WorldWideScience

Sample records for relationships phylogenetic analysis

  1. Multigene analysis of lophophorate and chaetognath phylogenetic relationships.

    Science.gov (United States)

    Helmkampf, Martin; Bruchhaus, Iris; Hausdorf, Bernhard

    2008-01-01

    Maximum likelihood and Bayesian inference analyses of seven concatenated fragments of nuclear-encoded housekeeping genes indicate that Lophotrochozoa is monophyletic, i.e., the lophophorate groups Bryozoa, Brachiopoda and Phoronida are more closely related to molluscs and annelids than to Deuterostomia or Ecdysozoa. Lophophorates themselves, however, form a polyphyletic assemblage. The hypotheses that they are monophyletic and more closely allied to Deuterostomia than to Protostomia can be ruled out with both the approximately unbiased test and the expected likelihood weights test. The existence of Phoronozoa, a putative clade including Brachiopoda and Phoronida, has also been rejected. According to our analyses, phoronids instead share a more recent common ancestor with bryozoans than with brachiopods. Platyhelminthes is the sister group of Lophotrochozoa. Together these two constitute Spiralia. Although Chaetognatha appears as the sister group of Priapulida within Ecdysozoa in our analyses, alternative hypothesis concerning chaetognath relationships could not be rejected.

  2. PHYLOGENETIC RELATIONSHIPS AMONGST 10 Durio SPECIES BASED ON PCR-RFLP ANALYSIS OF TWO CHLOROPLAST GENES

    Directory of Open Access Journals (Sweden)

    Panca J. Santoso

    2013-07-01

    Full Text Available Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.

  3. Analysis of plasmid genes by phylogenetic profiling and visualization of homology relationships using Blast2Network

    Directory of Open Access Journals (Sweden)

    Bazzicalupo Marco

    2008-12-01

    Full Text Available Abstract Background Phylogenetic methods are well-established bioinformatic tools for sequence analysis, allowing to describe the non-independencies of sequences because of their common ancestor. However, the evolutionary profiles of bacterial genes are often complicated by hidden paralogy and extensive and/or (multiple horizontal gene transfer (HGT events which make bifurcating trees often inappropriate. In this context, plasmid sequences are paradigms of network-like relationships characterizing the evolution of prokaryotes. Actually, they can be transferred among different organisms allowing the dissemination of novel functions, thus playing a pivotal role in prokaryotic evolution. However, the study of their evolutionary dynamics is complicated by the absence of universally shared genes, a prerequisite for phylogenetic analyses. Results To overcome such limitations we developed a bioinformatic package, named Blast2Network (B2N, allowing the automatic phylogenetic profiling and the visualization of homology relationships in a large number of plasmid sequences. The software was applied to the study of 47 completely sequenced plasmids coming from Escherichia, Salmonella and Shigella spps. Conclusion The tools implemented by B2N allow to describe and visualize in a new way some of the evolutionary features of plasmid molecules of Enterobacteriaceae; in particular it helped to shed some light on the complex history of Escherichia, Salmonella and Shigella plasmids and to focus on possible roles of unannotated proteins. The proposed methodology is general enough to be used for comparative genomic analyses of bacteria.

  4. Mitochondrial DNA genomes organization and phylogenetic relationships analysis of eight anemonefishes (pomacentridae: amphiprioninae.

    Directory of Open Access Journals (Sweden)

    Jianlong Li

    Full Text Available Anemonefishes (Pomacentridae Amphiprioninae are a group of 30 valid coral reef fish species with their phylogenetic relationships still under debate. The eight available mitogenomes of anemonefishes were used to reconstruct the molecular phylogenetic tree; six were obtained from this study (Amphiprion clarkii, A. frenatus, A. percula, A. perideraion, A. polymnus and Premnas biaculeatus and two from GenBank (A. bicinctus and A. ocellaris. The seven Amphiprion species represent all four subgenera and P. biaculeatus is the only species from Premnas. The eight mitogenomes of anemonefishes encoded 13 protein-coding genes, two rRNA genes, 22 tRNA genes and two main non-coding regions, with the gene arrangement and translation direction basically identical to other typical vertebrate mitogenomes. Among the 13 protein-coding genes, A. ocellaris (AP006017 and A. percula (KJ174497 had the same length in ND5 with 1,866 bp, which were three nucleotides less than the other six anemonefishes. Both structures of ND5, however, could translate to amino acid successfully. Only four mitogenomes had the tandem repeats in D-loop; the tandem repeats were located in downstream after Conserved Sequence Block rather than the upstream and repeated in a simply way. The phylogenetic utility was tested with Bayesian and Maximum Likelihood methods using all 13 protein-coding genes. The results strongly supported that the subfamily Amphiprioninae was monophyletic and P. biaculeatus should be assigned to the genus Amphiprion. Premnas biaculeatus with the percula complex were revealed to be the ancient anemonefish species. The tree forms of ND1, COIII, ND4, Cytb, Cytb+12S rRNA, Cytb+COI and Cytb+COI+12S rRNA were similar to that 13 protein-coding genes, therefore, we suggested that the suitable single mitochondrial gene for phylogenetic analysis of anemonefishes maybe Cytb. Additional mitogenomes of anemonefishes with a combination of nuclear markers will be useful to

  5. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    NIRAJ SINGH

    for phylogenetic analysis of Gladiolus and related taxa using combined datasets from chloroplast genome. The psbA–trnH ... phylogenetic relationships among cultivars could be useful for hybridization programmes for further improvement of the crop. [Singh N. ... breeding in nature, and exhibited diverse pollination mech-.

  6. Molecular cytogenetic (FISH and genome analysis of diploid wheatgrasses and their phylogenetic relationship.

    Directory of Open Access Journals (Sweden)

    Gabriella Linc

    Full Text Available This paper reports detailed FISH-based karyotypes for three diploid wheatgrass species Agropyron cristatum (L. Beauv., Thinopyrum bessarabicum (Savul.&Rayss A. Löve, Pseudoroegneria spicata (Pursh A. Löve, the supposed ancestors of hexaploid Thinopyrum intermedium (Host Barkworth & D.R.Dewey, compiled using DNA repeats and comparative genome analysis based on COS markers. Fluorescence in situ hybridization (FISH with repetitive DNA probes proved suitable for the identification of individual chromosomes in the diploid JJ, StSt and PP genomes. Of the seven microsatellite markers tested only the (GAAn trinucleotide sequence was appropriate for use as a single chromosome marker for the P. spicata AS chromosome. Based on COS marker analysis, the phylogenetic relationship between diploid wheatgrasses and the hexaploid bread wheat genomes was established. These findings confirmed that the J and E genomes are in neighbouring clusters.

  7. Phylogenetic diversity and relationships among species of genus ...

    African Journals Online (AJOL)

    Fifty six Nicotiana species were used to construct phylogenetic trees and to asses the genetic relationships between them. Genetic distances estimated from RAPD analysis was used to construct phylogenetic trees using Phylogenetic Inference Package (PHYLIP). Since phylogenetic relationships estimated for closely ...

  8. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

    Science.gov (United States)

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

    1990-01-01

    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  9. A phylogenetic analysis of normal modes evolution in enzymes and its relationship to enzyme function.

    Science.gov (United States)

    Lai, Jason; Jin, Jing; Kubelka, Jan; Liberles, David A

    2012-09-21

    Since the dynamic nature of protein structures is essential for enzymatic function, it is expected that functional evolution can be inferred from the changes in protein dynamics. However, dynamics can also diverge neutrally with sequence substitution between enzymes without changes of function. In this study, a phylogenetic approach is implemented to explore the relationship between enzyme dynamics and function through evolutionary history. Protein dynamics are described by normal mode analysis based on a simplified harmonic potential force field applied to the reduced C(α) representation of the protein structure while enzymatic function is described by Enzyme Commission numbers. Similarity of the binding pocket dynamics at each branch of the protein family's phylogeny was analyzed in two ways: (1) explicitly by quantifying the normal mode overlap calculated for the reconstructed ancestral proteins at each end and (2) implicitly using a diffusion model to obtain the reconstructed lineage-specific changes in the normal modes. Both explicit and implicit ancestral reconstruction identified generally faster rates of change in dynamics compared with the expected change from neutral evolution at the branches of potential functional divergences for the α-amylase, D-isomer-specific 2-hydroxyacid dehydrogenase, and copper-containing amine oxidase protein families. Normal mode analysis added additional information over just comparing the RMSD of static structures. However, the branch-specific changes were not statistically significant compared to background function-independent neutral rates of change of dynamic properties and blind application of the analysis would not enable prediction of changes in enzyme specificity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Molecular characterization and phylogenetic relationships among ...

    African Journals Online (AJOL)

    Molecular characterization and phylogenetic relationships among and within species of Phalaenopsis (Epidendroideae: Orchidaceae) based on RAPD analysis. ... Ph. parishii, Ph. labbi nepal, Ph. speciosa, Ph. lobbi yellow, Ph. venosa, Ph. hieroglyphica, and Ph. maculata; the third group consisted of Ph. minho princess, ...

  11. AFLP analysis of genetic diversity and phylogenetic relationships of Brassica oleracea in Ireland.

    Science.gov (United States)

    El-Esawi, Mohamed A; Germaine, Kieran; Bourke, Paula; Malone, Renee

    2016-01-01

    Brassica oleracea L. is one of the most economically important vegetable crop species of the genus Brassica L. This species is threatened in Ireland, without any prior reported genetic studies. The use of this species is being very limited due to its imprecise phylogeny and uncompleted genetic characterisation. The main objective of this study was to assess the genetic diversity and phylogenetic relationships of a set of 25 Irish B. oleracea accessions using the powerful amplified fragment length polymorphism (AFLP) technique. A total of 471 fragments were scored across all the 11 AFLP primer sets used, out of which 423 (89.8%) were polymorphic and could differentiate the accessions analysed. The dendrogram showed that cauliflowers were more closely related to cabbages than kales were, and accessions of some cabbage types were distributed among different clusters within cabbage subgroups. Approximately 33.7% of the total genetic variation was found among accessions, and 66.3% of the variation resided within accessions. The total genetic diversity (HT) and the intra-accessional genetic diversity (HS) were 0.251 and 0.156, respectively. This high level of variation demonstrates that the Irish B. oleracea accessions studied should be managed and conserved for future utilisation and exploitation in food and agriculture. In conclusion, this study addressed important phylogenetic questions within this species, and provided a new insight into the inclusion of four accessions of cabbages and kales in future breeding programs for improving varieties. AFLP markers were efficient for assessing genetic diversity and phylogenetic relationships in Irish B. oleracea species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  12. Comparative analysis of DNA polymorphisms and phylogenetic relationships among Syzygium cumini Skeels based on phenotypic characters and RAPD technique.

    Science.gov (United States)

    Singh, Jitendra P; Singh, Ak; Bajpai, Anju; Ahmad, Iffat Zareen

    2014-01-01

    The Indian black berry (Syzygium cumini Skeels) has a great nutraceutical and medicinal properties. As in other fruit crops, the fruit characteristics are important attributes for differentiation were also determined for different accessions of S. cumini. The fruit weight, length, breadth, length: breadth ratio, pulp weight, pulp content, seed weight and pulp: seed ratio significantly varied in different accessions. Molecular characterization was carried out using PCR based RAPD technique. Out of 80 RAPD primers, only 18 primers produced stable polymorphisms that were used to examine the phylogenetic relationship. A sum of 207 loci were generated out of which 201 loci found polymorphic. The average genetic dissimilarity was 97 per cent among jamun accessions. The phylogenetic relationship was also determined by principal coordinates analysis (PCoA) that explained 46.95 per cent cumulative variance. The two-dimensional PCoA analysis showed grouping of the different accessions that were plotted into four sub-plots, representing clustering of accessions. The UPGMA (r = 0.967) and NJ (r = 0.987) dendrogram constructed based on the dissimilarity matrix revealed a good degree of fit with the cophenetic correlation value. The dendrogram grouped the accessions into three main clusters according to their eco-geographical regions which given useful insight into their phylogenetic relationships.

  13. Genome-wide analysis of SINA family in plants and their phylogenetic relationships.

    Science.gov (United States)

    Wang, Meng; Jin, Ying; Fu, Junjie; Zhu, Yun; Zheng, Jun; Hu, Jian; Wang, Guoying

    2008-06-01

    SINA genes in plants are part of a multigene family with 5 members in Arabidopsis thaliana, 10 members in Populus trichocarpa, 6 members in Oryza sativa, at least 6 members in Zea mays and at least 1 member in Physcomitrella patens. Six members in maize were confirmed by RT-PCR. All SINAs have one RING domain and one SINA domain. These two domains are highly conserved in plants. According to the motif organization and phylogenetic tree, SINA family members were divided into 2 groups. In addition, through semi-quantitative RT-PCR analysis of maize members and Digital Northern analysis of Arabidopsis and rice members, we found that the tissue expression patterns are more diverse in monocot than in Arabidopsis.

  14. Genetic variation and phylogenetic relationship analysis of Jatropha curcas L. inferred from nrDNA ITS sequences.

    Science.gov (United States)

    Guo, Guo-Ye; Chen, Fang; Shi, Xiao-Dong; Tian, Yin-Shuai; Yu, Mao-Qun; Han, Xue-Qin; Yuan, Li-Chun; Zhang, Ying

    2016-01-01

    Genetic variation and phylogenetic relationships among 102 Jatropha curcas accessions from Asia, Africa, and the Americas were assessed using the internal transcribed spacer region of nuclear ribosomal DNA (nrDNA ITS). The average G+C content (65.04%) was considerably higher than the A+T (34.96%) content. The estimated genetic diversity revealed moderate genetic variation. The pairwise genetic divergences (GD) between haplotypes were evaluated and ranged from 0.000 to 0.017, suggesting a higher level of genetic differentiation in Mexican accessions than those of other regions. Phylogenetic relationships and intraspecific divergence were inferred by Bayesian inference (BI), maximum parsimony (MP), and median joining (MJ) network analysis and were generally resolved. The J. curcas accessions were consistently divided into three lineages, groups A, B, and C, which demonstrated distant geographical isolation and genetic divergence between American accessions and those from other regions. The MJ network analysis confirmed that Central America was the possible center of origin. The putative migration route suggested that J. curcas was distributed from Mexico or Brazil, via Cape Verde and then split into two routes. One route was dispersed to Spain, then migrated to China, eventually spreading to southeastern Asia, while the other route was dispersed to Africa, via Madagascar and migrated to China, later spreading to southeastern Asia. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  15. Analysis of Fatty Acid and Growth Profiles in Ten Shewanella spp. to Associate Phylogenetic Relationships

    Science.gov (United States)

    2015-10-25

    microorganisms from the same genus using physiological responses. To understand these changes, a shift in fatty acid length distributions and growth of...phylogenetically dissimilar microorganisms from the same genus using physiological responses. To understand these changes, a shift in fatty acid length...region contaminated with metals: relation with ecological characteristics and soil respiration. J. Biorem. Biodegrad . 6, 1000274/1000271-1000274

  16. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    2 attached at the base of tree as the diverging Iridaceae relative's lineage. Present study revealed that psbA-trnH region are useful in addressing questions of phylogenetic relationships among the Gladiolus cultivars, as these intergenic spacers are more variable and have more phylogenetically informative sites than the ...

  17. Phylogenetic relationships among Maloideae species

    Science.gov (United States)

    The Maloideae is a highly diverse sub-family of the Rosaceae containing several agronomically important species (Malus sp. and Pyrus sp.) and their wild relatives. Previous phylogenetic work within the group has revealed extensive intergeneric hybridization and polyploidization. In order to develop...

  18. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  19. Phenotypic diversity and phylogenetic relationship between the ...

    African Journals Online (AJOL)

    Phenotypic diversity and phylogenetic relationship between the Bakosi/Baweri and other pig breeds ( Sus scrofa Domesticus ) in the humid forest with monomodal rainfall agro-ecological zone of Cameroon.

  20. Analysis of mitochondrial DNA: taxonomic and phylogenetic relationships in two fish taxa (Pisces: Mugilidae and Cyprinidae).

    Science.gov (United States)

    Semina, A V; Polyakova, N E; Brykov, Vl A

    2007-12-01

    To solve some systematic questions as well as to study genetic variability and evolutionary relationships in two groups of fish belonging to the Mugilid (Mugilidae) and Cyprinid (Cyprinidae) families, we have used restriction fragment length polymorphism analysis of mitochondrial DNA (mtDNA) fragments amplified in polymerase chain reaction. The analysis of three mtDNA fragments of 7220 bp total length of six Mugilid species has shown that Mediterranean Liza aurata, L. ramada, L. saliens, and Chelon labrosus form a common cluster, L. aurata and C. labrosus being the closest relatives, whereas L. haematocheilus (syn. C. haematocheilus) of the Sea of Japan forms a sister group to the Mediterranean cluster. It was found that Chelon and Liza genera are paraphyletic, and therefore their division into two genera is unnatural and they should be synonymized. According to priority, Liza species should be ascribed to Chelon genus. Mugil cephalus is the most distant compared to the rest of the species studied. The level of genetic divergence between allopatric samples of M. cephalus from the Sea of Japan and the Mediterranean Sea has proved to be very high--4.5% of nucleotide substitutions. The analysis of four mtDNA fragments of 9340 bp total length of six Cyprinid species has shown that L. waleckii is the most genetically distant. Pseudaspius leptocephalus is a sister group to Tribolodon species. All Tribolodon species form a common cluster with T. sachalinensis as a root. The remaining species form two branches, one of which includes T. nakamurai and T. brandtii, another one combines T. hakonensis and a new form of Tribolodon revealed that is close to T. hakonensis by its mtDNA (2.4% of nucleotide substitutions). This new form might be an independent species.

  1. A comparative ZOO-FISH analysis in bats elucidates the phylogenetic relationships between Megachiroptera and five microchiropteran families.

    Science.gov (United States)

    Volleth, M; Heller, K G; Pfeiffer, R A; Hameister, H

    2002-01-01

    Fluorescence in-situ hybridization with human whole chromosome painting probes (WCPs) was applied to compare the karyotypes of members of five bat families. Twenty-five evolutionarily conserved units (ECUs) were identified by ZOO-FISH analysis. In 10 of these 25 ECUs, thorough GTG-band comparison revealed an identical banding pattern in all families studied. Differences in the remaining ECUs were used as characters to judge the phylogenetic relationships within Chiroptera. Close relationships were found between Rhinolophidae and Hipposideridae. Also closely related are the representatives of the yangochiropteran families Phyllostomidae (genus studied: Glossophaga, Volleth et al. 1999), Molossidae and Vespertilionidae. All microchiropteran species studied here share four common features not found in the megachiropteran species Eonycteris spelaea. Two of these are considered as derived characters with a high probability of parallel evolution. On the other hand, Eonycteris shares one common, probably derived feature with the rhinolophoid families Rhinolophidae and Hipposideridae and an additional one only with Hipposideridae. At the moment, the relationships between Yangochiroptera, Rhinolophoidea and Megachiroptera must be left in an unsolved trichotomy. Comparison of neighboring segment combinations found in Chiroptera with those found in other mammalian taxa revealed six synapomorphic features for Chiroptera. Therefore, for karyological reasons, monophyly of Chiroptera is strongly supported.

  2. Atelinae phylogenetic relationships: the trichotomy revived?

    Science.gov (United States)

    Collins, A C

    2004-08-01

    This research examines phylogenetic relationships between members of the Atelinae subfamily (Alouatta, Ateles, Brachyteles, and Lagothrix), based on analysis of three genetic regions. Two loci, cytochrome c oxidase subunit II (COII) and the hypervariable I portion of the control region, are part of the mitochondrial genome. The other is a single-copy nuclear gene, Aldolase A Intron V. Analysis of these genetic regions provides support for tribe Alouattini containing the Alouatta species, while tribe Atelini contains the other three genera. However, these three genetic regions produce conflicting results for relationships among tribe Atelini members. Previous genetic studies supported grouping Brachyteles with Lagothrix, leaving Ateles in a separate subclade. The present data sets vary based on the genetic region analyzed and method of analysis suggesting all possible cladistic relationships. These results are more consistent with investigations of morphology and behavior among these primates. The primary cause of discrepancy between this study and previous genetic studies is postulated to reside in increased sampling in the present study of genetic variation among members of the Atelinae, specifically Ateles. The present study utilized samples of Ateles from all postulated species for this genetically variable primate, while previous studies used only one or two species of Ateles. This paper demonstrates that shifting relationships are produced when different species of Ateles are used to reconstruct phylogenies. This research concludes that a trichotomy should still be supported between members of tribe Atelini until further analyses, which include additional Atelinae haplotypes are conducted. Copyright 2003 Wiley-Liss, Inc.

  3. The complete chloroplast genome sequence of Ampelopsis: gene organization, comparative analysis and phylogenetic relationships to other angiosperms

    Directory of Open Access Journals (Sweden)

    Gurusamy eRaman

    2016-03-01

    Full Text Available Ampelopsis brevipedunculata is an economically important plant that belongs to the Vitaceae family of angiosperms. The phylogenetic placement of Vitaceae is still unresolved. Recent phylogenetic studies suggested that it should be placed in various alternative families including Caryophyllaceae, asteraceae, Saxifragaceae, Dilleniaceae, or with the rest of the rosid families. However, these analyses provided weak supportive results because they were based on only one of several genes. Accordingly, complete chloroplast genome sequences are required to resolve the phylogenetic relationships among angiosperms. Recent phylogenetic analyses based on the complete chloroplast genome sequence suggested strong support for the position of Vitaceae as the earliest diverging lineage of rosids and placed it as a sister to the remaining rosids. These studies also revealed relationships among several major lineages of angiosperms; however, they highlighted the significance of taxon sampling for obtaining accurate phylogenies. In the present study, we sequenced the complete chloroplast genome of A. brevipedunculata and used these data to assess the relationships among 32 angiosperms, including 18 taxa of rosids. The Ampelopsis chloroplast genome is 161,090 bp in length, and includes a pair of inverted repeats of 26,394 bp that are separated by small and large single copy regions of 19,036 bp and 89,266 bp, respectively. The gene content and order of Ampelopsis is identical to many other unrearranged angiosperm chloroplast genomes, including Vitis and tobacco. A phylogenetic tree constructed based on 70 protein-coding genes of 33 angiosperms showed that both Saxifragales and Vitaceae diverged from the rosid clade and formed two clades with 100% bootstrap value. The position of the Vitaceae is sister to Saxifragales, and both are the basal and earliest diverging lineages. Moreover, Saxifragales forms a sister clade to Vitaceae of rosids. Overall, the results of

  4. Phylogenetic relationships within the cyst-forming nematodes (Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of ribosomal DNA.

    Science.gov (United States)

    Subbotin, S A; Vierstraete, A; De Ley, P; Rowe, J; Waeyenberge, L; Moens, M; Vanfleteren, J R

    2001-10-01

    The ITS1, ITS2, and 5.8S gene sequences of nuclear ribosomal DNA from 40 taxa of the family Heteroderidae (including the genera Afenestrata, Cactodera, Heterodera, Globodera, Punctodera, Meloidodera, Cryphodera, and Thecavermiculatus) were sequenced and analyzed. The ITS regions displayed high levels of sequence divergence within Heteroderinae and compared to outgroup taxa. Unlike recent findings in root knot nematodes, ITS sequence polymorphism does not appear to complicate phylogenetic analysis of cyst nematodes. Phylogenetic analyses with maximum-parsimony, minimum-evolution, and maximum-likelihood methods were performed with a range of computer alignments, including elision and culled alignments. All multiple alignments and phylogenetic methods yielded similar basic structure for phylogenetic relationships of Heteroderidae. The cyst-forming nematodes are represented by six main clades corresponding to morphological characters and host specialization, with certain clades assuming different positions depending on alignment procedure and/or method of phylogenetic inference. Hypotheses of monophyly of Punctoderinae and Heteroderinae are, respectively, strongly and moderately supported by the ITS data across most alignments. Close relationships were revealed between the Avenae and the Sacchari groups and between the Humuli group and the species H. salixophila within Heteroderinae. The Goettingiana group occupies a basal position within this subfamily. The validity of the genera Afenestrata and Bidera was tested and is discussed based on molecular data. We conclude that ITS sequence data are appropriate for studies of relationships within the different species groups and less so for recovery of more ancient speciations within Heteroderidae. Copyright 2001 Academic Press.

  5. Comprehensive transcriptome analysis provides new insights into nutritional strategies and phylogenetic relationships of chrysophytes

    Directory of Open Access Journals (Sweden)

    Daniela Beisser

    2017-01-01

    Full Text Available Background Chrysophytes are protist model species in ecology and ecophysiology and important grazers of bacteria-sized microorganisms and primary producers. However, they have not yet been investigated in detail at the molecular level, and no genomic and only little transcriptomic information is available. Chrysophytes exhibit different trophic modes: while phototrophic chrysophytes perform only photosynthesis, mixotrophs can gain carbon from bacterial food as well as from photosynthesis, and heterotrophs solely feed on bacteria-sized microorganisms. Recent phylogenies and megasystematics demonstrate an immense complexity of eukaryotic diversity with numerous transitions between phototrophic and heterotrophic organisms. The question we aim to answer is how the diverse nutritional strategies, accompanied or brought about by a reduction of the plasmid and size reduction in heterotrophic strains, affect physiology and molecular processes. Results We sequenced the mRNA of 18 chrysophyte strains on the Illumina HiSeq platform and analysed the transcriptomes to determine relations between the trophic mode (mixotrophic vs. heterotrophic and gene expression. We observed an enrichment of genes for photosynthesis, porphyrin and chlorophyll metabolism for phototrophic and mixotrophic strains that can perform photosynthesis. Genes involved in nutrient absorption, environmental information processing and various transporters (e.g., monosaccharide, peptide, lipid transporters were present or highly expressed only in heterotrophic strains that have to sense, digest and absorb bacterial food. We furthermore present a transcriptome-based alignment-free phylogeny construction approach using transcripts assembled from short reads to determine the evolutionary relationships between the strains and the possible influence of nutritional strategies on the reconstructed phylogeny. We discuss the resulting phylogenies in comparison to those from established approaches

  6. Phylogenetic relationship among Kenyan sorghum germplasms ...

    African Journals Online (AJOL)

    Mr Kiboi

    phylogenetic relationships based on 10 DNA fragments at AltSB loci with SbMATE, ORF9 and MITE primers. .... estimate the overall genetic diversity in Kenyan sorghum lines: Cheprot et al. 3529 ..... EARN project and Generation Challenge (GCP), ... genetics and molecular biology of plant aluminum resistance and toxicity.

  7. phangorn: phylogenetic analysis in R.

    Science.gov (United States)

    Schliep, Klaus Peter

    2011-02-15

    phangorn is a package for phylogenetic reconstruction and analysis in the R language. Previously it was only possible to estimate phylogenetic trees with distance methods in R. phangorn, now offers the possibility of reconstructing phylogenies with distance based methods, maximum parsimony or maximum likelihood (ML) and performing Hadamard conjugation. Extending the general ML framework, this package provides the possibility of estimating mixture and partition models. Furthermore, phangorn offers several functions for comparing trees, phylogenetic models or splits, simulating character data and performing congruence analyses. phangorn can be obtained through the CRAN homepage http://cran.r-project.org/web/packages/phangorn/index.html. phangorn is licensed under GPL 2.

  8. Phylogenetic analysis of molecular and morphological data highlights uncertainty in the relationships of fossil and living species of Elopomorpha (Actinopterygii: Teleostei).

    Science.gov (United States)

    Dornburg, Alex; Friedman, Matt; Near, Thomas J

    2015-08-01

    Elopomorpha is one of the three main clades of living teleost fishes and includes a range of disparate lineages including eels, tarpons, bonefishes, and halosaurs. Elopomorphs were among the first groups of fishes investigated using Hennigian phylogenetic methods and continue to be the object of intense phylogenetic scrutiny due to their economic significance, diversity, and crucial evolutionary status as the sister group of all other teleosts. While portions of the phylogenetic backbone for Elopomorpha are consistent between studies, the relationships among Albula, Pterothrissus, Notacanthiformes, and Anguilliformes remain contentious and difficult to evaluate. This lack of phylogenetic resolution is problematic as fossil lineages are often described and placed taxonomically based on an assumed sister group relationship between Albula and Pterothrissus. In addition, phylogenetic studies using morphological data that sample elopomorph fossil lineages often do not include notacanthiform or anguilliform lineages, potentially introducing a bias toward interpreting fossils as members of the common stem of Pterothrissus and Albula. Here we provide a phylogenetic analysis of DNA sequences sampled from multiple nuclear genes that include representative taxa from Albula, Pterothrissus, Notacanthiformes and Anguilliformes. We integrate our molecular dataset with a morphological character matrix that spans both living and fossil elopomorph lineages. Our results reveal substantial uncertainty in the placement of Pterothrissus as well as all sampled fossil lineages, questioning the stability of the taxonomy of fossil Elopomorpha. However, despite topological uncertainty, our integration of fossil lineages into a Bayesian time calibrated framework provides divergence time estimates for the clade that are consistent with previously published age estimates based on the elopomorph fossil record and molecular estimates resulting from traditional node-dating methods. Copyright

  9. Open Reading Frame Phylogenetic Analysis on the Cloud

    Directory of Open Access Journals (Sweden)

    Che-Lun Hung

    2013-01-01

    Full Text Available Phylogenetic analysis has become essential in researching the evolutionary relationships between viruses. These relationships are depicted on phylogenetic trees, in which viruses are grouped based on sequence similarity. Viral evolutionary relationships are identified from open reading frames rather than from complete sequences. Recently, cloud computing has become popular for developing internet-based bioinformatics tools. Biocloud is an efficient, scalable, and robust bioinformatics computing service. In this paper, we propose a cloud-based open reading frame phylogenetic analysis service. The proposed service integrates the Hadoop framework, virtualization technology, and phylogenetic analysis methods to provide a high-availability, large-scale bioservice. In a case study, we analyze the phylogenetic relationships among Norovirus. Evolutionary relationships are elucidated by aligning different open reading frame sequences. The proposed platform correctly identifies the evolutionary relationships between members of Norovirus.

  10. Mitochondrial DNA sequence-based phylogenetic relationship ...

    Indian Academy of Sciences (India)

    cophaga ranges from 0.037–0.106 and 0.049–0.207 for COI and ND5 genes, respectively (tables 2 and 3). Analysis of genetic distance on the basis of sequence difference for both the mitochondrial genes shows very little genetic difference. The discrepancy in the phylogenetic trees based on individ- ual genes may be due ...

  11. Analysis of Comparative Sequence and Genomic Data to Verify Phylogenetic Relationship and Explore a New Subfamily of Bacterial Lipases.

    Directory of Open Access Journals (Sweden)

    Malihe Masomian

    Full Text Available Thermostable and organic solvent-tolerant enzymes have significant potential in a wide range of synthetic reactions in industry due to their inherent stability at high temperatures and their ability to endure harsh organic solvents. In this study, a novel gene encoding a true lipase was isolated by construction of a genomic DNA library of thermophilic Aneurinibacillus thermoaerophilus strain HZ into Escherichia coli plasmid vector. Sequence analysis revealed that HZ lipase had 62% identity to putative lipase from Bacillus pseudomycoides. The closely characterized lipases to the HZ lipase gene are from thermostable Bacillus and Geobacillus lipases belonging to the subfamily I.5 with ≤ 57% identity. The amino acid sequence analysis of HZ lipase determined a conserved pentapeptide containing the active serine, GHSMG and a Ca(2+-binding motif, GCYGSD in the enzyme. Protein structure modeling showed that HZ lipase consisted of an α/β hydrolase fold and a lid domain. Protein sequence alignment, conserved regions analysis, clustal distance matrix and amino acid composition illustrated differences between HZ lipase and other thermostable lipases. Phylogenetic analysis revealed that this lipase represented a new subfamily of family I of bacterial true lipases, classified as family I.9. The HZ lipase was expressed under promoter Plac using IPTG and was characterized. The recombinant enzyme showed optimal activity at 65 °C and retained ≥ 97% activity after incubation at 50 °C for 1h. The HZ lipase was stable in various polar and non-polar organic solvents.

  12. Ultrastructure, biology, and phylogenetic relationships of kinorhyncha.

    Science.gov (United States)

    Neuhaus, Birger; Higgins, Robert P

    2002-07-01

    The article summarizes current knowledge mainly about the (functional) morphology and ultrastructure, but also about the biology, development, and evolution of the Kinorhyncha. The Kinorhyncha are microscopic, bilaterally symmetrical, exclusively free-living, benthic, marine animals and ecologically part of the meiofauna. They occur throughout the world from the intertidal to the deep sea, generally in sediments but sometimes associated with plants or other animals. From adult stages 141 species are known, but 38 species have been described from juvenile stages. The trunk is arranged into 11 segments as evidenced by cuticular plates, sensory spots, setae or spines, nervous system, musculature, and subcuticular glands. The ultrastructure of several organ systems and the postembryonic development are known for very few species. Almost no data are available about the embryology and only a single gene has been sequenced for a single species. The phylogenetic relationships within Kinorhyncha are unresolved. Priapulida, Loricifera, and Kinorhyncha are grouped together as Scalidophora, but arguments are found for every possible sistergroup relationship within this taxon. The recently published Ecdysozoa hypothesis suggests a closer relationship of the Scalidophora, Nematoda, Nematomorpha, Tardigrada, Onychophora, and Arthropoda.

