-PCR coupled with probe-melting analysis can double the detection throughputs within one fluorescence channel, it is expected to be a good solution for the problem of low-throughput in current real-time PCR. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

    OpenAIRE

    Kang, Xiao-ping; Jiang, Tao; Li, Yong-qiang; Lin, Fang; Liu, Hong; Chang, Guo-hui; Zhu, Qing-yu; Qin, E-de; Qin, Cheng-feng; Yang, Yin-hui

    2010-01-01

    Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009) influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose) for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same a...

  18. A real time Taqman RT-PCR for the detection of rabbit hemorrhagic disease virus 2 (RHDV2).

    Science.gov (United States)

    Duarte, Margarida Dias; Carvalho, Carina L; Barros, Silvia C; Henriques, Ana M; Ramos, Fernanda; Fagulha, Teresa; Luís, Tiago; Duarte, Elsa L; Fevereiro, Miguel

    2015-07-01

    A specific real time RT-PCR for the detection of RHDV2 was developed and validated using RHDV and RHDV2 RNA preparations from positive field samples. The system was designed to amplify a 127 nucleotide-long RNA region located within the vp60 gene, based on the alignment of six sequences originated in Portugal, obtained in our laboratory, and 11 sequences from France and Italy. The primers and probe target sequences are highly conserved in the vast majority of the RHDV2 sequences presently known. In the sequences showing variability, only one mismatch is found per strain, usually outlying the 3' end of the primer or probe hybridization sequences. The specificity of the method was demonstrated in vitro with a panel of common rabbit pathogens. Standardization was performed with RNA transcripts obtained from a recombinant plasmid harboring the target sequence. The method was able to detected nine RNA molecules with an efficiency of 99.4% and a R(2) value of 1. Repeatability and reproducibility of the method were very high, with coefficients of variation lower than 2.40%. The assay was proven a valuable tool to diagnose most of RDVH2 circulating strains, and may be also useful to monitor viral loads, and consequently, disease progression and vaccination efficacy. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Identification of Dobrava, Hantaan, Seoul, and Puumala viruses by one-step real-time RT-PCR.

    Science.gov (United States)

    Aitichou, Mohamed; Saleh, Sharron S; McElroy, Anita K; Schmaljohn, C; Ibrahim, M Sofi

    2005-03-01

    We developed four assays for specifically identifying Dobrava (DOB), Hantaan (HTN), Puumala (PUU), and Seoul (SEO) viruses. The assays are based on the real-time one-step reverse transcriptase polymerase chain reaction (RT-PCR) with the small segment used as the target sequence. The detection limits of DOB, HTN, PUU, and SEO assays were 25, 25, 25, and 12.5 plaque-forming units, respectively. The assays were evaluated in blinded experiments, each with 100 samples that contained Andes, Black Creek Canal, Crimean-Congo hemorrhagic fever, Rift Valley fever and Sin Nombre viruses in addition to DOB, HTN, PUU and SEO viruses. The sensitivity levels of the DOB, HTN, PUU, and SEO assays were 98%, 96%, 92% and 94%, respectively. The specificity of DOB, HTN and SEO assays was 100% and the specificity of the PUU assay was 98%. Because of the high levels of sensitivity, specificity, and reproducibility, we believe that these assays can be useful for diagnosing and differentiating these four Old-World hantaviruses.

  20. Comparison of ELISA and dual stage real time RT-PCR to differentiate Sabin like and non-Sabin like poliovirus isolates.

    Science.gov (United States)

    Kaundal, Nirmal; Sarkate, Purva; Prakash, Charu; Rishi, Narayan

    2017-06-01

    Environmental surveillance of polioviruses has been used as an important tool in monitoring circulation of wild polioviruses and/or Vaccine derived polioviruses in sewage samples. It is important to distinguish Sabin like isolates from non-Sabin like; ELISA & dual stage real time RT-PCR have been used for the same. Current study was carried out on sewage isolates to compare ELISA & RT-PCR with sequencing to distinguish Sabin like from non-Sabin like. Out of 468 sewage specimens, 91 (19.44%) were non-polio enteroviruses positive and 377 (80.56%) were polio positive by virus isolation method. A total of 488 polio virus isolates were detected by L20B and RD route which were further subjected to ELISA and RT-PCR. The results were compared with sequencing. On comparison, the specificity of ELISA was only 66.67% in spite of very low sensitivity (3.43%). The sensitivity of RT-PCR was 97.71% which makes it a good primary screening test for detection of non-Sabin like viruses. However, the specificity was only 33.33%. RT-PCR appears to be a sensitive tool for detecting non-Sabin like viruses however; the isolates which are non-Sabin like by RT-PCR may not necessarily be mutated viruses. ELISA cannot be used for differentiation of Sabin likes from non-Sabin likes due to low sensitivity.

  1. Evaluation of RIDA®GENE norovirus GI/GII real time RT-PCR using stool specimens collected from children and adults with acute gastroenteritis.

    Science.gov (United States)

    Kanwar, N; Hassan, F; Barclay, L; Langley, C; Vinjé, J; Bryant, P W; George, K St; Mosher, L; Matthews-Greer, J M; Rocha, M A; Beenhouwer, D O; Harrison, C J; Moffatt, M; Shastri, N; Selvarangan, R

    2018-04-10

    Norovirus is the leading cause of epidemic and sporadic acute gastroenteritis (AGE) in the United States. Widespread prevalence necessitates implementation of accurate norovirus detection assays in clinical diagnostic laboratories. To evaluate RIDA ® GENE norovirus GI/GII real-time RT-PCR assay (RGN RT-PCR) using stool samples from patients with sporadic AGE. Patients between 14 days to 101 years of age with symptoms of AGE were enrolled prospectively at four sites across the United States during 2014-2015. Stool specimens were screened for the presence of norovirus RNA by the RGN RT-PCR assay. Results were compared with a reference method that included conventional RT-PCR and sequencing of a partial region of the 5'end of the norovirus ORF2 gene. A total of 259 (36.0%) of 719 specimens tested positive for norovirus by the reference method. The RGN RT-PCR assay detected norovirus in 244 (94%) of these 259 norovirus positive specimens. The sensitivity and specificity (95% confidence interval) of the RGN RT-PCR assay for detecting norovirus genogroup (G) I was 82.8% (63.5-93.5) and 99.1% (98.0-99.6) and for GII was 94.8% (90.8-97.2) and 98.6% (96.9-99.4), respectively. Seven specimens tested positive by the RGN-RT PCR that were negative by the reference method. The fifteen false negative samples were typed as GII.4 Sydney, GII.13, GI.3, GI.5, GI.2, GII.1, and GII.3 in the reference method. The RGN RT-PCR assay had a high sensitivity and specificity for the detection of norovirus in stool specimens from patients with sporadic AGE. Copyright © 2018. Published by Elsevier B.V.

  2. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    Directory of Open Access Journals (Sweden)

    Soares Fernando A

    2009-03-01

    Full Text Available Abstract Background HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC and fluorescence in situ hybridization (FISH. These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. Methods To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. Results The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4% and HER-2 transcript overexpression (20%. Moreover, 2+ immunostaining cases presented nonamplified status (50% by CISH and HER-2 downexpression (38.5% by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350. Conclusion Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene.

  3. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    International Nuclear Information System (INIS)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia GT; Bérgamo, Nádia A; Neto, Francisco A Moraes; Domingues, Maria AC; Soares, Fernando A; Caldeira, José RF; Rogatto, Silvia R

    2009-01-01

    HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH). These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization) is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4%) and HER-2 transcript overexpression (20%). Moreover, 2+ immunostaining cases presented nonamplified status (50%) by CISH and HER-2 downexpression (38.5%) by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350). Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene

  4. Real-time onestep RT-PCR for the detection and differentiation of European and North American types of PRRSV in boar semen

    DEFF Research Database (Denmark)

    Hjulsager, Charlotte Kristiane; Larsen, Lars Erik

    and safe diagnostic procedure, since cDNA synthesis and PCR is performed sequentially without inbetween opening of the PCR-tubes, thus eliminating a substantial contamination risk. The aim of the present study was to validate a real-time OneStep RT-PCR assay for the simultaneous detection...

  5. Development of a real-time RT-PCR assay based on primer-probe energy transfer for the detection of all serotypes of bluetongue virus

    DEFF Research Database (Denmark)

    Leblanc, N; Rasmussen, Thomas Bruun; Fernandez, J

    2010-01-01

    A real-time RT-PCR assay based on the primer–probe energy transfer (PriProET) was developed to detect all 24 serotypes of bluetongue virus (BTV). BTV causes serious disease, primarily in sheep, but in other ruminants as well. A distinguishing characteristic of the assay is its tolerance toward...

  6. Development of a novel quantitative real-time RT-PCR assay for the simultaneous detection of all serotypes of Foot-and-mouth disease virus

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; de Stricker, K.

    2003-01-01

    Foot-and-mouth disease virus (FMDV) spreads extremely fast and the need for rapid and robust diagnostic virus detection systems was obvious during the recent European epidemic. Using a novel real-time RT-PCR system based on primer-probe energy transfer (PriProET) we present here an assay targeting...

  7. Ex vivo screening for immunodominant viral epitopes by quantitative real time polymerase chain reaction (qRT-PCR

    Directory of Open Access Journals (Sweden)

    Nagorsen Dirk

    2003-12-01

    Full Text Available Abstract The identification and characterization of viral epitopes across the Human Leukocyte Antigen (HLA polymorphism is critical for the development of actives-specific or adoptive immunotherapy of virally-mediated diseases. This work investigates whether cytokine mRNA transcripts could be used to identify epitope-specific HLA-restricted memory T lymphocytes reactivity directly in fresh peripheral blood mononuclear cells (PBMCs from viral-seropositive individuals in response to ex vivo antigen recall. PBMCs from HLA-A*0201 healthy donors, seropositive for Cytomegalovirus (CMV and Influenza (Flu, were exposed for different periods and at different cell concentrations to the HLA-A*0201-restricted viral FluM158–66 and CMVpp65495–503 peptides. Quantitative real time PCR (qRT-PCR was employed to evaluate memory T lymphocyte immune reactivation by measuring the production of mRNA encoding four cytokines: Interferon-γ (IFN-γ, Interleukin-2 (IL-2, Interleukin-4 (IL-4, and Interleukin-10 (IL-10. We could characterize cytokine expression kinetics that illustrated how cytokine mRNA levels could be used as ex vivo indicators of T cell reactivity. Particularly, IFN-γ mRNA transcripts could be consistently detected within 3 to 12 hours of short-term stimulation in levels sufficient to screen for HLA-restricted viral immune responses in seropositive subjects. This strategy will enhance the efficiency of the identification of viral epitopes independently of the individual HLA phenotype and could be used to follow the intensity of immune responses during disease progression or in response to in vivo antigen-specific immunization.

  8. Ex vivo screening for immunodominant viral epitopes by quantitative real time polymerase chain reaction (qRT-PCR)

    Science.gov (United States)

    Provenzano, Maurizio; Mocellin, Simone; Bonginelli, Paola; Nagorsen, Dirk; Kwon, Seog-Woon; Stroncek, David

    2003-01-01

    The identification and characterization of viral epitopes across the Human Leukocyte Antigen (HLA) polymorphism is critical for the development of actives-specific or adoptive immunotherapy of virally-mediated diseases. This work investigates whether cytokine mRNA transcripts could be used to identify epitope-specific HLA-restricted memory T lymphocytes reactivity directly in fresh peripheral blood mononuclear cells (PBMCs) from viral-seropositive individuals in response to ex vivo antigen recall. PBMCs from HLA-A*0201 healthy donors, seropositive for Cytomegalovirus (CMV) and Influenza (Flu), were exposed for different periods and at different cell concentrations to the HLA-A*0201-restricted viral FluM158–66 and CMVpp65495–503 peptides. Quantitative real time PCR (qRT-PCR) was employed to evaluate memory T lymphocyte immune reactivation by measuring the production of mRNA encoding four cytokines: Interferon-γ (IFN-γ), Interleukin-2 (IL-2), Interleukin-4 (IL-4), and Interleukin-10 (IL-10). We could characterize cytokine expression kinetics that illustrated how cytokine mRNA levels could be used as ex vivo indicators of T cell reactivity. Particularly, IFN-γ mRNA transcripts could be consistently detected within 3 to 12 hours of short-term stimulation in levels sufficient to screen for HLA-restricted viral immune responses in seropositive subjects. This strategy will enhance the efficiency of the identification of viral epitopes independently of the individual HLA phenotype and could be used to follow the intensity of immune responses during disease progression or in response to in vivo antigen-specific immunization. PMID:14675481

  9. Rapid detection of Enterovirus and Coxsackievirus A10 by a TaqMan based duplex one-step real time RT-PCR assay.

    Science.gov (United States)

    Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng

    2017-06-01

    A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Selection of reference genes for quantitative real time RT-PCR during dimorphism in the zygomycete Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco I; Jácome-Galarza, Irvin E; Gutiérrez-Corona, Félix; Ramírez-Díaz, Martha I; Campos-García, Jesús; Meza-Carmen, Víctor

    2015-03-01

    Mucor circinelloides is a dimorphic fungal model for studying several biological processes including cell differentiation (yeast-mold transitions) as well as biodiesel and carotene production. The recent release of the first draft sequence of the M. circinelloides genome, combined with the availability of analytical methods to determine patterns of gene expression, such as quantitative Reverse transcription-Polymerase chain reaction (qRT-PCR), and the development of molecular genetic tools for the manipulation of the fungus, may help identify M. circinelloides gene products and analyze their relevance in different biological processes. However, no information is available on M. circinelloides genes of stable expression that could serve as internal references in qRT-PCR analyses. One approach to solve this problem consists in the use of housekeeping genes as internal references. However, validation of the usability of these reference genes is a fundamental step prior to initiating qRT-PCR assays. This work evaluates expression of several constitutive genes by qRT-PCR throughout the morphological differentiation stages of M. circinelloides; our results indicate that tfc-1 and ef-1 are the most stable genes for qRT-PCR assays during differentiation studies and they are proposed as reference genes to carry out gene expression studies in this fungus.

  11. Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa

    DEFF Research Database (Denmark)

    Bachanek-Bankowska, Katarzyna; Mero, Herieth R.; Wadsworth, Jemma

    2016-01-01

    Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping...... methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within...... sequencing. Samples (n = 71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious...

  12. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Directory of Open Access Journals (Sweden)

    Gilberto A Santiago

    Full Text Available Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV. There are four genetically distinct DENVs (DENV-1-4 that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  13. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Science.gov (United States)

    Santiago, Gilberto A; Vergne, Edgardo; Quiles, Yashira; Cosme, Joan; Vazquez, Jesus; Medina, Juan F; Medina, Freddy; Colón, Candimar; Margolis, Harold; Muñoz-Jordán, Jorge L

    2013-01-01

    Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV). There are four genetically distinct DENVs (DENV-1-4) that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA) for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  14. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  15. Evaluation of FTA cards as a laboratory and field sampling device for the detection of foot-and-mouth disease virus and serotyping by RT-PCR and real-time RT-PCR.

    Science.gov (United States)

    Muthukrishnan, Madhanmohan; Singanallur, Nagendrakumar B; Ralla, Kumar; Villuppanoor, Srinivasan A

    2008-08-01

    Foot-and-mouth disease virus (FMDV) samples transported to the laboratory from far and inaccessible areas for serodiagnosis pose a major problem in a tropical country like India, where there is maximum temperature fluctuation. Inadequate storage methods lead to spoilage of FMDV samples collected from clinically positive animals in the field. Such samples are declared as non-typeable by the typing laboratories with the consequent loss of valuable epidemiological data. The present study evaluated the usefulness of FTA Classic Cards for the collection, shipment, storage and identification of the FMDV genome by RT-PCR and real-time RT-PCR. The stability of the viral RNA, the absence of infectivity and ease of processing the sample for molecular methods make the FTA cards a useful option for transport of FMDV genome for identification and serotyping. The method can be used routinely for FMDV research as it is economical and the cards can be transported easily in envelopes by regular document transport methods. Live virus cannot be isolated from samples collected in FTA cards, which is a limitation. This property can be viewed as an advantage as it limits the risk of transmission of live virus.

  16. Development of a novel real-time RT-PCR assay to detect Seneca Valley virus-1 associated with emerging cases of vesicular disease in pigs.

    Science.gov (United States)

    Fowler, Veronica L; Ransburgh, Russell H; Poulsen, Elizabeth G; Wadsworth, Jemma; King, Donald P; Mioulet, Valerie; Knowles, Nick J; Williamson, Susanna; Liu, Xuming; Anderson, Gary A; Fang, Ying; Bai, Jianfa

    2017-01-01

    Seneca Valley virus 1 (SVV-1) can cause vesicular disease that is clinically indistinguishable from foot-and-mouth disease, vesicular stomatitis and swine vesicular disease. SVV-1-associated disease has been identified in pigs in several countries, namely USA, Canada, Brazil and China. Diagnostic tests are required to reliably detect this emerging virus, and this report describes the development and evaluation of a novel real-time (r) reverse-transcription (RT) PCR assay (rRT-PCR), targeting the viral polymerase gene (3D) of SVV-1. This new assay detected all historical and contemporary SVV-1 isolates examined (n=8), while no cross-reactivity was observed with nucleic acid templates prepared from other vesicular disease viruses or common swine pathogens. The analytical sensitivity of the rRT-PCR was 0.79 TCID 50 /ml and the limit of detection was equivalent using two different rRT-PCR master-mixes. The performance of the test was further evaluated using pig nasal (n=25) and rectal swab samples (n=25), where concordant results compared to virus sequencing were generated for 43/50 samples. The availability of this assay, will enable laboratories to rapidly detect SVV-1 in cases of vesicular disease in pigs, negated for notifiable diseases, and could enable existing knowledge gaps to be investigated surrounding the natural epidemiology of SVV-1. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Selection of reference genes for quantitative real-time RT-PCR studies in tomato fruit of the genotype MT-Rg1

    Directory of Open Access Journals (Sweden)

    Karla L. González-Aguilera

    2016-09-01

    Full Text Available Quantitative real-time RT-PCR (qRT-PCR has become one of the most widely used methods for accurate quantification of gene expression. Since there are no universal reference genes for normalization, the optimal strategy to normalize raw qRT-PCR data is to perform an initial comparison of a set of independent reference genes to assess the most stable ones in each biological model. Normalization of a qRT-PCR experiment helps to ensure that the results are both statistically significant and biologically meaningful. Tomato is the model of choice to study fleshy fruit development. The miniature tomato (Solanum lycopersicum L. cultivar Micro-Tom (MT is considered a model system for tomato genetics and functional genomics. A new genotype, containing the Rg1 allele, improves tomato in vitro regeneration. In this work, we evaluated the expression stability of four tomato reference genes, namely CAC, SAND, Expressed and ACTIN2. We showed that the genes CAC and Exp are the best reference genes of the four we tested during fruit development in the MT-Rg1 genotype. Furthermore, we validated the reference genes by showing that the expression profiles of the transcription factors FRUITFULL1 (FUL1 and APETALA2c (AP2c during fruit development are comparable to previous reports using other tomato cultivars.

  18. Comparison of multiplex RT-PCR and real-time HybProbe assay for serotyping of dengue virus using reference strains and clinical samples from India

    Directory of Open Access Journals (Sweden)

    Anita Chakravarti

    2016-01-01

    Full Text Available Background: Dengue virus serotyping is crucial from clinical management and epidemiological point of view. Aims: To compare efficacy of two molecular detection and typing methods, namely, multiplex reverse transcription polymerase chain reaction (RT-PCR and real-time Hybprobe assay using a panel of known dilution of four reference Dengue virus strains and a panel of sera collected from clinically suspected dengue patients. Settings: This study was conducted at a tertiary-care teaching hospital in Delhi, India. Materials and Methods: Dengue serotype specific virus strains were used as prototypes for serotyping assays. Viral load was quantified by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR. Acute phase serum samples were collected from 79 patients with clinically suspected Dengue fever on their first day of presentation during September-October 2012. Viral RNA from serum and cell culture supernatant was extracted. Reverse transcription was carried out. Quantitative detection of DENV RNA from reference strain culture supernatants and each of the 79 patient samples by real-time PCR was performed using light cycler Taqman master mix kit. Serotyping was done by multiplex RT-PCR assay and Hybprobe assay. Results: The multiplex RT-PCR assay, though found to be 100% specific, couldn't serotype either patient or reference strains with viral load less than 1000 RNA copies/ml. The Hybprobe assay was found to have 100% specificity and had a lower limit of serotype detection of merely 3.54 RNA copies/ml. Conclusions: HybProbe assay has an important role especially in situations where serotyping is to be performed in clinical samples with low viral load.

  19. Characterization of human coronavirus etiology in Chinese adults with acute upper respiratory tract infection by real-time RT-PCR assays.

    Directory of Open Access Journals (Sweden)

    Roujian Lu

    Full Text Available BACKGROUND: In addition to SARS associated coronaviruses, 4 non-SARS related human coronaviruses (HCoVs are recognized as common respiratory pathogens. The etiology and clinical impact of HCoVs in Chinese adults with acute upper respiratory tract infection (URTI needs to be characterized systematically by molecular detection with excellent sensitivity. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we detected 4 non-SARS related HCoV species by real-time RT-PCR in 981 nasopharyngeal swabs collected from March 2009 to February 2011. All specimens were also tested for the presence of other common respiratory viruses and newly identified viruses, human metapneumovirus (hMPV and human bocavirus (HBoV. 157 of the 981 (16.0% nasopharyngeal swabs were positive for HCoVs. The species detected were 229E (96 cases, 9.8%, OC43 (42 cases, 4.3%, HKU1 (16 cases, 1.6% and NL63 (11 cases, 1.1%. HCoV-229E was circulated in 21 of the 24 months of surveillance. The detection rates for both OC43 and NL63 were showed significantly year-to-year variation between 2009/10 and 2010/11, respectively (P<0.001 and P = 0.003, and there was a higher detection frequency of HKU1 in patients aged over 60 years (P = 0.03. 48 of 157(30.57% HCoV positive patients were co-infected. Undifferentiated human rhinoviruses and influenza (Flu A were the most common viruses detected (more than 35% in HCoV co-infections. Respiratory syncytial virus (RSV, human parainfluenza virus (PIV and HBoV were detected in very low rate (less than 1% among adult patients with URTI. CONCLUSIONS/SIGNIFICANCE: All 4 non-SARS-associated HCoVs were more frequently detected by real-time RT-PCR assay in adults with URTI in Beijing and HCoV-229E led to the most prevalent infection. Our study also suggested that all non-SARS-associated HCoVs contribute significantly to URTI in adult patients in China.

  20. Detection, quantitation and identification of enteroviruses from surface waters and sponge tissue from the Florida Keys using real-time RT-PCR

    Science.gov (United States)

    Donaldson, K.A.; Griffin, Dale W.; Paul, J.H.

    2002-01-01

    A method was developed for the quantitative detection of pathogenic human enteroviruses from surface waters in the Florida Keys using Taqman (R) one-step Reverse transcription (RT)-PCR with the Model 7700 ABI Prism (R) Sequence Detection System. Viruses were directly extracted from unconcentrated grab samples of seawater, from seawater concentrated by vortex flow filtration using a 100kD filter and from sponge tissue. Total RNA was extracted from the samples, purified and concentrated using spin-column chromatography. A 192-196 base pair portion of the 5??? untranscribed region was amplified from these extracts. Enterovirus concentrations were estimated using real-time RT-PCR technology. Nine of 15 sample sites or 60% were positive for the presence of pathogenic human enteroviruses. Considering only near-shore sites, 69% were positive with viral concentrations ranging from 9.3viruses/ml to 83viruses/g of sponge tissue (uncorrected for extraction efficiency). Certain amplicons were selected for cloning and sequencing for identification. Three strains of waterborne enteroviruses were identified as Coxsackievirus A9, Coxsackievirus A16, and Poliovirus Sabin type 1. Time and cost efficiency of this one-step real-time RT-PCR methodology makes this an ideal technique to detect, quantitate and identify pathogenic enteroviruses in recreational waters. Copyright ?? 2002 Elsevier Science Ltd.

  1. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR for detection of avian metapneumovirus subtype A Comparação entre as técnicas de RT-PCR convencional e RT-PCR em tempo real para a detecção do metapneumovírus aviários subtipo A

    Directory of Open Access Journals (Sweden)

    Helena Lage Ferreira

    2009-08-01

    Full Text Available Avian metapneumovirus (AMPV belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F gene and nucleocapsid (N gene were compared with an established test for the attachment (G gene. All the RT-PCR tested assays were able to detect the AMPV/A. The lower detection limits were observed using the N-, F- based RRT-PCR and F-based conventional RT-PCR (10(0.3 to 10¹ TCID50 mL-1. The present study suggests that the conventional F-based RT-PCR presented similar detection limit when compared to N- and F-based RRT-PCR and they can be successfully used for AMPV/A detection.O metapneumovírus aviário (AMPV pertence ao gênero Metapneumovirus, família Paramyxoviridae. Isolamento viral, sorologia e detecção do RNA genômico são atualmente as técnicas utilizadas para o diagnóstico desse agente. O objetivo do presente estudo foi comparar a detecção de RNA viral de seis isolados de AMPV, subtipo A (AMPV/A, utilizando diferentes métodos de RT-PCR convencional e real time RT-PCR (RRT-PCR. Duas novas técnicas de RT-PCR convencional e duas técnicas de RRT-PCR, ambas para a detecção dos genes da nucleoproteína (N e da proteína de fusão (F, foram comparadas com um RT-PCR previamente estabelecido para a detecção do AMPV (gene da glicoproteína -G. Todos esses métodos foram capazes de detectar os isolados AMPV/A. As técnicas RRT-PCR (genes F e N mostraram os menores limites de detecção (10(0.3 to 10¹ TCID50 mL-1. Os resultados sugerem que as técnicas RT-PCR convencional (gene F e as técnicas de RRT-PCR (gene F e N desenvolvidas no presente estudo podem ser utilizadas com sucesso para a detecção do

  2. Conventional and real time RT-PCR assays for the detection and differentiation of variant rabbit hemorrhagic disease virus (RHDVb) and its recombinants.

    Science.gov (United States)

    Dalton, K P; Arnal, J L; Benito, A A; Chacón, G; Martín Alonso, J M; Parra, F

    2018-01-01

    Since its emergence, variant RHDV (RHDVb/RHDV2) has spread throughout the Iberian Peninsula aided by the apparent lack of cross protection provided by classic (genogroup 1; G1) strain derived vaccines. In addition to RHDVb, full-length genome sequencing of RHDV strains has recently revealed the circulation of recombinant viruses on the Iberian Peninsula. These recombinant viruses contain the RHDVb structural protein encoding sequences and the non-structural coding regions of either pathogenic RHDV-G1 strains or non-pathogenic (np) rabbit caliciviruses. The aim of the work was twofold: firstly to validate a diagnostic real time RT-PCR developed in 2012 for the detection of RHDVb strains and secondly, to design a conventional RT-PCR for the differentiation of RHDVb strains from RHDVb recombinants by subsequent sequencing of the amplicon. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa.

    Science.gov (United States)

    Bachanek-Bankowska, Katarzyna; Mero, Herieth R; Wadsworth, Jemma; Mioulet, Valerie; Sallu, Raphael; Belsham, Graham J; Kasanga, Christopher J; Knowles, Nick J; King, Donald P

    2016-11-01

    Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within the VP1-coding region that share high intra-lineage identity, but do not cross-react with FMD viruses from other serotypes that circulate in the region. These serotype-specific assays operate with the same thermal profile as the pan-diagnostic tests making it possible to run them in parallel to produce C T values comparable to the pan-diagnostic test detecting the 3D-coding region. These assays were evaluated alongside the established pan-specific molecular test using field samples and virus isolates collected from Tanzania, Kenya and Ethiopia that had been previously characterised by nucleotide sequencing. Samples (n=71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious virus could still be serotyped using these assays. These serotype-specific real-time RT-PCR assays can detect and characterise FMDVs currently circulating in East Africa and hence improve disease control in this region. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  4. Correlation of immune activation with HIV-1 RNA levels assayed by real-time RT-PCR in HIV-1 Subtype C infected patients in Northern India

    Science.gov (United States)

    Agarwal, Atima; Sankaran, Sumathi; Vajpayee, Madhu; Sreenivas, V; Seth, Pradeep; Dandekar, Satya

    2014-01-01

    Background Assays with specificity and cost effectiveness are needed for the measurement of HIV-1 burden to monitor disease progression or response to anti-retroviral therapy (ART) in HIV-1 subtype C infected patients. Objectives The objective of this study was to develop and validate an affordable; one step Real-Time RT-PCR assay with high specificity and sensitivity to measure plasma HIV-1 loads in HIV-1 subtype C infected patients. Results We developed an RT-PCR assay to detect and quantitate plasma HIV-1 levels in HIV-1 subtype C infected patients. An inverse correlation between plasma viral loads (PVL) and CD4+ T-cell numbers was detected at all CDC stages. Significant correlations were found between CD8+ T-cell activation and PVL, as well as with the clinical and immunological status of the patients. Conclusions The RT-PCR assay provides a sensitive method to measure PVL in HIV-1 subtype C infected patients. Viral loads correlated with immune activation and can be used to monitor HIV care in India. PMID:17962068

  5. Early diagnosis of dengue in travelers: comparison of a novel real-time RT-PCR, NS1 antigen detection and serology.

    Science.gov (United States)

    Huhtamo, Eili; Hasu, Essi; Uzcátegui, Nathalie Y; Erra, Elina; Nikkari, Simo; Kantele, Anu; Vapalahti, Olli; Piiparinen, Heli

    2010-01-01

    The increased traveling to dengue endemic regions and the numerous epidemics have led to a rise in imported dengue. The laboratory diagnosis of acute dengue requires several types of tests and often paired samples are needed for obtaining reliable results. Although several diagnostic methods are available, proper comparative data on their performance are lacking. To compare the performance of novel methods including a novel pan-DENV real-time RT-PCR and a commercially available NS1 capture-EIA in regard to IgM detection for optimizing the early diagnosis of DENV in travelers. A panel of 99 selected early phase serum samples of dengue patients was studied by real-time RT-PCR, NS1 antigen ELISA, IgM-EIA, IgG-IFA and cell culture virus isolation. The novel real-time RT-PCR was shown specific and sensitive for detection of DENV-1-4 RNA and suitable for diagnostic use. The diagnostic rate using combination of RNA and IgM detection was 99% and using NS1 and IgM detection 95.9%. The results of RNA and NS1 antigen detection disagreed in 15.5% of samples that had only RNA or NS1 antigen detected. The diagnostic rates of early samples are higher when either RNA or NS1 antigen detection is combined with IgM detection. Besides the differences in the RNA and NS1 detection assays, the observed discrepancy of results could suggest individual variation or differences in timing of these markers in patient serum. Copyright (c) 2009 Elsevier B.V. All rights reserved.

  6. Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland.

    LENUS (Irish Health Repository)

    Menton, John F

    2007-01-01

    BACKGROUND: Noroviruses are the most common cause of non-bacterial gastroenteritis. Improved detection methods have seen a large increase in the number of human NoV genotypes in the last ten years. The objective of this study was to develop a fast method to detect, quantify and genotype positive NoV samples from Irish hospitals. RESULTS: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developed based on the ORF1-ORF2 region. The sensitivity and reactivity of the two assays used was validated using a reference stool panel containing 14 NoV genotypes. The assays were then used to investigate two outbreaks of gastroenteritis in two Irish hospitals. 56 samples were screened for NoV using a real-time RT-PCR assay and 26 samples were found to be positive. Genotyping of these positive samples found that all positives belonged to the GII\\/4 variant of NoV. CONCLUSION: The combination of the Real-time assay and the reverse line blot hybridisation assay provided a fast and accurate method to investigate a NoV associated outbreak. It was concluded that the predominant genotype circulating in these Irish hospitals was GII\\/4 which has been associated with the majority of NoV outbreaks worldwide. The assays developed in this study are useful tools for investigating NoV infection.

  7. Novel Molecular Beacon Probe-Based Real-Time RT-PCR Assay for Diagnosis of Crimean-Congo Hemorrhagic Fever Encountered in India

    Directory of Open Access Journals (Sweden)

    Aman Kamboj

    2014-01-01

    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is an emerging zoonotic disease in India and requires immediate detection of infection both for preventing further transmission and for controlling the infection. The present study describes development, optimization, and evaluation of a novel molecular beacon-based real-time RT-PCR assay for rapid, sensitive, and specific diagnosis of Crimean-Congo hemorrhagic fever virus (CCHFV. The developed assay was found to be a better alternative to the reported TaqMan assay for routine diagnosis of CCHF.

  8. Evaluation of 793/B-like and Mass-like vaccine strain kinetics in experimental and field conditions by real-time RT-PCR quantification.

    Science.gov (United States)

    Tucciarone, C M; Franzo, G; Berto, G; Drigo, M; Ramon, G; Koutoulis, K C; Catelli, E; Cecchinato, M

    2018-01-01

    Infectious bronchitis virus (IBV) is a great economic burden both for productive losses and costs of the control strategies. Many different vaccination protocols are applied in the same region and even in consecutive cycles on the same farm in order to find the perfect balance between costs and benefits. In Northern Italy, the usual second vaccination is more and more often moved up to the chick's first d of life. The second strain administration together with the common Mass priming by spray at the hatchery allows saving money and time and reducing animal stress. The present work compared the different vaccine strains (Mass-like or B48, and 1/96) kinetics both in field conditions and in a 21-day-long experimental trial in broilers, monitoring the viral replication by upper respiratory tract swabbing and vaccine specific real time reverse transcription PCR (RT-PCR) quantification. In both field and experimental conditions, titers for all the vaccines showed an increasing trend in the first 2 wk and then a decrease, though still remaining detectable during the whole monitored period. IBV field strain and avian Metapneumovirus (aMPV) presence also was also investigated by RT-PCR and sequencing, and by multiplex real-time RT-PCR, respectively, revealing a consistency in the pathogen introduction timing at around 30 d, in correspondence with the vaccine titer's main decrease. These findings suggest the need for an accurate knowledge of live vaccine kinetics, whose replication can compete with the other pathogen one, providing additional protection to be added to what is conferred by the adaptive immune response. © 2017 Poultry Science Association Inc.

  9. Gene expression analysis of the rat testis after treatment with di(2-ethylhexyl) phthalate using cDNA microarray and real-time RT-PCR

    International Nuclear Information System (INIS)

    Kijima, Kazuyasu; Toyosawa, Kaoru; Yasuba, Masashi; Matsuoka, Nobuo; Adachi, Tetsuya; Komiyama, Masatoshi; Mori, Chisato

    2004-01-01

    To investigate the effects of di(2-ethylhexyl) phthalate (DEHP) on gene expression in rat testis, 6-week-old male Sprague-Dawley rats were given a single oral dose of 20 or 2000 mg/kg and euthanized 3, 6, 24, or 72 h thereafter. Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)-positive cells were significantly increased in the testis at 24 and 72 h after the exposure to 2000 mg/kg of DEHP. On cDNA microarray analysis, in addition to apoptosis-related genes, genes associated with atrophy, APEX nuclease, MutS homologue (E. coli), testosterone-repressed-prostatic-message-2 (TRPM-2), connective tissue growth factor, collagen alpha 2 type V, and cell adhesion kinase were differentially expressed. To investigate the relationship between histopathological alteration and gene expression, we selected genes associated with apoptosis and analyzed their expression by real-time quantitative reverse transcription-polymerase chain reaction (RT-PCR). With 20 mg/kg of DEHP treatment, bcl-2, key gene related to apoptosis, was increased. Up-regulation of bcl-2, inhibitor of Apaf-1/caspase-9/caspase-2 cascade of apoptosis, may be related to the fact that no morphological apoptotic change was induced after dosing of 20 mg/kg DEHP. With 2000 mg/kg of DEHP treatment, the apoptotic activator cascade, Fas/FasL, FADD/caspase-8/caspase-3 cascade, and Apaf-1/caspase-9/caspase-2 cascade were increased and bcl-2 was decreased. Thus, these gene regulations might lead the cells into apoptosis in the case of high exposure to DEHP. In contrast, FADD/caspase-10/caspase-6 cascade and caspase-11/caspase-3 cascade were not increased. These results indicate that the cascades of FADD/caspase-10/caspase-6 and caspase-11/caspase-3 are not related to apoptosis with DEHP treatment

  10. Multiplex real-time RT-PCR assay for bovine viral diarrhea virus type 1, type 2 and HoBi-like pestivirus.

    Science.gov (United States)

    Mari, Viviana; Losurdo, Michele; Lucente, Maria Stella; Lorusso, Eleonora; Elia, Gabriella; Martella, Vito; Patruno, Giovanni; Buonavoglia, Domenico; Decaro, Nicola

    2016-03-01

    HoBi-like pestiviruses are emerging pestiviruses that infect cattle causing clinical forms overlapping to those induced by bovine viral diarrhea virus (BVDV) 1 and 2. As a consequence of their widespread distribution reported in recent years, molecular tools for rapid discrimination among pestiviruses infecting cattle are needed. The aim of the present study was to develop a multiplex real-time RT-PCR assay, based on the TaqMan technology, for the rapid and unambiguous characterisation of all bovine pestiviruses, including the emerging HoBi-like strains. The assay was found to be sensitive, specific and repeatable, ensuring detection of as few as 10(0)-10(1) viral RNA copies. No cross-reactions between different pestiviral species were observed even in samples artificially contaminated with more than one pestivirus. Analysis of field samples tested positive for BVDV-1, BVDV-2 or HoBi-like virus by a nested PCR protocol revealed that the developed TaqMan assay had equal or higher sensitivity and was able to discriminate correctly the viral species in all tested samples, whereas a real-time RT-PCR assay previously developed for HoBi-like pestivirus detection showed cross-reactivity with few high-titre BVDV-2 samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Cross-platform evaluation of commercial real-time SYBR green RT-PCR kits for sensitive and rapid detection of European bat Lyssavirus type 1.

    Science.gov (United States)

    Picard-Meyer, Evelyne; Peytavin de Garam, Carine; Schereffer, Jean Luc; Marchal, Clotilde; Robardet, Emmanuelle; Cliquet, Florence

    2015-01-01

    This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R (2) values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  12. Cross-Platform Evaluation of Commercial Real-Time SYBR Green RT-PCR Kits for Sensitive and Rapid Detection of European Bat Lyssavirus Type 1

    Directory of Open Access Journals (Sweden)

    Evelyne Picard-Meyer

    2015-01-01

    Full Text Available This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R2 values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  13. Validation of reference genes for quantitative expression analysis by real-time rt-PCR in four lepidopteran insects.

    Science.gov (United States)

    Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei

    2012-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae), Chilo suppressalis Walker (Crambidae), and Spodoptera exigua Hübner (Noctuidae) to study their expression stability. The algorithms of geNorm, NormFinder, stability index, and ΔCt analysis were used to evaluate these HKGs. Across different developmental stages, actin A1 was the most stable in P. xylostella and C. suppressalis, but it was the least stable in B. mori and S. exigua. Rp49 and GAPDH were the most stable in B. mori and S. exigua, respectively. In different tissues, GAPDH, E2F, and Rp49 were the most stable in B. mori, S. exigua, and C. suppressalis, respectively. The relative abundances of Siwi genes estimated by 2(-ΔΔCt) method were tested with different HKGs as the reference gene, proving the importance of internal controls in qPCR data analysis. The results not only presented a list of suitable reference genes in four lepidopteran insects, but also proved that the expression stabilities of HKGs were different among evolutionarily close species. There was no single universal reference gene that could be used in all situations. It is indispensable to validate the expression of HKGs before using them as the internal control in qPCR.

  14. Validation of Reference Genes for Quantitative Expression Analysis by Real-Time RT-PCR in Four Lepidopteran Insects

    OpenAIRE

    Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei

    2012-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae...

  15. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum using quantitative real-time RT-PCR.

    Directory of Open Access Journals (Sweden)

    Jacinta Gimeno

    Full Text Available Switchgrass (Panicum virgatum has received a lot of attention as a forage and bioenergy crop during the past few years. Gene expression studies are in progress to improve new traits and develop new cultivars. Quantitative real time PCR (qRT-PCR has emerged as an important technique to study gene expression analysis. For accurate and reliable results, normalization of data with reference genes is essential. In this work, we evaluate the stability of expression of genes to use as reference for qRT-PCR in the grass P. virgatum. Eleven candidate reference genes, including eEF-1α, UBQ6, ACT12, TUB6, eIF-4a, GAPDH, SAMDC, TUA6, CYP5, U2AF, and FTSH4, were validated for qRT-PCR normalization in different plant tissues and under different stress conditions. The expression stability of these genes was verified by the use of two distinct algorithms, geNorm and NormFinder. Differences were observed after comparison of the ranking of the candidate reference genes identified by both programs but eEF-1α, eIF-4a, CYP5 and U2AF are ranked as the most stable genes in the samples sets under study. Both programs discard the use of SAMDC and TUA6 for normalization. Validation of the reference genes proposed by geNorm and NormFinder were performed by normalization of transcript abundance of a group of target genes in different samples. Results show similar expression patterns when the best reference genes selected by both programs were used but differences were detected in the transcript abundance of the target genes. Based on the above research, we recommend the use of different statistical algorithms to identify the best reference genes for expression data normalization. The best genes selected in this study will help to improve the quality of gene expression data in a wide variety of samples in switchgrass.

  16. Identification of normalization factors for quantitative real-time RT-PCR analysis of gene expression in Pacific abalone Haliotis discus hannai

    Science.gov (United States)

    Qiu, Reng; Sun, Boguang; Fang, Shasha; Sun, Li; Liu, Xiao

    2013-03-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is widely used in studies of gene expression. In most of these studies, housekeeping genes are used as internal references without validation. To identify appropriate reference genes for qRT-PCR in Pacific abalone Haliotis discus hannai, we examined the transcription stability of six housekeeping genes in abalone tissues in the presence and absence of bacterial infection. For this purpose, abalone were infected with the bacterial pathogen Vibrio anguillarum for 12 h and 48 h. The mRNA levels of the housekeeping genes in five tissues (digestive glands, foot muscle, gill, hemocyte, and mantle) were determined by qRT-PCR. The PCR data was subsequently analyzed with the geNorm and NormFinder algorithms. The results show that in the absence of bacterial infection, elongation factor-1-alpha and beta-actin were the most stably expressed genes in all tissues, and thus are suitable as cross-tissue type normalization factors. However, we did not identify any universal reference genes post infection because the most stable genes varied between tissue types. Furthermore, for most tissues, the optimal reference genes identified by both algorithms at 12 h and 48 h post-infection differed. These results indicate that bacterial infection induced significant changes in the expression of abalone housekeeping genes in a manner that is dependent on tissue type and duration of infection. As a result, different normalization factors must be used for different tissues at different infection points.

  17. Diagnosis of Barmah Forest Virus Infection by a Nested Real-Time SYBR Green RT-PCR Assay

    OpenAIRE

    Hueston, Linda; Toi, Cheryl S.; Jeoffreys, Neisha; Sorrell, Tania; Gilbert, Gwendolyn

    2013-01-01

    Barmah Forest virus (BFV) is a mosquito borne (+) ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR ne...

  18. Pandemic preparedness in Hawaii: a multicenter verification of real-time RT-PCR for the direct detection of influenza virus types A and B.

    Science.gov (United States)

    Whelen, A Christian; Bankowski, Matthew J; Furuya, Glenn; Honda, Stacey; Ueki, Robert; Chan, Amelia; Higa, Karen; Kumashiro, Diane; Moore, Nathaniel; Lee, Roland; Koyamatsu, Terrie; Effler, Paul V

    2010-01-01

    We integrated multicenter, real-time (RTi) reverse transcription polymerase chain reaction (RT-PCR) screening into a statewide laboratory algorithm for influenza surveillance and response. Each of three sites developed its own testing strategy and was challenged with one randomized and blinded panel of 50 specimens previously tested for respiratory viruses. Following testing, each participating laboratory reported its results to the Hawaii State Department of Health, State Laboratories Division for evaluation and possible discrepant analysis. Two of three laboratories reported a 100% sensitivity and specificity, resulting in a 100% positive predictive value and a 100% negative predictive value (NPV) for influenza type A. The third laboratory showed a 71% sensitivity for influenza type A (83% NPV) with 100% specificity. All three laboratories were 100% sensitive and specific for the detection of influenza type B. Discrepant analysis indicated that the lack of sensitivity experienced by the third laboratory may have been due to the analyte-specific reagent probe used by that laboratory. Use of a newer version of the product with a secondary panel of 20 specimens resulted in a sensitivity and specificity of 100%. All three laboratories successfully verified their ability to conduct clinical testing for influenza using diverse nucleic acid extraction and RTi RT-PCR platforms. Successful completion of the verification by all collaborating laboratories paved the way for the integration of those facilities into a statewide laboratory algorithm for influenza surveillance and response.

  19. Diagnosis of Barmah Forest virus infection by a nested real-time SYBR green RT-PCR assay.

    Directory of Open Access Journals (Sweden)

    Linda Hueston

    Full Text Available Barmah Forest virus (BFV is a mosquito borne (+ ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR negative. Two culture-positive (neutralizing antibody negative samples were positive on first round PCR, while one sample (IgM and neutralizing antibody strongly positive, IgG negative was positive on second round PCR, suggesting that viral RNA is detectable and transiently present in early infection. PCR can provide results faster than culture, is capable of high throughput and by sequencing the PCR product strain variants can be characterized.

  20. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  1. Simultaneous detection of Zika, Chikungunya and Dengue viruses by a multiplex real-time RT-PCR assay.

    Science.gov (United States)

    Pabbaraju, Kanti; Wong, Sallene; Gill, Kara; Fonseca, Kevin; Tipples, Graham A; Tellier, Raymond

    2016-10-01

    In the recent past, arboviruses such as Chikungunya (CHIKV) and Zika (ZIKV) have increased their area of endemicity and presented as an emerging global public health threat. To design an assay for the simultaneous detection of ZIKV, CHIKV and Dengue (DENV) 1-4 from patients with symptoms of arboviral infection. This would be advantageous because of the similar clinical presentation typically encountered with these viruses and their co-circulation in endemic areas. In this study we have developed and validated a triplex real time reverse transcription PCR assay using hydrolysis probes targeting the non-structural 5 (NS5) region of ZIKV, non-structural protein 4 (nsP4) from CHIKV and 3' untranslated region (3'UTR) of DENV 1-4. The 95% LOD by the triplex assay was 15 copies/reaction for DENV-1 and less than 10 copies/reaction for all other viruses. The triplex assay was 100% specific and did not amplify any of the other viruses tested. The assay was reproducible and adaptable to testing different specimen types including serum, plasma, urine, placental tissue, brain tissue and amniotic fluid. This assay can be easily implemented for diagnostic testing of patient samples, even in a high throughput laboratory. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Development of a real-time RT-PCR assay for the simultaneous identification, quantitation and differentiation of avian metapneumovirus subtypes A and B.

    Science.gov (United States)

    Cecchinato, Mattia; Lupini, Caterina; Munoz Pogoreltseva, Olga Svetlana; Listorti, Valeria; Mondin, Alessandra; Drigo, Michele; Catelli, Elena

    2013-01-01

    In recent years, special attention has been paid to real-time polymerase chain reaction (PCR) for avian metapneumovirus (AMPV) diagnosis, due to its numerous advantages over classical PCR. A new multiplex quantitative real-time reverse transcription-PCR (qRT-PCR) with molecular beacon probe assay, designed to target the SH gene, was developed. The test was evaluated in terms of specificity, sensitivity and repeatability, and compared with conventional RT nested-PCR based on the G gene. All of the AMPV subtype A and B strains tested were amplified and specifically detected while no amplification occurred with other non-target bird respiratory pathogens. The detection limit of the assay was 10(-0.41) median infectious dose/ml and 10(1.15) median infectious dose/ml when the AMPV-B strain IT/Ty/B/Vr240/87 and the AMPV-A strain IT/Ty/A/259-01/03 were used, respectively, as templates. In all cases, the amplification efficiency was approximately 2 and the error values were 0.9375) between crossing point values and virus quantities, making the assay herein designed reliable for quantification. When the newly developed qRT-PCR was compared with a conventional RT nested-PCR, it showed greater sensitivity with RNA extracted from both positive controls and from experimentally infected birds. This assay can be effectively used for the detection, identification, differentiation and quantitation of AMPV subtype A or subtype B to assist in disease diagnosis and to carry out rapid surveillance with high levels of sensitivity and specificity.

  3. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    International Nuclear Information System (INIS)

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues or cells under investigation

  4. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    Directory of Open Access Journals (Sweden)

    Radtke Arnold

    2008-11-01

    Full Text Available Abstract Background Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR. The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC is presented. Methods Six genes, beta-2-microglobulin (B2M, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, hydroxymethyl-bilane synthase (HMBS, hypoxanthine phosphoribosyl-transferase 1 (HPRT1, succinate dehydrogenase complex, subunit A (SDHA and ubiquitin C (UBC, with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. Results HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Conclusion Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the

  5. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    Science.gov (United States)

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Background Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Methods Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. Results HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Conclusion Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues

  6. The effect of various disinfectants on detection of avian influenza virus by real time RT-PCR.

    Science.gov (United States)

    Suarez, D L; Spackman, E; Senne, D A; Bulaga, L; Welsch, A C; Froberg, K

    2003-01-01

    An avian influenza (AI) real time reverse transcriptase-polymerase chain reaction (RRT-PCR) test was previously shown to be a rapid and sensitive method to identify AI virus-infected birds in live-bird markets (LBMs). The test can also be used to identify avian influenza virus (AIV) from environmental samples. Consequently, the use of RRT-PCR was being considered as a component of the influenza eradication program in the LBMs to assure that each market was properly cleaned and disinfected before allowing the markets to be restocked. However, the RRT-PCR test cannot differentiate between live and inactivated virus, particularly in environmental samples where the RRT-PCR test potentially could amplify virus that had been inactivated by commonly used disinfectants, resulting in a false positive test result. To determine whether this is a valid concern, a study was conducted in three New Jersey LBMs that were previously shown to be positive for the H7N2 AIV. Environmental samples were collected from all three markets following thorough cleaning and disinfection with a phenolic disinfectant. Influenza virus RNA was detected in at least one environmental sample from two of the three markets when tested by RRT-PCR; however, all samples were negative by virus isolation using the standard egg inoculation procedure. As a result of these findings, laboratory experiments were designed to evaluate several commonly used disinfectants for their ability to inactivate influenza as well as disrupt the RNA so that it could not be detected by the RRT-PCR test. Five disinfectants were tested: phenolic disinfectants (Tek-trol and one-stroke environ), a quaternary ammonia compound (Lysol no-rinse sanitizer), a peroxygen compound (Virkon-S), and sodium hypochlorite (household bleach). All five disinfectants were effective at inactivating AIV at the recommended concentrations, but AIV RNA in samples inactivated with phenolic and quaternary ammonia compounds could still be detected by RRT

  7. Comparison of real-time SYBR green dengue assay with real-time taqman RT-PCR dengue assay and the conventional nested PCR for diagnosis of primary and secondary dengue infection

    Science.gov (United States)

    Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee

    2011-01-01

    Background: Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conventional nested PCR (modified Lanciotti). Materials and Methods: Eight cultured virus strains were diluted in tenth dilution down to undetectable level by the PCR to optimize the primer, temperature (annealing, and extension and to detect the limit of detection of the assay. Hundred and ninety three ELISA and PCR proved dengue clinical samples were tested with real time SYBR® Green assay, real time Taqman® assay to compare the sensitivity and specificity. Results: Sensitivity and specificity of real time SYBR® green dengue assay (84% and 66%, respectively) was almost comparable to those (81% and 74%) of Taqman real time PCR dengue assay. Real time SYBR® green RT-PCR was equally sensitive in primary and secondary infection while real time Taqman was less sensitive in the secondary infection. Sensitivity of real time Taqman on DENV3 (87%) was equal to SYBR green real time PCR dengue assay. Conclusion: We developed low cost rapid diagnostic SYBR green dengue assay. Further study is needed to make duplex primer assay for the serotyping of dengue virus. PMID:22363089

  8. Intra-laboratory validation of chronic bee paralysis virus quantitation using an accredited standardised real-time quantitative RT-PCR method.

    Science.gov (United States)

    Blanchard, Philippe; Regnault, Julie; Schurr, Frank; Dubois, Eric; Ribière, Magali

    2012-03-01

    Chronic bee paralysis virus (CBPV) is responsible for chronic bee paralysis, an infectious and contagious disease in adult honey bees (Apis mellifera L.). A real-time RT-PCR assay to quantitate the CBPV load is now available. To propose this assay as a reference method, it was characterised further in an intra-laboratory study during which the reliability and the repeatability of results and the performance of the assay were confirmed. The qPCR assay alone and the whole quantitation method (from sample RNA extraction to analysis) were both assessed following the ISO/IEC 17025 standard and the recent XP U47-600 standard issued by the French Standards Institute. The performance of the qPCR assay and of the overall CBPV quantitation method were validated over a 6 log range from 10(2) to 10(8) with a detection limit of 50 and 100 CBPV RNA copies, respectively, and the protocol of the real-time RT-qPCR assay for CBPV quantitation was approved by the French Accreditation Committee. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. [Detecting HB-1 Expression Level in Bone Marrow of Acute Leukemia Patients by Real-Time Fluorescence Quantitative RT-PCR].

    Science.gov (United States)

    Wang, Qing-Yun; Li, Yuan; Ji, Li; Liang, Ze-Yin; Liu, Wei; Ren, Han-Yun; Qiu, Zhi-Xiang

    2018-02-01

    To investigate the expression level of HB-1 gene in patients with acute lymphoblastic leukemia (ALL) and the significance of HB-1 gene in monitoring of minimal residual disease (MRD). The method of real-time fluorescence quantitative RT-PCR (Taqman probe) was established to detect the expression levels of HB-1 gene; then the sensitivity, specificity and repeatability of this assay were evaluated and verified. The HB-1 gene expression levels in bone marrow of 183 cases of ALL, 70 cases of acute myeloid leukemias (AML), 52 cases of non-malignant hematologic diseases and 24 healthy hematopoietic stem cell donors were detected. The correlation of HB-1 level with diagnosis and relapse was analyzed by detecting bone marrow samples of 33 B-ALL. The sensitivity of this assay reached the 10 -4 level. The coefficient of variation for inter-batch and inter-tube of HB-1 were 6.79% and 4.80%, respectively. It was found that HB-1 gene specifically expressed in acute B lymphoblastic leukemia. The median expression levels of HB-1 gene in newly diagnosed and relapsed B-ALL patients were statistically significantly higher than those in ALL in complete remission(CR), newly diagnosed T-ALL, newly diagnosed AML, non-malignant hematologic diseases, and healthy hematopoietic stem cell donors(33.0% vs 0.68%, 0.07%, 0.02%, 0.58% and 0, respectively) (P0.05). The expression level of HB-1 gene declined sharply when B-ALL patients reached complete remission (0-7.99%, with median level 0.68%), but increased when relapsed (7.69%, 8.08% and 484.0% in 3 relapsed samples), which was in accordance with results of flow cytometry. HB-1 gene specifically expressed in acute B lymphoblastic leukemia cells. The established real-time fluorescence quantitative RT-PCR assay shows good sensitivity, specificity and repeatability, thus, can be used as a biological marker in the clinical detection, monitoring MRD and predicting of early relapse for B-ALL patients.

  10. Use of quantitative real-time RT-PCR to investigate the correlation between viremia and viral shedding of canine distemper virus, and infection outcomes in experimentally infected dogs.

    Science.gov (United States)

    Sehata, Go; Sato, Hiroaki; Ito, Toshihiro; Imaizumi, Yoshitaka; Noro, Taichi; Oishi, Eiji

    2015-07-01

    We used real-time RT-PCR and virus titration to examine canine distemper virus (CDV) kinetics in peripheral blood and rectal and nasal secretions from 12 experimentally infected dogs. Real-time RT-PCR proved extremely sensitive, and the correlation between the two methods for rectal and nasal (r=0.78, 0.80) samples on the peak day of viral RNA was good. Although the dogs showed diverse symptoms, viral RNA kinetics were similar; the peak of viral RNA in the symptomatic dogs was consistent with the onset of symptoms. These results indicate that real-time RT-PCR is sufficiently sensitive to monitor CDV replication in experimentally infected dogs regardless of the degree of clinical manifestation and suggest that the peak of viral RNA reflects active CDV replication.

  11. Laboratory validation of two real-time RT-PCR methods with 5'-tailed primers for an enhanced detection of foot-and-mouth disease virus.

    Science.gov (United States)

    Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris

    2017-08-01

    The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Quantitation of O6-methylguanine-DNA methyltransferase gene messenger RNA in gliomas by means of real-time RT-PCR and clinical response to nitrosoureas.

    Science.gov (United States)

    Tanaka, Satoshi; Oka, Hidehiro; Fujii, Kiyotaka; Watanabe, Kaoru; Nagao, Kumi; Kakimoto, Atsushi

    2005-09-01

    1. O6-methylguanine-DNA methyltransferase (MGMT) mRNA was measured in 50 malignant gliomas that had received 1-(4-amino-2-methyl-5-pyrimidynyl) methyl-3-(2-chloroethyl)-3-nitrosourea hydrochloride (ACNU) after the resection of the tumor by real-time reverse transcription-polymerase chain reaction (RT-PCR) using TaqMan probe. 2. The mean absolute value of MGMTmRNA normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for 50 tumors was 1.29 x 10(4)+/- 1.28 x 10(4) copy/microg RNA (mean +/- SD). The amount of MGMTmRNA less than 6 x 10(3) copy/microg RNA was the most significant factor in predicting the initial effect of treatment with ACNU by multi-variant regression analysis (p = 0.0157). 3. These results suggest that quantitation of MGMTmRNA is the excellent method for predicting for the effect of ACNU in glioma therapy.

  13. High-level expression of podoplanin in benign and malignant soft tissue tumors: immunohistochemical and quantitative real-time RT-PCR analysis.

    Science.gov (United States)

    Xu, Yongjun; Ogose, Akira; Kawashima, Hiroyuki; Hotta, Tetsuo; Ariizumi, Takashi; Li, Guidong; Umezu, Hajime; Endo, Naoto

    2011-03-01

    Podoplanin is a 38 kDa mucin-type transmembrane glycoprotein that was first identified in rat glomerular epithelial cells (podocytes). It is expressed in normal lymphatic endothelium, but is absent from vascular endothelial cells. D2-40 is a commercially available mouse monoclonal antibody which binds to an epitope on human podoplanin. D2-40 immunoreactivity is therefore highly sensitive and specific for lymphatic endothelium. Recent investigations have shown widespread applications of immunohistochemical staining with D2-40 in evaluating podoplanin expression as an immunohistochemical marker for diagnosis and prognosis in various tumors. To determine whether the podoplanin (D2-40) antibody may be useful for the diagnosis of soft tissue tumors, 125 cases, including 4 kinds of benign tumors, 15 kinds of malignant tumors and 3 kinds of tumor-like lesions were immunostained using the D2-40 antibody. Total RNA was extracted from frozen tumor tissue obtained from 41 corresponding soft tissue tumor patients and 12 kinds of soft tissue tumor cell lines. Quantitative real-time PCR reactions were performed. Immunohistochemical and quantitative real-time RT-PCR analyses demonstrated the expression of the podoplanin protein and mRNA in the majority of benign and malignant soft tissue tumors and tumor-like lesions examined, with the exception of alveolar soft part sarcoma, embryonal and alveolar rhabdomyosarcoma, extraskeletal Ewing's sarcoma/peripheral primitive neuro-ectodermal tumor and lipoma, which were completely negative for podoplanin. Since it is widely and highly expressed in nearly all kinds of soft tissue tumors, especially in spindle cell sarcoma, myxoid type soft tissue tumors and soft tissue tumors of the nervous system, podoplanin is considered to have little value in the differential diagnosis of soft tissue tumors.

  14. Detection and characterization of Newcastle disease virus in clinical samples using real time RT-PCR and melting curve analysis based on matrix and fusion genes amplification

    Directory of Open Access Journals (Sweden)

    Saad Sharawi

    2013-10-01

    Full Text Available Aim: Newcastle disease is still one of the major threats for poultry industry allover the world. Therefore, attempt was made in this study to use the SYBR Green I real-time PCR with melting curves analysis as for detection and differentiation of NDV strains in suspected infected birds. Materials and Methods: Two sets of primers were used to amplify matrix and fusion genes in samples collected from suspectly infected birds (chickens and pigeons. Melting curve analysis in conjunction with real time PCR was conducted for identifying different pathotypes of the isolated NDVs. Clinical samples were propagated on specific pathogen free ECE and tested for MDT and ICIP. Results: The velogenic NDVs isolated from chickens and pigeons were distinguished with mean T 85.03±0.341 and m 83.78±0.237 respectively for M-gene amplification and for F-gene amplification the mean T were 84.04±0.037 and m 84.53±0.223. On the other hand the lentogenic NDV isolates including the vaccinal strains (HB1 and LaSota have a higher mean T (86.99±0.021 for M-gene amplification and 86.50±0.063 for F-gene amplification. The test showed no reaction with m unrelated RNA samples. In addition, the results were in good agreement with both virus isolation and biological pathotyping (MDT and ICIP. The assay offers an attractive alternative method for the diagnosis of NDV that can be easily applied in laboratory diagnosis as a screening test for the detection and differentiation of NDV infections. Conclusion: As was shown by the successful rapid detection and pathotyping of 15 NDV strains in clinical samples representing velogenic and lentogenic NDV strains, and the agreement with the results of virus isolation , biological pathotyping and pathogenicity indices. The results of this report suggests that the described SybrGreen I real-time RT-PCR assay in conjunction with Melting curve analysis used as a rapid, specific and simple diagnostic tools for detection and pathotyping of

  15. Evaluation of the Xpert Flu test and comparison with in-house real-time RT-PCR assays for detection of influenza virus from 2008 to 2011 in Marseille, France.

    Science.gov (United States)

    Salez, N; Ninove, L; Thirion, L; Gazin, C; Zandotti, C; de Lamballerie, X; Charrel, R N

    2012-04-01

    Rapid documentation of respiratory specimens can have an impact on the management of patients and their relatives in terms of preventive and curative measures. We compared the results of the Xpert(®) Flu assay (Cepheid) with three real-time RT-PCR assays using 127 nasopharyngeal samples, of which 75 were positive for influenza A (with 52 identified as A/H1N1-2009) and 52 were positive for influenza B. The Xpert(®) Flu assay presented a quasi-absence of non-interpretable tests, and showed sensitivity and specificity of 100% and 100% for Flu A, 98.4% and 100% for A/H1N1-2009, and 80.7% and 100% for Flu B. © 2012 The Authors. Clinical Microbiology and Infection © 2012 European Society of Clinical Microbiology and Infectious Diseases.

  16. Development of single step RT-PCR for detection of Kyasanur forest disease virus from clinical samples

    Directory of Open Access Journals (Sweden)

    Gouri Chaubal

    2018-02-01

    Discussion and conclusion: The previously published sensitive real time RT-PCR assay requires higher cost in terms of reagents and machine setup and technical expertise has been the primary reason for development of this assay. A single step RT-PCR is relatively easy to perform and more cost effective than real time RT-PCR in smaller setups in the absence of Biosafety Level-3 facility. This study reports the development and optimization of single step RT-PCR assay which is more sensitive and less time-consuming than nested RT-PCR and cost effective for rapid diagnosis of KFD viral RNA.

  17. Development of single-step multiplex real-time RT-PCR assays for rapid diagnosis of enterovirus 71, coxsackievirus A6, and A16 in patients with hand, foot, and mouth disease.

    Science.gov (United States)

    Puenpa, Jiratchaya; Suwannakarn, Kamol; Chansaenroj, Jira; Vongpunsawad, Sompong; Poovorawan, Yong

    2017-10-01

    Real-time reverse-transcription polymerase chain reaction (rRT-PCR) to detect enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) has facilitated the rapid and accurate identification of the two most common etiological agents underlying hand, foot, and mouth disease (HFMD). However, the worldwide emergence of CV-A6 infection in HFMD necessitates development of an improved multiplex rRT-PCR method. To rapidly determine the etiology of HFMD, two rRT-PCR assays using TaqMan probes were developed to differentiate among three selected common enteroviruses (EV-A71, CV-A16 and CV-A6) and to enable broad detection of enteroviruses (pan-enterovirus assay). No cross-reactions were observed with other RNA viruses examined. The detection limits of both assays were 10 copies per microliter for EV-A71, CV-A6 and CV-A16, and pan-enterovirus. The methods showed high accuracy (EV-A71, 90.6%; CV-A6, 92.0%; CV-A16, 100%), sensitivity (EV-A71, 96.5%; CV-A6, 95.8%; CV-A16, 99.0%), and specificity (EV-A71, 100%; CV-A6, 99.9%; CV-A16, 99.9%) in testing clinical specimens (n=1049) during 2014-2016, superior to those of conventional RT-PCR. Overall, the multiplex rRT-PCR assays enabled highly sensitive detection and rapid simultaneous typing of EV-A71, CV-A6 and CV-A16, and enteroviruses, rendering them feasible and attractive methods for large-scale surveillance of enteroviruses associated with HFMD outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Comparison of the genexpert enterovirus assay (GXEA) with real-time one step RT-PCR for the detection of enteroviral RNA in the cerebrospinal fluid of patients with meningitis.

    Science.gov (United States)

    Hong, JiYoung; Kim, Ahyoun; Hwang, Seoyeon; Cheon, Doo-Sung; Kim, Jong-Hyen; Lee, June-Woo; Park, Jae-Hak; Kang, Byunghak

    2015-02-13

    Enteroviruses (EVs) are the leading cause of aseptic meningitis worldwide. Detection of enteroviral RNA in clinical specimens has been demonstrated to improve the management of patient care, especially that of neonates and young children. To establish a sensitive and reliable assay for routine laboratory diagnosis, we compared the sensitivity and specificity of the GeneXpert Enterovirus Assay (GXEA) with that of the reverse transcription polymerase chain reaction (RT-PCR) based assay referred to as real-time one step RT-PCR (RTo-PCR). The sensitivity/specificity produced by GXEA and RTo-PCR were 100%/100% and 65%/100%, respectively. Both methods evaluated in this article can be used for detection of enterovirus in clinical specimens and these nucleic acid amplification methods are useful assays for the diagnosis of enteroviral infection.

  19. Validation of reference genes for gene expression analysis in olive (Olea europaea) mesocarp tissue by quantitative real-time RT-PCR

    Science.gov (United States)

    2014-01-01

    Background Gene expression analysis using quantitative reverse transcription PCR (qRT-PCR) is a robust method wherein the expression levels of target genes are normalised using internal control genes, known as reference genes, to derive changes in gene expression levels. Although reference genes have recently been suggested for olive tissues, combined/independent analysis on different cultivars has not yet been tested. Therefore, an assessment of reference genes was required to validate the recent findings and select stably expressed genes across different olive cultivars. Results A total of eight candidate reference genes [glyceraldehyde 3-phosphate dehydrogenase (GAPDH), serine/threonine-protein phosphatase catalytic subunit (PP2A), elongation factor 1 alpha (EF1-alpha), polyubiquitin (OUB2), aquaporin tonoplast intrinsic protein (TIP2), tubulin alpha (TUBA), 60S ribosomal protein L18-3 (60S RBP L18-3) and polypyrimidine tract-binding protein homolog 3 (PTB)] were chosen based on their stability in olive tissues as well as in other plants. Expression stability was examined by qRT-PCR across 12 biological samples, representing mesocarp tissues at various developmental stages in three different olive cultivars, Barnea, Frantoio and Picual, independently and together during the 2009 season with two software programs, GeNorm and BestKeeper. Both software packages identified GAPDH, EF1-alpha and PP2A as the three most stable reference genes across the three cultivars and in the cultivar, Barnea. GAPDH, EF1-alpha and 60S RBP L18-3 were found to be most stable reference genes in the cultivar Frantoio while 60S RBP L18-3, OUB2 and PP2A were found to be most stable reference genes in the cultivar Picual. Conclusions The analyses of expression stability of reference genes using qRT-PCR revealed that GAPDH, EF1-alpha, PP2A, 60S RBP L18-3 and OUB2 are suitable reference genes for expression analysis in developing Olea europaea mesocarp tissues, displaying the highest level

  20. Performance of a commercial assay for the diagnosis of influenza A (H1N1 infection in comparison to the Centers for Disease Control and Prevention protocol of real time RT-PCR

    Directory of Open Access Journals (Sweden)

    María G Barbás

    2012-03-01

    Full Text Available At the time of influenza A (H1N1 emergency, the WHO responded with remarkable speed by releasing guidelines and a protocol for a real-time RT-PCR assay (rRT-PCR. The aim of the present study was to evalúate the performance of the "Real Time Ready Influenza A/H1N1 Detection Set" (June 2009-Roche kit in comparison to the CDC reference rRT-PCR protocol. The overall sensitivity of the Roche assay for detection of the Inf A gene in the presence or absence of the H1 gene was 74.5 %. The sensitivity for detecting samples that were only positive for the Inf A gene (absence of the H1 gene was 53.3 % whereas the sensitivity for H1N1-positive samples (presence of the Inf A gene and any other swine gene was 76.4 %. The specificity of the assay was 97.1 %. A new version of the kit (November 2009 is now available, and a recent evaluation of its performance showed good sensitivity to detect pandemic H1N1 compared to other molecular assays.Durante la pandemia de influenza A (H1N1, la OMS recomendó algoritmos y protocolos de detección del virus mediante RT-PCR en tiempo real. El objetivo del presente estudio fue evaluar el desempeño del equipo que comercializa la empresa Roche, Real Time Ready Influenza A/H1N1 Detection Set (junio de 2009, en comparación con el protocolo de RT-PCR en tiempo real de los CDC. La sensibilidad global del ensayo de Roche para la detección del gen Inf A en presencia o ausencia del gen H1 fue 74,5 %. La sensibilidad para la detección de muestras positivas solo para el gen Inf A (ausencia del gen H1 fue 53,3 % y la sensibilidad para la detección de muestras positivas para H1N1 (presencia del gen Inf A y cualquier otro gen porcino fue 76,4 %. La especificidad fue 97,1 %. Existe una nueva versión del equipo (noviembre 2009 que, según se ha descrito, presenta buena sensibilidad en comparación con otros ensayos moleculares para detectar H1N1 pandémica.

  1. Real-time RT-PCR analysis of mRNA decay: half-life of Beta-actin mRNA in human leukemia CCRF-CEM and Nalm-6 cell lines

    Directory of Open Access Journals (Sweden)

    Barredo Julio C

    2002-03-01

    Full Text Available Abstract Background We describe an alternative method to determine mRNA half-life (t1/2 based on the Real-Time RT-PCR procedure. This approach was evaluated by using the β-actin gene as a reference molecule for measuring of mRNA stability. Results Human leukemia Nalm-6 and CCRF-CEM cells were treated with various concentrations of Actinomycin D to block transcription and aliquots were removed periodically. Total RNA was isolated and quantified using the RiboGreen® fluorescent dye with the VersaFluor Fluorometer System. One μg of total RNA was reverse transcribed and used as template for the amplification of a region of the β-actin gene (231 bp. To generate the standard curve, serial ten-fold dilutions of the pBactin-231 vector containing the cDNA amplified fragment were employed, β-actin mRNAs were quantified by Real-Time RT-PCR using the SYBR® Green I fluorogenic dye and data analyzed using the iCycle iQ system software. Using this method, the β-actin mRNA exhibited a half-life of 6.6 h and 13.5 h in Nalm-6 and CCRF-CEM cells, respectively. The t1/2 value obtained for Nalm-6 is comparable to those estimated from Northern blot studies, using normal human leukocytes (5.5 h. Conclusions We have developed a rapid, sensitive, and reliable method based on Real-Time RT-PCR for measuring mRNA half-life. Our results confirm that β-actin mRNA half-life can be affected by the cellular growth rate.

  2. Estudio comparativo entre una prueba rápida y RT-PCR tiempo real en el diagnóstico de influenza AH1N1 2009 Comparative study of a rapid testing with real time RT-PCR for diagnosis of influenza AH1N1 2009

    Directory of Open Access Journals (Sweden)

    Luz Araceli Castro-Cárdenas

    2011-08-01

    Full Text Available OBJETIVO: Comparar la prueba QuickVue Influenza A+B empleando como estándar la RT-PCR tiempo real para influenza AH1N1 2009. MATERIAL Y MÉTODOS: Estudio retrospectivo-comparativo de 135 muestras de vías respiratorias de individuos sintomáticos para influenza procesadas de mayo 2009 a octubre 2010.Las pruebas citadas se realizaron simultáneamente. Se utilizó el software Confidence Interval Analysis 2000. RESULTADOS: Sensibilidad 62.96; especificidad 94.44; valor predictivo negativo 62.9; valor predictivo positivo 94.44; razón de probabilidad positiva 11.33 y razón de probabilidad negativa 0.39. Se calcularon intervalos de confianza a 95. DISCUSIÓN: Los valores obtenidos concuerdan con otros estudios donde la sensibilidad fluctúa de 50 a 70 y especificidad entre 90 y 95 por ciento. La prueba QuickVue Influenza A+B es rápida, simple y de menor costo que el RT-PCR tiempo real, útil para identificar el tipo de virus en brotes de influenza de una población determinadaOBJECTIVE: Compare QuickVue Influenza A+B test with real-time RT-PCR for the diagnosis of influenza AH1N1 2009. MATERIAL AND METHODS: Retrospective-comparative study of 135 respiratory specimens from individuals with symptoms of influenza processed from May 2009 to October 2010.The above mentioned tests were performed simultaneously. For statistic analysisthe softwareof Confidence IntervalAnalysis 2000 was used. RESULTS: The parameters obtained were: sensitivity 62.96; specificity 94.44; negative predictive value 62.9; positive predictive value 94.44; positive likelihood ratio 11.33; negative likelihood ratio 0.39. Confidence intervals to 95,were calculated to all of the above data. DISCUSSION: The test QuickVue InfluenzaA+B is a rapid,simple test,with lower cost than real-time RT-PCR useful for identifying the type of virus outbreaks of influenza in a given population.It correlates well with more specific test and similar reports.

  3. Development of tailored real-time RT-PCR assays for the detection and differentiation of serotype O, A and Asia-1 foot-and-mouth disease virus lineages circulating in the Middle East.

    Science.gov (United States)

    Reid, Scott M; Mioulet, Valerie; Knowles, Nick J; Shirazi, Nazeem; Belsham, Graham J; King, Donald P

    2014-10-01

    Rapid and accurate diagnosis is essential for effective control of foot-and-mouth disease (FMD). In countries where FMD is endemic, identification of the serotypes of the causative virus strains is important for vaccine selection and tracing the source of outbreaks. In this study, real-time reverse transcription polymerase chain reaction (rRT-PCR) assays using primer/probe sets designed from the VP1 coding region of the virus genomes were developed for the specific detection of serotype O, A and Asia-1 FMD viruses (FMDVs) circulating in the Middle East. These assays were evaluated using representative field samples of serotype O strains belonging exclusively to the PanAsia-2 lineage, serotype A strains of the Iran-05 lineage and serotype Asia-1 viruses from three relevant sub-groups. When RNA extracted from archival and contemporary field strains was tested using one- or two-step rRT-PCR assays, all three primer/probe sets detected the RNA from homotypic viruses and no cross-reactivity was observed with heterotypic viruses. Similar results were obtained using both single- and multiplex assay formats. Using plasmid standards, the minimum detection level of these tests was found to be lower than two copies. The results illustrate the potential of tailored rRT-PCR tools for the detection and categorization of viruses circulating in the Middle East belonging to distinct subgroups of serotypes O, A and Asia-1. These assays can also overcome the problem of serotyping samples which are found positive by the generic rRT-PCR diagnostic assays but negative by virus isolation and antigen-detection ELISA which would otherwise have to be serotyped by nucleotide sequencing. A similar approach could be used to develop serotyping assays for FMDV strains circulating in other regions of the world. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  4. Real Time RT-PCR with a Newly Designed Set of Promers Confirmed the Presence of 2b and 2x/d Myosim Heavy Chain mRNAs in the Rat Slow Soleus Muscle

    Czech Academy of Sciences Publication Activity Database

    Žurmanová, Jitka; Půta, F.; Stopková, R.; Soukup, Tomáš

    2008-01-01

    Roč. 57, č. 6 (2008), s. 973-978 ISSN 0862-8408 R&D Projects: GA MŠk(CZ) LC554; GA ČR(CZ) GA305/06/1115; GA ČR(CZ) GA304/08/0256 Grant - others:EC(XE) LSH-CT-2004-511978 Institutional research plan: CEZ:AV0Z50110509 Keywords : rat slow soleus muscle * myosin heavy chain isoforms * real time RT-PCR Subject RIV: ED - Physiology Impact factor: 1.653, year: 2008

  5. One-step multiplex real-time RT-PCR assay for detecting and genotyping wild-type group A rotavirus strains and vaccine strains (Rotarix® and RotaTeq®) in stool samples

    Science.gov (United States)

    Mijatovic-Rustempasic, Slavica; Esona, Mathew D.; Tam, Ka Ian; Quaye, Osbourne; Bowen, Michael D.

    2016-01-01

    Background. Group A rotavirus (RVA) infection is the major cause of acute gastroenteritis (AGE) in young children worldwide. Introduction of two live-attenuated rotavirus vaccines, RotaTeq® and Rotarix®, has dramatically reduced RVA associated AGE and mortality in developed as well as in many developing countries. High-throughput methods are needed to genotype rotavirus wild-type strains and to identify vaccine strains in stool samples. Quantitative RT-PCR assays (qRT-PCR) offer several advantages including increased sensitivity, higher throughput, and faster turnaround time. Methods. In this study, a one-step multiplex qRT-PCR assay was developed to detect and genotype wild-type strains and vaccine (Rotarix® and RotaTeq®) rotavirus strains along with an internal processing control (Xeno or MS2 RNA). Real-time RT-PCR assays were designed for VP7 (G1, G2, G3, G4, G9, G12) and VP4 (P[4], P[6] and P[8]) genotypes. The multiplex qRT-PCR assay also included previously published NSP3 qRT-PCR for rotavirus detection and Rotarix® NSP2 and RotaTeq® VP6 qRT-PCRs for detection of Rotarix® and RotaTeq® vaccine strains respectively. The multiplex qRT-PCR assay was validated using 853 sequence confirmed stool samples and 24 lab cultured strains of different rotavirus genotypes. By using thermostable rTth polymerase enzyme, dsRNA denaturation, reverse transcription (RT) and amplification (PCR) steps were performed in single tube by uninterrupted thermocycling profile to reduce chances of sample cross contamination and for rapid generation of results. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Results. The VP7 qRT-PCRs exhibited 98.8–100% sensitivity, 99.7–100% specificity, 85–95% efficiency and a limit of detection of 4–60 copies per singleplex reaction. The VP7 qRT-PCRs exhibited 81–92% efficiency and limit of detection of 150–600 copies in multiplex reactions. The VP4 qRT-PCRs exhibited 98.8

  6. Circadian transitions in radiation dose-dependent augmentation of mRNA levels for DNA damage-induced genes elicited by accurate real-time RT-PCR quantification

    International Nuclear Information System (INIS)

    Ishihara, Hiroshi; Tanaka, Izumi; Yakumaru, Haruko

    2010-01-01

    Molecular mechanisms of intracellular response after DNA-damage by exposure to ionizing radiation have been studied. In the case of cells isolated from living body of human and experimental animals, alteration of the responsiveness by physiological oscillation such as circadian rhythm must be considered. To examine the circadian variation in the response of p53-responsible genes p21, mdm2, bax, and puma, we established a method to quantitate their mRNA levels with high reproducibility and accuracy based on real-time reverse transcription polymerase chain reaction (RT-PCR) and compared the levels of responsiveness in mouse hemocytes after diurnal irradiation to that after nocturnal irradiation. Augmentations of p21 and mdm2 mRNA levels with growth-arrest and of puma mRNA before apoptosis were confirmed by time-course experiment in RAW264.7, and dose-dependent increases in the peak levels of all the RNA were shown. Similarly, the relative RNA levels of p21, mdm2, bax, and puma per glyceraldehyde-3-phosphate dehydrogenase (GAPDH) also increased dose-dependently in peripheral blood and bone marrow cells isolated from whole-body-irradiated mice. Induction levels of all messages reduced by half after nighttime irradiation as compared with daytime irradiation in blood cells. In marrow cells, nighttime irradiation enhanced the p21 and mdm2 mRNA levels than daytime irradiation. No significant difference in bax or puma mRNA levels was observed between nighttime and daytime irradiation in marrow cells. This suggests that early-stage cellular responsiveness in DNA damage-induced genes is modulated between diurnal and nocturnal irradiation. (author)

  7. Selection of housekeeping genes for normalization by real-time RT-PCR: analysis of Or-MYB1 gene expression in Orobanche ramosa development.

    Science.gov (United States)

    González-Verdejo, C I; Die, J V; Nadal, S; Jiménez-Marín, A; Moreno, M T; Román, B

    2008-08-15

    Real-time PCR has become the method of choice for accurate and in-depth expression studies of candidate genes. To avoid bias, real-time PCR is referred to one or several internal control genes that should not fluctuate among treatments. A need for reference genes in the parasitic plant Orobanche ramosa has emerged, and the studies in this area have not yet been evaluated. In this study, the genes 18S rRNA, Or-act1, Or-tub1, and Or-ubq1 were compared in terms of expression stability using the BestKeeper software program. Among the four common endogenous control genes, Or-act1 and Or-ubq1 were the most stable in O. ramosa samples. In parallel, a study was carried out studying the expression of the transcription factor Or-MYB1 that seemed to be implicated during preinfection stages. The normalization strategy presented here is a prerequisite to accurate real-time PCR expression profiling that, among other things, opens up the possibility of studying messenger RNA levels of low-copy-number-like transcription factors.

  8. Real-time RT-PCR systems for CTC detection from blood samples of breast cancer and gynaecological tumour patients (Review).

    Science.gov (United States)

    Andergassen, Ulrich; Kölbl, Alexandra C; Mahner, Sven; Jeschke, Udo

    2016-04-01

    Cells, which detach from a primary epithelial tumour and migrate through lymphatic vessels and blood stream are called 'circulating tumour cells'. These cells are considered to be the main root of remote metastasis and are correlated to a worse prognosis concerning progression-free and overall survival of the patients. Therefore, the detection of the minimal residual disease is of great importance regarding therapeutic decisions. Many different detection strategies are already available, but only one method, the CellSearch® system, reached FDA approval. The present review focusses on the detection of circulating tumour cells by means of real-time PCR, a highly sensitive method based on differences in gene expression between normal and malignant cells. Strategies for an enrichment of tumour cells are mentioned, as well as a large panel of potential marker genes. Drawbacks and advantages of the technique are elucidated, whereas, the greatest advantage might be, that by selection of appropriate marker genes, also tumour cells, which have already undergone epithelial to mesenchymal transition can be detected. Finally, the application of real-time PCR in different gynaecological malignancies is described, with breast cancer being the most studied cancer entity.

  9. Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia.

    Science.gov (United States)

    Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí

    2005-01-01

    Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific

  10. Selection of reference genes for normalisation of real-time RT-PCR in brain-stem death injury in Ovis aries

    Directory of Open Access Journals (Sweden)

    Fraser John F

    2009-07-01

    Full Text Available Abstract Background Heart and lung transplantation is frequently the only therapeutic option for patients with end stage cardio respiratory disease. Organ donation post brain stem death (BSD is a pre-requisite, yet BSD itself causes such severe damage that many organs offered for donation are unusable, with lung being the organ most affected by BSD. In Australia and New Zealand, less than 50% of lungs offered for donation post BSD are suitable for transplantation, as compared with over 90% of kidneys, resulting in patients dying for lack of suitable lungs. Our group has developed a novel 24 h sheep BSD model to mimic the physiological milieu of the typical human organ donor. Characterisation of the gene expression changes associated with BSD is critical and will assist in determining the aetiology of lung damage post BSD. Real-time PCR is a highly sensitive method involving multiple steps from extraction to processing RNA so the choice of housekeeping genes is important in obtaining reliable results. Little information however, is available on the expression stability of reference genes in the sheep pulmonary artery and lung. We aimed to establish a set of stably expressed reference genes for use as a standard for analysis of gene expression changes in BSD. Results We evaluated the expression stability of 6 candidate normalisation genes (ACTB, GAPDH, HGPRT, PGK1, PPIA and RPLP0 using real time quantitative PCR. There was a wide range of Ct-values within each tissue for pulmonary artery (15–24 and lung (16–25 but the expression pattern for each gene was similar across the two tissues. After geNorm analysis, ACTB and PPIA were shown to be the most stably expressed in the pulmonary artery and ACTB and PGK1 in the lung tissue of BSD sheep. Conclusion Accurate normalisation is critical in obtaining reliable and reproducible results in gene expression studies. This study demonstrates tissue associated variability in the selection of these

  11. [Validation of a real time RT-PCR assay to detect foot-and-mouth disease virus and assessment of its performance in acute infection].

    Science.gov (United States)

    Fondevila, Norberto; Compaired, Diego; Maradei, Eduardo; Duffy, Sergio

    2014-01-01

    A specific real time reverse transcription polymerase chain reaction (RT-PCRrt) for the detection of foot-and-mouth disease virus was validated using the LightCycler thermocycler 2.0 and its reagents as recommended by the World Organization for Animal Health and was assessed for the detection of the virus in acute infection of cattle experimentally vaccinated and challenged with virus A Argentina/2001 or A24 Cruzeiro. The technique proved to be robust, showing coefficients of variation lower than 4% for different ARN extractions, days or repetitions and was able to detect up to 0,4 TCID 50%, and/or up to 100 RNA molecules. In probang samples, diagnostic sensitivity was 93.1 (95% CI 86.5-96.6) and diagnostic specificity 100 (95% CI 96.3-100). The results of the challenge in vaccinated or multivaccinated bovines showed that although there were high levels of clinical protection in the vaccinated group, FMDV could be detected in all challenged groups. However, detection was 100 times lower in immunized animals. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.

  12. Validation of a norovirus multiplex real-time RT-PCR assay for the detection of norovirus GI and GII from faeces samples.

    LENUS (Irish Health Repository)

    Jones, S

    2011-01-01

    Norovirus is a leading cause of infectious non-bacterial gastroenteritis. The virus is highly contagious and has multiple modes of transmission, presenting a growing challenge to hospital-based healthcare. In this study, a total of 120 stool samples are tested for the presence of norovirus GI and GII by the Roche two-step Lightcycler 2.0 assay incorporating primers and probes produced by TIB Molbiol, and the results are compared with results from the National Virus Reference Laboratory. The Roche\\/TIB Molbiol assay produced 51 positive results and 69 negative results. Discrepancy analysis was performed for six conflicting results using a second real-time polymerase chain reaction (PCR) assay (Roche\\/TIB Molbiol) and this confirmed that four of the five discrepant positive results were true positives. A single discrepant negative result generated by the Roche assay remained negative using the second assay. Sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) were calculated to be 98%, 98.6%, 98.0% and 98.6%, respectively. Melting curve analysis was used to differentiate genogroups I and II and this showed that 92% of strains belonged to genogroup II.

  13. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Directory of Open Access Journals (Sweden)

    Shiyin Zhang

    Full Text Available The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD, which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71 and coxsackie A16 (CA16 are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  14. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Science.gov (United States)

    Zhang, Shiyin; Wang, Jin; Yan, Qiang; He, Shuizhen; Zhou, Wenbin; Ge, Shengxiang; Xia, Ningshao

    2014-01-01

    The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD), which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71) and coxsackie A16 (CA16) are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs) in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  15. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data

    Directory of Open Access Journals (Sweden)

    Alves-Ferreira Marcio

    2010-03-01

    Full Text Available Abstract Background Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR. Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. Results By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1α5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhβTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. Conclusion We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references

  16. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data.

    Science.gov (United States)

    Artico, Sinara; Nardeli, Sarah M; Brilhante, Osmundo; Grossi-de-Sa, Maria Fátima; Alves-Ferreira, Marcio

    2010-03-21

    Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR). Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1alpha5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhbetaTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references for normalization of gene expression measures in

  17. Transcript Quantification of Genes Involved in Steviol Glycoside Biosynthesis in Stevia rebaudiana Bertoni by Real-Time Polymerase Chain Reaction (RT-PCR).

    Science.gov (United States)

    Modi, Arpan; Kumar, Nitish; Narayanan, Subhash

    2016-01-01

    Stevia (Stevia rebaudiana Bertoni) is a medicinal plant having sweet, diterpenoid glycosides known as steviol glycosides which are 200-300 times sweeter than sucrose (0.4 % solution). They are synthesized mainly in the leaves via plastid localized 2-C-methyl-D-erythrose-4-phosphate pathway (MEP pathway). Fifteen genes are involved in the formation of these glycosides. In the present protocol, a method for the quantification of transcripts of these genes is shown. The work involves RNA extraction and cDNA preparation, and therefore, procedures for the confirmation of DNA-free cDNA preparation have also been illustrated. Moreover, details of plant treatments are not mentioned as this protocol may apply to relative gene expression profile in any medicinal plant with any treatment. The treatments are numbered as T0 (Control), T1, T2, T3, and T4.

  18. Real-time RT-PCR expression analysis of chitinase and endoglucanase genes in the three-way interaction between the biocontrol strain Clonostachys rosea IK726, Botrytis cinera and strawberry

    DEFF Research Database (Denmark)

    Mamarabadi, Mojtaba; Jensen, Birgit; Jensen, Søren Dan Funck

    2008-01-01

    Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two endoglucan......Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two...... endoglucanase genes from C. rosea strain IK726 was analyzed using real-time RT-PCR in vitro and in strawberry leaves during interaction with B. cinerea. Specific primers were designed for ß-tubulin genes from C. rosea and B. cinerea, respectively, and a gene encoding a DNA-binding protein (DBP) from strawberry......, allowing in situ activity assessment of each fungus in vitro and during their interaction on strawberry leaves. Growth of B. cinerea was inhibited in all pathogen-antagonist interactions while the activity of IK726 was slightly increased. In all in vitro interactions, four of the six genes were upregulated...

  19. Comparative evaluation of the CerTest VIASURE flu A, B & RSV real time RT-PCR detection kit on the BD MAX system versus a routine in-house assay for detection of influenza A and B virus during the 2016/17 influenza season

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Bek-Thomsen, Malene; Andersen, Signe Dalsgaard

    2018-01-01

    laboratory technician "hands on" time but also the laboratory turnaround time is of interest. OBJECTIVES: We evaluated the performance of the VIASURE Flu A, B & RSV Real Time RT-PCR Detection Kit (CerTest Biotec) for detecting Influenza A and B viruses. STUDY DESIGN: During the 2016/17 influenza season 532...

  20. Development of tailored real-time RT-PCR assays for the detection and differentiation of serotype O, A and Asia-1 foot-and-mouth disease virus lineages circulating in the Middle East

    DEFF Research Database (Denmark)

    Reid, Scott M.; Mioulet, Valerie; Knowles, Nick J.

    2014-01-01

    transcription polymerase chain reaction (rRT-PCR) assays using primer/probe sets designed from the VP1 coding region of the virus genomes were developed for the specific detection of serotype O, A and Asia-1 FMD viruses (FMDVs) circulating in the Middle East. These assays were evaluated using representative...... by the generic rRT-PCR diagnostic assays but negative by virus isolation and antigen-detection ELISA which would otherwise have to be serotyped by nucleotide sequencing. A similar approach could be used to develop serotyping assays for FMDV strains circulating in other regions of the world....

  1. Accuracy of rapid influenza diagnostic test and immunofluorescence assay compared to real time RT-PCR in children with influenza A(H1N1pdm09 infection 

    Directory of Open Access Journals (Sweden)

    Aneta Nitsch-Osuch

    2012-10-01

    Full Text Available  Introduction:The influenza burden among children is underestimated. The aim of our study was to estimate the accuracy of the rapid influenza detection test (RIDT BD Directigen™ EZ Flu A B® and direct immunofluorescence assay (DFA used among children with influenza-like illness (ILI consulted in the ambulatory care clinic.Material/Methods:A total of 150 patients were enrolled in the study. Inclusion criteria were: age less than 59 months, presentation of ILI according to the CDC (Centers for Disease Control and Prevention definition (fever >37.8°C, cough and/or sore throat in the absence of another known cause of illness, duration of symptoms shorter than 96 hours. Two nasal swabs and one pharyngeal swab were obtained from patients and tested by RIDT, DFA and real time RT-PCR as the reference method.Results:For influenza A (H1N1pdm09 virus sensitivity of RIDT was 62.2�0(95�0CI 46.5–76.2� specificity 97.1�0(95�0CI 91.8–99.4� PPV 90.3�0(95�0CI 74.3–98� NPV 85.7�0(95�0CI 78.1–91.5� for DFA sensitivity was 60�0(95�0CI 51.9–63.2� specificity 96�0(95�0CI 88.7–98.8� PPV 93.1�0(95�0CI 80.5–98� NPV 72.7�0(95�0CI 67.2–74.9� Analysis of logistic regression revealed that the chance of receiving a true positive result of RIDT was twice as high when the test was conducted during the first 48 hours of symptoms (OR 0.40 vs OR 0.22.Conclusions:The accuracy of RIDT is comparable with DFA and both methods are very specific but moderately sensitive in diagnosis of influenza in young children. Both methods may be recommended for screening for influenza among children.

  2. Evaluation of the suitability of six host genes as internal control in real-time RT-PCR assays in chicken embryo cell cultures infected with infectious bursal disease virus

    DEFF Research Database (Denmark)

    Li, Yiping; Bang, Dang Duong; Handberg, Kurt

    2005-01-01

    following a 7-day IBDV infection. The CE cells were inoculated with various multiplicity of infection (MOI) of IBDV vaccine strain Bursine-2, the expression of genes was measured by quantitative real-time PCR-based on cDNA synthesized from either normalized (100 ng) or non-normalized (10 mu l) total RNA...

  3. Field evaluation of an open and polyvalent universal HIV-1/SIVcpz/SIVgor quantitative RT-PCR assay for HIV-1 viral load monitoring in comparison to Abbott RealTime HIV-1 in Cameroon.

    Science.gov (United States)

    Guichet, Emilande; Aghokeng, Avelin; Eymard-Duvernay, Sabrina; Vidal, Nicole; Ayouba, Ahidjo; Mpoudi Ngole, Eitel; Delaporte, Eric; Ciaffi, Laura; Peeters, Martine

    2016-11-01

    With the increasing demand of HIV viral load (VL) tests in resource-limited countries (RLCs) there is a need for assays at affordable cost and able to quantify all known HIV-1 variants. VLs obtained with a recently developed open and polyvalent universal HIV-1/SIVcpz/SIVgor RT-qPCR were compared to Abbott RealTime HIV-1 assay in Cameroon. On 474 plasma samples, characterized by a wide range of VLs and a broad HIV-1 group M genetic diversity, 97.5% concordance was observed when using the lower detection limit of each assay. When using the threshold of 3.00 log 10 copies/mL, according to WHO guidelines to define virological failure (VF) in RLCs, the concordance was 94.7%, 360/474 versus 339/474 patients were identified with VF with the new assay and Abbott RealTime HIV-1, respectively. Higher VLs were measured with the new assay, +0.47 log 10 copies/mL (95% CI; 0.42-0.52) as shown with Bland-Altman analysis. Eleven samples from patients on VF with drug resistance were not detected by Abbott RealTime HIV-1 versus two only with the new assay. Overall, our study showed that the new assay can be easily implemented in a laboratory in RLCs with VL experience and showed good performance on a wide diversity of HIV-1 group M variants. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Development and Characterization of Probe-Based Real Time Quantitative RT-PCR Assays for Detection and Serotyping of Foot-And-Mouth Disease Viruses Circulating in West Eurasia

    DEFF Research Database (Denmark)

    Jamal, Syed M.; Belsham, Graham

    2015-01-01

    Asia,A-Iran05 and Asia-1 (Group-II and Group-VII (Sindh-08)). In addition, field samples from Iran and Bulgaria, containing FMDVs belonging to the O-PanAsiaANT-10 subline-agewere also tested. Each of the three primer/probe sets was designed to be specific for just one of the serotypes O, A and Asia-1 of FMDV....... Due to the heterogeneity of FMD viruses (FMDVs) in different parts of the world, region specific diagnostic tests are required. In this study, hydrolysableprobe-based real time reverse transcription quantitative polymerase chain reaction (RTqPCR) assays were developed for specific detection...... and serotyping of the FMDVs currently circulating in West Eurasia. These assays were evaluated, in parallel with pan-FMDV diagnosticassays and earlier serotype-specific assays, using field samples originating from Pakistan and Afghanistan containing FMD viruses belonging to different sublineages of OPan...

  5. Development and evaluation of a real-time RT-PCR assay for the detection of Ebola virus (Zaire) during an Ebola outbreak in Guinea in 2014-2015.

    Science.gov (United States)

    Dedkov, V G; Magassouba, N' F; Safonova, M V; Deviatkin, A A; Dolgova, A S; Pyankov, O V; Sergeev, A A; Utkin, D V; Odinokov, G N; Safronov, V A; Agafonov, A P; Maleev, V V; Shipulin, G A

    2016-02-01

    In early February 2014, an outbreak of the Ebola virus disease caused by Zaire ebolavirus (EBOV) occurred in Guinea; cases were also recorded in other West African countries with a combined population of approximately 25 million. A rapid, sensitive and inexpensive method for detecting EBOV is needed to effectively control such outbreak. Here, we report a real-time reverse-transcription PCR assay for Z. ebolavirus detection used by the Specialized Anti-epidemic Team of the Russian Federation during the Ebola virus disease prevention mission in the Republic of Guinea. The analytical sensitivity of the assay is 5 × 10(2) viral particles per ml, and high specificity is demonstrated using representative sampling of viral, bacterial and human nucleic acids. This assay can be applied successfully for detecting the West African strains of Z. ebolavirus as well as on strains isolated in the Democratic Republic of the Congo in 2014. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Development and Characterization of Probe-Based Real Time Quantitative RT-PCR Assays for Detection and Serotyping of Foot-And-Mouth Disease Viruses Circulating in West Eurasia.

    Science.gov (United States)

    Jamal, Syed M; Belsham, Graham J

    2015-01-01

    Rapid and accurate diagnosis of foot-and-mouth disease (FMD) and virus serotyping are of paramount importance for control of this disease in endemic areas where vaccination is practiced. Ideally this virus characterization should be achieved without the need for virus amplification in cell culture. Due to the heterogeneity of FMD viruses (FMDVs) in different parts of the world, region specific diagnostic tests are required. In this study, hydrolysable probe-based real time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays were developed for specific detection and serotyping of the FMDVs currently circulating in West Eurasia. These assays were evaluated, in parallel with pan-FMDV diagnostic assays and earlier serotype-specific assays, using field samples originating from Pakistan and Afghanistan containing FMD viruses belonging to different sublineages of O-PanAsia, A-Iran05 and Asia-1 (Group-II and Group-VII (Sindh-08)). In addition, field samples from Iran and Bulgaria, containing FMDVs belonging to the O-PanAsiaANT-10 sublineage were also tested. Each of the three primer/probe sets was designed to be specific for just one of the serotypes O, A and Asia-1 of FMDV and detected the RNA from the target viruses with cycle threshold (CT) values comparable with those obtained with the serotype-independent pan-FMDV diagnostic assays. No cross-reactivity was observed in these assays between the heterotypic viruses circulating in the region. The assays reported here have higher diagnostic sensitivity (100% each for serotypes O and Asia-1, and 92% [95% CI = 81.4-100%] for serotype A positive samples) and specificity (100% each for serotypes O, A and Asia-1 positive samples) for the viruses currently circulating in West Eurasia compared to the serotyping assays reported earlier. Comparisons of the sequences of the primers and probes used in these assays and the corresponding regions of the circulating viruses provided explanations for the poor

  7. Development and Characterization of Probe-Based Real Time Quantitative RT-PCR Assays for Detection and Serotyping of Foot-And-Mouth Disease Viruses Circulating in West Eurasia.

    Directory of Open Access Journals (Sweden)

    Syed M Jamal

    Full Text Available Rapid and accurate diagnosis of foot-and-mouth disease (FMD and virus serotyping are of paramount importance for control of this disease in endemic areas where vaccination is practiced. Ideally this virus characterization should be achieved without the need for virus amplification in cell culture. Due to the heterogeneity of FMD viruses (FMDVs in different parts of the world, region specific diagnostic tests are required. In this study, hydrolysable probe-based real time reverse transcription quantitative polymerase chain reaction (RT-qPCR assays were developed for specific detection and serotyping of the FMDVs currently circulating in West Eurasia. These assays were evaluated, in parallel with pan-FMDV diagnostic assays and earlier serotype-specific assays, using field samples originating from Pakistan and Afghanistan containing FMD viruses belonging to different sublineages of O-PanAsia, A-Iran05 and Asia-1 (Group-II and Group-VII (Sindh-08. In addition, field samples from Iran and Bulgaria, containing FMDVs belonging to the O-PanAsiaANT-10 sublineage were also tested. Each of the three primer/probe sets was designed to be specific for just one of the serotypes O, A and Asia-1 of FMDV and detected the RNA from the target viruses with cycle threshold (CT values comparable with those obtained with the serotype-independent pan-FMDV diagnostic assays. No cross-reactivity was observed in these assays between the heterotypic viruses circulating in the region. The assays reported here have higher diagnostic sensitivity (100% each for serotypes O and Asia-1, and 92% [95% CI = 81.4-100%] for serotype A positive samples and specificity (100% each for serotypes O, A and Asia-1 positive samples for the viruses currently circulating in West Eurasia compared to the serotyping assays reported earlier. Comparisons of the sequences of the primers and probes used in these assays and the corresponding regions of the circulating viruses provided explanations for

  8. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples.

    Science.gov (United States)

    Mehta, Rohini; Birerdinc, Aybike; Hossain, Noreen; Afendy, Arian; Chandhoke, Vikas; Younossi, Zobair; Baranova, Ancha

    2010-05-21

    Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR) is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  9. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples

    Directory of Open Access Journals (Sweden)

    Afendy Arian

    2010-05-01

    Full Text Available Abstract Background Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Results Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. Conclusions We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  10. Monitoring and improving the sensitivity of dengue nested RT-PCR used in longitudinal surveillance in Thailand.

    Science.gov (United States)

    Klungthong, Chonticha; Manasatienkij, Wudtichai; Phonpakobsin, Thipwipha; Chinnawirotpisan, Piyawan; Rodpradit, Prinyada; Hussem, Kittinun; Thaisomboonsuk, Butsaya; Ong-ajchaowlerd, Prapapun; Nisalak, Ananda; Kalayanarooj, Siripen; Buddhari, Darunee; Gibbons, Robert V; Jarman, Richard G; Yoon, In-Kyu; Fernandez, Stefan

    2015-02-01

    AFRIMS longitudinal dengue surveillance in Thailand depends on the nested RT-PCR and the dengue IgM/IgG ELISA. To examine and improve the sensitivity of the nested RT-PCR using a panel of archived samples collected during dengue surveillance. A retrospective analysis of 16,454 dengue IgM/IgG ELISA positive cases collected between 2000 and 2013 was done to investigate the sensitivity of the nested RT-PCR. From these cases, 318 acute serum specimens or extracted RNA, previously found to be negative by the nested RT-PCR, were tested using TaqMan real-time RT-PCR (TaqMan rRT-PCR). To improve the sensitivity of nested RT-PCR, we designed a new primer based on nucleotide sequences from contemporary strains found to be positive by the TaqMan rRT-PCR. Sensitivity of the new nested PCR was calculated using a panel of 87 samples collected during 2011-2013. The percentage of dengue IgM/IgG ELISA positive cases that were negative by the nested RT-PCR varied from 17% to 42% for all serotypes depending on the year. Using TaqMan rRT-PCR, dengue RNA was detected in 194 (61%) of the 318 acute sera or extracted RNA previously found to be negative by the nested RT-PCR. The newly designed DENV-1 specific primer increased the sensitivity of DENV-1 detection by the nested RT-PCR from 48% to 88%, and of all 4 serotypes from 73% to 87%. These findings demonstrate the impact of genetic diversity and signal erosion on the sensitivity of PCR-based methods. Published by Elsevier B.V.

  11. Simultaneous detection of three lily viruses using Triplex IC-RT-PCR.

    Science.gov (United States)

    Zhang, Yubao; Wang, Yajun; Xie, Zhongkui; Yang, Guo; Guo, Zhihong; Wang, Le

    2017-11-01

    Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily. Copyright © 2017. Published by Elsevier B.V.

  12. A RT-PCR method for selective amplification and phenotypic characterization of all three serotypes of Sabin-related polioviruses from viral mixtures

    Directory of Open Access Journals (Sweden)

    Eliane Veiga da Costa

    2012-08-01

    Full Text Available Outbreaks caused by vaccine-derived polioviruses are challenging the final eradication of paralytic poliomyelitis. Therefore, the surveillance of the acute flaccid paralysis cases based on poliovirus isolation and characterization remains an essential activity. Due to the use of trivalent oral poliovirus vaccine (OPV, mixtures containing more than one serotype of Sabin-related polioviruses are frequently isolated from clinical samples. Because each poliovirus isolate needs to be individually analyzed, we designed polymerase chain reaction primers that can selectively distinguish and amplify a genomic segment of the three Sabin-related poliovirus serotypes present in mixtures, thus, optimizing the diagnosis and providing prompt information to support epidemiologic actions.

  13. Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

    Science.gov (United States)

    Mo, Yiqun; Wan, Rong; Zhang, Qunwei

    2012-01-01

    Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

  14. Selection and Validation of Reference Genes for qRT-PCR Expression Analysis of Candidate Genes Involved in Olfactory Communication in the Butterfly Bicyclus anynana

    OpenAIRE

    Arun, Alok; Bauml?, V?ronique; Amelot, Ga?l; Nieberding, Caroline M.

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at ident...

  15. Outcome on EPIZONE Extension on VER/ VNN: Diagnostics, proficiency test and qRT-PCR validation

    DEFF Research Database (Denmark)

    Bigarré, Laurent; Panzarin, Valentina; Baud, Marine

    2012-01-01

    1 is to bring valuable genetic information on the second genome component of a given isolate. ANSES has developed new DNA probes targeting RNA1 with the goal of detecting all genotypes of nodaviruses. The aim of the project is thus: - To organize, conduct and report an inter-laboratory proficiency...... test for detection of aquatic nodaviruses by real time RT-PCR targeting RNA1 and RNA2, respectively. - To test a newly developed real-time RT-PCR targeting RNA1: sensitivity, specificity, range of detection and genetic information provided by sequencing the PCR product. Materials & methods Primers...... to be extracted by each partner. In the meantime, ANSES produced and distributed RNA extracted from healthy or infected fish (2 genogroups), or cell culture; one sample from cell culture had to be serially diluted to test the sensitivity of each method in partners’ hands. Samples were tested in duplicates...

  16. Differential expression analysis of boron transporters and some stress-related genes in response to 24-epibrassinolide and boron by semi-quantitative RT-PCR in Arabidopsis thaliana (L. Heynh

    Directory of Open Access Journals (Sweden)

    Surgun Yonca

    2016-01-01

    Full Text Available Plant steroidal hormones, brassinosteroids (BRs, promote plant developmental processes and enhance tolerance to several abiotic stresses including high boron (B stress. To examine the possible role of BR in high B-induced stress at the transcriptional level, we investigated the response of B transporter genes (BOR1-4, high B-induced genes (MATE, Hsp-like, BR-induced genes (Hsp70-4, Hsp90-1 and other stress-related genes (LTI/COR78, LEA4-5 upon exogenous treatments of 24-epibrassinolide (EBL on Arabidopsis thaliana (L. Heynh exposed to high concentrations of boric acid (BA using semi-quantitative RT-PCR. BA treatments led to down regulation of BOR1 and BOR3 genes in leaf and root tissues and higher concentration of EBL further decreased expression of these genes in roots. The expression of high B-induced genes was observed to be upregulated by 1 μM EBL treatment under high B stress in both tissues of the seedlings. The upregulation of BR-induced genes were clearly evident in root tissues co-treated with 1 μM EBL and BA as compared to BA alone. Higher concentration of EBL was found to be more effective in increasing expression of LTI/COR78 gene in root and LEA4-5 gene in shoot tissues. To our knowledge, this is the first report how exogenous application of EBL modulates high B stress responses at molecular level in model plant Arabidopsis thaliana.

  17. Performance of nested RT-PCR on CSF for tuberculous meningitis diagnosis in HIV-infected patients.

    Science.gov (United States)

    Gualberto, F A S; Gonçalves, M G; Fukasawa, L O; Santos, A M Ramos Dos; Sacchi, C T; Harrison, L H; Boulware, D R; Vidal, J E

    2017-10-01

    Timely diagnosis of tuberculous meningitis (TBM) in patients with human immunodeficiency virus (HIV) infection remains a challenge. Despite the current scale-up of the Xpert® MTB/RIF assay, other molecular diagnostic tools are necessary, particularly in referral centres in low- and middle-income countries without Xpert testing. To determine the diagnostic performance of nested real-time polymerase chain reaction (nRT-PCR) in HIV-infected TBM patients categorised according to standardised clinical case definitions. Based on clinical, laboratory and imaging data, HIV-infected patients with suspected TBM were prospectively categorised as 'definite TBM', 'probable TBM', 'possible TBM' or 'not TBM'. We evaluated nRT-PCR sensitivity and specificity in diagnosing TBM among definite TBM cases, and among definite + probable TBM cases. Ninety-two participants were enrolled in the study. nRT-PCR sensitivity for definite TBM (n = 8) was 100% (95%CI 67-100) and 86% (95%CI 60-96) for both definite and probable TBM (n = 6). Assuming that 'not TBM' patients (n = 74) were true-negatives, nRT-PCR specificity was 100% (95%CI 95-100). The possible TBM group (n = 4) had no nRT-PCR positives. The nRT-PCR is a useful rule-in test for HIV-infected patients with TBM according to international consensus case definitions. As nRT-PCR cannot exclude TBM, studies comparing and combining nRT-PCR with other assays are necessary for a rule-out test.

  18. Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

    Science.gov (United States)

    Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

    2017-01-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

  19. Molecular analysis of dolphin morbillivirus: A new sensitive detection method based on nested RT-PCR.

    Science.gov (United States)

    Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro

    2016-09-01

    Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Selection of reference genes for qRT-PCR analysis of gene expression in sea cucumber Apostichopus japonicus during aestivation

    Science.gov (United States)

    Zhao, Ye; Chen, Muyan; Wang, Tianming; Sun, Lina; Xu, Dongxue; Yang, Hongsheng

    2014-11-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is a technique that is widely used for gene expression analysis, and its accuracy depends on the expression stability of the internal reference genes used as normalization factors. However, many applications of qRT-PCR used housekeeping genes as internal controls without validation. In this study, the expression stability of eight candidate reference genes in three tissues (intestine, respiratory tree, and muscle) of the sea cucumber Apostichopus japonicus was assessed during normal growth and aestivation using the geNorm, NormFinder, delta CT, and RefFinder algorithms. The results indicate that the reference genes exhibited significantly different expression patterns among the three tissues during aestivation. In general, the β-tubulin (TUBB) gene was relatively stable in the intestine and respiratory tree tissues. The optimal reference gene combination for intestine was 40S ribosomal protein S18 (RPS18), TUBB, and NADH dehydrogenase (NADH); for respiratory tree, it was β-actin (ACTB), TUBB, and succinate dehydrogenase cytochrome B small subunit (SDHC); and for muscle it was α-tubulin (TUBA) and NADH dehydrogenase [ubiquinone] 1 α subcomplex subunit 13 (NDUFA13). These combinations of internal control genes should be considered for use in further studies of gene expression in A. japonicus during aestivation.

  1. Diagnosis of intestinal parasites in a rural community of Venezuela : Advantages and disadvantages of using microscopy or RT-PCR

    NARCIS (Netherlands)

    Incani, Renzo Nino; Ferrer, Elizabeth; Hoek, Denise; Ramak, Robbert; Roelfsema, Jeroen; Mughini-Gras, Lapo; Kortbeek, Titia M.; Pinelli, Elena

    2017-01-01

    A cross-sectional study was carried out to determine the prevalence and diagnostic performance of microscopy and real time PCR (RT-PCR) for 14 intestinal parasites in a Venezuelan rural community with a long history of persistent intestinal parasitic infections despite the implementation of regular

  2. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  3. Trends and advances in food analysis by real-time polymerase chain reaction.

    Science.gov (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

  4. Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

    Science.gov (United States)

    2014-01-01

    Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

  5. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  6. RT-PCR Detection of HIV in Republic of Macedonia

    Directory of Open Access Journals (Sweden)

    Golubinka Bosevska

    2008-11-01

    Full Text Available The aim of the study was to detect HIV RNA in seropositive patients using RT-PCR method and thus, to establish PCR methodology in the routine laboratory works.The total of 33 examined persons were divided in two groups: 1 13 persons seropositive for HIV; and 2 20 healthy persons - randomly selected blood donors that made the case control group. The subjects age was between 25 and 52 years (average 38,5.ELFA test for combined detection of HIV p24 antigen and anti HIV-1 + 2 IgG and ELISA test for detection of antibodies against HIV-1 and HIV-2, were performed for each examined person. RNA from the whole blood was extracted using a commercial kit based on salt precipitation. Detection of HIV RNA was performed using RT-PCR kit. Following nested PCR, the product was separated by electrophoresis in 1,5 % agarose gel. The result was scored positive if the band of 210bp was visible regardless of intensity Measures of precaution were taken during all the steps of the work and HIV infected materials were disposed of accordingly.In the group of blood donors ELFA, ELISA and RT-PCR were negative. Assuming that prevalence of HIV infection is zero, the clinical specificity of RT-PCR is 100 %. The analytical specificity of RT-PCR method was tested against Hepatitis C and B, Human Papiloma Virus, Cytomegalovirus, Herpes Simplex Virus, Rubella Virus, Mycobacterium tuberculosis, Chlamydia trachomatis. None of these templates yielded amplicon. In the group of 13 seropositive persons, 33 samples were analyzed. HIV RNA was detected in 15 samples. ELISA and ELFA test were positive in all samples. Different aliquots of the samples were tested independently and showed the same results. After different periods of storing the RNA samples at -70°C, RT-PCR reaction was identical to the one performed initially. The obtained amplicons were maintained frozen at -20°C for a week and the subsequently performed electrophoresis was identical to the previous one. The reaction is

  7. RT-PCR Protocols - Methods in Molecular Biology

    Directory of Open Access Journals (Sweden)

    Manuela Monti

    2011-03-01

    Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........

  8. Table 1. Real-time qRT-PCR verification of eight DEGs. Gene ...

    Indian Academy of Sciences (India)

    (TCA)8. GGGTCCGAGTGCCTTAATTT. TGTGGGATGTGTTGTGTGTG 60.32 59.88. HAAS VR 415 BMK.5319. (T)13. GATTCACGTGTGCCATCATC TGGACAATTCATTCAAAAAGAAAA 59.93 59.87 372. HAAS_VR_417 BMK.5329. (AG)6. ATCCCGGGGTGAAAAATAAA AGAAATGGTGCAATGGGTTC 60.36 59.80 157. (GAC)5 ...

  9. Diagnosis of intestinal parasites in a rural community of Venezuela: Advantages and disadvantages of using microscopy or RT-PCR.

    Science.gov (United States)

    Incani, Renzo Nino; Ferrer, Elizabeth; Hoek, Denise; Ramak, Robbert; Roelfsema, Jeroen; Mughini-Gras, Lapo; Kortbeek, Titia; Pinelli, Elena

    2017-03-01

    A cross-sectional study was carried out to determine the prevalence and diagnostic performance of microscopy and real time PCR (RT-PCR) for 14 intestinal parasites in a Venezuelan rural community with a long history of persistent intestinal parasitic infections despite the implementation of regular anthelminthic treatments. A total of 228 participants were included in this study. A multiplex RT-PCR was used for the detection of Dientamoeba fragilis, Giardia intestinalis, Cryptosporidium sp. and a monoplex RT-PCR for Entamoeba histolytica. Furthermore, a multiplex PCR was performed for detection of Ascaris lumbricoides, Strongyloides stercoralis, Necator americanus and Ancylostoma duodenale. Combined microscopy-PCR revealed prevalences of 49.3% for A. lumbricoides, 10.1% for N. americanus (no A. duodenale was detected), 2.0% for S. stercoralis, 40.4% for D. fragilis, 35.1% for G. intestinalis, and 7.9% for E. histolytica/dispar. Significant increases in prevalence at PCR vs. microscopy were found for A. lumbricoides, G. intestinalis and D. fragilis. Other parasites detected by microscopy alone were Trichuris trichiura (25.7%), Enterobius vermicularis (3.4%), Blastocystis sp. (65.8%), and the non-pathogenic Entamoeba coli (28.9%), Entamoeba hartmanni (12.3%), Endolimax nana (19.7%) and Iodamoeba bütschlii (7.5%). Age- but no gender-related differences in prevalences were found for A. lumbricoides, T. trichiura, G. intestinalis, and E. histolytica/dispar. The persistently high prevalences of intestinal helminths are probably related to the high faecal pollution as also evidenced by the high prevalences of non-pathogenic intestinal protozoans. These results highlight the importance of using sensitive diagnostic techniques in combination with microscopy to better estimate the prevalence of intestinal parasites, especially in the case of D. fragilis trophozoites, which deteriorate very rapidly and would be missed by microscopy. In addition, the differentiation between

  10. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  11. Simple, specific molecular typing of dengue virus isolates using one-step RT-PCR and restriction fragment length polymorphism.

    Science.gov (United States)

    Ortiz, Alma; Capitan, Zeuz; Mendoza, Yaxelis; Cisneros, Julio; Moreno, Brechla; Zaldivar, Yamitzel; Garcia, Mariana; Smith, Rebecca E; Motta, Jorge; Pascale, Juan Miguel

    2012-10-01

    A one-step RT-PCR and one-enzyme RFLP was used to detect and distinguish among flaviviruses, including the four serotypes of dengue and the St. Louis Encephalitis, West Nile and Yellow Fever viruses in cultured virus samples or acute-phase human serum. Using a previously described RT-PCR, but novel RFLP procedure, results are obtained in 24 h with basic PCR and electrophoresis equipment. There is 95% agreement between RT-PCR/RFLP results and those achieved by indirect immunofluorescence assays, and 100% agreement between RT-PCR/RFLP results and gene sequencing. This method is more rapid than tests of cytopathic effect based on virus isolation in tissue culture, and simpler than real-time PCR. It does not require specialized equipment, radioisotopes or computer analysis and is a method that can be applied widely in the developing world. It allows for prompt determination of whether a flavivirus is the cause of illness in a febrile patient, rapid identification of dengue serotypes in circulation, and improved patient management in cases where prior dengue exposure make dengue hemorrhagic fever or dengue shock syndrome a risk. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Quantitative RT-PCR analysis of estrogen receptor gene expression in laser microdissected prostate cancer tissue.

    Science.gov (United States)

    Walton, Thomas J; Li, Geng; McCulloch, Thomas A; Seth, Rashmi; Powe, Desmond G; Bishop, Michael C; Rees, Robert C

    2009-06-01

    Real-time quantitative RT-PCR analysis of laser microdissected tissue is considered the most accurate technique for determining tissue gene expression. The discovery of estrogen receptor beta (ERbeta) has focussed renewed interest on the role of estrogen receptors in prostate cancer, yet few studies have utilized the technique to analyze estrogen receptor gene expression in prostate cancer. Fresh tissue was obtained from 11 radical prostatectomy specimens and from 6 patients with benign prostate hyperplasia. Pure populations of benign and malignant prostate epithelium were laser microdissected, followed by RNA isolation and electrophoresis. Quantitative RT-PCR was performed using primers for androgen receptor (AR), estrogen receptor beta (ERbeta), estrogen receptor alpha (ERalpha), progesterone receptor (PGR) and prostate specific antigen (PSA), with normalization to two housekeeping genes. Differences in gene expression were analyzed using the Mann-Whitney U-test. Correlation coefficients were analyzed using Spearman's test. Significant positive correlations were seen when AR and AR-dependent PSA, and ERalpha and ERalpha-dependent PGR were compared, indicating a representative population of RNA transcripts. ERbeta gene expression was significantly over-expressed in the cancer group compared with benign controls (P cancer group (P prostate cancer specimens. In concert with recent studies the findings suggest differential production of ERbeta splice variants, which may play important roles in the genesis of prostate cancer. (c) 2009 Wiley-Liss, Inc.

  13. Performance of a RT-PCR Assay in Comparison to FISH and Immunohistochemistry for the Detection of ALK in Non-Small Cell Lung Cancer.