  13. Phylogenetic and biogeographic analysis of sphaerexochine trilobites.

    Directory of Open Access Journals (Sweden)

    Curtis R Congreve

    Full Text Available BACKGROUND: Sphaerexochinae is a speciose and widely distributed group of cheirurid trilobites. Their temporal range extends from the earliest Ordovician through the Silurian, and they survived the end Ordovician mass extinction event (the second largest mass extinction in Earth history. Prior to this study, the individual evolutionary relationships within the group had yet to be determined utilizing rigorous phylogenetic methods. Understanding these evolutionary relationships is important for producing a stable classification of the group, and will be useful in elucidating the effects the end Ordovician mass extinction had on the evolutionary and biogeographic history of the group. METHODOLOGY/PRINCIPAL FINDINGS: Cladistic parsimony analysis of cheirurid trilobites assigned to the subfamily Sphaerexochinae was conducted to evaluate phylogenetic patterns and produce a hypothesis of relationship for the group. This study utilized the program TNT, and the analysis included thirty-one taxa and thirty-nine characters. The results of this analysis were then used in a Lieberman-modified Brooks Parsimony Analysis to analyze biogeographic patterns during the Ordovician-Silurian. CONCLUSIONS/SIGNIFICANCE: The genus Sphaerexochus was found to be monophyletic, consisting of two smaller clades (one composed entirely of Ordovician species and another composed of Silurian and Ordovician species. By contrast, the genus Kawina was found to be paraphyletic. It is a basal grade that also contains taxa formerly assigned to Cydonocephalus. Phylogenetic patterns suggest Sphaerexochinae is a relatively distinctive trilobite clade because it appears to have been largely unaffected by the end Ordovician mass extinction. Finally, the biogeographic analysis yields two major conclusions about Sphaerexochus biogeography: Bohemia and Avalonia were close enough during the Silurian to exchange taxa; and during the Ordovician there was dispersal between Eastern Laurentia and

  14. Phylogenetic relationships of African sunbird-like warblers: Moho ...

    African Journals Online (AJOL)

    Phylogenetic relationships of African sunbird-like warblers: Moho ( Hypergerus atriceps ), Green Hylia ( Hylia prasina ) and Tit-hylia ( Pholidornis rushiae ) ... different points in avian evolution reduces the phylogenetic signal in molecular sequence data, making difficult the reconstruction of relationships among taxa resulting ...

  15. An attempt to reconstruct phylogenetic relationships within Caribbean nummulitids: simulating relationships and tracing character evolution

    Science.gov (United States)

    Eder, Wolfgang; Ives Torres-Silva, Ana; Hohenegger, Johann

    2017-04-01

    Phylogenetic analysis and trees based on molecular data are broadly applied and used to infer genetical and biogeographic relationship in recent larger foraminifera. Molecular phylogenetic is intensively used within recent nummulitids, however for fossil representatives these trees are only of minor informational value. Hence, within paleontological studies a phylogenetic approach through morphometric analysis is of much higher value. To tackle phylogenetic relationships within the nummulitid family, a much higher number of morphological character must be measured than are commonly used in biometric studies, where mostly parameters describing embryonic size (e.g., proloculus diameter, deuteroloculus diameter) and/or the marginal spiral (e.g., spiral diagrams, spiral indices) are studied. For this purpose 11 growth-independent and/or growth-invariant characters have been used to describe the morphological variability of equatorial thin sections of seven Carribbean nummulitid taxa (Nummulites striatoreticulatus, N. macgillavry, Palaeonummulites willcoxi, P.floridensis, P. soldadensis, P.trinitatensis and P.ocalanus) and one outgroup taxon (Ranikothalia bermudezi). Using these characters, phylogenetic trees were calculated using a restricted maximum likelihood algorithm (REML), and results are cross-checked by ordination and cluster analysis. Square-change parsimony method has been run to reconstruct ancestral states, as well as to simulate the evolution of the chosen characters along the calculated phylogenetic tree and, independent - contrast analysis was used to estimate confidence intervals. Based on these simulations, phylogenetic tendencies of certain characters proposed for nummulitids (e.g., Cope's rule or nepionic acceleration) can be tested, whether these tendencies are valid for the whole family or only for certain clades. At least, within the Carribean nummulitids, phylogenetic trends along some growth-independent characters of the embryo (e.g., first

  16. Phylogenetic relationships of Hemiptera inferred from mitochondrial and nuclear genes.

    Science.gov (United States)

    Song, Nan; Li, Hu; Cai, Wanzhi; Yan, Fengming; Wang, Jianyun; Song, Fan

    2016-11-01

    Here, we reconstructed the Hemiptera phylogeny based on the expanded mitochondrial protein-coding genes and the nuclear 18S rRNA gene, separately. The differential rates of change across lineages may associate with long-branch attraction (LBA) effect and result in conflicting estimates of phylogeny from different types of data. To reduce the potential effects of systematic biases on inferences of topology, various data coding schemes, site removal method, and different algorithms were utilized in phylogenetic reconstruction. We show that the outgroups Phthiraptera, Thysanoptera, and the ingroup Sternorrhyncha share similar base composition, and exhibit "long branches" relative to other hemipterans. Thus, the long-branch attraction between these groups is suspected to cause the failure of recovering Hemiptera under the homogeneous model. In contrast, a monophyletic Hemiptera is supported when heterogeneous model is utilized in the analysis. Although higher level phylogenetic relationships within Hemiptera remain to be answered, consensus between analyses is beginning to converge on a stable phylogeny.

  17. Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae)

    Science.gov (United States)

    Carrizo García, Carolina; Barfuss, Michael H. J.; Sehr, Eva M.; Barboza, Gloria E.; Samuel, Rosabelle; Moscone, Eduardo A.; Ehrendorfer, Friedrich

    2016-01-01

    Background and Aims Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Methods Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Key Results Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. Conclusions New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum. A clearly distinct early-diverging clade can be distinguished, centred in western–north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The

  18. Phylogenetic Analysis Using Protein Mass Spectrometry.

    Science.gov (United States)

    Ma, Shiyong; Downard, Kevin M; Wong, Jason W H

    2017-01-01

    Through advances in molecular biology, comparative analysis of DNA sequences is currently the cornerstone in the study of molecular evolution and phylogenetics. Nevertheless, protein mass spectrometry offers some unique opportunities to enable phylogenetic analyses in organisms where DNA may be difficult or costly to obtain. To date, the methods of phylogenetic analysis using protein mass spectrometry can be classified into three categories: (1) de novo protein sequencing followed by classical phylogenetic reconstruction, (2) direct phylogenetic reconstruction using proteolytic peptide mass maps, and (3) mapping of mass spectral data onto classical phylogenetic trees. In this chapter, we provide a brief description of the three methods and the protocol for each method along with relevant tools and algorithms.

  19. Assessment of phylogenetic sensitivity for reconstructing HIV-1 epidemiological relationships.

    Science.gov (United States)

    Beloukas, Apostolos; Magiorkinis, Emmanouil; Magiorkinis, Gkikas; Zavitsanou, Asimina; Karamitros, Timokratis; Hatzakis, Angelos; Paraskevis, Dimitrios

    2012-06-01

    Phylogenetic analysis has been extensively used as a tool for the reconstruction of epidemiological relations for research or for forensic purposes. It was our objective to assess the sensitivity of different phylogenetic methods and various phylogenetic programs to reconstruct epidemiological links among HIV-1 infected patients that is the probability to reveal a true transmission relationship. Multiple datasets (90) were prepared consisting of HIV-1 sequences in protease (PR) and partial reverse transcriptase (RT) sampled from patients with documented epidemiological relationship (target population), and from unrelated individuals (control population) belonging to the same HIV-1 subtype as the target population. Each dataset varied regarding the number, the geographic origin and the transmission risk groups of the sequences among the control population. Phylogenetic trees were inferred by neighbor-joining (NJ), maximum likelihood heuristics (hML) and Bayesian methods. All clusters of sequences belonging to the target population were correctly reconstructed by NJ and Bayesian methods receiving high bootstrap and posterior probability (PP) support, respectively. On the other hand, TreePuzzle failed to reconstruct or provide significant support for several clusters; high puzzling step support was associated with the inclusion of control sequences from the same geographic area as the target population. In contrary, all clusters were correctly reconstructed by hML as implemented in PhyML 3.0 receiving high bootstrap support. We report that under the conditions of our study, hML using PhyML, NJ and Bayesian methods were the most sensitive for the reconstruction of epidemiological links mostly from sexually infected individuals. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Mitochondrial genomes of Meloidogyne chitwoodi and M. incognita (Nematoda: Tylenchina): comparative analysis, gene order and phylogenetic relationships with other nematodes.

    Science.gov (United States)

    Humphreys-Pereira, Danny A; Elling, Axel A

    2014-01-01

    Root-knot nematodes (Meloidogyne spp.) are among the most important plant pathogens. In this study, the mitochondrial (mt) genomes of the root-knot nematodes, M. chitwoodi and M. incognita were sequenced. PCR analyses suggest that both mt genomes are circular, with an estimated size of 19.7 and 18.6-19.1kb, respectively. The mt genomes each contain a large non-coding region with tandem repeats and the control region. The mt gene arrangement of M. chitwoodi and M. incognita is unlike that of other nematodes. Sequence alignments of the two Meloidogyne mt genomes showed three translocations; two in transfer RNAs and one in cox2. Compared with other nematode mt genomes, the gene arrangement of M. chitwoodi and M. incognita was most similar to Pratylenchus vulnus. Phylogenetic analyses (Maximum Likelihood and Bayesian inference) were conducted using 78 complete mt genomes of diverse nematode species. Analyses based on nucleotides and amino acids of the 12 protein-coding mt genes showed strong support for the monophyly of class Chromadorea, but only amino acid-based analyses supported the monophyly of class Enoplea. The suborder Spirurina was not monophyletic in any of the phylogenetic analyses, contradicting the Clade III model, which groups Ascaridomorpha, Spiruromorpha and Oxyuridomorpha based on the small subunit ribosomal RNA gene. Importantly, comparisons of mt gene arrangement and tree-based methods placed Meloidogyne as sister taxa of Pratylenchus, a migratory plant endoparasitic nematode, and not with the sedentary endoparasitic Heterodera. Thus, comparative analyses of mt genomes suggest that sedentary endoparasitism in Meloidogyne and Heterodera is based on convergent evolution. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Phylogenetic relationships of the lancelets of the genus ...

    African Journals Online (AJOL)

    phylogenetic relationships of the Branchiostoma lancelets from South (Xiamen) and North (Qingdao and Rizhao) China, and phylogenetic trees constructed also included the existing data from Japanese waters. The genetic distances of the lancelets between South and North China averaged 0.19, 0.21, and 0.17 based on ...

  2. Molecular characterization and phylogenetic relationships among microsporidian isolates infecting silkworm, Bombyx mori using small subunit rRNA (SSU-rRNA) gene sequence analysis.

    Science.gov (United States)

    Nath, B Surendra; Gupta, S K; Bajpai, A K

    2012-12-01

    The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect.

  3. Phylogenetic versus functional signals in the evolution of form-function relationships in terrestrial vision.

    Science.gov (United States)

    Motani, Ryosuke; Schmitz, Lars

    2011-08-01

    Phylogeny is deeply pertinent to evolutionary studies. Traits that perform a body function are expected to be strongly influenced by physical "requirements" of the function. We investigated if such traits exhibit phylogenetic signals, and, if so, how phylogenetic noises bias quantification of form-function relationships. A form-function system that is strongly influenced by physics, namely the relationship between eye morphology and visual optics in amniotes, was used. We quantified the correlation between form (i.e., eye morphology) and function (i.e., ocular optics) while varying the level of phylogenetic bias removal through adjusting Pagel's λ. Ocular soft-tissue dimensions exhibited the highest correlation with ocular optics when 1% of phylogenetic bias expected from Brownian motion was removed (i.e., λ= 0.01); the value for hard-tissue data were 8%. A small degree of phylogenetic bias therefore exists in morphology despite of the stringent functional constraints. We also devised a phylogenetically informed discriminant analysis and recorded the effects of phylogenetic bias on this method using the same data. Use of proper λ values during phylogenetic bias removal improved misidentification rates in resulting classifications when prior probabilities were assumed to be equal. Even a small degree of phylogenetic bias affected the classification resulting from phylogenetically informed discriminant analysis. © 2011 The Author(s). Evolution© 2011 The Society for the Study of Evolution.

  4. Conformation of phylogenetic relationship of Penaeidae shrimp based on morphometric and molecular investigations.

    Science.gov (United States)

    Rajakumaran, P; Vaseeharan, B; Jayakumar, R; Chidambara, R

    2014-01-01

    Understanding of accurate phylogenetic relationship among Penaeidae shrimp is important for academic and fisheries industry. The Morphometric and Randomly amplified polymorphic DNA (RAPD) analysis was used to make the phylogenetic relationsip among 13 Penaeidae shrimp. For morphometric analysis forty variables and total lengths of shrimp were measured for each species, and removed the effect of size variation. The size normalized values obtained was subjected to UPGMA (Unweighted Pair-Group Method with Arithmetic Mean) cluster analysis. For RAPD analysis, the four primers showed reliable differentiation between species, and used correlation coefficient between the DNA banding patterns of 13 Penaeidae species to construct UPGMA dendrogram. Phylogenetic relationship from morphometric and molecular analysis for Penaeidae species found to be congruent. We concluded that as the results from morphometry investigations concur with molecular one, phylogenetic relationship obtained for the studied Penaeidae are considered to be reliable.

  5. Genetic divergence and phylogenetic relationships in grey mullets (Teleostei: Mugilidae) based on PCR-RFLP analysis of mtDNA segments.

    Science.gov (United States)

    Papasotiropoulos, V; Klossa-Kilia, E; Kilias, G; Alahiotis, S

    2002-04-01

    The genetic differentiation and phylogenetic relationships among five species of the Mugilidae family (Mugil cephalus, Chelon labrosus, Liza aurata, Liza ramada, and Liza saliens) were investigated at the mtDNA level, on samples taken from Messolongi lagoon-Greece. RFLP analysis of three PCR-amplified mtDNA gene segments (12s rRNA, 16s rRNA, and CO I) was used. Ten, eight, and nine restriction enzymes were found to have at least one recognition site at 12s rRNA, 16s rRNA, and CO I genes, respectively. Several fragment patterns were revealed to be species-specific, and thus they could be useful in species taxonomy as diagnostic markers, as well as for further evolutionary studies. Seven different haplotypes were detected. The greatest amount of genetic differentiation was observed at the interspecific level, while little variation was revealed at the intraspecific level. The highest values of nucleotide sequence divergence were observed between M. cephalus and all the other species, while the lowest was found between C. labrosus and L. saliens. Dendrograms obtained by the three different methods (UPGMA, Neighbor-Joining, and Dollo parsimony), were found to exhibit in all cases the same topology. According to this, the most distinct species is M. cephalus, while the other species are clustered in two separate groups, thefirst one containing L. aurata and L. ramada, the other L. saliens and C. labrosus. This last clustering makes the monophyletic origin of the genus Liza questionable.

  6. Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae).

    Science.gov (United States)

    Carrizo García, Carolina; Barfuss, Michael H J; Sehr, Eva M; Barboza, Gloria E; Samuel, Rosabelle; Moscone, Eduardo A; Ehrendorfer, Friedrich

    2016-07-01

    Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum A clearly distinct early-diverging clade can be distinguished, centred in western-north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The diversification of Capsicum has culminated in the origin

  7. Phylogenetic analysis, genetic diversity and relationships between the recently segregated species of Corynandra and Cleoserrata from the genus Cleome using DNA barcoding and molecular markers.

    Science.gov (United States)

    Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Gholave, Avinash Ramchandra; Kadam, Suhas Kishor; Kotibhaskar, Shreya Vijaykumar; Yadav, Shrirang Ramchandra; Govindwar, Sanjay Prabhu

    2016-01-01

    Cleome is the largest genus in the family Cleomaceae and it is known for its various medicinal properties. Recently, some species from the Cleome genus (Cleome viscosa, Cleome chelidonii, Cleome felina and Cleome speciosa) are split into genera Corynandra (Corynandra viscosa, Corynandra chelidonii, Corynandra felina), and Cleoserrata (Cleoserrata speciosa). The objective of this study was to obtain DNA barcodes for these species for their accurate identification and determining phylogenetic relationships. Out of 10 screened barcoding regions, rbcL, matK and ITS1 regions showed higher PCR efficiency and sequencing success. This study added matK, rbcL and ITS1 barcodes for the identification of Corynandra chelidonii, Corynandra felina, Cleome simplicifolia and Cleome aspera species in existing barcode data. Corynandra chelidonii and Corynandra felina species belong to the Corynandra genus, but they are not grouped with the Corynandra viscosa species, however clustered with the Cleome species. Molecular marker analysis showed 100% polymorphism among the studied plant samples. Diversity indices for molecular markers were ranged from He=0.1115-0.1714 and I=0.2268-0.2700, which indicates a significant amount of genetic diversity among studied species. Discrimination of the Cleome and Corynandra species from Cleoserrata speciosa was obtained by two RAPD primers (OPA-4 and RAPD-17) and two ISSR primers (ISSR-1 and ISSR-2). RAPD and ISSR markers are useful for the genetic characterization of these studied species. The present investigation will be helpful to understand the relationships of Cleome lineages with Corynandra and Cleoserrata species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  8. Phylogenetic comparative methods complement discriminant function analysis in ecomorphology.

    Science.gov (United States)

    Barr, W Andrew; Scott, Robert S

    2014-04-01

    In ecomorphology, Discriminant Function Analysis (DFA) has been used as evidence for the presence of functional links between morphometric variables and ecological categories. Here we conduct simulations of characters containing phylogenetic signal to explore the performance of DFA under a variety of conditions. Characters were simulated using a phylogeny of extant antelope species from known habitats. Characters were modeled with no biomechanical relationship to the habitat category; the only sources of variation were body mass, phylogenetic signal, or random "noise." DFA on the discriminability of habitat categories was performed using subsets of the simulated characters, and Phylogenetic Generalized Least Squares (PGLS) was performed for each character. Analyses were repeated with randomized habitat assignments. When simulated characters lacked phylogenetic signal and/or habitat assignments were random, ecomorphology. Copyright © 2013 Wiley Periodicals, Inc.

  9. Phylogenetic relationships among members of the Pachydactylus ...

    African Journals Online (AJOL)

    The Pachydactylus capensis group is a phenetically-defined assemblage of five small-bodied geckos broadly distributed in eastern southern Africa. Several additional small-bodied Pachydactylus have been historically considered subspecies of P. capensis or members of this group. To assess evolutionary relationships ...

  10. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Mariën J

    2008-03-01

    Full Text Available Abstract Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length, of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  11. Revealing pancrustacean relationships: phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

    Science.gov (United States)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

    2008-03-12

    In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  12. Genetic and phylogenetic analysis of ten Gobiidae species in China ...

    African Journals Online (AJOL)

    To study the genetic and phylogenetic relationship of gobioid fishes in China, the representatives of 10 gobioid fishes from 2 subfamilies in China were examined by amplified fragment length polymorphism (AFLP) analysis. We established 220 AFLP bands for 45 individuals from the 10 species, and the percentage of ...

  13. Phylogenetic analysis of the genus Hordeum using repetitive DNA sequences

    DEFF Research Database (Denmark)

    Svitashev, S.; Bryngelsson, T.; Vershinin, A.

    1994-01-01

    A set of six cloned barley (Hordeum vulgare) repetitive DNA sequences was used for the analysis of phylogenetic relationships among 31 species (46 taxa) of the genus Hordeum, using molecular hybridization techniques. In situ hybridization experiments showed dispersed organization of the sequences...

  14. Phylogenetic relationships within and among Brassica species from ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-02

    May 2, 2008 ... Inappropriate tree reconstruction methods would pose a problem only in the basal relationships rather than in terminal taxa; the paraphyly observed in this study applied mostly to terminal taxa. This study recovered sufficient phylogenetic characters to separate accessions of the same species, making.

  15. The phylogenetic relationships among infraorders and superfamilies of Diptera based on morphological evidence

    DEFF Research Database (Denmark)

    Lambkin, Christine L.; Sinclair, Bradley J.; Pape, Thomas

    2013-01-01

    Members of the megadiverse insect order Diptera (flies) have successfully colonized all continents and nearly all habitats. There are more than 154 000 described fly species, representing 1012% of animal species. Elucidating the phylogenetic relationships of such a large component of global...... biodiversity is challenging, but significant advances have been made in the last few decades. Since Hennig first discussed the monophyly of major groupings, Diptera has attracted much study, but most researchers have used non-numerical qualitative methods to assess morphological data. More recently......, quantitative phylogenetic methods have been used on both morphological and molecular data. All previous quantitative morphological studies addressed narrower phylogenetic problems, often below the suborder or infraorder level. Here we present the first numerical analysis of phylogenetic relationships...

  16. Phylogenetic relationships and evolutionary patterns of the order Collodaria (Radiolaria.

    Directory of Open Access Journals (Sweden)

    Yoshiyuki Ishitani

    Full Text Available Collodaria are the only group of Radiolaria that has a colonial lifestyle. This group is potentially the most important plankton in the oligotrophic ocean because of its large biomass and the high primary productivity associated with the numerous symbionts inside a cell or colony. The evolution of Collodaria could thus be related to the changes in paleo-productivity that have affected organic carbon fixation in the oligotrophic ocean. However, the fossil record of Collodaria is insufficient to trace their abundance through geological time, because most collodarians do not have silicified shells. Recently, molecular phylogeny based on nuclear small sub-unit ribosomal DNA (SSU rDNA confirmed Collodaria to be one of five orders of Radiolaria, though the relationship among collodarians is still unresolved because of inadequate taxonomic sampling. Our phylogenetic analysis has revealed four novel collodarian sequences, on the basis of which collodarians can be divided into four clades that correspond to taxonomic grouping at the family level: Thalassicollidae, Collozoidae, Collosphaeridae, and Collophidae. Comparison of the results of our phylogenetic analyses with the morphological characteristics of each collodarian family suggests that the first ancestral collodarians had a solitary lifestyle and left no silica deposits. The timing of events estimated from molecular divergence calculations indicates that naked collodarian lineages first appeared around 45.6 million years (Ma ago, coincident with the diversification of diatoms in the pelagic oceans. Colonial collodarians appeared after the formation of the present ocean circulation system and the development of oligotrophic conditions in the equatorial Pacific (ca. 33.4 Ma ago. The divergence of colonial collodarians probably caused a shift in the efficiency of primary production during this period.

  17. Phylogenetic Relationships and Evolutionary Patterns of the Order Collodaria (Radiolaria)

    Science.gov (United States)

    Ishitani, Yoshiyuki; Ujiié, Yurika; de Vargas, Colomban; Not, Fabrice; Takahashi, Kozo

    2012-01-01

    Collodaria are the only group of Radiolaria that has a colonial lifestyle. This group is potentially the most important plankton in the oligotrophic ocean because of its large biomass and the high primary productivity associated with the numerous symbionts inside a cell or colony. The evolution of Collodaria could thus be related to the changes in paleo-productivity that have affected organic carbon fixation in the oligotrophic ocean. However, the fossil record of Collodaria is insufficient to trace their abundance through geological time, because most collodarians do not have silicified shells. Recently, molecular phylogeny based on nuclear small sub-unit ribosomal DNA (SSU rDNA) confirmed Collodaria to be one of five orders of Radiolaria, though the relationship among collodarians is still unresolved because of inadequate taxonomic sampling. Our phylogenetic analysis has revealed four novel collodarian sequences, on the basis of which collodarians can be divided into four clades that correspond to taxonomic grouping at the family level: Thalassicollidae, Collozoidae, Collosphaeridae, and Collophidae. Comparison of the results of our phylogenetic analyses with the morphological characteristics of each collodarian family suggests that the first ancestral collodarians had a solitary lifestyle and left no silica deposits. The timing of events estimated from molecular divergence calculations indicates that naked collodarian lineages first appeared around 45.6 million years (Ma) ago, coincident with the diversification of diatoms in the pelagic oceans. Colonial collodarians appeared after the formation of the present ocean circulation system and the development of oligotrophic conditions in the equatorial Pacific (ca. 33.4 Ma ago). The divergence of colonial collodarians probably caused a shift in the efficiency of primary production during this period. PMID:22567112

  18. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species.

    Science.gov (United States)

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Despite differences in morphology, the genera representing 'true citrus fruit trees' are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial 'species' of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between 'true citrus fruit trees' were clarified. Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the

  19. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species

    Science.gov (United States)

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will

  20. Phylogenetic relationships of Scomberomorus commerson using sequence analysis of the mtDNA D-loop region in the Persian Gulf, Oman Sea and Arabian Sea

    Directory of Open Access Journals (Sweden)

    Ana Mansourkiaei

    2016-04-01

    Full Text Available Abstract Narrow-barred Spanish mackerel, Scomberomorus commerson, is an epipelagic and migratory species of family Scombridae which have a significant role in terms of ecology and fishery. 100 samples were collected from the Persian Gulf, Oman Sea and Arabian Sea. Part of their dorsal fins was snipped and transferred to micro-tubes containing ethanol; then, DNAs were extracted and HRM-Real Time PCR was performed to designate representative specimens for sequencing. Phylogenetic relationships of S. commerson from Persian Gulf, Oman Sea and Arabian Sea were investigated using sequence data of mitochondrial DNA D-loop region. None clustered Neighbor Joining tree indicated the proximity amid S. commerson in four sites. As numbers demonstrated in sequence analyses of mitochondrial DNA D-Loop region a sublimely high degree of genetic similarity among S. commerson from the Persian Gulf and Oman Sea were perceived, thereafter, having one stock structure of S. commerson in four regions were proved, and this approximation can be merely justified by their migration process along the coasts of Oman Sea and Persian Gulf. Therefore, the assessment of distribution patterns of 20 haplotypes in the constructed phylogenetic tree using mtDNA D-Loop sequences ascertained that no significant clustering according to the sampling sites was concluded.

  1. Phylogenetic relationships among species of Lutzomyia, subgenus Lutzomyia (Diptera: Psychodidae).

    Science.gov (United States)

    Pinto, Israel S; Filho, José D Andrade; Santos, Claudiney B; Falqueto, Aloísio; Leite, Yuri L R

    2010-01-01

    Lutzomyia França is the largest and most diverse sand fly genus in the New World and contains all the species involved in the transmission of American visceral leishmaniasis (AVL). Morphological characters were used to test the monophyly and to infer phylogenetic relationships among members of the Lutzomyia subgenus. Fifty-two morphological characters from male and female adult specimens belonging to 18 species of Lu. (Lutzomyia) were scored and analyzed. The resulting phylogeny confirms the monophyly of this subgenus and reveals four main internal clades. These four clades, however, do not support the classification of the subgenus in two series, longipalpis and cavernicola, because neither is necessarily monophyletic. Knowledge on phylogenetic relationships among these relevant vectors of AVL should be used as a tool for monitoring target taxa and a first step for establishing an early warning system for disease control.

  2. Phylogenetically informed logic relationships improve detection of biological network organization

    Science.gov (United States)

    2011-01-01

    Background A "phylogenetic profile" refers to the presence or absence of a gene across a set of organisms, and it has been proven valuable for understanding gene functional relationships and network organization. Despite this success, few studies have attempted to search beyond just pairwise relationships among genes. Here we search for logic relationships involving three genes, and explore its potential application in gene network analyses. Results Taking advantage of a phylogenetic matrix constructed from the large orthologs database Roundup, we invented a method to create balanced profiles for individual triplets of genes that guarantee equal weight on the different phylogenetic scenarios of coevolution between genes. When we applied this idea to LAPP, the method to search for logic triplets of genes, the balanced profiles resulted in significant performance improvement and the discovery of hundreds of thousands more putative triplets than unadjusted profiles. We found that logic triplets detected biological network organization and identified key proteins and their functions, ranging from neighbouring proteins in local pathways, to well separated proteins in the whole pathway, and to the interactions among different pathways at the system level. Finally, our case study suggested that the directionality in a logic relationship and the profile of a triplet could disclose the connectivity between the triplet and surrounding networks. Conclusion Balanced profiles are superior to the raw profiles employed by traditional methods of phylogenetic profiling in searching for high order gene sets. Gene triplets can provide valuable information in detection of biological network organization and identification of key genes at different levels of cellular interaction. PMID:22172058

  3. Phylogenetic relationships of Chaetomium isolates based on the ...

    African Journals Online (AJOL)

    Molecular characterization of 18 Chaetomium isolates collected from India based on the internal transcribed spacer (ITS) region of the rRNA gene sequences was done. Phylogenetic analysis of full length ITS region showed that Chaetomium globosum isolates, Cg1, Cg2, Cg6, Cg11 and Cg15, Chaetomium spp. isolates, ...

  4. Host specificity and phylogenetic relationships of chicken and turkey parvoviruses

    Science.gov (United States)

    Previous reports indicate that the newly discovered chicken parvoviruses (ChPV) and turkey parvoviruses (TuPV) are very similar to each other, yet they represent different species within a new genus of Parvoviridae. Currently, strain classification is based on the phylogenetic analysis of a 561 bas...

  5. Phylogenetic relationships of Chaetomium isolates based on the ...

    African Journals Online (AJOL)

    Biotech Unit

    2013-02-27

    Feb 27, 2013 ... Phylogenetic analysis of Chaetomium species. The evolutionary history was inferred using the maximum parsimony method. The bootstrap consensus tree inferred from. 1000 replicates is taken to represent the evolutionary history of the taxa analyzed (Felsenstein, 1985). The MP tree was obtained using.

  6. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum

    Science.gov (United States)

    Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

    2017-01-01

    Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the

  7. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum.

    Directory of Open Access Journals (Sweden)

    Xiuqing Zhang

    Full Text Available Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality

  8. Evidence for a close phylogenetic relationship between Melissococcus pluton, the causative agent of European foulbrood disease, and the genus Enterococcus.

    Science.gov (United States)

    Cai, J; Collins, M D

    1994-04-01

    The 16S rRNA gene sequence of Melissococcus pluton, the causative agent of European foulbrood disease, was determined in order to investigate the phylogenetic relationships between this organism and other low-G + C-content gram-positive bacteria. A comparative sequence analysis revealed that M. pluton is a close phylogenetic relative of the genus Enterococcus.

  9. Phylogenetic relationships among vietnamese cocoa accessions using a non-coding region of the chloroplast dna

    International Nuclear Information System (INIS)

    Ha, L.T.V.; Dung, T.N.; Phuoc, P.H.D.

    2017-01-01

    Cocoa cultivation has increased in tropical areas around the world, including Vietnam, due to the high demand of cocoa beans for chocolate production. The genetic diversity of cocoa genotypes is recognized to be complex, however, their phylogenetic relationships need to be clarified. The present study aimed to classify the cocoa genotypes, that are imported and cultivated in Vietnam, based on a chloroplast DNA region. Sixty-three Vietnamese Cocoa accessions were collected from different regions in Southern Vietnam. Their phylogenetic relationships were identified using the universal primers c-B49317 and d-A49855 from the chloroplast DNA region. The sequences were situated in the trnL intron genes which are identify the closest terrestrial plant species of the chloroplast genome. DNA sequences were determined and subjected to an analysis of the phylogenetic relationship using the maximum evolution method. The genetic analysis showed clustering of 63 cocoa accessions in three groups: the domestically cultivated Trinitario group, the Indigenous cultivars, and the cultivations from Peru. The analyzed sequencing data also illustrated that the TD accessions and CT accessions were related genetically closed. Based on those results the genetic relation between PA and NA accessions was established as the hybrid origins of the TD and CT accessions. Some foreign accessions, including UIT, SCA and IMC accessions were confirmed of their genetic relationship. The present study is the first report of phylogenetic relationships of Vietnamese cocoa collections. The cocoa program in Vietnam has been in development for thirty years. (author)

  10. Different relationships between temporal phylogenetic turnover and phylogenetic similarity and in two forests were detected by a new null model.

    Science.gov (United States)

    Huang, Jian-Xiong; Zhang, Jian; Shen, Yong; Lian, Ju-yu; Cao, Hong-lin; Ye, Wan-hui; Wu, Lin-fang; Bin, Yue

    2014-01-01

    Ecologists have been monitoring community dynamics with the purpose of understanding the rates and causes of community change. However, there is a lack of monitoring of community dynamics from the perspective of phylogeny. We attempted to understand temporal phylogenetic turnover in a 50 ha tropical forest (Barro Colorado Island, BCI) and a 20 ha subtropical forest (Dinghushan in southern China, DHS). To obtain temporal phylogenetic turnover under random conditions, two null models were used. The first shuffled names of species that are widely used in community phylogenetic analyses. The second simulated demographic processes with careful consideration on the variation in dispersal ability among species and the variations in mortality both among species and among size classes. With the two models, we tested the relationships between temporal phylogenetic turnover and phylogenetic similarity at different spatial scales in the two forests. Results were more consistent with previous findings using the second null model suggesting that the second null model is more appropriate for our purposes. With the second null model, a significantly positive relationship was detected between phylogenetic turnover and phylogenetic similarity in BCI at a 10 m×10 m scale, potentially indicating phylogenetic density dependence. This relationship in DHS was significantly negative at three of five spatial scales. This could indicate abiotic filtering processes for community assembly. Using variation partitioning, we found phylogenetic similarity contributed to variation in temporal phylogenetic turnover in the DHS plot but not in BCI plot. The mechanisms for community assembly in BCI and DHS vary from phylogenetic perspective. Only the second null model detected this difference indicating the importance of choosing a proper null model.

  11. Sequence comparison and phylogenetic analysis of core gene of ...

    African Journals Online (AJOL)

    Phylogenetic analysis suggests that our sequences are clustered with sequences reported from Japan. This is the first phylogenetic analysis of HCV core gene from Pakistani population. Our sequences and sequences from Japan are grouped into same cluster in the phylogenetic tree. Sequence comparison and ...

  12. SICLE: a high-throughput tool for extracting evolutionary relationships from phylogenetic trees

    Directory of Open Access Journals (Sweden)

    Dan F. DeBlasio

    2016-08-01

    Full Text Available We present the phylogeny analysis software SICLE (Sister Clade Extractor, an easy-to-use, high-throughput tool to describe the nearest neighbors to a node of interest in a phylogenetic tree as well as the support value for the relationship. The application is a command line utility that can be embedded into a phylogenetic analysis pipeline or can be used as a subroutine within another C++ program. As a test case, we applied this new tool to the published phylome of Salinibacter ruber, a species of halophilic Bacteriodetes, identifying 13 unique sister relationships to S. ruber across the 4,589 gene phylogenies. S. ruber grouped with bacteria, most often other Bacteriodetes, in the majority of phylogenies, but 91 phylogenies showed a branch-supported sister association between S. ruber and Archaea, an evolutionarily intriguing relationship indicative of horizontal gene transfer. This test case demonstrates how SICLE makes it possible to summarize the phylogenetic information produced by automated phylogenetic pipelines to rapidly identify and quantify the possible evolutionary relationships that merit further investigation. SICLE is available for free for noncommercial use at http://eebweb.arizona.edu/sicle/.

  13. SICLE: a high-throughput tool for extracting evolutionary relationships from phylogenetic trees.

    Science.gov (United States)

    DeBlasio, Dan F; Wisecaver, Jennifer H

    2016-01-01

    We present the phylogeny analysis software SICLE (Sister Clade Extractor), an easy-to-use, high-throughput tool to describe the nearest neighbors to a node of interest in a phylogenetic tree as well as the support value for the relationship. The application is a command line utility that can be embedded into a phylogenetic analysis pipeline or can be used as a subroutine within another C++ program. As a test case, we applied this new tool to the published phylome of Salinibacter ruber, a species of halophilic Bacteriodetes, identifying 13 unique sister relationships to S. ruber across the 4,589 gene phylogenies. S. ruber grouped with bacteria, most often other Bacteriodetes, in the majority of phylogenies, but 91 phylogenies showed a branch-supported sister association between S. ruber and Archaea, an evolutionarily intriguing relationship indicative of horizontal gene transfer. This test case demonstrates how SICLE makes it possible to summarize the phylogenetic information produced by automated phylogenetic pipelines to rapidly identify and quantify the possible evolutionary relationships that merit further investigation. SICLE is available for free for noncommercial use at http://eebweb.arizona.edu/sicle/.

  14. [Comparative leaf anatomy and phylogenetic relationships of 11 species of Laeliinae with emphasis on Brassavola (Orchidaceae)].

    Science.gov (United States)

    Noguera-Savelli, Eliana; Jáuregui, Damelis

    2011-09-01

    Brassavola inhabits a wide altitude range and habitat types from Northern Mexico to Northern Argentina. Classification schemes in plants have normally used vegetative and floral characters, but when species are very similar, as in this genus, conflicts arise in species delimitation, and alternative methods should be applied. In this study we explored the taxonomic and phylogenetic value of the anatomical structure of leaves in Brassavola; as ingroup, seven species of Brassavola were considered, and as an outgroup Guarianthe skinneri, Laelia anceps, Rhyncholaelia digbyana and Rhyncholaelia glauca were evaluated. Leaf anatomical characters were studied in freehand cross sections of the middle portion with a light microscope. Ten vegetative anatomical characters were selected and coded for the phylogenetic analysis. Phylogenetic reconstruction was carried out under maximum parsimony using the program NONA through WinClada. Overall, Brassavola species reveal a wide variety of anatomical characters, many of them associated with xeromorphic plants: thick cuticle, hypodermis and cells of the mesophyll with spiral thickenings in the secondary wall. Moreover, mesophyll is either homogeneous or heterogeneous, often with extravascular bundles of fibers near the epidermis at both terete and flat leaves. All vascular bundles are collateral, arranged in more than one row in the mesophyll. The phylogenetic analysis did not resolve internal relationships of the genus; we obtained a polytomy, indicating that the anatomical characters by themselves have little phylogenetic value in Brassavola. We concluded that few anatomical characters are phylogenetically important; however, they would provide more support to elucidate the phylogenetic relantionships in the Orchidaceae and other plant groups if they are used in conjunction with morphological and/or molecular characters.

  15. A Distance Measure for Genome Phylogenetic Analysis

    Science.gov (United States)

    Cao, Minh Duc; Allison, Lloyd; Dix, Trevor

    Phylogenetic analyses of species based on single genes or parts of the genomes are often inconsistent because of factors such as variable rates of evolution and horizontal gene transfer. The availability of more and more sequenced genomes allows phylogeny construction from complete genomes that is less sensitive to such inconsistency. For such long sequences, construction methods like maximum parsimony and maximum likelihood are often not possible due to their intensive computational requirement. Another class of tree construction methods, namely distance-based methods, require a measure of distances between any two genomes. Some measures such as evolutionary edit distance of gene order and gene content are computational expensive or do not perform well when the gene content of the organisms are similar. This study presents an information theoretic measure of genetic distances between genomes based on the biological compression algorithm expert model. We demonstrate that our distance measure can be applied to reconstruct the consensus phylogenetic tree of a number of Plasmodium parasites from their genomes, the statistical bias of which would mislead conventional analysis methods. Our approach is also used to successfully construct a plausible evolutionary tree for the γ-Proteobacteria group whose genomes are known to contain many horizontally transferred genes.

  16. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

    NARCIS (Netherlands)

    Timmermans, M.J.T.N.; Roelofs, D.; Mariën, A.G.H.; van Straalen, N.M.

    2008-01-01

    Background. In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an

  17. Revealing pancrustacean relationships : phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    NARCIS (Netherlands)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

    2008-01-01

    BACKGROUND: In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an

  18. The phylogenetic relationships of endemic Australasian trichostrongylin families (Nematoda: Strongylida) parasitic in marsupials and monotremes.

    Science.gov (United States)

    Chilton, Neil B; Huby-Chilton, Florence; Koehler, Anson V; Gasser, Robin B; Beveridge, Ian

    2015-10-01

    The phylogenetic relationships of the endemic (or largely endemic) Australasian trichostrongylin nematode families Herpetostrongylidae, Mackerrastrongylidae and Nicollinidae as well as endemic trichostrongylin nematodes currently placed in the families Trichostrongylidae and Molineidae were examined using the complete large subunit (28S) ribosomal RNA gene. The Herpetostrongylinae proved to be monophyletic. However, representatives of the Nicollinidae nested with the Herpetostrongylinae. The Mackerrastrongylidae was also a monophyletic group and included Peramelistrongylus, currently classified within the Trichostrongylidae. The Globocephaloidinae, currently considered to be a subfamily of the Herpetostrongylidae, was excluded from the family in the current analysis. Ollulanus and Libyostrongylus, included for the first time in a molecular phylogenetic analysis, were placed within the Trichostrongylidae. This study provided strong support for the Herpetostrongylidae (including within it the Nicollinidae, but excluding the Globocephaloidinae) and the Mackerrastrongylidae as monophyletic assemblages. Additional studies are required to resolve the relationships of the remaining endemic Australasian trichostrongylin genera.

  19. Contrasting HIV phylogenetic relationships and V3 loop protein similarities

    Energy Technology Data Exchange (ETDEWEB)

    Korber, B. (Los Alamos National Lab., NM (United States) Santa Fe Inst., NM (United States)); Myers, G. (Los Alamos National Lab., NM (United States))

    1992-01-01

    At least five distinct sequence subtypes of HIV-I can be identified from the major centers of the AMS pandemic. While it is too early to tell whether these subtypes are serologically or phenotypically similar or distinct in terms of properties such as pathogenicity and transmissibility, we can begin to investigate their potential for phenotypic divergence at the protein sequence level. Phylogenetic analysis of HIV DNA sequences is being widely used to examine lineages of different viral strains as they evolve and spread throughout the globe. We have identified five distinct HIV-1 subtypes (designated A-E), or clades, based on phylogenetic clustering patterns generated from genetic information from both the gag and envelope (env) genes from a spectrum of international isolates. Our initial observations concerning both HIV-1 and HIV-2 sequences indicate that conserved patterns in protein chemistry may indeed exist across distant lineages. Such patterns in V3 loop amino acid chemistry may be indicative of stable lineages or convergence within this highly variable, though functionally and immunologically critical, region. We think that there may be parallels between the apparently stable HIV-2 V3 lineage and the previously mentioned HIV-1 V3 loops which are very similar at the protein level despite being distant by cladistic analysis, and which do not possess the distinctive positively charged residues. Highly conserved V3 loop protein sequences are also encountered in SIVAGMs and CIVs (chimpanzee viral strains), which do not appear to be pathogenic in their wild-caught natural hosts.

  20. Contrasting HIV phylogenetic relationships and V3 loop protein similarities

    Energy Technology Data Exchange (ETDEWEB)

    Korber, B. [Los Alamos National Lab., NM (United States)]|[Santa Fe Inst., NM (United States); Myers, G. [Los Alamos National Lab., NM (United States)

    1992-12-31

    At least five distinct sequence subtypes of HIV-I can be identified from the major centers of the AMS pandemic. While it is too early to tell whether these subtypes are serologically or phenotypically similar or distinct in terms of properties such as pathogenicity and transmissibility, we can begin to investigate their potential for phenotypic divergence at the protein sequence level. Phylogenetic analysis of HIV DNA sequences is being widely used to examine lineages of different viral strains as they evolve and spread throughout the globe. We have identified five distinct HIV-1 subtypes (designated A-E), or clades, based on phylogenetic clustering patterns generated from genetic information from both the gag and envelope (env) genes from a spectrum of international isolates. Our initial observations concerning both HIV-1 and HIV-2 sequences indicate that conserved patterns in protein chemistry may indeed exist across distant lineages. Such patterns in V3 loop amino acid chemistry may be indicative of stable lineages or convergence within this highly variable, though functionally and immunologically critical, region. We think that there may be parallels between the apparently stable HIV-2 V3 lineage and the previously mentioned HIV-1 V3 loops which are very similar at the protein level despite being distant by cladistic analysis, and which do not possess the distinctive positively charged residues. Highly conserved V3 loop protein sequences are also encountered in SIVAGMs and CIVs (chimpanzee viral strains), which do not appear to be pathogenic in their wild-caught natural hosts.

  1. Phylogenetic relationship and virulence inference of Streptococcus Anginosus Group: curated annotation and whole-genome comparative analysis support distinct species designation

    Science.gov (United States)

    2013-01-01

    VNTR numbers that occurred over the course of one year. Conclusions The comparative genomic analysis of the SAG clarifies the phylogenetics of these bacteria and supports the distinct species classification. Numerous potential virulence determinants were identified and provide a foundation for further studies into SAG pathogenesis. Furthermore, the data may be used to enable the development of rapid diagnostic assays and therapeutics for these pathogens. PMID:24341328

  2. Resolving ambiguity in the phylogenetic relationship of genotypes A, B, and C of hepatitis B virus

    Science.gov (United States)

    2013-01-01

    Background Hepatitis B virus (HBV) is an important infectious agent that causes widespread concern because billions of people are infected by at least 8 different HBV genotypes worldwide. However, reconstruction of the phylogenetic relationship between HBV genotypes is difficult. Specifically, the phylogenetic relationships among genotypes A, B, and C are not clear from previous studies because of the confounding effects of genotype recombination. In order to clarify the evolutionary relationships, a rigorous approach is required that can effectively explore genetic sequences with recombination. Result In the present study, phylogenetic relationship of the HBV genotypes was reconstructed using a consensus phylogeny of phylogenetic trees of HBV genome segments. Reliability of the reconstructed phylogeny was extensively evaluated in agreements of local phylogenies of genome segments. The reconstructed phylogenetic tree revealed that HBV genotypes B and C had a closer phylogenetic relationship than genotypes A and B or A and C. Evaluations showed the consensus method was capable to reconstruct reliable phylogenetic relationship in the presence of recombinants. Conclusion The consensus method implemented in this study provides an alternative approach for reconstructing reliable phylogenetic relationships for viruses with possible genetic recombination. Our approach revealed the phylogenetic relationships of genotypes A, B, and C of HBV. PMID:23758960

  3. Phylogenetic analysis of fungal ABC transporters.

    Science.gov (United States)

    Kovalchuk, Andriy; Driessen, Arnold J M

    2010-03-16

    The superfamily of ABC proteins is among the largest known in nature. Its members are mainly, but not exclusively, involved in the transport of a broad range of substrates across biological membranes. Many contribute to multidrug resistance in microbial pathogens and cancer cells. The diversity of ABC proteins in fungi is comparable with those in multicellular animals, but so far fungal ABC proteins have barely been studied. We performed a phylogenetic analysis of the ABC proteins extracted from the genomes of 27 fungal species from 18 orders representing 5 fungal phyla thereby covering the most important groups. Our analysis demonstrated that some of the subfamilies of ABC proteins remained highly conserved in fungi, while others have undergone a remarkable group-specific diversification. Members of the various fungal phyla also differed significantly in the number of ABC proteins found in their genomes, which is especially reduced in the yeast S. cerevisiae and S. pombe. Data obtained during our analysis should contribute to a better understanding of the diversity of the fungal ABC proteins and provide important clues about their possible biological functions.

  4. Phylogenetic relationships of the South American Doradoidea (Ostariophysi: Siluriformes

    Directory of Open Access Journals (Sweden)

    José L. O. Birindelli

    Full Text Available A phylogenetic analysis based on 311 morphological characters is presented for most species of the Doradidae, all genera of the Auchenipteridae, and representatives of 16 other catfish families. The hypothesis that was derived from the six most parsimonious trees support the monophyly of the South American Doradoidea (Doradidae plus Auchenipteridae, as well as the monophyly of the clade Doradoidea plus the African Mochokidae. In addition, the clade with Sisoroidea plus Aspredinidae was considered sister to Doradoidea plus Mochokidae. Within the Auchenipteridae, the results support the monophyly of the Centromochlinae and Auchenipterinae. The latter is composed of Tocantinsia, and four monophyletic units, two small with Asterophysusand Liosomadoras, and Pseudotatiaand Pseudauchenipterus, respectively, and two large ones with the remaining genera. Within the Doradidae, parsimony analysis recovered Wertheimeriaas sister to Kalyptodoras, composing a clade sister to all remaining doradids, which include Franciscodorasand two monophyletic groups: Astrodoradinae (plus Acanthodorasand Agamyxis and Doradinae (new arrangement. Wertheimerinae, new subfamily, is described for Kalyptodoras and Wertheimeria. Doradinae is corroborated as monophyletic and composed of four groups, one including Centrochirand Platydoras, the other with the large-size species of doradids (except Oxydoras, another with Orinocodoras, Rhinodoras, and Rhynchodoras, and another with Oxydorasplus all the fimbriate-barbel doradids. Based on the results, the species of Opsodoras are included in Hemidoras; and Tenellus, new genus, is described to include Nemadoras trimaculatus, N. leporhinusand Nemadoras ternetzi. Due to conflicting hypotheses of the phylogenetic position of Acanthodoras, Agamyxis, and Franciscodoras, these are considered as incertae sedisin Doradidae. All suprageneric taxa of the Doradoidea are diagnosed based on synapomorphic morphological characteristics.

  5. Comparative phylogenetic analysis of intergenic spacers and small ...

    African Journals Online (AJOL)

    The phylogenetic analysis of test isolates included assessment of variation in sequences and length of IGS and SSU-rRNA genes with reference to 16 different microsporidian sequences. The results proved that IGS sequences have more variation than SSU-rRNA gene sequences. Analysis of phylogenetic trees reveal that ...

  6. Phylogenetic relationships within and among Brassica species from ...

    African Journals Online (AJOL)

    Consequently, two potentially susceptible B. napus accessions were identified. The high polymorphic information content (PIC) and number of phylogenetically informative bands established RAPD as a useful tool for phylogenetic reconstruction, quantification of genetic diversity for conservation, cultivar classification and ...

  7. Exploring the relationship between sequence similarity and accurate phylogenetic trees.

    Science.gov (United States)

    Cantarel, Brandi L; Morrison, Hilary G; Pearson, William

    2006-11-01

    We have characterized the relationship between accurate phylogenetic reconstruction and sequence similarity, testing whether high levels of sequence similarity can consistently produce accurate evolutionary trees. We generated protein families with known phylogenies using a modified version of the PAML/EVOLVER program that produces insertions and deletions as well as substitutions. Protein families were evolved over a range of 100-400 point accepted mutations; at these distances 63% of the families shared significant sequence similarity. Protein families were evolved using balanced and unbalanced trees, with ancient or recent radiations. In families sharing statistically significant similarity, about 60% of multiple sequence alignments were 95% identical to true alignments. To compare recovered topologies with true topologies, we used a score that reflects the fraction of clades that were correctly clustered. As expected, the accuracy of the phylogenies was greatest in the least divergent families. About 88% of phylogenies clustered over 80% of clades in families that shared significant sequence similarity, using Bayesian, parsimony, distance, and maximum likelihood methods. However, for protein families with short ancient branches (ancient radiation), only 30% of the most divergent (but statistically significant) families produced accurate phylogenies, and only about 70% of the second most highly conserved families, with median expectation values better than 10(-60), produced accurate trees. These values represent upper bounds on expected tree accuracy for sequences with a simple divergence history; proteins from 700 Giardia families, with a similar range of sequence similarities but considerably more gaps, produced much less accurate trees. For our simulated insertions and deletions, correct multiple sequence alignments did not perform much better than those produced by T-COFFEE, and including sequences with expressed sequence tag-like sequencing errors did not

  8. Penicillium simile sp. nov. revealed by morphological and phylogenetic analysis.

    Science.gov (United States)

    Davolos, Domenico; Pietrangeli, Biancamaria; Persiani, Anna Maria; Maggi, Oriana

    2012-02-01

    The morphology of three phenetically identical Penicillium isolates, collected from the bioaerosol in a restoration laboratory in Italy, displayed macro- and microscopic characteristics that were similar though not completely ascribable to Penicillium raistrickii. For this reason, a phylogenetic approach based on DNA sequencing analysis was performed to establish both the taxonomic status and the evolutionary relationships of these three peculiar isolates in relation to previously described species of the genus Penicillium. We used four nuclear loci (both rRNA and protein coding genes) that have previously proved useful for the molecular investigation of taxa belonging to the genus Penicillium at various evolutionary levels. The internal transcribed spacer region (ITS1-5.8S-ITS2), domains D1 and D2 of the 28S rDNA, a region of the tubulin beta chain gene (benA) and part of the calmodulin gene (cmd) were amplified by PCR and sequenced. Analysis of the rRNA genes and of the benA and cmd sequence data indicates the presence of three isogenic isolates belonging to a genetically distinct species of the genus Penicillium, here described and named Penicillium simile sp. nov. (ATCC MYA-4591(T)  = CBS 129191(T)). This novel species is phylogenetically different from P. raistrickii and other related species of the genus Penicillium (e.g. Penicillium scabrosum), from which it can be distinguished on the basis of morphological trait analysis.

  9. Phylogenetic relationships of Malaysia's long-tailed macaques, Macaca fascicularis, based on cytochrome b sequences.

    Science.gov (United States)

    Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir

    2014-01-01

    Phylogenetic relationships among Malaysia's long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo's population was distinguished from Peninsula's population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia's M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  10. Consequences of recombination on traditional phylogenetic analysis

    DEFF Research Database (Denmark)

    Schierup, M H; Hein, J

    2000-01-01

    We investigate the shape of a phylogenetic tree reconstructed from sequences evolving under the coalescent with recombination. The motivation is that evolutionary inferences are often made from phylogenetic trees reconstructed from population data even though recombination may well occur (mt......DNA or viral sequences) or does occur (nuclear sequences). We investigate the size and direction of biases when a single tree is reconstructed ignoring recombination. Standard software (PHYLIP) was used to construct the best phylogenetic tree from sequences simulated under the coalescent with recombination....... With recombination present, the length of terminal branches and the total branch length are larger, and the time to the most recent common ancestor smaller, than for a tree reconstructed from sequences evolving with no recombination. The effects are pronounced even for small levels of recombination that may...

  11. Relationships among North American and Japanese Laetiporus isolates inferred from molecular phylogenetics and single-spore incompatibility reactions

    Science.gov (United States)

    Mark T. Banik; Daniel L. Lindner; Yuko Ota; Tsutomu Hattori

    2010-01-01

    Relationships were investigated among North American and Japanese isolates of Laetiporus using phylogenetic analysis of ITS sequences and single-spore isolate incompatibility. Single-spore isolate pairings revealed no significant compatibility between North American and Japanese isolates. ITS analysis revealed 12 clades within the core ...

  12. Bryozoans are returning home: recolonization of freshwater ecosystems inferred from phylogenetic relationships.

    Science.gov (United States)

    Koletić, Nikola; Novosel, Maja; Rajević, Nives; Franjević, Damjan

    2015-01-01

    Bryozoans are aquatic invertebrates that inhabit all types of aquatic ecosystems. They are small animals that form large colonies by asexual budding. Colonies can reach the size of several tens of centimeters, while individual units within a colony are the size of a few millimeters. Each individual within a colony works as a separate zooid and is genetically identical to each other individual within the same colony. Most freshwater species of bryozoans belong to the Phylactolaemata class, while several species that tolerate brackish water belong to the Gymnolaemata class. Tissue samples for this study were collected in the rivers of Adriatic and Danube basin and in the wetland areas in the continental part of Croatia (Europe). Freshwater and brackish taxons of bryozoans were genetically analyzed for the purpose of creating phylogenetic relationships between freshwater and brackish taxons of the Phylactolaemata and Gymnolaemata classes and determining the role of brackish species in colonizing freshwater and marine ecosystems. Phylogenetic relationships inferred on the genes for 18S rRNA, 28S rRNA, COI, and ITS2 region confirmed Phylactolaemata bryozoans as radix bryozoan group. Phylogenetic analysis proved Phylactolaemata bryozoan's close relations with taxons from Phoronida phylum as well as the separation of the Lophopodidae family from other families within the Plumatellida genus. Comparative analysis of existing knowledge about the phylogeny of bryozoans and the expansion of known evolutionary hypotheses is proposed with the model of settlement of marine and freshwater ecosystems by the bryozoans group during their evolutionary past. In this case study, brackish bryozoan taxons represent a link for this ecological phylogenetic hypothesis. Comparison of brackish bryozoan species Lophopus crystallinus and Conopeum seurati confirmed a dual colonization of freshwater ecosystems throughout evolution of this group of animals.

  13. Phylogenetic relationships of typical antbirds (Thamnophilidae and test of incongruence based on Bayes factors

    Directory of Open Access Journals (Sweden)

    Nylander Johan AA

    2004-07-01

    Full Text Available Abstract Background The typical antbirds (Thamnophilidae form a monophyletic and diverse family of suboscine passerines that inhabit neotropical forests. However, the phylogenetic relationships within this assemblage are poorly understood. Herein, we present a hypothesis of the generic relationships of this group based on Bayesian inference analyses of two nuclear introns and the mitochondrial cytochrome b gene. The level of phylogenetic congruence between the individual genes has been investigated utilizing Bayes factors. We also explore how changes in the substitution models affected the observed incongruence between partitions of our data set. Results The phylogenetic analysis supports both novel relationships, as well as traditional groupings. Among the more interesting novel relationship suggested is that the Terenura antwrens, the wing-banded antbird (Myrmornis torquata, the spot-winged antshrike (Pygiptila stellaris and the russet antshrike (Thamnistes anabatinus are sisters to all other typical antbirds. The remaining genera fall into two major clades. The first includes antshrikes, antvireos and the Herpsilochmus antwrens, while the second clade consists of most antwren genera, the Myrmeciza antbirds, the "professional" ant-following antbirds, and allied species. Our results also support previously suggested polyphyly of Myrmotherula antwrens and Myrmeciza antbirds. The tests of phylogenetic incongruence, using Bayes factors, clearly suggests that allowing the gene partitions to have separate topology parameters clearly increased the model likelihood. However, changing a component of the nucleotide substitution model had much higher impact on the model likelihood. Conclusions The phylogenetic results are in broad agreement with traditional classification of the typical antbirds, but some relationships are unexpected based on external morphology. In these cases their true affinities may have been obscured by convergent evolution and

  14. Phylogenetic analysis using parsimony and likelihood methods.

    Science.gov (United States)

    Yang, Z

    1996-02-01

    The assumptions underlying the maximum-parsimony (MP) method of phylogenetic tree reconstruction were intuitively examined by studying the way the method works. Computer simulations were performed to corroborate the intuitive examination. Parsimony appears to involve very stringent assumptions concerning the process of sequence evolution, such as constancy of substitution rates between nucleotides, constancy of rates across nucleotide sites, and equal branch lengths in the tree. For practical data analysis, the requirement of equal branch lengths means similar substitution rates among lineages (the existence of an approximate molecular clock), relatively long interior branches, and also few species in the data. However, a small amount of evolution is neither a necessary nor a sufficient requirement of the method. The difficulties involved in the application of current statistical estimation theory to tree reconstruction were discussed, and it was suggested that the approach proposed by Felsenstein (1981, J. Mol. Evol. 17: 368-376) for topology estimation, as well as its many variations and extensions, differs fundamentally from the maximum likelihood estimation of a conventional statistical parameter. Evidence was presented showing that the Felsenstein approach does not share the asymptotic efficiency of the maximum likelihood estimator of a statistical parameter. Computer simulations were performed to study the probability that MP recovers the true tree under a hierarchy of models of nucleotide substitution; its performance relative to the likelihood method was especially noted. The results appeared to support the intuitive examination of the assumptions underlying MP. When a simple model of nucleotide substitution was assumed to generate data, the probability that MP recovers the true topology could be as high as, or even higher than, that for the likelihood method. When the assumed model became more complex and realistic, e.g., when substitution rates were

  15. BioMatriX: Sequence analysis, structure visualization, phylogenetics ...

    African Journals Online (AJOL)

    bmx-biomatrix.blogspot.com) developed for biological science community to augment scientific research regarding genomics, proteomics, phylogenetics and linkage analysis in one platform. BioMatriX offers multi-functional services to perform ...

  16. Phylogenetic analysis of anemone fishes of the Persian Gulf using ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-06-17

    Jun 17, 2008 ... genetic diversity among samples was investigated by phylogenetic analysis. Results show that there is ... more about the living organisms found in this region. Many marine ... Kish (modified from Pous et al., 2004). Table 2.

  17. [Telomere length and phylogenetic relationship of Baikal and Siberian planarians (Turbellaria, Tricladida)].

    Science.gov (United States)

    Koroleva, A G; Evtushenko, E V; Timoshkin, O A; Vershinin, A V; Kiril'chik, S V

    2013-01-01

    Dynamics of the telomeric DNA (tDNA) and the phylogeny of the Baikal and Siberian planarians have been studied based on the analysis of the 18S rDNA and beta-actin gene fragments. A relationship between tDNA and the planarians size has been demonstrated. Giant planarians with a minor exception have longer tDNA than little planarians. Phylogenetic affinity between the species that have the stretched tracks of tDNA, big size and similar habitats may indicate possible role of tDNA in the development of the indefinite regenerative capacity of planarians.

  18. Phylogenetic analyses of Vitis (Vitaceae) based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids.

    Science.gov (United States)

    Jansen, Robert K; Kaittanis, Charalambos; Saski, Christopher; Lee, Seung-Bum; Tomkins, Jeffrey; Alverson, Andrew J; Daniell, Henry

    2006-04-09

    The Vitaceae (grape) is an economically important family of angiosperms whose phylogenetic placement is currently unresolved. Recent phylogenetic analyses based on one to several genes have suggested several alternative placements of this family, including sister to Caryophyllales, asterids, Saxifragales, Dilleniaceae or to rest of rosids, though support for these different results has been weak. There has been a recent interest in using complete chloroplast genome sequences for resolving phylogenetic relationships among angiosperms. These studies have clarified relationships among several major lineages but they have also emphasized the importance of taxon sampling and the effects of different phylogenetic methods for obtaining accurate phylogenies. We sequenced the complete chloroplast genome of Vitis vinifera and used these data to assess relationships among 27 angiosperms, including nine taxa of rosids. The Vitis vinifera chloroplast genome is 160,928 bp in length, including a pair of inverted repeats of 26,358 bp that are separated by small and large single copy regions of 19,065 bp and 89,147 bp, respectively. The gene content and order of Vitis is identical to many other unrearranged angiosperm chloroplast genomes, including tobacco. Phylogenetic analyses using maximum parsimony and maximum likelihood were performed on DNA sequences of 61 protein-coding genes for two datasets with 28 or 29 taxa, including eight or nine taxa from four of the seven currently recognized major clades of rosids. Parsimony and likelihood phylogenies of both data sets provide strong support for the placement of Vitaceae as sister to the remaining rosids. However, the position of the Myrtales and support for the monophyly of the eurosid I clade differs between the two data sets and the two methods of analysis. In parsimony analyses, the inclusion of Gossypium is necessary to obtain trees that support the monophyly of the eurosid I clade. However, maximum likelihood analyses place

  19. Phylogenetic analyses of Vitis (Vitaceae based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids

    Directory of Open Access Journals (Sweden)

    Alverson Andrew J

    2006-04-01

    Full Text Available Abstract Background The Vitaceae (grape is an economically important family of angiosperms whose phylogenetic placement is currently unresolved. Recent phylogenetic analyses based on one to several genes have suggested several alternative placements of this family, including sister to Caryophyllales, asterids, Saxifragales, Dilleniaceae or to rest of rosids, though support for these different results has been weak. There has been a recent interest in using complete chloroplast genome sequences for resolving phylogenetic relationships among angiosperms. These studies have clarified relationships among several major lineages but they have also emphasized the importance of taxon sampling and the effects of different phylogenetic methods for obtaining accurate phylogenies. We sequenced the complete chloroplast genome of Vitis vinifera and used these data to assess relationships among 27 angiosperms, including nine taxa of rosids. Results The Vitis vinifera chloroplast genome is 160,928 bp in length, including a pair of inverted repeats of 26,358 bp that are separated by small and large single copy regions of 19,065 bp and 89,147 bp, respectively. The gene content and order of Vitis is identical to many other unrearranged angiosperm chloroplast genomes, including tobacco. Phylogenetic analyses using maximum parsimony and maximum likelihood were performed on DNA sequences of 61 protein-coding genes for two datasets with 28 or 29 taxa, including eight or nine taxa from four of the seven currently recognized major clades of rosids. Parsimony and likelihood phylogenies of both data sets provide strong support for the placement of Vitaceae as sister to the remaining rosids. However, the position of the Myrtales and support for the monophyly of the eurosid I clade differs between the two data sets and the two methods of analysis. In parsimony analyses, the inclusion of Gossypium is necessary to obtain trees that support the monophyly of the eurosid I clade

  20. The complete mitochondrial genome of Sesarmops sinensis reveals gene rearrangements and phylogenetic relationships in Brachyura.