    Science.gov (United States)

    Hout, David R; Schweitzer, Brock L; Lawrence, Kasey; Morris, Stephan W; Tucker, Tracy; Mazzola, Rosetta; Skelton, Rachel; McMahon, Frank; Handshoe, John; Lesperance, Mary; Karsan, Aly; Saltman, David L

    2017-08-01

    Patients with lung cancers harboring an activating anaplastic lymphoma kinase ( ALK ) rearrangement respond favorably to ALK inhibitor therapy. Fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC) are validated and widely used screening tests for ALK rearrangements but both methods have limitations. The ALK RGQ RT-PCR Kit (RT-PCR) is a single tube quantitative real-time PCR assay for high throughput and automated interpretation of ALK expression. In this study, we performed a direct comparison of formalin-fixed paraffin-embedded (FFPE) lung cancer specimens using all three ALK detection methods. The RT-PCR test (diagnostic cut-off Δ C t of ≤8) was shown to be highly sensitive (100%) when compared to FISH and IHC. Sequencing of RNA detected full-length ALK transcripts or EML4-ALK and KIF5B-ALK fusion variants in discordant cases in which ALK expression was detected by the ALK RT-PCR test but negative by FISH and IHC. The overall specificity of the RT-PCR test for the detection of ALK in cases without full-length ALK expression was 94% in comparison to FISH and sequencing. These data support the ALK RT-PCR test as a highly efficient and reliable diagnostic screening approach to identify patients with non-small cell lung cancer whose tumors are driven by oncogenic ALK.

  14. A Multiplex RT-PCR Assay for S. aureus, L. monocytogenes, and Salmonella spp. Detection in Raw Milk with Pre-enrichment

    Directory of Open Access Journals (Sweden)

    Tian Ding

    2017-05-01

    Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.

  15. Impacts of Satellite Orbit and Clock on Real-Time GPS Point and Relative Positioning.

    Science.gov (United States)

    Shi, Junbo; Wang, Gaojing; Han, Xianquan; Guo, Jiming

    2017-06-12

    Satellite orbit and clock corrections are always treated as known quantities in GPS positioning models. Therefore, any error in the satellite orbit and clock products will probably cause significant consequences for GPS positioning, especially for real-time applications. Currently three types of satellite products have been made available for real-time positioning, including the broadcast ephemeris, the International GNSS Service (IGS) predicted ultra-rapid product, and the real-time product. In this study, these three predicted/real-time satellite orbit and clock products are first evaluated with respect to the post-mission IGS final product, which demonstrates cm to m level orbit accuracies and sub-ns to ns level clock accuracies. Impacts of real-time satellite orbit and clock products on GPS point and relative positioning are then investigated using the P3 and GAMIT software packages, respectively. Numerical results show that the real-time satellite clock corrections affect the point positioning more significantly than the orbit corrections. On the contrary, only the real-time orbit corrections impact the relative positioning. Compared with the positioning solution using the IGS final product with the nominal orbit accuracy of ~2.5 cm, the real-time broadcast ephemeris with ~2 m orbit accuracy provided <2 cm relative positioning error for baselines no longer than 216 km. As for the baselines ranging from 574 to 2982 km, the cm-dm level positioning error was identified for the relative positioning solution using the broadcast ephemeris. The real-time product could result in <5 mm relative positioning accuracy for baselines within 2982 km, slightly better than the predicted ultra-rapid product.

  16. Impacts of Satellite Orbit and Clock on Real-Time GPS Point and Relative Positioning

    Directory of Open Access Journals (Sweden)

    Junbo Shi

    2017-06-01

    Full Text Available Satellite orbit and clock corrections are always treated as known quantities in GPS positioning models. Therefore, any error in the satellite orbit and clock products will probably cause significant consequences for GPS positioning, especially for real-time applications. Currently three types of satellite products have been made available for real-time positioning, including the broadcast ephemeris, the International GNSS Service (IGS predicted ultra-rapid product, and the real-time product. In this study, these three predicted/real-time satellite orbit and clock products are first evaluated with respect to the post-mission IGS final product, which demonstrates cm to m level orbit accuracies and sub-ns to ns level clock accuracies. Impacts of real-time satellite orbit and clock products on GPS point and relative positioning are then investigated using the P3 and GAMIT software packages, respectively. Numerical results show that the real-time satellite clock corrections affect the point positioning more significantly than the orbit corrections. On the contrary, only the real-time orbit corrections impact the relative positioning. Compared with the positioning solution using the IGS final product with the nominal orbit accuracy of ~2.5 cm, the real-time broadcast ephemeris with ~2 m orbit accuracy provided <2 cm relative positioning error for baselines no longer than 216 km. As for the baselines ranging from 574 to 2982 km, the cm–dm level positioning error was identified for the relative positioning solution using the broadcast ephemeris. The real-time product could result in <5 mm relative positioning accuracy for baselines within 2982 km, slightly better than the predicted ultra-rapid product.

  17. Design and analysis of Q-RT-PCR assays for haematological malignancies using mixed effects models

    DEFF Research Database (Denmark)

    Bøgsted, Martin; Mandrup, Charlotte; Petersen, Anders

    2009-01-01

    research use and needs qualit control for accuracy and precision. Especially the identification of experimental variations and statistical analysis has recently created discussions. The standard analytical technique is to use the Delta-Delta-Ct method. Although this method accounts for sample specific...... developed based on a linear mixed effects model for factorial designs. The model consists of an analysis of variance where the variation of each fixed effect of interest and identified experimental and biological nuisance variations are split. Hereby it accounts for varying efficiency, inhomogeneous......The recent WHO classification of haematological malignancies includes detection of genetic abnormalities with rognostic significance. Consequently, an increasing number of specific real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR) based assays are in clinical...

  18. Biomarker discovery for colon cancer using a 761 gene RT-PCR assay

    Directory of Open Access Journals (Sweden)

    Hackett James R

    2007-08-01

    Full Text Available Abstract Background Reverse transcription PCR (RT-PCR is widely recognized to be the gold standard method for quantifying gene expression. Studies using RT-PCR technology as a discovery tool have historically been limited to relatively small gene sets compared to other gene expression platforms such as microarrays. We have recently shown that TaqMan® RT-PCR can be scaled up to profile expression for 192 genes in fixed paraffin-embedded (FPE clinical study tumor specimens. This technology has also been used to develop and commercialize a widely used clinical test for breast cancer prognosis and prediction, the Onco typeDX™ assay. A similar need exists in colon cancer for a test that provides information on the likelihood of disease recurrence in colon cancer (prognosis and the likelihood of tumor response to standard chemotherapy regimens (prediction. We have now scaled our RT-PCR assay to efficiently screen 761 biomarkers across hundreds of patient samples and applied this process to biomarker discovery in colon cancer. This screening strategy remains attractive due to the inherent advantages of maintaining platform consistency from discovery through clinical application. Results RNA was extracted from formalin fixed paraffin embedded (FPE tissue, as old as 28 years, from 354 patients enrolled in NSABP C-01 and C-02 colon cancer studies. Multiplexed reverse transcription reactions were performed using a gene specific primer pool containing 761 unique primers. PCR was performed as independent TaqMan® reactions for each candidate gene. Hierarchal clustering demonstrates that genes expected to co-express form obvious, distinct and in certain cases very tightly correlated clusters, validating the reliability of this technical approach to biomarker discovery. Conclusion We have developed a high throughput, quantitatively precise multi-analyte gene expression platform for biomarker discovery that approaches low density DNA arrays in numbers of

  19. Epidemiological, clinical and laboratory profile of scrub typhus cases detected by serology and RT-PCR in Kumaon, Uttarakhand: a hospital-based study.

    Science.gov (United States)

    Rawat, Vinita; Singh, Rajesh Kumar; Kumar, Ashok; Saxena, Sandip R; Varshney, Umesh; Kumar, Mukesh

    2018-04-01

    We analysed the epidemiology, clinical and laboratory data of the 168 scrub typhus cases confirmed by a combination of any one of the following: real time polymerase chain reaction (RT-PCR) and/or immunofluorescence assay (IFA) (IgM and/or IgG). The peak season for scrub typhus was from July to October. By multivariate binary logistic regression analysis, the risk of scrub typhus was about four times in those working in occupation related to forest work. Major clinical manifestations were fever (100%), myalgia (65%), cough (51%) and vomiting (46%); major complications were meningitis/meningoencephatilitis (12.5%) and multi-organ failure (MOF) and pneumonia (5.3% each). Laboratory investigations revealed raised aminotranferase levels and thrombocytopenia in most confirmed cases. We conclude that scrub typhus is an important cause of febrile illness in the Kumaon hills of Uttarakhand where this disease had not previously been considered to exist.

  20. Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba skin biopsies

    Directory of Open Access Journals (Sweden)

    Casini Silvia

    2006-09-01

    Full Text Available Abstract Background Odontocete cetaceans occupy the top position of the marine food-web and are particularly sensitive to the bioaccumulation of lipophilic contaminants. The effects of environmental pollution on these species are highly debated and various ecotoxicological studies have addressed the impact of xenobiotic compounds on marine mammals, raising conservational concerns. Despite its sensitivity, quantitative real-time PCR (qRT-PCR has never been used to quantify gene induction caused by exposure of cetaceans to contaminants. A limitation for the application of qRT-PCR is the need for appropriate reference genes which allow the correct quantification of gene expression. A systematic evaluation of potential reference genes in cetacean skin biopsies is presented, in order to validate future qRT-PCR studies aiming at using the expression of selected genes as non-lethal biomarkers. Results Ten commonly used housekeeping genes (HKGs were partially sequenced in the striped dolphin (Stenella coeruleoalba and, for each gene, PCR primer pairs were specifically designed and tested in qRT-PCR assays. The expression of these potential control genes was examined in 30 striped dolphin skin biopsy samples, obtained from specimens sampled in the north-western Mediterranean Sea. The stability of selected control genes was determined using three different specific VBA applets (geNorm, NormFinder and BestKeeper which produce highly comparable results. Glyceraldehyde-3P-dehydrogenase (GAPDH and tyrosine 3-monooxygenase (YWHAZ always rank as the two most stably expressed HKGs according to the analysis with geNorm and Normfinder, and are defined as optimal control genes by BestKepeer. Ribosomal protein L4 (RPL4 and S18 (RPS18 also exhibit a remarkable stability of their expression levels. On the other hand, transferrin receptor (TFRC, phosphoglycerate kinase 1 (PGK1, hypoxanthine ribosyltransferase (HPRT1 and β-2-microglobin (B2M show variable expression

  1. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    Directory of Open Access Journals (Sweden)

    Parida Manmohan

    2008-01-01

    Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.

  2. Relation between Euclidean and real time calculations of Green functions at finite temperature

    International Nuclear Information System (INIS)

    Bochkarev, A.

    1993-01-01

    We find a relation between the semiclassical approximation of the temperature (Matsubara) two-point correlator and the corresponding classical Green function in real time at finite temperature. The anharmonic oscillator at finite temperature is used to illustrate our statement, which is however of rather general origin

  3. Establishment of realtime RT-PCR assay to detect polio virus in the Acute Flaccid Paralysis laboratory surveillance

    Directory of Open Access Journals (Sweden)

    Nike Susanti

    2016-07-01

    Full Text Available AbstrakLatar belakang: Virus polio indigenous terakhir ditemukan di Indonesia tahun 1995 tetapi ancaman viruspolio impor dan mutasi virus dari Oral Polio Vaccine (OPV menjadi Vaccine Derived Poliovirus (VDPVmasih berlanjut. Tahun 1991 WHO mengembangkan Surveilans Acute Flaccid Paralysis (AFP dan tahun2014, identifikasi virus polio dengan real-time reverse transcriptase Polymerase Chain Reaction (rRTPCRmulai digunakan di Laboratorium Nasional Polio Pusat Biomedis dan Teknologi Dasar Kesehatan.Tujuan dari penggunaan rRT-PCR untuk mendapatkan metode yang cepat dan lebih baik dalam memantausirkulasi dan mutasi virus polio.Metode: Isolat polio positif diidentifikasi menggunakanan rRT PCR dengan kombinasi primer dan probeyang ditetapkan WHO. RNA virus di konversi ke cDNA menggunakan reverse transcriptase lalu diamplifikasimenggunakan taq polymerase. Produk PCR di deteksi dan diidentifikasi dengan hibridisasi menggunakanprobe spesifik. Sintesis cDNA dan reaksi PCR menggunakan primer yang dilekatkan di probe. Kombinasiprimer dan probe menghasilkan identifikasi serotipe dan intratypic differentiation (ITD dari isolat virus.Hasil: Selama tahun 2014, NPL Jakarta menerima 604 kasus AFP dari surveilans dan lima kasusterdeteksi positif mengandung virus polio. Semua spesimen positif mengandung virus polio yang berasaldari vaksin. Dua kasus positif virus polio tipe P2 (40%, satu kasus jenis virus polio P1 (20%, 1 kasusjenis virus polio P3 (20% dan satu kasus virus polio campuran jenis P1 + P2 (20%.Kesimpulan: Real-time PCR dapat digunakan di Laboratorium Polio Jakarta untuk membantu identifikasivirus Polio secara cepat. Tes ini dapat digunakan untuk memantau sirkulasi virus polio pada populasiyang rutin diimunisasi dengan OPV. (Health Science Journal of Indonesia 2016;7:27-31Kata kunci: ITD, Poliovirus, Identification, rRT-PCR AbstractBackground: The last indigenous polio was detected in 1995 but the threat of wild type polio viruses and themutation of Oral

  4. Detection of bacterial species involved in perimplantitis concerned with cultural and RT-PCR

    Directory of Open Access Journals (Sweden)

    Marcello Gatti

    2010-06-01

    Full Text Available Dental implants offer new treatment options for edentulous either partially or completely, now represent a viable alternative to conventional fixed protheses. Dental implants are colonized by a flora dominated by Gram-positive facultative aerobic, while in patients with bone loss and formation of pockets peri-implant diseases was found a significant difference in the composition of microflora, bacteria, Gram-negative anaerobes in particular Fusobacterium spp., Treponema denticola (Spirochetes, Tannerella forsythensis, Aggregatibacter actinomycetemcomitans, Prevotella intermedia as interim black-pigmented bacteria, Porphyromonas gingivalis, often in high concentrations. Aims. The purpose of this study was to identify those at risk of perimplantitis using 2 techniques: RT-PCR examination of trade and culture. The results were compared taking into consideration the advantages and disadvantages of both methods. Materials and methods.We studied 24 patients (14 women and 10 men, aged, women between 43 and 76 years, with an average of 63.8 + / - 10.9 years, men between 45 and 88 years with a average of 64.3 years + / - 12.5 years. Was performed a double levy of sub-gingival plaque at multiple sites that had an implant CAL (clinical attachment level> 4mm in order to assess the microbiological identification with the two techniques: Examining culture and Real-Time PCR of Commerce ( Gum-Sunstar that identifies 4 bacterial species: A. actinomycetemcomitans (A.a., P.gingivalis (P.g., T.forsythensis (T.f., and T.denticola (T.d.. Results. All patients studied were positive to both tests with charger high: the consideration of tenure, with CFU / ml > 105, was positive in 66.6% of samples by:T.f., and P.g., in 12.5% for A.a., while T.d. not been sought by examining culture, the RT-PCR was positive, with high loads, in 95.8% of samples for T.f., in 79.1% for P.g., in 12.5% for A.a. and 20.8% for T.d.The test crop showed the presence of even P.intermedia in 91

  5. Validation of reference genes for quantitative RT-PCR normalization in Suaeda aralocaspica, an annual halophyte with heteromorphism and C4 pathway without Kranz anatomy

    Directory of Open Access Journals (Sweden)

    Jing Cao

    2016-02-01

    Full Text Available Reverse transcription quantitative real-time polymerase chain reaction (qRT-PCR is a powerful analytical technique for the measurement of gene expression, which depends on the stability of the reference gene used for data normalization. Suaeda aralocaspica, an annual halophyte with heteromorphic seeds and possessing C4 photosynthesis pathway without Kranz anatomy, is an ideal plant species to identify stress tolerance-related genes and compare relative expression at transcriptional level. So far, no molecular information is available for this species. In the present study, six traditionally used reference genes were selected and their expression stability in two types of seeds of S. aralocaspica under different experimental conditions was evaluated. Three analytical programs, geNorm, NormFinder and BestKeeper, were used to assess and rank the stability of reference gene expression. Results revealed that although some reference genes may display different transcriptional profiles between the two types of seeds, β-TUB and GAPDH appeared to be the most suitable references under different developmental stages and tissues. GAPDH was the appropriate reference gene under different germination time points and salt stress conditions, and ACTIN was suitable for various abiotic stress treatments for the two types of seeds. For all the sample pools, β-TUB served as the most stable reference gene, whereas 18S rRNA and 28S rRNA performed poorly and presented as the least stable genes in our study. UBQ seemed to be unsuitable as internal control under different salt treatments. In addition, the expression of a photosynthesis-related gene (PPDK of C4 pathway and a salt tolerance-related gene (SAT of S. aralocaspica were used to validate the best performance reference genes. This is the first systematic comparison of reference gene selection for qRT-PCR work in S. aralocaspica and these data will facilitate further studies on gene expression in this species

  6. Comparison of RT-PCR-Dot blot hybridization based on radioisotope 32P with conventional RT-PCR and commercial ELISA Assays for blood screening of HIV-1

    International Nuclear Information System (INIS)

    Maria Lina R; Andi Yasmon

    2011-01-01

    There are many commercial ELISA and rapid test kits that have been used for blood screening; however, the kits can give false positive and negative results. Therefore, RT-PCR (Reverse Transcription Polymerase Chain Reaction) - Dot Blot Hybridization based on radioisotope 32 P (RDBR) method was developed in this research, to compare the method with the conventional RT-PCR and commercial ELISA Enzyme-Linked lmmunosorbent Assay) kit. This method is efficient for screening of large blood specimens and surveillance study. Eighty seven samples were used and serum of the samples were tested by ELISA to detect HIV-1. The HIV-l RNA genome was extracted from plasma samples and tested using the RT-PCR and RDBR methods. Of 87 samples that were tested, the rates of positive testing of the RT-PCR, the RDBR, and the ELISA were 71.26%, 74.71%, and 80.46%, respectively. The RDBR (a combination of RTPCR and dot blot hybridization) was more sensitive than conventional RT-PCR by showing 3.45% in increase number of positive specimens. The results showed that of 9 samples (10.34%) were negative RDBR and positive ELISA, while 4 samples (4.60%) were negative ELISA and positive RDBR. The two methods showed slightly difference in the results but further validation is still needed. However, RDBR has high potential as an alternative method for screening of blood in large quantities when compared to method of conventional RT-PCR and ELISA. (author)

  7. Detection and Analysis of Circular RNAs by RT-PCR.

    Science.gov (United States)

    Panda, Amaresh C; Gorospe, Myriam

    2018-03-20

    Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.

  8. Neurofeedback using real-time near-infrared spectroscopy enhances motor imagery related cortical activation.

    Directory of Open Access Journals (Sweden)

    Masahito Mihara

    Full Text Available Accumulating evidence indicates that motor imagery and motor execution share common neural networks. Accordingly, mental practices in the form of motor imagery have been implemented in rehabilitation regimes of stroke patients with favorable results. Because direct monitoring of motor imagery is difficult, feedback of cortical activities related to motor imagery (neurofeedback could help to enhance efficacy of mental practice with motor imagery. To determine the feasibility and efficacy of a real-time neurofeedback system mediated by near-infrared spectroscopy (NIRS, two separate experiments were performed. Experiment 1 was used in five subjects to evaluate whether real-time cortical oxygenated hemoglobin signal feedback during a motor execution task correlated with reference hemoglobin signals computed off-line. Results demonstrated that the NIRS-mediated neurofeedback system reliably detected oxygenated hemoglobin signal changes in real-time. In Experiment 2, 21 subjects performed motor imagery of finger movements with feedback from relevant cortical signals and irrelevant sham signals. Real neurofeedback induced significantly greater activation of the contralateral premotor cortex and greater self-assessment scores for kinesthetic motor imagery compared with sham feedback. These findings suggested the feasibility and potential effectiveness of a NIRS-mediated real-time neurofeedback system on performance of kinesthetic motor imagery. However, these results warrant further clinical trials to determine whether this system could enhance the effects of mental practice in stroke patients.

  9. A standard curve based method for relative real time PCR data processing

    Directory of Open Access Journals (Sweden)

    Krause Andreas

    2005-03-01

    Full Text Available Abstract Background Currently real time PCR is the most precise method by which to measure gene expression. The method generates a large amount of raw numerical data and processing may notably influence final results. The data processing is based either on standard curves or on PCR efficiency assessment. At the moment, the PCR efficiency approach is preferred in relative PCR whilst the standard curve is often used for absolute PCR. However, there are no barriers to employ standard curves for relative PCR. This article provides an implementation of the standard curve method and discusses its advantages and limitations in relative real time PCR. Results We designed a procedure for data processing in relative real time PCR. The procedure completely avoids PCR efficiency assessment, minimizes operator involvement and provides a statistical assessment of intra-assay variation. The procedure includes the following steps. (I Noise is filtered from raw fluorescence readings by smoothing, baseline subtraction and amplitude normalization. (II The optimal threshold is selected automatically from regression parameters of the standard curve. (III Crossing points (CPs are derived directly from coordinates of points where the threshold line crosses fluorescence plots obtained after the noise filtering. (IV The means and their variances are calculated for CPs in PCR replicas. (V The final results are derived from the CPs' means. The CPs' variances are traced to results by the law of error propagation. A detailed description and analysis of this data processing is provided. The limitations associated with the use of parametric statistical methods and amplitude normalization are specifically analyzed and found fit to the routine laboratory practice. Different options are discussed for aggregation of data obtained from multiple reference genes. Conclusion A standard curve based procedure for PCR data processing has been compiled and validated. It illustrates that

  10. Lung Injury; Relates to Real-Time Endoscopic Monitoring of Single Cells Respiratory Health in Lung

    Science.gov (United States)

    2017-09-01

    AWARD NUMBER: W81XWH-16-1-0253 TITLE: Lung Injury; Relates to Real- Time Endoscopic Monitoring of Single Cells Respiratory Health in Lung...2017 TYPE OF REPORT: Annual PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland 21702-5012 DISTRIBUTION ...STATEMENT: Approved for Public Release; Distribution Unlimited The views, opinions and/or findings contained in this report are those of the author(s

  11. Hippocampus activation related to 'real-time' processing of visuospatial change.

    Science.gov (United States)

    Beudel, M; Leenders, K L; de Jong, B M

    2016-12-01

    The delay associated with cerebral processing time implies a lack of real-time representation of changes in the observed environment. To bridge this gap for motor actions in a dynamical environment, the brain uses predictions of the most plausible future reality based on previously provided information. To optimise these predictions, adjustments to actual experiences are necessary. This requires a perceptual memory buffer. In our study we gained more insight how the brain treats (real-time) information by comparing cerebral activations related to judging past-, present- and future locations of a moving ball, respectively. Eighteen healthy subjects made these estimations while fMRI data was obtained. All three conditions evoked bilateral dorsal-parietal and premotor activations, while judgment of the location of the ball at the moment of judgment showed increased bilateral posterior hippocampus activation relative to making both future and past judgments at the one-second time-sale. Since the condition of such 'real-time' judgments implied undistracted observation of the ball's actual movements, the associated hippocampal activation is consistent with the concept that the hippocampus participates in a top-down exerted sensory gating mechanism. In this way, it may play a role in novelty (saliency) detection. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Use of RT-PCR and elisa techniques for the diagnostic of infectious bronchitis virus in broilers at slaughter

    Directory of Open Access Journals (Sweden)

    Davi de Oliveira Almeida

    2015-03-01

    Full Text Available ABSTRACT. Almeida D.O., Tortely R., Nascimento E.R., Khan M., Pereira V.L.A & Babapoor S. [Use of RT-PCR and elisa techniques for the diagnostic of infectious bronchitis virus in broilers at slaughter.] Uso das técnicas de RT-PCR e elisa no diagnóstico da bronquite infecciosa em frangos de corte ao abate. Revista Brasileira de Medicina Veterinária, 37(1:55-59, 2015. Departamento de Saúde Coletiva Veterinária e Saúde Pública, Universidade Federal Fluminense, Rua Vital Brazil Filho, 64, Santa Rosa, Niterói, RJ 24230-340, Brasil. E-mail: elmiro@vm.uff.br Avian infectious bronchitis (IB is a viral, acute and highly contagious disease caused by infectious bronchitis virus (IBV. The disease affects broilers improvement and performance causing major economic losses in the world poultry industry. Generally, IBV infections can be diagnosed by detection of IBV itself or the specific antibody response. This study aimed to detect IBV in broilers under Sanitary Inspection by RT-PCR and ELISA, comparing the results and relating them with the average weight of the flock. Samples were collected from 40 vaccinated broiler flocks under Sanitary Inspection at slaughter. Ten birds from every flock were randomly selected and blood samples were collected for ELISA as well three birds had their trachea and caecal tonsils collected for RT- -PCR test. From 40 flocks, 30 were IBV positive by ELISA and 26 by RT-PCR, in which 15 were detected simultaneously in trachea and caecal tonsil and 5 in each sample. There was no agreement between ELISA and RT-PCR results regarding IBV diagnosis as well positivity in both tests was not statistically significant with the average weight of the flock. There was an improvement on IBV diagnosis when caecal tonsils and tracheas were used instead of just one of them. Considering the only vaccine serotype allowed by Brazilian government is the Mass serotype and its persistence in broilers would only be detected up to 28 days

  13. Selection of Reference Genes for qRT-PCR Analysis of Gene Expression in Stipa grandis during Environmental Stresses.

    Directory of Open Access Journals (Sweden)

    Dongli Wan

    Full Text Available Stipa grandis P. Smirn. is a dominant plant species in the typical steppe of the Xilingole Plateau of Inner Mongolia. Selection of suitable reference genes for the quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR is important for gene expression analysis and research into the molecular mechanisms underlying the stress responses of S. grandis. In the present study, 15 candidate reference genes (EF1 beta, ACT, GAPDH, SamDC, CUL4, CAP, SNF2, SKIP1, SKIP5, SKIP11, UBC2, UBC15, UBC17, UCH, and HERC2 were evaluated for their stability as potential reference genes for qRT-PCR under different stresses. Four algorithms were used: GeNorm, NormFinder, BestKeeper, and RefFinder. The results showed that the most stable reference genes were different under different stress conditions: EF1beta and UBC15 during drought and salt stresses; ACT and GAPDH under heat stress; SKIP5 and UBC17 under cold stress; UBC15 and HERC2 under high pH stress; UBC2 and UBC15 under wounding stress; EF1beta and UBC17 under jasmonic acid treatment; UBC15 and CUL4 under abscisic acid treatment; and HERC2 and UBC17 under salicylic acid treatment. EF1beta and HERC2 were the most suitable genes for the global analysis of all samples. Furthermore, six target genes, SgPOD, SgPAL, SgLEA, SgLOX, SgHSP90 and SgPR1, were selected to validate the most and least stable reference genes under different treatments. Our results provide guidelines for reference gene selection for more accurate qRT-PCR quantification and will promote studies of gene expression in S. grandis subjected to environmental stress.

  14. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    OpenAIRE

    Parida Manmohan; Shrivastava Ambuj; Santhosh SR; Dash Paban; Saxena Parag; Rao PV

    2008-01-01

    Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR) for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Jap...

  15. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected wit...... of the twenty-three VI-positive specimens were negative when tested by RT-PCR-ELISA. The diagnostic sensitivity and specificity of the RT-PCR-ELISA was 91% and 97%, respectively, using VI in SPF eggs as the gold reference standard....

  16. No control genes required: Bayesian analysis of qRT-PCR data.

    Directory of Open Access Journals (Sweden)

    Mikhail V Matz

    Full Text Available Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process.In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts. Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests.Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  17. No control genes required: Bayesian analysis of qRT-PCR data.

    Science.gov (United States)

    Matz, Mikhail V; Wright, Rachel M; Scott, James G

    2013-01-01

    Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR) is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process. In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC) algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts). Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization) but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests. Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  18. Dengue Virus NS1 Protein as a Diagnostic Marker: Commercially Available ELISA and Comparison to qRT-PCR and Serological Diagnostic Assays Currently Used by the State of Florida

    Directory of Open Access Journals (Sweden)

    Jason H. Ambrose

    2017-01-01

    Full Text Available Background. The proper management of patients infected with dengue virus requires early detection. Here, real-time molecular assays have proven useful but have limitations, whereas ELISAs that detect antibodies are still favored but results are obtained too late to be of clinical value. The production of DENV NS1 peaks early during infection and its detection can combine the advantages of both diagnostic approaches. Methods. This study compared assays currently used for detecting DENV infection at the Florida Department of Health including anti-DENV IgM and IgG ELISAs as well as qRT-PCR, against a commercially available DENV NS1 ELISA. These comparisons were made among a group of 21 human sera. Results. Nine of 14 (64.3% DENV qRT-PCR+ samples were also DENV NS1+. Interestingly, the 5 NS1− samples that were qRT-PCR+ were additionally IgM− and IgG+ suggesting a nonprimary infection. Compared to qRT-PCR, the NS1 assay had a sensitivity of 64.3%, specificity 100%, PPV of 100%, and NPV of 58.3%. Conclusions. The NS1 ELISA performed as expected in known DENV qRT-PCR+ samples; however negative NS1 results for qRT-PCR+ and IgG+ sera seemingly reduced the usefulness of the NS1 ELISA for nonprimary cases. We therefore conclude that diagnosis obtained via DENV NS1 ELISA deserves further investigation.

  19. Reference gene selection for real-time quantitative PCR analysis of the mouse uterus in the peri-implantation period.

    Directory of Open Access Journals (Sweden)

    Pengfei Lin

    Full Text Available The study of uterine gene expression patterns is valuable for understanding the biological and molecular mechanisms that occur during embryo implantation. Real-time quantitative RT-PCR (qRT-PCR is an extremely sensitive technique that allows for the precise quantification of mRNA abundance; however, selecting stable reference genes suitable for the normalization of qRT-PCR data is required to avoid the misinterpretation of experimental results and erroneous analyses. This study employs several mouse models, including an early pregnancy, a pseudopregnancy, a delayed implantation and activation, an artificial decidualization and a hormonal treatment model; ten candidate reference genes (PPIA, RPLP0, HPRT1, GAPDH, ACTB, TBP, B2M, 18S, UBC and TUBA that are found in uterine tissues were assessed for their suitability as internal controls for relative qRT-PCR quantification. GeNorm(PLUS, NormFinder, and BestKeeper were used to evaluate these candidate reference genes, and all of these methods identified RPLP0 and GAPDH as the most stable candidates and B2M and 18S as the least stable candidates. However, when the different models were analyzed separately, the reference genes exhibited some variation in their expression levels.

  20. Detecting Newcastle disease virus in combination of RT-PCR with red blood cell absorption

    Directory of Open Access Journals (Sweden)

    Liu Chengqian

    2011-05-01

    Full Text Available Abstract Reverse transcription-polymerase chain reaction (RT-PCR has limited sensitivity when treating complicated samples, such as feces, waste-water in farms, and nucleic acids, protein rich tissue samples, all the factors may interfere with the sensitivity of PCR test or generate false results. In this study, we developed a sensitive RT-PCR, combination of red blood cell adsorption, for detecting Newcastle disease virus (NDV. One pair of primers which was highly homologous to three NDV pathotypes was designed according to the consensus nucleocapsid protein (NP gene sequence. To eliminate the interfere of microbes and toxic substances, we concentrated and purified NDV from varied samples utilizing the ability of NDV binding red blood cells (RBCs. The RT-PCR coupled with red blood cell adsorption was much more sensitive in comparison with regular RT-PCR. The approach could also be used to detect other viruses with the property of hemagglutination, such as influenza viruses.

  1. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  2. RT-PCR and real-time PCR analysis of E2A-PBX1, TEL-AML1 ...

    Indian Academy of Sciences (India)

    Department of Molecular Oncology, Cancer Institute (WIA) 38, Sardar Patel Road, Chennai 600 036, India; Department of Biotechnology, Dr M. G. R. Educational and Research Institute, Dr M. G. R. University, Maduravoyal, Chennai 600 095, India; Department of Hemato Immunology, Cancer Institute (WIA) 38, Sardar Patel ...

  3. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    Science.gov (United States)

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  4. Sequence Optimized Real-Time RT-PCR Assay for Detection of Crimean-Congo Hemorrhagic Fever Virus

    Science.gov (United States)

    2017-03-21

    on the linear range of the curve 129 using a nonlinear regression analysis. A two-way ANOVA with Sidak’s multiple comparisons test was 130 done to...currently fielded CCHFV assay. 31 TR-17-094 DISTRIBUTION STATEMENT A: Approved for public release; distribution is unlimited. 2 Introduction 32...analyses were performed using GraphPrism 6 (GraphPad Software, San Diego, CA). 128 Assay linearity based on the preliminary LOD was determined based

  5. Norovirus Real Time RT-PCR Detection Technology Transition to the Joint Biological Identification and Diagnosis System (JBAIDS)

    Science.gov (United States)

    2012-09-21

    virus and Southampton virus, and II (GII), which includes Bristol virus, Lordsdale virus, Toronto virus, Mexico virus, Hawaii virus and Snow Mountain...Shigella flexneriATCC12022 1 Negative Shigella sonnei ATCC25931 1 Negative Vibrio cholera (NAG) (Culture) 2 Negative Vibrio cholera (Ogawa...Culture) 1 Negative Vibrio cholera (Inaga) (Culture) 1 Negative Sapovivus (Known specimen extract) 2 Negative Rotavirus (Known specimen extract) 2

  6. VEGF system expression by immunohistochemistry and real-time RT-PCR study on collared peccary placenta

    DEFF Research Database (Denmark)

    Santos, Tatiana C.; Oliveira, Moacir F.; Papa, Paula C.

    2014-01-01

    Vascular endothelial growth factor (VEGF) is known to induce endothelial cell proliferation, to promote cell migration, and to inhibit apoptosis, thus playing a central role in angiogenesis and in the regulation of vasculogenesis. The expression of the VEGF-ligand receptor system was studied in t...

  7. RT-PCR and real-time PCR analysis of E2A-PBX1, TEL-AML1 ...

    Indian Academy of Sciences (India)

    2011-08-19

    Aug 19, 2011 ... group of 1–25 years (50 pediatric and 14 young adults). Diagnosis of ... 3% agarose gel to visualize the amplified products of fusion gene transcripts. .... translocation in 13.4% (177/1321, range 9–23%) of child- hood ALL in Far ... to apoptosis, growth factor interactions and alters cell–cell and cell–matrix ...

  8. A real-time RT-PCR method to detect viable Giardia lamblia cysts in environmental waters.

    Science.gov (United States)

    Baque, Robert H; Gilliam, Amy O; Robles, Liza D; Jakubowski, Walter; Slifko, Theresa R

    2011-05-01

    Currently, USEPA Method 1623 is the standard assay used for simultaneous detection of Giardia cysts and Cryptosporidium oocysts in various water matrices. However, the method is unable to distinguish between species, genotype, or to assess viability. Therefore, the objective of the present study was to address the shortcomings of USEPA Method 1623 by developing a novel molecular-based method that can assess viability of Giardia cysts in environmental waters and identify genotypes that pose a human health threat (assemblage groups A and B). Primers and TaqMan(®) probes were designed to target the beta-giardin gene in order to discriminate among species and assemblages. Viability was determined by detection of de-novo mRNA synthesis after heat induction. The beta-giardin primer/probe sets were able to detect and differentiate between Giardia lamblia assemblages A and B, and did not detect Giardia muris (mouse species) or G. lamblia assemblages C, D, E and F (non-human), with the exception of Probe A which did detect G. lamblia assemblage F DNA. Additionally, DNA or cDNA of other waterborne organisms were not detected, suggesting that the method is specific to Giardia assemblages. Assay applicability was demonstrated by detection of viable G. lamblia cysts in spiked (assemblage B) and unspiked (assemblage A and B) reclaimed water samples. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. Field Evaluation of a Deployable RT-PCR Assay System for Real-Time Identification of Dengue Virus

    National Research Council Canada - National Science Library

    McAvin, James C; Blow, Jamie A; Putnam, John L; Swaby, James A

    2004-01-01

    Dengue fever and the more severe form of the disease, dengue hemorrhagic fever, occurs in tropical and subtropical regions globally through infection by one or more of four viral serotypes, DEN-1, DEN-2, DEN-3 and DEN-4...

  10. Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells

    International Nuclear Information System (INIS)

    Raynor, Michael; Stephenson, Sally-Anne; Walsh, David CA; Pittman, Kenneth B; Dobrovic, Alexander

    2002-01-01

    Immunomagnetic enrichment followed by RT-PCR (immunobead RT-PCR) is an efficient methodology to identify disseminated carcinoma cells in the blood and bone marrow. The RT-PCR assays must be both specific for the tumor cells and sufficiently sensitive to enable detection of single tumor cells. We have developed a method to test RT-PCR assays for any cancer. This has been investigated using a panel of RT-PCR markers suitable for the detection of breast cancer cells. In the assay, a single cell line-derived tumor cell is added to 100 peripheral blood mononuclear cells (PBMNCs) after which mRNA is isolated and reverse transcribed for RT-PCR analysis. PBMNCs without added tumor cells are used as specificity controls. The previously studied markers epidermal growth factor receptor (EGFR), mammaglobin 1 (MGB1), epithelial cell adhesion molecule (EpCAM/TACSTD1), mucin 1 (MUC1), carcinoembryonic antigen (CEA) were tested. Two new epithelial-specific markers ELF3 and EphB4 were also tested. MUC1 was unsuitable as strong amplification was detected in 100 cell PBMNC controls. Expression of ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 was found to be both specific for the tumor cell, as demonstrated by the absence of a signal in most 100 cell PBMNC controls, and sensitive enough to detect a single tumor cell in 100 PBMNCs using a single round of RT-PCR. ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 are appropriate RT-PCR markers for use in a marker panel to detect disseminated breast cancer cells after immunomagnetic enrichment

  11. Evaluation of a single-tube fluorogenic RT-PCR assay for detection of bovine respiratory syncytial virus in clinical samples

    DEFF Research Database (Denmark)

    Hakhverdyan, Mikhayil; Hägglund, Sara; Larsen, Lars Erik

    2005-01-01

    understanding of the virus. In this study, a BRSV fluorogenic reverse transcription PCR (fRT-PCR) assay, based on TaqMan principle, was developed and evaluated on a large number of clinical samples, representing various cases of natural and experimental BRSV infections. By using a single-step closed-tube format......, the turn-around time was shortened drastically and results were obtained with minimal risk for cross-contamination. According to comparative analyses, the detection limit of the fRT-PCR was on the same level as that of a nested PCR and the sensitivity relatively higher than that of a conventional PCR......, antigen ELISA (Ag-ELISA) and virus isolation (VI). Interspersed negative control samples, samples from healthy animals and eight symptomatically or genetically related viruses were all negative, confirming a high specificity of the assay. Taken together, the data indicated that the fRT-PCR assay can...

  12. Red blood cells in cerebrospinal fluid as possible inhibitory factor for enterovirus RT-PCR

    Directory of Open Access Journals (Sweden)

    Sérgio Monteiro de Almeida

    Full Text Available ABSTRACT The presence of hemoglobin in samples are considered an important inhibitory factor for polymerase chain reaction (PCR. The aim of this study was to examine the influence of red blood cells (RBCs in cerebrospinal fluid (CSF as an inhibitory factor to reverse transcription polymerase chain reaction (RT-PCR for enteroviruses (EV. Forty-four CSF samples from patients showing characteristics of viral meningitis were assessed for EV by RT-PCR. Viral RNA extracted with guanidine isothyocianate buffer and virus detection was performed by in-house nested PCR. Positivity for EV RT-PCR was higher in CSF samples without RBCs than in samples with RBCs: 13(26% and 36(9.2%, p = 0.001. In the group with positive EV RT-PCR, the mean + SD CSF RBC was 37 ± 183 cell/mm3; the group with negative results had 580 + 2,890 cell/mm3 (p = 0.007. The acceptable upper limit for CSF RBCs that could not influence RT-PCR was 108 cells/mm3. CSF samples with negative results for EV RT-PCR have more erythrocytes.

  13. Real-Time Algorithm for Relative Position Estimation Between Person and Robot Using a Monocular Camera

    International Nuclear Information System (INIS)

    Lee, Jung Uk; Sun, Ju Young; Won, Mooncheol

    2013-01-01

    In this paper, we propose a real-time algorithm for estimating the relative position of a person with respect to a robot (camera) using a monocular camera. The algorithm detects the head and shoulder regions of a person using HOG (Histogram of Oriented Gradient) feature vectors and an SVM (Support Vector Machine) classifier. The size and location of the detected area are used for calculating the relative distance and angle between the person and the camera on a robot. To increase the speed of the algorithm, we use a GPU and NVIDIA's CUDA library; the resulting algorithm speed is ∼ 15 Hz. The accuracy of the algorithm is compared with the output of a SICK laser scanner

  14. Real-Time Algorithm for Relative Position Estimation Between Person and Robot Using a Monocular Camera

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jung Uk [Samsung Electroics, Suwon (Korea, Republic of); Sun, Ju Young; Won, Mooncheol [Chungnam Nat' l Univ., Daejeon (Korea, Republic of)

    2013-12-15

    In this paper, we propose a real-time algorithm for estimating the relative position of a person with respect to a robot (camera) using a monocular camera. The algorithm detects the head and shoulder regions of a person using HOG (Histogram of Oriented Gradient) feature vectors and an SVM (Support Vector Machine) classifier. The size and location of the detected area are used for calculating the relative distance and angle between the person and the camera on a robot. To increase the speed of the algorithm, we use a GPU and NVIDIA's CUDA library; the resulting algorithm speed is ∼ 15 Hz. The accuracy of the algorithm is compared with the output of a SICK laser scanner.

  15. Real-time sun protection decisions in first-degree relatives of melanoma patients.

    Science.gov (United States)

    Hay, Jennifer L; Shuk, Elyse; Schofield, Elizabeth; Loeb, Rebecca; Holland, Susan; Burkhalter, Jack; Li, Yuelin

    2017-09-01

    Melanoma is the most serious skin cancer, and consistent use of sun protection is recommended to reduce risk. Yet sun protection use is generally inconsistent. Understanding the decisional factors driving sun protection choices could aid in intervention development to promote sun protection maintenance. In 59 first-degree relatives of melanoma patients, an interactive voice response system (IVRS) on participants' cell phones was used to assess twice daily (morning, afternoon) real-time sun protection usage (sunscreen, shade, hats, protective clothing) and decision factors (weather, type of activity, convenience, social support) over a 14-day summer interval where morning and afternoon outdoor exposures were anticipated. Generalized estimating equations and hierarchical linear models were used to examine the effect of demographics and decisional factors on sun protection choices over time. Sun protection use was inconsistent (e.g., 61% used sunscreen inconsistently). Most strategies were used independently, with the exception of moderate overlap of sunscreen and hat usage. Decision factors were highly relevant for sun protection. For instance, sunscreen use was related to the perception of having adequate time to apply it, whereas shade and hat usage were each related to convenience. Few findings emerged by gender, age, time of day, or year. Significant within-subject variation remained, however. The findings support continued examination of decision factors in understanding sun protection consistency in real time. Interventions where cues to action and environmental supports work together in varied settings can be developed to improve sun protection maintenance in populations at risk for this common disease. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  16. Real-time changes in corticospinal excitability related to motor imagery of a force control task

    DEFF Research Database (Denmark)

    Tatemoto, Tsuyoshi; Tsuchiya, Junko; Numata, Atsuki

    2017-01-01

    Objective To investigate real-time excitability changes in corticospinal pathways related to motor imagery in a changing force control task, using transcranial magnetic stimulation (TMS). Methods Ten healthy volunteers learnt to control the contractile force of isometric right wrist dorsiflexion...... in order to track an on-screen sine wave form. Participants performed the trained task 40 times with actual muscle contraction in order to construct the motor image. They were then instructed to execute the task without actual muscle contraction, but by imagining contraction of the right wrist...... in dorsiflexion. Motor evoked potentials (MEPs), induced by TMS in the right extensor carpi radialis muscle (ECR) and flexor carpi radialis muscle (FCR), were measured during motor imagery. MEPs were induced at five time points: prior to imagery, during the gradual generation of the imaged wrist dorsiflexion...

  17. Análise de citocinas pela RT-PCR em pacientes com rinite alérgica RT-PCR cytokine study in patients with allergic rhinitis

    Directory of Open Access Journals (Sweden)

    Tarcimara Moreira da Silva

    2009-02-01

    knowing the cytokine expressions during this period. MATERIALS AND METHODS: Another prospective and transversal study was carried out, selecting 30 patients, 13 of these patients were pauci-symptomatic and 17 were non atopic. The groups were selected by means of a medical interview, an otolaryngologic clinical exam and allergy skin tests - Prick Test. The cytokines were investigated in fragments of the nasal mucosa, using RT-PCR - chosen because it has good reproducibility and specificity. RESULTS: IL-5, IL-8, IFN-gama cytokine values were kept homogeneous in relation to the control group. Only IL-4 presented significant statistic differences. CONCLUSION: Asymptomatic patients with allergic rhinitis presented with normalization of cytokine expression in the nasal mucosa, with exception of IL-4.

  18. Direct recovery of infectious Pestivirus from a full-length RT-PCR amplicon

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Reimann, Ilona; Hoffmann, Bernd

    2008-01-01

    This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro, and the result......This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro......, and the resulting RNA transcripts were electroporated into ovine cells. Infectious virus was obtained after one cell culture passage. The rescued viruses had a phenotype similar to the parental Border Disease virus strain. Therefore, direct generation of infectious pestiviruses from full-length RT-PCR cDNA products...

  19. Recommendations relating to safety-critical real-time software in nuclear power plants

    International Nuclear Information System (INIS)

    1992-01-01

    The Advisory Committee on Nuclear Safety (ACNS) has reviewed safety issues associated with the software for the digital computers in the safety shutdown systems for the Darlington NGS. From this review the ACNS has developed four recommendations for safety-critical real-time software in nuclear power plants. These recommendations cover: the completion of the present efforts to develop an overall standard and sub-tier standards for safety-critical real-time software; the preparation of schedules and lists of responsibilities for this development; the concentration of AECB efforts on ensuring the scrutability of safety-critical real-time software; and, the collection of data on reliability and causes of failure (error) of safety-critical real-time software systems and on the probability and causes of common-mode failures (errors). (9 refs.)

  20. Emotion Regulation Training for Training Warfighters with Combat Related PTSD Using Real Time fMRI and EEG Assisted Neurofeedback

    Science.gov (United States)

    2016-10-01

    AWARD NUMBER: W81XWH-12-1-0607 TITLE: Emotion Regulation Training for Treating Warfighters with Combat-Related PTSD Using Real-Time fMRI...TYPE Annual 3. DATES COVERED 30 Sep 2015 - 29 Sep 2016 4. TITLE AND SUBTITLE Emotion Regulation Training for Treating Warfighters with Combat...emphasize dysregulation of the amygdala, which is involved in the regulation of PTSD-relevant emotions . We are utilizing real-time functional magnetic

  1. Selection and validation of endogenous reference genes for qRT-PCR analysis in leafy spurge (Euphorbia esula.

    Directory of Open Access Journals (Sweden)

    Wun S Chao

    Full Text Available Quantitative real-time polymerase chain reaction (qRT-PCR is the most important tool in measuring levels of gene expression due to its accuracy, specificity, and sensitivity. However, the accuracy of qRT-PCR analysis strongly depends on transcript normalization using stably expressed reference genes. The aim of this study was to find internal reference genes for qRT-PCR analysis in various experimental conditions for seed, adventitious underground bud, and other organs of leafy spurge. Eleven candidate reference genes (BAM4, PU1, TRP-like, FRO1, ORE9, BAM1, SEU, ARF2, KAPP, ZTL, and MPK4 were selected from among 171 genes based on expression stabilities during seed germination and bud growth. The other ten candidate reference genes were selected from three different sources: (1 3 stably expressed leafy spurge genes (60S, bZIP21, and MD-100 identified from the analyses of leafy spurge microarray data; (2 3 orthologs of Arabidopsis "general purpose" traditional reference genes (GAPDH_1, GAPDH_2, and UBC; and (3 4 orthologs of Arabidopsis stably expressed genes (UBC9, SAND, PTB, and F-box identified from Affymetrix ATH1 whole-genome GeneChip studies. The expression stabilities of these 21 genes were ranked based on the C(T values of 72 samples using four different computation programs including geNorm, Normfinder, BestKeeper, and the comparative ΔC(T method. Our analyses revealed SAND, PTB, ORE9, and ARF2 to be the most appropriate reference genes for accurate normalization of gene expression data. Since SAND and PTB were obtained from 4 orthologs of Arabidopsis, while ORE9 and ARF2 were selected from 171 leafy spurge genes, it was more efficient to identify good reference genes from the orthologs of other plant species that were known to be stably expressed than that of randomly testing endogenous genes. Nevertheless, the two newly identified leafy spurge genes, ORE9 and ARF2, can serve as orthologous candidates in the search for reference genes

  2. Identification of suitable reference genes for gene expression normalization in qRT-PCR analysis in watermelon.

    Directory of Open Access Journals (Sweden)

    Qiusheng Kong

    Full Text Available Watermelon is one of the major Cucurbitaceae crops and the recent availability of genome sequence greatly facilitates the fundamental researches on it. Quantitative real-time reverse transcriptase PCR (qRT-PCR is the preferred method for gene expression analyses, and using validated reference genes for normalization is crucial to ensure the accuracy of this method. However, a systematic validation of reference genes has not been conducted on watermelon. In this study, transcripts of 15 candidate reference genes were quantified in watermelon using qRT-PCR, and the stability of these genes was compared using geNorm and NormFinder. geNorm identified ClTUA and ClACT, ClEF1α and ClACT, and ClCAC and ClTUA as the best pairs of reference genes in watermelon organs and tissues under normal growth conditions, abiotic stress, and biotic stress, respectively. NormFinder identified ClYLS8, ClUBCP, and ClCAC as the best single reference genes under the above experimental conditions, respectively. ClYLS8 and ClPP2A were identified as the best reference genes across all samples. Two to nine reference genes were required for more reliable normalization depending on the experimental conditions. The widely used watermelon reference gene 18SrRNA was less stable than the other reference genes under the experimental conditions. Catalase family genes were identified in watermelon genome, and used to validate the reliability of the identified reference genes. ClCAT1and ClCAT2 were induced and upregulated in the first 24 h, whereas ClCAT3 was downregulated in the leaves under low temperature stress. However, the expression levels of these genes were significantly overestimated and misinterpreted when 18SrRNA was used as a reference gene. These results provide a good starting point for reference gene selection in qRT-PCR analyses involving watermelon.

  3. Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix® RT-PCR.

    Science.gov (United States)

    Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

    2018-04-01

    Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

  4. Quantitative RT-PCR for titration of replication-defective recombinant Semliki Forest virus.

    Science.gov (United States)

    Puglia, Ana L P; Rezende, Alexandre G; Jorge, Soraia A C; Wagner, Renaud; Pereira, Carlos A; Astray, Renato M

    2013-11-01

    Virus titration may constitute a drawback in the development and use of replication-defective viral vectors like Semliki Forest virus (SFV). The standardization and validation of a reverse transcription quantitative PCR (qRT-PCR) method for SFV titration is presented here. The qRT-PCR target is located within the nsp1 gene of the non-structural polyprotein SFV region (SFV RNA), which allows the strategy to be used for several different recombinant SFV constructs. Titer determinations were carried out by performing virus titration and infection assays with SFVs containing an RNA coding region for the rabies virus glycoprotein (RVGP) or green fluorescent protein (GFP). Results showed that the standardized qRT-PCR is applicable for different SFV constructs, and showed good reproducibility. To evaluate the correlation between the amount of functional SFV RNA in a virus lot and its infectivity in BHK-21 cell cultures, a temperature mediated titer decrease was performed and successfully quantitated by qRT-PCR. When used for cell infection at the same multiplicity of infection (MOI), the temperature treated SFV-RVGP samples induced the same levels of RVGP expression. Similarly, when different SFV-GFP lots with different virus titers, as accessed by qRT-PCR, were used for cell infection at the same MOI, the cultures showed comparable amounts of fluorescent cells. The data demonstrate a good correlation between the amount of virus used for infection, as measured by its SFV RNA, and the protein synthesis in the cells. In conclusion, the qRT-PCR method developed here is accurate and enables the titration of replication-defective SFV vectors, an essential aid for viral vector development as well as for establishment of production bioprocesses. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. The incidence and distribution characteristics of MLL rearrangements in Chinese acute myeloid leukemia patients by multiplex nested RT-PCR.

    Science.gov (United States)

    Yang, Hua; Cao, Tingting; Gao, Li; Wang, Lili; Zhu, Chengying; Xu, Yuanyuan; Jing, Yu; Zhu, Haiyan; Lv, Na; Yu, Li

    2017-07-20

    Occurrence of MLL (Mixed Lineage Leukemia) gene rearrangements indicates poor prognosis in acute myeloid leukemia (AML) patients. This is the first study to report the positive rate and distribution characteristics of MLL rearrangements in AML patients in north China. We used multiplex nested real time PCR (RT-PCR) to screen for incidence of 11 MLL rearrangements in 433 AML patients. Eleven MLL rearrangements included (MLL-PTD, MLL-AF9, MLL-ELL, MLL-AF10, MLL-AF17, MLL-AF6, MLL-ENL, MLL-AF1Q, MLL-CBP, MLL-AF1P, MLL-AFX1). There were 68 AML patients with MLL rearrangements, and the positive rate was 15.7%. MLL-PTD (4.84%) was detected in 21 patients, MLL-AF9 in 15, (3.46%), MLL-ELL in 10 (2.31%), MLL-AF10 in 8 (1.85%), MLL-AF1Q in 2 (0.46%), 3 cases each of MLL-AF17, MLL-AF6, MLL-ENL (0.69% each), a and single case each of MLL-CBP, MLL-AF1P, and MLL-AFX1 (0.23% each). The highest rate of MLL rearrangements was found in 24 patients with M5 subtype AML, occurring in 24 cases (35.3%). MLL rearrangements occurred in 21 patients with M2 subtype AML (30.9%), and in 10 patients with M4 subtype AML (14.7%). Screening fusion genes by multiplex nested RT-PCR is a convenient, fast, economical, and accurate method for diagnosis and predicting prognosis of AML.

  6. Expression analysis of fiber related genes in cotton (gossypium hirsutum l.) through real time pcr

    International Nuclear Information System (INIS)

    Iqbal, N.; Khatoon, A.; Asif, M.; Bashir, A.

    2016-01-01

    Cotton fibers are unicellular seed trichomes and the largest known plant cells. Fiber morphogenesis in cotton is a complex process involving a large number of genes expressed throughout fiber development process. The expression profiling of five gene families in various cotton tissues was carried out through real time PCR. Expression analysis revealed that transcripts of expansin, tubulin and E6 were elevated from 5 to 20 days post anthesis (DPA) fibers. Three Lipid transfer proteins (LTPs) including LTP1, LTP3, LTP7 exhibited highest expression in 10 - 20 DPA fibers. Transcripts of LTP3 were detected in fibers and non fiber tissues that of LTP7 were almost negligible in non fiber tissues. Sucrose phosphate synthase gene showed highest expression in 10 DPA fibers while sucrose synthse (susy) expressed at higher rate in 5-20 DPA fibers as well as roots. The results reveal that most of fiber related genes showed high expression in 5-20 DPA fibers. Comprehensive expression study may help to determine tissue and stage specificity of genes under study. The study may also help to explore complex process of fiber development and understand the role of these genes in fiber development process. Highly expressed genes in fibers may be transformed in cotton for improvement of fiber quality traits. Genes that were expressed specifically in fibers or other tissues could be used for isolation of upstream regulatory sequences. (author)

  7. A real-time, quantitative PCR protocol for assessing the relative parasitemia of Leucocytozoon in waterfowl

    Science.gov (United States)

    Smith, Matthew M.; Schmutz, Joel A.; Apelgren, Chloe; Ramey, Andy M.

    2015-01-01

    Microscopic examination of blood smears can be effective at diagnosing and quantifying hematozoa infections. However, this method requires highly trained observers, is time consuming, and may be inaccurate for detection of infections at low levels of parasitemia. To develop a molecular methodology for identifying and quantifying Leucocytozoon parasite infection in wild waterfowl (Anseriformes), we designed a real-time, quantitative PCR protocol to amplify Leucocytozoon mitochondrial DNA using TaqMan fluorogenic probes and validated our methodology using blood samples collected from waterfowl in interior Alaska during late summer and autumn (n = 105). By comparing our qPCR results to those derived from a widely used nested PCR protocol, we determined that our assay showed high levels of sensitivity (91%) and specificity (100%) in detecting Leucocytozoon DNA from host blood samples. Additionally, results of a linear regression revealed significant correlation between the raw measure of parasitemia produced by our qPCR assay (Ct values) and numbers of parasites observed on blood smears (R2 = 0.694, P = 0.003), indicating that our assay can reliably determine the relative parasitemia levels among samples. This methodology provides a powerful new tool for studies assessing effects of haemosporidian infection in wild avian species.

  8. Monitoring, Tracking, and Recording Pancreas-Related Health Issues in Real Time

    Science.gov (United States)

    Chrysikos, Theofilos; Zisi, Iliana; Katsini, Christina; Raptis, George E.; Kotsopoulos, Stavros

    2017-11-01

    The monitoring of pancreas-related health issues in real-time and outside the medical room is a challenge in the wide e-health domain. This paper introduces WHEAMO, a novel e-health platform which employs medical implants (biosensors), which function as antennas, planted in the pancreas. WHEAMO uses wireless in-body propagation to track, monitor, and record critical parameters, such as glucose. The signal reaches the skin and then it is propagated in an indoor environment (e.g., medical room) over to a terminal equipped with adaptive, user-configurable, and intelligent mechanisms which provide personalized recommendations to varying WHEAMO users (e.g., medical personnel, health care workers, patients). The personalized nature of the provided recommendations is based on patients unique characteristics via a sophisticated knowledge-base. The fundamentals of in-body and on-body wireless propagation and channel characterization have been studied in a series of published works. Researchers have tested both electric-field (dipole) and magnetic-field (patch, loop) antennas. Another important aspect concerns the frequency band in which the signal propagation will occur. Among the frequencies that have gathered scientific and academic interest are the Medical Implant Communication Service (MICS) band at 402-405 MHz, the 900 MHz channel and the industrial, scientific and medical (ISM) radio band at 2.45 GHz.

  9. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  10. Real-time changes in corticospinal excitability related to motor imagery of a force control task.

    Science.gov (United States)

    Tatemoto, Tsuyoshi; Tsuchiya, Junko; Numata, Atsuki; Osawa, Ryuji; Yamaguchi, Tomofumi; Tanabe, Shigeo; Kondo, Kunitsugu; Otaka, Yohei; Sugawara, Kenichi

    2017-09-29

    To investigate real-time excitability changes in corticospinal pathways related to motor imagery in a changing force control task, using transcranial magnetic stimulation (TMS). Ten healthy volunteers learnt to control the contractile force of isometric right wrist dorsiflexion in order to track an on-screen sine wave form. Participants performed the trained task 40 times with actual muscle contraction in order to construct the motor image. They were then instructed to execute the task without actual muscle contraction, but by imagining contraction of the right wrist in dorsiflexion. Motor evoked potentials (MEPs), induced by TMS in the right extensor carpi radialis muscle (ECR) and flexor carpi radialis muscle (FCR), were measured during motor imagery. MEPs were induced at five time points: prior to imagery, during the gradual generation of the imaged wrist dorsiflexion (Increasing phase), the peak value of the sine wave, during the gradual reduction (Decreasing phase), and after completion of the task. The MEP ratio, as the ratio of imaged MEPs to resting-state, was compared between pre- and post-training at each time point. In the ECR muscle, the MEP ratio significantly increased during the Increasing phase and at the peak force of dorsiflexion imagery after training. Moreover, the MEP ratio was significantly greater in the Increasing phase than in the Decreasing phase. In the FCR, there were no significant consistent changes. Corticospinal excitability during motor imagery in an isometric contraction task was modulated in relation to the phase of force control after image construction. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. A comparison of the sensitivities of detection of Plasmodium falciparum gametocytes by magnetic fractionation, thick blood film microscopy, and RT-PCR

    Directory of Open Access Journals (Sweden)

    St-Pierre Tim G

    2009-05-01

    Full Text Available Abstract Background The magnetic properties of Plasmodium-infected erythrocytes have been exploited for different clinical and research purposes. A recent study in a rural clinical setting in Papua New Guinea has demonstrated that Plasmodium falciparum gametocyte detection is facilitated by magnetic deposition microscopy but no study has yet determined the relative sensitivity and limit of detection of a magnetic fractionation technique. The present study compares the detection limit and sensitivity of a technique based on the use of commercially available magnetic fractionation columns with those for thick blood film microscopy and reverse transcriptase polymerase chain reaction (RT-PCR methods. Methods Gametocyte detection in six series of dilutions of cultured P. falciparum parasites with known gametocytaemia was conducted using magnetic fractionation, thick blood film, and RT-PCR techniques. Results The preparations obtained by the magnetic fractionation method were of thin film quality allowing easy gametocyte identification by light microscopy. Magnetic fractionation had a higher sensitivity and approximately two orders of magnitude better limit of detection than thick blood film microscopy. Gametocytes were also more readily detectable on the magnetically fractionated preparations. Magnetic fractionation had a similar limit of detection to that of RT-PCR. Conclusion Magnetic fractionation is a highly sensitive and convenient method for gametocyte detection in comparison with the standard thick blood film and RT-PCR methods, and could readily be adapted to field application.