    Science.gov (United States)

    Tang, Bo-Ping; Xin, Zhao-Zhe; Liu, Yu; Zhang, Dai-Zhen; Wang, Zheng-Fei; Zhang, Hua-Bin; Chai, Xin-Yue; Zhou, Chun-Lin; Liu, Qiu-Ning

    2017-01-01

    Mitochondrial genome (mitogenome) is very important to understand molecular evolution and phylogenetics. Herein, in this study, the complete mitogenome of Sesarmops sinensis was reported. The mitogenome was 15,905 bp in size, and contained 13 protein-coding genes (PCGs), two ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, and a control region (CR). The AT skew and the GC skew are both negative in the mitogenomes of S. sinensis. The nucleotide composition of the S. sinensis mitogenome was also biased toward A + T nucleotides (75.7%). All tRNA genes displayed a typical mitochondrial tRNA cloverleaf structure, except for the trnS1 gene, which lacked a dihydroxyuridine arm. S. sinensis exhibits a novel rearrangement compared with the Pancrustacean ground pattern and other Brachyura species. Based on the 13 PCGs, the phylogenetic analysis showed that S. sinensis and Sesarma neglectum were clustered on one branch with high nodal support values, indicating that S. sinensis and S. neglectum have a sister group relationship. The group (S. sinensis + S. neglectum) was sister to (Parasesarmops tripectinis + Metopaulias depressus), suggesting that S. sinensis belongs to Grapsoidea, Sesarmidae. Phylogenetic trees based on amino acid sequences and nucleotide sequences of mitochondrial 13 PCGs using BI and ML respectively indicate that section Eubrachyura consists of four groups clearly. The resulting phylogeny supports the establishment of a separate subsection Potamoida. These four groups correspond to four subsections of Raninoida, Heterotremata, Potamoida, and Thoracotremata.

  1. Delineation of Streptococcus dysgalactiae, its subspecies, and its clinical and phylogenetic relationship to Streptococcus pyogenes

    DEFF Research Database (Denmark)

    Jensen, Anders; Kilian, Mogens

    2011-01-01

    The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered...

  2. [Phylogenetic relationships of the species of Oxytropis DC. subg. Oxytropis and Phacoxytropis (Fabaceae) from Asian Russia inferred from the nucleotide sequence analysis of the intergenic spacers of the chloroplast genome].

    Science.gov (United States)

    Kholina, A B; Kozyrenko, M M; Artyukova, E V; Sandanov, D V; Andrianova, E A

    2016-08-01

    The nucleotide sequence analysis of trnH–psbA, trnL–trnF, and trnS–trnG intergenic spacer regions of chloroplast DNA performed in the representatives of the genus Oxytropis from Asian Russia provided clarification of the phylogenetic relationships of some species and sections in the subgenera Oxytropis and Phacoxytropis and in the genus Oxytropis as a whole. Only the section Mesogaea corresponds to the subgenus Phacoxytropis, while the section Janthina of the same subgenus groups together with the sections of the subgenus Oxytropis. The sections Chrysantha and Ortholoma of the subgenus Oxytropis are not only closely related to each other, but together with the section Mesogaea, they are grouped into the subgenus Phacoxytropis. It seems likely that the sections Chrysantha and Ortholoma should be assigned to the subgenus Phacoxytropis, and the section Janthina should be assigned to the subgenus Oxytropis. The molecular differences were identified between O. coerulea and O. mandshurica from the section Janthina that were indicative of considerable divergence of their chloroplast genomes and the species independence of the taxa. The species independence of O. czukotica belonging to the section Arctobia was also confirmed.

  3. Phylogenetic relationships among populations of Pristurus rupestris Blanford,1874 (Sauria: Sphaerodactylidae) in southern Iran

    OpenAIRE

    YOUSOFI, SUGOL; POUYANI, ESKANDAR RASTEGAR; HOJATI, VIDA

    2015-01-01

    We examined intraspecific relationships of the subspecies Pristurus rupestris iranicus from the northern Persian Gulf area (Hormozgan, Bushehr, and Sistan and Baluchestan provinces). Phylogenetic relationships among these samples were estimated based on the mitochondrial cytochrome b gene. We used three methods of phylogenetic tree reconstruction (maximum likelihood, maximum parsimony, and Bayesian inference). The sampled populations were divided into 5 clades but exhibit little genetic diver...

  4. Assessing the relationships between phylogenetic and functional singularities in sharks (Chondrichthyes).

    Science.gov (United States)

    Cachera, Marie; Le Loc'h, François

    2017-08-01

    The relationships between diversity and ecosystem functioning have become a major focus of science. A crucial issue is to estimate functional diversity, as it is intended to impact ecosystem dynamics and stability. However, depending on the ecosystem, it may be challenging or even impossible to directly measure ecological functions and thus functional diversity. Phylogenetic diversity was recently under consideration as a proxy for functional diversity. Phylogenetic diversity is indeed supposed to match functional diversity if functions are conservative traits along evolution. However, in case of adaptive radiation and/or evolutive convergence, a mismatch may appear between species phylogenetic and functional singularities. Using highly threatened taxa, sharks, this study aimed to explore the relationships between phylogenetic and functional diversities and singularities. Different statistical computations were used in order to test both methodological issue (phylogenetic reconstruction) and overall a theoretical questioning: the predictive power of phylogeny for function diversity. Despite these several methodological approaches, a mismatch between phylogeny and function was highlighted. This mismatch revealed that (i) functions are apparently nonconservative in shark species, and (ii) phylogenetic singularity is not a proxy for functional singularity. Functions appeared to be not conservative along the evolution of sharks, raising the conservational challenge to identify and protect both phylogenetic and functional singular species. Facing the current rate of species loss, it is indeed of major importance to target phylogenetically singular species to protect genetic diversity and also functionally singular species in order to maintain particular functions within ecosystem.

  5. Phylogenetic Analysis of the Bee Tribe Anthidiini | Combey | Journal ...

    African Journals Online (AJOL)

    The phylogenetic relationships among members of long tongue bee tribe Anthidiini (Megachilidae: Megachilinae) were investigated at the Department of Entomology and Wildlife, University of Cape Coast (Ghana) and the Agricultural Research Council, Pretoria (South Af-rica) from July, 2006 to May, 2007. Ten museums ...

  6. Complete mitochondrial genomes elucidate phylogenetic relationships of the deep-sea octocoral families Coralliidae and Paragorgiidae

    Science.gov (United States)

    Figueroa, Diego F.; Baco, Amy R.

    2014-01-01

    In the past decade, molecular phylogenetic analyses of octocorals have shown that the current morphological taxonomic classification of these organisms needs to be revised. The latest phylogenetic analyses show that most octocorals can be divided into three main clades. One of these clades contains the families Coralliidae and Paragorgiidae. These families share several taxonomically important characters and it has been suggested that they may not be monophyletic; with the possibility of the Coralliidae being a derived branch of the Paragorgiidae. Uncertainty exists not only in the relationship of these two families, but also in the classification of the two genera that make up the Coralliidae, Corallium and Paracorallium. Molecular analyses suggest that the genus Corallium is paraphyletic, and it can be divided into two main clades, with the Paracorallium as members of one of these clades. In this study we sequenced the whole mitochondrial genome of five species of Paragorgia and of five species of Corallium to use in a phylogenetic analysis to achieve two main objectives; the first to elucidate the phylogenetic relationship between the Paragorgiidae and Coralliidae and the second to determine whether the genera Corallium and Paracorallium are monophyletic. Our results show that other members of the Coralliidae share the two novel mitochondrial gene arrangements found in a previous study in Corallium konojoi and Paracorallium japonicum; and that the Corallium konojoi arrangement is also found in the Paragorgiidae. Our phylogenetic reconstruction based on all the protein coding genes and ribosomal RNAs of the mitochondrial genome suggest that the Coralliidae are not a derived branch of the Paragorgiidae, but rather a monophyletic sister branch to the Paragorgiidae. While our manuscript was in review a study was published using morphological data and several fragments from mitochondrial genes to redefine the taxonomy of the Coralliidae. Paracorallium was subsumed

  7. Phylogenetic relationships among anuran trypanosomes as revealed by riboprinting.

    Science.gov (United States)

    Clark, C G; Martin, D S; Diamond, L S

    1995-01-01

    Twenty trypanosome isolates from Anura (frogs and toads) assigned to several species were characterized by riboprinting-restriction enzyme digestion of polymerase chain reaction amplified small subunit ribosomal RNA genes. Restriction site polymorphisms allowed distinction of all the recognized species and no intraspecific variation in riboprint patterns was detected. Phylogenetic reconstruction using parsimony and distance estimates based on restriction fragment comigration showed Trypanosoma chattoni to be only distantly related to the other species, while T. ranarum and T. fallisi appear to be sister taxa despite showing non-overlapping host specificities.

  8. Supermatrix and species tree methods resolve phylogenetic relationships within the big cats, Panthera (Carnivora: Felidae).

    Science.gov (United States)

    Davis, Brian W; Li, Gang; Murphy, William J

    2010-07-01

    The pantherine lineage of cats diverged from the remainder of modern Felidae less than 11 million years ago and consists of the five big cats of the genus Panthera, the lion, tiger, jaguar, leopard, and snow leopard, as well as the closely related clouded leopard. A significant problem exists with respect to the precise phylogeny of these highly threatened great cats. Despite multiple publications on the subject, no two molecular studies have reconstructed Panthera with the same topology. These evolutionary relationships remain unresolved partially due to the recent and rapid radiation of pantherines in the Pliocene, individual speciation events occurring within less than 1 million years, and probable introgression between lineages following their divergence. We provide an alternative, highly supported interpretation of the evolutionary history of the pantherine lineage using novel and published DNA sequence data from the autosomes, both sex chromosomes and the mitochondrial genome. New sequences were generated for 39 single-copy regions of the felid Y chromosome, as well as four mitochondrial and four autosomal gene segments, totaling 28.7 kb. Phylogenetic analysis of these new data, combined with all published data in GenBank, highlighted the prevalence of phylogenetic disparities stemming either from the amplification of a mitochondrial to nuclear translocation event (numt), or errors in species identification. Our 47.6 kb combined dataset was analyzed as a supermatrix and with respect to individual partitions using maximum likelihood and Bayesian phylogenetic inference, in conjunction with Bayesian Estimation of Species Trees (BEST) which accounts for heterogeneous gene histories. Our results yield a robust consensus topology supporting the monophyly of lion and leopard, with jaguar sister to these species, as well as a sister species relationship of tiger and snow leopard. These results highlight new avenues for the study of speciation genomics and

  9. Assessment of genetic diversity and phylogenetic relationships of Korean native chicken breeds using microsatellite markers

    Directory of Open Access Journals (Sweden)

    Joo Hee Seo

    2017-10-01

    Full Text Available Objective This study was conducted to investigate the basic information on genetic structure and characteristics of Korean Native chickens (NC and foreign breeds through the analysis of the pure chicken populations and commercial chicken lines of the Hanhyup Company which are popular in the NC market, using the 20 microsatellite markers. Methods In this study, the genetic diversity and phylogenetic relationships of 445 NC from five different breeds (NC, Leghorn [LH], Cornish [CS], Rhode Island Red [RIR], and Hanhyup [HH] commercial line were investigated by performing genotyping using 20 microsatellite markers. Results The highest genetic distance was observed between RIR and LH (18.9%, whereas the lowest genetic distance was observed between HH and NC (2.7%. In the principal coordinates analysis (PCoA illustrated by the first component, LH was clearly separated from the other groups. The correspondence analysis showed close relationship among individuals belonging to the NC, CS, and HH lines. From the STRUCTURE program, the presence of 5 clusters was detected and it was found that the proportion of membership in the different clusters was almost comparable among the breeds with the exception of one breed (HH, although it was highest in LH (0.987 and lowest in CS (0.578. For the cluster 1 it was high in HH (0.582 and in CS (0.368, while for the cluster 4 it was relatively higher in HH (0.392 than other breeds. Conclusion Our study showed useful genetic diversity and phylogenetic relationship data that can be utilized for NC breeding and development by the commercial chicken industry to meet consumer demands.

  10. Unraveling the phylogenetic relationships of the Eccoptochilinae, an enigmatic array of ordovician cheirurid trilobites.

    Directory of Open Access Journals (Sweden)

    I Wesley Gapp

    Full Text Available The Cheiruridae are a diverse group of trilobites and several subfamilies within the clade have been the focus of recent phylogenetic studies. This paper focuses on the relationships of one of those subfamilies, the Ordovician Eccoptochilinae. We analyze sixteen species from six genera within the traditionally defined group, using the pilekiid Anacheirurus frederici as an outgroup. To assess the monophyly of the Eccoptochilinae seven sphaerexochine species, Kawina arnoldi, Sphaerexochus arenosus, S. atacius, S. latifrons, S. mirus, S. parvus, and S. scabridus were included in the analysis as well. The results of this analysis show that the genus Eccoptochile represents a paraphyletic grade and species traditionally assigned to Parasphaerexochus and Skelipyx plot within Pseudosphaerexochus. Also, representative species of Sphaerexochinae plot within the traditionally defined Eccoptochilinae, suggesting Eccoptochilinae itself is paraphyletic. To resolve this, we propose all species of Pseudosphaerexochus be placed within Sphaerexochinae and Eccoptochilinae be restricted to a monotypic Eccoptochile clavigera.

  11. Genetic diversity and phylogenetic relationship in different genotypes of cotton for future breeding

    Directory of Open Access Journals (Sweden)

    Jehan

    2017-11-01

    Full Text Available Background: To make the plants well adapted and more resistant to diseases and other environmental stresses there is always a need to improve the quality of plant’s genome i.e. to increase its genetic diversity. Methods: In the present study six variety and six lines of cotton were investigated for their genetic diversity and phylogenetic relationship. For this purpose 35 different RAPD primers obtained from the Gene Link Technologies, USA were used. Results: Among 35 RAPD primers, 13 primers produced reproducible PCR bands while the rest failed to show any amplification product. Our results indicated that the total count of the reproducible bands was 670 and polymorphic loci were counted to be 442 which constitute 66% of total loci. Phylogenetic analysis revealed two major groups each consists of 7 and 5 genotypes respectively. Genotypes Lp1 and Tp4 were placed at maximum genetic distance and in separate groups and could be utilized for future cotton breeding. Conclusions: RAPD analysis is a cheaper and time saving technique for the determination of genetic diversity of different cotton genotypes. Cotton genotype Lp1 and Tp4 could be the best candidates for future breeding programs as both genotypes are genetically distant from each other.

  12. TREEFINDER: a powerful graphical analysis environment for molecular phylogenetics

    Directory of Open Access Journals (Sweden)

    von Haeseler Arndt

    2004-06-01

    Full Text Available Abstract Background Most analysis programs for inferring molecular phylogenies are difficult to use, in particular for researchers with little programming experience. Results TREEFINDER is an easy-to-use integrative platform-independent analysis environment for molecular phylogenetics. In this paper the main features of TREEFINDER (version of April 2004 are described. TREEFINDER is written in ANSI C and Java and implements powerful statistical approaches for inferring gene tree and related analyzes. In addition, it provides a user-friendly graphical interface and a phylogenetic programming language. Conclusions TREEFINDER is a versatile framework for analyzing phylogenetic data across different platforms that is suited both for exploratory as well as advanced studies.

  13. BLAST-EXPLORER helps you building datasets for phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Claverie Jean-Michel

    2010-01-01

    Full Text Available Abstract Background The right sampling of homologous sequences for phylogenetic or molecular evolution analyses is a crucial step, the quality of which can have a significant impact on the final interpretation of the study. There is no single way for constructing datasets suitable for phylogenetic analysis, because this task intimately depends on the scientific question we want to address, Moreover, database mining softwares such as BLAST which are routinely used for searching homologous sequences are not specifically optimized for this task. Results To fill this gap, we designed BLAST-Explorer, an original and friendly web-based application that combines a BLAST search with a suite of tools that allows interactive, phylogenetic-oriented exploration of the BLAST results and flexible selection of homologous sequences among the BLAST hits. Once the selection of the BLAST hits is done using BLAST-Explorer, the corresponding sequence can be imported locally for external analysis or passed to the phylogenetic tree reconstruction pipelines available on the Phylogeny.fr platform. Conclusions BLAST-Explorer provides a simple, intuitive and interactive graphical representation of the BLAST results and allows selection and retrieving of the BLAST hit sequences based a wide range of criterions. Although BLAST-Explorer primarily aims at helping the construction of sequence datasets for further phylogenetic study, it can also be used as a standard BLAST server with enriched output. BLAST-Explorer is available at http://www.phylogeny.fr

  14. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  15. Phylogenetic relationships and divergence dates of softshell turtles (Testudines: Trionychidae) inferred from complete mitochondrial genomes.

    Science.gov (United States)

    Li, H; Liu, J; Xiong, L; Zhang, H; Zhou, H; Yin, H; Jing, W; Li, J; Shi, Q; Wang, Y; Liu, J; Nie, L

    2017-05-01

    The softshell turtles (Trionychidae) are one of the most widely distributed reptile groups in the world, and fossils have been found on all continents except Antarctica. The phylogenetic relationships among members of this group have been previously studied; however, disagreements regarding its taxonomy, its phylogeography and divergence times are still poorly understood as well. Here, we present a comprehensive mitogenomic study of softshell turtles. We sequenced the complete mitochondrial genomes of 10 softshell turtles, in addition to the GenBank sequence of Dogania subplana, Lissemys punctata, Trionyx triunguis, which cover all extant genera within Trionychidae except for Cyclanorbis and Cycloderma. These data were combined with other mitogenomes of turtles for phylogenetic analyses. Divergence time calibration and ancestral reconstruction were calculated using BEAST and RASP software, respectively. Our phylogenetic analyses indicate that Trionychidae is the sister taxon of Carettochelyidae, and support the monophyly of Trionychinae and Cyclanorbinae, which is consistent with morphological data and molecular analysis. Our phylogenetic analyses have established a sister taxon relationship between the Asian Rafetus and the Asian Palea + Pelodiscus + Dogania + Nilssonia + Amyda, whereas a previous study grouped the Asian Rafetus with the American Apalone. The results of divergence time estimates and area ancestral reconstruction show that extant Trionychidae originated in Asia at around 108 million years ago (MA), and radiations mainly occurred during two warm periods, namely Late Cretaceous-Early Eocene and Oligocene. By combining the estimated divergence time and the reconstructed ancestral area of softshell turtles, we determined that the dispersal of softshell turtles out of Asia may have taken three routes. Furthermore, the times of dispersal seem to be in agreement with the time of the India-Asia collision and opening of the Bering Strait, which

  16. Nuclear and cpDNA sequences combined provide strong inference of higher phylogenetic relationships in the phlox family (Polemoniaceae).

    Science.gov (United States)

    Johnson, Leigh A; Chan, Lauren M; Weese, Terri L; Busby, Lisa D; McMurry, Samuel

    2008-09-01

    Members of the phlox family (Polemoniaceae) serve as useful models for studying various evolutionary and biological processes. Despite its biological importance, no family-wide phylogenetic estimate based on multiple DNA regions with complete generic sampling is available. Here, we analyze one nuclear and five chloroplast DNA sequence regions (nuclear ITS, chloroplast matK, trnL intron plus trnL-trnF intergeneric spacer, and the trnS-trnG, trnD-trnT, and psbM-trnD intergenic spacers) using parsimony and Bayesian methods, as well as assessments of congruence and long branch attraction, to explore phylogenetic relationships among 84 ingroup species representing all currently recognized Polemoniaceae genera. Relationships inferred from the ITS and concatenated chloroplast regions are similar overall. A combined analysis provides strong support for the monophyly of Polemoniaceae and subfamilies Acanthogilioideae, Cobaeoideae, and Polemonioideae. Relationships among subfamilies, and thus for the precise root of Polemoniaceae, remain poorly supported. Within the largest subfamily, Polemonioideae, four clades corresponding to tribes Polemonieae, Phlocideae, Gilieae, and Loeselieae receive strong support. The monogeneric Polemonieae appears sister to Phlocideae. Relationships within Polemonieae, Phlocideae, and Gilieae are mostly consistent between analyses and data permutations. Many relationships within Loeselieae remain uncertain. Overall, inferred phylogenetic relationships support a higher-level classification for Polemoniaceae proposed in 2000.

  17. Genetic variation and phylogenetic relationships of the ectomycorrhizal Floccularia luteovirens on the Qinghai-Tibet Plateau.

    Science.gov (United States)

    Xing, Rui; Gao, Qing-Bo; Zhang, Fa-Qi; Fu, Peng-Cheng; Wang, Jiu-Li; Yan, Hui-Ying; Chen, Shi-Long

    2017-08-01

    Floccularia luteovirens, as an ectomycorrhizal fungus, is widely distributed in the Qinghai-Tibet Plateau. As an edible fungus, it is famous for its unique flavor. Former studies mainly focus on the chemical composition and genetic structure of this species. However, the phylogenetic relationship between genotypes remains unknown. In this study, the genetic variation and phylogenetic relationship between the genotypes of F. luteovirens in Qinghai-Tibet Plateau was estimated through the analysis on two protein-coding genes (rpb1 and ef-1α) from 398 individuals collected from 24 wild populations. The sample covered the entire range of this species during all the growth seasons from 2011 to 2015. 13 genotypes were detected and moderate genetic diversity was revealed. Based on the results of network analysis, the maximum likelihood (ML), maximum parsimony (MP), and Bayesian inference (BI) analyses, the genotypes H-1, H-4, H-6, H-8, H-10, and H-11 were grouped into one clade. Additionally, a relatively higher genotype diversity (average h value is 0.722) and unique genotypes in the northeast edge of Qinghai- Tibet plateau have been found, combined with the results of mismatch analysis and neutrality tests indicated that Southeast Qinghai-Tibet plateau was a refuge for F. luteovirens during the historical geological or climatic events (uplifting of the Qinghai-Tibet Plateau or Last Glacial Maximum). Furthermore, the present distribution of the species on the Qinghai-Tibet plateau has resulted from the recent population expansion. Our findings provide a foundation for the future study of the evolutionary history and the speciation of this species.

  18. Current Understanding of Ecdysozoa and its Internal Phylogenetic Relationships.

    Science.gov (United States)

    Giribet, Gonzalo; Edgecombe, Gregory D

    2017-09-01

    Twenty years after its proposal, the monophyly of molting protostomes-Ecdysozoa-is a well-corroborated hypothesis, but the interrelationships of its major subclades are more ambiguous than is commonly appreciated. Morphological and molecular support for arthropods, onychophorans and tardigrades as a clade (Panarthropoda) continues to be challenged by a grouping of tardigrades with Nematoida in some molecular analyses, although onychophorans are consistently recovered as the sister group of arthropods. The status of Cycloneuralia and Scalidophora, each proposed by morphologists in the 1990s and widely employed in textbooks, is in flux: Cycloneuralia is typically non-monophyletic in molecular analyses, and Scalidophora is either contradicted or incompletely tested because of limited genomic and transcriptomic data for Loricifera, Kinorhyncha, and Priapulida. However, novel genomic data across Ecdysozoa should soon be available to tackle these difficult phylogenetic questions. The Cambrian fossil record indicates crown-group members of various ecdysozoan phyla as well as stem-group taxa that assist with reconstructing the most recent common ancestor of panarthropods and cycloneuralians. © The Author 2017. Published by Oxford University Press on behalf of the Society for Integrative and Comparative Biology. All rights reserved. For permissions please email: journals.permissions@oup.com.

  19. The phylogenetic relationships of basal archosauromorphs, with an emphasis on the systematics of proterosuchian archosauriforms

    Science.gov (United States)

    2016-01-01

    The early evolution of archosauromorphs during the Permo-Triassic constitutes an excellent empirical case study to shed light on evolutionary radiations in deep time and the timing and processes of recovery of terrestrial faunas after a mass extinction. However, macroevolutionary studies of early archosauromorphs are currently limited by poor knowledge of their phylogenetic relationships. In particular, one of the main early archosauromorph groups that need an exhaustive phylogenetic study is “Proterosuchia,” which as historically conceived includes members of both Proterosuchidae and Erythrosuchidae. A new data matrix composed of 96 separate taxa (several of them not included in a quantitative phylogenetic analysis before) and 600 osteological characters was assembled and analysed to generate a comprehensive higher-level phylogenetic hypothesis of basal archosauromorphs and shed light on the species-level interrelationships of taxa historically identified as proterosuchian archosauriforms. The results of the analysis using maximum parsimony include a polyphyletic “Prolacertiformes” and “Protorosauria,” in which the Permian Aenigmastropheus and Protorosaurus are the most basal archosauromorphs. The enigmatic choristoderans are either found as the sister-taxa of all other lepidosauromorphs or archosauromorphs, but consistently placed within Sauria. Prolacertids, rhynchosaurs, allokotosaurians and tanystropheids are the major successive sister clades of Archosauriformes. The Early Triassic Tasmaniosaurus is recovered as the sister-taxon of Archosauriformes. Proterosuchidae is unambiguosly restricted to five species that occur immediately after and before the Permo-Triassic boundary, thus implying that they are a short-lived “disaster” clade. Erythrosuchidae is composed of eight nominal species that occur during the Early and Middle Triassic. “Proterosuchia” is polyphyletic, in which erythrosuchids are more closely related to Euparkeria and more

  20. [Irritable bowel syndrome: frequency and phylogenetic relationship of Blastocystis sp. from Mexican patients].

    Science.gov (United States)

    Ramírez-Miranda, M E; Jiménez-González, D E; Rodríguez-Campa, M E; González-Angulo, A; Hernández-Castellanos, R; Sara Arroyo-Escalante, A; Romero-Valdovinos, M; Martínez-Hernández, F; Flisser, A; Maravilla, P

    2011-01-01

    Recent studies reported increased presence of Blastocystis in patients with Irritable Bowel Syndrome (IBS) and an etiologic role has been proposed. The pathogenic role of Blastocystis is controversial, because it is frequently found not only in individuals with enteric symptoms but also in healthy and asymptomatic subjects. Furthermore, there are few studies of blastocistosis in Mexico. To assess the frequency of Blastocystis sp. in IBS patients using molecular techniques and to describe its phylogenetic relationship with sequences of other countries. IBS patients according to Rome III criteria were enrolled. In all patients evaluations included: colonoscopies, coproparasitoscopic studies, coproculture, fecal virus screening. PCR and sequencing for Blastocystis sp. were also performed. We recruited 11 men and 51 women with a mean age of 45.6 (SD ± 15.7) years. Eighty-six percent of the IBS patients presented a normal colonoscopy, 8% showed polyps and 6% diverticular disease. Blastocystis sp. was identified in 25% patients (all of them with normal colonoscopy), while two patients had Endolimax nana and Entamoeba histolytica/E. dispar, respectively. Phylogenetic analysis showed that major sequences of Mexican carriers clustered together with sequences of parasites from Japan and Denmark; furthermore, two sequences from IBS patients were grouped in a single cluster. Blastocystis sp. was identified in 25% of the IBS patients. Our data support the hypothesis of clonal lineages in distinct geographical areas in the world.

  1. Phylogenetic relationships of North American Gomphidae and their close relatives

    Science.gov (United States)

    Intrafamilial relationships among clubtail dragonflies (Gomphidae) have been the subject of many morphological studies, but have not yet been systematically evaluated using molecular data. Here we present the first molecular phylogeny of Gomphidae. We include six of the eight sub...

  2. Phylogenetic analysis of West Nile virus, Nuevo Leon State, Mexico.

    Science.gov (United States)

    Blitvich, Bradley J; Fernández-Salas, Ildefonso; Contreras-Cordero, Juan F; Loroño-Pino, María A; Marlenee, Nicole L; Díaz, Francisco J; González-Rojas, José I; Obregón-Martínez, Nelson; Chiu-García, Jorge A; Black, William C; Beaty, Barry J

    2004-07-01

    West Nile virus RNA was detected in brain tissue from a horse that died in June 2003 in Nuevo Leon State, Mexico. Nucleotide sequencing and phylogenetic analysis of the premembrane and envelope genes showed that the virus was most closely related to West Nile virus isolates collected in Texas in 2002.

  3. PhyloSift: phylogenetic analysis of genomes and metagenomes.

    Science.gov (United States)

    Darling, Aaron E; Jospin, Guillaume; Lowe, Eric; Matsen, Frederick A; Bik, Holly M; Eisen, Jonathan A

    2014-01-01

    Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection. In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata. These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454).

  4. PhyloSift: phylogenetic analysis of genomes and metagenomes

    Directory of Open Access Journals (Sweden)

    Aaron E. Darling

    2014-01-01

    Full Text Available Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection.In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata.These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454.

  5. Phylogenetic diversity analysis of Trichoderma species based on ...

    African Journals Online (AJOL)

    vi-4177/CSAU be assigned as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit ...

  6. Characterization and phylogenetic analysis of α-gliadin gene ...

    Indian Academy of Sciences (India)

    Supplementary data: Characterization and phylogenetic analysis of α-gliadin gene sequences reveals significant genomic divergence in Triticeae species. Guang-Rong Li, Tao Lang, En-Nian Yang, Cheng Liu ... The MITE insertion at the 3 UTR is boxed. Figure 2. The secondary structure of MITE insertion in HM452949.

  7. Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping

    2012-09-01

    To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

  8. Phylogenetic relationships of Malaysia's pig-tailed macaque Macaca nemestrina based on D-loop region sequences

    Science.gov (United States)

    Abdul-Latiff M. A., B.; Ampeng, A.; Yaakop, S.; Md-Zain B., M.

    2014-09-01

    Phylogenetic relationships among Malaysian pig-tailed macaques have never been established even though the data are crucial in aiding conservation plan for the species. The aims of this study is to establish the phylogenetic relationships of Macaca nemestrina in Malaysia. A total of 21 genetic samples of M. nemestrina yielding 458 bp of D-loop sequences were used in phylogenetic analyses, in addition to one sample of M. fascicularis which was used as an outgroup. Sequence character analysis revealed that D-loop locus contains 23% parsimony informative character detected among the ingroups. Further analysis indicated a clear separation between populations originating from different regions; the Malay Peninsula populations are separated from Borneo Insular population; and Perak population formed a distinctive clade within Peninsular Malaysia populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo population was distinguished from Peninsula population (100% bootstrap value in the NJ, MP, 1.00 posterior probability in Bayesian trees). Perak's population was separated from other Peninsula populations (100% in NJ, 99% in MP and 1.00 in Bayesian). D-loop region of mtDNA is proven to be a suitable locus in studying the separation of M. nemestrina at population level. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  9. Diversity of Kale (Brassica oleracea var. sabellica): Glucosinolate Content and Phylogenetic Relationships.

    Science.gov (United States)

    Hahn, Christoph; Müller, Anja; Kuhnert, Nikolai; Albach, Dirk

    2016-04-27

    Recently, kale has become popular due to nutritive components beneficial for human health. It is an important source of phytochemicals such as glucosinolates that trigger associated cancer-preventive activity. However, nutritional value varies among glucosinolates and among cultivars. Here, we start a systematic determination of the content of five glucosinolates in 25 kale varieties and 11 non-kale Brassica oleracea cultivars by HPLC-DAD-ESI-MS(n) and compare the profiles with results from the analysis of SNPs derived from a KASP genotyping assay. Our results demonstrate that the glucosinolate levels differ markedly among varieties of different origin. Comparison of the phytochemical data with phylogenetic relationships revealed that the common name kale refers to at least three different groups. German, American, and Italian kales differ morphologically and phytochemically. Landraces do not show outstanding glucosinolate levels. Our results demonstrate the diversity of kale and the importance of preserving a broad genepool for future breeding purposes.

  10. Re-visiting phylogenetic and taxonomic relationships in the genus Saga (Insecta: Orthoptera.

    Directory of Open Access Journals (Sweden)

    Balázs Kolics

    Full Text Available Twelve of the 13 bushcricket species of the Saga genus are bisexuals and diploids, except the parthenogenetic and tetraploid bush cricket, Saga pedo. Despite a continuous research effort stretching through the 1900s, the taxonomic relationships of the Saga species are still disputed. In this study, our primary aim was to reveal natural relationships of the European Saga species and three of their Asian relatives, with special attention to the problematic taxonomy of two subspecies: S. campbelli campbelli and S. c. gracilis. Following a phylogenetic analysis of eight species, a comprehensive study was carried out on the above three taxa by using acoustic and morphometric approaches in parallel. Our phylogenetic data showed that European Saga species evolved from a monophyletic lineage. The geographical transitional species S. cappadocica was positioned between European and Asian lineages supporting the idea that the European Saga lineage originated phylogeographically from the Asian clade. The above results showed better agreement with the morphological data than with earlier ones based either on karyology or acoustic information only. After reviewing our data, we concluded that Saga pedo has most likely evolved from S. c. gracilis and not from S. rammei or S. ephippigera, as proposed by earlier studies. S. c. gracilis shares the same ITS2 haplotype with S. pedo, indicating that the latter could have evolved from populations of the former, probably through whole genome duplication. Based on acoustic and morphometric differences, we propose to elevate the two subspecies, S. campbelli campbelli and S. c. gracilis, to species level status, as Saga gracilis Kis 1962, and Saga campbelli Uvarov 1921. The present work sets the stage for future genetic and experimental investigations of Saginae and highlights the need for additional comprehensive analysis involving more Asian Saga species.

  11. Re-visiting phylogenetic and taxonomic relationships in the genus Saga (Insecta: Orthoptera).

    Science.gov (United States)

    Kolics, Balázs; Ács, Zoltán; Chobanov, Dragan Petrov; Orci, Kirill Márk; Qiang, Lo Shun; Kovács, Balázs; Kondorosy, Előd; Decsi, Kincső; Taller, János; Specziár, András; Orbán, László; Müller, Tamás

    2012-01-01

    Twelve of the 13 bushcricket species of the Saga genus are bisexuals and diploids, except the parthenogenetic and tetraploid bush cricket, Saga pedo. Despite a continuous research effort stretching through the 1900s, the taxonomic relationships of the Saga species are still disputed. In this study, our primary aim was to reveal natural relationships of the European Saga species and three of their Asian relatives, with special attention to the problematic taxonomy of two subspecies: S. campbelli campbelli and S. c. gracilis. Following a phylogenetic analysis of eight species, a comprehensive study was carried out on the above three taxa by using acoustic and morphometric approaches in parallel. Our phylogenetic data showed that European Saga species evolved from a monophyletic lineage. The geographical transitional species S. cappadocica was positioned between European and Asian lineages supporting the idea that the European Saga lineage originated phylogeographically from the Asian clade. The above results showed better agreement with the morphological data than with earlier ones based either on karyology or acoustic information only. After reviewing our data, we concluded that Saga pedo has most likely evolved from S. c. gracilis and not from S. rammei or S. ephippigera, as proposed by earlier studies. S. c. gracilis shares the same ITS2 haplotype with S. pedo, indicating that the latter could have evolved from populations of the former, probably through whole genome duplication. Based on acoustic and morphometric differences, we propose to elevate the two subspecies, S. campbelli campbelli and S. c. gracilis, to species level status, as Saga gracilis Kis 1962, and Saga campbelli Uvarov 1921. The present work sets the stage for future genetic and experimental investigations of Saginae and highlights the need for additional comprehensive analysis involving more Asian Saga species.

  12. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera using nuclear encoded housekeeping genes.

    Directory of Open Access Journals (Sweden)

    Malcolm S Hill

    Full Text Available Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges.We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha, but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p, Myxospongiae(p, Spongillida(p, Haploscleromorpha(p (the marine haplosclerids and Democlavia(p. We found conflicting results concerning the relationships of Keratosa(p and Myxospongiae(p to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p+Spongillida(p+Democlavia(p. In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p are sister to Haploscleromorpha(p rather than part of Democlavia(p. Within Keratosa(p, we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p, Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p, Tetractinellida(p, composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis, was consistently revealed as the sister group to all other members of Democlavia(p. Within Tetractinellida(p, we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae, and polyphyly of Hadromerida and Halichondrida.These results, using an independent nuclear gene set, confirmed

  13. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera) using nuclear encoded housekeeping genes.

    Science.gov (United States)

    Hill, Malcolm S; Hill, April L; Lopez, Jose; Peterson, Kevin J; Pomponi, Shirley; Diaz, Maria C; Thacker, Robert W; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A; di Stefano, Michael; Tarver, James E; Collins, Allen G

    2013-01-01

    Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p), Myxospongiae(p), Spongillida(p), Haploscleromorpha(p) (the marine haplosclerids) and Democlavia(p). We found conflicting results concerning the relationships of Keratosa(p) and Myxospongiae(p) to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p)+Spongillida(p)+Democlavia(p). In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p)) are sister to Haploscleromorpha(p) rather than part of Democlavia(p). Within Keratosa(p), we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p), Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p), Tetractinellida(p), composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlavia(p). Within Tetractinellida(p), we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. These results, using an independent nuclear gene set

  14. The complete genome structure and phylogenetic relationship of infectious hematopoietic necrosis virus

    Science.gov (United States)

    Morzunov , Sergey P.; Winton, James R.; Nichol, Stuart T.

    1995-01-01

    Infectious hematopoietic necrosis virus (IHNV), a member of the family Rhabdoviridae, causes a severe disease with high mortality in salmonid fish. The nucleotide sequence (11, 131 bases) of the entire genome was determined for the pathogenic WRAC strain of IHNV from southern Idaho. This allowed detailed analysis of all 6 genes, the deduced amino acid sequences of their encoded proteins, and important control motifs including leader, trailer and gene junction regions. Sequence analysis revealed that the 6 virus genes are located along the genome in the 3′ to 5′ order: nucleocapsid (N), polymerase-associated phosphoprotein (P or M1), matrix protein (M or M2), surface glycoprotein (G), a unique non-virion protein (NV) and virus polymerase (L). The IHNV genome RNA was found to have highly complementary termini (15 of 16 nucleotides). The gene junction regions display the highly conserved sequence UCURUC(U)7RCCGUG(N)4CACR (in the vRNA sense), which includes the typical rhabdovirus transcription termination/polyadenylation signal and a novel putative transcription initiation signal. Phylogenetic analysis of M, G and L protein sequences allowed insights into the evolutionary and taxonomic relationship of rhabdoviruses of fish relative to those of insects or mammals, and a broader sense of the relationship of non-segmented negative-strand RNA viruses. Based on these data, a new genus, piscivirus, is proposed which will initially contain IHNV, viral hemorrhagic septicemia virus and Hirame rhabdovirus.

  15. Intraspecific relationship within the genus convolvulus l. inferred by rbcl gene using different phylogenetic approaches

    International Nuclear Information System (INIS)

    Kausar, S.; Qamarunnisa, S.

    2016-01-01

    A molecular systematics analysis was conducted using sequence data of chloroplast rbcL gene for the genus Convolvulus L., by distance and character based phylogenetic methods. Fifteen representative members from genus Convolvulus L., were included as in group whereas two members from a sister family Solanaceae were taken as out group to root the tree. Intraspecific relationships within Convolvulus were inferred by distance matrix, maximum parsimony and bayesian analysis. Transition/transversion ratio was also calculated and it was revealed that in the investigated Convolvulus species, transitional changes were more prevalent in rbcL gene. The nature of rbcL gene in the present study was observed to be conserved, as it does not show major variations between examined species. Distance matrix represented the minimal genetic variations between some species (C. glomeratus and C. pyrrhotrichus), thus exhibiting them as close relatives. The result of parsimonious and bayesian analysis revealed almost similar clades however maximum parsimony based tree was unable to establish relationship between some Convolvulus species. The bayesian inference method was found to be the method of choice for establishing intraspecific associations between Convolvulus species using rbcL data as it clearly defined the connections supported by posterior probability values. (author)

  16. A phylogenetic perspective on the individual species-area relationship in temperate and tropical tree communities.

    Science.gov (United States)

    Yang, Jie; Swenson, Nathan G; Cao, Min; Chuyong, George B; Ewango, Corneille E N; Howe, Robert; Kenfack, David; Thomas, Duncan; Wolf, Amy; Lin, Luxiang

    2013-01-01

    Ecologists have historically used species-area relationships (SARs) as a tool to understand the spatial distribution of species. Recent work has extended SARs to focus on individual-level distributions to generate individual species area relationships (ISARs). The ISAR approach quantifies whether individuals of a species tend have more or less species richness surrounding them than expected by chance. By identifying richness 'accumulators' and 'repellers', respectively, the ISAR approach has been used to infer the relative importance of abiotic and biotic interactions and neutrality. A clear limitation of the SAR and ISAR approaches is that all species are treated as evolutionarily independent and that a large amount of work has now shown that local tree neighborhoods exhibit non-random phylogenetic structure given the species richness. Here, we use nine tropical and temperate forest dynamics plots to ask: (i) do ISARs change predictably across latitude?; (ii) is the phylogenetic diversity in the neighborhood of species accumulators and repellers higher or lower than that expected given the observed species richness?; and (iii) do species accumulators, repellers distributed non-randomly on the community phylogenetic tree? The results indicate no clear trend in ISARs from the temperate zone to the tropics and that the phylogenetic diversity surrounding the individuals of species is generally only non-random on very local scales. Interestingly the distribution of species accumulators and repellers was non-random on the community phylogenies suggesting the presence of phylogenetic signal in the ISAR across latitude.

  17. Phylogenetic relationships in the "grossulariae" species group of the genus Aphis (Hemiptera: Sternorrhyncha: Aphididae): Molecular evidence

    DEFF Research Database (Denmark)

    Turcinaviciene, Jorga; Rakauskas, Rimantas; Pedersen, Bo Vest

    2006-01-01

    Phylogenetic relationships among Palaearctic Ribes and/or Onagraceae inhabiting Aphis species from five countries were examined using mitochondrial gene cytochrome oxidase I (CO-I) and nuclear gene elongation factor 1 a (EF-1a) sequences. There was no major conflict between the trees obtained fro...

  18. Phylogenetic Relationships of Citrus and Its Relatives Based on matK Gene Sequences

    Science.gov (United States)

    Penjor, Tshering; Uehara, Miki; Ide, Manami; Matsumoto, Natsumi; Matsumoto, Ryoji

    2013-01-01

    The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that “true citrus fruit trees” could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions, we have

  19. Phylogenetic relationships of citrus and its relatives based on matK gene sequences.

    Directory of Open Access Journals (Sweden)

    Tshering Penjor

    Full Text Available The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that "true citrus fruit trees" could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions

  20. Phylogenetic relationships of citrus and its relatives based on matK gene sequences.

    Science.gov (United States)

    Penjor, Tshering; Yamamoto, Masashi; Uehara, Miki; Ide, Manami; Matsumoto, Natsumi; Matsumoto, Ryoji; Nagano, Yukio

    2013-01-01

    The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that "true citrus fruit trees" could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions, we have

  1. Phylogenetic relationships in Asarum: Effect of data partitioning and a revised classification.

    Science.gov (United States)

    Sinn, Brandon T; Kelly, Lawrence M; Freudenstein, John V

    2015-05-01

    Generic boundaries and infrageneric relationships among the charismatic temperate magnoliid Asarum sensu lato (Aristolochiaceae) have long been uncertain. Previous molecular phylogenetic analyses used either plastid or nuclear loci alone and varied greatly in their taxonomic implications for the genus. We analyzed additional molecular markers from the nuclear and plastid genomes, reevaluated the possibility of a derived loss of autonomous self-pollination, and investigated the topological effects of matrix-partitioning-scheme choice. We sequenced seven plastid regions and the nuclear ITS1-ITS2 region of 58 individuals representing all previously recognized Asarum s.l. segregate genera and the monotypic genus Saruma. Matrices were partitioned using common a priori partitioning schemes and PartitionFinder. Topologies that were recovered using a priori partitioning of matrices differed from those recovered using a PartitionFinder-selected scheme, and by analysis method. We recovered six monophyletic groups that we circumscribed into three subgenera and six sections. Putative fungal mimic characters served as synapomorphies only for subgenus Heterotropa. Subgenus Geotaenium, a new subgenus, was recovered as sister to the remainder of Asarum by ML analyses of highly partitioned datasets. Section Longistylis, also newly named, is sister to section Hexastylis. Our analyses do not unambiguously support a single origin for all fungal-mimicry characters. Topologies recovered through the analysis of PartitionFinder-optimized matrices can differ drastically from those inferred from a priori partitioned matrices, and by analytical method. We recommend that investigators evaluate the topological effects of matrix partitioning using multiple methods of phylogenetic reconstruction. © 2015 Botanical Society of America, Inc.

  2. Phylogenetic and recombination analysis of tomato spotted wilt virus.

    Directory of Open Access Journals (Sweden)

    Sen Lian

    Full Text Available Tomato spotted wilt virus (TSWV severely damages and reduces the yield of many economically important plants worldwide. In this study, we determined the whole-genome sequences of 10 TSWV isolates recently identified from various regions and hosts in Korea. Phylogenetic analysis of these 10 isolates as well as the three previously sequenced isolates indicated that the 13 Korean TSWV isolates could be divided into two groups reflecting either two different origins or divergences of Korean TSWV isolates. In addition, the complete nucleotide sequences for the 13 Korean TSWV isolates along with previously sequenced TSWV RNA segments from Korea and other countries were subjected to phylogenetic and recombination analysis. The phylogenetic analysis indicated that both the RNA L and RNA M segments of most Korean isolates might have originated in Western Europe and North America but that the RNA S segments for all Korean isolates might have originated in China and Japan. Recombination analysis identified a total of 12 recombination events among all isolates and segments and five recombination events among the 13 Korea isolates; among the five recombinants from Korea, three contained the whole RNA L segment, suggesting reassortment rather than recombination. Our analyses provide evidence that both recombination and reassortment have contributed to the molecular diversity of TSWV.

  3. Phylogenetic relationships of Salmonella based on rRNA sequences

    DEFF Research Database (Denmark)

    Christensen, H.; Nordentoft, Steen; Olsen, J.E.

    1998-01-01

    separated by 16S rRNA analysis and found to be closely related to the Escherichia coli and Shigella complex by both 16S and 23S rRNA analyses. The diphasic serotypes S. enterica subspp. I and VI were separated from the monophasic serotypes subspp. IIIa and IV, including S. bongori, by 23S rRNA sequence...

  4. Mammoth and Elephant Phylogenetic Relationships: Mammut Americanum, the Missing Outgroup

    Directory of Open Access Journals (Sweden)

    Ludovic Orlando

    2007-01-01

    Full Text Available At the morphological level, the woolly mammoth has most often been considered as the sister-species of Asian elephants, but at the DNA level, different studies have found support for proximity with African elephants. Recent reports have increased the available sequence data and apparently solved the discrepancy, finding mammoths to be most closely related to Asian elephants. However, we demonstrate here that the three competing topologies have similar likelihood, bayesian and parsimony supports. The analysis further suggests the inadequacy of using Sirenia or Hyracoidea as outgroups. We therefore argue that orthologous sequences from the extinct American mastodon will be required to defi nitively solve this long-standing question.

  5. Comparative analyses of plastid genomes from fourteen Cornales species: inferences for phylogenetic relationships and genome evolution.

    Science.gov (United States)

    Fu, Chao-Nan; Li, Hong-Tao; Milne, Richard; Zhang, Ting; Ma, Peng-Fei; Yang, Jing; Li, De-Zhu; Gao, Lian-Ming

    2017-12-08

    The Cornales is the basal lineage of the asterids, the largest angiosperm clade. Phylogenetic relationships within the order were previously not fully resolved. Fifteen plastid genomes representing 14 species, ten genera and seven families of Cornales were newly sequenced for comparative analyses of genome features, evolution, and phylogenomics based on different partitioning schemes and filtering strategies. All plastomes of the 14 Cornales species had the typical quadripartite structure with a genome size ranging from 156,567 bp to 158,715 bp, which included two inverted repeats (25,859-26,451 bp) separated by a large single-copy region (86,089-87,835 bp) and a small single-copy region (18,250-18,856 bp) region. These plastomes encoded the same set of 114 unique genes including 31 transfer RNA, 4 ribosomal RNA and 79 coding genes, with an identical gene order across all examined Cornales species. Two genes (rpl22 and ycf15) contained premature stop codons in seven and five species respectively. The phylogenetic relationships among all sampled species were fully resolved with maximum support. Different filtering strategies (none, light and strict) of sequence alignment did not have an effect on these relationships. The topology recovered from coding and noncoding data sets was the same as for the whole plastome, regardless of filtering strategy. Moreover, mutational hotspots and highly informative regions were identified. Phylogenetic relationships among families and intergeneric relationships within family of Cornales were well resolved. Different filtering strategies and partitioning schemes do not influence the relationships. Plastid genomes have great potential to resolve deep phylogenetic relationships of plants.

  6. Mitochondrial DNA sequence-based phylogenetic relationship of Trichiurus lepturus (Perciformes: Trichiuridae) from the Persian Gulf

    Science.gov (United States)

    Tamadoni Jahromi, S.; Mohd Noor, S. A.; Pirian, K.; Dehghani, R.; Nazemi, M.; Khazaali, A.

    2016-01-01

    In this study, mitochondrial DNA analysis using 16S ribosomal DNA (rDNA) was performed to investigate the phylogeny relationship of Trichiurus lepturus in the Persian Gulf compared to the other investigated area. The amplification of 16S rDNA resulted in a product of 600 bp in all samples. The results showed that the isolated strain belongs to T. lepturus showing 42 divergence sites among the same reported partial sequences of 16S rRNA gene from the other area (West Atlantic and Indo-Pacific area). Phylogeny results showed that all 18 haplotypes of the species clustered into five clades with reasonably high bootstrap support of values (>64%). Overall, the tree topology for both phylogenetic and phenetic trees for 16S rDNA was similar. Both trees exposed two major clusters, one wholly containing the haplotypes of the T. lepturus species belonging to Indo-Pacific area with two major sister groups including Persian Gulf specimen and the other cleared the Western Atlantic and Japan individuals clustered in another distinct clade supporting the differentiation between the two areas. Phylogenic relationship observed between the Persian Gulf and the other Indo-Pacific Individuals suggested homogeneity between two mentioned areas. PMID:27822250

  7. Phylogenetic relationships of the Orang Asli and Iban of Malaysia based on maternal markers.

    Science.gov (United States)

    Ang, K C; Leow, J W H; Yeap, W K; Hood, S; Mahani, M C; Md-Zain, B M

    2011-04-12

    Malaysia remains as a crossroad of different cultures and peoples, and it has long been recognized that studying its population history can provide crucial insight into the prehistory of Southeast Asia as a whole. The earliest inhabitants were the Orang Asli in Peninsular Malaysia and the indigenous groups in Sabah and Sarawak. Although they were the earliest migrants in this region, these tribes are divided geographically by the South China Sea. We analyzed DNA sequences of 18 Orang Asli using mitochondrial DNA extracted from blood samples, each representing one sub-tribe, and from five Sarawakian Iban. Mitochondrial DNA was extracted from hair samples in order to examine relationships with the main ethnic groups in Malaysia. The D-loop region and cytochrome b genes were used as the candidate loci. Phylogenetic relationships were investigated using maximum parsimony and neighbor joining algorithms, and each tree was subjected to bootstrap analysis with 1000 replicates. Analyses of the HVS I region showed that the Iban are not a distinct group from the Orang Asli; they form a sub-clade within the Orang Asli. Based on the cytochrome b gene, the Iban clustered with the Orang Asli in the same clade. We found evidence for considerable gene flow between Orang Asli and Iban. We concluded that the Orang Asli, Iban and the main ethnic groups of Malaysia are probably derived from a common ancestor. This is in agreement with a single-route migration theory, but it does not dismiss a two-route migration theory.

  8. Phylogenetic Analysis of Petunia sensu Jussieu (Solanaceae) using Chloroplast DNA RFLP

    OpenAIRE

    ANDO, TOSHIO; KOKUBUN, HISASHI; WATANABE, HITOSHI; TANAKA, NORIO; YUKAWA, TOMOHISA; HASHIMOTO, GORO; MARCHESI, EDUARDO; SUÁREZ, ENRIQUE; BASUALDO, ISABEL L.

    2005-01-01

    • Background and Aims The phylogenetic relationships of Petunia sensu Jussieu (Petunia sensu Wijsman plus Calibrachoa) are unclear. This study aimed to resolve this uncertainty using molecular evidence.

  9. Phylogenetic analysis of hepatitis B virus in pakistan

    International Nuclear Information System (INIS)

    Baig, S.; Hasnain, N.U.

    2008-01-01

    To identify the distribution pattern of Hepatitis B Virus (HBV) genotype in a group of patients and to study its phylogenetic divergence. Two hundred and one HBV infected patients were genotyped for this study. All HbsAg positive individuals, either healthy carriers or suffering from conditions such as acute or chronic hepatitis, cirrhosis and hepatocellular carcinoma were included. Hepatitis B patients co-infected with other hepatic viruses were excluded. Hepatitis B virus DNA was extracted from serum, and subjected to a nested PCR, using the primers type-specific for genotype detection. Phylogenetic analysis was performed in the pre-S1 through S genes of HBV. The divergence was studied through 15 sequences of 967bp submitted to the DBJ/EMBL/GenBank databases accessible under accession number EF584640 through EF584654. Out of 201 patients tested, 156 were males and 45 were females. Genotype D was the predominant type found in 128 (64%) patients followed by A in 47 (23%) and mixed A/D in 26 (13%). Phylogenetic analysis confirmed the dominance of genotype D and subtype ayw2. There was dominance of genotype D subtype ayw2. It had a close resemblance with HBV strains that circulate in Iran, India and Japan. (author)

  10. galaxieEST: addressing EST identity through automated phylogenetic analysis.

    Science.gov (United States)

    Nilsson, R Henrik; Rajashekar, Balaji; Larsson, Karl-Henrik; Ursing, Björn M

    2004-07-05

    Research involving expressed sequence tags (ESTs) is intricately coupled to the existence of large, well-annotated sequence repositories. Comparatively complete and satisfactory annotated public sequence libraries are, however, available only for a limited range of organisms, rendering the absence of sequences and gene structure information a tangible problem for those working with taxa lacking an EST or genome sequencing project. Paralogous genes belonging to the same gene family but distinguished by derived characteristics are particularly prone to misidentification and erroneous annotation; high but incomplete levels of sequence similarity are typically difficult to interpret and have formed the basis of many unsubstantiated assumptions of orthology. In these cases, a phylogenetic study of the query sequence together with the most similar sequences in the database may be of great value to the identification process. In order to facilitate this laborious procedure, a project to employ automated phylogenetic analysis in the identification of ESTs was initiated. galaxieEST is an open source Perl-CGI script package designed to complement traditional similarity-based identification of EST sequences through employment of automated phylogenetic analysis. It uses a series of BLAST runs as a sieve to retrieve nucleotide and protein sequences for inclusion in neighbour joining and parsimony analyses; the output includes the BLAST output, the results of the phylogenetic analyses, and the corresponding multiple alignments. galaxieEST is available as an on-line web service for identification of fungal ESTs and for download / local installation for use with any organism group at http://galaxie.cgb.ki.se/galaxieEST.html. By addressing sequence relatedness in addition to similarity, galaxieEST provides an integrative view on EST origin and identity, which may prove particularly useful in cases where similarity searches return one or more pertinent, but not full, matches and

  11. Analysis of Acorus calamus chloroplast genome and its phylogenetic implications.

    Science.gov (United States)

    Goremykin, Vadim V; Holland, Barbara; Hirsch-Ernst, Karen I; Hellwig, Frank H

    2005-09-01

    Determining the phylogenetic relationships among the major lines of angiosperms is a long-standing problem, yet the uncertainty as to the phylogenetic affinity of these lines persists. While a number of studies have suggested that the ANITA (Amborella-Nymphaeales-Illiciales-Trimeniales-Aristolochiales) grade is basal within angiosperms, studies of complete chloroplast genome sequences also suggested an alternative tree, wherein the line leading to the grasses branches first among the angiosperms. To improve taxon sampling in the existing chloroplast genome data, we sequenced the chloroplast genome of the monocot Acorus calamus. We generated a concatenated alignment (89,436 positions for 15 taxa), encompassing almost all sequences usable for phylogeny reconstruction within spermatophytes. The data still contain support for both the ANITA-basal and grasses-basal hypotheses. Using simulations we can show that were the ANITA-basal hypothesis true, parsimony (and distance-based methods with many models) would be expected to fail to recover it. The self-evident explanation for this failure appears to be a long-branch attraction (LBA) between the clade of grasses and the out-group. However, this LBA cannot explain the discrepancies observed between tree topology recovered using the maximum likelihood (ML) method and the topologies recovered using the parsimony and distance-based methods when grasses are deleted. Furthermore, the fact that neither maximum parsimony nor distance methods consistently recover the ML tree, when according to the simulations they would be expected to, when the out-group (Pinus) is deleted, suggests that either the generating tree is not correct or the best symmetric model is misspecified (or both). We demonstrate that the tree recovered under ML is extremely sensitive to model specification and that the best symmetric model is misspecified. Hence, we remain agnostic regarding phylogenetic relationships among basal angiosperm lineages.

  12. [A phylogenetic analysis of plant communities of Teberda Biosphere Reserve].

    Science.gov (United States)

    Shulakov, A A; Egorov, A V; Onipchenko, V G

    2016-01-01

    Phylogenetic analysis of communities is based on the comparison of distances on the phylogenetic tree between species of a community under study and those distances in random samples taken out of local flora. It makes it possible to determine to what extent a community composition is formed by more closely related species (i.e., "clustered") or, on the opposite, it is more even and includes species that are less related with each other. The first case is usually interpreted as a result of strong influence caused by abiotic factors, due to which species with similar ecology, a priori more closely related, would remain: In the second case, biotic factors, such as competition, may come to the fore and lead to forming a community out of distant clades due to divergence of their ecological niches: The aim of this' study Was Ad explore the phylogenetic structure in communities of the northwestern Caucasus at two spatial scales - the scale of area from 4 to 100 m2 and the smaller scale within a community. The list of local flora of the alpine belt has been composed using the database of geobotanic descriptions carried out in Teberda Biosphere Reserve at true altitudes exceeding.1800 m. It includes 585 species of flowering plants belonging to 57 families. Basal groups of flowering plants are.not represented in the list. At the scale of communities of three classes, namely Thlaspietea rotundifolii - commumties formed on screes and pebbles, Calluno-Ulicetea - alpine meadow, and Mulgedio-Aconitetea subalpine meadows, have not demonstrated significant distinction of phylogenetic structure. At intra level, for alpine meadows the larger share of closely related species. (clustered community) is detected. Significantly clustered happen to be those communities developing on rocks (class Asplenietea trichomanis) and alpine (class Juncetea trifidi). At the same time, alpine lichen proved to have even phylogenetic structure at the small scale. Alpine (class Salicetea herbaceae) that

  13. Construction of phylogenetic trees by kernel-based comparative analysis of metabolic networks.

    Science.gov (United States)

    Oh, S June; Joung, Je-Gun; Chang, Jeong-Ho; Zhang, Byoung-Tak

    2006-06-06

    To infer the tree of life requires knowledge of the common characteristics of each species descended from a common ancestor as the measuring criteria and a method to calculate the distance between the resulting values of each measure. Conventional phylogenetic analysis based on genomic sequences provides information about the genetic relationships between different organisms. In contrast, comparative analysis of metabolic pathways in different organisms can yield insights into their functional relationships under different physiological conditions. However, evaluating the similarities or differences between metabolic networks is a computationally challenging problem, and systematic methods of doing this are desirable. Here we introduce a graph-kernel method for computing the similarity between metabolic networks in polynomial time, and use it to profile metabolic pathways and to construct phylogenetic trees. To compare the structures of metabolic networks in organisms, we adopted the exponential graph kernel, which is a kernel-based approach with a labeled graph that includes a label matrix and an adjacency matrix. To construct the phylogenetic trees, we used an unweighted pair-group method with arithmetic mean, i.e., a hierarchical clustering algorithm. We applied the kernel-based network profiling method in a comparative analysis of nine carbohydrate metabolic networks from 81 biological species encompassing Archaea, Eukaryota, and Eubacteria. The resulting phylogenetic hierarchies generally support the tripartite scheme of three domains rather than the two domains of prokaryotes and eukaryotes. By combining the kernel machines with metabolic information, the method infers the context of biosphere development that covers physiological events required for adaptation by genetic reconstruction. The results show that one may obtain a global view of the tree of life by comparing the metabolic pathway structures using meta-level information rather than sequence

  14. Construction of phylogenetic trees by kernel-based comparative analysis of metabolic networks

    Directory of Open Access Journals (Sweden)

    Chang Jeong-Ho

    2006-06-01

    Full Text Available Abstract Background To infer the tree of life requires knowledge of the common characteristics of each species descended from a common ancestor as the measuring criteria and a method to calculate the distance between the resulting values of each measure. Conventional phylogenetic analysis based on genomic sequences provides information about the genetic relationships between different organisms. In contrast, comparative analysis of metabolic pathways in different organisms can yield insights into their functional relationships under different physiological conditions. However, evaluating the similarities or differences between metabolic networks is a computationally challenging problem, and systematic methods of doing this are desirable. Here we introduce a graph-kernel method for computing the similarity between metabolic networks in polynomial time, and use it to profile metabolic pathways and to construct phylogenetic trees. Results To compare the structures of metabolic networks in organisms, we adopted the exponential graph kernel, which is a kernel-based approach with a labeled graph that includes a label matrix and an adjacency matrix. To construct the phylogenetic trees, we used an unweighted pair-group method with arithmetic mean, i.e., a hierarchical clustering algorithm. We applied the kernel-based network profiling method in a comparative analysis of nine carbohydrate metabolic networks from 81 biological species encompassing Archaea, Eukaryota, and Eubacteria. The resulting phylogenetic hierarchies generally support the tripartite scheme of three domains rather than the two domains of prokaryotes and eukaryotes. Conclusion By combining the kernel machines with metabolic information, the method infers the context of biosphere development that covers physiological events required for adaptation by genetic reconstruction. The results show that one may obtain a global view of the tree of life by comparing the metabolic pathway

  15. Soft-tissue anatomy of the extant hominoids: a review and phylogenetic analysis

    Science.gov (United States)

    Gibbs, S; Collard, M; Wood, B

    2002-01-01

    This paper reports the results of a literature search for information about the soft-tissue anatomy of the extant non-human hominoid genera, Pan, Gorilla, Pongo and Hylobates, together with the results of a phylogenetic analysis of these data plus comparable data for Homo. Information on the four extant non-human hominoid genera was located for 240 out of the 1783 soft-tissue structures listed in the Nomina Anatomica. Numerically these data are biased so that information about some systems (e.g. muscles) and some regions (e.g. the forelimb) are over-represented, whereas other systems and regions (e.g. the veins and the lymphatics of the vascular system, the head region) are either under-represented or not represented at all. Screening to ensure that the data were suitable for use in a phylogenetic analysis reduced the number of eligible soft-tissue structures to 171. These data, together with comparable data for modern humans, were converted into discontinuous character states suitable for phylogenetic analysis and then used to construct a taxon-by-character matrix. This matrix was used in two tests of the hypothesis that soft-tissue characters can be relied upon to reconstruct hominoid phylogenetic relationships. In the first, parsimony analysis was used to identify cladograms requiring the smallest number of character state changes. In the second, the phylogenetic bootstrap was used to determine the confidence intervals of the most parsimonious clades. The parsimony analysis yielded a single most parsimonious cladogram that matched the molecular cladogram. Similarly the bootstrap analysis yielded clades that were compatible with the molecular cladogram; a (Homo, Pan) clade was supported by 95% of the replicates, and a (Gorilla, Pan, Homo) clade by 96%. These are the first hominoid morphological data to provide statistically significant support for the clades favoured by the molecular evidence. PMID:11833653

  16. Phylogenetic relationships of Malaysia’s long-tailed macaques, Macaca fascicularis, based on cytochrome b sequences

    Science.gov (United States)

    Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir

    2014-01-01

    Abstract Phylogenetic relationships among Malaysia’s long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo’s population was distinguished from Peninsula’s population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia’s M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations

  17. Detection and phylogenetic analysis of bacteriophage WO in spiders (Araneae).

    Science.gov (United States)

    Yan, Qian; Qiao, Huping; Gao, Jin; Yun, Yueli; Liu, Fengxiang; Peng, Yu

    2015-11-01

    Phage WO is a bacteriophage found in Wolbachia. Herein, we represent the first phylogenetic study of WOs that infect spiders (Araneae). Seven species of spiders (Araneus alternidens, Nephila clavata, Hylyphantes graminicola, Prosoponoides sinensis, Pholcus crypticolens, Coleosoma octomaculatum, and Nurscia albofasciata) from six families were infected by Wolbachia and WO, followed by comprehensive sequence analysis. Interestingly, WO could be only detected Wolbachia-infected spiders. The relative infection rates of those seven species of spiders were 75, 100, 88.9, 100, 62.5, 72.7, and 100 %, respectively. Our results indicated that both Wolbachia and WO were found in three different body parts of N. clavata, and WO could be passed to the next generation of H. graminicola by vertical transmission. There were three different sequences for WO infected in A. alternidens and two different WO sequences from C. octomaculatum. Only one sequence of WO was found for the other five species of spiders. The discovered sequence of WO ranged from 239 to 311 bp. Phylogenetic tree was generated using maximum likelihood (ML) based on the orf7 gene sequences. According to the phylogenetic tree, WOs in N. clavata and H. graminicola were clustered in the same group. WOs from A. alternidens (WAlt1) and C. octomaculatum (WOct2) were closely related to another clade, whereas WO in P. sinensis was classified as a sole cluster.