  12. Hippocampus activation related to 'real-time' processing of visuospatial change

    NARCIS (Netherlands)

    Beudel, M.; Leenders, K. L.; de Jong, B. M.

    2016-01-01

    The delay associated with cerebral processing time implies a lack of real-time representation of changes in the observed environment. To bridge this gap for motor actions in a dynamical environment, the brain uses predictions of the most plausible future reality based on previously provided

  13. Sensitive detection of novel Indian isolate of BTV 21 using ns1 gene based real-time PCR assay

    Directory of Open Access Journals (Sweden)

    Gaya Prasad

    2013-06-01

    Full Text Available Aim: The study was conducted to develop ns1 gene based sensitive real-time RT-PCR assay for diagnosis of India isolates of bluetongue virus (BTV. Materials and Methods: The BTV serotype 21 isolate (KMNO7 was isolated from Andhra Pradesh and propagated in BHK-21 cell line in our laboratory. The Nucleic acid (dsRNA of virus was extracted using Trizol method and cDNA was prepared using a standard protocol. The cDNA was allowed to ns1 gene based group specific PCR to confirm the isolate as BTV. The viral RNA was diluted 10 folds and the detection limit of ns1 gene based RT-PCR was determined. Finally the tenfold diluted viral RNA was subjected to real-time RT-PCR using ns1 gene primer and Taq man probe to standardized the reaction and determine the detection limit. Results: The ns1 gene based group specific PCR showed a single 366bp amplicon in agarose gel electrophoresis confirmed the sample as BTV. The ns1 gene RT-PCR using tenfold diluted viral RNA showed the detection limit of 70.0 fg in 1%agarose gel electrophoresis. The ns1 gene based real time RT-PCR was successfully standardized and the detection limit was found to be 7.0 fg. Conclusion: The ns1 gene based real-time RT-PCR was successfully standardized and it was found to be 10 times more sensitive than conventional RT-PCR. Key words: bluetongue, BTV21, RT-PCR, Real time RT-PCR, ns1 gene [Vet World 2013; 6(8.000: 554-557

  14. Detecting the Presence of Nora Virus in "Drosophila" Utilizing Single Fly RT-PCR

    Science.gov (United States)

    Munn, Bethany; Ericson, Brad; Carlson, Darby J.; Carlson, Kimberly A.

    2015-01-01

    A single fly RT-PCR protocol has recently been developed to detect the presence of the persistent, horizontally transmitted Nora virus in "Drosophila." Wild-caught flies from Ohio were tested for the presence of the virus, with nearly one-fifth testing positive. The investigation presented can serve as an ideal project for biology…

  15. RT-PCR for detection of all seven genotypes of Lyssavirus genus.

    Science.gov (United States)

    Vázquez-Morón, S; Avellón, A; Echevarría, J E

    2006-08-01

    The Lyssavirus genus includes seven species or genotypes named 1-7. Rabies genotypes correlate with geographical distribution and specific hosts. Co-circulation of different lyssaviruses, imported cases, and the presence of unknown viruses, such as Aravan, Khujand, Irkut and West Caucasian Bat Virus, make it necessary to use generic methods able to detect all lyssaviruses. Primer sequences were chosen from conserved regions in all genotypes in order to optimise a generic RT-PCR. Serial dilutions of 12 RNA extracts from all seven Lyssavirus genotypes were examined to compare the sensitivity of the RT-PCR standardised in this study with a published RT-PCR optimised for EBLV1 detection and capable of amplifying RNA from all seven lyssaviruses. All seven genotypes were detected by both RT-PCRs, however, the sensitivity was higher with the new version of the test. Twenty samples submitted for rabies diagnosis were tested by the new RT-PCR. Eight out of 20 samples from six dogs, one horse and one bat were found positive, in agreement with immunofluorescence results. Seven samples from terrestrial mammals were genotype 1 and one from a bat was genotype 5. In conclusion, this method can be used to complement immunofluorescence for the diagnosis of rabies, enabling the detection of unexpected lyssaviruses during rabies surveillance.

  16. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected...

  17. Identification and characterization of a novel tospovirus species using a new RT-PCR approach

    NARCIS (Netherlands)

    Cortez, I.; Saaijer, J.; Wonjkaew, K.S.; Pereira, A.M.; Goldbach, R.W.; Peters, D.; Kormelink, R.

    2001-01-01

    Summary. A novel tospovirus serologically distinct from all established tospo- virus species was found in Thailand in Physalis minima L. The S RNA of this virus was cloned by a new RT-PCR approach revealing a nucleotide sequence of 3257 nucleotides. The ambisense RNA segment encoded a nonstructural

  18. [REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].

    Science.gov (United States)

    Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A

    2015-01-01

    Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

  19. Real-time shadows

    CERN Document Server

    Eisemann, Elmar; Assarsson, Ulf; Wimmer, Michael

    2011-01-01

    Important elements of games, movies, and other computer-generated content, shadows are crucial for enhancing realism and providing important visual cues. In recent years, there have been notable improvements in visual quality and speed, making high-quality realistic real-time shadows a reachable goal. Real-Time Shadows is a comprehensive guide to the theory and practice of real-time shadow techniques. It covers a large variety of different effects, including hard, soft, volumetric, and semi-transparent shadows.The book explains the basics as well as many advanced aspects related to the domain

  20. Outbreak of hepatitis E virus infection in Darfur, Sudan: effectiveness of real-time reverse transcription-PCR analysis of dried blood spots.

    Science.gov (United States)

    Mérens, Audrey; Guérin, Philippe Jean; Guthmann, Jean-Paul; Nicand, Elisabeth

    2009-06-01

    Biological samples collected in refugee camps during an outbreak of hepatitis E were used to compare the accuracy of hepatitis E virus RNA amplification by real-time reverse transcription-PCR (RT-PCR) for sera and dried blood spots (concordance of 90.6%). Biological profiles (RT-PCR and serology) of asymptomatic individuals were also analyzed.

  1. Mathematical analysis of the real time array PCR (RTA PCR) process

    NARCIS (Netherlands)

    Dijksman, Johan Frederik; Pierik, A.

    2012-01-01

    Real time array PCR (RTA PCR) is a recently developed biochemical technique that measures amplification curves (like with quantitative real time Polymerase Chain Reaction (qRT PCR)) of a multitude of different templates in a sample. It combines two different methods in order to profit from the

  2. Techniques for optimizing human-machine information transfer related to real-time interactive display systems

    Science.gov (United States)

    Granaas, Michael M.; Rhea, Donald C.

    1989-01-01

    In recent years the needs of ground-based researcher-analysts to access real-time engineering data in the form of processed information has expanded rapidly. Fortunately, the capacity to deliver that information has also expanded. The development of advanced display systems is essential to the success of a research test activity. Those developed at the National Aeronautics and Space Administration (NASA), Western Aeronautical Test Range (WATR), range from simple alphanumerics to interactive mapping and graphics. These unique display systems are designed not only to meet basic information display requirements of the user, but also to take advantage of techniques for optimizing information display. Future ground-based display systems will rely heavily not only on new technologies, but also on interaction with the human user and the associated productivity with that interaction. The psychological abilities and limitations of the user will become even more important in defining the difference between a usable and a useful display system. This paper reviews the requirements for development of real-time displays; the psychological aspects of design such as the layout, color selection, real-time response rate, and interactivity of displays; and an analysis of some existing WATR displays.

  3. Development and evaluation of a real-time one step Reverse-Transcriptase PCR for quantitation of Chandipura Virus

    Directory of Open Access Journals (Sweden)

    Tandale Babasaheb V

    2008-12-01

    Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy

  4. Proteomic analysis and qRT-PCR verification of temperature response to Arthrospira (Spirulina platensis.

    Directory of Open Access Journals (Sweden)

    Wang Huili

    Full Text Available Arthrospira (Spirulina platensis (ASP is a representative filamentous, non-N2-fixing cyanobacterium that has great potential to enhance the food supply and possesses several valuable physiological features. ASP tolerates high and low temperatures along with highly alkaline and salty environments, and can strongly resist oxidation and irradiation. Based on genomic sequencing of ASP, we compared the protein expression profiles of this organism under different temperature conditions (15°C, 35°Cand 45°C using 2-DE and peptide mass fingerprinting techniques. A total of 122 proteins having a significant differential expression response to temperature were retrieved. Of the positively expressed proteins, the homologies of 116 ASP proteins were found in Arthrospira (81 proteins in Arthrospira platensis str. Paraca and 35 in Arthrospira maxima CS-328. The other 6 proteins have high homology with other microorganisms. We classified the 122 differentially expressed positive proteins into 14 functions using the COG database, and characterized their respective KEGG metabolism pathways. The results demonstrated that these differentially expressed proteins are mainly involved in post-translational modification (protein turnover, chaperones, energy metabolism (photosynthesis, respiratory electron transport, translation (ribosomal structure and biogenesis and carbohydrate transport and metabolism. Others proteins were related to amino acid transport and metabolism, cell envelope biogenesis, coenzyme metabolism and signal transduction mechanisms. Results implied that these proteins can perform predictable roles in rendering ASP resistance against low and high temperatures. Subsequently, we determined the transcription level of 38 genes in vivo in response to temperature and identified them by qRT-PCR. We found that the 26 differentially expressed proteins, representing 68.4% of the total target genes, maintained consistency between transcription and

  5. Analysis of gene expression in small numbers of purified hemopoietic progenitor cells by RT-PCR.

    Science.gov (United States)

    Ziegler, B L; Lamping, C P; Thoma, S J; Fliedner, T M

    1995-05-01

    Primitive hemopoietic stem cells represent the most probable targets for genetic alterations due to exposure to ionizing irradiation or chemical carcinogens. We have applied a two-step protocol for the purification of CD34+HLA-DR-/low hemopoietic progenitor cells from cord blood (CB). CD34+ cells were isolated by monoclonal antibody (mAb) against CD34 (My10) and immunomagnetic beads. Beads were cleaved off the CD34+ cells by enzymatic treatment with chymopapain. Due to chymopapain-resistance of epitopes recognized by the used mAbs purity control of CD34+ cells and separation into CD34+HLA-DR-/low and CD34+HLA-DR+ subsets could be performed by using flow cytometry. Two miniaturized procedures were applied to isolate poly(A)+ mRNA for the reverse transcription polymerase chain reaction (RT-PCR) from small numbers of CD34+HLA-DR-/low cells. In five experiments, the mean purity of immunomagnetically isolated CD34+ cells was 93.8% +/- 3.9. Flow cytometry sorting of CD34+ cells resulted in pure CD34+HLA-DR-/low populations (purity > 98.8%; range 98.8% to 99.9%; viability > 96%) with an average yield of 2600 +/- 800 cells/5 x 10(7) low density CB cells. By RT-PCR using both poly(A)+ mRNA isolation procedures, sequences corresponding to CD34 and beta 2-microglobulin were amplified from as few as 20 cells. Furthermore, a sequence-independent RT-PCR (SIP-RT-PCR) was applied to amplify the cDNA derived from five erythroblasts isolated from a burst-forming unit-erythroid (BFU-E). Upon hybridization, full-length c-fos message was detected in the SIP-RT-PCR amplified material. Our data demonstrate that gene expression can be detected at the transcriptional level in small numbers of hemopoietic progenitor cells. In addition, the SIP-RT-PCR may allow the amplification of unique mRNA species when subtractive hybridization procedures are performed. The presented data should be useful to analyze gene expression in rare subsets of radiation-exposed immature hemopoietic stem

  6. Real-time geomagnetic monitoring for space weather-related applications: Opportunities and challenges

    Science.gov (United States)

    Love, Jeffrey J.; Finn, Carol A.

    2017-07-01

    An examination is made of opportunities and challenges for enhancing global, real-time geomagnetic monitoring that would be beneficial for a variety of operational projects. This enhancement in geomagnetic monitoring can be attained by expanding the geographic distribution of magnetometer stations, improving the quality of magnetometer data, increasing acquisition sampling rates, increasing the promptness of data transmission, and facilitating access to and use of the data. Progress will benefit from new partnerships to leverage existing capacities and harness multisector, cross-disciplinary, and international interests.

  7. Investigations for a multi-marker RT-PCR to improve sensitivity of disseminated tumor cell detection.

    NARCIS (Netherlands)

    Vlems, F.A.; Diepstra, J.H.S.; Cornelissen, I.M.; Ligtenberg, M.J.L.; Wobbes, Th.; Punt, C.J.A.; Krieken, J.H.J.M. van; Ruers, T.J.M.; Muijen, G.N.P. van

    2003-01-01

    BACKGROUND: In order to develop a multi-marker RT-PCR, which as such may be more sensitive than a single marker assay for the detection of disseminated tumor cells, we evaluated six RT-PCR markers: cytokeratin 20 (CK20), carcinoembryonic antigen (CEA), guanylyl cyclase C (GCC), epidermal growth

  8. Investigations for a multi-marker RT-PCR to improve sensitivity of disseminated tumor cell detection

    NARCIS (Netherlands)

    Vlems, F. A.; Diepstra, J. H. S.; Cornelissen, I. M. H. A.; Ligtenberg, M. J. L.; Wobbes, Th; Punt, C. J. A.; van Krieken, J. H. J. M.; Ruers, T. J. M.; van Muijen, G. N. P.

    2003-01-01

    In order to develop a multi-marker RT-PCR, which as such may be more sensitive than a single marker assay for the detection of disseminated tumor cells, we evaluated six RT-PCR markers: cytokeratin 20 (CK20), carcinoembryonic antigen (CEA), guanylyl cyclase C (GCC), epidermal growth factor receptor

  9. Development of duplex RT-PCR-ELISA for the simultaneous detection of hepatitis A virus and hepatitis E virus.

    Science.gov (United States)

    Tahk, Hongmin; Lee, Min Hwa; Lee, Kang Bum; Cheon, Doo-Sung; Choi, Changsun

    2011-07-01

    This study aimed to develop a specific and sensitive duplex reverse transcription polymerase chain reaction enzyme-linked immunosorbent assay (duplex RT-PCR-ELISA) for hepatitis A virus (HAV) and hepatitis E virus (HEV). Duplex RT-PCR-ELISA could detect and differentiate HAV and HEV with specific probes. When ELISA technique was used to detect probe-bound RT-PCR products, duplex RT-PCR-ELISA could detect as little as 0.1 ng/μL HAV and HEV from clinical samples. Human norovirus, enterovirus, poliovirus, murine norovirus and feline calicivirus were used for the specificity test; all were negative. Therefore duplex RT-PCR-ELISA can be used for the simultaneous detection of HAV and HEV in contaminated fecal samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Identification and validation of reference genes for quantitative real-time PCR in Drosophila suzukii (Diptera: Drosophilidae.

    Directory of Open Access Journals (Sweden)

    Yifan Zhai

    Full Text Available To accurately evaluate gene expression levels and obtain more accurate quantitative real-time RT-PCR (qRT-PCR data, normalization relative to reliable reference gene(s is required. Drosophila suzukii, is an invasive fruit pest native to East Asia, and recently invaded Europe and North America, the stability of its reference genes have not been previously investigated. In this study, ten candidate reference genes (RPL18, RPS3, AK, EF-1β, TBP, NADH, HSP22, GAPDH, Actin, α-Tubulin, were evaluated for their suitability as normalization genes under different biotic (developmental stage, tissue and population, and abiotic (photoperiod, temperature conditions. The three statistical approaches (geNorm, NormFinder and BestKeeper and one web-based comprehensive tool (RefFinder were used to normalize analysis of the ten candidate reference genes identified α-Tubulin, TBP and AK as the most stable candidates, while HSP22 and Actin showed the lowest expression stability. We used three most stable genes (α-Tubulin, TBP and AK and one unstably expressed gene to analyze the expression of P-glycoprotein in abamectin-resistant and sensitive strains, and the results were similar to reference genes α-Tubulin, TBP and AK, which show good stability, while the result of HSP22 has a certain bias. The three validated reference genes can be widely used for quantification of target gene expression with qRT-PCR technology in D.suzukii.

  11. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  12. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    Science.gov (United States)

    McMillan, Mary; Pereg, Lily

    2014-01-01

    Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA) in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA) is sufficient for effective normalisation of qRT-PCR data.

  13. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    Directory of Open Access Journals (Sweden)

    Mary McMillan

    Full Text Available Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA is sufficient for effective normalisation of qRT-PCR data.

  14. Detection of avian metapneumovirus subtypes in turkeys using RT-PCR.

    Science.gov (United States)

    Ongor, H; Karahan, M; Kalin, R; Bulut, H; Cetinkaya, B

    2010-03-20

    This study investigated the prevalence of avian metapneumovirus (aMPV) and the detection of molecular subtypes of field strains of the virus using RT-PCR in clinically healthy turkeys and those showing signs of respiratory disease. In the RT-PCR examination of 624 tracheal tissue samples collected from a local turkey abattoir, 2.9 per cent (18/624) of samples tested positive. In the examination of tracheal swab samples collected from flocks with respiratory problems, 18 of 20 samples tested positive. When the results were assessed at flock level, aMPV infection was detected in only one of the 23 clinically healthy turkey flocks, whereas all four flocks with respiratory problems were infected. Molecular typing using primers specific to the attachment glycoprotein (G) gene showed that all 36 positive samples belonged to subtype B. Partial sequence analysis of DNA samples showed 95 per cent homology between the field types and the reference strain aMPV subtype B. Whereas clinically healthy turkeys had been vaccinated with a subtype A virus vaccine, the flocks with respiratory problems had been vaccinated with a subtype B virus vaccine. Despite four blind passages of RT-PCR-positive samples on Vero and chicken embryo fibroblast cells, no cytopathic effect was detected by microscopic examination.

  15. Real-time systems

    OpenAIRE

    Badr, Salah M.; Bruztman, Donald P.; Nelson, Michael L.; Byrnes, Ronald Benton

    1992-01-01

    This paper presents an introduction to the basic issues involved in real-time systems. Both real-time operating sys and real-time programming languages are explored. Concurrent programming and process synchronization and communication are also discussed. The real-time requirements of the Naval Postgraduate School Autonomous Under Vehicle (AUV) are then examined. Autonomous underwater vehicle (AUV), hard real-time system, real-time operating system, real-time programming language, real-time sy...

  16. Identification and validation of quantitative real-time reverse transcription PCR reference genes for gene expression analysis in teak (Tectona grandis L.f.).

    Science.gov (United States)

    Galeano, Esteban; Vasconcelos, Tarcísio Sales; Ramiro, Daniel Alves; De Martin, Valentina de Fátima; Carrer, Helaine

    2014-07-22

    Teak (Tectona grandis L.f.) is currently the preferred choice of the timber trade for fabrication of woody products due to its extraordinary qualities and is widely grown around the world. Gene expression studies are essential to explore wood formation of vascular plants, and quantitative real-time reverse transcription PCR (qRT-PCR) is a sensitive technique employed for quantifying gene expression levels. One or more appropriate reference genes are crucial to accurately compare mRNA transcripts through different tissues/organs and experimental conditions. Despite being the focus of some genetic studies, a lack of molecular information has hindered genetic exploration of teak. To date, qRT-PCR reference genes have not been identified and validated for teak. Identification and cloning of nine commonly used qRT-PCR reference genes from teak, including ribosomal protein 60s (rp60s), clathrin adaptor complexes medium subunit family (Cac), actin (Act), histone 3 (His3), sand family (Sand), β-Tubulin (Β-Tub), ubiquitin (Ubq), elongation factor 1-α (Ef-1α), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Expression profiles of these genes were evaluated by qRT-PCR in six tissue and organ samples (leaf, flower, seedling, root, stem and branch secondary xylem) of teak. Appropriate gene cloning and sequencing, primer specificity and amplification efficiency was verified for each gene. Their stability as reference genes was validated by NormFinder, BestKeeper, geNorm and Delta Ct programs. Results obtained from all programs showed that TgUbq and TgEf-1α are the most stable genes to use as qRT-PCR reference genes and TgAct is the most unstable gene in teak. The relative expression of the teak cinnamyl alcohol dehydrogenase (TgCAD) gene in lignified tissues at different ages was assessed by qRT-PCR, using TgUbq and TgEf-1α as internal controls. These analyses exposed a consistent expression pattern with both reference genes. This study proposes a first broad

  17. Construction of an adult barnacle (Balanus amphitrite cDNA library and selection of reference genes for quantitative RT-PCR studies

    Directory of Open Access Journals (Sweden)

    Burgess J Grant

    2009-06-01

    Full Text Available Abstract Background Balanus amphitrite is a barnacle commonly used in biofouling research. Although many aspects of its biology have been elucidated, the lack of genetic information is impeding a molecular understanding of its life cycle. As part of a wider multidisciplinary approach to reveal the biogenic cues influencing barnacle settlement and metamorphosis, we have sequenced and annotated the first cDNA library for B. amphitrite. We also present a systematic validation of potential reference genes for normalization of quantitative real-time PCR (qRT-PCR data obtained from different developmental stages of this animal. Results We generated a cDNA library containing expressed sequence tags (ESTs from adult B. amphitrite. A total of 609 unique sequences (comprising 79 assembled clusters and 530 singlets were derived from 905 reliable unidirectionally sequenced ESTs. Bioinformatics tools such as BLAST, HMMer and InterPro were employed to allow functional annotation of the ESTs. Based on these analyses, we selected 11 genes to study their ability to normalize qRT-PCR data. Total RNA extracted from 7 developmental stages was reverse transcribed and the expression stability of the selected genes was compared using geNorm, BestKeeper and NormFinder. These software programs produced highly comparable results, with the most stable gene being mt-cyb, while tuba, tubb and cp1 were clearly unsuitable for data normalization. Conclusion The collection of B. amphitrite ESTs and their annotation has been made publically available representing an important resource for both basic and applied research on this species. We developed a qRT-PCR assay to determine the most reliable reference genes. Transcripts encoding cytochrome b and NADH dehydrogenase subunit 1 were expressed most stably, although other genes also performed well and could prove useful to normalize gene expression studies.

  18. Real-time measurement of relative sensor position changes using ultrasonic signal evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Yastrebova, O.; Bulavinov, A.; Kroening, M. [Fraunhofer Institute Nondestructive Testing IZFP, Saarbruecken (Germany)

    2008-07-01

    Ultrasonic testing is considered to be one of the most commonly applied nondestructive testing techniques for flaw detection and material characterization. Traditional Nondestructive Testing (NDT) provides detection of material discontinuities that may cause failure within the designed lifetime of a part or component. In addition, Quantitative Nondestructive Testing (QNDT) provides means to obtain required information about type, size and location of deficiencies to the integrity of the inspected structure and further use under specific, given load conditions. The ''Acoustic Mouse'' technique has been developed as a tool for manual ultrasonic inspection to provide test results that can be evaluated quantitatively. The ultrasonic data are processed by real-time variation methods to extract position information from backscattered acoustic noise and geometric scatter signals in the inspection volume. The position and positional changes of the ''Acoustic Mouse'' sensor (transducer) are determined by the sequential analysis of ultrasonic data (highresolution sector-scans), which are acquired and reconstructed using the Sampling Phased Array technique. The results of first experiments conducted with linear scanning and intentional lift-offs demonstrate sufficient accuracy in position measurements. (orig.)

  19. A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

    Science.gov (United States)

    Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

    2013-10-01

    A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

  20. Identification and differentiation of the twenty six bluetongue virus serotypes by RT-PCR amplification of the serotype-specific genome segment 2.

    Directory of Open Access Journals (Sweden)

    Narender S Maan

    Full Text Available Bluetongue (BT is an arthropod-borne viral disease, which primarily affects ruminants in tropical and temperate regions of the world. Twenty six bluetongue virus (BTV serotypes have been recognised worldwide, including nine from Europe and fifteen in the United States. Identification of BTV serotype is important for vaccination programmes and for BTV epidemiology studies. Traditional typing methods (virus isolation and serum or virus neutralisation tests (SNT or VNT are slow (taking weeks, depend on availability of reference virus-strains or antisera and can be inconclusive. Nucleotide sequence analyses and phylogenetic comparisons of genome segment 2 (Seg-2 encoding BTV outer-capsid protein VP2 (the primary determinant of virus serotype were completed for reference strains of BTV-1 to 26, as well as multiple additional isolates from different geographic and temporal origins. The resulting Seg-2 database has been used to develop rapid (within 24 h and reliable RT-PCR-based typing assays for each BTV type. Multiple primer-pairs (at least three designed for each serotype were widely tested, providing an initial identification of serotype by amplification of a cDNA product of the expected size. Serotype was confirmed by sequencing of the cDNA amplicons and phylogenetic comparisons to previously characterised reference strains. The results from RT-PCR and sequencing were in perfect agreement with VNT for reference strains of all 26 BTV serotypes, as well as the field isolates tested. The serotype-specific primers showed no cross-amplification with reference strains of the remaining 25 serotypes, or multiple other isolates of the more closely related heterologous BTV types. The primers and RT-PCR assays developed in this study provide a rapid, sensitive and reliable method for the identification and differentiation of the twenty-six BTV serotypes, and will be updated periodically to maintain their relevance to current BTV distribution and

  1. RT-PCR for confirmation of echovirus 30 isolated in Belém, Brazil

    Directory of Open Access Journals (Sweden)

    Maria de Lourdes C. Gomes

    Full Text Available Echovirus (Echo 30 or human enterovirus B is the most frequent enterovirus associated with meningitis cases. Epidemics and outbreaks of this disease caused by Echo 30 have occurred in several countries. In Brazil, Echo 30 has been isolated from sporadic cases and outbreaks that occurred mainly in the south and southeast regions. We used RT-PCR to examine Echo 30 isolates from meningitis cases detected from March 2002 to December 2003 in Belém, state of Pará, in northern Brazil. The patients were attended in a Basic Health Unit (State Health Secretary of Pará, where cerebrospinal fluid (CSF was collected and stored in liquid nitrogen. Weekly visits were made by technicians from Evandro Chagas Institute to the health unit and samples were stored at -70ºC in the laboratory until use. HEp-2 and RD cell lines were used for viral isolation and neutralization with specific antisera for viral identification. RNA extraction was made using Trizol reagent. The RT-PCR was made in one step, and the total mixture (50 µL was composed of: RNA, reaction buffer, dNTP, primers, Rnase inhibitor, reverse transcriptase, Taq polymerase and water. The products were visualized in agarose gel stained with ethidium bromide, visualized under UV light. Among the 279 CSF samples examined, 30 (10.7% were EV positive, 29 being Echo 30 and one was Cox B. Nineteen Echo 30 were examined with RT-PCR; 18 tested positive (762 and 494 base pairs. The use of this technique permitted viral identification in less time than usual, which benefits the patient and is of importance for public-health interventions.

  2. Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

    Directory of Open Access Journals (Sweden)

    Alok Arun

    Full Text Available Real-time quantitative reverse transcription PCR (qRT-PCR is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae, two developmental stages (pupal and adult and two sexes (male and female, all of which were subjected to two food treatments (food stress and control feeding ad libitum. The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the

  3. Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

    Science.gov (United States)

    Arun, Alok; Baumlé, Véronique; Amelot, Gaël; Nieberding, Caroline M

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae), two developmental stages (pupal and adult) and two sexes (male and female), all of which were subjected to two food treatments (food stress and control feeding ad libitum). The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the expression

  4. Reference gene selection for qRT-PCR assays in Stellera chamaejasme subjected to abiotic stresses and hormone treatments based on transcriptome datasets.

    Science.gov (United States)

    Liu, Xin; Guan, Huirui; Song, Min; Fu, Yanping; Han, Xiaomin; Lei, Meng; Ren, Jingyu; Guo, Bin; He, Wei; Wei, Yahui

    2018-01-01

    Stellera chamaejasme Linn, an important poisonous plant of the China grassland, is toxic to humans and livestock. The rapid expansion of S. chamaejasme has greatly damaged the grassland ecology and, consequently, seriously endangered the development of animal husbandry. To draft efficient prevention and control measures, it has become more urgent to carry out research on its adaptive and expansion mechanisms in different unfavorable habitats at the genetic level. Quantitative real-time polymerase chain reaction (qRT-PCR) is a widely used technique for studying gene expression at the transcript level; however, qRT-PCR requires reference genes (RGs) as endogenous controls for data normalization and only through appropriate RG selection and qRT-PCR can we guarantee the reliability and robustness of expression studies and RNA-seq data analysis. Unfortunately, little research on the selection of RGs for gene expression data normalization in S. chamaejasme has been reported. In this study, 10 candidate RGs namely, 18S , 60S , CYP , GAPCP1 , GAPDH2 , EF1B , MDH , SAND , TUA1 , and TUA6 , were singled out from the transcriptome database of S. chamaejasme , and their expression stability under three abiotic stresses (drought, cold, and salt) and three hormone treatments (abscisic acid, ABA; gibberellin, GA; ethephon, ETH) were estimated with the programs geNorm, NormFinder, and BestKeeper. Our results showed that GAPCP1 and EF1B were the best combination for the three abiotic stresses, whereas TUA6 and SAND , TUA1 and CYP , GAPDH2 and 60S were the best choices for ABA, GA, and ETH treatment, respectively. Moreover, GAPCP1 and 60S were assessed to be the best combination for all samples, and 18S was the least stable RG for use as an internal control in all of the experimental subsets. The expression patterns of two target genes ( P5CS2 and GI ) further verified that the RGs that we selected were suitable for gene expression normalization. This work is the first attempt to

  5. Reference gene selection for qRT-PCR assays in Stellera chamaejasme subjected to abiotic stresses and hormone treatments based on transcriptome datasets

    Directory of Open Access Journals (Sweden)

    Xin Liu

    2018-04-01

    Full Text Available Background Stellera chamaejasme Linn, an important poisonous plant of the China grassland, is toxic to humans and livestock. The rapid expansion of S. chamaejasme has greatly damaged the grassland ecology and, consequently, seriously endangered the development of animal husbandry. To draft efficient prevention and control measures, it has become more urgent to carry out research on its adaptive and expansion mechanisms in different unfavorable habitats at the genetic level. Quantitative real-time polymerase chain reaction (qRT-PCR is a widely used technique for studying gene expression at the transcript level; however, qRT-PCR requires reference genes (RGs as endogenous controls for data normalization and only through appropriate RG selection and qRT-PCR can we guarantee the reliability and robustness of expression studies and RNA-seq data analysis. Unfortunately, little research on the selection of RGs for gene expression data normalization in S. chamaejasme has been reported. Method In this study, 10 candidate RGs namely, 18S, 60S, CYP, GAPCP1, GAPDH2, EF1B, MDH, SAND, TUA1, and TUA6, were singled out from the transcriptome database of S. chamaejasme, and their expression stability under three abiotic stresses (drought, cold, and salt and three hormone treatments (abscisic acid, ABA; gibberellin, GA; ethephon, ETH were estimated with the programs geNorm, NormFinder, and BestKeeper. Result Our results showed that GAPCP1 and EF1B were the best combination for the three abiotic stresses, whereas TUA6 and SAND, TUA1 and CYP, GAPDH2 and 60S were the best choices for ABA, GA, and ETH treatment, respectively. Moreover, GAPCP1 and 60S were assessed to be the best combination for all samples, and 18S was the least stable RG for use as an internal control in all of the experimental subsets. The expression patterns of two target genes (P5CS2 and GI further verified that the RGs that we selected were suitable for gene expression normalization. Discussion

  6. DETECTION OF CLASSICAL SWINE FEVER VIRUS BY RT-PCR IN WEST BENGAL, INDIA

    Directory of Open Access Journals (Sweden)

    Sumit Chowdhury

    2016-12-01

    Full Text Available Classical swine fever is a deadly disease of swine, caused by a RNA virus. The present study has identified presence of the classical swine fever virus (CSFV in pigs of West Bengal by one step reverse transcriptase PCR (RT-PCR performed using 5’ NTR specific primers. Internal organs from clinically affected pigs were examined from three districts of West Bengal. RT-PCT has identified presence of CSFV in all the tissues examined confirming presence of CSFV in different parts of the state.

  7. Sensitive real-time PCR detection of pathogenic Leptospira spp. and a comparison of nucleic acid amplification methods for the diagnosis of leptospirosis.

    Science.gov (United States)

    Waggoner, Jesse J; Balassiano, Ilana; Abeynayake, Janaki; Sahoo, Malaya K; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Vital-Brazil, Juliana Magalhães; Pinsky, Benjamin A

    2014-01-01

    Bacteria of the genus Leptospira, the causative agents of leptospirosis, are categorized into pathogenic and non-pathogenic species. However, the benefit of using a clinical diagnostic that is specific for pathogenic species remains unclear. In this study, we present the development of a real-time PCR (rtPCR) for the detection of pathogenic Leptospira (the pathogenic rtPCR), and we perform a comparison of the pathogenic rtPCR with a published assay that detects all Leptospira species [the undifferentiated febrile illness (UFI) assay] and a reference 16S Leptospira rtPCR, which was originally designed to detect pathogenic species. For the pathogenic rtPCR, a new hydrolysis probe was designed for use with primers from the UFI assay, which targets the 16S gene. The pathogenic rtPCR detected Leptospira DNA in 37/37 cultured isolates from 5 pathogenic and one intermediate species. Two strains of the non-pathogenic L. biflexa produced no signal. Clinical samples from 65 patients with suspected leptospirosis were then tested using the pathogenic rtPCR and a reference Leptospira 16S rtPCR. All 65 samples had tested positive for Leptospira using the UFI assay; 62 (95.4%) samples tested positive using the pathogenic rtPCR (p = 0.24). Only 24 (36.9%) samples tested positive in the reference 16S rtPCR (pLeptospira species in 49/50 cases, including 3 cases that were only detected using the UFI assay. The pathogenic rtPCR displayed similar sensitivity to the UFI assay when testing clinical specimens with no difference in specificity. Both assays proved significantly more sensitive than a real-time molecular test used for comparison. Future studies are needed to investigate the clinical and epidemiologic significance of more sensitive Leptospira detection using these tests.

  8. Validation of putative reference genes for normalization of Q-RT-PCR data from paraffin-embedded lymphoid tissue

    DEFF Research Database (Denmark)

    Green, Tina Marie; de Stricker, Karin; Møller, Michael Boe

    2009-01-01

    Normalization of quantitative reverse transcription-PCR (Q-RT-PCR) data to appropriate tissue-specific reference genes is an essential part of interpreting the results. This study aimed to determine the most appropriate reference genes for normalizing gene expressions in lymphatic tissue...... was 0.93 (Pnormalization with the appropriate reference genes. Thus, we show that formalin-fixed, paraffin-embedded lymphoid samples are suitable for Q-RT-PCR when using thoroughly validated reference genes....

  9. An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV

    Directory of Open Access Journals (Sweden)

    Miyazawa Takayuki

    2010-12-01

    Full Text Available Abstract During pilot studies to investigate the presence of viral RNA of xenotropic murine leukemia virus (MLV-related virus (XMRV infection in sera from chronic fatigue syndrome (CFS patients in Japan, a positive band was frequently detected at the expected product size in negative control samples when detecting a partial gag region of XMRV using a one-step RT-PCR kit. We suspected that the kit itself might have been contaminated with small traces of endogenous MLV genome or XMRV and attempted to evaluate the quality of the kit in two independent laboratories. We purchased four one-step RT-PCR kits from Invitrogen, TaKaRa, Promega and QIAGEN in Japan. To amplify the partial gag gene of XMRV or other MLV-related viruses, primer sets (419F and 1154R, and GAG-I-F and GAG-I-R which have been widely used in XMRV studies were employed. The nucleotide sequences of the amplicons were determined and compared with deposited sequences of a polytropic endogenous MLV (PmERV, XMRV and endogenous MLV-related viruses derived from CFS patients. We found that the enzyme mixtures of the one-step RT-PCR kit from Invitrogen were contaminated with RNA derived from PmERV. The nucleotide sequence of a partial gag region of the contaminant amplified by RT-PCR was nearly identical (99.4% identity to a PmERV on chromosome 7 and highly similar (96.9 to 97.6% to recently identified MLV-like viruses derived from CFS patients. We also determined the nucleotide sequence of a partial env region of the contaminant and found that it was almost identical (99.6% to the PmERV. In the investigation of XMRV infection in patients of CFS and prostate cancer, researchers should prudently evaluate the test kits for the presence of endogenous MLV as well as XMRV genomes prior to PCR and RT-PCR tests.

  10. A simple RT-PCR-based strategy for screening connexin identity

    Directory of Open Access Journals (Sweden)

    M. Urban

    1999-08-01

    Full Text Available Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.

  11. Strategy for the maximization of clinically relevant information from hepatitis C virus, RT-PCR quantification.

    LENUS (Irish Health Repository)

    Levis, J

    2012-02-03

    BACKGROUND: The increasing clinical application of viral load assays for monitoring viral infections has been an incentive for the development of standardized tests for the hepatitis C virus. OBJECTIVE: To develop a simple model for the prediction of baseline viral load in individuals infected with the hepatitis C virus. METHODOLOGY: Viral load quantification of each patient\\'s first sample was assessed by RT-PCR-ELISA using the Roche MONITOR assay in triplicate. Genotype of the infecting virus was identified by reverse line probe hybridization, using amplicons resulting from the qualitative HCV Roche AMPLICOR assay. RESULTS: Retrospective evaluation of first quantitative values suggested that 82.4% (n=168\\/204) of individuals had a viral load between 4.3 and 6.7 log(10) viral copies per ml. A few patients (3.4%; n=7\\/204) have a serum viremia less than the lower limit of the linear range of the RT-PCR assay. Subsequent, prospective evaluation of hepatitis C viral load of all new patients using a model based on the dynamic range of viral load in the retrospective group correctly predicted the dynamic range in 75.9% (n=33\\/54). CONCLUSION: The dynamic range of hepatitis C viremia extends beyond the linear range of the Roche MONITOR assay. Accurate determination of serum viremia is substantially improved by dilution of specimens prior to quantification.

  12. Evaluation of gamma-sterilization (60Co) by RT-PCR by DHFR expression detection

    International Nuclear Information System (INIS)

    Converso, Ana Paula G.; Andrade Junior, Heitor F. de; Vieira, Daniel P.

    2007-01-01

    The improvement of techniques to detect pathogen agents in blood had reduced significantly the contamination mechanisms by hemocomponents in blood transfusion procedures. Ionizing radiation is a method that has presented several applications on medicine and in currently days has been showing special attention on blood banks which has been applied to avoid TA-GVHD development. DHFR is an enzyme constitutive in Plasmodium protozoa and has an important role in folate metabolism on these parasites. Detecting the expression of RNAm coder for this enzyme is possible to evaluate the viability of this parasite in blood samples. Plasmodium chabaudi AJ is a parasite that induces lethal malaria in rodents similar to human malaria In this work, the objective was to detect the presence of plasmodium protozoa in irradiated blood samples, infected experimentally, through the application of a RT-PCR using primers for the coder sequence of DHFR's mRNA. We studied doses of ionizing radiation between 0 and 75 Gy. The irradiation procedures were accomplished in Center of Radiation Technology of IPEN-CNEN in a 60 Co panoramic source. Our results had demonstrated that RT-PCR is a sensible method to evaluate the viability of plasmodium in blood samples because the technique could detect low parasite burden in all tested samples. (author)

  13. Evaluation of gamma-sterilization ({sup 60}Co) by RT-PCR by DHFR expression detection

    Energy Technology Data Exchange (ETDEWEB)

    Converso, Ana Paula G.; Andrade Junior, Heitor F. de [Instituto de Medicina Tropical de Sao Paulo, Sao Paulo, SP (Brazil)]. E-mail: anapaulagconverso@gmail.com; hfandrad@usp.br; Vieira, Daniel P. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Instituto de Medicina Tropical de Sao Paulo, Sao Paulo, SP (Brazil); E-mail: dperezv@usp.br

    2007-07-01

    The improvement of techniques to detect pathogen agents in blood had reduced significantly the contamination mechanisms by hemocomponents in blood transfusion procedures. Ionizing radiation is a method that has presented several applications on medicine and in currently days has been showing special attention on blood banks which has been applied to avoid TA-GVHD development. DHFR is an enzyme constitutive in Plasmodium protozoa and has an important role in folate metabolism on these parasites. Detecting the expression of RNAm coder for this enzyme is possible to evaluate the viability of this parasite in blood samples. Plasmodium chabaudi AJ is a parasite that induces lethal malaria in rodents similar to human malaria In this work, the objective was to detect the presence of plasmodium protozoa in irradiated blood samples, infected experimentally, through the application of a RT-PCR using primers for the coder sequence of DHFR's mRNA. We studied doses of ionizing radiation between 0 and 75 Gy. The irradiation procedures were accomplished in Center of Radiation Technology of IPEN-CNEN in a {sup 60}Co panoramic source. Our results had demonstrated that RT-PCR is a sensible method to evaluate the viability of plasmodium in blood samples because the technique could detect low parasite burden in all tested samples. (author)

  14. Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR

    Directory of Open Access Journals (Sweden)

    Hoseong Choi

    2013-03-01

    Full Text Available To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.

  15. Detection of canine distemper virus nucleoprotein gene by RT-PCR in urine of dogs with distemper clinical signs

    International Nuclear Information System (INIS)

    Gebara, C.M.S.; Wosiachi, S.R.; Negrao, F.J.; Oliveira, D.B. de; Beloni, S.N.E.; Alfieri, A.A.; Alfieri, A.F.

    2004-01-01

    The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV) nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control) included 20 assymptomatic dogs. A c2 was used to test RT-PCR results according to clinical form and hematological characteristics. The RT-PCR was positive for CDV in 47% (41/87) of the urine samples from dogs with clinical signs. All samples from assymptomatic dogs were RT-PCR negatives. Positive samples were found in all groups of dogs with distemper symptoms according to the following propositions: 51.2% (21/41), 29% (11/37) and 100% (9/9) for groups A, B and C, respectively. In all clinical forms (groups A, B and C) leucocytosis was the most frequent observed hematological alteration. No relationship between RT-PCR results and hematological changes was observed. The results showed that independently of the clinical stage of the illness the RT-PCR based on urine sample can be applied for ante mortem diagnosis of CDV

  16. Unequal distribution of RT-PCR artifacts along the E1-E2 region of Hepatitis C virus.

    Science.gov (United States)

    Domingo-Calap, Pilar; Sentandreu, Vicente; Bracho, Maria Alma; González-Candelas, Fernando; Moya, Andrés; Sanjuán, Rafael

    2009-10-01

    Although viral variability studies have focused traditionally on consensus sequences, the relevance of molecular clone sequences for studying viral evolution at the intra-host level is being increasingly recognized. However, for this approach to be reliable, RT-PCR artifacts do not have to contribute excessively to the observed variability. Molecular clone sequences were obtained from an in vitro transcript to estimate the maximum error rate associated to RT-PCR for the Hepatitis C virus (HCV) E1-E2 region. On average, the frequency of RT-PCR errors was one order of magnitude lower than the level of intra-host genetic variability observed in samples from an HCV outbreak. However, RT-PCR errors were not distributed evenly along the E1-E2 region and were concentrated heavily in the hypervariable region 2 (HVR 2). Although it is concluded that RT-PCR molecular clone sequences are reliable, these results warn against extrapolation of RT-PCR error rates to different genome regions. The data suggest that the RNA sequence context or secondary structure can determine the fidelity of in vitro transcription or reverse transcription. Potentially, these factors might also modify the fidelity of the viral polymerase.

  17. Assessing reference genes for accurate transcript normalization using quantitative real-time PCR in pearl millet [Pennisetum glaucum (L. R. Br].

    Directory of Open Access Journals (Sweden)

    Prasenjit Saha

    Full Text Available Pearl millet [Pennisetum glaucum (L. R.Br.], a close relative of Panicoideae food crops and bioenergy grasses, offers an ideal system to perform functional genomics studies related to C4 photosynthesis and abiotic stress tolerance. Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR provides a sensitive platform to conduct such gene expression analyses. However, the lack of suitable internal control reference genes for accurate transcript normalization during qRT-PCR analysis in pearl millet is the major limitation. Here, we conducted a comprehensive assessment of 18 reference genes on 234 samples which included an array of different developmental tissues, hormone treatments and abiotic stress conditions from three genotypes to determine appropriate reference genes for accurate normalization of qRT-PCR data. Analyses of Ct values using Stability Index, BestKeeper, ΔCt, Normfinder, geNorm and RefFinder programs ranked PP2A, TIP41, UBC2, UBQ5 and ACT as the most reliable reference genes for accurate transcript normalization under different experimental conditions. Furthermore, we validated the specificity of these genes for precise quantification of relative gene expression and provided evidence that a combination of the best reference genes are required to obtain optimal expression patterns for both endogeneous genes as well as transgenes in pearl millet.

  18. Enhancement of Near-Real-Time Cloud Analysis and Related Analytic Support for Whole Sky Imagers

    National Research Council Canada - National Science Library

    Shields, Janet E; Karr, Monette E; Burden, Art R; Johnson, Richard W; Hodgkiss, William S

    2007-01-01

    ... DO #4, between 25 May 01 and 31 September 06. This work relates to the Air Force s need to characterize the cloud distribution during day and night, for a variety of applications, including support of satellite tracking, and support of research...

  19. An Efficient Quality-Related Fault Diagnosis Method for Real-Time Multimode Industrial Process

    Directory of Open Access Journals (Sweden)

    Kaixiang Peng

    2017-01-01

    Full Text Available Focusing on quality-related complex industrial process performance monitoring, a novel multimode process monitoring method is proposed in this paper. Firstly, principal component space clustering is implemented under the guidance of quality variables. Through extraction of model tags, clustering information of original training data can be acquired. Secondly, according to multimode characteristics of process data, the monitoring model integrated Gaussian mixture model with total projection to latent structures is effective after building the covariance description form. The multimode total projection to latent structures (MTPLS model is the foundation of problem solving about quality-related monitoring for multimode processes. Then, a comprehensive statistics index is defined which is based on the posterior probability of the monitored samples belonging to each Gaussian component in the Bayesian theory. After that, a combined index is constructed for process monitoring. Finally, motivated by the application of traditional contribution plot in fault diagnosis, a gradient contribution rate is applied for analyzing the variation of variable contribution rate along samples. Our method can ensure the implementation of online fault monitoring and diagnosis for multimode processes. Performances of the whole proposed scheme are verified in a real industrial, hot strip mill process (HSMP compared with some existing methods.

  20. The RASNIK real-time relative alignment monitor for the CDF inner tracking detectors

    International Nuclear Information System (INIS)

    Goldstein, David; Saltzberg, David

    2003-01-01

    We describe the design and operation of the RASNIK optical relative alignment system designed for and installed on the CDF inner tracking detectors. The system provides low-cost minute-by-minute alignment monitoring with submicron precision. To reduce ambiguities, we modified the original three-element RASNIK design to a two-element one. Since the RASNIKs are located within 10-40 cm of the beam line, the systems were built from low-mass and radiation-hard components and are operated in a mode which reduces damage from radiation. We describe the data-acquisition system, which has been running without interruption since before the CDF detector was rolled into its collision hall in March 2001. We evaluate what has been learned about sources of detector motion from almost 2 years of RASNIK data and discuss possible improvements to the system

  1. Real-Time PCR (qPCR) Primer Design Using Free Online Software

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

  2. Free cancer cell detection in peritoneal cavity in gastric cancer patients by RT-PCR for CEA

    International Nuclear Information System (INIS)

    Lee, Jong Inn; Moon, Nan Mo; Paik, Nam Sun; Choi, Dong Wook; Bang, Ho Yun; Hong, Seok Il

    1997-12-01

    Authors applied RT-PCR assay to detecting CEA expressing free cancer cells in peritoneal cavity of 114 gastric cancer patients to find an indication for prophylactic treatment to prevent peritoneal recurrence. Sixty-three of 114 cases were positive for RT-PCR, of which 16 cases were positive for cytologic examination and 47 cases were negative. Forty-nine of 51 cases who were negative for RT-PCR were negative for cytologic examination. Positivity for RT-PCR according to the depth of invasion were as follows : two (28.6 %) of seven cases whose cancer invaded mucosal or submucosal layer were positive. Ten (45.5 %) of 22 cases whose cancer invaded muscular or subserosal layer were positive. Forty-one (57.7 %) of 71 serosa involved cases were positive. Eleven (78.6 %) of cases who had grossly perioneal seedings were positive (p=0.026). However, all of 7 EGC cases, 19 of 22 cases whose cancer invaded to muscle layer or to subserosa were negative for cytologic examination, and eight of 13 cases who had had peritoneal seedings were positive. Positivity for RT-PCR according to cell differentiation were as follows: forty-two (61.8 %) of 68 cases who cancer were poorly differentiated type were positive. (p=0.163) Serum level of CEA of RT-PCR positive group and that of negative group were not statistically different. It was revealed that RT-PCR was more sensitive than cytologic examination in detecting free tumor cells, especially in pm, ss and serosa positive cancers, so if further study with more cases and longer follow-up is performed, its role as prognostic factor and an indication of prophylactic therapy will be clarified. (author). 22 refs., 5 tabs

  3. Free cancer cell detection in peritoneal cavity in gastric cancer patients by RT-PCR for CEA

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jong Inn; Moon, Nan Mo; Paik, Nam Sun; Choi, Dong Wook; Bang, Ho Yun; Hong, Seok Il [Korea Cancer Center Hospital, Seoul (Korea, Republic of)

    1997-12-01

    Authors applied RT-PCR assay to detecting CEA expressing free cancer cells in peritoneal cavity of 114 gastric cancer patients to find an indication for prophylactic treatment to prevent peritoneal recurrence. Sixty-three of 114 cases were positive for RT-PCR, of which 16 cases were positive for cytologic examination and 47 cases were negative. Forty-nine of 51 cases who were negative for RT-PCR were negative for cytologic examination. Positivity for RT-PCR according to the depth of invasion were as follows : two (28.6 %) of seven cases whose cancer invaded mucosal or submucosal layer were positive. Ten (45.5 %) of 22 cases whose cancer invaded muscular or subserosal layer were positive. Forty-one (57.7 %) of 71 serosa involved cases were positive. Eleven (78.6 %) of cases who had grossly perioneal seedings were positive (p=0.026). However, all of 7 EGC cases, 19 of 22 cases whose cancer invaded to muscle layer or to subserosa were negative for cytologic examination, and eight of 13 cases who had had peritoneal seedings were positive. Positivity for RT-PCR according to cell differentiation were as follows: forty-two (61.8 %) of 68 cases who cancer were poorly differentiated type were positive. (p=0.163) Serum level of CEA of RT-PCR positive group and that of negative group were not statistically different. It was revealed that RT-PCR was more sensitive than cytologic examination in detecting free tumor cells, especially in pm, ss and serosa positive cancers, so if further study with more cases and longer follow-up is performed, its role as prognostic factor and an indication of prophylactic therapy will be clarified. (author). 22 refs., 5 tabs.

  4. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Identification of rat genes by TWINSCAN gene prediction, RT-PCR, and direct sequencing

    DEFF Research Database (Denmark)

    Wu, Jia Qian; Shteynberg, David; Arumugam, Manimozhiyan

    2004-01-01

    an alternative approach: reverse transcription-polymerase chain reaction (RT-PCR) and direct sequencing based on dual-genome de novo predictions from TWINSCAN. We tested 444 TWINSCAN-predicted rat genes that showed significant homology to known human genes implicated in disease but that were partially...... in the single-intron experiment. Spliced sequences were amplified in 46 cases (34%). We conclude that this procedure for elucidating gene structures with native cDNA sequences is cost-effective and will become even more so as it is further optimized.......The publication of a draft sequence of a third mammalian genome--that of the rat--suggests a need to rethink genome annotation. New mammalian sequences will not receive the kind of labor-intensive annotation efforts that are currently being devoted to human. In this paper, we demonstrate...

  6. Emulating a crowded intracellular environment in vitro dramatically improves RT-PCR performance

    International Nuclear Information System (INIS)

    Lareu, Ricky R.; Harve, Karthik S.; Raghunath, Michael

    2007-01-01

    The polymerase chain reaction's (PCR) phenomenal success in advancing fields as diverse as Medicine, Agriculture, Conservation, or Paleontology is based on the ability of using isolated prokaryotic thermostable DNA polymerases in vitro to copy DNA irrespective of origin. This process occurs intracellularly and has evolved to function efficiently under crowded conditions, namely in an environment packed with macromolecules. However, current in vitro practice ignores this important biophysical parameter of life. In order to more closely emulate conditions of intracellular biochemistry in vitro we added inert macromolecules into reverse transcription (RT) and PCR. We show dramatic improvements in all parameters of RT-PCR including 8- to 10-fold greater sensitivity, enhanced polymerase processivity, higher specific amplicon yield, greater primer annealing and specificity, and enhanced DNA polymerase thermal stability. The faster and more efficient reaction kinetics was a consequence of the cumulative molecular and thermodynamic effects of the excluded volume effect created by macromolecular crowding

  7. Expanding Horizons in Mitigating Earthquake Related Disasters in Urban Areas: Global Development of Real-Time Seismology

    OpenAIRE

    Utkucu, Murat; Küyük, Hüseyin Serdar; Demir, İsmail Hakkı

    2016-01-01

    Abstract Real-time seismology is a newly developing alternative approach in seismology to mitigate earthquake hazard. It exploits up-to-date advances in seismic instrument technology, data acquisition, digital communications and computer systems for quickly transforming data into earthquake information in real-time to reduce earthquake losses and its impact on social and economic life in the earthquake prone densely populated urban and industrial areas.  Real-time seismology systems are not o...

  8. Combination of RT-PCR and proteomics for the identification of Crimean-Congo hemorrhagic fever virus in ticks

    Directory of Open Access Journals (Sweden)

    Isabel G. Fernández de Mera

    2017-07-01

    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is an emerging tick-borne zoonotic disease caused by the CCHF virus (CCHFV. In this study, an experimental approach combining RT-PCR and proteomics was used for the identification and characterization of CCHFV in 106 ticks from 7 species that were collected from small ruminants in Greece. The methodological approach included an initial screening for CCHFV by RT-PCR followed by proteomics analysis of positive and control negative tick samples. This novel approach allowed the identification of CCHFV-positive ticks and provided additional information to corroborate the RT-PCR findings using a different approach. Two ticks, Dermacentor marginatus and Haemaphysalis parva collected from a goat and a sheep, respectively were positive for CCHFV. The sequences for CCHFV RNA segments S and L were characterized by RT-PCR and proteomics analysis of tick samples, respectively. These results showed the possibility of combining analyses at the RNA and protein levels using RT-PCR and proteomics for the characterization of CCHFV in ticks. The results supported that the CCHFV identified in ticks are genetic variants of the AP92 strain. Although the AP92-like strains probably do not represent a high risk of CCHF to the population, the circulation of genetically diverse CCHFV strains could potentially result in the appearance of novel viral genotypes with increased pathogenicity and fitness.

  9. Determinazione quantitativa di HCV-RNA: valutazione comparativa dei saggi Abbott Real-Time e Versant bDNA v.3

    Directory of Open Access Journals (Sweden)

    Aldo Manzin

    2007-06-01

    Full Text Available Hepatitis C virus (HCV RNA measurement before, during and after antiviral therapy has become an essential tool in the management of interferon-based treatment of HCV-related infections. Conventional Polymerase Chain Reaction (PCR has been largely used to obtain quantitative data, but laborious, time-consuming post-PCR handling steps are required to gain valuable results. Real time (RT PCR now provides advantages over end-point (EP PCR due to its improved rapidity, sensitivity, reproducibility and the reduced risk of carry-over contamination, and has now proven itself to be valuable for the more precise monitoring of viral load kinetics and assessing antiviral response.The Abbott Real-Time HCV-RNA is a recently introduced assay for the automated processing of clinical samples and HCV-RNA quantitation: its basic technology relies on use of fluorescent linear probes (dynamic range using 0.5 ml as input target= 12-108 IU/mL and a hybridization/detection step at low temperature (35°C, which allows target mismatches to be tolerated. To determine the clinical application of the Abbott Real-Time assay and defining its correlation with the Bayer Versant bDNA v.3 assay, 68 consecutive samples from unselected HCV-infected patients were retrospectively analysed with RT and the results obtained using the two tests compared.A good correlation was found between RT-PCR and bDNA: 97% of samples tested had a result within a 0.5 log HCV IU/mL difference (bias=0.15 log, whereas 6 samples negative with bDNA gave positive results with Abbott RT (range, 1.89-3.07 log IU/mL and “in-house” qualitative RT-PCR assays.

  10. Real-time appraisal of the spatially distributed heat related health risk and energy demand of cities

    Science.gov (United States)

    Keramitsoglou, Iphigenia; Kiranoudis, Chris T.; Sismanidis, Panagiotis

    2016-08-01

    The Urban Heat Island (UHI) is an adverse environmental effect of urbanization that increases the energy demand of cities, impacts the human health, and intensifies and prolongs heatwave events. To facilitate the study of UHIs the Institute for Astronomy, Astrophysics, Space Applications and Remote Sensing of the National Observatory of Athens (IAASARS/NOA) has developed an operational real-time system that exploits remote sensing image data from Meteosat Second Generation - Spinning Enhanced Visible and Infrared Imager (MSG-SEVIRI) and generates high spatiotemporal land surface temperature (LST) and 2 m air temperature (TA) time series. These datasets form the basis for the generation of higher value products and services related to energy demand and heat-related health issues. These products are the heatwave hazard (HZ); the HUMIDEX (i.e. an index that describes the temperature felt by an individual exposed to heat and humidity); and the cooling degrees (CD; i.e. a measure that reflects the energy needed to cool a building). The spatiotemporal characteristics of HZ, HUMIDEX and CD are unique (1 km/5 min) and enable the appraisal of the spatially distributed heat related health risk and energy demand of cities. In this paper, the real time generation of the high spatiotemporal HZ, HUMIDEX and CD products is discussed. In addition, a case study corresponding to Athens' September 2015 heatwave is presented so as to demonstrate their capabilities. The overall aim of the system is to provide high quality data to several different end users, such as health responders, and energy suppliers. The urban thermal monitoring web service is available at http://snf-652558.vm.okeanos.grnet.gr/treasure/portal/info.html.

  11. Validation of reference genes for quantitative RT-PCR studies of gene expression in perennial ryegrass (Lolium perenne L.

    Directory of Open Access Journals (Sweden)

    Thrush Anthony

    2010-01-01

    Full Text Available Abstract Background Perennial ryegrass (Lolium perenne L. is an important pasture and turf crop. Biotechniques such as gene expression studies are being employed to improve traits in this temperate grass. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is among the best methods available for determining changes in gene expression. Before analysis of target gene expression, it is essential to select an appropriate normalisation strategy to control for non-specific variation between samples. Reference genes that have stable expression at different biological and physiological states can be effectively used for normalisation; however, their expression stability must be validated before use. Results Existing Serial Analysis of Gene Expression data were queried to identify six moderately expressed genes that had relatively stable gene expression throughout the year. These six candidate reference genes (eukaryotic elongation factor 1 alpha, eEF1A; TAT-binding protein homolog 1, TBP-1; eukaryotic translation initiation factor 4 alpha, eIF4A; YT521-B-like protein family protein, YT521-B; histone 3, H3; ubiquitin-conjugating enzyme, E2 were validated for qRT-PCR normalisation in 442 diverse perennial ryegrass (Lolium perenne L. samples sourced from field- and laboratory-grown plants under a wide range of experimental conditions. Eukaryotic EF1A is encoded by members of a multigene family exhibiting differential expression and necessitated the expression analysis of different eEF1A encoding genes; a highly expressed eEF1A (h, a moderately, but stably expressed eEF1A (s, and combined expression of multigene eEF1A (m. NormFinder identified eEF1A (s and YT521-B as the best combination of two genes for normalisation of gene expression data in perennial ryegrass following different defoliation management in the field. Conclusions This study is unique in the magnitude of samples tested with the inclusion of numerous field-grown samples

  12. Application and evaluation of RT-PCR-ELISA for the nucleoprotein and RT-PCR for detection of low-pathogenic H5 and H7 subtypes of avian influenza virus

    DEFF Research Database (Denmark)

    Dybkær, Karen; Munch, Mette; Handberg, Kurt J.

    2004-01-01

    Three 1-tube Reverse Transcriptase Polymerase Chain Reactions (RT-PCR) directed against the genes encoding the nucleoprotein (NP) and the H5 and H7 hemagglutinin (HA) gene, respectively, were used for detection of avian influenza virus (AIV) in various specimens. A total of 1,040 samples...... originating from chickens experimentally infected with 2 different low pathogenic avian influenza viruses, from domestic ducks and from wild aquatic birds were examined. The outcome of 1) the universal AIV RT-PCR including a PCR-enzyme-linked immunosorbent assay (ELISA) procedure directed against NP (NP RT...