  18. Phylogenetic relationships of the Cochliopinae (Rissooidea: Hydrobiidae): an enigmatic group of aquatic gastropods.

    Science.gov (United States)

    Liu, H P; Hershler, R; Thompson, F G

    2001-10-01

    Phylogenetic analysis based on a partial sequence of the mitochondrial cytochrome c oxidase subunit I gene was performed for 26 representatives of the aquatic gastropod subfamily Cochliopinae, 6 additional members of the family Hydrobiidae, and outgroup species of the families Rissoidae and Pomatiopsidae. Maximum-parsimony analysis yielded a single shortest tree which resolved two monophyletic groups: (1) a clade containing all cochliopine taxa with the exception of Antroselates and (2) a clade composed of Antroselates and the hydrobiid genus Amnicola. The clade containing both of these monophyletic groups was depicted as more closely related to members of the family Pomatiopsidae than to other hydrobiid snails which were basally positioned in our topology. New anatomical evidence supports recognition of the cochliopine and Antroselates-Amnicola clades, and structure within the monophyletic group of cochliopines is largely congruent with genitalic characters. However, the close relationship between the Pomatiopsidae and these clades is in conflict with commonly accepted classifications and suggests that a widely accepted scenario for genitalic evolution in these snails is in need of further study. Copyright 2001 Academic Press.

  19. Complete mitochondrial genome of threatened mahseer Tor tor (Hamilton 1822) and its phylogenetic relationship within Cyprinidae family.

    Science.gov (United States)

    Pavan-Kumar, A; Raman, Sudhanshu; Koringa, Prakash G; Patel, Namrata; Shah, Tejas; Singh, Rajeev K; Krishna, Gopal; Joshi, C G; Gireesh-Babu, P; Chaudhari, Aparna

    2016-12-01

    The mahseers (Tor, Neolissochilus and Naziritor) are an important group of fishes endemic to Asia with the conservation status of most species evaluated as threatened. Conservation plans to revive these declining wild populations are hindered by unstable taxonomy. Molecular phylogeny studies with mitochondrial genome have been successfully used to reconstruct the phylogenetic tree and to resolve taxonomic ambiguity. In the present study, complete mitochondrial genome of Tor tor has been sequenced using ion torrent next-generation sequencing platform with coverage of more than 1000 x. Comparative mitogenome analysis shows higher divergence value at ND1 gene than COI gene. Further, occurrence of a distinct genetic lineage of T. tor is revealed. The phylogenetic relationship among mahseer group has been defined as Neolissochilus hexagonolepis ((T. sinensis (T. putitora, T. tor), (T. khudree, T. tambroides)).

  20. Morphometric relationship, phylogenetic correlation, and character evolution in the species-rich genus Aphis (Hemiptera: Aphididae.

    Directory of Open Access Journals (Sweden)

    Hyojoong Kim

    2010-07-01

    Full Text Available The species-rich genus Aphis consists of more than 500 species, many of them host-specific on a wide range of plants, yet very similar in general appearance due to convergence toward particular morphological types. Most species have been historically clustered into four main phenotypic groups (gossypii, craccivora, fabae, and spiraecola groups. To confirm the morphological hypotheses between these groups and to examine the characteristics that determine them, multivariate morphometric analyses were performed using 28 characters measured/counted from 40 species. To infer whether the morphological relationships are correlated with the genetic relationships, we compared the morphometric dataset with a phylogeny reconstructed from the combined dataset of three mtDNA and one nuclear DNA regions.Based on a comparison of morphological and molecular datasets, we confirmed morphological reduction or regression in the gossypii group unlike in related groups. Most morphological characteristics of the gossypii group were less variable than for the other groups. Due to these, the gossypii group could be morphologically well separated from the craccivora, fabae, and spiraecola groups. In addition, the correlation of the rates of evolution between morphological and DNA datasets was highly significant in their diversification.The morphological separation between the gossypii group and the other species-groups are congruent with their phylogenetic relationships. Analysis of trait evolution revealed that the morphological traits found to be significant based on the morphometric analyses were confidently correlated with the phylogeny. The dominant patterns of trait evolution resulting in increased rates of short branches and temporally later evolution are likely suitable for the modality of Aphis speciation because they have adapted species-specifically, rapidly, and more recently on many different host plants.

  1. Possible sister groups and phylogenetic relationships among selected North Pacific and North Atlantic Rhodophyta

    Science.gov (United States)

    Lindstrom, Sandra C.

    1987-09-01

    Although the cool temperate (boreal) waters of the N. Pacific and N. Atlantic share many similar if not identical species, there have been few studies to test the identity of these species pairs. Whereas such tests are important from a taxonomic perspective, they tell us little if anything about biogeographic relationships. A more useful approach is one employing phylogenetic systematics (cladistics). The interpretation of phylogenetic diagrams (cladograms) in terms of biogeographic area relationships is explained. It is argued that cladistic analyses of taxa occurring in the cool temperate waters of the northern oceans can provide biogeographic tracks, which in turn can suggest the origins and migrations of species and possibly even floras. A number of cool temperate taxa that appear particularly amenable to this approach are discussed, including genera in the Palmariaceae, Corallinaceae, Dumontiaceae, Solieriaceae, Petrocelidaceae, Ceramiaceae and Rhodomelaceae.

  2. Phylogenetic relationships and evolutionary history of the reef fish family Labridae.

    Science.gov (United States)

    Westneat, Mark W; Alfaro, Michael E

    2005-08-01

    The family Labridae (including scarines and odacines) contains 82 genera and about 600 species of fishes that inhabit coastal and continental shelf waters in tropical and temperate oceans throughout the world. The Labridae (the wrasses) is the fifth largest fish family and second largest marine fish family, and is one of the most morphologically and ecologically diversified families of fishes in size, shape, and color. Labrid phylogeny is a long-standing problem in ichthyology that is part of the larger question of relationships within the suborder Labroidei. A phylogenetic analysis of labrids was conducted to investigate relationships among the six classical tribes of wrasses, the affinities of the wrasses to the parrotfishes (scarines), and the broad phylogenetic structure among labrid genera. Four gene fragments were sequenced from 98 fish species, including 84 labrid fishes and 14 outgroup taxa. Taxa were chosen from all major labrid clades and most major global ocean regions where labrid fishes exist, as well as cichlid, pomacentrid, and embiotocid outgroups. From the mitochondrial genome we sequenced portions of 12S rRNA (1000 bp) and 16S rRNA (585 bp), which were aligned by using a secondary structure model. From the nuclear genome, we sequenced part of the protein-coding genes RAG2 (846 bp) and Tmo4C4 (541 bp). Maximum likelihood, maximum parsimony, and Bayesian analyses on the resulting 2972 bp of DNA sequence produced similar topologies that confirm the monophyly of a family Labridae that includes the parrotfishes and butterfishes and strong support for many previously identified taxonomic subgroups. The tribe Hypsigenyini (hogfishes, tuskfishes) is the sister group to the remaining labrids and includes odacines and the chisel-tooth wrasse Pseudodax moluccanus, a species previously considered close to scarines. Cheilines and scarines are sister-groups, closely related to the temperate Labrini, and pseudocheilines and cheilines are split in all phylogenies

  3. PHYLOGENETIC RELATIONSHIPS AMONG VIETNAMESE COCOA ACCESSIONS USING A NON-CODING REGION OF THE CHLOROPLAST DNA

    OpenAIRE

    Lam Thi, Viet Ha; D.T., Khang; Everaert, Helena; T.N, Dung; P.H.D, Phuoc; H.T., Toan; Dewettinck, Koen; Messens, Kathy

    2017-01-01

    Cocoa (Theobroma cacao L.) cultivation has increased in tropical areas around the world, including Vietnam, due to the high demand of cocoa beans for chocolate production. The genetic diversity of cocoa genotypes is recognized to be complex, however, their phylogenetic relationships need to be clarified. The present study aimed to classify the cocoa genotypes that are imported and cultivated in Vietnam based on a chloroplast DNA region. Sixty-three Vietnamese Cocoa accessions were collected f...

  4. Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria

    Science.gov (United States)

    Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.

    2003-01-01

    The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.

  5. New insights into the phylogenetic relationships, character evolution, and phytogeographic patterns of Calceolaria (Calceolariaceae).

    Science.gov (United States)

    Cosacov, Andrea; Sérsic, Alicia N; Sosa, Victoria; De-Nova, J Arturo; Nylinder, Stephan; Cocucci, Andrea A

    2009-12-01

    Biogeographical patterns and diversification processes in Andean and Patagonian flora are not yet well understood. Calceolaria is a highly diversified genus of these areas, representing one of the most specialized plant-pollinator systems because flowers produce nonvolatile oils, a very unusual floral reward. Phylogenetic analyses with molecular (ITS and matK) and morphological characters from 103 Calceolaria species were conducted to examine relationships, to understand biogeographic patterns, and to detect evolutionary patterns of floral and ecological characters. Total evidence analysis retrieved three major clades, which strongly correspond to the three previously recognized subgenera, although only subgenus Rosula was retrieved as a monophyletic group. A single historical event explains the expansion from the southern to central Andes, while different parallel evolutionary lines show a northward expansion from the central to northern Andes across the Huancabamba Deflection, an important geographical barrier in northern Peru. Polyploidy, acquisition of elaiophores, and a nototribic pollination mechanism are key aspects of the evolutionary history of Calceolaria. Pollination interactions were more frequently established with Centris than with Chalepogenus oil-collecting bee species. The repeated loss of the oil gland and shifts to pollen as the only reward suggest an evolutionary tendency from highly to moderately specialized pollination systems.

  6. Phylogenetic Relationships of Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Gobioninae Inferred from Multiple Nuclear Gene Sequences

    Directory of Open Access Journals (Sweden)

    Keun-Yong Kim

    2013-01-01

    Full Text Available Gobionine species belonging to the genera Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Cyprinidae have been heavily studied because of problems on taxonomy, threats of extinction, invasion, and human health. Nucleotide sequences of three nuclear genes, that is, recombination activating protein gene 1 (rag1, recombination activating gene 2 (rag2, and early growth response 1 gene (egr1, from Pseudorasbora, Pseudopungtungia, and Pungtungia species residing in China, Japan, and Korea, were analyzed to elucidate their intergeneric and interspecific phylogenetic relationships. In the phylogenetic tree inferred from their multiple gene sequences, Pseudorasbora, Pseudopungtungia and Pungtungia species ramified into three phylogenetically distinct clades; the “tenuicorpa” clade composed of Pseudopungtungia tenuicorpa, the “parva” clade composed of all Pseudorasbora species/subspecies, and the “herzi” clade composed of Pseudopungtungia nigra, and Pungtungia herzi. The genus Pseudorasbora was recovered as monophyletic, while the genus Pseudopungtungia was recovered as polyphyletic. Our phylogenetic result implies the unstable taxonomic status of the genus Pseudopungtungia.

  7. Phylogenetic groups among Klebsiella pneumoniae isolates from Brazil: relationship with antimicrobial resistance and origin.

    Science.gov (United States)

    de Melo, Maíra Espíndola Silva; Cabral, Adriane Borges; Maciel, Maria Amélia Vieira; da Silveira, Vera Magalhães; de Souza Lopes, Ana Catarina

    2011-05-01

    The objectives of this study were to determine the distribution of phylogenetic groups among Klebsiella pneumoniae isolates from Recife, Brazil and to assess the relationship between the groups and the isolation sites and resistance profile. Ninety four isolates of K. pneumoniae from hospital or community infections and from normal microbiota were analyzed by gyrA PCR-RFLP, antibiotic susceptibility, and adonitol fermentation. The results revealed the distinction of three phylogenetic groups, as it has also been reported in Europe, showing that these clusters are highly conserved within K. pneumoniae. Group KpI was dominantly represented by hospital and community isolates while groups KpII and KpIII displayed mainly normal microbiota isolates. The resistance to third generation cephalosporins, aztreonam, imipenem, amoxicillin/clavulanic acid, and streptomycin was only observed in KpI. The percentage of resistance was higher in KpI, followed by KpII and KpIII. The differences in the distribution of K. pneumoniae phylogenetic groups observed in this study suggest distinctive clinical and epidemiological characteristics among the three groups, which is important to understand the epidemiology of infections caused by this organism. This is the first study in Brazil on K. pneumoniae isolates from normal microbiota and community infections regarding the distribution of phylogenetic groups based on the gyrA gene.

  8. Detecting Network Communities: An Application to Phylogenetic Analysis

    Science.gov (United States)

    Andrade, Roberto F. S.; Rocha-Neto, Ivan C.; Santos, Leonardo B. L.; de Santana, Charles N.; Diniz, Marcelo V. C.; Lobão, Thierry Petit; Goés-Neto, Aristóteles; Pinho, Suani T. R.; El-Hani, Charbel N.

    2011-01-01

    This paper proposes a new method to identify communities in generally weighted complex networks and apply it to phylogenetic analysis. In this case, weights correspond to the similarity indexes among protein sequences, which can be used for network construction so that the network structure can be analyzed to recover phylogenetically useful information from its properties. The analyses discussed here are mainly based on the modular character of protein similarity networks, explored through the Newman-Girvan algorithm, with the help of the neighborhood matrix . The most relevant networks are found when the network topology changes abruptly revealing distinct modules related to the sets of organisms to which the proteins belong. Sound biological information can be retrieved by the computational routines used in the network approach, without using biological assumptions other than those incorporated by BLAST. Usually, all the main bacterial phyla and, in some cases, also some bacterial classes corresponded totally (100%) or to a great extent (>70%) to the modules. We checked for internal consistency in the obtained results, and we scored close to 84% of matches for community pertinence when comparisons between the results were performed. To illustrate how to use the network-based method, we employed data for enzymes involved in the chitin metabolic pathway that are present in more than 100 organisms from an original data set containing 1,695 organisms, downloaded from GenBank on May 19, 2007. A preliminary comparison between the outcomes of the network-based method and the results of methods based on Bayesian, distance, likelihood, and parsimony criteria suggests that the former is as reliable as these commonly used methods. We conclude that the network-based method can be used as a powerful tool for retrieving modularity information from weighted networks, which is useful for phylogenetic analysis. PMID:21573202

  9. The complete mitochondrial genome of Pallisentis celatus (Acanthocephala) with phylogenetic analysis of acanthocephalans and rotifers.

    Science.gov (United States)

    Pan, Ting Shuang; Nie, Pin

    2013-07-01

    Acanthocephalans are a small group of obligate endoparasites. They and rotifers are recently placed in a group called Syndermata. However, phylogenetic relationships within classes of acanthocephalans, and between them and rotifers, have not been well resolved, possibly due to the lack of molecular data suitable for such analysis. In this study, the mitochondrial (mt) genome was sequenced from Pallisentis celatus (Van Cleave, 1928), an acanthocephalan in the class Eoacanthocephala, an intestinal parasite of rice-field eel, Monopterus albus (Zuiew, 1793), in China. The complete mt genome sequence of P. celatus is 13 855 bp long, containing 36 genes including 12 protein-coding genes, 22 transfer RNAs (tRNAs) and 2 ribosomal RNAs (rRNAs) as reported for other acanthocephalan species. All genes are encoded on the same strand and in the same direction. Phylogenetic analysis indicated that acanthocephalans are closely related with a clade containing bdelloids, which then correlates with the clade containing monogononts. The class Eoacanthocephala, containing P. celatus and Paratenuisentis ambiguus (Van Cleave, 1921) was closely related to the Palaeacanthocephala. It is thus indicated that acanthocephalans may be just clustered among groups of rotifers. However, the resolving of phylogenetic relationship among all classes of acanthocephalans and between them and rotifers may require further sampling and more molecular data.

  10. Phylogenetic and Diversity Analysis of Dactylis glomerata Subspecies Using SSR and IT-ISJ Markers.

    Science.gov (United States)

    Yan, Defei; Zhao, Xinxin; Cheng, Yajuan; Ma, Xiao; Huang, Linkai; Zhang, Xinquan

    2016-10-31

    The genus Dactylis , an important forage crop, has a wide geographical distribution in temperate regions. While this genus is thought to include a single species, Dactylis glomerata , this species encompasses many subspecies whose relationships have not been fully characterized. In this study, the genetic diversity and phylogenetic relationships of nine representative Dactylis subspecies were examined using SSR and IT-ISJ markers. In total, 21 pairs of SSR primers and 15 pairs of IT-ISJ primers were used to amplify 295 polymorphic bands with polymorphic rates of 100%. The average polymorphic information contents (PICs) of SSR and IT-ISJ markers were 0.909 and 0.780, respectively. The combined data of the two markers indicated a high level of genetic diversity among the nine D. glomerata subspecies, with a Nei's gene diversity index value of 0.283 and Shannon's diversity of 0.448. Preliminarily phylogenetic analysis results revealed that the 20 accessions could be divided into three groups (A, B, C). Furthermore, they could be divided into five clusters, which is similar to the structure analysis with K = 5. Phylogenetic placement in these three groups may be related to the distribution ranges and the climate types of the subspecies in each group. Group A contained eight accessions of four subspecies, originating from the west Mediterranean, while Group B contained seven accessions of three subspecies, originating from the east Mediterranean.

  11. Application of multigene phylogenetics and site-stripping to resolve intraordinal relationships in the Rhodymeniales (Rhodophyta).

    Science.gov (United States)

    Filloramo, Gina V; Saunders, Gary W

    2016-06-01

    Previous molecular assessments of the red algal order Rhodymeniales have confirmed its monophyly and distinguished the six currently recognized families (viz. Champiaceae, Faucheaceae, Fryeellaceae, Hymenocladiaceae, Lomentariaceae, and Rhodymeniaceae); however, relationships among most of these families have remained unresolved possibly as a result of substitution saturation at deeper phylogenetic nodes. The objective of the current study was to improve rhodymenialean systematics by increasing taxonomic representation and using a more robust multigene dataset of mitochondrial (COB, COI/COI-5P), nuclear (LSU, EF2) and plastid markers (psbA, rbcL). Additionally, we aimed to prevent phylogenetic inference problems associated with substitution saturation (particularly at the interfamilial nodes) by removing fast-evolving sites and analyzing a series of progressively more conservative alignments. The Rhodymeniales was resolved as two major lineages: (i) the Fryeellaceae as sister to the Faucheaceae and Lomentariaceae; and (ii) the Rhodymeniaceae allied to the Champiaceae and Hymenocladiaceae. Support at the interfamilial nodes was highest when 20% of variable sites were removed. Inclusion of Binghamiopsis, Chamaebotrys, and Minium, which were absent in previous phylogenetic investigations, established their phylogenetic affinities while assessment of two genera consistently polyphyletic in phylogenetic analyses, Erythrymenia and Lomentaria, resulted in the proposition of the novel genera Perbella and Fushitsunagia. The taxonomic position of Drouetia was reinvestigated with re-examination of holotype material of D. coalescens to clarify tetrasporangial development in this genus. In addition, we added three novel Australian species to Drouetia as a result of ongoing DNA barcoding assessments-D. aggregata sp. nov., D. scutellata sp. nov., and D. viridescens sp. nov. © 2016 Phycological Society of America.

  12. A contribution to the understanding of phylogenetic relationships among species of the genus Octopus (Octopodidae: Cephalopoda

    Directory of Open Access Journals (Sweden)

    María Soledad Acosta-Jofré

    2011-11-01

    Full Text Available Many species of the genus Octopus are important resources for fisheries worldwide. Its approximately 200 species show a strong similarity in structural morphology and a wide diversity in skin coloration and patterning, behaviour and life strategies that have hampered the study of phylogenetic relationships. We used a Bayesian approach to estimate as yet unknown phylogenetic relationships among O. tehuelchus from the southwestern Atlantic, new specimens of O. mimus (Chile and Peru and other Octopus species, and used Bayes factors to test phylogenetic hypotheses. O. tehuelchus was more closely related to the genera Callistoctopus, Grimpella and Macroctopus than to Octopus, and therefore its generic placement may need a revision. O. vulgaris specimens from Costa Rica (Pacific Ocean and O. oculifer grouped with O. mimus. Bayes factors showed positive evidence in favor of this grouping and therefore these individuals could have been misidentified, being in fact O. mimus. O. vulgaris specimens from the Costa Rican Caribbean were more related to O. mimus than to other O. vulgaris and could represent a cryptic species. The remaining O. vulgaris clustered with O. tetricus. Bayes factors found strong evidence against the monophyly of O. vulgaris as currently defined, giving statistical support to the monophyly of an O. vulgaris s. str. + O. tetricus group proposed previously by other authors.

  13. Endosymbiosis In Statu Nascendi: Close Phylogenetic RelationshipBetween Obligately Endosymbiotic and Obligately Free-LivingPolynucleobacter Strains (Betaproteobacteria)

    Energy Technology Data Exchange (ETDEWEB)

    Vannini, Claudia; Pockl, Matthias; Petroni, Giulio; Wu, Qinglong; Lang, Elke; Stackebrandt, Erko; Schrallhammer, Martina; Richardson, PaulM.; Hahn, Martin W.

    2006-07-21

    Bacterial strains affiliated to the phylogenetically shallowsubcluster C (PnecC) of the 28 Polynucleobacter cluster, which ischaracterized by a minimal 16S rRNA gene sequence similarity of approx.98.5 percent, have been reported to occur as obligate endosymbionts of 30ciliates (Euplotes spp.), as well as to occur as free-living cells in thepelagic zone of freshwater habitats. We investigated if these two groupsof closely related bacteria represent 32 strains fundamentally differingin lifestyle, or if they simply represent different stages of afacultative endosymbiotic lifestyle. The phylogenetic analysis of 16SrRNA gene and 16S34 23S ITS sequences of five endosymbiont strains fromtwo different Euplotes species and 40 pure culture strains demonstratedhost-species-specific clustering of the endosymbiont 36 sequences withinthe PnecC subcluster. The sequences of the endosymbionts showedcharacteristics indicating an obligate endosymbiotic lifestyle.Cultivation experiments 38 revealed fundamental differences inphysiological adaptations, and determination of the genome sizesindicated a slight size reduction in endosymbiotic strains. We concludethat the 40 two groups of PnecC bacteria represent obligately free-livingand obligately endosymbiotic strains, respectively, and do not representdifferent stages of the same complex lifecycle. 42 These closely relatedstrains occupy completely separated ecological niches. To our bestknowledge, this is the closest phylogenetic relationship between obligateendosymbionts and 44 obligately free-living bacteria everrevealed.

  14. Phylogenetic analysis of methanogens from the bovine rumen

    Directory of Open Access Journals (Sweden)

    Forster Robert J

    2001-05-01

    Full Text Available Abstract Background Interest in methanogens from ruminants has resulted from the role of methane in global warming and from the fact that cattle typically lose 6 % of ingested energy as methane. Several species of methanogens have been isolated from ruminants. However they are difficult to culture, few have been consistently found in high numbers, and it is likely that major species of rumen methanogens are yet to be identified. Results Total DNA from clarified bovine rumen fluid was amplified using primers specific for Archaeal 16S rRNA gene sequences (rDNA. Phylogenetic analysis of 41 rDNA sequences identified three clusters of methanogens. The largest cluster contained two distinct subclusters with rDNA sequences similar to Methanobrevibacter ruminantium 16S rDNA. A second cluster contained sequences related to 16S rDNA from Methanosphaera stadtmanae, an organism not previously described in the rumen. The third cluster contained rDNA sequences that may form a novel group of rumen methanogens. Conclusions The current set of 16S rRNA hybridization probes targeting methanogenic Archaea does not cover the phylogenetic diversity present in the rumen and possibly other gastro-intestinal tract environments. New probes and quantitative PCR assays are needed to determine the distribution of the newly identified methanogen clusters in rumen microbial communities.

  15. Phylogenetic analysis and taxonomic revision of Physodactylinae (Coleoptera, Elateridae

    Directory of Open Access Journals (Sweden)

    Simone Policena Rosa

    2014-01-01

    Full Text Available A phylogeny based on male morphological characters and taxonomic revision of the Physodactylinae genera are presented. The phylogenetic analysis based on 66 male characters resulted in the polyphyly of Physodactylinae which comprises four independent lineages. Oligostethius and Idiotropia from Africa were found to be sister groups. Teslasena from Brazil was corroborated as belonging to Cardiophorinae clade. The South American genera Physodactylus and Dactylophysus were found to be sister groups and phylogenetically related to Heterocrepidius species. The Oriental Toxognathus resulted as sister group of that clade plus (Dicrepidius ramicornis (Lissomus sp, Physorhynus erythrocephalus. Taxonomic revisions include diagnoses and redescriptions of genera and distributional records and illustrations of species. Key to species of Teslasena, Toxognathus, Dactylophysus and Physodactylus are also provided. Teslasena lucasi is synonymized with T. femoralis. A new species of Dactylophysus is described, D. hirtus sp. nov., and lectotypes are designated to non-conspecific D. mendax sensu Fleutiaux and Heterocrepidius mendax Candèze. Physodactylus niger is removed from synonymy under P. oberthuri; P. carreti is synonymized with P. niger; P. obesus and P. testaceus are synonymized with P. sulcatus. Nine new species are described in Physodactylus: P. asper sp. nov., P. brunneus sp. nov., P. chassaini sp. nov., P. flavifrons sp. nov., P. girardi sp. nov., P. gounellei sp. nov., P. latithorax sp. nov., P. patens sp. nov. and P. tuberculatus sp. nov.

  16. A phylogenetic transform enhances analysis of compositional microbiota data.

    Science.gov (United States)

    Silverman, Justin D; Washburne, Alex D; Mukherjee, Sayan; David, Lawrence A

    2017-02-15

    Surveys of microbial communities (microbiota), typically measured as relative abundance of species, have illustrated the importance of these communities in human health and disease. Yet, statistical artifacts commonly plague the analysis of relative abundance data. Here, we introduce the PhILR transform, which incorporates microbial evolutionary models with the isometric log-ratio transform to allow off-the-shelf statistical tools to be safely applied to microbiota surveys. We demonstrate that analyses of community-level structure can be applied to PhILR transformed data with performance on benchmarks rivaling or surpassing standard tools. Additionally, by decomposing distance in the PhILR transformed space, we identified neighboring clades that may have adapted to distinct human body sites. Decomposing variance revealed that covariation of bacterial clades within human body sites increases with phylogenetic relatedness. Together, these findings illustrate how the PhILR transform combines statistical and phylogenetic models to overcome compositional data challenges and enable evolutionary insights relevant to microbial communities.

  17. The Nothoaspis amazoniensis Complete Mitogenome: A Comparative and Phylogenetic Analysis

    Directory of Open Access Journals (Sweden)

    Paulo H. C. Lima

    2018-03-01

    Full Text Available The molecular biology era, together with morphology, molecular phylogenetics, bioinformatics, and high-throughput sequencing technologies, improved the taxonomic identification of Argasidae family members, especially when considering specimens at different development stages, which remains a great difficulty for acarologists. These tools could provide important data and insights on the history and evolutionary relationships of argasids. To better understand these relationships, we sequenced and assembled the first complete mitochondrial genome of Nothoaspis amazoniensis. We used phylogenomics to identify the evolutionary history of this species of tick, comparing the data obtained with 26 complete mitochondrial sequences available in biological databases. The results demonstrated the absence of genetic rearrangements, high similarity and identity, and a close organizational link between the mitogenomes of N. amazoniensis and other argasids analyzed. In addition, the mitogenome had a monophyletic cladistic taxonomic arrangement, encompassed by representatives of the Afrotropical and Neotropical regions, with specific parasitism in bats, which may be indicative of an evolutionary process of cospeciation between vectors and the host.

  18. Molecular and morphological analyses reveal phylogenetic relationships of stingrays focusing on the family Dasyatidae (Myliobatiformes.

    Directory of Open Access Journals (Sweden)

    Kean Chong Lim

    Full Text Available Elucidating the phylogenetic relationships of the current but problematic Dasyatidae (Order Myliobatiformes was the first priority of the current study. Here, we studied three molecular gene markers of 43 species (COI gene, 33 species (ND2 gene and 34 species (RAG1 gene of stingrays to draft out the phylogenetic tree of the order. Nine character states were identified and used to confirm the molecularly constructed phylogenetic trees. Eight or more clades (at different hierarchical level were identified for COI, ND2 and RAG1 genes in the Myliobatiformes including four clades containing members of the present Dasyatidae, thus rendering the latter non-monophyletic. The uncorrected p-distance between these four 'Dasytidae' clades when compared to the distance between formally known families confirmed that these four clades should be elevated to four separate families. We suggest a revision of the present classification, retaining the Dasyatidae (Dasyatis and Taeniurops species but adding three new families namely, Neotrygonidae (Neotrygon and Taeniura species, Himanturidae (Himantura species and Pastinachidae (Pastinachus species. Our result indicated the need to further review the classification of Dasyatis microps. By resolving the non-monophyletic problem, the suite of nine character states enables the natural classification of the Myliobatiformes into at least thirteen families based on morphology.

  19. Phylogenetic Analysis of Apple scar skin viroid Isolates in Korea

    Directory of Open Access Journals (Sweden)

    Kang Hee Cho

    2015-12-01

    Full Text Available To identify genome sequences of Apple scar skin viroid (ASSVd isolates in Korea, the field survey was performed from ‘Hongro’ apple orchards located in eight sites in South Korea (Bongwha, Cheongsong, Dangjin, Gimchoen, Muju, Mungyeong, Suwon, and Yeongwol. ASSVd was detected by RT-PCR and PCR fragments were cloned into cloning vector. Full-length viral genomes of eight ASSVd isolates were sequenced and compared with 21 isolates reported previously from Korea, India, China, Japan and Greece. Eight isolates in this study showed 92.2-99.7% nucleotide sequence identities with those reported previously. Phylogenetic analysis showed that seven isolates reported in this study belong to the same group distinct from other groups.

  20. Phylogenetic relationships and morphological evolution in Lentinus, Polyporellus and Neofavolus, emphasizing southeastern Asian taxa.

    Science.gov (United States)

    Seelan, Jaya Seelan Sathiya; Justo, Alfredo; Nagy, Laszlo G; Grand, Edward A; Redhead, Scott A; Hibbett, David

    2015-01-01

    The genus Lentinus (Polyporaceae, Basidiomycota) is widely documented from tropical and temperate forests and is taxonomically controversial. Here we studied the relationships between Lentinus subg. Lentinus sensu Pegler (i.e. sections Lentinus, Tigrini, Dicholamellatae, Rigidi, Lentodiellum and Pleuroti and polypores that share similar morphological characters). We generated sequences of internal transcribed spacers (ITS) and partial 28S regions of nuc rDNA and genes encoding the largest subunit of RNA polymerase II (RPB1), focusing on Lentinus subg. Lentinus sensu Pegler and the Neofavolus group, combined these data with sequences from GenBank (including RPB2 gene sequences) and performed phylogenetic analyses with maximum likelihood and Bayesian methods. We also evaluated the transition in hymenophore morphology between Lentinus, Neofavolus and related polypores with ancestral state reconstruction. Single-gene phylogenies and phylogenies combining ITS and 28S with RPB1 and RPB2 genes all support existence of a Lentinus/Polyporellus clade and a separate Neofavolus clade. Polyporellus (represented by P. arcularius, P. ciliatus, P. brumalis) forms a clade with species representing Lentinus subg. Lentinus sensu Pegler (1983), excluding L. suavissimus. Lentinus tigrinus appears as the sister group of Polyporellus in the four-gene phylogeny, but this placement was weakly supported. All three multigene analyses and the single-gene analysis using ITS strongly supported Polyporus tricholoma as the sister group of the Lentinus/Polyporellus clade; only the 28S rRNA phylogeny failed to support this placement. Under parsimony the ancestral hymenophoral configuration for the Lentinus/Polyporellus clade is estimated to be circular pores, with independent transitions to angular pores and lamellae. The ancestral state for the Neofavolus clade is estimated to be angular pores, with a single transition to lamellae in L. suavissimus. We propose that Lentinus suavissimus (section

  1. Phylogenetic analysis of Tibetan mastiffs based on mitochondrial ...

    Indian Academy of Sciences (India)

    ZHANJUN REN

    Tibetan mastiffs have close relationship with humans in guarding ... analysis of origin of dog by sequencing mtDNA has been reported. ... However, study on evolutionary relation- ..... tral test and mismatch distribution were explained by rapid.