  13. Diagnosis of ventricular drainage-related bacterial meningitis by broad-range real-time polymerase chain reaction

    DEFF Research Database (Denmark)

    Deutch, Susanna; Dahlberg, Daniel; Hedegaard, Jesper

    2007-01-01

    OBJECTIVE: To compare a broad-range real-time polymerase chain reaction (PCR) diagnostic strategy with culture to evaluate additional effects on the etiological diagnosis and the quantification of the bacterial load during the course of ventricular drainage-related bacterial meningitis (VR......-BM). METHODS: We applied a PCR that targeted conserved regions of the 16S ribosomal ribonucleic acid gene to cerebrospinal fluid (CSF) samples from patients with external ventricular drainage or a ventriculoperitoneal shunt during the course of VR-BM. We compared the PCR results with CSF cultures. A total...... of 350 routine CSF samples were consecutively collected from 86 patients. The CSF deoxyribonucleic acid was automatically purified and subjected to PCR. Amplicons from the PCR samples that were positive for VR-BM were subsequently deoxyribonucleic acid sequenced for final identification. Clinical data...

  14. Real-time specifications

    DEFF Research Database (Denmark)

    David, A.; Larsen, K.G.; Legay, A.

    2015-01-01

    A specification theory combines notions of specifications and implementations with a satisfaction relation, a refinement relation, and a set of operators supporting stepwise design. We develop a specification framework for real-time systems using Timed I/O Automata as the specification formalism......, with the semantics expressed in terms of Timed I/O Transition Systems. We provide constructs for refinement, consistency checking, logical and structural composition, and quotient of specifications-all indispensable ingredients of a compositional design methodology. The theory is implemented in the new tool Ecdar...

  15. Exploring Valid Reference Genes for Quantitative Real-Time PCR Analysis in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2015-01-01

    The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study...

  16. Utility of dengue NS1 antigen rapid diagnostic test for use in difficult to reach areas and its comparison with dengue NS1 ELISA and qRT-PCR.

    Science.gov (United States)

    Shukla, Mohan K; Singh, Neeru; Sharma, Ravendra K; Barde, Pradip V

    2017-07-01

    The objective of this study was to demonstrate the utility of dengue virus (DENV) non structural protein 1 (NS1) based rapid diagnostic test (RDT) for use in tribal and difficult to reach areas for early dengue (DEN) diagnosis in acute phase patients and evaluate its sensitivity and specificity against DENV NS1 enzyme linked immune sorbent assay (ELISA) and real time reverse transcriptase polymerase chain reaction (qRT-PCR). The DENV NS1 RDT was used for preliminary diagnosis during outbreaks in difficult to reach rural and tribal areas. The diagnosis was confirmed by DENV NS1 ELISA in the laboratory. The samples were also tested and serotyped by qRT-PCR. The results were evaluated using statistical tests. The DENV NS1 RDT showed 99.2% sensitivity and 96.0% specificity when analyzed using DENV NS1 ELISA as standard. The specificity and sensitivity of the RDT when compared with qRT-PCR was 93.6% and 91.1%, respectively. The serotype specific evaluation showed more than 90% sensitivity and specificity for DENV-1, 2, and 3. The RDT proved a good diagnostic tool in difficult to reach rural and tribal areas. Further evaluation studies with different commercially available RDTs in different field conditions are essential, that will help clinicians and patients for treatment and programme managers for timely intervention. © 2017 Wiley Periodicals, Inc.

  17. Rapid diagnosis of avian influenza virus in wild birds: Use of a portable rRT-PCR and freeze-dried reagents in the field

    Science.gov (United States)

    Takekawa, John Y.; Hill, N.J.; Schultz, A.K.; Iverson, S.A.; Cardona, C.J.; Boyce, W.M.; Dudley, J.P.

    2011-01-01

    Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal. Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene. The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey

  18. Enhancing the sensitivity of Dengue virus serotype detection by RT-PCR among infected children in India.

    Science.gov (United States)

    Ahamed, Syed Fazil; Vivek, Rosario; Kotabagi, Shalini; Nayak, Kaustuv; Chandele, Anmol; Kaja, Murali-Krishna; Shet, Anita

    2017-06-01

    Dengue surveillance relies on reverse transcription-polymerase chain reaction (RT-PCR), for confirmation of dengue virus (DENV) serotypes. We compared efficacies of published and modified primer sets targeting envelope (Env) and capsid-premembrane (C-prM) genes for detection of circulating DENV serotypes in southern India. Acute samples from children with clinically-diagnosed dengue were used for RT-PCR testing. All samples were also subjected to dengue serology (NS1 antigen and anti-dengue-IgM/IgG rapid immunochromatographic assay). Nested RT-PCR was performed on viral RNA using three methods targeting 654bp C-prM, 511bp C-prM and 641bp Env regions, respectively. RT-PCR-positive samples were validated by population sequencing. Among 171 children with suspected dengue, 121 were dengue serology-positive and 50 were dengue serology-negative. Among 121 serology-positives, RT-PCR detected 91 (75.2%) by CprM654, 72 (59.5%) by CprM511, and 74 (61.1%) by Env641. Among 50 serology-negatives, 10 (20.0%) were detected by CprM654, 12 (24.0%) by CprM511, and 11 (22.0%) by Env641. Overall detection rate using three methods sequentially was 82.6% (100/121) among serology-positive and 40.0% (20/50) among serology-negative samples; 6.6% (8/120) had co-infection with multiple DENV serotypes. We conclude that detection of acute dengue was enhanced by a modified RT-PCR method targeting the 654bp C-prM region, and further improved by using all three methods sequentially. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Simultaneous detection of Plasmodium vivax and Plasmodium falciparum gametocytes in clinical isolates by multiplex-nested RT-PCR.

    Science.gov (United States)

    Kuamsab, Napaporn; Putaporntip, Chaturong; Pattanawong, Urassaya; Jongwutiwes, Somchai

    2012-06-10

    Gametocyte carriage is essential for malaria transmission and endemicity of disease; thereby it is a target for malaria control strategies. Malaria-infected individuals may harbour gametocytes below the microscopic detection threshold that can be detected by reverse transcription polymerase chain reaction (RT-PCR) targeting gametocyte-specific mRNA. To date, RT-PCR has mainly been applied to the diagnosis of Plasmodium falciparum gametocytes but very limited for that of Plasmodium vivax. A multiplex-nested RT-PCR targeting Pfs25 and Pvs25 mRNA specific to mature gametocytes of P. falciparum and P. vivax, respectively, was developed. The assay was evaluated using blood samples collected in rainy and dry seasons from febrile patients,in a malaria-endemic area in Thailand. Malaria diagnosis was performed by Giemsa-stained blood smears and 18S rRNA PCR. The multiplex-nested RT-PCR detected Pfs25 mRNA in 75 of 86 (87.2%) P. falciparum-infected individuals and Pvs25 mRNA in 82 of 90 (91.1%) P. vivax malaria patients diagnosed by 18S rRNA PCR. Gametocytes were detected in 38 (eight P. falciparum and 30 P. vivax) of 157 microscopy positive samples, implying that a large number of patients harbour sub-microscopic gametocytaemia. No seasonal differences in gametocyte carriage were observed for both malaria species diagnosed by multiplex-nested RT-PCR. With single-nested RT-PCR targeting Pfs25 or Pvs25 mRNA as standard, the multiplex-nested RT-PCR offered sensitivities of 97.4% and 98.9% and specificities of 100% and 98.8% for diagnosing mature gametocytes of P. falciparum and P. vivax, respectively. The minimum detection limit of the multiplex-nested PCR was 10 copies of templates. The multiplex-nested RT-PCR developed herein is useful for simultaneous assessment of both P. falciparum and P. vivax gametocyte carriage that is prevalent and generally sympatric in several malaria-endemic areas outside Africa.

  20. Galectin-3 and Beclin1/Atg6 genes in human cancers: using cDNA tissue panel, qRT-PCR, and logistic regression model to identify cancer cell biomarkers.

    Directory of Open Access Journals (Sweden)

    Halliday A Idikio

    Full Text Available Cancer biomarkers are sought to support cancer diagnosis, predict cancer patient response to treatment and survival. Identifying reliable biomarkers for predicting cancer treatment response needs understanding of all aspects of cancer cell death and survival. Galectin-3 and Beclin1 are involved in two coordinated pathways of programmed cell death, apoptosis and autophagy and are linked to necroptosis/necrosis. The aim of the study was to quantify galectin-3 and Beclin1 mRNA in human cancer tissue cDNA panels and determine their utility as biomarkers of cancer cell survival.A panel of 96 cDNAs from eight (8 different normal and cancer tissue types were used for quantitative real-time polymerase chain reaction (qRT-PCR using ABI7900HT. Miner2.0, a web-based 4- and 3-parameter logistic regression software was used to derive individual well polymerase chain reaction efficiencies (E and cycle threshold (Ct values. Miner software derived formula was used to calculate mRNA levels and then fold changes. The ratios of cancer to normal tissue levels of galectin-3 and Beclin1 were calculated (using the mean for each tissue type. Relative mRNA expressions for galectin-3 were higher than for Beclin1 in all tissue (normal and cancer types. In cancer tissues, breast, kidney, thyroid and prostate had the highest galectin-3 mRNA levels compared to normal tissues. High levels of Beclin1 mRNA levels were in liver and prostate cancers when compared to normal tissues. Breast, kidney and thyroid cancers had high galectin-3 levels and low Beclin1 levels.Galectin-3 expression patterns in normal and cancer tissues support its reported roles in human cancer. Beclin1 expression pattern supports its roles in cancer cell survival and in treatment response. qRT-PCR analysis method used may enable high throughput studies to generate molecular biomarker sets for diagnosis and predicting cancer treatment response.

  1. Combined Metabonomic and Quantitative RT-PCR Analyses Revealed Metabolic Reprogramming Associated with Fusarium graminearum Resistance in Transgenic Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Fangfang Chen

    2018-01-01

    Full Text Available Fusarium head blight disease resulting from Fusarium graminearum (FG infection causes huge losses in global production of cereals and development of FG-resistant plants is urgently needed. To understand biochemistry mechanisms for FG resistance, here, we have systematically investigated the plant metabolomic phenotypes associated with FG resistance for transgenic Arabidopsis thaliana expressing a class-I chitinase (Chi, a Fusarium-specific recombinant antibody gene (CWP2 and fused Chi-CWP2. Plant disease indices, mycotoxin levels, metabonomic characteristics, and expression levels of several key genes were measured together with their correlations. We found that A. thaliana expressing Chi-CWP2 showed higher FG resistance with much lower disease indices and mycotoxin levels than the wild-type and the plants expressing Chi or CWP2 alone. The combined metabonomic and quantitative RT-PCR analyses revealed that such FG-resistance was closely associated with the promoted biosynthesis of secondary metabolites (phenylpropanoids, alkanoids and organic osmolytes (proline, betaine, glucose, myo-inositol together with enhanced TCA cycle and GABA shunt. These suggest that the concurrently enhanced biosyntheses of the shikimate-mediated secondary metabolites and organic osmolytes be an important strategy for A. thaliana to develop and improve FG resistance. These findings provide essential biochemical information related to FG resistance which is important for developing FG-resistant cereals.

  2. Housekeeping gene expression during fetal brain development in the rat-validation by semi-quantitative RT-PCR.

    Science.gov (United States)

    Al-Bader, Maie Dawoud; Al-Sarraf, Hameed Ali

    2005-04-21

    Mammalian gene expression is usually carried out at the level of mRNA where the amount of mRNA of interest is measured under different conditions such as growth and development. It is therefore important to use a "housekeeping gene", that does not change in relative abundance during the experimental conditions, as a standard or internal control. However, recent data suggest that expression of some housekeeping genes may vary with the extent of cell proliferation, differentiation and under various experimental conditions. In this study, the expression of various housekeeping genes (18S rRNA [18S], glyceraldehydes-3-phosphate dehydrogenase [G3PDH], beta-glucuronidase [BGLU], histone H4 [HH4], ribosomal protein L19 [RPL19] and cyclophilin [CY]) was investigated during fetal rat brain development using semi-quantitative RT-PCR at 16, 19 and 21 days gestation. It was found that all genes studied, with exception to G3PDH, did not show any change in their expression levels during development. G3PDH, on the other hand, showed increased expression with development. These results suggest that the choice of a housekeeping gene is critical to the interpretation of experimental results and should be modified according to the nature of the study.

  3. Identification and validation of reference genes for quantitative RT-PCR normalization in wheat

    Directory of Open Access Journals (Sweden)

    Porceddu Enrico

    2009-02-01

    Full Text Available Abstract Background Usually the reference genes used in gene expression analysis have been chosen for their known or suspected housekeeping roles, however the variation observed in most of them hinders their effective use. The assessed lack of validated reference genes emphasizes the importance of a systematic study for their identification. For selecting candidate reference genes we have developed a simple in silico method based on the data publicly available in the wheat databases Unigene and TIGR. Results The expression stability of 32 genes was assessed by qRT-PCR using a set of cDNAs from 24 different plant samples, which included different tissues, developmental stages and temperature stresses. The selected sequences included 12 well-known HKGs representing different functional classes and 20 genes novel with reference to the normalization issue. The expression stability of the 32 candidate genes was tested by the computer programs geNorm and NormFinder using five different data-sets. Some discrepancies were detected in the ranking of the candidate reference genes, but there was substantial agreement between the groups of genes with the most and least stable expression. Three new identified reference genes appear more effective than the well-known and frequently used HKGs to normalize gene expression in wheat. Finally, the expression study of a gene encoding a PDI-like protein showed that its correct evaluation relies on the adoption of suitable normalization genes and can be negatively affected by the use of traditional HKGs with unstable expression, such as actin and α-tubulin. Conclusion The present research represents the first wide screening aimed to the identification of reference genes and of the corresponding primer pairs specifically designed for gene expression studies in wheat, in particular for qRT-PCR analyses. Several of the new identified reference genes outperformed the traditional HKGs in terms of expression stability

  4. Real Time Revisited

    Science.gov (United States)

    Allen, Phillip G.

    1985-12-01

    The call for abolishing photo reconnaissance in favor of real time is once more being heard. Ten years ago the same cries were being heard with the introduction of the Charge Coupled Device (CCD). The real time system problems that existed then and stopped real time proliferation have not been solved. The lack of an organized program by either DoD or industry has hampered any efforts to solve the problems, and as such, very little has happened in real time in the last ten years. Real time is not a replacement for photo, just as photo is not a replacement for infra-red or radar. Operational real time sensors can be designed only after their role has been defined and improvements made to the weak links in the system. Plodding ahead on a real time reconnaissance suite without benefit of evaluation of utility will allow this same paper to be used ten years from now.

  5. Galactomannan and Real-Time PCR in the diagnosis of invasive Aspergillosis: preliminary data

    Directory of Open Access Journals (Sweden)

    Cristina Pedrotti

    2014-03-01

    Full Text Available The diagnosis of invasive aspergillosis is notoriously difficult. The standard culture-based methods have shown considerable limitations in performance. For this reason, non-culture methods have been increasingly employed for the diagnosis of invasive aspergillosis, and, among them, the methods based on Real-Time polymerase chain reaction (RT-PCR. In this study we assess the contribution in lowering diagnosis errors provided by the RT-PCR method when run alongside other methods. We analyzed 23 biological samples, 14 serum samples, and 9 bronchoalveolar lavage samples (BAL from 10 immunocompromised patients who were selected according to EORTC/MSG criteria (European Organization for Research and Treatment of Cancer/Mycoses Study Group. On the serum sample we searched the galactomannan (GM (Platelia Aspergillus® and the fungal genome (MycAssayTMAspergillus; the BAL samples were subjected also to the culture tests. In 11 serum samples the results showed concordance between GM and RT–PCR tests, while in 3 samples we report discordance: 2 results were GM positive and RT-PCR negative, and 1 results GM negative and RT-PCR indeterminate. In 5 BAL samples the results showed concordance between the two methods, while 4 were GM positive and RT-PCR negative. The data, although still preliminary, suggest an increased accuracy in the diagnosis of suspected invasive aspergillosis when employing both RT-PCR and GM tests given that the RT-PCR test eliminates the false positive results of the GM test. The PCR methods require, however, further applications of this type of diagnostic because of the severe limit given by the lack of standardization.

  6. Relative quantification of mRNA: comparison of methods currently used for real-time PCR data analysis

    Directory of Open Access Journals (Sweden)

    Koppel Juraj

    2007-12-01

    Full Text Available Abstract Background Fluorescent data obtained from real-time PCR must be processed by some method of data analysis to obtain the relative quantity of target mRNA. The method chosen for data analysis can strongly influence results of the quantification. Results To compare the performance of six techniques which are currently used for analysing fluorescent data in real-time PCR relative quantification, we quantified four cytokine transcripts (IL-1β, IL-6 TNF-α, and GM-CSF in an in vivo model of colonic inflammation. Accuracy of the methods was tested by quantification on samples with known relative amounts of target mRNAs. Reproducibility of the methods was estimated by the determination of the intra-assay and inter-assay variability. Cytokine expression normalized to the expression of three reference genes (ACTB, HPRT, SDHA was then determined using the six methods for data analysis. The best results were obtained with the relative standard curve method, comparative Ct method and with DART-PCR, LinRegPCR and Liu & Saint exponential methods when average amplification efficiency was used. The use of individual amplification efficiencies in DART-PCR, LinRegPCR and Liu & Saint exponential methods significantly impaired the results. The sigmoid curve-fitting (SCF method produced medium performance; the results indicate that the use of appropriate type of fluorescence data and in some instances manual selection of the number of amplification cycles included in the analysis is necessary when the SCF method is applied. We also compared amplification efficiencies (E and found that although the E values determined by different methods of analysis were not identical, all the methods were capable to identify two genes whose E values significantly differed from other genes. Conclusion Our results show that all the tested methods can provide quantitative values reflecting the amounts of measured mRNA in samples, but they differ in their accuracy and

  7. Safety surrogate histograms (SSH): A novel real-time safety assessment of dilemma zone related conflicts at signalized intersections.

    Science.gov (United States)

    Ghanipoor Machiani, Sahar; Abbas, Montasir

    2016-11-01

    Drivers' indecisiveness in dilemma zones (DZ) could result in crash-prone situations at signalized intersections. DZ is to the area ahead of an intersection in which drivers encounter a dilemma regarding whether to stop or proceed through the intersection when the signal turns yellow. An improper decision to stop by the leading driver, combined with the following driver deciding to go, can result in a rear-end collision, unless the following driver recognizes a collision is imminent and adjusts his or her behavior at or shortly after the onset of yellow. Considering the significance of DZ-related crashes, a comprehensive safety measure is needed to characterize the level of safety at signalized intersections. In this study, a novel safety surrogate measure was developed utilizing real-time radar field data. This new measure, called safety surrogate histogram (SSH), captures the degree and frequency of DZ-related conflicts at each intersection approach. SSH includes detailed information regarding the possibility of crashes, because it is calculated based on the vehicles conflicts. An example illustrating the application of the new methodology at two study sites in Virginia is presented and discussed, and a comparison is provided between SSH and other DZ-related safety surrogate measures mentioned in the literature. The results of the study reveal the efficacy of the SSH as complementary to existing surrogate measures. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Deterministic one-way simulation of two-way, real-time cellular automata and its related problems

    Energy Technology Data Exchange (ETDEWEB)

    Umeo, H; Morita, K; Sugata, K

    1982-06-13

    The authors show that for any deterministic two-way, real-time cellular automaton, m, there exists a deterministic one-way cellular automation which can simulate m in twice real-time. Moreover the authors present a new type of deterministic one-way cellular automata, called circular cellular automata, which are computationally equivalent to deterministic two-way cellular automata. 7 references.

  9. Development of Real-Time PCR Methods for the Detection of Bacterial Meningitis Pathogens without DNA Extraction.

    Directory of Open Access Journals (Sweden)

    Jeni Vuong

    Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.

  10. RT-PCR analysis of dystrophin mRNA in DND/BMD patients

    Energy Technology Data Exchange (ETDEWEB)

    Ciafaloni, E.; Silva, H.A.R. de; Roses, A.D. [Duke Univ. Medical Center, Durham, NC (United States)

    1994-09-01

    Duchenne and Becker muscular dystrophies (DMD, BMD) are X-linked recessive disorders caused by mutations in the dystrophin (dys) gene. The majority of these mutations are intragenic deletions of duplications routinely detected by Southern biots and multiplex PCR. The remainder are very likely, smaller mutations, mostly point-mutations. Detection of these mutations is very difficult due to the size and complexity of the dys gene. We applied RT-PCR to analyse the entire dys mRNA of three DMD patients with no detectable genomic defect. In two unrelated patients, a duplication of the 62 bp exon 2 was identified. This causes a frameshift sufficient to explain the DMD phenotype. In the third patient, who had congenital DMD and severe mental retardation, a complex pattern of aberrant splicing at the 3-prime exons 67-79 was observed. Sural nerve biopsy in this patient showed the complete absence of Dp116. PCR-SSCP studies are presently in progress to identify the mutations responsible for the aberrant splicing patterns.

  11. Multiplex RT-PCR and Automated Microarray for Detection of Eight Bovine Viruses.

    Science.gov (United States)

    Lung, O; Furukawa-Stoffer, T; Burton Hughes, K; Pasick, J; King, D P; Hodko, D

    2017-12-01

    Microarrays can be a useful tool for pathogen detection as it allow for simultaneous interrogation of the presence of a large number of genetic sequences in a sample. However, conventional microarrays require extensive manual handling and multiple pieces of equipment for printing probes, hybridization, washing and signal detection. In this study, a reverse transcription (RT)-PCR with an accompanying novel automated microarray for simultaneous detection of eight viruses that affect cattle [vesicular stomatitis virus (VSV), bovine viral diarrhoea virus type 1 and type 2, bovine herpesvirus 1, bluetongue virus, malignant catarrhal fever virus, rinderpest virus (RPV) and parapox viruses] is described. The assay accurately identified a panel of 37 strains of the target viruses and identified a mixed infection. No non-specific reactions were observed with a panel of 23 non-target viruses associated with livestock. Vesicular stomatitis virus was detected as early as 2 days post-inoculation in oral swabs from experimentally infected animals. The limit of detection of the microarray assay was as low as 1 TCID 50 /ml for RPV. The novel microarray platform automates the entire post-PCR steps of the assay and integrates electrophoretic-driven capture probe printing in a single user-friendly instrument that allows array layout and assay configuration to be user-customized on-site. © 2016 Her Majesty the Queen in Right of Canada.

  12. Transweb - real time transportation threat assessment analysis tool: look what the future may bring for energy related infrastructure?

    International Nuclear Information System (INIS)

    Dilger, F.; Ballard, J.D.

    2005-01-01

    Full text: Transweb is envisioned as a transportation threat assessment program and this real time GIS based web assessment too (a.k.a., GTA for GIS threat assessment) can be used to plan railroad or highway shipments of hazardous waste (e.g., toxic industrial chemicals - TIC's) and high-level nuclear waste materials (e.g., like those destined for Yucca Mountain - HLW) that may be used in energy production facilities. Transweb will become a vulnerability mapping and analysis tool that can be used by transportation planners, emergency response personnel, security/safety managers, and law enforcement to route such shipments, make contingency plans in the event of altered road or rail conditions, and/or to assist in the response to an accident or human initiated event like terrorism. The initial phase of the project will seek to establish the protocol on highway shipments and follow up phases will focus on rail GTA's. This paper will report on the initial development of this analytical technique, define the problems associated with such analysis, and offer examples of its analytical possibilities for threat assessment relative to energy related facilities like nuclear power generation stations. (author)

  13. Detection of canine distemper virus nucleocapsid protein gene in canine peripheral blood mononuclear cells by RT-PCR.

    Science.gov (United States)

    Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T

    1995-06-01

    For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.

  14. Sodium sulphite inhibition of potato and cherry polyphenolics in nucleic acid extraction for virus detection by RT-PCR.

    Science.gov (United States)

    Singh, R P; Nie, X; Singh, M; Coffin, R; Duplessis, P

    2002-01-01

    Phenolic compounds from plant tissues inhibit reverse transcription-polymerase chain reaction (RT-PCR). Multiple-step protocols using several additives to inhibit polyphenolic compounds during nucleic acid extraction are common, but time consuming and laborious. The current research highlights that the inclusion of 0.65 to 0.70% of sodium sulphite in the extraction buffer minimizes the pigmentation of nucleic acid extracts and improves the RT-PCR detection of Potato virus Y (PVY) and Potato leafroll virus (PLRV) in potato (Solanum tuberosum) tubers and Prune dwarf virus (PDV) and Prunus necrotic ringspot virus (PNRSV) in leaves and bark in the sweet cherry (Prunus avium) tree. Substituting sodium sulphite in the nucleic acid extraction buffer eliminated the use of proteinase K during extraction. Reagents phosphate buffered saline (PBS)-Tween 20 and polyvinylpyrrolidone (PVP) were also no longer required during RT or PCR phase. The resultant nucleic acid extracts were suitable for both duplex and multiplex RT-PCR. This simple and less expensive nucleic acid extraction protocol has proved very effective for potato cv. Russet Norkotah, which contains a high amount of polyphenolics. Comparing commercially available RNA extraction kits (Catrimox and RNeasy), the sodium sulphite based extraction protocol yielded two to three times higher amounts of RNA, while maintaining comparable virus detection by RT-PCR. The sodium sulphite based extraction protocol was equally effective in potato tubers, and in leaves and bark from the cherry tree.

  15. Detection of EML4-ALK in lung adenocarcinoma using pleural effusion with FISH, IHC, and RT-PCR methods.

    Directory of Open Access Journals (Sweden)

    Leilei Liu

    Full Text Available Anaplastic lymphoma kinase (ALK and echinoderm microtubule-associated protein-like 4 (EML4 gene rearrangements occur in approximately 5% of non-small-cell lung cancers (NSCLC, leading to the overexpression of anaplastic lymphoma kinase and predicting a response to the targeted inhibitor, crizotinib. Malignant pleural effusion occurs in most patients with advanced lung cancer, especially adenocarcinoma, and tissue samples are not always available from these patients. We attempted to clarify the feasibility of detecting the EML4-ALK fusion gene in pleural effusion cells using different methods. We obtained 66 samples of pleural effusion from NSCLC patients. The pleural effusion fluid was centrifuged, and the cellular components obtained were formalin fixed and paraffin embedded. The EML4-ALK fusion gene status was determined with fluorescent in situ hybridization (FISH, reverse transcription-polymerase chain reaction (RT-PCR, and immunohistochemistry (IHC. EML4-ALK was detected in three of 66 patient samples (4.5% with RT-PCR. When the RT-PCR data were used as the standard, one false positive and one false negative samples were identified with IHC; and one false negative sample was identified with FISH. These results suggest that a block of pleural effusion cells can be used to detect the EML4-ALK fusion gene. IHC had good sensitivity, but low specificity. FISH had low sensitivity, but high specificity. RT-PCR is a good candidate method for detecting EML4-ALK in blocks of pleural effusion cells from lung cancer patients.

  16. Molecular detection of infectious bronchitis and Newcastle disease viruses in broiler chickens with respiratory signs using Duplex RT-PCR.

    Science.gov (United States)

    Saba Shirvan, Aylar; Mardani, Karim

    2014-01-01

    Infectious bronchitis (IB) and Newcastle disease (ND) are highly contagious and the most economically important diseases of the poultry affecting respiratory tract and causing economic losses in poultry industry throughout the world. In the present study, the simultaneous detection and differentiation of causative agents of these diseases were investigated using duplex-RT-PCR. RNA was extracted from vaccinal and reference strains of infectious bronchitis virus (IBV) and Newcastle disease virus (NDV) and then cDNA was synthesized. Using two universal primer sets for detection of IBV and NDV, the duplex-RT-PCR was developed. In order to assess the efficiency of the developed duplex RT-PCR, a number of 12 broiler farms with the symptoms of respiratory tract infection was sampled (trachea, lung and kidney were sampled from affected birds suspicious for IBV and NDV infections). After RNA extraction from tissues and cDNA synthesis, the presence of IBV and NDV genome were investigated using duplex-PCR. The results showed that three of twelve examined broiler farms were positive for IBV and two farms were positive for NDV and IBV. The results revealed that the duplex-RT-PCR is a quick and sensitive procedure for simultaneously detecting IBV and NDV in birds with respiratory infections.

  17. Effect of specific or random c-DNA priming on sensitivity of tyrosinase nested RT-PCR : Potential clinical relevance

    NARCIS (Netherlands)

    Calogero, A; Hospers, GAP; Timmer-Bosscha, H; Mulder, NH; Schraffordt Koops, H.

    2000-01-01

    The reverse transcriptase polymerase chain reaction (RT-PCR) can be of clinical relevance in identifying malignant melanoma cells in blood or tissues of patients at risk for disseminated melanoma. The diagnostic value of this marker however, is still controversial. The objective of this study was to

  18. A duplex real-time RT-PCR system with an internal control offers sensitive and reliable broad spectrum detection of Squash mosaic virus variants

    Science.gov (United States)

    Squash mosaic virus (SqMV) is a seed-borne virus, belonging to the genus Commovirus in the subfamily Comoviridae of family Secoviridae. SqMV has a bipartite single-stranded ribonucleic acid (RNA) genome (RNA1 and RNA2) encapsidated separately with two capsid proteins. Two serotypes (genotypes) of ...

  19. Comparison of two real-time RT-PCR assays for differentiation of C-strain vaccinated from classical swine fever infected pigs and wild boars

    DEFF Research Database (Denmark)

    Widén, F.; Everett, H.; Blome, S.

    2014-01-01

    Classical swine fever is one of the most important infectious diseases for the pig industry worldwide due to its economic impact. Vaccination is an effective means to control disease, however within the EU its regular use is banned owing to the inability to differentiate infected and vaccinated a...

  20. When can real-time quantitative RT-PCR effectively define molecular relapse in acute promyelocytic leukemia patients? (Results of the French Belgian Swiss APL Group).

    Science.gov (United States)

    Cassinat, Bruno; de Botton, Stéphane; Kelaidi, Charikleia; Ades, Lionel; Zassadowski, Fabien; Guillemot, Isabelle; Schlageter, Marie-Helene; Raffoux, Emmanuel; Harousseau, Jean-Luc; Legrand, Olivier; Escoffre-Barbe, Martine; Reman, Oumedaly; Gardembas, Martine; Himberlin, Chantal; Cahn, Jean Yves; Guyotat, Denis; Bouscary, Didier; Parry, Anne; Rousselot, Philippe; Baruchel, Andre; Dombret, Hervé; Chevret, Sylvie; Fenaux, Pierre; Chomienne, Christine

    2009-09-01

    10-20% of APL patients relapse and the challenge remains to early identify these patients to improve survival rate. We report PML-RARalpha transcript detection by RQ-PCR in 260 consecutive APL patients (n = 970 samples). 223 patients with samples of sufficient RNA quality to demonstrate they reached molecular remission were monitored for MRD. During follow-up, 38 of these patients were tested positive for PML-RARalpha mRNA. 13 out of the 38 patients (34%) effectively developed hematological relapse. In the first positive sample, specific PML-RARalpha NCN thresholds over which, or under which, patients could effectively be predicted to relapse or not, were identified and subsequently validated in a second cohort.

  1. Searching for the best real-time RT-PCRs to detect Zika virus infections: the importance of comparing several protocols

    Directory of Open Access Journals (Sweden)

    F.M. de Moraes

    2018-05-01

    Full Text Available Clinical manifestations of Zika, dengue, and chikungunya virus infections are very similar, making it difficult to reach a diagnosis based only on clinical grounds. In addition, there is an intense cross-reactivity between antibodies directed to Zika virus and other flaviviruses, and an accurate Zika diagnosis is best achieved by real-time RT-PCR. However, some real-time RT-PCR show better performance than others. To reach the best possible Zika diagnosis, the analytic sensitivity of some probe-based real-time RT-PCR amplifying Zika virus RNA was evaluated in spiked and clinical samples. We evaluated primers and probes to detect Zika virus, which had been published before, and tested sensitivity using serum spiked and patient samples by real-time RT-PCR. When tested against spiked samples, the previously described primers showed different sensitivity, with very similar results when samples from patients (serum and urine were analyzed. Real-time RT-PCR designed to amplify Zika virus NS1 showed the best analytical sensitivity for all samples.

  2. Contact tracing with a real-time location system: A case study of increasing relative effectiveness in an emergency department.

    Science.gov (United States)

    Hellmich, Thomas R; Clements, Casey M; El-Sherif, Nibras; Pasupathy, Kalyan S; Nestler, David M; Boggust, Andy; Ernste, Vickie K; Marisamy, Gomathi; Koenig, Kyle R; Hallbeck, M Susan

    2017-12-01

    Contact tracing is the systematic method of identifying individuals potentially exposed to infectious diseases. Electronic medical record (EMR) use for contact tracing is time-consuming and may miss exposed individuals. Real-time location systems (RTLSs) may improve contact identification. Therefore, the relative effectiveness of these 2 contact tracing methodologies were evaluated. During a pertussis outbreak in the United States, a retrospective case study was conducted between June 14 and August 31, 2016, to identify the contacts of confirmed pertussis cases, using EMR and RTLS data in the emergency department of a tertiary care medical center. Descriptive statistics and a paired t test (α = 0.05) were performed to compare contacts identified by EMR versus RTLS, as was correlation between pertussis patient length of stay and the number of potential contacts. Nine cases of pertussis presented to the emergency department during the identified time period. RTLS doubled the potential exposure list (P < .01). Length of stay had significant positive correlation with contacts identified by RTLS (ρ = 0.79; P = .01) but not with EMR (ρ = 0.43; P = .25). RTLS doubled the potential pertussis exposures beyond EMR-based contact identification. Thus, RTLS may be a valuable addition to the practice of contact tracing and infectious disease monitoring. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  3. DAG expression: high-throughput gene expression analysis of real-time PCR data using standard curves for relative quantification.

    Directory of Open Access Journals (Sweden)

    María Ballester

    Full Text Available BACKGROUND: Real-time quantitative PCR (qPCR is still the gold-standard technique for gene-expression quantification. Recent technological advances of this method allow for the high-throughput gene-expression analysis, without the limitations of sample space and reagent used. However, non-commercial and user-friendly software for the management and analysis of these data is not available. RESULTS: The recently developed commercial microarrays allow for the drawing of standard curves of multiple assays using the same n-fold diluted samples. Data Analysis Gene (DAG Expression software has been developed to perform high-throughput gene-expression data analysis using standard curves for relative quantification and one or multiple reference genes for sample normalization. We discuss the application of DAG Expression in the analysis of data from an experiment performed with Fluidigm technology, in which 48 genes and 115 samples were measured. Furthermore, the quality of our analysis was tested and compared with other available methods. CONCLUSIONS: DAG Expression is a freely available software that permits the automated analysis and visualization of high-throughput qPCR. A detailed manual and a demo-experiment are provided within the DAG Expression software at http://www.dagexpression.com/dage.zip.

  4. Selecting a set of housekeeping genes for quantitative real-time PCR in normal and tetraploid haemocytes of soft-shell clams, Mya arenaria.

    Science.gov (United States)

    Siah, A; Dohoo, C; McKenna, P; Delaporte, M; Berthe, F C J

    2008-09-01

    The transcripts involved in the molecular mechanisms of haemic neoplasia in relation to the haemocyte ploidy status of the soft-shell clam, Mya arenaria, have yet to be identified. For this purpose, real-time quantitative RT-PCR constitutes a sensitive and efficient technique, which can help determine the gene expression involved in haemocyte tetraploid status in clams affected by haemic neoplasia. One of the critical steps in comparing transcription profiles is the stability of selected housekeeping genes, as well as an accurate normalization. In this study, we selected five reference genes, S18, L37, EF1, EF2 and actin, generally used as single control genes. Their expression was analyzed by real-time quantitative RT-PCR at different levels of haemocyte ploidy status in order to select the most stable genes. Using the geNorm software, our results showed that L37, EF1 and S18 represent the most stable gene expressions related to various ploidy status ranging from 0 to 78% of tetraploid haemocytes in clams sampled in North River (Prince Edward Island, Canada). However, actin gene expression appeared to be highly regulated. Hence, using it as a housekeeping gene in tetraploid haemocytes can result in inaccurate data. To compare gene expression levels related to haemocyte ploidy status in Mya arenaria, using L37, EF1 and S18 as housekeeping genes for accurate normalization is therefore recommended.

  5. Near-Real-Time Surveillance of Illnesses Related to Shellfish Consumption in British Columbia: Analysis of Poison Center Data.

    Science.gov (United States)

    Wan, Victoria; McIntyre, Lorraine; Kent, Debra; Leong, Dennis; Henderson, Sarah B

    2018-02-23

    Data from poison centers have the potential to be valuable for public health surveillance of long-term trends, short-term aberrations from those trends, and poisonings occurring in near-real-time. This information can enable long-term prevention via programs and policies and short-term control via immediate public health response. Over the past decade, there has been an increasing use of poison control data for surveillance in the United States, Europe, and New Zealand, but this resource still remains widely underused. The British Columbia (BC) Drug and Poison Information Centre (DPIC) is one of five such services in Canada, and it is the only one nested within a public health agency. This study aimed to demonstrate how DPIC data are used for routine public health surveillance in near-real-time using the case study of its alerting system for illness related to consumption of shellfish (ASIRCS). Every hour, a connection is opened between the WBM software Visual Dotlab Enterprise, which holds the DPIC database, and the R statistical computing environment. This platform is used to extract, clean, and merge all necessary raw data tables into a single data file. ASIRCS automatically and retrospectively scans a 24-hour window within the data file for new cases related to illnesses from shellfish consumption. Detected cases are queried using a list of attributes: the caller location, exposure type, reasons for the exposure, and a list of keywords searched in the clinical notes. The alert generates a report that is tailored to the needs of food safety specialists, who then assess and respond to detected cases. The ASIRCS system alerted on 79 cases between January 2015 and December 2016, and retrospective analysis found 11 cases that were missed. All cases were reviewed by food safety specialists, and 58% (46/79) were referred to designated regional health authority contacts for follow-up. Of the 42% (33/79) cases that were not referred to health authorities, some were

  6. Suitable reference genes for real-time PCR in human HBV-related hepatocellular carcinoma with different clinical prognoses

    International Nuclear Information System (INIS)

    Fu, Li-Yun; Jia, Hu-Liang; Dong, Qiong-Zhu; Wu, Jin-Cai; Zhao, Yue; Zhou, Hai-Jun; Ren, Ning; Ye, Qin-Hai; Qin, Lun-Xiu

    2009-01-01

    Housekeeping genes are routinely used as endogenous references to account for experimental differences in gene expression assays. However, recent reports show that they could be de-regulated in different diseases, model animals, or even under varied experimental conditions, which may lead to unreliable results and consequently misinterpretations. This study focused on the selection of suitable reference genes for quantitative PCR in human hepatitis B virus (HBV)-related hepatocellular carcinoma (HCC) with different clinical outcomes. We evaluated 6 commonly used housekeeping genes' expression levels in 108 HBV-related HCCs' matched tumor and non-tomor tissue samples with different clinical outcomes and 26 normal liver specimens by real-time PCR. The expression stability of the 6 genes was compared using the software programs geNorm and NormFinder. To show the impact of reference genes on data analysis, we took PGK1 as a target gene normalized by each reference gene, and performed one-way ANOVA and the equivalence test. With the geNorm and NormFinder software programs, analysis of TBP and HPRT1 showed the best stability in all tissue samples, while 18s and ACTB were less stable. When 18s or ACTB was used for normalization, no significant difference of PGK1 expression (p > 0.05) was found among HCC tissues with and without metastasis, and normal liver specimens; however, dramatically differences (p < 0.001) were observed when either TBP or the combination of TBP and HPRT1 were selected as reference genes. TBP and HPRT1 are the most reliable reference genes for q-PCR normalization in HBV-related HCC specimens. However, the well-used ACTB and 18S are not suitable, which actually lead to the misinterpretation of the results in gene expression analysis

  7. Avaliação das técnicas de RT-PCR e heminested RT-PCR em cérebros de cães com sinais neurológicos compatíveis com cinomose

    Directory of Open Access Journals (Sweden)

    Adriana Cortez

    2015-12-01

    Full Text Available The diagnostic value of RT-PCR and hemi-nested RT-PCR (hnRT-PCR was compared in brain samples of dogs presenting neurological signs compatible with canine distemper. Samples of central nervous system (CNS were collected from 68 dogs and tested by direct immunofluorescence test (RFID and, independent of the results, they were stored at -20°C for at least three years. They were submitted to the RT-PCR and hnRT-PCR techniques aiming to determine the gene responsible for the viral nucleoprotein decoding. Fifty-nine samples were positive for RIFD, 40 for RT-PCR (Kappa = 0.358 and 54 for hnRT-PCR (Kappa = 0.740. All nine RIFD negative samples were also negative for RT-PCR and hnRT-PCR. In spite of the storage duration and proper sample conditions, the estimated accordance between hnRT-PCR and RIFD demonstrated that hnRT-PCR technique can be applied in retrospective studies.

  8. Real time urbanism

    Directory of Open Access Journals (Sweden)

    Ana Ruiz Varona

    2012-12-01

    Full Text Available Nowadays, given the technological revolution of the society of information, the administrative management of the cities faces a new problem not as related to the projection of the urban space as to the capacity of controlling and measuring the process of direct and centralized production of the cities by part of some non-homogeneous social multitudes, in a hyper-accelerated time towards instantaneity. Against libertarian apologies of the new “participative urbanisms”, the article puts forward a discourse that shows the lost associated to the new problem of temporal instantaneity. In this regard we claim new process of mediation that allow administrations and urbanist monitoring the production of the city. To that end, a previous and necessary step will be the redefinition of the role of a new real time urbanist.

  9. Real-time reverse transcription-polymerase chain reaction assays for identification of wild poliovirus 1 & 3.

    Science.gov (United States)

    Sharma, Deepa K; Nalavade, Uma P; Deshpande, Jagadish M

    2015-10-01

    The poliovirus serotype identification and intratypic differentiation by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay is suitable for serotype mixtures but not for intratypic mixtures of wild and vaccine poliovirus strains. This study was undertaken to develop wild poliovirus 1 and 3 (WPV1 and WPV3) specific rRT-PCR assays for use. Specific primers and probes for rRT-PCR were designed based on VP1 sequences of WPV1 and WPV3 isolated in India since 2000. The specificity of the rRT-PCR assays was evaluated using WPV1 and WPV3 of different genetic lineages, non-polio enteroviruses (NPEVs) and mixtures of wild/wild and wild/Sabin vaccine strains. The sensitivity of the assays was determined by testing serial 10-fold dilutions of wild poliovirus 1 and 3 stock suspensions of known titre. No cross-reactivity with Sabin strains, intertypic wild poliovirus isolates or 27 types of NPEVs across all the four Enterovirus species was found for both the wild poliovirus 1 and 3 rRT-PCR assays. All WPV1 and WPV3 strains isolated since 2000 were successfully amplified. The rRT-PCR assays detected 10 4.40 CCID 50 /ml of WPV1 and 10 4.00 CCID 50 /ml of WPV3, respectively either as single isolate or mixture with Sabin vaccine strains or intertypic wild poliovirus. rRT-PCR assays for WPV1 and WPV3 have been validated to detect all the genetic variations of the WPV1 and WPV3 isolated in India for the last decade. When used in combination with the current rRT-PCR assay testing was complete for confirmation of the presence of wild poliovirus in intratypic mixtures.

  10. Real Time Systems

    DEFF Research Database (Denmark)

    Christensen, Knud Smed

    2000-01-01

    Describes fundamentals of parallel programming and a kernel for that. Describes methods for modelling and checking parallel problems. Real time problems.......Describes fundamentals of parallel programming and a kernel for that. Describes methods for modelling and checking parallel problems. Real time problems....

  11. In-situ real-time x-ray scattering for probing the processing-structure-performance relation

    KAUST Repository

    Smilgies, Detlef-M.

    2014-01-01

    © 2014 Materials Research Society. In-situ X-ray scattering methodology is discussed, in order to analyze the microstructure development of soft functional materials during coating, annealing, and drying processes in real-time. The relevance of a fundamental understanding of coating processes for future industrial production is pointed out.

  12. Metabolic regulation analysis of an ethanologenic Escherichia coli strain based on RT-PCR and enzymatic activities

    Directory of Open Access Journals (Sweden)

    Martinez Alfredo

    2008-05-01

    Full Text Available Abstract Background A metabolic regulation study was performed, based upon measurements of enzymatic activities, fermentation performance, and RT-PCR analysis of pathways related to central carbon metabolism, in an ethanologenic Escherichia coli strain (CCE14 derived from lineage C. In comparison with previous engineered strains, this E coli derivative has a higher ethanol production rate in mineral medium, as a result of the elevated heterologous expression of the chromosomally integrated genes encoding PDCZm and ADHZm (pyruvate decarboxylase and alcohol dehydrogenase from Zymomonas mobilis. It is suggested that this behavior might be due to lineage differences between E. coli W and C. Results This study demonstrated that the glycolytic flux is controlled, in this case, by reactions outside glycolysis, i.e., the fermentative pathways. Changes in ethanol production rate in this ethanologenic strain result in low organic acid production rates, and high glycolytic and ethanologenic fluxes, that correlate with enhanced transcription and enzymatic activity levels of PDCZm and ADHZm. Furthermore, a higher ethanol yield (90% of the theoretical in glucose-mineral media was obtained with CCE14 in comparison with previous engineered E. coli strains, such as KO11, that produces a 70% yield under the same conditions. Conclusion Results suggest that a higher ethanol formation rate, caused by ahigher PDCZm and ADHZm activities induces a metabolic state that cells compensate through enhanced glucose transport, ATP synthesis, and NAD-NADH+H turnover rates. These results show that glycolytic enzymatic activities, present in E. coli W and C under fermentative conditions, are sufficient to contend with increases in glucose consumption and product formation rates.

  13. Epidemiology of Human Parechovirus Type1 in Clinical Samples from Children with Gastroenteritis Using RT-PCR

    Directory of Open Access Journals (Sweden)

    Dabirmanesh B

    2011-03-01

    Full Text Available Background and Objectives: Human parechovirus type-1 (HPeV-1 is a genus of picornaviridea with a single stranded positive sense RNA genome. In general it seems to be responsible for more gastrointestinal and respiratory syndromes and less responsible for central nervous system (CNS symptoms. Since there is no accurate information about diagnosis and epidemiology of HPeV-1 in Iran and it is very important to distinguish between viral and bacterial diarrhea to decrease the unnecessary use of antibiotics, this study aimed at rapid detection and epidemiology of HPeV-1 in stool samples from children with gastroenteritis using specific RT-PCR. Methods: Viral RNA was isolated from 472 stool samples from children (under 4 years old with diarrhea; CDNA was prepared and amplified using specific primers from 5′untranslated region (5′ UTR of HPeV-1 genome by nested RT-PCR. Amplified DNA product was electrophoresed on 1% agarose gel and a single band of 265 bp was obtained. Data were analyzed by SPSS software. We also performed a comparison between the cell culture (Vero and RT-PCR method for HPeV1 detection.Results: Out of 472 samples examined during two years, 112 samples were HpeV-1 positive (23.7%. The results showed that the prevalence of this virus was in children under one year (6-12 months old with diarrhea (p=0.036 in spring and autumn (p<0.001. Boys had more positive cases than the girls (p<0.001. Out of 20 samples which were found positive by HPeV1 RT-PCR only three of them showed CPE on Vero Cells after a week.Conclusion: The results revealed that RT-PCR is a more practical and sensitive technique for HPeV-1 detection directly from clinical samples, which is valuable for epidemiology. Also, the rapid detection of HPeV1 by RT-PCR can decrease both the unnecessary use of antibiotics and the costs in clinical practice

  14. Epidemiology of Human Parechovirus Type1 in Clinical Samples from Children with Gastroenteritis Using RT-PCR

    Directory of Open Access Journals (Sweden)

    F Ghazi

    2012-05-01

    Full Text Available

    Background and Objectives: Human parechovirus type-1 (HPeV-1 is a genus of picornaviridea with a single stranded positive sense RNA genome. In general it seems to be responsible for more gastrointestinal and respiratory syndromes and less responsible for central nervous system (CNS symptoms. Since there is no accurate information about diagnosis and epidemiology of HPeV-1 in Iran and it is very important to distinguish between viral and bacterial diarrhea to decrease the unnecessary use of antibiotics, this study aimed at rapid detection and epidemiology of HPeV-1 in stool samples from children with gastroenteritis using specific RT-PCR.

     

    Methods: Viral RNA was isolated from 472 stool samples from children (under 4 years old with diarrhea; CDNA was prepared and amplified using specific primers from 5untranslated region (5 UTR of HPeV-1 genome by nested RT-PCR. Amplified DNA product was electrophoresed on 1% agarose gel and a single band of 265 bp was obtained. Data were analyzed by SPSS software. We also performed a comparison between the cell culture (Vero and RT-PCR method for HPeV1 detection.

     

    Results: Out of 472 samples examined during two years, 112 samples were HpeV-1 positive (23.7%. The results showed that the prevalence of this virus was in children under one year (6-12 months old with diarrhea (p=0.036 in spring and autumn (p<0.001. Boys had more positive cases than the girls (p<0.001. Out of 20 samples which were found positive by HPeV1 RT-PCR only three of them showed CPE on Vero Cells after a week.

     

    Conclusion: The results revealed that RT-PCR is a more practical and sensitive technique for HPeV-1 detection directly from clinical samples, which is valuable for epidemiology. Also, the rapid

  15. Validation of tumor markers in central nervous system germ cell tumors by real-time reverse transcriptase polymerase chain reaction using formalin-fixed paraffin-embedded tissues.

    Science.gov (United States)

    Kim, Dowhan; Lee, Da Hye; Choi, Junjeong; Shim, Kyu Won; Kim, Se Hoon

    2013-01-01

    The therapeutic protocols for treatment of germinomas and non-germinomatous germ cell tumors (NGGCTs) are completely different, so it is important to distinguish pure germinomas from NGGCTs. As it can be difficult to diagnose by morphology alone, immunohisto-chemistry (IHC) has been widely used as an ancillary test to improve diagnostic accuracy. However, IHC has limitations due to the misinterpretation of results or the aberrant loss of immunoreactivity. However, real-time RT-PCR has certain advantages over IHC, including its quantitative nature. The aim of our study was to evaluate the usefulness of real-time RT-PCR on formalin-fixed paraffin-embedded (FFPE) tissue blocks for the diagnosis of germ cell tumors of the central nervous system. We selected eight markers of germ cell tumors using a literature search, and validated them using real-time RT-PCR. Among them, POU5F1, NANOG and TGFB2 were statistically significant (P=0.05) in multiple comparisons (MANOVA) of three groups (pure germinomas, mature teratomas and malignant germ cell tumors). Two-group (pure germinomas and NGGCTs) discriminant analysis achieved a 70.0% success rate in cross-validation. We concluded that real-time RT-PCR using FFPE tissue has adequate validating power comparable to IHC in the diagnosis of central nervous system germ cell tumors; therefore, when IHC is not available, not conclusive or not informative, RT-PCR is a potential alternative to a repeat biopsy.

  16. Relative quantitative RT-PCR to study the expression of plant nutrient transporters in arbuscular mycorrhizas

    DEFF Research Database (Denmark)

    Burleigh, S.H.

    2001-01-01

    had high reproducibility and reflected trends in gene expression as observed by Northern blotting. Using this technique, it was demonstrated that both the high-affinity phosphate transporter MtPt2 and a putative nitrate transporter from Medicago truncatula were down-regulated in roots when colonized...

  17. Understanding chemical-potential-related transient pore-pressure response to improve real-time borehole (in)stability predictions

    Energy Technology Data Exchange (ETDEWEB)

    Tare, U. A.; Mody, F. K.; Mese, A. I. [Haliburton Energy Services, TX (United States)

    2002-07-01

    In order to develop a real-time wellbore (in)stability modelling capability, experimental work was carried out to investigate the role of the chemical potential of drilling fluids on transient pore pressure and time-dependent rock property alterations of shale formations. Time-dependent alterations in the pore pressure, acoustic and rock properties of formations subjected to compressive tri-axial test were recorded during the experiments involving the Pore Pressure Transmission (PPT) test. Based on the transient pore pressure of shale exposed to the test fluid presented here, the 20 per cent calcium chloride showed a very low membrane efficiency of 4.45 per cent. The need for a thorough understanding of the drilling fluid/shale interaction prior to applying any chemical potential wellbore (in)stability model to real-time drilling operations was emphasized. 9 refs., 5 figs.

  18. Validation of reference genes for quantitative real-time PCR in Périgord black truffle (Tuber melanosporum) developmental stages.

    Science.gov (United States)

    Zarivi, Osvaldo; Cesare, Patrizia; Ragnelli, Anna Maria; Aimola, Pierpaolo; Leonardi, Marco; Bonfigli, Antonella; Colafarina, Sabrina; Poma, Anna Maria; Miranda, Michele; Pacioni, Giovanni

    2015-08-01

    The symbiotic fungus Tuber melanosporum Vittad. (Périgord black truffle) belongs to the Ascomycota and forms mutualistic symbiosis with tree and shrub roots. This truffle has a high value in a global market and is cultivated in many countries of both hemispheres. The publication of the T. melanosporum genome has given researchers unique opportunities to learn more about the biology of the fungus. Real-time quantitative PCR (qRT-PCR) is a definitive technique for quantitating differences in transcriptional gene expression levels between samples. To facilitate gene expression studies and obtain more accurate qRT-PCR data, normalization relative to stable housekeeping genes is required. These housekeeping genes must show stable expression under given experimental conditions for the qRT-PCR results to be accurate. Unfortunately, there are no studies on the stability of housekeeping genes used in T. melanosporum development. In this study, we present a morphological and microscopical classification of the developmental stages of T. melanosporum fruit body, and investigate the expression levels of 12 candidate reference genes (18S rRNA; 5.8S rRNA; Elongation factor 1-alpha; Elongation factor 1-beta; α-tubulin; 60S ribosomal protein L29; β-tubulin; 40S ribosomal protein S1; 40S ribosomal protein S3; Glucose-6-phosphate dehydrogenase; β-actin; Ubiquitin-conjugating enzyme). To evaluate the suitability of these genes as endogenous controls, five software-based approaches and one web-based comprehensive tool (RefFinder) were used to analyze and rank the tested genes. We demonstrate here that the 18S rRNA gene shows the most stable expression during T. melanosporum development and that a set of three genes, 18S rRNA, Elongation factor 1-alpha and 40S ribosomal protein S3, is the most suitable to normalize qRT-PCR data from all the analyzed developmental stages; conversely, 18S rRNA, Glucose-6-phosphate dehydrogenase and Elongation factor 1-alpha are the most suitable

  19. An Evidence-Based Approach to Detection by DASI-ELISA and RT-PCR in Dormant Period

    Directory of Open Access Journals (Sweden)

    Antonio Olmos

    2008-01-01

    Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASI-ELISA and RT-PCR.

  20. A community resource for high-throughput quantitative RT-PCR analysis of transcription factor gene expression in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Redman Julia C

    2008-07-01

    Full Text Available Abstract Background Medicago truncatula is a model legume species that is currently the focus of an international genome sequencing effort. Although several different oligonucleotide and cDNA arrays have been produced for genome-wide transcript analysis of this species, intrinsic limitations in the sensitivity of hybridization-based technologies mean that transcripts of genes expressed at low-levels cannot be measured accurately with these tools. Amongst such genes are many encoding transcription factors (TFs, which are arguably the most important class of regulatory proteins. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is the most sensitive method currently available for transcript quantification, and one that can be scaled up to analyze transcripts of thousands of genes in parallel. Thus, qRT-PCR is an ideal method to tackle the problem of TF transcript quantification in Medicago and other plants. Results We established a bioinformatics pipeline to identify putative TF genes in Medicago truncatula and to design gene-specific oligonucleotide primers for qRT-PCR analysis of TF transcripts. We validated the efficacy and gene-specificity of over 1000 TF primer pairs and utilized these to identify sets of organ-enhanced TF genes that may play important roles in organ development or differentiation in this species. This community resource will be developed further as more genome sequence becomes available, with the ultimate goal of producing validated, gene-specific primers for all Medicago TF genes. Conclusion High-throughput qRT-PCR using a 384-well plate format enables rapid, flexible, and sensitive quantification of all predicted Medicago transcription factor mRNAs. This resource has been utilized recently by several groups in Europe, Australia, and the USA, and we expect that it will become the 'gold-standard' for TF transcript profiling in Medicago truncatula.

  1. Reference Gene Selection for qRT-PCR Normalization Analysis in kenaf (Hibiscus cannabinus L. under Abiotic Stress and Hormonal Stimuli

    Directory of Open Access Journals (Sweden)

    Xiaoping Niu

    2017-05-01

    Full Text Available Kenaf (Hibiscus cannabinus L., an environmental friendly and economic fiber crop, has a certain tolerance to abiotic stresses. Identification of reliable reference genes for transcript normalization of stress responsive genes expression by quantitative real-time PCR (qRT-PCR is important for exploring the molecular mechanisms of plants response to abiotic stresses. In this study, nine candidate reference genes were cloned, and their expression stabilities were assessed in 132 abiotic stress and hormonal stimuli samples of kenaf using geNorm, NormFinder, and BestKeeper algorithms. Results revealed that HcPP2A (Protein phosphatase 2A and HcACT7 (Actin 7 were the optimum reference genes across all samples; HcUBC (Ubiquitin-conjugating enzyme like protein was the worst reference gene for transcript normalization. The reliability of the selected reference genes was further confirmed by evaluating the expression profile of HcWRKY28 gene at different stress durations. This work will benefit future studies on discovery of stress-tolerance genes and stress-signaling pathways in this important fiber crop.

  2. Reference gene identification for reliable normalisation of quantitative RT-PCR data in Setaria viridis.

    Science.gov (United States)

    Nguyen, Duc Quan; Eamens, Andrew L; Grof, Christopher P L

    2018-01-01

    Quantitative real-time polymerase chain reaction (RT-qPCR) is the key platform for the quantitative analysis of gene expression in a wide range of experimental systems and conditions. However, the accuracy and reproducibility of gene expression quantification via RT-qPCR is entirely dependent on the identification of reliable reference genes for data normalisation. Green foxtail ( Setaria viridis ) has recently been proposed as a potential experimental model for the study of C 4 photosynthesis and is closely related to many economically important crop species of the Panicoideae subfamily of grasses, including Zea mays (maize), Sorghum bicolor (sorghum) and Sacchurum officinarum (sugarcane). Setaria viridis (Accession 10) possesses a number of key traits as an experimental model, namely; (i) a small sized, sequenced and well annotated genome; (ii) short stature and generation time; (iii) prolific seed production, and; (iv) is amendable to Agrobacterium tumefaciens -mediated transformation. There is currently however, a lack of reference gene expression information for Setaria viridis ( S. viridis ). We therefore aimed to identify a cohort of suitable S. viridis reference genes for accurate and reliable normalisation of S. viridis RT-qPCR expression data. Eleven putative candidate reference genes were identified and examined across thirteen different S. viridis tissues. Of these, the geNorm and NormFinder analysis software identified SERINE / THERONINE - PROTEIN PHOSPHATASE 2A ( PP2A ), 5 '- ADENYLYLSULFATE REDUCTASE 6 ( ASPR6 ) and DUAL SPECIFICITY PHOSPHATASE ( DUSP ) as the most suitable combination of reference genes for the accurate and reliable normalisation of S. viridis RT-qPCR expression data. To demonstrate the suitability of the three selected reference genes, PP2A , ASPR6 and DUSP , were used to normalise the expression of CINNAMYL ALCOHOL DEHYDROGENASE ( CAD ) genes across the same tissues. This approach readily demonstrated the suitably of the three

  3. Real time expert systems

    International Nuclear Information System (INIS)

    Asami, Tohru; Hashimoto, Kazuo; Yamamoto, Seiichi

    1992-01-01

    Recently, aiming at the application to the plant control for nuclear reactors and traffic and communication control, the research and the practical use of the expert system suitable to real time processing have become conspicuous. In this report, the condition for the required function to control the object that dynamically changes within a limited time is presented, and the technical difference between the real time expert system developed so as to satisfy it and the expert system of conventional type is explained with the actual examples and from theoretical aspect. The expert system of conventional type has the technical base in the problem-solving equipment originating in STRIPS. The real time expert system is applied to the fields accompanied by surveillance and control, to which conventional expert system is hard to be applied. The requirement for the real time expert system, the example of the real time expert system, and as the techniques of realizing real time processing, the realization of interruption processing, dispersion processing, and the mechanism of maintaining the consistency of knowledge are explained. (K.I.)

  4. Use of sodC versus ctrA for real-time polymerase chain reaction-based detection of Neisseria meningitidis in sterile body fluids

    Directory of Open Access Journals (Sweden)

    Fábio Takenori Higa

    2013-04-01

    Full Text Available We evaluated the use of a newly described sodC-based real-time-polymerase chain reaction (RT-PCR assay for detecting Neisseria meningitidis in normally sterile sites, such as cerebrospinal fluid and serum. The sodC-based RT-PCR assay has an advantage over ctrA for detecting nongroupable N. meningitidis isolates, which are commonly present in asymptomatic pharyngeal carriage. However, in our study, sodC-based RT-PCR was 7.5% less sensitive than ctrA. Given the public health impact of possible false-negative results due to the use of the sodC target gene alone, sodC-based RT-PCR for the diagnosis of meningococcal meningitis should be used with caution.

  5. qRT-PCR quantification of the biological control agent Trichoderma harzianum in peat and compost-based growing media.

    Science.gov (United States)

    Beaulieu, Robert; López-Mondéjar, Rubén; Tittarelli, Fabio; Ros, Margarita; Pascual, José Antonio

    2011-02-01

    To ensure proper use of Trichoderma harzianum in agriculture, accurate data must be obtained in population monitoring. The effectiveness of qRT-PCR to quantify T. harzianum in different growing media was compared to the commonly used techniques of colony counting and qPCR. Results showed that plate counting and qPCR offered similar T. harzianum quantification patterns of an initial rapid increase in fungal population that decreased over time. However, data from qRT-PCR showed a population curve of active T. harzianum with a delayed onset of initial growth which then increased throughout the experiment. Results demonstrated that T. harzianum can successfully grow in these media and that qRT-PCR can offer a more distinct representation of active T. harzianum populations. Additionally, compost amended with T. harzianum exhibited a lower Fusarium oxysporum infection rate (67%) and lower percentage of fresh weight loss (11%) in comparison to amended peat (90% infection rate, 23% fresh weight loss). Copyright © 2010 Elsevier Ltd. All rights reserved.

  6. A comparative kinetic RT/-PCR strategy for the quantitation of mRNAs in microdissected human renal biopsy specimens.

    Science.gov (United States)

    Del Prete, D; Forino, M; Gambaro, G; D'Angelo, A; Baggio, B; Anglani, F

    1998-01-01

    Molecular biology techniques, to be applicable to a diagnostic renal biopsy specimen, should (1) be highly sensitive to be performed on a very small quantity of tissue; (2) be quantitative because they have to analyze genes normally expressed in the tissue and (3) allow the analysis of as large a number of genes as possible. Among different methods, only the reverse-transcriptase polymerase chain reaction (RT/-PCR) might comply with previous requisites, but the few RT/-PCR examples on renal biopsies in the literature do not allow starting RNA quantification and quality control; furthermore they have the drawback of analyzing only few genes. In an ongoing study to assess the expression of a number of genes in glomeruli and in tubulointerstitium of patients with different nephropathies, we developed a comparative RT/-PCR kinetic strategy based on the purification and quantification of total glomerular and tubulointerstitial RNA and on the use of an internal standard, the housekeeping gene G3PDH. We demonstrate that in microdissected diagnostic renal biopsies (1) glomerular and interstitial starting RNA can be quantified; (2) the G3PDH gene may be used both as an internal standard and as an indirect marker of RNA integrity; (3) as low as 28 ng of total RNA is sufficient to obtain PCR products of eight genes, and (4) it is worth to operate on microdissected biopsy specimens because of the different expression of genes in the two renal compartments.

  7. Study of the Efficacy of Real Time-PCR Method for Amikacin Determination Using Microbial Assay

    Directory of Open Access Journals (Sweden)

    Farzaneh Lotfipour

    2015-06-01

    Full Text Available Purpose: Microbial assay is used to determine the potency of antibiotics and vitamins. In spite of its advantages like simplicity and easiness, and to reveal the slight changes in the molecules, the microbial assay suffers from significant limitations; these methods are of lower specificity, accuracy and sensitivity. The objective of the present study is to evaluate the efficacy of real time-PCR technique in comparison with turbidimetric method for microbial assay of amikacin. Methods: Microbial determination of amikacin by turbidimetric method was performed according to USP. Also amikacin concentrations were determined by microbial assay using taq-man quantitative PCR method. Standard curves in different concentration for both methods were plotted and method validation parameters of linearity, precision and accuracy were calculated using statistical procedures. Results: The RT-PCR method was linear in the wider concentration range (5.12 – 38.08 for RT-PCR versus 8.00 – 30.47 for turbidimetric method with a better correlation coefficient (0.976 for RT-PCR versus 0.958 for turbidimetric method. RT-PCR method with LOQ of 5.12 ng/ml was more sensitive than turbidimetric method with LOQ of 8.00 ng/ml and the former could detect and quantify low concentrations of amikacin. The results of accuracy and precision evaluation showed that the RT-PCR method was accurate and precise in all of the tested concentration. Conclusion: The RT-PCR method described here provided an accurate and precise technique for measurement of amikacin potency and it can be a candidate for microbial determination of the antibiotics with the same test organism.

  8. Real-time measurement of blood pressure with Nexfin in a patient with thalidomide-related phocomelia.

    Science.gov (United States)

    Earle, Rosie; Vaghadia, Himat; Shanahan, Enda; Tang, Raymond; Sawka, Andrew

    2016-11-01

    We report the novel application of photoplethysmographic technology with the Nexfin HD monitor for real-time measurement of blood pressure (BP) in a patient with tetraamelia. The patient was a 58-year-old man with tetraamelia secondary to thalidomide exposure in utero, who presented for surgical excision of a maxillary schwannoma. Because difficulty of cuff use on rudimentary limbs and failure to gain invasive arterial access due to abnormalities of limb vasculature, this population is known to pose some unique challenges for BP measurement. Nexfin may offer an alternative noninvasive method to detect BP in patients with phocomelia during the perioperative period. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Real-time transmission of work-related data of drivers as an element of fleet management

    Directory of Open Access Journals (Sweden)

    Robert MUHA

    2009-01-01

    Full Text Available The introduction of digital tachographs does not bring much novelty in terms of time limits for drivers involved in road transport, but rather narrows the space for workload restrictions abuse. Combined with the telematic systems (GNSS - Global Navigation Satellite System, which in addition to tracking bring a multitude of data on the vehicle, this device allows for a direct transmission of data on driver’s work in real time (the hours worked and rest-time used into the dispatch centre of the Carrier. The paper will present the importance of monitoring the driver’s activity and the observance of time limits for fleet management.

  10. Newborn screening for congenital cytomegalovirus using real-time polymerase chain reaction in umbilical cord blood.

    Science.gov (United States)

    Barkai, Galia; Barzilai, Asher; Mendelson, Ella; Tepperberg-Oikawa, Michal; Roth, Daphne Ari-Even; Kuint, Jacob

    2013-06-01

    Congenital cytomegalovirus (C-CMV) infection affects 0.4-2% of newborn infants in Israel, most of whom are asymptomatic. Of these, 10-20% will subsequently develop hearing impairment and may have benetitted from early detection by neonatal screeing. To retrospectively anaIyze the results of a screening program for C-CMV performed at the Sheba Medical Center, Tel, Hashomer, during a 1 year period, using real-time polymerase chain reaction (rt-PCR) from umbilical cord blood. CMV DNA was detected by rt-PCR performed on infants' cord blood. C-CMV was confirmed by urine culture (Shell-vial). All confirmed cases were further investigated for C-CMV manifestations by head ultrasound, complete blood count, liver enzyme measurement, ophthalmology examination and hearing investigation. During the period 1 June 2009 to 31 May 2010, 11,022 infants were born at the Sheba Medical Center, of whom 8105 (74%) were screened. Twenty-three (0.28%) were positive for CMV and 22 of them (96%) were confirmed by urine culture. Two additional infants, who had not been screened, were detected after clinical suspicion. All 24 infants were further Investigated, and 3 (12.5%) had central nervous system involvement (including hearing impairment) and were offered intravenous ganciclovir for 6 weeks. Eighteen infants (82%) would not otherwise have been diagnosed. The relatively low incidence of C-CMV detected in our screening program probably reflects the low sensitivity of cord blood screening. Nevertheless, this screening program reliably detected a non-negligible number of infants who could benefit from early detection. Other screening methods using saliva should be investigated further.

  11. Real-time radiography

    International Nuclear Information System (INIS)

    Bossi, R.H.; Oien, C.T.

    1981-01-01

    Real-time radiography is used for imaging both dynamic events and static objects. Fluorescent screens play an important role in converting radiation to light, which is then observed directly or intensified and detected. The radiographic parameters for real-time radiography are similar to conventional film radiography with special emphasis on statistics and magnification. Direct-viewing fluoroscopy uses the human eye as a detector of fluorescent screen light or the light from an intensifier. Remote-viewing systems replace the human observer with a television camera. The remote-viewing systems have many advantages over the direct-viewing conditions such as safety, image enhancement, and the capability to produce permanent records. This report reviews real-time imaging system parameters and components

  12. A novel RT-PCR for the detection of Helicobacter pylori and identification of clarithromycin resistance mediated by mutations in the 23S rRNA gene.

    Science.gov (United States)

    Redondo, Javier Jareño; Keller, Peter M; Zbinden, Reinhard; Wagner, Karoline

    2018-01-01

    In this study we evaluated the commercially available LightMix® RT-PCR assay for Helicobacter pylori detection and identification of clarithromycin (CLR) resistance in culture and clinical specimens (gastric biopsies and stool). The H. pylori LightMix® RT-PCR detects a 97bp long fragment of the 23S rRNA gene and allows the identification of 3 distinct point mutations conferring CLR resistance via melting curve analysis. The performance of the H. pylori LightMix® RT-PCR was evaluated using a set of 60 H. pylori strains showing phenotypical CLR susceptibility or CLR resistance (Minimum inhibitory concentrations from 0.016 to 256mg/L). We found high concordance (95%) between phenotypical CLR resistance screening by E-Test® and the Lightmix® RT-PCR. Discrepant results were verified by sequencing of the 23S rRNA gene that always confirmed the results obtained by Lightmix® RT-PCR. Furthermore, H. pylori was detected in clinical biopsy and stool specimens by Lightmix® RT-PCR that identified the correct H. pylori genotype. The LightMix® RT-PCR is an accurate, sensitive and easy to use test for H. pylori and CLR resistance detection and can therefore be readily implemented in any diagnostic laboratory. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Evaluation of ALK gene rearrangement in central nervous system metastases of non-small-cell lung cancer using two-step RT-PCR technique.

    Science.gov (United States)

    Nicoś, M; Krawczyk, P; Wojas-Krawczyk, K; Bożyk, A; Jarosz, B; Sawicki, M; Trojanowski, T; Milanowski, J

    2017-12-01

    RT-PCR technique has showed a promising value as pre-screening method for detection of mRNA containing abnormal ALK sequences, but its sensitivity and specificity is still discussable. Previously, we determined the incidence of ALK rearrangement in CNS metastases of NSCLC using IHC and FISH methods. We evaluated ALK gene rearrangement using two-step RT-PCR method with EML4-ALK Fusion Gene Detection Kit (Entrogen, USA). The studied group included 145 patients (45 females, 100 males) with CNS metastases of NSCLC and was heterogeneous in terms of histology and smoking status. 21% of CNS metastases of NSCLC (30/145) showed presence of mRNA containing abnormal ALK sequences. FISH and IHC tests confirmed the presence of ALK gene rearrangement and expression of ALK abnormal protein in seven patients with positive result of RT-PCR analysis (4.8% of all patients, 20% of RT-PCR positive patients). RT-PCR method compared to FISH analysis achieved 100% of sensitivity and only 82.7% of specificity. IHC method compared to FISH method indicated 100% of sensitivity and 97.8% of specificity. In comparison to IHC, RT-PCR showed identical sensitivity with high number of false positive results. Utility of RT-PCR technique in screening of ALK abnormalities and in qualification patients for molecularly targeted therapies needs further validation.

  14. Pathway and network-based analysis of genome-wide association studies and RT-PCR validation in polycystic ovary syndrome.

    Science.gov (United States)

    Shen, Haoran; Liang, Zhou; Zheng, Saihua; Li, Xuelian

    2017-11-01

    The purpose of this study was to identify promising candidate genes and pathways in polycystic ovary syndrome (PCOS). Microarray dataset GSE345269 obtained from the Gene Expression Omnibus database includes 7 granulosa cell samples from PCOS patients, and 3 normal granulosa cell samples. Differentially expressed genes (DEGs) were screened between PCOS and normal samples. Pathway enrichment analysis was conducted for DEGs using ClueGO and CluePedia plugin of Cytoscape. A Reactome functional interaction (FI) network of the DEGs was built using ReactomeFIViz, and then network modules were extracted, followed by pathway enrichment analysis for the modules. Expression of DEGs in granulosa cell samples was measured using quantitative RT-PCR. A total of 674 DEGs were retained, which were significantly enriched with inflammation and immune-related pathways. Eight modules were extracted from the Reactome FI network. Pathway enrichment analysis revealed significant pathways of each module: module 0, Regulation of RhoA activity and Signaling by Rho GTPases pathways shared ARHGAP4 and ARHGAP9; module 2, GlycoProtein VI-mediated activation cascade pathway was enriched with RHOG; module 3, Thromboxane A2 receptor signaling, Chemokine signaling pathway, CXCR4-mediated signaling events pathways were enriched with LYN, the hub gene of module 3. Results of RT-PCR confirmed the finding of the bioinformatic analysis that ARHGAP4, ARHGAP9, RHOG and LYN were significantly upregulated in PCOS. RhoA-related pathways, GlycoProtein VI-mediated activation cascade pathway, ARHGAP4, ARHGAP9, RHOG and LYN may be involved in the pathogenesis of PCOS.

  15. GMO detection using a bioluminescent real time reporter (BART of loop mediated isothermal amplification (LAMP suitable for field use

    Directory of Open Access Journals (Sweden)

    Kiddle Guy

    2012-04-01

    Full Text Available Abstract Background There is an increasing need for quantitative technologies suitable for molecular detection in a variety of settings for applications including food traceability and monitoring of genetically modified (GM crops and their products through the food processing chain. Conventional molecular diagnostics utilising real-time polymerase chain reaction (RT-PCR and fluorescence-based determination of amplification require temperature cycling and relatively complex optics. In contrast, isothermal amplification coupled to a bioluminescent output produced in real-time (BART occurs at a constant temperature and only requires a simple light detection and integration device. Results Loop mediated isothermal amplification (LAMP shows robustness to sample-derived inhibitors. Here we show the applicability of coupled LAMP and BART reactions (LAMP-BART for determination of genetically modified (GM maize target DNA at low levels of contamination (0.1-5.0% GM using certified reference material, and compare this to RT-PCR. Results show that conventional DNA extraction methods developed for PCR may not be optimal for LAMP-BART quantification. Additionally, we demonstrate that LAMP is more tolerant to plant sample-derived inhibitors, and show this can be exploited to develop rapid extraction techniques suitable for simple field-based qualitative tests for GM status determination. We also assess the effect of total DNA assay load on LAMP-BART quantitation. Conclusions LAMP-BART is an effective and sensitive technique for GM detection with significant potential for quantification even at low levels of contamination and in samples derived from crops such as maize with a large genome size. The resilience of LAMP-BART to acidic polysaccharides makes it well suited to rapid sample preparation techniques and hence to both high throughput laboratory settings and to portable GM detection applications. The impact of the plant sample matrix and genome loading

  16. Based Real Time Remote Health Monitoring Systems: A Review on Patients Prioritization and Related "Big Data" Using Body Sensors information and Communication Technology.

    Science.gov (United States)

    Kalid, Naser; Zaidan, A A; Zaidan, B B; Salman, Omar H; Hashim, M; Muzammil, H

    2017-12-29

    The growing worldwide population has increased the need for technologies, computerised software algorithms and smart devices that can monitor and assist patients anytime and anywhere and thus enable them to lead independent lives. The real-time remote monitoring of patients is an important issue in telemedicine. In the provision of healthcare services, patient prioritisation poses a significant challenge because of the complex decision-making process it involves when patients are considered 'big data'. To our knowledge, no study has highlighted the link between 'big data' characteristics and real-time remote healthcare monitoring in the patient prioritisation process, as well as the inherent challenges involved. Thus, we present comprehensive insights into the elements of big data characteristics according to the six 'Vs': volume, velocity, variety, veracity, value and variability. Each of these elements is presented and connected to a related part in the study of the connection between patient prioritisation and real-time remote healthcare monitoring systems. Then, we determine the weak points and recommend solutions as potential future work. This study makes the following contributions. (1) The link between big data characteristics and real-time remote healthcare monitoring in the patient prioritisation process is described. (2) The open issues and challenges for big data used in the patient prioritisation process are emphasised. (3) As a recommended solution, decision making using multiple criteria, such as vital signs and chief complaints, is utilised to prioritise the big data of patients with chronic diseases on the basis of the most urgent cases.

  17. Simultaneous VENTANA IHC and RT-PCR testing of ALK status in Chinese non-small cell lung cancer patients and response to crizotinib.

    Science.gov (United States)

    Xu, Chun-Wei; Wang, Wen-Xian; Chen, Yan-Ping; Chen, Yu; Liu, Wei; Zhong, Li-Hua; Chen, Fang-Fang; Zhuang, Wu; Song, Zheng-Bo; Chen, Xiao-Hui; Huang, Yun-Jian; Guan, Yan-Fang; Yi, Xin; Lv, Tang-Feng; Zhu, Wei-Feng; Lu, Jian-Ping; Wang, Xiao-Jiang; Shi, Yi; Lin, Xian-Dong; Chen, Gang; Song, Yong

    2018-04-11

    ALK rearrangement-advanced NSCLC patients respond to crizotinib. ALK rearrangement is currently determined with RT-PCR. VENTANA IHC is a standard method to identify ALK protein overexpression in NSCLC; however, VENTANA IHC has rarely been used to determine the response to crizotinib in Chinese patients with NSCLC and ALK overexpression. To better clarify the clinical implication of VENTANA IHC to detect ALK rearrangements, we conducted this study to analyze VENTANA IHC and RT-PCR in a large cohort of Chinese patients with NSCLC undergoing screening for ALK rearrangements. A total of 1720 patients with NSCLC who had ALK rearrangements detected by VENTANA IHC and/or RT-PCR were included in this analysis. We compared the efficacy and survival of ALK-positive patients detected by VENTANA IHC and RT-PCR. We used NGS to identify patients in whom the two methods were inconsistent. Among 1720 patients, 187 (10.87%) were shown to be ALK-positive by VENTANA IHC and/or RT-PCR, and 66 received crizotinib treatment. We identified 10.27% (172/1674) of patients as ALK-positive by the VENTANA IHC method, and 12.73% (41/322) of patients had ALK rearrangements by the RT-PCR method. Twenty-nine of 276 (10.51%) ALK-positive patients were simultaneously analyzed using VENTANA IHC and RT-PCR. The overall response rates were 65.90% (29/44) by VENTANA IHC and 55.88% (19/34) by RT-PCR. The disease control rates were 86.36% (38/44) by VENTANA IHC and 76.47% (26/34) by RT-PCR. In contrast, the median progression-free survival for VENTANA IHC and RT-PCR was 8.5 and 9.2 months, respectively. The VENTANA IHC and RT-PCR results obtained for 6 of 17 ALK-positive patients were inconsistent based on NGS; specifically, 4 patients had EML4-ALK fusions, 2 patients had non EML4-ALK fusions, 1 patient had a KCL1-ALK fusion, and one patient had a FBXO36-ALK fusion. VENTANA IHC is a reliable and rapid screening tool used in routine pathologic laboratories for the identification of suitable candidates for

  18. A quantitative method to evaluate mesenchymal stem cell lipofection using real-time PCR.

    Science.gov (United States)

    Ribeiro, S C; Mendes, R; Madeira, C; Monteiro, G A; da Silva, C L; Cabral, J M S

    2010-01-01

    Genetic modification of human mesenchymal stem cells (MSC) is a powerful tool to improve the therapeutic utility of these cells and to increase the knowledge on their regulation mechanisms. In this context, strong efforts have been made recently to develop efficient nonviral gene delivery systems. Although several studies addressed this question most of them use the end product of a reporter gene instead of the DNA uptake quantification to test the transfection efficiency. In this study, we established a method based on quantitative real-time PCR (RT-PCR) to determine the intracellular plasmid DNA copy number in human MSC after lipofection. The procedure requires neither specific cell lysis nor DNA purification. The influence of cell number on the RT-PCR sensitivity was evaluated. The method showed good reproducibility, high sensitivity, and a wide linear range of 75-2.5 x 10⁶ plasmid DNA copies per cell. RT-PCR results were then compared with the percentage of transfected cells assessed by flow cytometry analysis, which showed that flow cytometry-based results are not always proportional to plasmid cellular uptake determined by RT-PCR. This work contributed for the establishment of a rapid quantitative assay to determine intracellular plasmid DNA in stem cells, which will be extremely beneficial for the optimization of gene delivery strategies. © 2010 American Institute of Chemical Engineers

  19. Clinical utility of RT-PCR in assessing HER 2 gene expression versus traditional IHC and FISH in breast cancer patients.

    Science.gov (United States)

    Suryavanshi, Moushumi; Mehta, Anurag; Jaipuria, Jiten; Kumar, Dushyant; Vishwakarma, Gayatri; Panigrahi, Manoj Kumar; Verma, Haristuti; Saifi, Mumtaz; Sharma, Sanjeev; Tandon, Simran; Doval, D C; Das, Bhudev C

    2018-02-09

    IHC and FISH are used for categorizing HER 2 status in breast cancer at the protein and DNA level, respectively. HER 2 expression at the RNA level is quantitative, cheaper, easier to standardize and free from interobserver variation. 115 consecutive patients were tested by IHC, FISH and RT-PCR (test cohort). Assuming FISH result to be the response variable, ROC curves for RT-PCR ratio were analyzed to label HER 2 negative, equivocal and positive cases as RT-PCR score 1, 2 and 3, respectively. Inter-relationships between RT-PCR, IHC and FISH were defined. 'Clinical benefit' of a test was defined as proportion of patients labeled unequivocally as HER 2 positive or negative. Population for 1 year was simulated constraint to previous reports of HER 2 positivity and IHC category distribution by a meta-analysis of previous studies that evaluated concordance between IHC and FISH to determine HER 2 status (simulation cohort). Four diagnostic pathways in the simulation cohort were defined-(1) initial IHC, followed by FISH (conventional pathway); (2) initial RT-PCR, followed by FISH; (3) initial IHC, followed by RT-PCR and then by FISH; (4) initial RT-PCR, followed by IHC and then by FISH. The clinical benefit of IHC and RT-PCR in the four pathways was analyzed and sensitivity analysis for incremental cost-effectiveness ratio and cost-benefit comapring RT-PCR against IHC, both as first-line tests and among those with IHC score 2 as a reflex second-line test was performed by the Monte Carlo technique. 115 patients comprised the study population. While none with IHC score of 0 or 1 was FISH positive for HER 2, all cases with IHC score of 3 were FISH positive. 43 cases were assigned IHC score of 2. Thus, 72 patients benefited from the initial IHC testing [clinical benefit 62.6%], with the overall concordance between IHC and FISH being 100% for those with IHC score of 0, 1 and 3 (conclusive IHC categories). For RT-PCR with 100% concordance, 15.7% (115-97 = 18) patients

  20. A probe-based qRT-PCR method to profile immunological gene expression in blood of captive beluga whales (Delphinapterus leucas

    Directory of Open Access Journals (Sweden)

    Ming-An Tsai

    2017-09-01

    Full Text Available Cytokines are fundamental for a functioning immune system, and thus potentially serve as important indicators of animal health. Quantitation of mRNA using quantitative reverse transcription polymerase chain reaction (qRT-PCR is an established immunological technique. It is particularly suitable for detecting the expression of proteins against which monoclonal antibodies are not available. In this study, we developed a probe-based quantitative gene expression assay for immunological assessment of captive beluga whales (Delphinapterus leucas that is one of the most common cetacean species on display in aquariums worldwide. Six immunologically relevant genes (IL-2Rα, -4, -10, -12, TNFα, and IFNγ were selected for analysis, and two validated housekeeping genes (PGK1 and RPL4 with stable expression were used as reference genes. Sixteen blood samples were obtained from four animals with different health conditions and stored in RNAlater™ solution. These samples were used for RNA extraction followed by qRT-PCR analysis. Analysis of gene transcripts was performed by relative quantitation using the comparative Cq method with the integration of amplification efficiency and two reference genes. The expression levels of each gene in the samples from clinically healthy animals were normally distributed. Transcript outliers for IL-2Rα, IL-4, IL-12, TNFα, and IFNγ were noticed in four samples collected from two clinically unhealthy animals. This assay has the potential to identify immune system deviation from normal state, which is caused by health problems. Furthermore, knowing the immune status of captive cetaceans could help both trainers and veterinarians in implementing preventive approaches prior to disease onset.

  1. COMPARISON OF TWO TOTAL RNA EXTRACTION PROTOCOLS FROM CHO-K1 CELLS FOR RT-PCR: CUT-OFF COST FOR RESEARCHERS

    Directory of Open Access Journals (Sweden)

    Vasila Packeer Mohamed

    2014-05-01

    Full Text Available ABSTRACT: Various methods have been described to extract RNA from adherent mammalian cells. RNA isolation in conjunction with reverse transcription polymerase chain reaction (RT-PCR is a valuable tool used to study gene expression profiling. This approach is now being used in mammalian cell bioprocessing to help understand and improve the system. The objective of this study was to compare and determine the most suitable RNA extraction method for CHO-K1 cells in a setting where a relatively large amount of samples was involved. Total RNA was extracted using Total RNA purification kit (without DNase treatment; Norgen, Canada and RNeasy mini kit (with DNase treatment; Qiagen, USA respectively. The extracted RNA was then reverse transcribed, and the cDNA was subjected to PCR-amplifying 18S. Yield from RNeasy kit was significantly higher (0.316 ± 0.033 µg/µl; p=0.004 than Total RNA purification kit (0.177 ± 0.0243 µg/µl. However, RNA purity for both methods was close to 2.0 and there was no significant difference between the methods. Total RNA purification kit is less expensive than RNeasy kit. Since there is no DNase treatment step in the former, extraction time for RNA is shorter. When the extracted RNA was subjected to RT-PCR, both methods were able to show detection of 18S at 219 bp.   Therefore, this study demonstrates that both protocols are suitable for RNA extraction for CHO-K1 cells. RNeasy mini kit (Qiagen is recommended if higher yields is the primary concern and Total RNA Purification kit (Norgen is recommended if time and cost are concerned. ABSTRAK: Pelbagai kaedah telah digunakan untuk mengekstrak RNA daripada sel mamalia lekat.  Pemencilan RNA dengan menggunakan reaksi rantai polimerase transkripsi berbalik (RT-PCR merupakan kaedah penting yang digunakan dalam mengkaji pernyataan gen berprofil.  Pendekatan ini kini digunakan dalam pemprosesan bio sel mamalia untuk memahami dan menambah baik sistem.  Tujuan kajian dijalankan

  2. Penerapan Metode Diagnosis Cepat Virus Avian Influenza H5N1 dengan Metode Single Step Multiplex RT-PCR

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2010-12-01

    Full Text Available Avian influenza (AI virus is a segmented single stranded (ss RNA virus with negative polarity andbelong to the Orthomyxoviridae family. Diagnose of AI virus can be performed using conventional methodsbut it has low sensitivity and specificity. The objective of the research was to apply rapid, precise, andaccurate diagnostic method for AI virus and also to determine its type and subtype based on the SingleStep Multiplex Reverse Transcriptase-Polymerase Chain Reaction targeting M, H5, and N1 genes. In thismethod M, H5 and NI genes were simultaneously amplified in one PCR tube. The steps of this researchconsist of collecting viral RNAs from 10 different AI samples originated from Maros Disease InvestigationCenter during 2007. DNA Amplification was conducted by Simplex RT-PCR using M primer set. Then, bysingle step multiplex RT-PCR were conducted simultaneously using M, H5 and N1 primers set. The RTPCRproducts were then separated on 1.5% agarose gel, stained by ethidum bromide and visualized underUV transilluminator. Results showed that 8 of 10 RNA virus samples could be amplified by Simplex RTPCRfor M gene which generating a DNA fragment of 276 bp. Amplification using multiplex RT-PCRmethod showed two of 10 samples were AI positive using multiplex RT-PCR, three DNA fragments weregenerated consisting of 276 bp for M gene, 189 bp for H5 gene, and 131 bp for N1. In this study, rapid andeffective diagnosis method for AI virus can be conducted by using simultaneous Single Step Multiplex RTPCR.By this technique type and subtype of AI virus, can also be determined, especially H5N1.

  3. Development of an in situ magnetic beads based RT-PCR method for electrochemiluminescent detection of rotavirus

    Science.gov (United States)

    Zhan, Fangfang; Zhou, Xiaoming

    2012-12-01

    Rotaviruses are double-stranded RNA viruses belonging to the family of enteric pathogens. It is a major cause of diarrhoeal disease in infants and young children worldwide. Consequently, rapid and accurate detection of rotaviruses is of great importance in controlling and preventing food- and waterborne diseases and outbreaks. Reverse transcription-polymerase chain reaction (RT-PCR) is a reliable method that possesses high specificity and sensitivity. It has been widely used to detection of viruses. Electrochemiluminescence (ECL) can be considered as an important and powerful tool in analytical and clinical application with high sensitivity, excellent specificity, and low cost. Here we have developed a method for the detection of rotavirus by combining in situ magnetic beads (MBs) based RT-PCR with ECL. RT of rotavirus RNA was carried out in a traditional way and the resulting cDNA was directly amplified on MBs. Forward primers were covalently bounded to MBs and reverse primers were labeled with tris-(2, 2'-bipyridyl) ruthenium (TBR). During the PCR cycling, the TBR labeled products were directly loaded and enriched on the surface of MBs. Then the MBs-TBR complexes could be analyzed by a magnetic ECL platform without any post-modification or post-incubation which avoid some laborious manual operations and achieve rapid yet sensitive detection. In this study, rotavirus from fecal specimens was successfully detected within 2 h, and the limit of detection was estimated to be 104copies/μL. This novel in situ MBs based RT-PCR with ECL detection method can be used for pathogen detection in food safety field and clinical diagnosis.

  4. Evaluation of a duplex reverse-transcription real-time PCR assay for the detection of encephalomyocarditis virus.

    Science.gov (United States)

    Qin, Shaomin; Underwood, Darren; Driver, Luke; Kistler, Carol; Diallo, Ibrahim; Kirkland, Peter D

    2018-06-01

    We evaluated a fluorogenic probe-based assay for the detection of encephalomyocarditis virus (EMCV) by comparing a set of published primers and probe to a new set of primers and probe. The published reagents failed to amplify a range of Australian isolates and an Italian reference strain of EMCV. In contrast, an assay based on 2 new sets of primers and probes that were run in a duplex reverse-transcription real-time PCR (RT-rtPCR) worked well, with high amplification efficiency. The analytical sensitivity was ~100-fold higher than virus isolation in cell culture. The intra-assay variation was 0.21-4.90%. No cross-reactivity was observed with a range of other porcine viruses. One hundred and twenty-two clinical specimens were tested simultaneously by RT-rtPCR and virus isolation in cell culture; 72 specimens gave positive results by RT-rtPCR, and 63 of these were also positive by virus isolation. Of 245 archived cell culture isolates of EMCV that were tested in the RT-rtPCR, 242 samples were positive. The new duplex RT-rtPCR assay is a reliable tool for the detection of EMCV in clinical specimens and for use in epidemiologic investigations.

  5. Comparison of real-time and quantitative polymerase chain reaction assays in detection of cytomegalovirus DNA in clinical specimens

    International Nuclear Information System (INIS)

    Gokahmetoglu, S.; Deniz, E.

    2007-01-01

    To compare the real-time (RT) and qualitative (Q) polymerase chain reaction (PCR) assays for detection of Cytomegalovirus (CMV) DNA. The study took place in the Department of Microbiology, Erciyes University, Kayseri and in Iontek Laboratory, Istanbul, Turkey, from August to December 2006. One hundred and seven clinical specimens from 67 patients were included in the study. Cytomegalovirus DNA was investigated using RT-PCR kit (Fluorion Iontek, Turkey) and Q-PCR kit (Fluorion Iontek, Turkey). Deoxyribonucleic acid sequencing was applied to the samples that yielded discrepant results in both assays. Mac Nema's Chi Square test was used for statistical analysis. Of the specimens, 27 were found positive with both assays: 9 with only RT-PCR, and 11 with only Q-PCR assay. Both assays were found negative in 60 of the specimens. There was a good agreement between the 2 assays in 87(81.3%) of the specimens. There was no statistical significant difference between the assays (p>0.05). Two of the 11 samples that RT-PCR negative Q-PCR positive, and 3 of 9 samples that RT-PCR positive Q-PCR negative were found to be CMV DNA positive by DNA sequencing. A good level of concordance between RT-PCR and Q-PCR assays for CMV DNA detection has been found. (author)

  6. Variation in Bluetongue virus real-time reverse transcription polymerase chain reaction assay results in blood samples of sheep, cattle, and alpaca.

    Science.gov (United States)

    Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M

    2011-07-01

    Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.

  7. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

    Science.gov (United States)

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

    2018-01-23

    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  8. Monitoring in Real Time the Formation and Removal of Biofilms from Clinical Related Pathogens Using an Impedance-Based Technology

    Science.gov (United States)

    Gutiérrez, Diana; Hidalgo-Cantabrana, Claudio; Rodríguez, Ana; García, Pilar

    2016-01-01

    Bacteria found in diverse ecosystems grow in a community of aggregated cells that favors their survival and colonization. Different extracellular polymeric substances are used to entrap this multispecies community forming a biofilm, which can be associated to biotic and abiotic surfaces. This widespread and successful way of bacterial life, however, can lead to negative effects for human activity since many pathogen and spoiling bacteria form biofilms which are not easy to eradicate. Therefore, the search for novel anti-biofilm bio-active molecules is a very active research area for which simple, reliable, and fast screening methods are demanded. In this work we have successfully validated an impedance-based method, initially developed for the study of adherent eukaryotic cells, to monitor the formation of single-species biofilms of three model bacteria in real time. The xCelligence real time cell analyzer (RTCA) equipment uses specific microtiter E-plates coated with gold-microelectrodes that detect the attachment of adherent cells, thus modifying the impedance signal. In the current study, this technology allowed the distinction between biofilm-producers and non-producers of Staphylococcus aureus and Staphylococcus epidermidis, as well as the formation of Streptococcus mutans biofilms only when sucrose was present in the culture medium. Besides, different impedance values permitted discrimination among the biofilm-producing strains tested regardless of the nature of the polymeric biofilm matrix. Finally, we have continuously monitored the inhibition of staphylococcal biofilm formation by the bacteriophage phi-IPLA7 and the bacteriophage-encoded endolysin LysH5, as well as the removal of a preformed biofilm by this last antimicrobial treatment. Results observed with the impedance-based method showed high correlation with those obtained with standard approaches, such as crystal violet staining and bacteria enumeration, as well as with those obtained upon other

  9. Monitoring in Real Time the Formation and Removal of Biofilms from Clinical Related Pathogens Using an Impedance-Based Technology.

    Directory of Open Access Journals (Sweden)

    Diana Gutiérrez

    Full Text Available Bacteria found in diverse ecosystems grow in a community of aggregated cells that favors their survival and colonization. Different extracellular polymeric substances are used to entrap this multispecies community forming a biofilm, which can be associated to biotic and abiotic surfaces. This widespread and successful way of bacterial life, however, can lead to negative effects for human activity since many pathogen and spoiling bacteria form biofilms which are not easy to eradicate. Therefore, the search for novel anti-biofilm bio-active molecules is a very active research area for which simple, reliable, and fast screening methods are demanded. In this work we have successfully validated an impedance-based method, initially developed for the study of adherent eukaryotic cells, to monitor the formation of single-species biofilms of three model bacteria in real time. The xCelligence real time cell analyzer (RTCA equipment uses specific microtiter E-plates coated with gold-microelectrodes that detect the attachment of adherent cells, thus modifying the impedance signal. In the current study, this technology allowed the distinction between biofilm-producers and non-producers of Staphylococcus aureus and Staphylococcus epidermidis, as well as the formation of Streptococcus mutans biofilms only when sucrose was present in the culture medium. Besides, different impedance values permitted discrimination among the biofilm-producing strains tested regardless of the nature of the polymeric biofilm matrix. Finally, we have continuously monitored the inhibition of staphylococcal biofilm formation by the bacteriophage phi-IPLA7 and the bacteriophage-encoded endolysin LysH5, as well as the removal of a preformed biofilm by this last antimicrobial treatment. Results observed with the impedance-based method showed high correlation with those obtained with standard approaches, such as crystal violet staining and bacteria enumeration, as well as with those

  10. Monitoring in Real Time the Formation and Removal of Biofilms from Clinical Related Pathogens Using an Impedance-Based Technology.

    Science.gov (United States)

    Gutiérrez, Diana; Hidalgo-Cantabrana, Claudio; Rodríguez, Ana; García, Pilar; Ruas-Madiedo, Patricia

    2016-01-01

    Bacteria found in diverse ecosystems grow in a community of aggregated cells that favors their survival and colonization. Different extracellular polymeric substances are used to entrap this multispecies community forming a biofilm, which can be associated to biotic and abiotic surfaces. This widespread and successful way of bacterial life, however, can lead to negative effects for human activity since many pathogen and spoiling bacteria form biofilms which are not easy to eradicate. Therefore, the search for novel anti-biofilm bio-active molecules is a very active research area for which simple, reliable, and fast screening methods are demanded. In this work we have successfully validated an impedance-based method, initially developed for the study of adherent eukaryotic cells, to monitor the formation of single-species biofilms of three model bacteria in real time. The xCelligence real time cell analyzer (RTCA) equipment uses specific microtiter E-plates coated with gold-microelectrodes that detect the attachment of adherent cells, thus modifying the impedance signal. In the current study, this technology allowed the distinction between biofilm-producers and non-producers of Staphylococcus aureus and Staphylococcus epidermidis, as well as the formation of Streptococcus mutans biofilms only when sucrose was present in the culture medium. Besides, different impedance values permitted discrimination among the biofilm-producing strains tested regardless of the nature of the polymeric biofilm matrix. Finally, we have continuously monitored the inhibition of staphylococcal biofilm formation by the bacteriophage phi-IPLA7 and the bacteriophage-encoded endolysin LysH5, as well as the removal of a preformed biofilm by this last antimicrobial treatment. Results observed with the impedance-based method showed high correlation with those obtained with standard approaches, such as crystal violet staining and bacteria enumeration, as well as with those obtained upon other

  11. Route around real time

    International Nuclear Information System (INIS)

    Terrier, Francois

    1996-01-01

    The greater and greater autonomy and complexity asked to the control and command systems lead to work on introducing techniques such as Artificial Intelligence or concurrent object programming in industrial applications. However, while the critical feature of these systems impose to control the dynamics of the proposed solutions, their complexity often imposes a high adaptability to a partially modelled environment. The studies presented start from low level control and command systems to more complex applications at higher levels, such as 'supervision systems'. Techniques such as temporal reasoning and uncertainty management are proposed for the first studies, while the second are tackled with programming techniques based on the real time object paradigm. The outcomes of this itinerary crystallize on the ACCORD project which targets to manage - on the whole life cycle of a real time application - these two problematics, sometimes antagonistic: control of the dynamics and adaptivity. (author) [fr

  12. Understanding chemical-potential-related transient pore-pressure response to improve real-time borehole (in)stability predictions

    Energy Technology Data Exchange (ETDEWEB)

    Tare, U.A.; Mody, F.K.; Mese, A.I. [Halliburton Energy Services, Cairo (Egypt)

    2000-11-01

    Experimental studies were conducted to explain the concept of a real-time wellbore (in)stability logging methodology. The role of the chemical potential of drilling fluids on transient pore pressure and time-dependent rock property alterations of shale formations was examined by providing details about a pore pressure transmission (PPT) test. The PPT experiments exposed formation (shale) cores under simulated downhole conditions to various salt solutions and drilling fluids. The main objective was to translate the results of the PPT tests to actual drilling conditions. A 20 per cent w/w calcium chloride solution was exposed to a Pierre II shale under high pressure in the PPT apparatus. The PPT test was used to estimate the impact of a drilling fluid on shale pore pressure. The efficiency of the salt solution/shale system was also estimated. Estimates of the dynamic rock properties were made based on the obtained acoustic data. It was determined that in order to accurately model time-dependent wellbore (in)stability in the field, it is important to calibrate representative shale core response to drilling fluids under realistic in-situ conditions. The 20 per cent w/w calcium chloride solution showed very low membrane efficiency of 4.45 per cent. It was concluded that changes in the shale dynamic rock properties as a function of test fluid exposure can be obtained from the simultaneous acquisition of sonic compression and shear wave velocity data. 12 refs., 5 figs.

  13. Real time falling leaves

    OpenAIRE

    Vázquez Alcocer, Pere Pau; Balsa, Marcos

    2007-01-01

    There is a growing interest in simulating natural phenomena in computer graphics applications. Animating natural scenes in real time is one of the most challenging problems due to the inherent complexity of their structure, formed by millions of geometric entities, and the interactions that happen within. An example of natural scenario that is needed for games or simulation programs are forests. Forests are difficult to render because the huge amount of geometric entities and the large amount...

  14. Real Time Strategy Language

    OpenAIRE

    Hayes, Roy; Beling, Peter; Scherer, William

    2014-01-01

    Real Time Strategy (RTS) games provide complex domain to test the latest artificial intelligence (AI) research. In much of the literature, AI systems have been limited to playing one game. Although, this specialization has resulted in stronger AI gaming systems it does not address the key concerns of AI researcher. AI researchers seek the development of AI agents that can autonomously interpret learn, and apply new knowledge. To achieve human level performance, current AI systems rely on game...

  15. Real Time Processing

    CERN Multimedia

    CERN. Geneva; ANDERSON, Dustin James; DOGLIONI, Caterina

    2015-01-01

    The LHC provides experiments with an unprecedented amount of data. Experimental collaborations need to meet storage and computing requirements for the analysis of this data: this is often a limiting factor in the physics program that would be achievable if the whole dataset could be analysed. In this talk, I will describe the strategies adopted by the LHCb, CMS and ATLAS collaborations to overcome these limitations and make the most of LHC data: data parking, data scouting, and real-time analysis.

  16. Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis).

    Science.gov (United States)

    Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret

    2003-12-01

    A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.

  17. Virus isolation vs RT-PCR: which method is more successful in detecting VHSV and IHNV in fish tissue sampled under field conditions?

    DEFF Research Database (Denmark)

    Knüsel, R.; Bergmann, S. M.; Einer-Jensen, Katja

    2007-01-01

    in Switzerland. Compared to SPNT, the RT-PCR method detected, as with virus isolation, a much lower number of positive cases; reasons for this discrepancy are discussed. Our results indicate that RT-PCR can not only be successfully applied in field surveys, but may also be slightly more sensitive than virus......This study compared the results of reverse transcription-polymerase chain reaction (RT-PCR) and traditional virus isolation on cell culture in detection of viral haemorrhagic septicaemia virus (VHSV) and infectious haematopoietic necrosis virus (IHNV). RT-PCR was used for 172 tissue sample pools...... (total of 859 fish) originating from a field survey on the occurrence of VHSV and IHNV in farmed and wild salmonids in Switzerland. These samples represented all sites with fish that were either identified as virus-positive by means of virus isolation (three sites, four positive tissue sample pools) and...

  18. Simultaneous Detection of Mixed Infection of Onion yellow dwarf virus and an Allexivirus in RT-PCR for Ensuring Virus Free Onion Bulbs.

    Science.gov (United States)

    Kumar, Sandeep; Baranwal, V K; Joshi, Subodh; Arya, Meenakshi; Majumder, S

    2010-06-01

    Reduced seed production in onion is associated with Onion yellow dwarf virus (OYDV), a filamentous Potyvirus. Onion is also infected with other filamentous virus particles suspected to be Allexivirus. RT-PCR was used to detect mixed infection of both the viruses in leaves and bulbs. A duplex RT-PCR was developed, which simultaneously detected the presence of these two viruses in winter (Rabi) onion bulb. In summer (Kharif) onion bulbs only Allexivirus was detected. The absence of OYDV in summer crop is discussed. The sequencing of RT-PCR amplified products confirmed the identity of OYDV and Allexivirus, the latter showing closer identity to Garlic virus C (GVC)/Garlic mite-borne mosaic virus. This makes the first detection of an Allexivirus in onion crop in India. The duplex RT-PCR to detect these viruses (OYDV and Allexivirus) would be an improvement for indexing of viruses in onion bulbs for seed production.

  19. Quantitation of TGF-beta1 mRNA in porcine mesangial cells by comparative kinetic RT/PCR: comparison with ribonuclease protection assay and in situ hybridization.

    Science.gov (United States)

    Ceol, M; Forino, M; Gambaro, G; Sauer, U; Schleicher, E D; D'Angelo, A; Anglani, F

    2001-01-01

    Gene expression can be examined with different techniques including ribonuclease protection assay (RPA), in situ hybridisation (ISH), and quantitative reverse transcription-polymerase chain reaction (RT/PCR). These methods differ considerably in their sensitivity and precision in detecting and quantifying low abundance mRNA. Although there is evidence that RT/PCR can be performed in a quantitative manner, the quantitative capacity of this method is generally underestimated. To demonstrate that the comparative kinetic RT/PCR strategy-which uses a housekeeping gene as internal standard-is a quantitative method to detect significant differences in mRNA levels between different samples, the inhibitory effect of heparin on phorbol 12-myristate 13-acetate (PMA)-induced-TGF-beta1 mRNA expression was evaluated by RT/PCR and RPA, the standard method of mRNA quantification, and the results were compared. The reproducibility of RT/PCR amplification was calculated by comparing the quantity of G3PDH and TGF-beta1 PCR products, generated during the exponential phases, estimated from two different RT/PCR (G3PDH, r = 0.968, P = 0.0000; TGF-beta1, r = 0.966, P = 0.0000). The quantitative capacity of comparative kinetic RT/PCR was demonstrated by comparing the results obtained from RPA and RT/PCR using linear regression analysis. Starting from the same RNA extraction, but using only 1% of the RNA for the RT/PCR compared to RPA, significant correlation was observed (r = 0.984, P = 0.0004). Moreover the morphometric analysis of ISH signal was applied for the semi-quantitative evaluation of the expression and localisation of TGF-beta1 mRNA in the entire cell population. Our results demonstrate the close similarity of the RT/PCR and RPA methods in giving quantitative information on mRNA expression and indicate the possibility to adopt the comparative kinetic RT/PCR as reliable quantitative method of mRNA analysis. Copyright 2001 Wiley-Liss, Inc.

  20. A simplified strategy for sensitive detection of Rose rosette virus compatible with three RT-PCR chemistries.

    Science.gov (United States)

    Dobhal, Shefali; Olson, Jennifer D; Arif, Mohammad; Garcia Suarez, Johnny A; Ochoa-Corona, Francisco M

    2016-06-01

    Rose rosette disease is a disorder associated with infection by Rose rosette virus (RRV), a pathogen of roses that causes devastating effects on most garden cultivated varieties, and the wild invasive rose especially Rosa multiflora. Reliable and sensitive detection of this disease in early phases is needed to implement proper control measures. This study assesses a single primer-set based detection method for RRV and demonstrates its application in three different chemistries: Endpoint RT-PCR, TaqMan-quantitative RT-PCR (RT-qPCR) and SYBR Green RT-qPCR with High Resolution Melting analyses. A primer set (RRV2F/2R) was designed from consensus sequences of the nucleocapsid protein gene p3 located in the RNA 3 region of RRV. The specificity of primer set RRV2F/2R was validated in silico against published GenBank sequences and in-vitro against infected plant samples and an exclusivity panel of near-neighbor and other viruses that commonly infect Rosa spp. The developed assay is sensitive with a detection limit of 1fg from infected plant tissue. Thirty rose samples from 8 different states of the United States were tested using the developed methods. The developed methods are sensitive and reliable, and can be used by diagnostic laboratories for routine testing and disease management decisions. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Generic detection of poleroviruses using an RT-PCR assay targeting the RdRp coding sequence.

    Science.gov (United States)

    Lotos, Leonidas; Efthimiou, Konstantinos; Maliogka, Varvara I; Katis, Nikolaos I

    2014-03-01

    In this study a two-step RT-PCR assay was developed for the generic detection of poleroviruses. The RdRp coding region was selected as the primers' target, since it differs significantly from that of other members in the family Luteoviridae and its sequence can be more informative than other regions in the viral genome. Species specific RT-PCR assays targeting the same region were also developed for the detection of the six most widespread poleroviral species (Beet mild yellowing virus, Beet western yellows virus, Cucurbit aphid-borne virus, Carrot red leaf virus, Potato leafroll virus and Turnip yellows virus) in Greece and the collection of isolates. These isolates along with other characterized ones were used for the evaluation of the generic PCR's detection range. The developed assay efficiently amplified a 593bp RdRp fragment from 46 isolates of 10 different Polerovirus species. Phylogenetic analysis using the generic PCR's amplicon sequence showed that although it cannot accurately infer evolutionary relationships within the genus it can differentiate poleroviruses at the species level. Overall, the described generic assay could be applied for the reliable detection of Polerovirus infections and, in combination with the specific PCRs, for the identification of new and uncharacterized species in the genus. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. A multiplex RT-PCR assay for the rapid and differential diagnosis of classical swine fever and other pestivirus infections.

    Science.gov (United States)

    Díaz de Arce, Heidy; Pérez, Lester J; Frías, Maria T; Rosell, Rosa; Tarradas, Joan; Núñez, José I; Ganges, Llilianne

    2009-11-18

    Classical swine fever is a highly contagious viral disease causing severe economic losses in pig production almost worldwide. All pestivirus species can infect pigs, therefore accurate and rapid pestivirus detection and differentiation is of great importance to assure control measures in swine farming. Here we describe the development and evaluation of a novel multiplex, highly sensitive and specific RT-PCR for the simultaneous detection and rapid differentiation between CSFV and other pestivirus infections in swine. The universal and differential detection was based on primers designed to amplify a fragment of the 5' non-coding genome region for the detection of pestiviruses and a fragment of the NS5B gene for the detection of classical swine fever virus. The assay proved to be specific when different pestivirus strains from swine and ruminants were evaluated. The analytical sensitivity was estimated to be as little as 0.89TCID(50). The assay analysis of 30 tissue homogenate samples from naturally infected and non-CSF infected animals and 40 standard serum samples evaluated as part of two European Inter-laboratory Comparison Tests conducted by the European Community Reference Laboratory, Hanover, Germany proved that the multiplex RT-PCR method provides a rapid, highly sensitive, and cost-effective laboratory diagnosis for classical swine fever and other pestivirus infections in swine.

  3. Detecting Rice stripe virus (RSV) in the small brown planthopper (Laodelphax striatellus) with high specificity by RT-PCR.

    Science.gov (United States)

    Lijun, Cai; Xizhi, Ma; Lin, Kang; Kejing, Deng; Shouyuan, Zhao; Changben, Li

    2003-09-01

    Rice stripe disease, caused by Rice stripe virus (RSV), may lead to severe or even crippling losses in many rice-cultured countries and regions. As the most important vector of RSV, the small brown planthopper (SBPH) (Laodelphax striatellus) is largely responsible for the epidemic phase of the disease. Therefore, a rapid identification of RSV in the SBPH is of a great need for disease forecasting. A reverse transcription polymerase chain reaction (RT-PCR) assay is described to amplify a RSV gene in individual L. striatellus. By using primers matched to the viral RNA dependent RNA polymerase gene in RNA1, a 445 bp product was detected in viruliferous SBPHs. Meanwhile, the PCR products produced by the SBPH actin primers constructed across the boundary of an intron and an exon were used as RNA specific positive control for each stage of the experiment to ensure the validity of the negative results. Duplex RT-PCR conditions were established for the simultaneous detection of RSV and actin. This approach can be used for the early detection of RSV in L. striatellus and the subsequent rice stripe disease forecasting.

  4. Detection of rabies in camel, goat and cattle in Sudan using Fluorescent antibody test (FAT and hemi nested Polymerase Chain Reaction (hnRT-PCR

    Directory of Open Access Journals (Sweden)

    Baraa Abdalaziz Ahmed

    2016-09-01

    Full Text Available Objective: The objective of this study was to identify rabies virus in camels and other animals in Sudan. Materials and methods: Four camel samples were collected from Garraht Elzawia, Kab-kabia and North Darfur areas in Sudan. The samples were collected based on clinical signs. In addition, two camel samples were obtained from Khartoum and Tambool, one goat sample was collected from El-Fashir, and one cattle sample was obtained from Atbara. The samples were transported to the Veterinary Research Institute (VRI at Khartoum, Sudan for further studies. The samples were subjected for nested and hemi nested RT-PCR (hnRT-PCR along with the gold standard Fluorescent antibody test (FAT to diagnose rabies. Results: Out of eight samples, seven were found to be positive by both FAT and RT-PCR methods. The remaining one sample was positive by FAT but negative by hnRT-PCR indicating the suitablity of hnRT-PCR along with FAT for accurate diagnosis of rabies in animals. Conclusion: The study concluded that FAT and RT-PCR are useful tools for research and diagnosis of rabies. [J Adv Vet Anim Res 2016; 3(3.000: 274-277

  5. A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene.

    Science.gov (United States)

    Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

    2016-07-01

    The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher's exact test, and SPSS17 software. The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.

  6. Real Time Text Analysis

    Science.gov (United States)

    Senthilkumar, K.; Ruchika Mehra Vijayan, E.

    2017-11-01

    This paper aims to illustrate real time analysis of large scale data. For practical implementation we are performing sentiment analysis on live Twitter feeds for each individual tweet. To analyze sentiments we will train our data model on sentiWordNet, a polarity assigned wordNet sample by Princeton University. Our main objective will be to efficiency analyze large scale data on the fly using distributed computation. Apache Spark and Apache Hadoop eco system is used as distributed computation platform with Java as development language

  7. Real time Faraday spectrometer

    Science.gov (United States)

    Smith, Jr., Tommy E.; Struve, Kenneth W.; Colella, Nicholas J.

    1991-01-01

    This invention uses a dipole magnet to bend the path of a charged particle beam. As the deflected particles exit the magnet, they are spatially dispersed in the bend-plane of the magnet according to their respective momenta and pass to a plurality of chambers having Faraday probes positioned therein. Both the current and energy distribution of the particles is then determined by the non-intersecting Faraday probes located along the chambers. The Faraday probes are magnetically isolated from each other by thin metal walls of the chambers, effectively providing real time current-versus-energy particle measurements.

  8. Real time Faraday spectrometer

    International Nuclear Information System (INIS)

    Smith, T.E.; Struve, K.W.; Colella, N.J.

    1991-01-01

    This patent describes an invention which uses a dipole magnet to bend the path of a charged particle beam. As the deflected particles exit the magnet, they are spatially dispersed in the bend-plane of the magnet according to their respective momenta and pass to a plurality of chambers having Faraday probes positioned therein. Both the current and energy distribution of the particles is then determined by the non-intersecting Faraday probes located along the chambers. The Faraday probes are magnetically isolated from each other by thin metal walls of the chambers, effectively providing real time current-versus-energy particle measurements

  9. Real time psychrometric data collection

    International Nuclear Information System (INIS)

    McDaniel, K.H.

    1996-01-01

    Eight Mine Weather Stations (MWS) installed at the Waste Isolation Pilot Plant (WIPP) to monitor the underground ventilation system are helping to simulate real-time ventilation scenarios. Seasonal weather extremes can result in variations of Natural Ventilation Pressure (NVP) which can significantly effect the ventilation system. The eight MWS(s) (which previously collected and stored temperature, barometric pressure and relative humidity data for subsequent NVP calculations) were upgraded to provide continuous real-time data to the site wide Central monitoring System. This data can now be utilized by the ventilation engineer to create realtime ventilation simulations and trends which assist in the prediction and mitigation of NVP and psychrometric related events

  10. Real-time monitoring of methane oxidation in a simulated landfill cover soil and MiSeq pyrosequencing analysis of the related bacterial community structure.

    Science.gov (United States)

    Xing, Zhilin; Zhao, Tiantao; Gao, Yanhui; He, Zhi; Zhang, Lijie; Peng, Xuya; Song, Liyan

    2017-10-01

    Real-time CH 4 oxidation in a landfill cover soil was studied using automated gas sampling that determined biogas (CH 4 and CO 2 ) and O 2 concentrations at various depths in a simulated landfill cover soil (SLCS) column reactor. The real-time monitoring system obtained more than 10,000 biogas (CH 4 and CO 2 ) and O 2 data points covering 32 steady states of CH 4 oxidation with 32 different CH 4 fluxes (0.2-125mol·m -2 ·d -1 ). The kinetics of CH 4 oxidation at different depths (0-20cm, 20-40cm, and 40-60cm) of SLCS were well fit by a CH 4 -O 2 dual-substrate model based on 32 values (averaged, n=5-15) of equilibrated CH 4 concentrations. The quality of the fit (R 2 ranged from 0.90 to 0.96) was higher than those reported in previous studies, which suggests that real time monitoring is beneficial for CH 4 oxidation simulations. MiSeq pyrosequencing indicated that CH 4 flux events changed the bacterial community structure (e.g., increased the abundance of Bacteroidetes and Methanotrophs) and resulted in a relative increase in the amount of type I methanotrophs (Methylobacter and Methylococcales) and a decrease in the amount of type II methanotrophs (Methylocystis). Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. A Two-Step Lyssavirus Real-Time Polymerase Chain Reaction Using Degenerate Primers with Superior Sensitivity to the Fluorescent Antigen Test

    Directory of Open Access Journals (Sweden)

    Vanessa Suin

    2014-01-01

    Full Text Available A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR, based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

  12. Combined metabonomic and quantitative real-time PCR analyses reveal systems metabolic changes in Jurkat T-cells treated with HIV-1 Tat protein.

    Science.gov (United States)

    Liao, Wenting; Tan, Guangguo; Zhu, Zhenyu; Chen, Qiuli; Lou, Ziyang; Dong, Xin; Zhang, Wei; Pan, Wei; Chai, Yifeng

    2012-11-02

    HIV-1 Tat protein is released by infected cells and can affect bystander uninfected T cells and induce numerous biological responses which contribute to its pathogenesis. To elucidate the complex pathogenic mechanism, we conducted a comprehensive investigation on Tat protein-related extracellular and intracellular metabolic changes in Jurkat T-cells using combined gas chromatography-mass spectrometry (GC-MS), reversed-phase liquid chromatography-mass spectrometry (RPLC-MS) and a hydrophilic interaction liquid chromatography-mass spectrometry (HILIC-MS)-based metabonomics approach. Quantitative real-time PCR (qRT-PCR) analyses were further employed to measure expressions of several relevant enzymes together with perturbed metabolic pathways. Combined metabonomic and qRT-PCR analyses revealed that HIV-1 Tat caused significant and comprehensive metabolic changes, as represented by significant changes of 37 metabolites and 10 relevant enzymes in HIV-1 Tat-treated cells. Using MetaboAnalyst 2.0, it was found that 11 pathways (Impact-value >0.10) among the regulated pathways were acutely perturbed, including sphingolipid metabolism, glycine, serine and threonine metabolism, pyruvate metabolism, inositol phosphate metabolism, arginine and proline metabolism, citrate cycle, phenylalanine metabolism, tryptophan metabolism, pentose phosphate pathway, glycerophospholipid metabolism, glycolysis or gluconeogenesis. These results provide metabolic evidence of the complex pathogenic mechanism of HIV-1 Tat protein as a "viral toxin", and would help obligate Tat protein as "an important target" for therapeutic intervention and vaccine development.

  13. A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

    Science.gov (United States)

    Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

    2014-01-01

    A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

  14. Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze)

    Science.gov (United States)

    Quantitative real-time polymerase chain reaction (qRT-PCR) is a commonly used technique for measuring gene expression levels due to its simplicity, specificity, and sensitivity. Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a...

  15. The relative importance of real-time in-cab and external feedback in managing fatigue in real-world commercial transport operations.