  2. Phylogenetic Relationships of Five Asian Schilbid Genera Including Clupisoma (Siluriformes: Schilbeidae.

    Directory of Open Access Journals (Sweden)

    Jing Wang

    Full Text Available The phylogenetic relationships of Asian schilbid catfishes of the genera Clupisoma, Ailia, Horabagrus, Laides and Pseudeutropius are poorly understood, especially those of Clupisoma. Herein, we reconstruct the phylogeny of 38 species of catfishes belonging to 28 genera and 14 families using the concatenated mitochondrial genes COI, cytb, and 16S rRNA, as well as the nuclear genes RAG1 and RAG2. The resulting phylogenetic trees consistently place Clupisoma as the sister taxon of Laides, and the five representative Asian schilbid genera form two monophyletic groups with the relationships (Ailia (Laides, Clupisoma and (Horabagrus, Pseudeutropius. The so-called "Big Asia" lineage relates distantly to African schilbids. Independent analyses of the mitochondrial and nuclear DNA data yield differing trees for the two Asian schilbid groups. Analyses of the mitochondrial gene data support a sister-group relationship for (Ailia (Laides, Clupisoma and the Sisoroidea and a sister-taxon association of (Horabagrus, Pseudeutropius and the Bagridae. In contrast, analyses of the combined nuclear data indicate (Ailia (Laides, Clupisoma to be the sister group to (Horabagrus, Pseudeutropius. Our results indicate that the Horabagridae, recognized by some authors as consisting of Horabagrus, Pseudeutropius and Clupisoma does not include the latter genus. We formally erect a new family, Ailiidae fam. nov. for a monophyletic Asian group comprised of the genera Ailia, Laides and Clupisoma.

  3. Contribution of WUSCHEL-related homeobox (WOX genes to identify the phylogenetic relationships among Petunia species

    Directory of Open Access Journals (Sweden)

    Ana Lúcia Anversa Segatto

    Full Text Available Abstract Developmental genes are believed to contribute to major changes during plant evolution, from infrageneric to higher levels. Due to their putative high sequence conservation, developmental genes are rarely used as molecular markers, and few studies including these sequences at low taxonomic levels exist. WUSCHEL-related homeobox genes (WOX are transcription factors exclusively present in plants and are involved in developmental processes. In this study, we characterized the infrageneric genetic variation of Petunia WOX genes. We obtained phylogenetic relationships consistent with other phylogenies based on nuclear markers, but with higher statistical support, resolution in terminals, and compatibility with flower morphological changes.

  4. Expressed sequence tags as a tool for phylogenetic analysis of placental mammal evolution.

    Directory of Open Access Journals (Sweden)

    Morgan Kullberg

    Full Text Available BACKGROUND: We investigate the usefulness of expressed sequence tags, ESTs, for establishing divergences within the tree of placental mammals. This is done on the example of the established relationships among primates (human, lagomorphs (rabbit, rodents (rat and mouse, artiodactyls (cow, carnivorans (dog and proboscideans (elephant. METHODOLOGY/PRINCIPAL FINDINGS: We have produced 2000 ESTs (1.2 mega bases from a marsupial mouse and characterized the data for their use in phylogenetic analysis. The sequences were used to identify putative orthologous sequences from whole genome projects. Although most ESTs stem from single sequence reads, the frequency of potential sequencing errors was found to be lower than allelic variation. Most of the sequences represented slowly evolving housekeeping-type genes, with an average amino acid distance of 6.6% between human and mouse. Positive Darwinian selection was identified at only a few single sites. Phylogenetic analyses of the EST data yielded trees that were consistent with those established from whole genome projects. CONCLUSIONS: The general quality of EST sequences and the general absence of positive selection in these sequences make ESTs an attractive tool for phylogenetic analysis. The EST approach allows, at reasonable costs, a fast extension of data sampling from species outside the genome projects.

  5. Social Mating System and Sex-Biased Dispersal in Mammals and Birds: A Phylogenetic Analysis

    Science.gov (United States)

    Mabry, Karen E.; Shelley, Erin L.; Davis, Katie E.; Blumstein, Daniel T.; Van Vuren, Dirk H.

    2013-01-01

    The hypothesis that patterns of sex-biased dispersal are related to social mating system in mammals and birds has gained widespread acceptance over the past 30 years. However, two major complications have obscured the relationship between these two behaviors: 1) dispersal frequency and dispersal distance, which measure different aspects of the dispersal process, have often been confounded, and 2) the relationship between mating system and sex-biased dispersal in these vertebrate groups has not been examined using modern phylogenetic comparative methods. Here, we present a phylogenetic analysis of the relationship between mating system and sex-biased dispersal in mammals and birds. Results indicate that the evolution of female-biased dispersal in mammals may be more likely on monogamous branches of the phylogeny, and that females may disperse farther than males in socially monogamous mammalian species. However, we found no support for a relationship between social mating system and sex-biased dispersal in birds when the effects of phylogeny are taken into consideration. We caution that although there are larger-scale behavioral differences in mating system and sex-biased dispersal between mammals and birds, mating system and sex-biased dispersal are far from perfectly associated within these taxa. PMID:23483957

  6. Comprehensive Phylogenetic Analysis of Bovine Non-aureus Staphylococci Species Based on Whole-Genome Sequencing

    Science.gov (United States)

    Naushad, Sohail; Barkema, Herman W.; Luby, Christopher; Condas, Larissa A. Z.; Nobrega, Diego B.; Carson, Domonique A.; De Buck, Jeroen

    2016-01-01

    Non-aureus staphylococci (NAS), a heterogeneous group of a large number of species and subspecies, are the most frequently isolated pathogens from intramammary infections in dairy cattle. Phylogenetic relationships among bovine NAS species are controversial and have mostly been determined based on single-gene trees. Herein, we analyzed phylogeny of bovine NAS species using whole-genome sequencing (WGS) of 441 distinct isolates. In addition, evolutionary relationships among bovine NAS were estimated from multilocus data of 16S rRNA, hsp60, rpoB, sodA, and tuf genes and sequences from these and numerous other single genes/proteins. All phylogenies were created with FastTree, Maximum-Likelihood, Maximum-Parsimony, and Neighbor-Joining methods. Regardless of methodology, WGS-trees clearly separated bovine NAS species into five monophyletic coherent clades. Furthermore, there were consistent interspecies relationships within clades in all WGS phylogenetic reconstructions. Except for the Maximum-Parsimony tree, multilocus data analysis similarly produced five clades. There were large variations in determining clades and interspecies relationships in single gene/protein trees, under different methods of tree constructions, highlighting limitations of using single genes for determining bovine NAS phylogeny. However, based on WGS data, we established a robust phylogeny of bovine NAS species, unaffected by method or model of evolutionary reconstructions. Therefore, it is now possible to determine associations between phylogeny and many biological traits, such as virulence, antimicrobial resistance, environmental niche, geographical distribution, and host specificity. PMID:28066335

  7. Phylogenetic analysis of ferlin genes reveals ancient eukaryotic origins

    Directory of Open Access Journals (Sweden)

    Lek Monkol

    2010-07-01

    Full Text Available Abstract Background The ferlin gene family possesses a rare and identifying feature consisting of multiple tandem C2 domains and a C-terminal transmembrane domain. Much currently remains unknown about the fundamental function of this gene family, however, mutations in its two most well-characterised members, dysferlin and otoferlin, have been implicated in human disease. The availability of genome sequences from a wide range of species makes it possible to explore the evolution of the ferlin family, providing contextual insight into characteristic features that define the ferlin gene family in its present form in humans. Results Ferlin genes were detected from all species of representative phyla, with two ferlin subgroups partitioned within the ferlin phylogenetic tree based on the presence or absence of a DysF domain. Invertebrates generally possessed two ferlin genes (one with DysF and one without, with six ferlin genes in most vertebrates (three DysF, three non-DysF. Expansion of the ferlin gene family is evident between the divergence of lamprey (jawless vertebrates and shark (cartilaginous fish. Common to almost all ferlins is an N-terminal C2-FerI-C2 sandwich, a FerB motif, and two C-terminal C2 domains (C2E and C2F adjacent to the transmembrane domain. Preservation of these structural elements throughout eukaryotic evolution suggests a fundamental role of these motifs for ferlin function. In contrast, DysF, C2DE, and FerA are optional, giving rise to subtle differences in domain topologies of ferlin genes. Despite conservation of multiple C2 domains in all ferlins, the C-terminal C2 domains (C2E and C2F displayed higher sequence conservation and greater conservation of putative calcium binding residues across paralogs and orthologs. Interestingly, the two most studied non-mammalian ferlins (Fer-1 and Misfire in model organisms C. elegans and D. melanogaster, present as outgroups in the phylogenetic analysis, with results suggesting

  8. Phylogenetic relationships of Erysimum (Brassicaceae from the Baetic Mountains (SE Iberian Peninsula

    Directory of Open Access Journals (Sweden)

    Abdelaziz, Mohamed

    2014-06-01

    Full Text Available The Baetic mountains, located in the southern Iberian Peninsula, is a major hotspot of biodiversity in the Mediterranean Basin, constituting one of the most important glacial refugia for vascular plants in Europe. Despite their relatively limited extension, the Baetic Mountains contain almost 50% of the total endemic Erysimum species in the Iberian Peninsula. The broadly distributed Erysimum genus has diversified profusely in the Mediterranean region, with more than a hundred species described in the area, out of a total of c. 200 species included in the genus. We used two plastid DNA regions (ndhF and trnT-L and one nuclear DNA region (ITS1-5.8S rDNA-ITS2, with 3,556 bp total length, to carry out phylogenetic analysis by Bayesian inference, maximum likelihood and maximum parsimony, in order to explore the evolutionary relationships between the Erysimum species inhabiting these ranges. Analyses of concatenated sequences from the two genomes identified two main clades with no overlap in species composition so that samples from the same species fell within the same major clade. The phylogenetic relationships depicted by those two clades do not give support to the E. nevadense group, previously proposed on taxonomic grounds. In addition, our results indicated recurrent changes in flower colour in the Baetic Erysimum species although, alternatively, reticulate evolution, which is suggested by incongruent position of taxa in the different trees, may have also affected this trait.Las cordilleras Béticas, localizadas en el sudeste de la Península Ibérica, representan una importante zona para la biodiversidad de la cuenca mediterránea, constituyendo uno de los refugios glaciares más destacados de plantas vasculares en Europa. A pesar de su extensión relativamente limitada, las cordilleras Béticas albergan casi el 50% del total de las especies endémicas de Erysimum de la Península Ibérica. Erysimum es un género ampliamente distribuido, que se

  9. Conus pennaceus : a phylogenetic analysis of the Mozambican ...

    African Journals Online (AJOL)

    The genus Conus has over 500 species and is the most species-rich taxon of marine invertebrates. Based on mitochondrial DNA, this study focuses on the phylogenetics of Conus, particularly the pennaceus complex collected along the Mozambican coast. Phylogenetic trees based on both the 16S and the 12S ribosomal ...

  10. Orthology prediction at scalable resolution by phylogenetic tree analysis

    NARCIS (Netherlands)

    Heijden, R.T.J.M. van der; Snel, B.; Noort, V. van; Huynen, M.A.

    2007-01-01

    BACKGROUND: Orthology is one of the cornerstones of gene function prediction. Dividing the phylogenetic relations between genes into either orthologs or paralogs is however an oversimplification. Already in two-species gene-phylogenies, the complicated, non-transitive nature of phylogenetic

  11. Phylogenetic relationships and evolution of growth form in Cactaceae (Caryophyllales, Eudicotyledoneae).

    Science.gov (United States)

    Hernández-Hernández, Tania; Hernández, Héctor M; De-Nova, J Arturo; Puente, Raul; Eguiarte, Luis E; Magallón, Susana

    2011-01-01

    Cactaceae is one of the most charismatic plant families because of the extreme succulence and outstanding diversity of growth forms of its members. Although cacti are conspicuous elements of arid ecosystems in the New World and are model systems for ecological and anatomical studies, the high morphological convergence and scarcity of phenotypic synapomorphies make the evolutionary relationships and trends among lineages difficult to understand. We performed phylogenetic analyses implementing parsimony ratchet and likelihood methods, using a concatenated matrix with 6148 bp of plastid and nuclear markers (trnK/matK, matK, trnL-trnF, rpl16, and ppc). We included 224 species representing approximately 85% of the family's genera. Likelihood methods were used to perform an ancestral character reconstruction within Cactoideae, the richest subfamily in terms of morphological diversity and species number, to evaluate possible growth form evolutionary trends. Our phylogenetic results support previous studies showing the paraphyly of subfamily Pereskioideae and the monophyly of subfamilies Opuntioideae and Cactoideae. After the early divergence of Blossfeldia, Cactoideae splits into two clades: Cacteae, including North American globose and barrel-shaped members, and core Cactoideae, including the largest diversity of growth forms distributed throughout the American continent. Para- or polyphyly is persistent in different parts of the phylogeny. Main Cactoideae clades were found to have different ancestral growth forms, and convergence toward globose, arborescent, or columnar forms occurred in different lineages. Our study enabled us to provide a detailed hypothesis of relationships among cacti lineages and represents the most complete general phylogenetic framework available to understand evolutionary trends within Cactaceae.

  12. [Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

    Science.gov (United States)

    Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

    2002-06-01

    Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

  13. Molecular characterization and phylogenetic analysis of Fasciola hepatica from Peru.

    Science.gov (United States)

    Ichikawa-Seki, Madoka; Ortiz, Pedro; Cabrera, Maria; Hobán, Cristian; Itagaki, Tadashi

    2016-06-01

    The causative agent of fasciolosis in South America is thought to be Fasciola hepatica. In this study, Fasciola flukes from Peru were analyzed to investigate their genetic structure and phylogenetic relationships with those from other countries. Fasciola flukes were collected from the three definitive host species: cattle, sheep, and pigs. They were identified as F. hepatica because mature sperms were observed in their seminal vesicles, and also they displayed Fh type, which has an identical fragment pattern to F. hepatica in the nuclear internal transcribed spacer 1. Eight haplotypes were obtained from the mitochondrial NADH dehydrogenase subunit 1 (nad1) sequences of Peruvian F. hepatica; however, no special difference in genetic structure was observed between the three host species. Its extremely low genetic diversity suggests that the Peruvian population was introduced from other regions. Nad1 haplotypes identical to those of Peruvian F. hepatica were detected in China, Uruguay, Italy, Iran, and Australia. Our results indicate that F. hepatica rapidly expanded its range due to human migration. Future studies are required to elucidate dispersal route of F. hepatica from Europe, its probable origin, to other areas, including Peru. Copyright © 2015. Published by Elsevier Ireland Ltd.

  14. Molecular phylogenetic analysis of Fasciola flukes from eastern India.

    Science.gov (United States)

    Hayashi, Kei; Ichikawa-Seki, Madoka; Mohanta, Uday Kumar; Singh, T Shantikumar; Shoriki, Takuya; Sugiyama, Hiromu; Itagaki, Tadashi

    2015-10-01

    Fasciola flukes from eastern India were characterized on the basis of spermatogenesis status and nuclear ITS1. Both Fasciola gigantica and aspermic Fasciola flukes were detected in Imphal, Kohima, and Gantoku districts. The sequences of mitochondrial nad1 were analyzed to infer their phylogenetical relationship with neighboring countries. The haplotypes of aspermic Fasciola flukes were identical or showed a single nucleotide substitution compared to those from populations in the neighboring countries, corroborating the previous reports that categorized them in the same lineage. However, the prevalence of aspermic Fasciola flukes in eastern India was lower than those in the neighboring countries, suggesting that they have not dispersed throughout eastern India. In contrast, F. gigantica was predominant and well diversified, and the species was thought to be distributed in the area for a longer time than the aspermic Fasciola flukes. Fasciola gigantica populations from eastern India were categorized into two distinct haplogroups A and B. The level of their genetic diversity suggests that populations belonging to haplogroup A have dispersed from the west side of the Indian subcontinent to eastern India with the artificial movement of domestic cattle, Bos indicus, whereas populations belonging to haplogroup B might have spread from Myanmar to eastern India with domestic buffaloes, Bubalus bubalis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  15. Bayesian models for comparative analysis integrating phylogenetic uncertainty

    Directory of Open Access Journals (Sweden)

    Villemereuil Pierre de

    2012-06-01

    Full Text Available Abstract Background Uncertainty in comparative analyses can come from at least two sources: a phylogenetic uncertainty in the tree topology or branch lengths, and b uncertainty due to intraspecific variation in trait values, either due to measurement error or natural individual variation. Most phylogenetic comparative methods do not account for such uncertainties. Not accounting for these sources of uncertainty leads to false perceptions of precision (confidence intervals will be too narrow and inflated significance in hypothesis testing (e.g. p-values will be too small. Although there is some application-specific software for fitting Bayesian models accounting for phylogenetic error, more general and flexible software is desirable. Methods We developed models to directly incorporate phylogenetic uncertainty into a range of analyses that biologists commonly perform, using a Bayesian framework and Markov Chain Monte Carlo analyses. Results We demonstrate applications in linear regression, quantification of phylogenetic signal, and measurement error models. Phylogenetic uncertainty was incorporated by applying a prior distribution for the phylogeny, where this distribution consisted of the posterior tree sets from Bayesian phylogenetic tree estimation programs. The models were analysed using simulated data sets, and applied to a real data set on plant traits, from rainforest plant species in Northern Australia. Analyses were performed using the free and open source software OpenBUGS and JAGS. Conclusions Incorporating phylogenetic uncertainty through an empirical prior distribution of trees leads to more precise estimation of regression model parameters than using a single consensus tree and enables a more realistic estimation of confidence intervals. In addition, models incorporating measurement errors and/or individual variation, in one or both variables, are easily formulated in the Bayesian framework. We show that BUGS is a useful, flexible

  16. Bayesian models for comparative analysis integrating phylogenetic uncertainty

    Science.gov (United States)

    2012-01-01

    Background Uncertainty in comparative analyses can come from at least two sources: a) phylogenetic uncertainty in the tree topology or branch lengths, and b) uncertainty due to intraspecific variation in trait values, either due to measurement error or natural individual variation. Most phylogenetic comparative methods do not account for such uncertainties. Not accounting for these sources of uncertainty leads to false perceptions of precision (confidence intervals will be too narrow) and inflated significance in hypothesis testing (e.g. p-values will be too small). Although there is some application-specific software for fitting Bayesian models accounting for phylogenetic error, more general and flexible software is desirable. Methods We developed models to directly incorporate phylogenetic uncertainty into a range of analyses that biologists commonly perform, using a Bayesian framework and Markov Chain Monte Carlo analyses. Results We demonstrate applications in linear regression, quantification of phylogenetic signal, and measurement error models. Phylogenetic uncertainty was incorporated by applying a prior distribution for the phylogeny, where this distribution consisted of the posterior tree sets from Bayesian phylogenetic tree estimation programs. The models were analysed using simulated data sets, and applied to a real data set on plant traits, from rainforest plant species in Northern Australia. Analyses were performed using the free and open source software OpenBUGS and JAGS. Conclusions Incorporating phylogenetic uncertainty through an empirical prior distribution of trees leads to more precise estimation of regression model parameters than using a single consensus tree and enables a more realistic estimation of confidence intervals. In addition, models incorporating measurement errors and/or individual variation, in one or both variables, are easily formulated in the Bayesian framework. We show that BUGS is a useful, flexible general purpose tool for

  17. Phylogenetic relationships of rollers (Coraciidae) based on complete mitochondrial genomes and fifteen nuclear genes.

    Science.gov (United States)

    Johansson, Ulf S; Irestedt, Martin; Qu, Yanhua; Ericson, Per G P

    2018-04-06

    The rollers (Coraciidae) constitute a relative small avian family with ca. 12 species distributed in Africa, western and southern Eurasia, and eastern Australia. In this study we examine the phylogenetic relationships of all species currently recognized in the family, including two taxa whose taxonomic status is currently contested. By using shotgun sequencing on degraded DNA from museum study skins we have been able to recover complete mitochondrial genomes as well as 15 nuclear genes for in total 16 taxa. The gene sequences were analyzed both concatenated in a maximum likelihood framework as well in a species tree approach using MP-EST. The different analytical approaches yield similar, highly supported trees and support the current division of the rollers into two genera, Coracias and Eurystomus. The only conflict relates to the placement of the Blue-bellied Roller (C. cyanogaster), where the mitochondrial, and the concatenated nuclear and mitochondrial data set, place this taxon as sister to the other Coracias species, whereas nuclear data and the species tree analysis place it as the sister taxon of C. naevia and C. spatulatus. All analyses place the Eurasian roller (C. garrulus) with the two African species, Abyssinian Roller (C. abyssinica) and Liliac-breasted Roller (C. caudatus), and place this clade as the sister group to the Asian Coracias rollers. In addition, our results support a sister group relationship between the morphologically rather dissimilar Purple Roller (C. naevia) and Racquet-tailed Roller (C. spatulatus) and also support the division of Eurystomus in an African and an Asian clade. However, within the Asian clade the Azure Roller (E. azureus) from Halmahera appears to be nested within the Dollarbird (E. orientalis), indicating that that this taxon is a morphological divergent, but a rather recent offshoot, of the widespread Dollarbird. Similarly, the Purple-winged Roller (C. temminickii) from Sulawesi group together with C. benghalensis

  18. Molecular cytogenetic characterisation and phylogenetic analysis of the seven cultivated Vigna species (Fabaceae).

    Science.gov (United States)

    She, C-W; Jiang, X-H; Ou, L-J; Liu, J; Long, K-L; Zhang, L-H; Duan, W-T; Zhao, W; Hu, J-C

    2015-01-01

    The genomic organisation of the seven cultivated Vigna species, V. unguiculata, V. subterranea, V. angularis, V. umbellata, V. radiata, V. mungo and V. aconitifolia, was determined using sequential combined PI and DAPI (CPD) staining and dual-colour fluorescence in situ hybridisation (FISH) with 5S and 45S rDNA probes. For phylogenetic analyses, comparative genomic in situ hybridisation (cGISH) onto somatic chromosomes and sequence analysis of the internal transcribed spacer (ITS) of 45S rDNA were used. Quantitative karyotypes were established using chromosome measurements, fluorochrome bands and rDNA FISH signals. All species had symmetrical karyotypes composed of only metacentric or metacentric and submetacentric chromosomes. Distinct heterochromatin differentiation was revealed by CPD staining and DAPI counterstaining after FISH. The rDNA sites among all species differed in their number, location and size. cGISH of V. umbellata genomic DNA to the chromosomes of all species produced strong signals in all centromeric regions of V. umbellata and V. angularis, weak signals in all pericentromeric regions of V. aconitifolia, and CPD-banded proximal regions of V. mungo var. mungo. Molecular phylogenetic trees showed that V. angularis and V. umbellata were the closest relatives, and V. mungo and V. aconitifolia were relatively closely related; these species formed a group that was separated from another group comprising V. radiata, V. unguiculata ssp. sesquipedalis and V. subterranea. This result was consistent with the phylogenetic relationships inferred from the heterochromatin and cGISH patterns; thus, fluorochrome banding and cGISH are efficient tools for the phylogenetic analysis of Vigna species. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  19. Phylogenetic relationships, character evolution, and taxonomic implications within the slipper lobsters (Crustacea: Decapoda: Scyllaridae).

    Science.gov (United States)

    Yang, Chien-Hui; Bracken-Grissom, Heather; Kim, Dohyup; Crandall, Keith A; Chan, Tin-Yam

    2012-01-01

    The slipper lobsters belong to the family Scyllaridae which contains a total of 20 genera and 89 species distributed across four subfamilies (Arctidinae, Ibacinae, Scyllarinae, and Theninae). We have collected nucleotide sequence data from regions of five different genes (16S, 18S, COI, 28S, H3) to estimate phylogenetic relationships among 54 species from the Scyllaridae with a focus on the species rich subfamily Scyllarinae. We have included in our analyses at least one representative from all 20 genera in the Scyllaridae and 35 of the 52 species within the Scyllarinae. Our resulting phylogenetic estimate shows the subfamilies are monophyletic, except for Ibacinae, which has paraphyletic relationships among genera. Many of the genera within the Scyllarinae form non-monophyletic groups, while the genera from all other subfamilies form well supported clades. We discuss the implications of this history on the evolution of morphological characters and ecological transitions (nearshore vs. offshore) within the slipper lobsters. Finally, we identify, through ancestral state character reconstructions, key morphological features diagnostic of the major clades of diversity within the Scyllaridae and relate this character evolution to current taxonomy and classification. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Species boundaries and phylogenetic relationships in the critically endangered Asian box turtle genus Cuora.

    Science.gov (United States)

    Spinks, Phillip Q; Thomson, Robert C; Zhang, YaPing; Che, Jing; Wu, Yonghua; Shaffer, H Bradley

    2012-06-01

    Turtles are currently the most endangered major clade of vertebrates on earth, and Asian box turtles (Cuora) are in catastrophic decline. Effective management of this diverse turtle clade has been hampered by human-mediated, and perhaps natural hybridization, resulting in discordance between mitochondrial and nuclear markers and confusion regarding species boundaries and phylogenetic relationships among hypothesized species of Cuora. Here, we present analyses of mitochondrial and nuclear DNA data for all 12 currently hypothesized species to resolve both species boundaries and phylogenetic relationships. Our 15-gene, 40-individual nuclear data set was frequently in conflict with our mitochondrial data set; based on its general concordance with published morphological analyses and the strength of 15 independent estimates of evolutionary history, we interpret the nuclear data as representing the most reliable estimate of species boundaries and phylogeny of Cuora. Our results strongly reiterate the necessity of using multiple nuclear markers for phylogeny and species delimitation in these animals, including any form of DNA "barcoding", and point to Cuora as an important case study where reliance on mitochondrial DNA can lead to incorrect species identification. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Phylogenetic relationships in Peniocereus (Cactaceae) inferred from plastid DNA sequence data.

    Science.gov (United States)

    Arias, Salvador; Terrazas, Teresa; Arreola-Nava, Hilda J; Vázquez-Sánchez, Monserrat; Cameron, Kenneth M

    2005-10-01

    The phylogenetic relationships of Peniocereus (Cactaceae) species were studied using parsimony analyses of DNA sequence data. The plastid rpl16 and trnL-F regions were sequenced for 98 taxa including 17 species of Peniocereus, representatives from all genera of tribe Pachycereeae, four genera of tribe Hylocereeae, as well as from three additional outgroup genera of tribes Calymmantheae, Notocacteae, and Trichocereeae. Phylogenetic analyses support neither the monophyly of Peniocereus as currently circumscribed, nor the monophyly of tribe Pachycereeae since species of Peniocereus subgenus Pseudoacanthocereus are embedded within tribe Hylocereeae. Furthermore, these results show that the eight species of Peniocereus subgenus Peniocereus (Peniocereus sensu stricto) form a well-supported clade within subtribe Pachycereinae; P. serpentinus is also a member of this subtribe, but is sister to Bergerocactus. Moreover, Nyctocereus should be resurrected as a monotypic genus. Species of Peniocereus subgenus Pseudoacanthocereus are positioned among species of Acanthocereus within tribe Hylocereeae, indicating that they may be better classified within that genus. A number of morphological and anatomical characters, especially related to the presence or absence of dimorphic branches, are discussed to support these relationships.

  2. A Molecular Assessment of Phylogenetic Relationships and LineageDiversification Within the Family Salamandridae (Amphibia, Caudata)

    Energy Technology Data Exchange (ETDEWEB)

    Weisrock, David W.; Papenfuss, Theodore J.; Macey, J. Robert; Litvinchuk, Spartak N.; Polymeni, Rosa; Ugurtas, Ismail H.; Zhao, Ermi; Larson, Allan

    2005-08-08

    Phylogenetic relationships among species of the salamanderfamily Salamandridae are investigated using nearly 3000 nucleotide basesof newly reported mitochondrial DNA sequence data from the mtDNA genicregion spanning the genes tRNALeu-COI. This study uses nearlycomprehensive species-level sampling to provide the first completephylogeny for the Salamandridae. Deep phylogenetic relationships amongthe three most divergent lineages in the family Salamandrina terdigitata,a clade comprising the "True" salamanders, and a clade comprising allnewts except S. terdigitata are difficult to resolve. However, mostrelationships within the latter two lineages are resolved with robustlevels of branch support. The genera Euproctus and Triturus arestatistically shown to be nonmonophyletic, instead each contains adiverse set of lineages positioned within the large newt clade. The genusParamesotriton is also resolve as a nonmonophyletic group, with the newlydescribed species P. laoensis constituting a divergent lineage placed ina sister position to clade containing all Pachytriton species and allremaining Paramesotriton species. Sequence divergences between P.laoensis and other Paramesotriton species are as great as those comparingP. laoensis and species of the genera Cynops and Pachytriton. Analyses oflineage diversification across the Salamandridae indicate that, despiteits exceptional diversity, lineage accumulation appears to have beenconstant across time, indicating that it does not represent a truespecies radiation.

  3. Phylogenetic relationships among Neoechinorhynchus species (Acanthocephala: Neoechinorhynchidae) from North-East Asia based on molecular data.

    Science.gov (United States)

    Malyarchuk, Boris; Derenko, Miroslava; Mikhailova, Ekaterina; Denisova, Galina

    2014-02-01

    Phylogenetic and statistical analyses of DNA sequences of two genes, cytochrome oxidase subunit 1 (cox 1) of the mitochondrial DNA and 18S subunit of the nuclear ribosomal RNA (18S rRNA), was used to characterize Neoechinorhynchus species from fishes collected in different localities of North-East Asia. It has been found that four species can be clearly recognized using molecular markers-Neoechinorhynchus tumidus, Neoechinorhynchus beringianus, Neoechinorhynchus simansularis and Neoechinorhynchus salmonis. 18S sequences ascribed to Neoechinorhynchus crassus specimens from North-East Asia were identical to those of N. tumidus, but differed substantially from North American N. crassus. We renamed North-East Asian N. crassus specimens to N. sp., although the possibility that they represent a subspecies of N. tumidus cannot be excluded, taking into account a relatively small distance between cox 1 sequences of North-East Asian specimens of N. crassus and N. tumidus. Maximum likelihood, maximum parsimony and Bayesian inference analyses were performed for phylogeny reconstruction. All the phylogenetic trees showed that North-East Asian species of Neoechinorhynchus analyzed in this study represent independent clades, with the only exception of N. tumidus and N. sp. for 18S data. Phylogenetic analysis has shown that the majority of species sampled (N. tumidus+N. sp., N. simansularis and N. beringianus) are probably very closely related, while N. salmonis occupies separate position in the trees, possibly indicating a North American origin of this species. © 2013.

  4. Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences

    DEFF Research Database (Denmark)

    Dahlgren, S.S.; Oliveira, Rodrigo Gouveia; Gjerde, B.

    2008-01-01

    any effect on previously inferred phylogenetic relationships within the Sarcocystidae. The complete small subunit (ssu) rRNA gene sequences of all six Sarcocystis species from reindeer were used in the phylogenetic analyses along with ssu rRNA gene sequences of 85 other members of the Coccidea. Trees...... the six species in phylogenetic analyses of the Sarcocystidae, and also to investigate the phylogenetic relationships between the species from reindeer and those from other hosts. The study also aimed at revealing whether the inclusion of six Sarcocystis species from the same intermediate host would have....... tarandivulpes, formed a sister group to other Sarcocystis species with a canine definitive host. The position of S. hardangeri on the tree suggested that it uses another type of definitive host than the other Sarcocystis species in this clade. Considering the geographical distribution and infection intensity...

  5. Introgression evidence and phylogenetic relationships among three (ParaMisgurnus species as revealed by mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Jakovlić I.

    2013-01-01

    Full Text Available The taxonomy of (ParaMisgurnus genera is still debated. We therefore used mitochondrial and nuclear DNA markers to analyze the phylogenetic relationships among Misgurnus anguillicaudatus, Paramisgurnus dabryanus and Misgurnus fossilis. Differing phylogenetic signals from mitochondrial and nuclear marker data suggest an introgression event in the history of M. anguillicaudatus and M. mohoity. No substantial genetic evidence was found that Paramisgurnus dabryanus should be classified as a separate genus.

  6. Phylogenetic incongruence in E. coli O104: understanding the evolutionary relationships of emerging pathogens in the face of homologous recombination.

    Directory of Open Access Journals (Sweden)

    Weilong Hao

    Full Text Available Escherichia coli O104:H4 was identified as an emerging pathogen during the spring and summer of 2011 and was responsible for a widespread outbreak that resulted in the deaths of 50 people and sickened over 4075. Traditional phenotypic and genotypic assays, such as serotyping, pulsed field gel electrophoresis (PFGE, and multilocus sequence typing (MLST, permit identification and classification of bacterial pathogens, but cannot accurately resolve relationships among genotypically similar but pathotypically different isolates. To understand the evolutionary origins of E. coli O104:H4, we sequenced two strains isolated in Ontario, Canada. One was epidemiologically linked to the 2011 outbreak, and the second, unrelated isolate, was obtained in 2010. MLST analysis indicated that both isolates are of the same sequence type (ST678, but whole-genome sequencing revealed differences in chromosomal and plasmid content. Through comprehensive phylogenetic analysis of five O104:H4 ST678 genomes, we identified 167 genes in three gene clusters that have undergone homologous recombination with distantly related E. coli strains. These recombination events have resulted in unexpectedly high sequence diversity within the same sequence type. Failure to recognize or adjust for homologous recombination can result in phylogenetic incongruence. Understanding the extent of homologous recombination among different strains of the same sequence type may explain the pathotypic differences between the ON2010 and ON2011 strains and help shed new light on the emergence of this new pathogen.