    Science.gov (United States)

    Fitzharris, Michael; Liu, Sara; Stephens, Amanda N; Lenné, Michael G

    2017-05-29

    Real-time driver monitoring systems represent a solution to address key behavioral risks as they occur, particularly distraction and fatigue. The efficacy of these systems in real-world settings is largely unknown. This article has three objectives: (1) to document the incidence and duration of fatigue in real-world commercial truck-driving operations, (2) to determine the reduction, if any, in the incidence of fatigue episodes associated with providing feedback, and (3) to tease apart the relative contribution of in-cab warnings from 24/7 monitoring and feedback to employers. Data collected from a commercially available in-vehicle camera-based driver monitoring system installed in a commercial truck fleet operating in Australia were analyzed. The real-time driver monitoring system makes continuous assessments of driver drowsiness based on eyelid position and other factors. Data were collected in a baseline period where no feedback was provided to drivers. Real-time feedback to drivers then occurred via in-cab auditory and haptic warnings, which were further enhanced by direct feedback by company management when fatigue events were detected by external 24/7 monitors. Fatigue incidence rates and their timing of occurrence across the three time periods were compared. Relative to no feedback being provided to drivers when fatigue events were detected, in-cab warnings resulted in a 66% reduction in fatigue events, with a 95% reduction achieved by the real-time provision of direct feedback in addition to in-cab warnings (p safety culture of the company in terms of how the information is used. Data were analysed on a per-truck trip basis, and the findings are indicative of fatigue events in a large-scale commercial transport fleet. Future research ought to account for individual driver performance, which was not possible with the available data in this retrospective analysis. Evidence that real-time driver monitoring feedback is effective in reducing fatigue events is

  16. Detection of poliovirus type 2 in oysters by using cell culture and RT-PCR Detecção de poliovírus tipo 2 em ostras através de cultura celular e RT-PCR

    Directory of Open Access Journals (Sweden)

    Cecília E.B. Vinatea

    2006-03-01

    Full Text Available Shellfish are readily contaminated with viruses present in water containing sewage due to the concentrating effect of filter feeding. Enteroviruses are generally used as a model for the detection of viruses from shellfish due to their public health significance. In the present work, oysters were placed in glass aquaria containing seawater plus unicellular algae. Two experiments were performed: 1 oysters bioaccumulating four different poliovirus type 2 concentrations: 5 x 10(4, 2.5 x 10(4, 5 x 10³ and 5 x 10² PFU/mL during 20h; 2 oyster tissues directly inoculated with 6.0 x 10(5 and 1.0 x 10(5 PFU/mL. After viruses seeding, tissue samples were processed by an adsorption-elution-precipitation method. Positive controls were performed by seeding 6.0 x 10(5 PFU/mL of poliovirus type 2 directly on the final oyster tissue extracts. Oyster extracts were assayed for viruses recovery by plaque assay, RT-PCR and integrated cell culture-PCR methodologies (ICC/PCR. The last one was based on the inoculation of the samples onto VERO cell monolayer followed by RT-PCR analysis of the infected cell fluid. In the first experiment (20h bioaccumulation until 5 x 10³ PFU were detected after 24 and 48h growth on VERO cells. Direct RT-PCR and ICC/PCR were able to detect 3 and 0.04 PFU of poliovirus, respectively, when bioaccumulation assay was used. When direct tissue virus seeding was performed, the plaque assays showed that polioviruses were recovered in all tested concentrations. Based on these results, it is possible to conclude that viable polioviruses can be detected in oysters after bioaccumulation and these techniques can be directly applied for monitoring virus contamination in environmental samples.Devido ao hábito alimentar filtrante, os moluscos bivalves são contaminados por vírus presentes em águas contaminadas por esgoto. Os enterovírus são geralmente usados como modelos para a detecção de vírus em moluscos bivalves devido a sua import

  17. Rapid and sensitive detection of canine distemper virus by real-time reverse transcription recombinase polymerase amplification.

    Science.gov (United States)

    Wang, Jianchang; Wang, Jinfeng; Li, Ruiwen; Liu, Libing; Yuan, Wanzhe

    2017-08-15

    Canine distemper, caused by Canine distemper virus (CDV), is a highly contagious and fatal systemic disease in free-living and captive carnivores worldwide. Recombinase polymerase amplification (RPA), as an isothermal gene amplification technique, has been explored for the molecular detection of diverse pathogens. A real-time reverse transcription RPA (RT-RPA) assay for the detection of canine distemper virus (CDV) using primers and exo probe targeting the CDV nucleocapsid protein gene was developed. A series of other viruses were tested by the RT-RPA.Thirty-two field samples were further tested by RT-RPA, and the resuts were compared with those obtained by the real-time RT-PCR. The RT-RPA assay was performed successfully at 40 °C, and the results were obtained within 3 min-12 min. The assay could detect CDV, but did not show cross-detection of canine parvovirus-2 (CPV-2), canine coronavirus (CCoV), canine parainfluenza virus (CPIV), pseudorabies virus (PRV) or Newcastle disease virus (NDV), demonstrating high specificity. The analytical sensitivity of RT-RPA was 31.8 copies in vitro transcribed CDV RNA, which is 10 times lower than the real-time RT-PCR. The assay performance was validated by testing 32 field samples and compared to real-time RT-PCR. The results indicated an excellent correlation between RT-RPA and a reference real-time RT-PCR method. Both assays provided the same results, and R 2 value of the positive results was 0.947. The results demonstrated that the RT-RPA assay offers an alternative tool for simple, rapid, and reliable detection of CDV both in the laboratory and point-of-care facility, especially in the resource-limited settings.

  18. Development of a pan-Simbu real-time reverse transcriptase PCR for the detection of Simbu serogroup viruses and comparison with SBV diagnostic PCR systems.

    Science.gov (United States)

    Fischer, Melina; Schirrmeier, Horst; Wernike, Kerstin; Wegelt, Anne; Beer, Martin; Hoffmann, Bernd

    2013-11-05

    Schmallenberg virus (SBV), a novel orthobunyavirus of the Simbu serogroup, was first identified in October 2011 in dairy cattle in Germany, where it caused fever, diarrhea and a drop in milk yield. Since then, SBV additionally has been detected in adult sheep and goats. Although symptoms of acute infection were not observed, infection during a vulnerable phase of pregnancy caused congenital malformations and stillbirths. In view of the current situation and the possible emergence of further Simbu serogroup members, a pan-Simbu real-time reverse transcriptase (RT) PCR system for the reliable detection of Simbu serogroup viruses should be developed. In this study a pan-Simbu real-time RT-PCR system was established and compared to several SBV real-time RT-PCR assays. All PCR-systems were tested using a panel of different Simbu serogroup viruses as well as several field samples from diseased cattle, sheep and goats originating from all over Germany. Several pan-Simbu real-time RT-PCR products were sequenced via Sanger sequencing. Furthermore, in silico analyses were performed to investigate suitability for the detection of further orthobunyaviruses. All tested members of the Simbu serogroup (n = 14) as well as most of the field samples were successfully detected by the pan-Simbu real-time RT-PCR system. The comparison of this intercalating dye assay with different TaqMan probe-based assays developed for SBV diagnostics confirmed the functionality of the pan-Simbu assay for screening purposes. However, the SBV-TaqMan-assay SBV-S3 delivered the highest analytical sensitivity of less than ten copies per reaction for duplex systems including an internal control. In addition, for confirmation of SBV-genome detection the highly specific SBV-M1 assay was established. The pan-Simbu real-time RT-PCR system was able to detect all tested members of the Simbu serogroup, most of the SBV field samples as well as three tested Bunyamwera serogroup viruses with a suitable

  19. Real time spectrum analysis

    International Nuclear Information System (INIS)

    Blunden, A.; O'Prey, D.G.; Tait, W.H.

    1983-01-01

    A method is described for the separation of a composite pulse-height spectrum into its unresolved component parts, which belong to a set of measured library spectra. The method allows real-time estimation giving running estimates during acquisition of the spectrum, minimises computation space, especially for a number of parallel calculations, estimates in advance the rms errors, and produces a significance measure for the hypothesis that the composite contains only the library spectra. Least squares curve-fitting, and other methods, can be compared, with the formalism developed, allowing analytical comparison of the effect of detector energy resolution and detection efficiency. A rational basis for the choice between the various methods of spectrum analysis follows from the theory, minimising rms estimation errors. The method described is applicable for very low numbers of counts and poor resolution. (orig.)

  20. Real time production optimization

    Energy Technology Data Exchange (ETDEWEB)

    Saputelli, Luigi; Otavio, Joao; Araujo, Turiassu; Escorcia, Alvaro [Halliburton, Houston, TX (United States). Landmark Division

    2004-07-01

    Production optimization encompasses various activities of measuring, analyzing, modeling, prioritizing and implementing actions to enhance productivity of a field. We present a state-of-the-art framework for optimizing production on a continuous basis as new sensor data is acquired in real time. Permanently acquired data is modeled and analyzed in order to create predictive models. A model based control strategy is used to regulate well and field instrumentation. The optimum field operating point, which changes with time, satisfies the maximum economic return. This work is a starting point for further development in automatic, intelligent reservoir technologies which get the most out of the abilities of permanent, instrumented wells and remotely activated downhole completions. The strategy, tested with history-matched data from a compartmentalised giant field, proved to reduce operating costs while increasing oil recovery by 27% in this field. (author)

  1. Identification of Suitable Endogenous Normalizers for qRT- PCR Analysis of Plasma microRNA Expression in Essential Hypertension

    Science.gov (United States)

    Solayman, Mohamed Hassan M.; Langaee, Taimour; Patel, Archanakumari; El-Wakeel, Lamia; El-Hamamsy, Manal; Badary, Osama; Johnson, Julie A.

    2016-01-01

    Circulating microRNAs (miRNAs) are promising biomarkers for many diseases. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is a gold standard for miRNA expression profiling that requires proper data normalization. Since there is no universal normalizer, it is recommended to evaluate normalizers under every experimental condition. This study describes the identification of suitable endogenous normalizer(s) (ENs) for plasma miRNA expression in essential hypertension. Expression levels of 5 candidate ENs and 2 plasma quality markers were determined by qRT-PCR in plasma samples from 18 hypertensive patients and 10 healthy controls. NormFinder, GeNorm, and DataAssist software programs were used to select the best EN(s). Expression levels of the 5 candidate ENs were also analyzed in urine samples from hypertensive patients and compared to the plasma samples of the hypertensive patients. Among the analyzed candidates, hsa-miR-92a-3p was identified as the best EN, and hsa-miR-21-5p and hsa-miR-16-5p as next best. Moreover, hsa-miR-92a-3p showed the most consistent expression between plasma and urine In conclusion, this study showed that hsa-miR-92a-3p, hsa-miR-21-5p, and hsa-miR-16-5p may be used as normalizers for plasma miRNA expression data in essential hypertension studies. PMID:26798072

  2. Airborne rhinovirus detection and effect of ultraviolet irradiation on detection by a semi-nested RT-PCR assay

    Directory of Open Access Journals (Sweden)

    Rudnick Stephen

    2003-01-01

    Full Text Available Abstract Background Rhinovirus, the most common cause of upper respiratory tract infections, has been implicated in asthma exacerbations and possibly asthma deaths. Although the method of transmission of rhinoviruses is disputed, several studies have demonstrated that aerosol transmission is a likely method of transmission among adults. As a first step in studies of possible airborne rhinovirus transmission, we developed methods to detect aerosolized rhinovirus by extending existing technology for detecting infectious agents in nasal specimens. Methods We aerosolized rhinovirus in a small aerosol chamber. Experiments were conducted with decreasing concentrations of rhinovirus. To determine the effect of UV irradiation on detection of rhinoviral aerosols, we also conducted experiments in which we exposed aerosols to a UV dose of 684 mJ/m2. Aerosols were collected on Teflon filters and rhinovirus recovered in Qiagen AVL buffer using the Qiagen QIAamp Viral RNA Kit (Qiagen Corp., Valencia, California followed by semi-nested RT-PCR and detection by gel electrophoresis. Results We obtained positive results from filter samples that had collected at least 1.3 TCID50 of aerosolized rhinovirus. Ultraviolet irradiation of airborne virus at doses much greater than those used in upper-room UV germicidal irradiation applications did not inhibit subsequent detection with the RT-PCR assay. Conclusion The air sampling and extraction methodology developed in this study should be applicable to the detection of rhinovirus and other airborne viruses in the indoor air of offices and schools. This method, however, cannot distinguish UV inactivated virus from infectious viral particles.

  3. Simultaneous Expression of GUS and Actin Genes by Using the Multiplex RT-PCR and Multiplex Gold Nanoparticle Probes.

    Science.gov (United States)

    Ghazi, Yaser; Vaseghi, Akbar; Ahmadi, Sepideh; Haddadi, Fatemeh

    2018-04-23

    Gene expression analysis is considered to be extremely important in many different biological researches. DNA-based diagnostic test, which contributes to DNA identification, has higher specificity, cost, and speed than some biochemical and molecular methods. In this study, we try to use the novel nano technology approach with Multiplex RT-PCR and Gold nano particular probes (GNPs-probes) in order to get gene expression in Curcumas melons. We used Agrobacterium tumefactions for gene transfer and GUS reporter gene as a reporter. After cDNA synthesis, Multiplex PCR and Multiplex RT-PCR techniques were used. Finally, probes were designed for RNA of GUS and Actin genes, and then the analysis of the gene expression using the probes attached to GNPs was carried out and the color changes in the GNPs were applied. In the following, probes hybridization was checked with DNA between 400 to 700 nm wavelengths and the highest rate was observed in the 550 to 650 nm. The results show that the simultaneous use of GNP-attached detectors and Multiplex RT-PCRcan reduce time and costmore considerably than somelaboratory methods for gene expiration investigation. Additionally, it can be seen thatthere is an increase in sensitivity and specificity of our investigation. Based on our findings, this can bea novel study doneusingMultiplex RT-PCRand unmodified AuNPs for gene transfer and expression detection to plants. We can claim that this assay has a remarkable advantage including rapid, cost-effectiveness, specificity and accuracy to detect transfer and expression genes in plants. Also,we can use this technique from other gene expressionsin many different biology samples.

  4. Application of F⁺RNA Coliphages as Source Tracking Enteric Viruses on Parsley and Leek Using RT-PCR.

    Science.gov (United States)

    Shahrampour, Dina; Yavarmanesh, Masoud; Najafi, Mohammad Bagher Habibi; Mohebbi, Mohebbat

    2015-12-01

    The objective of this study was to identify sources of fecal contamination in leek and parsley, by using four different F(+)RNA coliphage genogroups (IV, I indicate animal fecal contamination and II, III indicate human fecal contamination). Three different concentrations (10(2), 10(4), 10(6) pfu/ml) of MS2 coliphage were inoculated on the surface of parsley and leek samples for detection of phage recovery efficiency among two methods of elution concentration (PEG-precipitation and Ultracentrifugation) by performing double agar layer (DAL) assay in three replications. Highest recovery of MS2 was observed in PEG method and in 10(6) inoculation concentration. Accordingly, the PEG method was used for washing and isolation of potentially contaminated phages of 30 collected samples (15 samples from the market and 15 samples from the farm). The final solutions of PEG method were tested for the enumeration of plaques by DAL assay. Total RNA was then extracted from recovered phages, and RT-PCR was performed by using four primer sets I, II, III, and IV. Incidence of F(+)RNA coliphages was observed in 12/15 (80 %) and 10/15 (66/6 %) of samples were obtained from farm and market, respectively, using both DAL and RT-PCR test methods. Different genotypes (I, II, and IV) of F(+)RNA coliphages were found in farm samples, while only genotype I was detected in market samples by using the primer sets. Due to the higher frequency of genotype I and IV, the absence of genotype III, and also the low frequency of genotype II, it is concluded that the contamination of vegetable (parsley and leek) in Neyshabour, Iran is most likely originated from animal sources.

  5. Real time polymerase chain reaction in diagnosis of chronic myeloid leukemia

    International Nuclear Information System (INIS)

    Tashfeen, S.; Ahmed, S.; Bhatti, F.A.; Ali, N.

    2014-01-01

    Objective: To compare the sensitivity and specificity of Real Time Polymerase Chain Reaction (RT-PCR) with conventional cytogenetics in diagnosis of chronic myeloid leukemia. Study Design: A cross-sectional, analytical study. Place and Duration of Study: The Armed Forces Institute of Pathology (AFIP), Rawalpindi, from December 2010 to January 2012. Methodology: A total number of 40 patients were studied, in which all were diagnosed as CML on peripheral blood and bone marrow aspiration. The subjects were tested for the presence of Philadelphia (Ph) chromosome by cytogenetics and BCR-ABL fusion gene by RT-PCR. 2-3 ml of venous blood was collected, half in sodium heparin (anti-coagulant) for cytogenetics and half in EDTA for PCR. For cytogenetics, cells were cultured for 72 hours in RPMI 1640 medium and examined by arresting in metaphase using Colchicine to identify Philadelphia chromosome. For PCR, RNA extraction was done by Tri Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT- PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of cytogenetics and RT PCR were compared. Results: Out of the 40 patients, PCR showed 37 (92.5%) were positive and 3 (7.5%) were negative for BCR-ABL fusion gene, whereas in cytogenetics 28 (70%) were positive for Ph chromosome and 12 (30%) were negative for Ph chromosome. Sensitivity and specificity of cytogenetics was 75.6% and 100% respectively. Conclusion: Real time PCR as compared to cytogenetics is less tedious, gives quick results, does not require multiple sampling due to culture failure and can be done on peripheral blood. (author)

  6. Comparison of the Diagnostic Value Between Real-Time Reverse Transcription-Polymerase Chain Reaction Assay and Histopathologic Examination in Sentinel Lymph Nodes for Patients With Gastric Carcinoma.

    Science.gov (United States)

    Kwak, Yoonjin; Nam, Soo Kyung; Shin, Eun; Ahn, Sang-Hoon; Lee, Hee Eun; Park, Do Joong; Kim, Woo Ho; Kim, Hyung-Ho; Lee, Hye Seung

    2016-05-01

    Sentinel lymph node (SLN)-based diagnosis in gastric cancers has shown varied sensitivities and false-negative rates in several studies. Application of the reverse transcription-polymerase chain reaction (RT-PCR) in SLN diagnosis has recently been proposed. A total of 155 SLNs from 65 patients with cT1-2, N0 gastric cancer were examined. The histopathologic results were compared with results obtained by real-time RT-PCR for detecting molecular RNA (mRNA) of cytokeratin (CK)19, carcinoembryonic antigen (CEA), and CK20. The sensitivity and specificity of the multiple marker RT-PCR assay standardized against the results of the postoperative histological examination were 0.778 (95% confidence interval [CI], 0.577-0.914) and 0.781 (95% CI, 0.700-0.850), respectively. In comparison, the sensitivity and specificity of intraoperative diagnosis were 0.819 (95% CI, 0.619-0.937) and 1.000 (95% CI, 0.972-1.000), respectively. The positive predictive value of the multiple-marker RT-PCR assay was 0.355 (95% CI, 0.192-0.546) for predicting non-SLN metastasis, which was lower than that of intraoperative diagnosis (0.813, 95% CI, 0.544-0.960). The real-time RT-PCR assay could detect SLN metastasis in gastric cancer. However, the predictive value of the real-time RT-PCR assay was lower than that of precise histopathologic examination and did not outweigh that of our intraoperative SLN diagnosis. © American Society for Clinical Pathology, 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Development of an In-House Multiplex Nested RT-PCR Method for Detecting Acute HIV-1 Infection in High Risk Populations.

    Science.gov (United States)

    Liu, Zhiying; Li, Wei; Xu, Meng; Sheng, Bo; Yang, Zixuan; Jiao, Yanmei; Zhang, Tong; Mou, Danlei; Chen, Dexi; Wu, Hao

    2015-01-01

    The detection of acute HIV infection (AHI) among high risk populations can help reduce secondary transmission of HIV. The nucleic acid testing (NAT) can shorten the test window period by up to 7-12 days. In this study, we describe an in-house NAT based on the multiplex nested RT-PCR method to detect the HIV RNA. We also evaluated it in a high risk cohort in Beijing. Four primer pairs were designed and evaluated for the detection of different HIV-1 subtypes in group M. Multiplex RT-PCR and nested PCR were performed. The sensitivity, specialty, primers compatibility among HIV subtypes were evaluated simultaneously. In an MSM cohort in Beijing during a 3-year period, a total of 11,808 blood samples that were negative by ELISA or indeterminate by Western blot were analyzed by this multiplex nested RT-PCR with pooling strategy. The multiplex nested RT-PCR was successfully applied for the detection of at least six HIV-1 subtypes. The sensitivity was 40 copies/ml and the specificity was 100%. A total of 29 people were tested HIV-1 positive with acute infection in a MSM cohort of Beijing during a 3 years period. This multiplex nested RT-PCR provides a useful tool for the rapid detection of acute HIV-1 infection. When used in combination with the 3(rd) generation ELISA, it can improve the detection rate of HIV infection, especially in the source limited regions.

  8. Improved Volitional Recall of Motor-Imagery-Related Brain Activation Patterns Using Real-Time Functional MRI-Based Neurofeedback.

    Science.gov (United States)

    Bagarinao, Epifanio; Yoshida, Akihiro; Ueno, Mika; Terabe, Kazunori; Kato, Shohei; Isoda, Haruo; Nakai, Toshiharu

    2018-01-01

    Motor imagery (MI), a covert cognitive process where an action is mentally simulated but not actually performed, could be used as an effective neurorehabilitation tool for motor function improvement or recovery. Recent approaches employing brain-computer/brain-machine interfaces to provide online feedback of the MI during rehabilitation training have promising rehabilitation outcomes. In this study, we examined whether participants could volitionally recall MI-related brain activation patterns when guided using neurofeedback (NF) during training. The participants' performance was compared to that without NF. We hypothesized that participants would be able to consistently generate the relevant activation pattern associated with the MI task during training with NF compared to that without NF. To assess activation consistency, we used the performance of classifiers trained to discriminate MI-related brain activation patterns. Our results showed significantly higher predictive values of MI-related activation patterns during training with NF. Additionally, this improvement in the classification performance tends to be associated with the activation of middle temporal gyrus/inferior occipital gyrus, a region associated with visual motion processing, suggesting the importance of performance monitoring during MI task training. Taken together, these findings suggest that the efficacy of MI training, in terms of generating consistent brain activation patterns relevant to the task, can be enhanced by using NF as a mechanism to enable participants to volitionally recall task-related brain activation patterns.

  9. Improved Volitional Recall of Motor-Imagery-Related Brain Activation Patterns Using Real-Time Functional MRI-Based Neurofeedback

    Directory of Open Access Journals (Sweden)

    Epifanio Bagarinao

    2018-04-01

    Full Text Available Motor imagery (MI, a covert cognitive process where an action is mentally simulated but not actually performed, could be used as an effective neurorehabilitation tool for motor function improvement or recovery. Recent approaches employing brain–computer/brain–machine interfaces to provide online feedback of the MI during rehabilitation training have promising rehabilitation outcomes. In this study, we examined whether participants could volitionally recall MI-related brain activation patterns when guided using neurofeedback (NF during training. The participants’ performance was compared to that without NF. We hypothesized that participants would be able to consistently generate the relevant activation pattern associated with the MI task during training with NF compared to that without NF. To assess activation consistency, we used the performance of classifiers trained to discriminate MI-related brain activation patterns. Our results showed significantly higher predictive values of MI-related activation patterns during training with NF. Additionally, this improvement in the classification performance tends to be associated with the activation of middle temporal gyrus/inferior occipital gyrus, a region associated with visual motion processing, suggesting the importance of performance monitoring during MI task training. Taken together, these findings suggest that the efficacy of MI training, in terms of generating consistent brain activation patterns relevant to the task, can be enhanced by using NF as a mechanism to enable participants to volitionally recall task-related brain activation patterns.

  10. Quantification of low-expressed mRNA using 5' LNA-containing real-time PCR primers

    International Nuclear Information System (INIS)

    Malgoyre, A.; Banzet, S.; Mouret, C.; Bigard, A.X.; Peinnequin, A.

    2007-01-01

    Real-time RT-PCR is the most sensitive and accurate method for mRNA quantification. Using specific recombinant DNA as a template, real-time PCR allows accurate quantification within a 7-log range and increased sensitivity below 10 copies. However, when using RT-PCR to quantify mRNA in biological samples, a stochastic off-targeted amplification can occur. Classical adjustments of assay parameters have minimal effects on such amplification. This undesirable amplification appears mostly to be dependent on specific to non-specific target ratio rather than on the absolute quantity of the specific target. This drawback, which decreases assay reliability, mostly appears when quantifying low-expressed transcript in a whole organ. An original primer design using properties of LNA allows to block off-target amplification. 5'-LNA substitution strengthens 5'-hybridization. Consequently on-target hybridization is stabilized and the probability for the off-target to lead to amplification is decreased

  11. Ovation Prime Real-Time

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Ovation Prime Real-Time (OPRT) product is a real-time forecast and nowcast model of auroral power and is an operational implementation of the work by Newell et...

  12. Characterization of mechanisms underlying degradation of sclerotia of Sclerotinia sclerotiorum by Aspergillus aculeatus Asp-4 using a combined qRT-PCR and proteomic approach.

    Science.gov (United States)

    Hu, Xiaojia; Qin, Lu; Roberts, Daniel P; Lakshman, Dilip K; Gong, Yangmin; Maul, Jude E; Xie, Lihua; Yu, Changbing; Li, Yinshui; Hu, Lei; Liao, Xiangsheng; Liao, Xing

    2017-08-31

    The biological control agent Aspergillus aculeatus Asp-4 colonizes and degrades sclerotia of Sclerotinia sclerotiorum resulting in reduced germination and disease caused by this important plant pathogen. Molecular mechanisms of mycoparasites underlying colonization, degradation, and reduction of germination of sclerotia of this and other important plant pathogens remain poorly understood. An RNA-Seq screen of Asp-4 growing on autoclaved, ground sclerotia of S. sclerotiorum for 48 h identified 997 up-regulated and 777 down-regulated genes relative to this mycoparasite growing on potato dextrose agar (PDA) for 48 h. qRT-PCR time course experiments characterized expression dynamics of select genes encoding enzymes functioning in degradation of sclerotial components and management of environmental conditions, including environmental stress. This analysis suggested co-temporal up-regulation of genes functioning in these two processes. Proteomic analysis of Asp-4 growing on this sclerotial material for 48 h identified 26 up-regulated and 6 down-regulated proteins relative to the PDA control. Certain proteins with increased abundance had putative functions in degradation of polymeric components of sclerotia and the mitigation of environmental stress. Our results suggest co-temporal up-regulation of genes involved in degradation of sclerotial compounds and mitigation of environmental stress. This study furthers the analysis of mycoparasitism of sclerotial pathogens by providing the basis for molecular characterization of a previously uncharacterized mycoparasite-sclerotial interaction.

  13. TaqMan探针荧光定量PCR检测花生油中掺入棕榈油的研究%Determination of palm oil adulterated in peanut oil with the TaqMan probe -based RT- PCR method

    Institute of Scientific and Technical Information of China (English)

    周慧; 梁宇斌; 吴苏喜; 李晓明; 裴伟; 杨涛

    2011-01-01

    The method of Real - time fluorescence quantitative polymerase chain reaction ( RT - PCR) with TaqMan fluorescent probe was chosen to fast detect the amount of palm oil mixed in peanut oil. MT3 - B gene of palm was selected as target gene to detect palm oil from peanut oil. The primers of MT3 - B and TaqMan probe were designed, MT3 - B gene reconstructed plasmid was built as absolute quantitative criteria for quantitative RT - PCR to establish standard curve. Peanut oil blended with 1% -40% concentration gradient palm oil was extracted DNA to test palm content by RT - PCR. The result showed that the correlation coefficient (R1) of standard curve with logarithmic linear regression analysis was 0.996. When the adulteration of palm oil in peanut oil reached 5% volume, MT3 - B gene of 17.431 copies per milli-liter of mixed oil could be detected . The method showed good sensitivity, specificity and repeatability.%根据棕榈内源基因MT3 -B设计引物和TaqMan探针,采用基因重组技术构建用于检测棕榈基因MT3 -B的重组质粒作为绝对定量标准品,建立标准曲线,对花生油中掺入棕榈油1% ~40%梯度混合油品提取DNA进行棕榈成分定量检测.结果表明,重组质粒标准品荧光定量标准曲线对数线性回归分析相关系数(R2)为0.996;花生油中掺入棕榈油达到5%时,可检出每亳升混合油品中棕榈MT3 -B基因17.431 copies,检测的重复性和特异性好.

  14. Three Experiments Examining the Use of Electroencephalogram,Event-Related Potentials, and Heart-Rate Variability for Real-Time Human-Centered Adaptive Automation Design

    Science.gov (United States)

    Prinzel, Lawrence J., III; Parasuraman, Raja; Freeman, Frederick G.; Scerbo, Mark W.; Mikulka, Peter J.; Pope, Alan T.

    2003-01-01

    Adaptive automation represents an advanced form of human-centered automation design. The approach to automation provides for real-time and model-based assessments of human-automation interaction, determines whether the human has entered into a hazardous state of awareness and then modulates the task environment to keep the operator in-the-loop , while maintaining an optimal state of task engagement and mental alertness. Because adaptive automation has not matured, numerous challenges remain, including what the criteria are, for determining when adaptive aiding and adaptive function allocation should take place. Human factors experts in the area have suggested a number of measures including the use of psychophysiology. This NASA Technical Paper reports on three experiments that examined the psychophysiological measures of event-related potentials, electroencephalogram, and heart-rate variability for real-time adaptive automation. The results of the experiments confirm the efficacy of these measures for use in both a developmental and operational role for adaptive automation design. The implications of these results and future directions for psychophysiology and human-centered automation design are discussed.

  15. A Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza A and the Novel Influenza A(H1N1 Strain

    Directory of Open Access Journals (Sweden)

    Theo P. Sloots

    2009-12-01

    Full Text Available Timely implementation of antiviral treatment and other public health based responses are dependent on accurate and rapid diagnosis of the novel pandemic influenza A(H1N1 strain. In this study we developed a duplex real-time PCR (RT-PCR (dFLU-TM assay for the simultaneous detection of a broad range of influenza A subtypes and specific detection of the novel H1N1 2009 pandemic strain. The assay was compared to the combined results of two previously described monoplex RT-PCR assays using 183 clinical samples and 10 seasonal influenza A isolates. Overall, the results showed that the dFLU-TM RT-PCR method is suitable for detection of influenza A, including the novel H1N1 pandemic strain, in clinical samples.

  16. Quantitative real-time PCR identifies a critical region of deletion on 22q13 related to prognosis in oral cancer

    DEFF Research Database (Denmark)

    Reis, Patricia P; Rogatto, Silvia R; Kowalski, Luiz P

    2002-01-01

    Quantitative real time PCR was performed on genomic DNA from 40 primary oral carcinomas and the normal adjacent tissues. The target genes ECGFB, DIA1, BIK, and PDGFB and the microsatellite markers D22S274 and D22S277, mapped on 22q13, were selected according to our previous loss of heterozygosity...... findings in head and neck tumors. Quantitative PCR relies on the comparison of the amount of product generated from a target gene and that generated from a disomic reference gene (GAPDH-housekeeping gene). Reactions have been performed with normal control in triplicates, using the 7700 Sequence Detection.......0018) for patients with DIA1 gene loss. Relative copy number losses detected in these sequences may be related to disease progression and a worse prognosis in patients with oral cancer....

  17. Comparison of the performance in detection of HPV infections between the high-risk HPV genotyping real time PCR and the PCR-reverse dot blot assays.

    Science.gov (United States)

    Zhang, Lahong; Dai, Yibei; Chen, Jiahuan; Hong, Liquan; Liu, Yuhua; Ke, Qiang; Chen, Yiwen; Cai, Chengsong; Liu, Xia; Chen, Zhaojun

    2018-01-01

    A new multiplex real-time PCR assay, the high-risk HPV genotyping real time PCR assay (HR HPV RT-PCR), has been developed to detect 15 high-risk HPV types with respective viral loads. In this report, a total of 684 cervical specimens from women diagnosed with vaginitis were assessed by the HR HPV RT-PCR and the PCR reaction and reverse dot blot (PCR-RDB) assays, using a PCR-sequencing method as a reference standard. A total coincidence of 97.7% between the HR HPV RT PCR and the PCR-RDB assays was determined with a Kappa value of 0.953. The HR HPV RT PCR assay had sensitivity, specificity, and concordance rates (accuracy) of 99.7%, 99.7%, and 99.7%, respectively, as confirmed by PCR-sequencing, while the PCR-RDB assay had respective rates of 98.8%, 97.1%, and 98.0%. The overall rate of HPV infection, determined by PCR-sequencing, in women diagnosed with vaginitis was 49.85%, including 36.26% of single infection and 13.6% of multiple infections. The most common infections among the 15 high-risk HPV types in women diagnosed with vaginitis were HPV-52, HPV-16, and HPV-58, with a total detection rate of 10.23%, 7.75%, and 5.85%, respectively. We conclude that the HR HPV RT PCR assay exhibits better clinical performance than the PCR-RDB assay, and is an ideal alternative method for HPV genotyping. In addition, the HR HPV RT PCR assay provides HPV DNA viral loads, and could serve as a quantitative marker in the diagnosis and treatment of single and multiple HPV infections. © 2017 Wiley Periodicals, Inc.

  18. RT-PCR and sequence analysis of the full-length fusion protein of Canine Distemper Virus from domestic dogs.

    Science.gov (United States)

    Romanutti, Carina; Gallo Calderón, Marina; Keller, Leticia; Mattion, Nora; La Torre, José

    2016-02-01

    During 2007-2014, 84 out of 236 (35.6%) samples from domestic dogs submitted to our laboratory for diagnostic purposes were positive for Canine Distemper Virus (CDV), as analyzed by RT-PCR amplification of a fragment of the nucleoprotein gene. Fifty-nine of them (70.2%) were from dogs that had been vaccinated against CDV. The full-length gene encoding the Fusion (F) protein of fifteen isolates was sequenced and compared with that of those of other CDVs, including wild-type and vaccine strains. Phylogenetic analysis using the F gene full-length sequences grouped all the Argentinean CDV strains in the SA2 clade. Sequence identity with the Onderstepoort vaccine strain was 89.0-90.6%, and the highest divergence was found in the 135 amino acids corresponding to the F protein signal-peptide, Fsp (64.4-66.7% identity). In contrast, this region was highly conserved among the local strains (94.1-100% identity). One extra putative N-glycosylation site was identified in the F gene of CDV Argentinean strains with respect to the vaccine strain. The present report is the first to analyze full-length F protein sequences of CDV strains circulating in Argentina, and contributes to the knowledge of molecular epidemiology of CDV, which may help in understanding future disease outbreaks. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Optimization of RT-PCR reactions in studies with genes of lignin biosynthetic route in Saccharum spontaneum

    Directory of Open Access Journals (Sweden)

    JUAN P.P. LLERENA

    Full Text Available ABSTRACT Saccharum spontaneum has been used for the development of energy cane a crop aimed to be used for the production of second-generation ethanol, or lignocellulosic ethanol. Lignin is a main challenge in the conversion of cell wall sugars into ethanol. In our studies to isolate the genes the lignin biosynthesis in S. spontaneum we have had great difficulty in RT-PCR reactions. Thus, we evaluated the effectiveness of different additives in the amplification of these genes. While COMT and CCoAOMT genes did not need any additives for other genes there was no amplification (HCT, F5H, 4CL and CCR or the yield was very low (CAD and C4H. The application of supplementary cDNA was enough to overcome the non-specificity and low yield for C4H and C3H, while the addition of 0.04% BSA + 2% formamide was effective to amplify 4CL, CCR, F5H and CCR. HCT was amplified only by addition of 0.04% BSA + 2% formamide + 0.1 M trehalose and amplification of PAL was possible with addition of 2% of DMSO. Besides optimization of expression assays, the results show that additives can act independently or synergistically.

  20. Assessment of six commercial plasma small RNA isolation kits using qRT-PCR and electrophoretic separation

    DEFF Research Database (Denmark)

    Meerson, Ari; Ploug, Thorkil

    2016-01-01

    of specific miRNAs in different samples varied considerably between the tested extraction methods. Of all kits tested, the QIAGEN miRNeasy kits (Mini and Serum/Plasma kits) and the Macherey-Nagel NucleoSpin kit produced the highest RNA yields. The QIAGEN Exo kit produced lesser yields than what could...... be extracted from the UC fraction using the QIAGEN miRNeasy kits and the Macherey-Nagel NucleoSpin kit. Bioanalyzer results showed an average correlation of R2¼0.8 with endogenous miRNA qRT-PCR results, for sample concentrations >40 pg/ml. The levels of the endogenous miRNAs measured in the two volunteer...... samples were compared with those in a larger group of subjects (n¼10) and found to be typical. Our comparison favors the use of the QIAGEN Serum/Plasma kit and the Macherey-Nagel NucleoSpin kit for plasma miRNA applications. Furthermore, extraction of miRNAs from the UC fraction results in higher yield...

  1. Microarray and RT-PCR screening for white spot syndrome virus immediate-early genes in cycloheximide-treated shrimp

    International Nuclear Information System (INIS)

    Liu Wangjing; Chang Yunshiang; Wang Chunghsiung; Kou, Guang-Hsiung; Lo Chufang

    2005-01-01

    Here, we report for the first time the successful use of cycloheximide (CHX) as an inhibitor to block de novo viral protein synthesis during WSSV (white spot syndrome virus) infection. Sixty candidate IE (immediate-early) genes were identified using a global analysis microarray technique. RT-PCR showed that the genes corresponding to ORF126, ORF242 and ORF418 in the Taiwan isolate were consistently CHX-insensitive, and these genes were designated ie1, ie2 and ie3, respectively. The sequences for these IE genes also appear in the two other WSSV isolates that have been sequenced. Three corresponding ORFs were identified in the China WSSV isolate, but only an ORF corresponding to ie1 was predicted in the Thailand isolate. In a promoter activity assay in Sf9 insect cells using EGFP (enhanced green fluorescence protein) as a reporter, ie1 showed very strong promoter activity, producing higher EGFP signals than the insect Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus (OpMNPV) ie2 promoter

  2. Real time sensor for therapeutic radiation delivery

    International Nuclear Information System (INIS)

    Bliss, M.; Craig, R.A.; Reeder, P.L.

    1998-01-01

    The invention is a real time sensor for therapeutic radiation. A probe is placed in or near the patient that senses in real time the dose at the location of the probe. The strength of the dose is determined by either an insertion or an exit probe. The location is determined by a series of vertical and horizontal sensing elements that gives the operator a real time read out dose location relative to placement of the patient. The increased accuracy prevents serious tissue damage to the patient by preventing overdose or delivery of a dose to a wrong location within the body. 14 figs

  3. Enteroviruses in blood of patients with type 1 diabetes detected by integrated cell culture and reverse transcription quantitative real-time PCR.

    Science.gov (United States)

    Alidjinou, Enagnon Kazali; Sane, Famara; Lefevre, Christine; Baras, Agathe; Moumna, Ilham; Engelmann, Ilka; Vantyghem, Marie-Christine; Hober, Didier

    2017-11-01

    Enteroviruses (EV) have been associated with type 1 diabetes (T1D), but EV RNA detection has been reported in only a small proportion of T1D patients. We studied whether integrated cell culture and reverse transcription real-time PCR could improve EV detection in blood samples from patients with T1D. Blood was collected from 13 patients with T1D. The presence of EV RNA in blood was investigated by using real-time RT-PCR. In addition, plasma and white blood cells (WBC) were inoculated to BGM and Vero cell line cultures. Culture supernatants and cells collected on day 7 and day 14 were tested for EV RNA by real-time RT-PCR. Enterovirus identification was performed through sequencing of the VP4/VP2 region. Enterovirus RNA was detected in blood by using real-time RT-PCR in only one out of 13 patients. The detection of EV RNA in cultures inoculated with clinical samples (plasma and/or WBC) gave positive results in five other patients. The viral loads were low, ranging from 45 to 4420 copies/ng of total RNA. One isolate was successfully identified as coxsackievirus B1. Integrated cell culture and reverse transcription real-time PCR can improve the detection rate of EV in blood samples of patients with T1D and can be useful to investigate further the relationship between EV and the disease.

  4. Tick-borne encephalitis virus-specific RT-PCR - a rapid test for detection of the pathogen without viral RNA purification

    Czech Academy of Sciences Publication Activity Database

    Rudenko, Natalia; Golovchenko, Maryna; Cihlářová, Věra; Grubhoffer, Libor

    2004-01-01

    Roč. 48, č. 3 (2004), s. 167-171 ISSN 0001-723X R&D Projects: GA ČR GA524/03/1326 Institutional research plan: CEZ:AV0Z6022909 Keywords : Ixodes ricinus * tick-borne encephalitis virus * RT-PCR Subject RIV: GJ - Animal Vermins ; Diseases, Veterinary Medicine Impact factor: 0.605, year: 2004

  5. Foot-and-mouth disease virus: A first inter-laboratory comparison trial to evaluate virus isolation and RT-PCR detection methods.

    NARCIS (Netherlands)

    Ferris, N.P.; King, D.P.; Reid, S.M.; Hutchings, G.H.; Shawa, A.E.; Paton, D.J.; Goris, N.; Haas, B.; Hoffmann, B.; Brocchi, E.; Bugnetti, M.; Dekker, A.; Clerq, De K.

    2006-01-01

    Five European reference laboratories participated in an exercise to evaluate the sensitivity and specificity of their routinely employed RT-PCR tests and cell cultures for the detection and isolation of foot-and-mouth disease (FMD) virus. Five identical sets of 20 coded samples were prepared from 10

  6. Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis

    DEFF Research Database (Denmark)

    Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.

    2000-01-01

    A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism a...

  7. Use of a custom RT-PCR array to analyze toxicity pathways at different life stages in Brown Norway Rat Brain following acute Toluene exposure.

    Science.gov (United States)

    To investigate the contribution of different life stages on response to toxicants, we utilized a custom designed RT-PCR array to examine the effects of acute exposure by oral gavage of the volatile organic solvent toluene (0.00, 0.65 or 1.0 glkg) in the brains of ma1e Brown Norwa...

  8. Establishment of a nanoparticle-assisted RT-PCR assay to distinguish field strains and attenuated strains of porcine epidemic diarrhea virus.

    Science.gov (United States)

    Zhu, Yu; Wang, Gui-Hua; Cui, Yu-Dong; Cui, Shang-Jin

    2016-09-01

    Porcine epidemic diarrhea virus (PEDV) can cause serious disease and even death in neonatal piglets, resulting in serious damage to the swine industry worldwide. Open reading frame 3 (ORF3) is the only accessory gene in the PEDV genome. Previous studies have indicated that PEDV vaccine strains have a partial deletion in ORF3. In this study, a nanoparticle-assisted polymerase chain reaction (nanoparticle-assisted RT-PCR) assay targeting the ORF3 of PEDV was developed to distinguish PEDV field strains from attenuated strains by using a specific pair of primers. The PCR products of field strains and attenuated strains were 264 bp and 215 bp in length, respectively. The sensitivity and specificity of this assay were also assessed. The nanoparticle-assisted RT-PCR assay was 10-100 times more sensitive than the conventional RT-PCR assay, with no cross-reactions when amplifying porcine pseudorabies virus (PRV), porcine circovirus type 2 (PCV2), classical swine fever virus (CSFV), porcine parvovirus (PPV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine rotavirus (RV), and porcine transmissible gastroenteritis virus (TGEV). The nanoparticle-assisted RT-PCR assay we describe here can be used to distinguish field strains from vaccine strains of PEDV, and it shows promise for reducing economic loss due to PEDV infection.

  9. The value of molecular expression of KIT and KIT ligand analysed using real-time polymerase chain reaction and immunohistochemistry as a prognostic indicator for canine cutaneous mast cell tumours.

    Science.gov (United States)

    Costa Casagrande, T A; de Oliveira Barros, L M; Fukumasu, H; Cogliati, B; Chaible, L M; Dagli, M L Z; Matera, J M

    2015-03-01

    This study investigated the correlation between KIT gene expression determined by immunohistochemistry and real-time polymerase chain reaction (RT-PCR) and the rate of tumour recurrence and tumour-related deaths in dogs affected with mast cell tumour (MCT). Kaplan-Meier curves were constructed to compare tumour recurrence and tumour-related death between patients. The log-rank test was used to check for significant differences between curves. KIT-I, KIT-II and KIT-III staining patterns were observed in 9 (11.11%), 50 (61.73%) and 22 (27.16%) tumours, respectively. Tumour recurrence rates and tumour-related deaths were not associated with KIT staining patterns (P = 0278, P > 0.05), KIT (P = 0.289, P > 0.05) or KIT ligand (P = 0.106, P > 0.05) gene expression. Despite the lack of association between KIT staining pattern and patient survival time, the results suggest a correlation between aberrant KIT localization and increased proliferative activity of MCTs. RT-PCR seems to be a sensible method for quantitative detection of KIT gene expression in canine MCT, although expressions levels are not correlated with prognosis. © 2013 Blackwell Publishing Ltd.

  10. Dependable Real-Time Systems

    Science.gov (United States)

    1991-09-30

    0196 or 413 545-0720 PI E-mail Address: krithi@nirvan.cs.umass.edu, stankovic(ocs.umass.edu Grant or Contract Title: Dependable Real - Time Systems Grant...Dependable Real - Time Systems " Grant or Contract Number: N00014-85-k-0398 L " Reporting Period: 1 Oct 87 - 30 Sep 91 , 2. Summary of Accomplishments ’ 2.1 Our...in developing a sound approach to scheduling tasks in complex real - time systems , (2) developed a real-time operating system kernel, a preliminary

  11. Evaluation of NGS and RT-PCR Methods for ALK Rearrangement in European NSCLC Patients: Results from the European Thoracic Oncology Platform Lungscape Project.

    Science.gov (United States)

    Letovanec, Igor; Finn, Stephen; Zygoura, Panagiota; Smyth, Paul; Soltermann, Alex; Bubendorf, Lukas; Speel, Ernst-Jan; Marchetti, Antonio; Nonaka, Daisuke; Monkhorst, Kim; Hager, Henrik; Martorell, Miguel; Sejda, Aleksandra; Cheney, Richard; Hernandez-Losa, Javier; Verbeken, Eric; Weder, Walter; Savic, Spasenija; Di Lorito, Alessia; Navarro, Atilio; Felip, Enriqueta; Warth, Arne; Baas, Paul; Meldgaard, Peter; Blackhall, Fiona; Dingemans, Anne-Marie; Dienemann, Hendrik; Dziadziuszko, Rafal; Vansteenkiste, Johan; O'Brien, Cathal; Geiger, Thomas; Sherlock, Jon; Schageman, Jeoffrey; Dafni, Urania; Kammler, Roswitha; Kerr, Keith; Thunnissen, Erik; Stahel, Rolf; Peters, Solange

    2018-03-01

    The reported prevalence of ALK receptor tyrosine kinase gene (ALK) rearrangement in NSCLC ranges from 2% to 7%. The primary standard diagnostic method is fluorescence in situ hybridization (FISH). Recently, immunohistochemistry (IHC) has also proved to be a reproducible and sensitive technique. Reverse-transcriptase polymerase chain reaction (RT-PCR) has also been advocated, and most recently, the advent of targeted next-generation sequencing (NGS) for ALK and other fusions has become possible. This study compares anaplastic lymphoma kinase (ALK) evaluation with all four techniques in resected NSCLC from the large European Thoracic Oncology Platform Lungscape cohort. A total of 96 cases from the European Thoracic Oncology Platform Lungscape iBiobank, with any ALK immunoreactivity were examined by FISH, central RT-PCR, and NGS. An H-score higher than 120 defines IHC positivity. RNA was extracted from the same formalin-fixed, paraffin-embedded tissues. For RT-PCR, primers covered the most frequent ALK translocations. For NGS, the Oncomine Solid Tumour Fusion Transcript Kit (Thermo Fisher Scientific, Waltham, MA) was used. The concordance was assessed using the Cohen κ coefficient (two-sided α ≤ 5%). NGS provided results for 77 of the 95 cases tested (81.1%), whereas RT-PCR provided results for 77 of 96 (80.2%). Concordance occurred in 55 cases of the 60 cases tested with all four methods (43 ALK negative and 12 ALK positive). Using ALK copositivity for IHC and FISH as the criterion standard, we derived a sensitivity for RT-PCR/NGS of 70.0%/85.0%, with a specificity of 87.1%/79.0%. When either RT-PCR or NGS was combined with IHC, the sensitivity remained the same, whereas the specificity increased to 88.7% and 83.9% respectively. NGS evaluation with the Oncomine Solid Tumour Fusion transcript kit and RT-PCR proved to have high sensitivity and specificity, advocating their use in routine practice. For maximal sensitivity and specificity, ALK status should be

  12. Pitfalls in interpretation of CT-values of RT-PCR in children with acute respiratory tract infections.

    Science.gov (United States)

    Wishaupt, Jérôme O; Ploeg, Tjeerd van der; Smeets, Leo C; Groot, Ronald de; Versteegh, Florens G A; Hartwig, Nico G

    2017-05-01

    The relation between viral load and disease severity in childhood acute respiratory tract infections (ARI) is not fully understood. To assess the clinical relevance of the relation between viral load, determined by cycle threshold (CT) value of real-time reverse transcription-polymerase chain reaction assays and disease severity in children with single- and multiple viral ARI. 582 children with ARI were prospectively followed and tested for 15 viruses. Correlations were calculated between CT values and clinical parameters. In single viral ARI, statistically significant correlations were found between viral loads of Respiratory Syncytial Virus (RSV) and hospitalization and between viral loads of Human Coronavirus (HCoV) and a disease severity score. In multiple-viral ARI, statistically significant correlations between viral load and clinical parameters were found. In RSV-Rhinovirus (RV) multiple infections, a low viral load of RV was correlated with a high length of hospital stay and a high duration of extra oxygen use. The mean CT value for RV, HCoV and Parainfluenza virus was significantly lower in single- versus multiple infections. Although correlations between CT values and clinical parameters in patients with single and multiple viral infection were found, the clinical importance of these findings is limited because individual differences in host-, viral and laboratory factors complicate the interpretation of statistically significant findings. In multiple infections, viral load cannot be used to differentiate between disease causing virus and innocent bystanders. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of oral candidiasis and in model biofilms.

    Science.gov (United States)

    Green, Clayton B; Cheng, Georgina; Chandra, Jyotsna; Mukherjee, Pranab; Ghannoum, Mahmoud A; Hoyer, Lois L

    2004-02-01

    An RT-PCR assay was developed to analyse expression patterns of genes in the Candida albicans ALS (agglutinin-like sequence) family. Inoculation of a reconstituted human buccal epithelium (RHE) model of mucocutaneous candidiasis with strain SC5314 showed destruction of the epithelial layer by C. albicans and also formation of an upper fungal layer that had characteristics similar to a biofilm. RT-PCR analysis of total RNA samples extracted from C. albicans-inoculated buccal RHE showed that ALS1, ALS2, ALS3, ALS4, ALS5 and ALS9 were consistently detected over time as destruction of the RHE progressed. Detection of transcripts from ALS7, and particularly from ALS6, was more sporadic, but not associated with a strictly temporal pattern. The expression pattern of ALS genes in C. albicans cultures used to inoculate the RHE was similar to that observed in the RHE model, suggesting that contact of C. albicans with buccal RHE does little to alter ALS gene expression. RT-PCR analysis of RNA samples extracted from model denture and catheter biofilms showed similar gene expression patterns to the buccal RHE specimens. Results from the RT-PCR analysis of biofilm RNA specimens were consistent between various C. albicans strains during biofilm development and were comparable to gene expression patterns in planktonic cells. The RT-PCR assay described here will be useful for analysis of human clinical specimens and samples from other disease models. The method will provide further insight into the role of ALS genes and their encoded proteins in the diverse interactions between C. albicans and its host.

  14. High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

    Science.gov (United States)

    Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

    2018-03-01

    One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  15. Doping-assisted low-pressure photoionization mass spectrometry for the real-time detection of lung cancer-related volatile organic compounds.

    Science.gov (United States)

    Li, Zhen; Xu, Ce; Shu, Jinian; Yang, Bo; Zou, Yao

    2017-04-01

    Real-time detection of lung cancer-related volatile organic compounds (VOCs) is a promising, non-intrusive technique for lung cancer (LC) prescreening. In this study, a novel method was designed to enhance the detection selectivity and sensitivity of LC-related polar VOCs by dichloromethane (CH 2 Cl 2 ) doping-assisted low-pressure photoionization mass spectrometry (LPPI-MS). Compared with conventional LPPI-MS, CH 2 Cl 2 doping-assisted LPPI-MS boosted the peak intensities of n-propanol, n-pentanal, acetone, and butyl acetate in nitrogen specifically by 53, 18, 16, and 43 times, respectively. The signal intensities of their daughter ions were inhibited or reduced. At relative humidity (RH) of 20%, the sensitivities of n-propanol, n-pentanal, acetone, and butyl acetate detection ranged from 116 to 452 counts/ppbv with a detection time of 10s and R 2 >0.99 for the linear calibration curves. The method was also applicable under higher RH levels of 50% and 90%. Breath samples obtained from 10 volunteers and spiked samples were investigated. Eight-fold enhancements in the signal intensities of polar VOCs were observed in the normal and spiked samples. These preliminary results demonstrate the efficacy of the dichloromethane doping-assisted LPPI technique for the detection of LC-related polar VOCs. Further studies are indispensible to illustrating the detailed mechanism and applying the technique to breath diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Factor VIII (F8) inversions in severe hemophilia A: Male germ cell origin and diagnosis with RT-PCR

    Energy Technology Data Exchange (ETDEWEB)

    Antonarakis, S.E. [Geneva Medical School (Switzerland)]|[Johns Hopkins School of Medicine, Baltimore, MD (United States); Rossiter, J.P. [Johns Hopkins School of Medicine, Baltimore, MD (United States); Young, M. [Geneva Medical School (Switzerland)] [and others

    1994-09-01

    The Factor VIII (F8) gene, which is defective in hemophilia A, is located in the most telomeric megabase of Xq. Inversions due to intrachromosomal homologous recombination between mispaired copies of gene A located within intron 22 of the gene and about 500 kb telomeric to it account for nearly half of the cases of severe hemophilia A. We hypothesized that pairing of Xq with its homolog inhibits the inversion process, and that therefore the event originates predominantly in male germ cells. In all 21 informative cases in which the inversion originated in a maternal grandparent, DNA polymorphism analysis using markers within or very closely linked to F8, determined that it occurred in the male germline. In addition, all but one of 56 mothers of sporadic cases due to inversions were carriers. The data indicate that the F8 gene inversions leading to severe hemophilia A occur almost exclusively in male germ cells. The mean age of maternal grandfathers at the birth of their carrier daughters was 29.9 years (13 cases), i.e. not different from the mean paternal age in the general population, supporting the hypothesis that the inversions occur in meiosis. The inversions can be diagnosed by Southern blot analysis. For more rapid diagnosis we have used RT-PCR of RNA ectopically expressed in blood. Oligonucleotides were used to PCR amplify, after the initial RT reaction of RNA samples using random hexamers, either the normal transcript (F8 exons 21 to 24;312 bp product) or the novel abnormal transcript that is generated after the inversion. Both type 1 and 2 inversions can be recognized in affecteds and carriers by the presence of the diagnostic PcR product of 248 bp. Correct diagnoses were made in samples from 6 patients and 2 carriers with type 1 inversions, 2 patients and 2 carriers with type 2 inversions and 5 normal controls.

  17. Result Variation and Efficiency Kinetics in Real-Time PCR

    Directory of Open Access Journals (Sweden)

    Reza Shahsiah

    2010-10-01

    Full Text Available Fluorescent monitoring of DNA amplification is the basis of real-time PCR. Absolute quantification can be achieved using a standard curve method. The standard curve is constructed by amplifying known amounts of standards under identical conditions to that of the samples.The objective of the current study is to propose a mathematical model to assess the acceptability of PCR resulys.Four commercial standards for HCV-RNA (hepatitis C virus RNA along with 6 patient samples were measured by real-time PCR, using two different RT-PCR reagents. The standard deviation of regression (Sy,x was calculated for each group of standard and compared by F-Test. The efficiency kinetics was computed by logistic regression, c2 goodness of fit test was preformed to assess the appropriateness of the efficiency curves.Calculated efficiencies were not significantly different from the value predicted by logistic regression model. Reactions with more variation showed less stable efficiency curves, with wider range of amplification efficiencies.Amplification efficiency kinetics can be computed by fitting a logistic regression curve to the gathered fluorescent data of each reaction. This model can be employed to assess the acceptability of PCR results calculated by standard curve method.

  18. Comparison of microscopy, ELISA, and real-time PCR for detection of Giardia intestinalis in human stool specimens

    Science.gov (United States)

    Beyhan, Yunus Emre; Taş Cengiz, Zeynep

    2017-08-23

    Background/aim: This study included patients who had digestive system complaints between August 2015 and October 2015. The research was designed to compare conventional microscopy with an antigen detection ELISA kit and the TaqMan-based real-time PCR (RT-PCR) technique for detection of Giardia intestinalis in human stool specimens. Materials and methods: Samples were concentrated by formalin-ether sedimentation technique and microscopic examinations were carried out on wet mount slides. A commercially available ELISA kit (Giardia CELISA, Cellabs, Brookvale, Australia) was used for immunoassay. DNA was extracted from fecal samples of about 200 mg using the QIAamp Fast DNA Stool Mini Kit (QIAGEN, Hilden, Germany) and the LightCycler Nano system (Roche Diagnostics, Mannheim, Germany) was used for the TaqMan-based RT-PCR assay. Results: A total of 94 stool samples, 38 of them diagnosed positive (40.4%) and 56 of them diagnosed negative by microscopy, were selected for evaluation by antigen detection and molecular assays. The prevalence of G. intestinalis infection was found as 46.8% (n: 44) and 79.8% (n: 75) by ELISA and RT-PCR, respectively. RT-PCR revealed by far the highest positivity rate compared to the other two methods. The difference between these methods was found to be statistically significant (P PCR, the sensitivity and specificity of microscopy and ELISA were 50.7% and 100% and 53.3% and 79%, respectively. Conclusion: RT-PCR seems to be much more sensitive and beneficial for rapid and accurate diagnosis of G. intestinalis in human stools.

  19. Model documentation for relations between continuous real-time and discrete water-quality constituents in Cheney Reservoir near Cheney, Kansas, 2001--2009

    Science.gov (United States)

    Stone, Mandy L.; Graham, Jennifer L.; Gatotho, Jackline W.

    2013-01-01

    Cheney Reservoir, located in south-central Kansas, is one of the primary water supplies for the city of Wichita, Kansas. The U.S. Geological Survey has operated a continuous real-time water-quality monitoring station in Cheney Reservoir since 2001; continuously measured physicochemical properties include specific conductance, pH, water temperature, dissolved oxygen, turbidity, fluorescence (wavelength range 650 to 700 nanometers; estimate of total chlorophyll), and reservoir elevation. Discrete water-quality samples were collected during 2001 through 2009 and analyzed for sediment, nutrients, taste-and-odor compounds, cyanotoxins, phytoplankton community composition, actinomycetes bacteria, and other water-quality measures. Regression models were developed to establish relations between discretely sampled constituent concentrations and continuously measured physicochemical properties to compute concentrations of constituents that are not easily measured in real time. The water-quality information in this report is important to the city of Wichita because it allows quantification and characterization of potential constituents of concern in Cheney Reservoir. This report updates linear regression models published in 2006 that were based on data collected during 2001 through 2003. The update uses discrete and continuous data collected during May 2001 through December 2009. Updated models to compute dissolved solids, sodium, chloride, and suspended solids were similar to previously published models. However, several other updated models changed substantially from previously published models. In addition to updating relations that were previously developed, models also were developed for four new constituents, including magnesium, dissolved phosphorus, actinomycetes bacteria, and the cyanotoxin microcystin. In addition, a conversion factor of 0.74 was established to convert the Yellow Springs Instruments (YSI) model 6026 turbidity sensor measurements to the newer YSI

  20. Novel real-time polymerase chain reaction assay for simultaneous detection of recurrent fusion genes in acute myeloid leukemia.

    Science.gov (United States)

    Dolz, Sandra; Barragán, Eva; Fuster, Óscar; Llop, Marta; Cervera, José; Such, Esperanza; De Juan, Inmaculada; Palanca, Sarai; Murria, Rosa; Bolufer, Pascual; Luna, Irene; Gómez, Inés; López, María; Ibáñez, Mariam; Sanz, Miguel A

    2013-09-01

    The recent World Health Organization classification recognizes different subtypes of acute myeloid leukemia (AML) according to the presence of several recurrent genetic abnormalities. Detection of these abnormalities and other molecular changes is of increasing interest because it contributes to a refined diagnosis and prognostic assessment in AML and enables monitoring of minimal residual disease. These genetic abnormalities can be detected using single RT-PCR, although the screening is still labor intensive and costly. We have developed a novel real-time RT-PCR assay to simultaneously detect 15 AML-associated rearrangements that is a simple and easily applicable method for use in clinical diagnostic laboratories. This method showed 100% specificity and sensitivity (95% confidence interval, 91% to 100% and 92% to 100%, respectively). The procedure was validated in a series of 105 patients with AML. The method confirmed all translocations detected using standard cytogenetics and fluorescence in situ hybridization and some additional undetected rearrangements. Two patients demonstrated two molecular rearrangements simultaneously, with BCR-ABL1 implicated in both, in addition to RUNX1-MECOM in one patient and PML-RARA in another. In conclusion, this novel real-time RT-PCR assay for simultaneous detection of multiple AML-associated fusion genes is a versatile and sensitive method for reliable screening of recurrent rearrangements in AML. Copyright © 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  1. High abundance of JS-1- and Chloroflexi-related Bacteria in deeply buried marine sediments revealed by quantitative, real-time PCR.

    Science.gov (United States)

    Blazejak, Anna; Schippers, Axel

    2010-05-01

    Sequences of members of the bacterial candidate division JS-1 and the classes Anaerolineae and Caldilineae of the phylum Chloroflexi are frequently found in 16S rRNA gene clone libraries obtained from marine sediments. Using a newly designed quantitative, real-time PCR assay, these bacterial groups were jointly quantified in samples from near-surface and deeply buried marine sediments from the Peru margin, the Black Sea, and a forearc basin off the island of Sumatra. In near-surface sediments, sequences of the JS-1 as well as Anaerolineae- and Caldilineae-related Bacteria were quantified with significantly lower 16S rRNA gene copy numbers than the sequences of total Bacteria. In contrast, in deeply buried sediments below approximately 1 m depth, similar quantities of the 16S rRNA gene copies of these specific groups and Bacteria were found. This finding indicates that JS-1 and Anaerolineae- and Caldilineae-related Bacteria might dominate the bacterial community in deeply buried marine sediments and thus seem to play an important ecological role in the deep biosphere.

  2. Dynamics of Penicillium camemberti growth quantified by real-time PCR on Camembert-type cheeses under different conditions of temperature and relative humidity.

    Science.gov (United States)

    Leclercq-Perlat, Marie-Noëlle; Picque, Daniel; Martin Del Campo Barba, Sandra Teresita; Monnet, Christophe

    2013-06-01

    Penicillium camemberti plays a major role in the flavor and appearance of Camembert-type cheeses. However, little is known about its mycelium growth kinetics during ripening. We monitored the growth of P. camemberti mycelium in Camembert-type cheeses using real-time PCR in 4 ripening runs, performed at 2 temperatures (8 and 16°C) and 2 relative humidities (88 and 98%). These findings were compared with P. camemberti quantification by spore concentration. During the first phase, the mycelium grew but no spores were produced, regardless of the ripening conditions. During the second phase, which began when lactose was depleted, the concentration of spores increased, especially in the cheeses ripened at 16°C. Sporulation was associated with a large decrease in the mycelial concentration in the cheeses ripened at 16°C and 98% relative humidity. It was hypothesized that lactose is the main energy source for the growth of P. camemberti mycelium at the beginning of ripening and that its depletion would trigger stress, resulting in sporulation. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  3. A strain-specific multiplex RT-PCR for Australian rabbit haemorrhagic disease viruses uncovers a new recombinant virus variant in rabbits and hares.

    Science.gov (United States)

    Hall, R N; Mahar, J E; Read, A J; Mourant, R; Piper, M; Huang, N; Strive, T

    2018-04-01

    Rabbit haemorrhagic disease virus (RHDV, or GI.1) is a calicivirus in the genus Lagovirus that has been widely utilized in Australia as a biological control agent for the management of overabundant wild European rabbit (Oryctolagus cuniculus) populations since 1996. Recently, two exotic incursions of pathogenic lagoviruses have been reported in Australia; GI.1a-Aus, previously called RHDVa-Aus, is a GI.1a virus detected in January 2014, and the novel lagovirus GI.2 (previously known as RHDV2). Furthermore, an additional GI.1a strain, GI.1a-K5 (also known as 08Q712), was released nationwide in March 2017 as a supplementary tool for wild rabbit management. To discriminate between these lagoviruses, a highly sensitive strain-specific multiplex RT-PCR assay was developed, which allows fast, cost-effective and sensitive detection of the four pathogenic lagoviruses currently known to be circulating in Australia. In addition, we developed a universal RT-qPCR assay to be used in conjunction with the multiplex assay that broadly detects all four viruses and facilitates quantification of viral RNA load in samples. These assays enable rapid detection, identification and quantification of pathogenic lagoviruses in the Australian context. Using these assays, a novel recombinant lagovirus was detected in rabbit tissue samples, which contained the non-structural genes of GI.1a-Aus and the structural genes of GI.2. This variant was also recovered from the liver of a European brown hare (Lepus europaeus). The impact of this novel recombinant on Australian wild lagomorph populations and its competitiveness in relation to circulating field strains, particularly GI.2, requires further studies. © 2017 Blackwell Verlag GmbH.

  4. Identifying Stable Reference Genes for qRT-PCR Normalisation in Gene Expression Studies of Narrow-Leafed Lupin (Lupinus angustifolius L..

    Directory of Open Access Journals (Sweden)

    Candy M Taylor

    Full Text Available Quantitative Reverse Transcription PCR (qRT-PCR is currently one of the most popular, high-throughput and sensitive technologies available for quantifying gene expression. Its accurate application depends heavily upon normalisation of gene-of-interest data with reference genes that are uniformly expressed under experimental conditions. The aim of this study was to provide the first validation of reference genes for Lupinus angustifolius (narrow-leafed lupin, a significant grain legume crop using a selection of seven genes previously trialed as reference genes for the model legume, Medicago truncatula. In a preliminary evaluation, the seven candidate reference genes were assessed on the basis of primer specificity for their respective targeted region, PCR amplification efficiency, and ability to discriminate between cDNA and gDNA. Following this assessment, expression of the three most promising candidates [Ubiquitin C (UBC, Helicase (HEL, and Polypyrimidine tract-binding protein (PTB] was evaluated using the NormFinder and RefFinder statistical algorithms in two narrow-leafed lupin lines, both with and without vernalisation treatment, and across seven organ types (cotyledons, stem, leaves, shoot apical meristem, flowers, pods and roots encompassing three developmental stages. UBC was consistently identified as the most stable candidate and has sufficiently uniform expression that it may be used as a sole reference gene under the experimental conditions tested here. However, as organ type and developmental stage were associated with greater variability in relative expression, it is recommended using UBC and HEL as a pair to achieve optimal normalisation. These results highlight the importance of rigorously assessing candidate reference genes for each species across a diverse range of organs and developmental stages. With emerging technologies, such as RNAseq, and the completion of valuable transcriptome data sets, it is possible that other

  5. Comparison of IHC, FISH and RT-PCR methods for detection of ALK rearrangements in 312 non-small cell lung cancer patients in Taiwan.

    Science.gov (United States)

    Wu, Yi-Cheng; Chang, Il-Chi; Wang, Chi-Liang; Chen, Tai-Di; Chen, Ya-Ting; Liu, Hui-Ping; Chu, Yen; Chiu, Yu-Ting; Wu, Tzu-Hua; Chou, Li-Hui; Chen, Yi-Rong; Huang, Shiu-Feng

    2013-01-01

    Recently Echinoderm microtubule-associated protein-like 4- anaplastic lymphoma kinase (EML4-ALK) fusion gene has become an important biomarker for ALK tyrosine kinase inhibitor (crizotinib) treatment in NSCLC. However, the best detection method and the significance of EML4-ALK variant types remain uncertain. Reverse transcriptase-polymerase chain reaction (RT-PCR), fluorescence in Situ hybridization (FISH) and Immunohistochemical (IHC) stain were performed on tumor tissues of 312 NSCLC patients for detection of ALK rearrangements. Mutation analyses for EGFR and KRAS genes were also performed. Thirteen of the 312 patients (4.17%) had ALK rearrangements detected by RT-PCR. If RT-PCR data was used as the gold standard, FISH tests had a low sensitivity (58.33%), but very good specificity (99.32%). IHC stain had better sensitivity (91.67%) than FISH, but lower specificity (79.52%), when the cut off was IHC2+. All of the 8 patients with high abundance of EML4-ALK positive cells in tumor tissues (assessed by the signal intensities of the RT-PCR product), were also have high expression of ALK protein (IHC3+), and positive for FISH, except one failed in FISH. Variants 3a+3b (4/5, 80%) of EML4-ALK fusion gene were more common to have high abundance of EML4-ALK positive cells in tumor tissues than variant 1 (1/3, 33.3%). Meta-analysis of the published data of 2273 NSCLC patients revealed that variant 3 (23/44, 52.3%) was the most common type in Chinese population, while variant 1 (28/37, 75.7%) was most common in Caucasian. Among the three detection methods, RT-PCR could detect not only the presence of EML4-ALK fusion gene and their variant types, but also the abundance of EML4-ALK positive cells in NSCLC tumor tissues. The latter two factors might affect the treatment response to anti-ALK inhibitor. Including RT-PCR as a diagnostic test for ALK inhibitor treatment in the prospective clinical trials is recommended.

  6. Comparison of IHC, FISH and RT-PCR methods for detection of ALK rearrangements in 312 non-small cell lung cancer patients in Taiwan.

    Directory of Open Access Journals (Sweden)

    Yi-Cheng Wu

    Full Text Available BACKGROUND: Recently Echinoderm microtubule-associated protein-like 4- anaplastic lymphoma kinase (EML4-ALK fusion gene has become an important biomarker for ALK tyrosine kinase inhibitor (crizotinib treatment in NSCLC. However, the best detection method and the significance of EML4-ALK variant types remain uncertain. METHODS: Reverse transcriptase-polymerase chain reaction (RT-PCR, fluorescence in Situ hybridization (FISH and Immunohistochemical (IHC stain were performed on tumor tissues of 312 NSCLC patients for detection of ALK rearrangements. Mutation analyses for EGFR and KRAS genes were also performed. RESULTS: Thirteen of the 312 patients (4.17% had ALK rearrangements detected by RT-PCR. If RT-PCR data was used as the gold standard, FISH tests had a low sensitivity (58.33%, but very good specificity (99.32%. IHC stain had better sensitivity (91.67% than FISH, but lower specificity (79.52%, when the cut off was IHC2+. All of the 8 patients with high abundance of EML4-ALK positive cells in tumor tissues (assessed by the signal intensities of the RT-PCR product, were also have high expression of ALK protein (IHC3+, and positive for FISH, except one failed in FISH. Variants 3a+3b (4/5, 80% of EML4-ALK fusion gene were more common to have high abundance of EML4-ALK positive cells in tumor tissues than variant 1 (1/3, 33.3%. Meta-analysis of the published data of 2273 NSCLC patients revealed that variant 3 (23/44, 52.3% was the most common type in Chinese population, while variant 1 (28/37, 75.7% was most common in Caucasian. CONCLUSIONS: Among the three detection methods, RT-PCR could detect not only the presence of EML4-ALK fusion gene and their variant types, but also the abundance of EML4-ALK positive cells in NSCLC tumor tissues. The latter two factors might affect the treatment response to anti-ALK inhibitor. Including RT-PCR as a diagnostic test for ALK inhibitor treatment in the prospective clinical trials is recommended.

  7. Technical challenges related to implementation of a formula one real time data acquisition and analysis system in a paediatric intensive care unit.

    Science.gov (United States)

    Matam, B Rajeswari; Duncan, Heather

    2018-06-01

    Most existing, expert monitoring systems do not provide the real time continuous analysis of the monitored physiological data that is necessary to detect transient or combined vital sign indicators nor do they provide long term storage of the data for retrospective analyses. In this paper we examine the feasibility of implementing a long term data storage system which has the ability to incorporate real-time data analytics, the system design, report the main technical issues encountered, the solutions implemented and the statistics of the data recorded. McLaren Electronic Systems expertise used to continually monitor and analyse the data from F1 racing cars in real time was utilised to implement a similar real-time data recording platform system adapted with real time analytics to suit the requirements of the intensive care environment. We encountered many technical (hardware and software) implementation challenges. However there were many advantages of the system once it was operational. They include: (1) The ability to store the data for long periods of time enabling access to historical physiological data. (2) The ability to alter the time axis to contract or expand periods of interest. (3) The ability to store and review ECG morphology retrospectively. (4) Detailed post event (cardiac/respiratory arrest or other clinically significant deteriorations in patients) data can be reviewed clinically as opposed to trend data providing valuable clinical insight. Informed mortality and morbidity reviews can be conducted. (5) Storage of waveform data capture to use for algorithm development for adaptive early warning systems. Recording data from bed-side monitors in intensive care/wards is feasible. It is possible to set up real time data recording and long term storage systems. These systems in future can be improved with additional patient specific metrics which predict the status of a patient thus paving the way for real time predictive monitoring.

  8. Real-time reverse transcription polymerase chain reaction method for detection of Canine distemper virus modified live vaccine shedding for differentiation from infection with wild-type strains.

    Science.gov (United States)

    Wilkes, Rebecca P; Sanchez, Elena; Riley, Matthew C; Kennedy, Melissa A

    2014-01-01

    Canine distemper virus (CDV) remains a common cause of infectious disease in dogs, particularly in high-density housing situations such as shelters. Vaccination of all dogs against CDV is recommended at the time of admission to animal shelters and many use a modified live virus (MLV) vaccine. From a diagnostic standpoint for dogs with suspected CDV infection, this is problematic because highly sensitive diagnostic real-time reverse transcription polymerase chain reaction (RT-PCR) tests are able to detect MLV virus in clinical samples. Real-time PCR can be used to quantitate amount of virus shedding and can differentiate vaccine strains from wild-type strains when shedding is high. However, differentiation by quantitation is not possible in vaccinated animals during acute infection, when shedding is low and could be mistaken for low level vaccine virus shedding. While there are gel-based RT-PCR assays for differentiation of vaccine strains from field strains based on sequence differences, the sensitivity of these assays is unable to match that of the real-time RT-PCR assay currently used in the authors' laboratory. Therefore, a real-time RT-PCR assay was developed that detects CDV MLV vaccine strains and distinguishes them from wild-type strains based on nucleotide sequence differences, rather than the amount of viral RNA in the sample. The test is highly sensitive, with detection of as few as 5 virus genomic copies (corresponding to 10(-1) TCID(50)). Sequencing of the DNA real-time products also allows phylogenetic differentiation of the wild-type strains. This test will aid diagnosis during outbreaks of CDV in recently vaccinated animals.

  9. Examination of issues related to the development and implementation of real-time operational safety monitoring tools in the nuclear power industry

    International Nuclear Information System (INIS)

    Puglia, William J.; Atefi, Bahman

    1995-01-01

    In recent years, risk and reliability techniques have been increasingly used to optimize deterministic requirements and to improve the operational safety of nuclear power stations. This paper discusses the historical development and current status of implementation of real-time operational safety monitoring tools in the nuclear power industry worldwide. A safety monitor is defined as a PC-based risk management tool, based on a plant specific PSA, which can be used to manage plant safety during the day-to-day operation of a nuclear power plant by planning maintenance activities and providing advisory information to plant operational staff in order to avoid high risk plant configurations. As this technique has only been applied in a few plants worldwide, the technology is still evolving and there are several technical and implementation-related issues which still need to be resolved. This paper attempts to summarize all such issues and describe how they have been addressed in several different applications of this technology around the world

  10. A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

    Science.gov (United States)

    Cascini, Fidelia; Passerotti, Stella; Martello, Simona

    2012-04-10

    In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  11. Detection of Brucella abortus DNA in aborted goats and sheep in Egypt by real-time PCR.

    Science.gov (United States)

    Wareth, Gamal; Melzer, Falk; Tomaso, Herbert; Roesler, Uwe; Neubauer, Heinrich

    2015-06-03

    Brucellosis is a major zoonoses affects wide range of domesticated as well as wild animals. Despite the eradication program of brucellosis in Egypt, the disease is still endemic among cattle, buffaloes, sheep, goats, and camels. In the present study, abortion occurred naturally among 25 animals (10 cows, 5 buffaloes, 9 Egyptian Baladi goats and 1 ewe) shared the same pasture were investigated by real-time polymerase chain reaction (RT-PCR). DNA of Brucella (B.) abortus was detected in serum of goats and sheep which has aborted recently by species-specific RT-PCR. The results suggest cross-species infection of B. abortus from cattle to non-preferred hosts raised in close contact. This article will renew our knowledge about the Brucella agent causing abortion in small ruminants in Egypt. Information provided in this study is important for surveillance program, because eradication programs and vaccination strategies may have to be adapted accordingly.

  12. Real-Time Parameter Identification

    Data.gov (United States)

    National Aeronautics and Space Administration — Armstrong researchers have implemented in the control room a technique for estimating in real time the aerodynamic parameters that describe the stability and control...

  13. Evaluation of candidate reference genes for normalization of quantitative RT-PCR in soybean tissues under various abiotic stress conditions.

    Directory of Open Access Journals (Sweden)

    Dung Tien Le

    Full Text Available Quantitative RT-PCR can be a very sensitive and powerful technique for measuring differential gene expression. Changes in gene expression induced by abiotic stresses are complex and multifaceted, which make determining stably expressed genes for data normalization difficult. To identify the most suitable reference genes for abiotic stress studies in soybean, 13 candidate genes collected from literature were evaluated for stability of expression under dehydration, high salinity, cold and ABA (abscisic acid treatments using delta CT and geNorm approaches. Validation of reference genes indicated that the best reference genes are tissue- and stress-dependent. With respect to dehydration treatment, the Fbox/ABC, Fbox/60s gene pairs were found to have the highest expression stability in the root and shoot tissues of soybean seedlings, respectively. Fbox and 60s genes are the most suitable reference genes across dehydrated root and shoot tissues. Under salt stress the ELF1b/IDE and Fbox/ELF1b are the most stably expressed gene pairs in roots and shoots, respectively, while 60s/Fbox is the best gene pair in both tissues. For studying cold stress in roots or shoots, IDE/60s and Fbox/Act27 are good reference gene pairs, respectively. With regard to gene expression analysis under ABA treatment in either roots, shoots or across these tissues, 60s/ELF1b, ELF1b/Fbox and 60s/ELF1b are the most suitable reference genes, respectively. The expression of ELF1b/60s, 60s/Fbox and 60s/Fbox genes was most stable in roots, shoots and both tissues, respectively, under various stresses studied. Among the genes tested, 60s was found to be the best reference gene in different tissues and under various stress conditions. The highly ranked reference genes identified from this study were proved to be capable of detecting subtle differences in expression rates that otherwise would be missed if a less stable reference gene was used.

  14. Prototyping real-time systems

    OpenAIRE

    Clynch, Gary

    1994-01-01

    The traditional software development paradigm, the waterfall life cycle model, is defective when used for developing real-time systems. This thesis puts forward an executable prototyping approach for the development of real-time systems. A prototyping system is proposed which uses ESML (Extended Systems Modelling Language) as a prototype specification language. The prototyping system advocates the translation of non-executable ESML specifications into executable LOOPN (Language of Object ...

  15. Real-time vision systems

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, R.; Hernandez, J.E.; Lu, Shin-yee [Lawrence Livermore National Lab., CA (United States)

    1994-11-15

    Many industrial and defence applications require an ability to make instantaneous decisions based on sensor input of a time varying process. Such systems are referred to as `real-time systems` because they process and act on data as it occurs in time. When a vision sensor is used in a real-time system, the processing demands can be quite substantial, with typical data rates of 10-20 million samples per second. A real-time Machine Vision Laboratory (MVL) was established in FY94 to extend our years of experience in developing computer vision algorithms to include the development and implementation of real-time vision systems. The laboratory is equipped with a variety of hardware components, including Datacube image acquisition and processing boards, a Sun workstation, and several different types of CCD cameras, including monochrome and color area cameras and analog and digital line-scan cameras. The equipment is reconfigurable for prototyping different applications. This facility has been used to support several programs at LLNL, including O Division`s Peacemaker and Deadeye Projects as well as the CRADA with the U.S. Textile Industry, CAFE (Computer Aided Fabric Inspection). To date, we have successfully demonstrated several real-time applications: bullet tracking, stereo tracking and ranging, and web inspection. This work has been documented in the ongoing development of a real-time software library.

  16. Quantitative RT-PCR based platform for rapid quantification of the transcripts of highly homologous multigene families and their members during grain development

    DEFF Research Database (Denmark)

    Kaczmarczyk, Agnieszka Ewa; Bowra, Steve; Elek, Zoltan

    2012-01-01

    expression combined with genetic variation in large multigene families with high homology among the alleles is very challenging. Results We designed a rapid qRT-PCR system with the aim of characterising the variation in the expression of hordein genes families. All the known D-, C-, B-, and gamma......-hordein sequences coding full length open reading frames were collected from commonly available databases. Phylogenetic analysis was performed and the members of the different hordein families were classified into subfamilies. Primer sets were designed to discriminate the gene expression level of whole families...... and its subgroups. More over the results indicate the genotypic specific gene expression. Conclusions Quantitative RT-PCR with SYBR Green labelling can be a useful technique to follow gene expression levels of large gene families with highly homologues members. We showed variation in the temporal...

  17. Design and performance of the CDC real-time reverse transcriptase PCR swine flu panel for detection of 2009 A (H1N1) pandemic influenza virus.

    Science.gov (United States)

    Shu, Bo; Wu, Kai-Hui; Emery, Shannon; Villanueva, Julie; Johnson, Roy; Guthrie, Erica; Berman, LaShondra; Warnes, Christine; Barnes, Nathelia; Klimov, Alexander; Lindstrom, Stephen

    2011-07-01

    Swine influenza viruses (SIV) have been shown to sporadically infect humans and are infrequently identified by the Influenza Division of the Centers for Disease Control and Prevention (CDC) after being received as unsubtypeable influenza A virus samples. Real-time reverse transcriptase PCR (rRT-PCR) procedures for detection and characterization of North American lineage (N. Am) SIV were developed and implemented at CDC for rapid identification of specimens from cases of suspected infections with SIV. These procedures were utilized in April 2009 for detection of human cases of 2009 A (H1N1) pandemic (pdm) influenza virus infection. Based on genetic sequence data derived from the first two viruses investigated, the previously developed rRT-PCR procedures were optimized to create the CDC rRT-PCR Swine Flu Panel for detection of the 2009 A (H1N1) pdm influenza virus. The analytical sensitivity of the CDC rRT-PCR Swine Flu Panel was shown to be 5 copies of RNA per reaction and 10(-1.3 - -0.7) 50% infectious doses (ID(50)) per reaction for cultured viruses. Cross-reactivity was not observed when testing human clinical specimens or cultured viruses that were positive for human seasonal A (H1N1, H3N2) and B influenza viruses. The CDC rRT-PCR Swine Flu Panel was distributed to public health laboratories in the United States and internationally from April 2009 until June 2010. The CDC rRT-PCR Swine Flu Panel served as an effective tool for timely and specific detection of 2009 A (H1N1) pdm influenza viruses and facilitated subsequent public health response implementation.

  18. Diagnostic accuracy of two multiplex real-time polymerase chain reaction assays for the diagnosis of meningitis in children in a resource-limited setting.

    Directory of Open Access Journals (Sweden)

    Jermaine Khumalo

    Full Text Available Accurate etiological diagnosis of meningitis is important, but difficult in resource-limited settings due to prior administration of antibiotics and lack of viral diagnostics. We aimed to develop and validate 2 real-time multiplex PCR (RT-PCR assays for the detection of common causes of community-acquired bacterial and viral meningitis in South African children.We developed 2 multiplex RT- PCRs for detection of S. pneumoniae, N. meningitidis, H. influenzae, enteroviruses, mumps virus and herpes simplex virus. We tested residual CSF samples from children presenting to a local paediatric hospital over a one-year period, whose CSF showed an abnormal cell count. Results were compared with routine diagnostic tests and the final discharge diagnosis. We calculated accuracy of the bacterial RT-PCR assay compared to CSF culture and using World Health Organisation definitions of laboratory-confirmed bacterial meningitis.From 292 samples, bacterial DNA was detected in 12 (4.1% and viral nucleic acids in 94 (32%. Compared to CSF culture, the sensitivity and specificity of the bacterial RT-PCR was 100% and 97.2% with complete agreement in organism identification. None of the cases positive by viral RT-PCR had a bacterial cause confirmed on CSF culture. Only 9/90 (10% of patients diagnosed clinically as bacterial meningitis or partially treated bacterial meningitis tested positive with the bacterial RT-PCR.In this population the use of 2 multiplex RT-PCRs targeting 6 common pathogens gave promising results. If introduced into routine diagnostic testing, these multiplex RT-PCR assays would supplement other diagnostic tests, and have the potential to limit unnecessary antibiotic therapy and hospitalisation.

  19. Comparison of in-house and commercial real time-PCR based carbapenemase gene detection methods in Enterobacteriaceae and non-fermenting gram-negative bacterial isolates.

    Science.gov (United States)

    Smiljanic, M; Kaase, M; Ahmad-Nejad, P; Ghebremedhin, B

    2017-07-10

    Carbapenemase-producing gram-negative bacteria are increasing globally and have been associated with outbreaks in hospital settings. Thus, the accurate detection of these bacteria in infections is mandatory for administering the adequate therapy and infection control measures. This study aimed to establish and evaluate a multiplex real-time PCR assay for the simultaneous detection of carbapenemase gene variants in gram-negative rods and to compare the performance with a commercial RT-PCR assay (Check-Direct CPE). 116 carbapenem-resistant Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumannii isolates were genotyped for carbapenemase genes by PCR and sequencing. The defined isolates were used for the validation of the in-house RT-PCR by use of designed primer pairs and probes. Among the carbapenem-resistant isolates the genes bla KPC , bla VIM , bla NDM or bla OXA were detected. Both RT-PCR assays detected all bla KPC , bla VIM and bla NDM in the isolates. The in-house RT-PCR detected 53 of 67 (79.0%) whereas the commercial assay detected only 29 (43.3%) of the OXA genes. The in-house sufficiently distinguished the most prevalent OXA types (23-like and 48-like) in the melting curve analysis and direct detection of the genes from positive blood culture vials. The Check-Direct CPE and the in-house RT-PCR assay detected the carbapenem resistance from solid culture isolates. Moreover, the in-house assay enabled the identification of carbapenemase genes directly from positive blood-culture vials. However, we observed insufficient detection of various OXA genes in both assays. Nevertheless, the in-house RT-PCR detected the majority of the OXA type genes in Enterobacteriaceae and A. baumannii.

  20. Real-Time Assessment of Fatigue in Patients With Multiple Sclerosis: How Does It Relate to Commonly Used Self-Report Fatigue Questionnaires?

    Science.gov (United States)

    Heine, Martin; van den Akker, Lizanne Eva; Blikman, Lyan; Hoekstra, Trynke; van Munster, Erik; Verschuren, Olaf; Visser-Meily, Anne; Kwakkel, Gert

    2016-11-01

    (1) To assess real-time patterns of fatigue; (2) to assess the association between a real-time fatigue score and 3 commonly used questionnaires (Checklist Individual Strength [CIS] fatigue subscale, Modified Fatigue Impact Scale (MFIS), and Fatigue Severity Scale [FSS]); and (3) to establish factors that confound the association between the real-time fatigue score and the conventional fatigue questionnaires in patients with multiple sclerosis (MS). Cross-sectional study. MS-specialized outpatient facility. Ambulant patients with MS (N=165) experiencing severe self-reported fatigue. Not applicable. A real-time fatigue score was assessed by sending participants 4 text messages on a particular day (How fatigued do you feel at this moment?; score range, 0-10). Latent class growth mixed modeling was used to determine diurnal patterns of fatigue. Regression analyses were used to assess the association between the mean real-time fatigue score and the CIS fatigue subscale, MFIS, and FSS. Significant associations were tested for candidate confounders (eg, disease severity, work status, sleepiness). Four significantly different fatigue profiles were identified by the real-time fatigue score, namely a stable high (n=79), increasing (n=57), stable low (n=16), and decreasing (n=13). The conventional questionnaires correlated poorly (rquestionnaires, ranging from 15.4% to 35%. Perceived fatigue showed 4 different diurnal patterns in patients with MS. Severity of sleepiness is an important confounder to take into account in the assessment of fatigue. Copyright © 2016 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  1. An Evidence-Based Approach to Plum Pox Virus Detection by DASI-ELISA and RT-PCR in Dormant Period

    Directory of Open Access Journals (Sweden)

    Antonio Olmos

    2008-01-01

    Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASIELISA and RT-PCR.

  2. Simultaneous detection and identification of four cherry viruses by two step multiplex RT-PCR with an internal control of plant nad5 mRNA.

    Science.gov (United States)

    Noorani, Md Salik; Awasthi, Prachi; Sharma, Maheshwar Prasad; Ram, Raja; Zaidi, Aijaz Asgar; Hallan, Vipin

    2013-10-01

    A multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed and standardized for the simultaneous detection of four cherry viruses: Cherry virus A (CVA, Genus; Capillovirus), Cherry necrotic rusty mottle virus (CNRMV, unassigned species of the Betaflexiviridae), Little cherry virus 1 (LChV-1, Genus; Closterovirus) and Prunus necrotic ringspot virus (PNRSV, Genus; Ilarvirus) with nad5 as plant internal control. A reliable and quick method for total plant RNA extraction from pome and stone fruit trees was also developed. To minimize primer dimer formation, a single antisense primer for CVA and CNRMV was used. A mixture of random hexamer and oligo (dT) primer was used for cDNA synthesis, which was highly suited and economic for multiplexing. All four viruses were detected successfully by mRT-PCR in artificially created viral RNA mixture and field samples of sweet cherry. The identity of the viruses was confirmed by sequencing. The assay could detect above viruses in diluted cDNA (10(-4)) and RNA (10(-3), except PNRSV which was detected only till ten times lesser dilution). The developed mRT-PCR will not only be useful for the detection of viruses from single or multiple infections of sweet cherry plants but also for other stone and pome fruits. The developed method will be therefore quite helpful for virus indexing, plant quarantine and certification programs. This is the first report for the simultaneous detection of four cherry viruses by mRT-PCR. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Measurement of indicator genes using global complementary DNA (cDNA) amplification, by polyadenylic acid reverse transcriptase polymerase chain reaction (poly A RT-PCR): A feasibility study using paired samples from tissue and ductal juice in patients undergoing pancreatoduodenectomy.

    Science.gov (United States)

    Sanyal, Sudip; Siriwardena, Ajith K; Byers, Richard

    2018-06-01

    The aim of this study is to compare gene expression profiles in RNA isolated from pancreatic ductal juice with the RNA expression profiles of the same genes from matched intra-operative tissue samples from pancreatic tumours. Intra-operative sampling of pancreatic juice and collection of matched tissue samples was undertaken in patients undergoing pancreatoduodenectomy for clinically suspected pancreatic cancer and a precursor lesion, main-duct intraductal papillary mucinous neoplasm. RNA was isolated and Poly A PCR was used to globally amplify the RNA. Real-time polymerase chain reaction (RT-PCR) was used to measure expression levels of 17 genes selected from microarray studies. Spearman's rank correlation test was used to examine the relationship of gene expression between pancreatic juice and tissue. The study was approved by Regional Ethics Committee. Mesothelin (MSLN) showed significant correlation (p cDNA using poly A PCR is technically feasible. Application of the technique to non-invasively obtained pancreatic juice during endoscopic assessment of tumours and the use of gene arrays of cancer indicator genes are the next steps in development of this technique. Copyright © 2018 IAP and EPC. Published by Elsevier B.V. All rights reserved.

  4. On-Orbit Quantitative Real-Time Gene Expression Analysis Using the Wetlab-2 System

    Science.gov (United States)

    Parra, Macarena; Jung, Jimmy; Almeida, Eduardo; Boone, Travis; Tran, Luan; Schonfeld, Julie

    2015-01-01

    NASA Ames Research Center's WetLab-2 Project enables on-orbit quantitative Reverse Transcriptase PCR (qRT-PCR) analysis without the need for sample return. The WetLab-2 system is capable of processing sample types ranging from microbial cultures to animal tissues dissected on-orbit. The project developed a RNA preparation module that can lyse cells and extract RNA of sufficient quality and quantity for use as templates in qRT-PCR reactions. Our protocol has the advantage of using non-toxic chemicals and does not require alcohols or other organics. The resulting RNA is dispensed into reaction tubes that contain all lyophilized reagents needed to perform qRT-PCR reactions. System operations require simple and limited crew actions including syringe pushes, valve turns and pipette dispenses. The project selected the Cepheid SmartCycler (TradeMark), a Commercial-Off-The-Shelf (COTS) qRT-PCR unit, because of its advantages including rugged modular design, low power consumption, rapid thermal ramp times and four-color multiplex detection. Single tube multiplex assays can be used to normalize for RNA concentration and integrity, and to study multiple genes of interest in each module. The WetLab-2 system can downlink data from the ISS to the ground after a completed run and uplink new thermal cycling programs. The ability to conduct qRT-PCR and generate results on-orbit is an important step towards utilizing the ISS as a National Laboratory facility. Specifically, the ability to get on-orbit data will provide investigators with the opportunity to adjust experimental parameters in real time without the need for sample return and re-flight. On orbit gene expression analysis can also eliminate the confounding effects on gene expression of reentry stresses and shock acting on live cells and organisms or the concern of RNA degradation of fixed samples and provide on-orbit gene expression benchmarking prior to sample return. Finally, the system can also be used for analysis of

  5. Evaluation of a multiplex real-time PCR assay for the detection of respiratory viruses in clinical specimens.

    Science.gov (United States)

    Rheem, Insoo; Park, Joowon; Kim, Tae-Hyun; Kim, Jong Wan

    2012-11-01

    In this study, we evaluated the analytical performance and clinical potential of a one-step multiplex real-time PCR assay for the simultaneous detection of 14 types of respiratory viruses using the AdvanSure RV real-time PCR Kit (LG Life Sciences, Korea). Three hundred and twenty clinical specimens were tested with the AdvanSure RV real-time PCR Kit and conventional multiplex reverse transcription (RT)-PCR assay. The assay results were analyzed and the one-step AdvanSure RV real-time PCR Kit was compared with the conventional multiplex RT-PCR assay with respect to the sensitivity and specificity of the detection of respiratory viruses. The limit of detection (LOD) was 1.31 plaque-forming units (PFU)/mL for human rhinoviruses (hRVs), 4.93 PFU/mL for human coronavirus HCoV-229E/NL63, 2.67 PFU/mL for human coronavirus HCoV-OC43, 18.20 PFU/mL for parainfluenza virus 1 (PIV)-1, 24.57 PFU/mL for PIV-2, 1.73 PFU/mL for PIV-3, 1.79 PFU/mL for influenza virus group (Flu) A, 59.51 PFU/mL for FluB, 5.46 PFU/mL for human respiratory syncytial virus (hRSV)-A, 17.23 PFU/mL for hRSV-B, 9.99 PFU/mL for human adenovirus (ADVs). The cross-reactivity test for this assay against 23 types of non-respiratory viruses showed negative results for all viruses tested. The agreement between the one-step AdvanSure multiplex real-time PCR assay and the conventional multiplex RT-PCR assay was 98%. The one-step AdvanSure RV multiplex real-time PCR assay is a simple assay with high potential for specific, rapid and sensitive laboratory diagnosis of respiratory viruses compared to conventional multiplex RT-PCR.

  6. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    Directory of Open Access Journals (Sweden)

    Aline Lavado Tolardo

    2016-06-01

    Full Text Available Vesiculoviruses (VSV are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections.

  7. A rapid silica spin column-based method of RNA extraction from fruit trees for RT-PCR detection of viruses.

    Science.gov (United States)

    Yang, Fan; Wang, Guoping; Xu, Wenxing; Hong, Ni

    2017-09-01

    Efficient recovery of high quality RNA is very important for successful RT-PCR detection of plant RNA viruses. High levels of polyphenols and polysaccharides in plant tissues can irreversibly bind to and/or co-precipitate with RNA, which influences RNA isolation. In this study, a silica spin column-based RNA isolation method was developed by using commercially available silica columns combined with the application of a tissue lysis solution, and binding and washing buffers with high concentration guanidinium thiocyanate (GuSCN, 50% w/v), which helps remove plant proteins, polysaccharides and polyphenolic compounds. The method was successfully used to extract high quality RNA from citrus (Citrus aurantifolia), grapevine (Vitis vinifera), peach (Prunus persica), pear (Pyrus spp.), taro (Colocosia esculenta) and tobacco (Nicotiana benthamiana) samples. The method was comparable to conventional CTAB method in RNA isolation efficiency, but it was more sample-adaptable and cost-effective than commercial kits. High quality RNA isolated using silica spin column-based method was successfully used for the RT-PCR and/or multiplex RT-PCR amplification of woody fruit tree viruses and a viroid. The study provided a useful tool for the detection and characterization of plant viruses. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. The current incidence of viral disease in korean sweet potatoes and development of multiplex rt-PCR assays for simultaneous detection of eight sweet potato viruses.

    Science.gov (United States)

    Kwak, Hae-Ryun; Kim, Mi-Kyeong; Shin, Jun-Chul; Lee, Ye-Ji; Seo, Jang-Kyun; Lee, Hyeong-Un; Jung, Mi-Nam; Kim, Sun-Hyung; Choi, Hong-Soo

    2014-12-01

    Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV) and sweet potato virus C (SPVC) were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1), Sweet potato virus G (SPVG), Sweet potato leaf curl virus (SPLCV), Sweet potato virus 2 ( SPV2), Sweet potato chlorotic fleck virus (SPCFV), and Sweet potato latent virus (SPLV) were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1) in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  9. The Current Incidence of Viral Disease in Korean Sweet Potatoes and Development of Multiplex RT-PCR Assays for Simultaneous Detection of Eight Sweet Potato Viruses

    Directory of Open Access Journals (Sweden)

    Hae-Ryun Kwak

    2014-12-01

    Full Text Available Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV and sweet potato virus C (SPVC were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1, Sweet potato virus G (SPVG, Sweet potato leaf curl virus (SPLCV, Sweet potato virus 2 ( SPV2, Sweet potato chlorotic fleck virus (SPCFV, and Sweet potato latent virus (SPLV were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1 in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  10. Diagnóstico temprano en un brote epidémico del virus Dengue en Piura usando RT-PCR y nested-PCR

    Directory of Open Access Journals (Sweden)

    Oscar Nolasco

    1997-07-01

    Full Text Available Un test de diagnóstico temprano (RT-PCR y Nested-PCR fue evaluado y comparado con métodos convencionales (cultivo in vitro, IFI y MAC-ELISA. Treinta y cuatro sueros de pacientes correspondientes de un brote epidémico de la costa norte peruana (Mancora, Piura en mayo de 1997 fueron incluidos en este estudio. Todos los sueros fueron obtenidos de pacientes que presentaron en los primeros cinco días manifestaciones clínicas siendo diagnosticados luego como dengue serotipo 1. Asimismo, RT-PCR permitió diagnosticar 82% de los sueros (28/34, sin embargo Mac-ELISA y cultivo in vitro reconocieron unicamente 41% de los sueros (14/34 y 38% de los sueros (13/34 respectivamente. Por lo tanto, el uso de esta herramienta molecular (RT-PCR y Nested-PCR permitiró dar un diagnóstico temprano a estos pacientes y actuar inmediatamente ante la presencia de un brote epidémico.

  11. Localisation of Abundant and Organ-Specific Genes Expressed in Rosa hybrida Leaves and Flower Buds by Direct In Situ RT-PCR

    Directory of Open Access Journals (Sweden)

    Agata Jedrzejuk

    2012-01-01

    Full Text Available In situ PCR is a technique that allows specific nucleic acid sequences to be detected in individual cells and tissues. In situ PCR and IS-RT-PCR are elegant techniques that can increase both sensitivity and throughput, but they are, at best, only semiquantitative; therefore, it is desirable first to ascertain the expression pattern by conventional means to establish the suitable conditions for each probe. In plants, in situ RT-PCR is widely used in the expression localisation of specific genes, including MADS-box and other function-specific genes or housekeeping genes in floral buds and other organs. This method is especially useful in small organs or during early developmental stages when the separation of particular parts is impossible. In this paper, we compared three different labelling and immunodetection methods by using in situ RT-PCR in Rosa hybrida flower buds and leaves. As target genes, we used the abundant β-actin and RhFUL gene, which is expressed only in the leaves and petals/sepals of flower buds. We used digoxygenin-11-dUTP, biotin-11-dUTP, and fluorescein-12-dUTP-labelled nucleotides and antidig-AP/ streptavidin-fluorescein-labelled antibodies. All of the used methods gave strong, specific signal and all of them may be used in localization of gene expression on tissue level in rose organs.

  12. [Disappearance of residual disease confirmed by RT-PCR following induction chemotherapy in two hypoplastic leukemia patients with t(8;21)].

    Science.gov (United States)

    Sawada, M; Tsurumi, H; Yamada, T; Hara, T; Oyama, M; Moriwaki, H

    1999-04-01

    Reverse transcriptase-polymerase chain reaction (RT-PCR) methods often detect the AML1/MTG8 fusion transcript even in acute myelogenous leukemia (AML) patients with t(8;21) who have been in long-term remission. We encountered 2 hypoplastic leukemia patients with t(8;21) who achieved cytogenetic remission with short-term conventional chemotherapy. Patient 1 was a 42-year-old woman. Chromosomal analysis detected t(8;21) (q22;q22) and PCR analysis (35 cycles PCR amplification; detection limit 1 x 10(-5) cells) detected the AML1/MTG8 fusion transcript. Complete remission was obtained with 1 course of chemotherapy consisting of low-dose cytarabine (20 mg x 14 days) and etoposide (50 mg x 14 days). After 2 courses of consolidation chemotherapy consisting of conventional-dose cytarabine and mitoxantrone, the RT-PCR findings were negative for the AML1/MTG8 fusion transcript. Patient 2 was a 67-year-old man. Cytogenetic analysis detected t(8;21) (q22;q22), and was positive for the AML1/MTG8 fusion transcript. After 2 courses of induction chemotherapy comprising low-dose cytarabine (20 mg x 14 days) and etoposide (50 mg x 14 days), and 3 courses of conventional consolidation chemotherapy, RT-PCR analysis confirmed the disappearance of the AML1/MTG8 fusion transcript.

  13. A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

    Science.gov (United States)

    Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

    2015-02-01

    A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Detecção do gene da nucleoproteína do vírus da cinomose canina por RT-PCR em urina de cães com sinais clínicos de cinomose Detection of canine distemper virus nucleoprotein gene by RT-PCR in urine of dogs with distemper clinical signs

    Directory of Open Access Journals (Sweden)

    C.M.S. Gebara

    2004-08-01

    Full Text Available A presença do vírus da cinomose canina (CDV foi avaliada pela reação em cadeia da polimerase, precedida de transcrição reversa (RT-PCR, em 87 amostras de urina de cães que apresentavam sinais clínicos sugestivos de cinomose. Os animais foram distribuídos em três grupos. No grupo A foram incluídos 41 cães com alterações sistêmicas; no grupo B, 37 cães com alterações neurológicas; e no grupo C, nove cães com alterações sistêmicas e neurológicas simultâneas. O grupo D (controle foi composto por 20 cães assintomáticos. Os resultados da RT-PCR foram correlacionados com a forma clínica da infecção e com as alterações hematológicas encontradas. Foi possível a amplificação parcial do gene da nucleoproteína do CDV em 41 (47,1% das 87 amostras de urina provenientes de cães com sinais clínicos sugestivos de cinomose. Todas as amostras obtidas de animais assintomáticos foram negativas na RT-PCR. Amostras positivas foram encontradas nos três grupos de animais com sinais clínicos na proporção de 51,2% (24/41, 29% (11/37 e 100% (9/9 para os grupos A, B e C, respectivamente. A leucocitose foi a alteração hematológica mais freqüente nos três grupos de cães com sinais clínicos porém, não foi possível estabelecer correlação entre o resultado da RT-PCR e as alterações hematológicas. Os resultados demonstraram que, independente da forma de apresentação clínica, a técnica da RT-PCR realizada em urina pode ser utilizada no diagnóstico ante mortem da infecção pelo CDV.The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control included 20 assymptomatic dogs. A chi2

  15. Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

    Science.gov (United States)

    Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

    2009-10-01

    Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

  16. Standardization and application of real-time polymerase chain reaction for rapid detection of bluetongue virus

    Directory of Open Access Journals (Sweden)

    I. Karthika Lakshmi

    2018-04-01

    Full Text Available Aim: The present study was designed to standardize real-time polymerase chain reaction (PCR for detecting the bluetongue virus from blood samples of sheep collected during outbreaks of bluetongue disease in the year 2014 in Andhra Pradesh and Telangana states of India. Materials and Methods: A 10-fold serial dilution of Plasmid PUC59 with bluetongue virus (BTV NS3 insert was used to plot the standard curve. BHK-21 and KC cells were used for in vitro propagation of virus BTV-9 at a TCID50/ml of 105 ml and RNA was isolated by the Trizol method. Both reverse transcription -PCR and real-time PCR using TaqMan probe were carried out with RNA extracted from virus-spiked culture medium and blood to compare the sensitivity by means of finding out the limit of detection (LoD. The results were verified by inoculating the detected and undetected dilutions onto cell cultures with further cytological (cytopathic effect and molecular confirmation (by BTV-NS1 group-specific PCR. The standardized technique was then applied to field samples (blood for detecting BTV. Results: The slope of the standard curve obtained was -3.23, and the efficiency was 103%. The LoD with RT-PCR was 8.269Ex103 number of copies of plasmid, whereas it was 13 with real-time PCR for plasmid dilutions. Similarly, LoD was determined for virus-spiked culture medium, and blood with both the types of PCR and the values were 103 TCID 50/ml and 104 TCID 50/ml with RT-PCR and 10° TCID 50/ml and 102 TCID 50/ml with real-time PCR, respectively. The standardized technique was applied to blood samples collected from BTV suspected animals; 10 among 20 samples were found positive with Cq values ranging from 27 to 39. The Cq value exhibiting samples were further processed in cell cultures and were confirmed to be BT positive. Likewise, Cq undetected samples on processing in cell cultures turned out to be BTV negative. Conclusion: Real-time PCR was found to be a very sensitive as well as reliable method

  17. GENE EXPRESSION CHANGES AND ANTI-PROLIFERATIVE EFFECT OF NONI (Morinda citrifolia FRUIT EXTRACT ANALYSED BY REAL TIME-PCR

    Directory of Open Access Journals (Sweden)

    hermansyah hermansyah

    2017-05-01

    Full Text Available To elucidate the anti-proliferative effect of noni (Morinda citrifolia fruit extract for a Saccharomyces cerevisiae model organism, analysis of gene expression changes related to cell cycle associated with inhibition effect of noni fruit extract was carried out. Anti-proliferative of noni fruit extract was analyzed using gene expression changes of Saccharomyces cerevisiae (strains FY833 and BY4741.  Transcriptional analysis of genes that play a role in cell cycle was conducted by growing cells on YPDAde broth medium containing 1% (w/v noni fruit extract, and then subjected using quantitative real-time polymerase chain reaction (RT-PCR.  Transcriptional level of genes CDC6 (Cell Division Cycle-6, CDC20 (Cell Division Cycle-20, FAR1 (Factor ARrest-1, FUS3 (FUSsion-3, SIC1 (Substrate/Subunit Inhibitor of Cyclin-dependent protein kinase-1, WHI5 (WHIskey-5, YOX1 (Yeast homeobOX-1 and YHP1 (Yeast Homeo-Protein-1 increased, oppositely genes expression of DBF4 (DumbBell Forming, MCM1 (Mini Chromosome Maintenance-1 and TAH11 (Topo-A Hypersensitive-11 decreased, while the expression level of genes CDC7 (Cell Division Cycle-7, MBP1 (MIul-box Binding Protein-1 and SWI6 (SWItching deficient-6 relatively unchanged. These results indicated that gene expression changes might associate with anti-proliferative effect from noni fruit extract. These gene expressions changes lead to the growth inhibition of S.cerevisiae cell because of cell cycle defect.

  18. Subtyping of swine influenza viruses using a high-throughput real time PCR platform

    DEFF Research Database (Denmark)

    Goecke, Nicole Bakkegård; Krog, Jesper Schak; Hjulsager, Charlotte Kristiane

    ). The results revealed that the performance of the dynamic chip was similar to conventional real time analysis. Discussion and conclusion. Application of the chip for subtyping of swine influenza has resulted in a significant reduction in time, cost and working hours. Thereby, it is possible to offer diagnostic...... test and subsequent subtyping is performed by real time RT-PCR (RT-qPCR) but several assays are needed to cover the wide range of circulating subtypes which is expensive,resource and time demanding. To mitigate these restrictions the high-throughput qPCR platform BioMark (Fluidigm) has been explored...... services with reduced price and turnover time which will facilitate choice of vaccines and by that lead to reduction of antibiotic used....

  19. Detection of circulating tumor cells with CK20 RT-PCR is an independent negative prognostic marker in colon cancer patients - a prospective study.

    Science.gov (United States)

    Hinz, Sebastian; Hendricks, Alexander; Wittig, Amke; Schafmayer, Clemens; Tepel, Jürgen; Kalthoff, Holger; Becker, Thomas; Röder, Christian

    2017-01-13

    Detection of circulating (CTC) or disseminated tumor cells (DTC) has been associated with negative prognosis and outcome in patients with colorectal cancer, though testing for these cells is not yet part of clinical routine. There are several different methodological approaches to detect tumor cells but standardized detection assays are not implemented so far. In this prospective monocentric study 299 patients with colon cancer were included. CTC and DTC were detected using CK20 RT-PCR as well as immunocytochemistry staining with anti-pan-keratin and anti-EpCAM antibodies. The primary endpoints were: Evaluation of CTC and DTC at the time of surgery and correlation with main tumor characteristics and overall (OS) and disease free survival (DFS). Patients with detectable CTC had a 5-year OS rate of 68% compared to a 5-year OS rate of 85% in patients without detectable CTC in the blood (p = 0.002). Detection of DTC in the bone marrow with CK20 RT-PCR was not associated with a worse OS or DFS. Detection of pan-cytokeratin positive DTC in the bone marrow correlated with a significantly reduced 5-year OS rate (p = 0.048), but detection of DTC in the bone marrow with the anti-EpCAM antibody did not significantly influence the 5-year OS rate (p = 0.958). By multivariate analyses only detection of CTC with CK20 RT-PCR in the blood was revealed to be an independent predictor of worse OS (HR1.94; 95% CI 1.0-3.7; p = 0.04) and DFS (HR 1.94; 95% CI 1.1-3.7; p = 0.044). Detection of CTC with CK20 RT-PCR is a highly specific and independent prognostic marker in colon cancer patients. Detection of DTC in the bone marrow with CK20 RT-PCR or immunohistochemistry with anti-EpCAM antibody is not associated with a negative prognostic influence.

  20. Detection of human papillomavirus by hybrid capture and real time PCR methods in patients with chronic cervicitis and cervical intraepithelial

    Directory of Open Access Journals (Sweden)

    Elisha Khandker

    2016-07-01

    Full Text Available Background and objectives:Cervical cancer due to Human papillomavirus (HPV is one of the leading causes of morbidity and mortality in women. Testing of HPV can identify women who are at risk of cervical cancer. Nowadays, molecular methods like real time polymerase chain reaction (PCR and hybrid capture technique are applied for detecting HPV in cervical specimens. The objective of the present study was to determine the rate of HPV infection in women with chronic cervicitis and cervical intraepithelial neoplasia (CIN by a commercial real time polymerase chain reaction test kit and by a hybrid capture HPV DNA test. Methods:Women aged between 20 to 55 years with chronic cervicitis and CIN were enrolled in the study after obtaining informed consent. Cervical specimen was collected by using cervical brush and stored in transport medium until used. HPV was detected by High Risk Screen Real-TM Quant 2x (Sacace, Biotechnologies SrI, Italy real time PCR kit (HR RT-PCR and by Hybrid Capture-2 High-Risk HPV DNA (Hc-2; Digene Corporation, USA test. Results: Total 72 women with chronic cervicitis and CIN of different grades were included in the study. Out of this, HPV infection detected by HR RT-PCR was 31 (43% and by Hc-2 was 14 (19.4%. Both the tests were able to detect HPV infection in all the CIN 3 cases and in most of the CIN 2 cases. However, HR RT-PCR detected higher number of HPV in chronic cervicitis and CIN1 cases. Conclusion:The study has shown that HR RT-PCR and Hc-2 tests are equally effective in detecting HPV infection in patients with CIN 2 and CIN 3 lesions. However, HR RT-PCR is more sensitive test for detecting HPV in chronic cervicitis and early CIN lesions and, therefore can be used in epidemiological study to detect presence of HPV in general population. IMC J Med Sci 2016; 10(2: 45-48

  1. Evaluation and optimization of SYBR Green real-time reverse transcription polymerase chain reaction as a tool for diagnosis of the Flavivirus genus in Brazil

    Directory of Open Access Journals (Sweden)

    Marilia Farignoli Romeiro

    2016-06-01

    Full Text Available Abstract: INTRODUCTION: The genus Flavivirus includes several pathogenic species that cause severe illness in humans. Therefore, a rapid and accurate molecular method for diagnosis and surveillance of these viruses would be of great importance. Here, we evaluate and optimize a quantitative real-time reverse transcription polymerase chain reaction (RT-PCR method for the diagnosis of the Flavivirus genus. METHODS: We evaluated different commercial kits that use the SYBR Green system for real-time RT-PCR with a primer set that amplifies a fragment of the NS5 flavivirus gene. The specificity and sensitivity of the assay were tested using twelve flaviviruses and ribonucleic acid (RNA transcribed from the yellow fever virus. Additionally, this assay was evaluated using the sera of 410 patients from different regions of Brazil with acute febrile illness and a negative diagnosis for the dengue virus. RESULTS: The real-time RT-PCR amplified all flaviviruses tested at a melting temperature of 79.92 to 83.49°C. A detection limit of 100 copies per ml was determined for this assay. Surprisingly, we detected dengue virus in 4.1% (17/410 of samples from patients with febrile illness and a supposedly negative dengue infection diagnosis. The viral load in patients ranged from 2.1×107to 3.4×103copies per ml. CONCLUSIONS: The real-time RT-PCR method may be very useful for preliminary diagnoses in screenings, outbreaks, and other surveillance studies. Moreover, this assay can be easily applied to monitor viral activity and to measure viral load in pathogenesis studies.

  2. Towards Real-Time Argumentation

    Directory of Open Access Journals (Sweden)

    Vicente JULIÁN

    2016-07-01

    Full Text Available In this paper, we deal with the problem of real-time coordination with the more general approach of reaching real-time agreements in MAS. Concretely, this work proposes a real-time argumentation framework in an attempt to provide agents with the ability of engaging in argumentative dialogues and come with a solution for their underlying agreement process within a bounded period of time. The framework has been implemented and evaluated in the domain of a customer support application. Concretely, we consider a society of agents that act on behalf of a group of technicians that must solve problems in a Technology Management Centre (TMC within a bounded time. This centre controls every process implicated in the provision of technological and customer support services to private or public organisations by means of a call centre. The contract signed between the TCM and the customer establishes penalties if the specified time is exceeded.

  3. Testing of real-time-software

    International Nuclear Information System (INIS)

    Friesland, G.; Ovenhausen, H.

    1975-05-01

    The situation in the area of testing real-time-software is unsatisfactory. During the first phase of the project PROMOTE (prozessorientiertes Modul- und Gesamttestsystem) an analysis of the momentary situation took place, results of which are summarized in the following study about some user interviews and an analysis of relevant literature. 22 users (industry, software-houses, hardware-manufacturers, and institutes) have been interviewed. Discussions were held about reliability of real-time software with special interest to error avoidance, testing, and debugging. Main aims of the analysis of the literature were elaboration of standard terms, comparison of existing test methods and -systems, and the definition of boundaries to related areas. During the further steps of this project some means and techniques will be worked out to systematically test real-time software. (orig.) [de

  4. Failure analysis of real-time systems

    International Nuclear Information System (INIS)

    Jalashgar, A.; Stoelen, K.

    1998-01-01

    This paper highlights essential aspects of real-time software systems that are strongly related to the failures and their course of propagation. The significant influence of means-oriented and goal-oriented system views in the description, understanding and analysing of those aspects is elaborated. The importance of performing failure analysis prior to reliability analysis of real-time systems is equally addressed. Problems of software reliability growth models taking the properties of such systems into account are discussed. Finally, the paper presents a preliminary study of a goal-oriented approach to model the static and dynamic characteristics of real-time systems, so that the corresponding analysis can be based on a more descriptive and informative picture of failures, their effects and the possibility of their occurrence. (author)

  5. Axial Tomography from Digitized Real Time Radiography

    Science.gov (United States)

    Zolnay, A. S.; McDonald, W. M.; Doupont, P. A.; McKinney, R. L.; Lee, M. M.

    1985-01-18

    Axial tomography from digitized real time radiographs provides a useful tool for industrial radiography and tomography. The components of this system are: x-ray source, image intensifier, video camera, video line extractor and digitizer, data storage and reconstruction computers. With this system it is possible to view a two dimensional x-ray image in real time at each angle of rotation and select the tomography plane of interest by choosing which video line to digitize. The digitization of a video line requires less than a second making data acquisition relatively short. Further improvements on this system are planned and initial results are reported.

  6. Relations between continuous real-time turbidity data and discrete suspended-sediment concentration samples in the Neosho and Cottonwood Rivers, east-central Kansas, 2009-2012

    Science.gov (United States)

    Foster, Guy M.

    2014-01-01

    The Neosho River and its primary tributary, the Cottonwood River, are the primary sources of inflow to the John Redmond Reservoir in east-central Kansas. Sedimentation rate in the John Redmond Reservoir was estimated as 743 acre-feet per year for 1964–2006. This estimated sedimentation rate is more than 80 percent larger than the projected design sedimentation rate of 404 acre-feet per year, and resulted in a loss of 40 percent of the conservation pool since its construction in 1964. To reduce sediment input into the reservoir, the Kansas Water Office implemented stream bank stabilization techniques along an 8.3 mile reach of the Neosho River during 2010 through 2011. The U.S. Geological Survey, in cooperation with the Kansas Water Office and funded in part through the Kansas State Water Plan Fund, operated continuous real-time water-quality monitors upstream and downstream from stream bank stabilization efforts before, during, and after construction. Continuously measured water-quality properties include streamflow, specific conductance, water temperature, and turbidity. Discrete sediment samples were collected from June 2009 through September 2012 and analyzed for suspended-sediment concentration (SSC), percentage of sediments less than 63 micrometers (sand-fine break), and loss of material on ignition (analogous to amount of organic matter). Regression models were developed to establish relations between discretely measured SSC samples, and turbidity or streamflow to estimate continuously SSC. Continuous water-quality monitors represented between 96 and 99 percent of the cross-sectional variability for turbidity, and had slopes between 0.91 and 0.98. Because consistent bias was not observed, values from continuous water-quality monitors were considered representative of stream conditions. On average, turbidity-based SSC models explained 96 percent of the variance in SSC. Streamflow-based regressions explained 53 to 60 percent of the variance. Mean squared

  7. Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs.

    Science.gov (United States)

    Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W

    2014-09-01

    Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We

  8. Evaluating viral interference between Influenza virus and Newcastle disease virus using real-time reverse transcription–polymerase chain reaction in chicken eggs

    Directory of Open Access Journals (Sweden)

    Ge Shengqiang

    2012-07-01

    Full Text Available Abstract Background Simultaneous and sequential allantoic cavity inoculations of Specific-pathogen-free (SPF chicken eggs with Influenza virus (AIV and Newcastle disease virus (NDV demonstrated that the interaction of AIV and NDV during co-infection was variable. Our research revisited the replication interference potential of AIV and NDV using real-time reverse transcription–polymerase chain reaction (real-time RT-PCR for AIV and NDV to specifically detect the viral genomes in mixed infections. Results Data from this survey showed that when different doses of NDV (Lasota or F48E8 and AIV (F98 or H5N1 were simultaneously inoculated into embryonating chicken eggs (ECE, interference with the growth of NDV occurred, while interference with the growth of AIV did not occur. When equal amount of the two viruses were sequentially employed, the degree of interference was dependent upon the time of superinfection and the virulence of virus. Conclusion AIV have a negative impact on NDV growth if they are inoculated simultaneously or sequentially and that the degree of interference depended upon the quantity and relative virulence of the virus strains used; however, interference with AIV was not observed. Only if NDV were inoculated at an earlier time will NDV able to interfere with the growth of AIV.

  9. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    Directory of Open Access Journals (Sweden)

    Meng Shuang

    2010-06-01

    Full Text Available Abstract Background The hepatitis C virus (HCV genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM, at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP/COBAS TaqMan (CTM assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection.

  10. Emotion Regulation Training for Treating Warfighters with Combat-Related PTSD Using Real-Time fMRI and EEG-Assisted Neurofeedback

    Science.gov (United States)

    2015-10-01

    art research aims to test ways to modulate the functions of the emotion circuit implicated in PTSD. We utilize the recent advances in real-time...Toronto Alexithymia Scale, ECS=Emotional Contagion Scale, BIS/BAS=Behavioral Inhibition System/Behavior Avoidance System, WASI= Wechsler Abbreviated...fMRI percent signal change maps were spatially smoothed using a Gaussian kernel with full width at h