  7. A molecular phylogenetic analysis of the Scarabaeinae (dung beetles).

    Science.gov (United States)

    Monaghan, Michael T; Inward, Daegan J G; Hunt, Toby; Vogler, Alfried P

    2007-11-01

    The dung beetles (Scarabaeinae) include ca. 5000 species and exhibit a diverse array of morphologies and behaviors. This variation presumably reflects the adaptation to a diversity of food types and the different strategies used to avoid competition for vertebrate dung, which is the primary breeding environment for most species. The current classification gives great weight to the major behavioral types, separating the ball rollers and the tunnelers, but existing phylogenetic studies have been based on limited taxonomic or biogeographic sampling and have been contradictory. Here, we present a molecular phylogenetic analysis of 214 species of Scarabaeinae, representing all 12 traditionally recognized tribes and six biogeographical regions, using partial gene sequences from one nuclear (28S) and two mitochondrial (cox1, rrnL) genes. Length variation in 28S (588-621 bp) and rrnL (514-523 bp) was subjected to a thorough evaluation of alternative alignments, gap-coding methods, and tree searches using model-based (Bayesian and likelihood), maximum parsimony, and direct optimization analyses. The small-bodied, non-dung-feeding Sarophorus+Coptorhina were basal in all reconstructions. These were closely related to rolling Odontoloma+Dicranocara, suggesting an early acquisition of rolling behavior. Smaller tribes and most genera were monophyletic, while Canthonini and Dichotomiini each consisted of multiple paraphyletic lineages at hierarchical levels equivalent to the smaller tribes. Plasticity of rolling and tunneling was evidenced by a lack of monophyly (S-H test, p > 0.05) and several reversals within clades. The majority of previously unrecognized clades were geographical, including the well-supported Neotropical Phanaeini+Eucraniini, and a large Australian clade of rollers as well as tunneling Coptodactyla and Demarziella. Only three lineages, Gymnopleurini, Copris+Microcopris and Onthophagus, were widespread and therefore appear to be dispersive at a global scale. A

  8. Phylogenetic Analysis of Phytophthora Species Based on Mitochondrial and Nuclear DNA Sequences

    NARCIS (Netherlands)

    Kroon, L.P.N.M.; Bakker, F.T.; Bosch, van den G.B.M.; Bonants, P.J.M.; Flier, W.G.

    2004-01-01

    A molecular phylogenetic analysis of the genus Phytophthora was performed, 113 isolates from 48 Phytophthora species were included in this analysis. Phylogenetic analyses were performed on regions of mitochondrial (cytochrome c oxidase subunit 1; NADH dehydrogenase subunit 1) and nuclear gene

  9. Sequence comparison and phylogenetic analysis of core gene of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-07-19

    Jul 19, 2010 ... and antisense primers, a single band of 573 base pairs .... Amino acid sequence alignment of Cluster I and Cluster II of phylogenetic tree. First ten sequences ... sequence weighting, postion-spiecific gap penalties and weight.

  10. Genotyping and phylogenetic analysis of Pneumocystis jirovecii isolates from India.

    Science.gov (United States)

    Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Agarwal, Sanjay Kumar; Samantaray, Jyotish Chandra; Kumar, Lalit; Kabra, Sushil Kumar; Luthra, Kalpana; Sreenivas, Vishnubhatla

    2010-08-01

    Pneumocystis jirovecii is the cause of Pneumocystis pneumonia (PCP) in immuno-compromised individuals. The aim of this study was to describe the genotypes/haplotypes of P. jirovecii in immuno-compromised individuals with positive polymerase chain reaction (PCR) result for PCP. The typing was based on sequence polymorphism at internal transcribed spacer (ITS) regions of rRNA operon. Phylogenetic relationship between Indian and global haplotypes was also studied. Between January 2005 to October 2008, 43 patients were found to be positive for Pneumocystis using PCR targeting mitochondrial large subunit rRNA (mt LSU rRNA) and ITS region. Genotyping of all the positive samples was performed at the ITS locus by direct sequencing. Nine ITS1 alleles (all previously known) and 11 ITS2 alleles (nine previously defined and two new) were observed. A total of 19 ITS haplotypes, including five novel haplotypes (DEL1r, Edel2, Hr, Adel3 and SYD1a), were observed. The most prevalent type was SYD1g (16.3%), followed by types Ea (11.6%), Ec (9.3%), Eg (6.9%), DEL1r (6.9%), Ne (6.9%) and Ai (6.9%). To detect mixed infection, 30% of the positive isolates were cloned and 4-5 clones were sequenced from each specimen. Cloning and sequencing identified two more haplotypes in addition to the 19 types. Mixed infection was identified in 3 of the 13 cloned samples (23.1%). Upon construction of a haplotype network of 21 haplotypes, type Eg was identified as the most probable ancestral type. The present study is the first study that describes the haplotypes of P. jirovecii based on the ITS gene from India. The study suggests a high diversity of P. jirovecii haplotypes in the population. Copyright 2010 Elsevier B.V. All rights reserved.

  11. Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia.

    Science.gov (United States)

    Haklová, B; Majláthová, V; Majláth, I; Harris, D J; Petrilla, V; Litschka-Koen, T; Oros, M; Peťko, B

    2014-03-01

    The blood parasites from the genus Hepatozoon Miller, 1908 (Apicomplexa: Adeleida: Hepatozoidae) represent the most common intracellular protozoan parasites found in snakes. In the present study, we examined 209 individuals of snakes, from different zoogeographical regions (Africa, America, Asia and Europe), for the occurrence of blood parasites using both molecular and microscopic examination methods, and assess phylogenetic relationships of all Hepatozoon parasites from snakes for the first time. In total, 178 blood smears obtained from 209 individuals, representing 40 species, were examined, from which Hepatozoon unicellular parasites were found in 26 samples (14·6% prevalence). Out of 180 samples tested by molecular method polymerase chain reaction (PCR), the presence of parasites was observed in 21 individuals (prevalence 11·6%): 14 snakes from Africa belonging to six genera (Dendroaspis, Dispholidus, Mehelya, Naja, Philothamnus and Python), five snakes from Asia from the genus Morelia and two snakes from America, from two genera (Coluber and Corallus). The intensity of infection varied from one to 1433 infected cells per 10 000 erythrocytes. Results of phylogenetic analyses (Bayesian and Maximum Likelihood) revealed the existence of five haplotypes divided into four main lineages. The present data also indicate neither geographical pattern of studied Hepatozoon sp., nor congruency in the host association.

  12. Phylogenetic relationships of Palaearctic Formica species (Hymenoptera, Formicidae based on mitochondrial cytochrome B sequences.

    Directory of Open Access Journals (Sweden)

    Anna V Goropashnaya

    Full Text Available Ants of genus Formica demonstrate variation in social organization and represent model species for ecological, behavioral, evolutionary studies and testing theoretical implications of the kin selection theory. Subgeneric division of the Formica ants based on morphology has been questioned and remained unclear after an allozyme study on genetic differentiation between 13 species representing all subgenera was conducted. In the present study, the phylogenetic relationships within the genus were examined using mitochondrial DNA sequences of the cytochrome b and a part of the NADH dehydrogenase subunit 6. All 23 Formica species sampled in the Palaearctic clustered according to the subgeneric affiliation except F. uralensis that formed a separate phylogenetic group. Unlike Coptoformica and Formica s. str., the subgenus Serviformica did not form a tight cluster but more likely consisted of a few small clades. The genetic distances between the subgenera were around 10%, implying approximate divergence time of 5 Myr if we used the conventional insect divergence rate of 2% per Myr. Within-subgenus divergence estimates were 6.69% in Serviformica, 3.61% in Coptoformica, 1.18% in Formica s. str., which supported our previous results on relatively rapid speciation in the latter subgenus. The phylogeny inferred from DNA sequences provides a necessary framework against which the evolution of social traits can be compared. We discuss implications of inferred phylogeny for the evolution of social traits.

  13. Phylogenetic relationship and Fourier-transform infrared spectroscopy-derived lipid determinants of lifespan parameters in the Saccharomyces cerevisiae yeast.

    Science.gov (United States)

    Molon, Mateusz; Zebrowski, Jacek

    2017-06-01

    Yeast ageing has been gaining much attention in gerontology research, yet the process itself is still not entirely clear. One of the constraints related to the use of the Saccharomyces cerevisiae yeast in studies is the ambiguity of the results concerning ageing determinants for different genetic backgrounds. In this paper, we compare reproductive potentials and lifespans of seven widely used haploid laboratory strains differing in daughter cells production capabilities and highlight the importance of choosing an appropriate genotype for the studies on ageing. Moreover, we show here links between post-reproductive lifespan and lipid metabolism, as well as between reproductive potential, reproductive lifespan and phylogenetic relationship. Using FTIR spectroscopy that generated a biochemical fingerprint of cells, coupled with chemometrics, we found that the band of carbonyl (C = O) stretching vibration discriminates the strains according to post-reproductive lifespan. The results indicated that prolonged post-reproductive lifespan was associated with relatively lower amount of fatty acids esterified to phospholipids compared to a free acid pool, thus implying phospholipid metabolism for the post-reproductive lifespan of yeast. In addition, phylogenetic analysis showed a correlation between nucleotide similarity and the reproductive potential or reproductive lifespan, but not to the longevity expressed in time units. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Estimating phylogenetic relationships despite discordant gene trees across loci: the species tree of a diverse species group of feather mites (Acari: Proctophyllodidae).

    Science.gov (United States)

    Knowles, Lacey L; Klimov, Pavel B

    2011-11-01

    With the increased availability of multilocus sequence data, the lack of concordance of gene trees estimated for independent loci has focused attention on both the biological processes producing the discord and the methodologies used to estimate phylogenetic relationships. What has emerged is a suite of new analytical tools for phylogenetic inference--species tree approaches. In contrast to traditional phylogenetic methods that are stymied by the idiosyncrasies of gene trees, approaches for estimating species trees explicitly take into account the cause of discord among loci and, in the process, provides a direct estimate of phylogenetic history (i.e. the history of species divergence, not divergence of specific loci). We illustrate the utility of species tree estimates with an analysis of a diverse group of feather mites, the pinnatus species group (genus Proctophyllodes). Discord among four sequenced nuclear loci is consistent with theoretical expectations, given the short time separating speciation events (as evident by short internodes relative to terminal branch lengths in the trees). Nevertheless, many of the relationships are well resolved in a Bayesian estimate of the species tree; the analysis also highlights ambiguous aspects of the phylogeny that require additional loci. The broad utility of species tree approaches is discussed, and specifically, their application to groups with high speciation rates--a history of diversification with particular prevalence in host/parasite systems where species interactions can drive rapid diversification.

  15. Phylogenetic relationship among East Asian species of the Stegana genus group (Diptera, Drosophilidae).

    Science.gov (United States)

    Li, Tong; Gao, Jian-jun; Lu, Jin-ming; Ji, Xing-lai; Chen, Hong-wei

    2013-01-01

    The phylogenetic relationship among 27 East Asian species of the Stegana genus group was reconstructed using DNA sequences of mitochondrial (COI and ND2) and nuclear (28S) genes. The results lent support to the current generic/subgeneric taxonomic classification in the genus group with the exceptions of the paraphyly of the genus Parastegana and the subgenus Oxyphortica in the genus Stegana. The ancestral areas and divergence times in the genus group were reconstructed/estimated, and accordingly, the biogeographical history of this important clade was discussed. It was proposed that, the evolution of the plant family Fagaceae, especially Quercus, may have played a certain role in facilitating the diversification of the Stegana genus group. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-01-01

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production. PMID:29215550

  17. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation.

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-12-07

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE , a biosynthesis gene cluster of γ-PGA, and pgdS , a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  18. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Directory of Open Access Journals (Sweden)

    Yi-Huang Hsueh

    2017-12-01

    Full Text Available Poly-γ-glutamic acid (γ-PGA is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  19. Biometrical studies upon hominoid teeth: the coefficient of variation, sexual dimorphism and questions of phylogenetic relationship.

    Science.gov (United States)

    Blumenberg, B

    1985-01-01

    Sexual dimorphism as a function of variation in hominoid tooth metrics has been investigated for four groups of taxa: Recent great apes (two subfamilies), Dryopiths (one subfamily), Ramapiths (one subfamily) and hominids (one family). Gorilla, and to a lesser extent Pan, appear characterized by very high levels of sexual dimorphism and meet several criteria for statistical outliers. Recent great apes are the only group exhibiting consistently high levels of sexual dimorphism. Ramapiths are the only group characterized by low levels of sexual dimorphism and their relative canine length is most similar to Dryopiths. Both Dryopiths and hominids contain taxa with low and intermediate levels of sexual dimorphism. The Gingerich and Shoeninger hypothesis relating coefficients of variation to occlusal complexity is supported. Non-parametric statistics suggest that homogeneity of coefficient of variation profiles over most of the tooth row is characteristic of only the Dryopiths and a composite data set composed of the Dryopith plus Ramapith tooth measurements. Oxnard's model for the multifactorial basis of multiple sexual dimorphisms is also supported. The Dryopith and hominid patterns of sexual dimorphism are similar, an observation that suggests phylogenetic relationship. At the taxonomic level of subfamily or family, sexual dimorphism is a character of cladistic usefulness and possible phylogenetic valence. Assuming that breeding system and sexual dimorphism are functional correlates as many workers suggest, then Ramapithecus sp. China, Sivapithecus indicus and possibly Australopithecus boisei are good candidates for having possessed monogamous breeding/social structures. All Dryopith taxa, S. sivalensis, Sivapithecus sp. China, A. afarensis, Homo habilis and H. erectus emerge as the best candidates for having possessed a polygynous breeding/social structure. No biometrical affinities of Ramapiths with hominids can be demonstrated and some phylogenetic relationship with

  20. Exploring Phylogenetic Relationships within Myriapoda and the Effects of Matrix Composition and Occupancy on Phylogenomic Reconstruction.

    Science.gov (United States)

    Fernández, Rosa; Edgecombe, Gregory D; Giribet, Gonzalo

    2016-09-01

    Myriapods, including the diverse and familiar centipedes and millipedes, are one of the dominant terrestrial arthropod groups. Although molecular evidence has shown that Myriapoda is monophyletic, its internal phylogeny remains contentious and understudied, especially when compared to those of Chelicerata and Hexapoda. Until now, efforts have focused on taxon sampling (e.g., by including a handful of genes from many species) or on maximizing matrix size (e.g., by including hundreds or thousands of genes in just a few species), but a phylogeny maximizing sampling at both levels remains elusive. In this study, we analyzed 40 Illumina transcriptomes representing 3 of the 4 myriapod classes (Diplopoda, Chilopoda, and Symphyla); 25 transcriptomes were newly sequenced to maximize representation at the ordinal level in Diplopoda and at the family level in Chilopoda. Ten supermatrices were constructed to explore the effect of several potential phylogenetic biases (e.g., rate of evolution, heterotachy) at 3 levels of gene occupancy per taxon (50%, 75%, and 90%). Analyses based on maximum likelihood and Bayesian mixture models retrieved monophyly of each myriapod class, and resulted in 2 alternative phylogenetic positions for Symphyla, as sister group to Diplopoda + Chilopoda, or closer to Diplopoda, the latter hypothesis having been traditionally supported by morphology. Within centipedes, all orders were well supported, but 2 deep nodes remained in conflict in the different analyses despite dense taxon sampling at the family level. Relationships among centipede orders in all analyses conducted with the most complete matrix (90% occupancy) are at odds not only with the sparser but more gene-rich supermatrices (75% and 50% supermatrices) and with the matrices optimizing phylogenetic informativeness or most conserved genes, but also with previous hypotheses based on morphology, development, or other molecular data sets. Our results indicate that a high percentage of ribosomal

  1. The combination of phylogenetic analysis with epidemiological and serological data to track HIV-1 transmission in a sexual transmission case.

    Directory of Open Access Journals (Sweden)

    Min Chen

    Full Text Available To investigate the linkage of HIV transmission from a man to a woman through unprotected sexual contact without disclosing his HIV-positive status.Combined with epidemiological information and serological tests, phylogenetic analysis was used to test the a priori hypothesis of HIV transmission from the man to the woman. Control subjects, infected with HIV through heterosexual intercourse, from the same location were also sampled. Phylogenetic analyses were performed using the consensus gag, pol and env sequences obtained from blood samples of the man, the woman and the local control subjects. The env quasispecies of the man, the woman, and two controls were also obtained using single genome amplification and sequencing (SGA/S to explore the paraphyletic relationship by phylogenetic analysis.Epidemiological information and serological tests indicated that the man was infected with HIV-1 earlier than the woman. Phylogenetic analyses of the consensus sequences showed a monophyletic cluster for the man and woman in all three genomic regions. Furthermore, gag sequences of the man and woman shared a unique recombination pattern from subtype B and C, which was different from those of CRF07_BC or CRF08_BC observed in the local samples. These indicated that the viral sequences from the two subjects display a high level of similarity. Further, viral quasispecies from the man exhibited a paraphyletic relationship with those from the woman in the Bayesian and maximum-likelihood (ML phylogenetic trees of the env region, which supported the transmission direction from the man to the woman.In the context of epidemiological and serological evidence, the results of phylogenetic analyses support the transmission from the man to the woman.

  2. Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

    Science.gov (United States)

    Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

    2007-04-10

    To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

  3. A bootstrap based analysis pipeline for efficient classification of phylogenetically related animal miRNAs

    Directory of Open Access Journals (Sweden)

    Gu Xun

    2007-03-01

    Full Text Available Abstract Background Phylogenetically related miRNAs (miRNA families convey important information of the function and evolution of miRNAs. Due to the special sequence features of miRNAs, pair-wise sequence identity between miRNA precursors alone is often inadequate for unequivocally judging the phylogenetic relationships between miRNAs. Most of the current methods for miRNA classification rely heavily on manual inspection and lack measurements of the reliability of the results. Results In this study, we designed an analysis pipeline (the Phylogeny-Bootstrap-Cluster (PBC pipeline to identify miRNA families based on branch stability in the bootstrap trees derived from overlapping genome-wide miRNA sequence sets. We tested the PBC analysis pipeline with the miRNAs from six animal species, H. sapiens, M. musculus, G. gallus, D. rerio, D. melanogaster, and C. elegans. The resulting classification was compared with the miRNA families defined in miRBase. The two classifications were largely consistent. Conclusion The PBC analysis pipeline is an efficient method for classifying large numbers of heterogeneous miRNA sequences. It requires minimum human involvement and provides measurements of the reliability of the classification results.

  4. A phylogenetic analysis of the sugar porters in hemiascomycetous yeasts.

    Science.gov (United States)

    Palma, Margarida; Goffeau, André; Spencer-Martins, Isabel; Baret, Philippe V

    2007-01-01

    A total of 214 members of the sugar porter (SP) family (TC 2.A.1.1) from eight hemiascomycetous yeasts: Saccharomyces cerevisiae, Candida glabrata, Kluyveromyces lactis, Ashbya (Eremothecium) gossypii, Debaryomyces hansenii, Yarrowia lipolytica, Candida albicans and Pichia stipitis, were identified. The yeast SPs were classified in 13 different phylogenetic clusters. Specific sugar substrates could be allocated to nine phylogenetic clusters, including two novel TC clusters that are specific to fungi, i.e. the glycerol:H(+) symporter (2.A.1.1.38) and the high-affinity glucose transporter (2.A.1.1.39). Four phylogenetic clusters are identified by the preliminary fifth number Z23, Z24, Z25 and Z26 and the substrates of their members remain undetermined. The amplification of the SP clusters across the Hemiascomycetes reflects adaptation to specific carbon and energy sources available in the habitat of each yeast species. (c) 2007 S. Karger AG, Basel.

  5. Improving the precision of the structure-function relationship by considering phylogenetic context.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available Understanding the relationship between protein structure and function is one of the foremost challenges in post-genomic biology. Higher conservation of structure could, in principle, allow researchers to extend current limitations of annotation. However, despite significant research in the area, a precise and quantitative relationship between biochemical function and protein structure has been elusive. Attempts to draw an unambiguous link have often been complicated by pleiotropy, variable transcriptional control, and adaptations to genomic context, all of which adversely affect simple definitions of function. In this paper, I report that integrating genomic information can be used to clarify the link between protein structure and function. First, I present a novel measure of functional proximity between protein structures (F-score. Then, using F-score and other entirely automatic methods measuring structure and phylogenetic similarity, I present a three-dimensional landscape describing their inter-relationship. The result is a "well-shaped" landscape that demonstrates the added value of considering genomic context in inferring function from structural homology. A generalization of methodology presented in this paper can be used to improve the precision of annotation of genes in current and newly sequenced genomes.

  6. Orthology prediction at scalable resolution by phylogenetic tree analysis

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2007-03-01

    Full Text Available Abstract Background Orthology is one of the cornerstones of gene function prediction. Dividing the phylogenetic relations between genes into either orthologs or paralogs is however an oversimplification. Already in two-species gene-phylogenies, the complicated, non-transitive nature of phylogenetic relations results in inparalogs and outparalogs. For situations with more than two species we lack semantics to specifically describe the phylogenetic relations, let alone to exploit them. Published procedures to extract orthologous groups from phylogenetic trees do not allow identification of orthology at various levels of resolution, nor do they document the relations between the orthologous groups. Results We introduce "levels of orthology" to describe the multi-level nature of gene relations. This is implemented in a program LOFT (Levels of Orthology From Trees that assigns hierarchical orthology numbers to genes based on a phylogenetic tree. To decide upon speciation and gene duplication events in a tree LOFT can be instructed either to perform classical species-tree reconciliation or to use the species overlap between partitions in the tree. The hierarchical orthology numbers assigned by LOFT effectively summarize the phylogenetic relations between genes. The resulting high-resolution orthologous groups are depicted in colour, facilitating visual inspection of (large trees. A benchmark for orthology prediction, that takes into account the varying levels of orthology between genes, shows that the phylogeny-based high-resolution orthology assignments made by LOFT are reliable. Conclusion The "levels of orthology" concept offers high resolution, reliable orthology, while preserving the relations between orthologous groups. A Windows as well as a preliminary Java version of LOFT is available from the LOFT website http://www.cmbi.ru.nl/LOFT.

  7. Evolution of oil-producing trichomes in Sisyrinchium (Iridaceae): insights from the first comprehensive phylogenetic analysis of the genus

    Science.gov (United States)

    Chauveau, Olivier; Eggers, Lilian; Raquin, Christian; Silvério, Adriano; Brown, Spencer; Couloux, Arnaud; Cruaud, Corine; Kaltchuk-Santos, Eliane; Yockteng, Roxana; Souza-Chies, Tatiana T.; Nadot, Sophie

    2011-01-01

    Background and Aims Sisyrinchium (Iridaceae: Iridoideae: Sisyrinchieae) is one of the largest, most widespread and most taxonomically complex genera in Iridaceae, with all species except one native to the American continent. Phylogenetic relationships within the genus were investigated and the evolution of oil-producing structures related to specialized oil-bee pollination examined. Methods Phylogenetic analyses based on eight molecular markers obtained from 101 Sisyrinchium accessions representing 85 species were conducted in the first extensive phylogenetic analysis of the genus. Total evidence analyses confirmed the monophyly of the genus and retrieved nine major clades weakly connected to the subdivisions previously recognized. The resulting phylogenetic hypothesis was used to reconstruct biogeographical patterns, and to trace the evolutionary origin of glandular trichomes present in the flowers of several species. Key Results and Conclusions Glandular trichomes evolved three times independently in the genus. In two cases, these glandular trichomes are oil-secreting, suggesting that the corresponding flowers might be pollinated by oil-bees. Biogeographical patterns indicate expansions from Central America and the northern Andes to the subandean ranges between Chile and Argentina and to the extended area of the Paraná river basin. The distribution of oil-flower species across the phylogenetic trees suggests that oil-producing trichomes may have played a key role in the diversification of the genus, a hypothesis that requires future testing. PMID:21527419

  8. The Complete Mitochondrial Genome of Corizus tetraspilus (Hemiptera: Rhopalidae) and Phylogenetic Analysis of Pentatomomorpha

    Science.gov (United States)

    Guo, Zhong-Long; Wang, Juan; Shen, Yu-Ying

    2015-01-01

    Insect mitochondrial genome (mitogenome) are the most extensively used genetic information for molecular evolution, phylogenetics and population genetics. Pentatomomorpha (>14,000 species) is the second largest infraorder of Heteroptera and of great economic importance. To better understand the diversity and phylogeny within Pentatomomorpha, we sequenced and annotated the complete mitogenome of Corizus tetraspilus (Hemiptera: Rhopalidae), an important pest of alfalfa in China. We analyzed the main features of the C. tetraspilus mitogenome, and provided a comparative analysis with four other Coreoidea species. Our results reveal that gene content, gene arrangement, nucleotide composition, codon usage, rRNA structures and sequences of mitochondrial transcription termination factor are conserved in Coreoidea. Comparative analysis shows that different protein-coding genes have been subject to different evolutionary rates correlated with the G+C content. All the transfer RNA genes found in Coreoidea have the typical clover leaf secondary structure, except for trnS1 (AGN) which lacks the dihydrouridine (DHU) arm and possesses a unusual anticodon stem (9 bp vs. the normal 5 bp). The control regions (CRs) among Coreoidea are highly variable in size, of which the CR of C. tetraspilus is the smallest (440 bp), making the C. tetraspilus mitogenome the smallest (14,989 bp) within all completely sequenced Coreoidea mitogenomes. No conserved motifs are found in the CRs of Coreoidea. In addition, the A+T content (60.68%) of the CR of C. tetraspilus is much lower than that of the entire mitogenome (74.88%), and is lowest among Coreoidea. Phylogenetic analyses based on mitogenomic data support the monophyly of each superfamily within Pentatomomorpha, and recognize a phylogenetic relationship of (Aradoidea + (Pentatomoidea + (Lygaeoidea + (Pyrrhocoroidea + Coreoidea)))). PMID:26042898

  9. Revised phylogenetic analysis of the Aetosauria (Archosauria: Pseudosuchia; assessing the effects of incongruent morphological character sets

    Directory of Open Access Journals (Sweden)

    William G. Parker

    2016-01-01

    Full Text Available Aetosauria is an early-diverging clade of pseudosuchians (crocodile-line archosaurs that had a global distribution and high species diversity as a key component of various Late Triassic terrestrial faunas. It is one of only two Late Triassic clades of large herbivorous archosaurs, and thus served a critical ecological role. Nonetheless, aetosaur phylogenetic relationships are still poorly understood, owing to an overreliance on osteoderm characters, which are often poorly constructed and suspected to be highly homoplastic. A new phylogenetic analysis of the Aetosauria, comprising 27 taxa and 83 characters, includes more than 40 new characters that focus on better sampling the cranial and endoskeletal regions, and represents the most comprenhensive phylogeny of the clade to date. Parsimony analysis recovered three most parsimonious trees; the strict consensus of these trees finds an Aetosauria that is divided into two main clades: Desmatosuchia, which includes the Desmatosuchinae and the Stagonolepidinae, and Aetosaurinae, which includes the Typothoracinae. As defined Desmatosuchinae now contains Neoaetosauroides engaeus and several taxa that were previously referred to the genus Stagonolepis, and a new clade, Desmatosuchini, is erected for taxa more closely related to Desmatosuchus. Overall support for some clades is still weak, and Partitioned Bremer Support (PBS is applied for the first time to a strictly morphological dataset demonstrating that this weak support is in part because of conflict in the phylogenetic signals of cranial versus postcranial characters. PBS helps identify homoplasy among characters from various body regions, presumably the result of convergent evolution within discrete anatomical modules. It is likely that at least some of this character conflict results from different body regions evolving at different rates, which may have been under different selective pressures.

  10. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  11. Applying phylogenetic analysis to viral livestock diseases: moving beyond molecular typing.

    Science.gov (United States)

    Olvera, Alex; Busquets, Núria; Cortey, Marti; de Deus, Nilsa; Ganges, Llilianne; Núñez, José Ignacio; Peralta, Bibiana; Toskano, Jennifer; Dolz, Roser

    2010-05-01

    Changes in livestock production systems in recent years have altered the presentation of many diseases resulting in the need for more sophisticated control measures. At the same time, new molecular assays have been developed to support the diagnosis of animal viral disease. Nucleotide sequences generated by these diagnostic techniques can be used in phylogenetic analysis to infer phenotypes by sequence homology and to perform molecular epidemiology studies. In this review, some key elements of phylogenetic analysis are highlighted, such as the selection of the appropriate neutral phylogenetic marker, the proper phylogenetic method and different techniques to test the reliability of the resulting tree. Examples are given of current and future applications of phylogenetic reconstructions in viral livestock diseases. Copyright 2009 Elsevier Ltd. All rights reserved.

  12. Phylogenetic relationships of German heavy draught horse breeds inferred from mitochondrial DNA D-loop variation.

    Science.gov (United States)

    Aberle, K S; Hamann, H; Drögemüller, C; Distl, O

    2007-04-01

    We analysed a 610-bp mitochondrial (mt)DNA D-loop fragment in a sample of German draught horse breeds and compared the polymorphic sites with sequences from Arabian, Hanoverian, Exmoor, Icelandic, Sorraia and Przewalski's Horses as well as with Suffolk, Shire and Belgian horses. In a total of 65 horses, 70 polymorphic sites representing 47 haplotypes were observed. The average percentage of polymorphic sites was 11.5% for the mtDNA fragment analysed. In the nine different draught horse breeds including South German, Mecklenburg, Saxon Thuringa coldblood, Rhenisch German, Schleswig Draught Horse, Black Forest Horse, Shire, Suffolk and Belgian, 61 polymorphic sites and 24 haplotypes were found. The phylogenetic analysis failed to show monophyletic groups for the draught horses. The analysis indicated that the draught horse populations investigated consist of diverse genetic groups with respect to their maternal lineage.

  13. Comparative analysis of mitochondrial genomes of five aphid species (Hemiptera: Aphididae and phylogenetic implications.

    Directory of Open Access Journals (Sweden)

    Yuan Wang

    Full Text Available Insect mitochondrial genomes (mitogenomes are of great interest in exploring molecular evolution, phylogenetics and population genetics. Only two mitogenomes have been previously released in the insect group Aphididae, which consists of about 5,000 known species including some agricultural, forestry and horticultural pests. Here we report the complete 16,317 bp mitogenome of Cavariella salicicola and two nearly complete mitogenomes of Aphis glycines and Pterocomma pilosum. We also present a first comparative analysis of mitochondrial genomes of aphids. Results showed that aphid mitogenomes share conserved genomic organization, nucleotide and amino acid composition, and codon usage features. All 37 genes usually present in animal mitogenomes were sequenced and annotated. The analysis of gene evolutionary rate revealed the lowest and highest rates for COI and ATP8, respectively. A unique repeat region exclusively in aphid mitogenomes, which included variable numbers of tandem repeats in a lineage-specific manner, was highlighted for the first time. This region may have a function as another origin of replication. Phylogenetic reconstructions based on protein-coding genes and the stem-loop structures of control regions confirmed a sister relationship between Cavariella and pterocommatines. Current evidence suggest that pterocommatines could be formally transferred into Macrosiphini. Our paper also offers methodological instructions for obtaining other Aphididae mitochondrial genomes.

  14. Complete Chloroplast Genomes of Papaver rhoeas and Papaver orientale: Molecular Structures, Comparative Analysis, and Phylogenetic Analysis

    Directory of Open Access Journals (Sweden)

    Jianguo Zhou

    2018-02-01

    Full Text Available Papaver rhoeas L. and P. orientale L., which belong to the family Papaveraceae, are used as ornamental and medicinal plants. The chloroplast genome has been used for molecular markers, evolutionary biology, and barcoding identification. In this study, the complete chloroplast genome sequences of P. rhoeas and P. orientale are reported. Results show that the complete chloroplast genomes of P. rhoeas and P. orientale have typical quadripartite structures, which are comprised of circular 152,905 and 152,799-bp-long molecules, respectively. A total of 130 genes were identified in each genome, including 85 protein-coding genes, 37 tRNA genes, and 8 rRNA genes. Sequence divergence analysis of four species from Papaveraceae indicated that the most divergent regions are found in the non-coding spacers with minimal differences among three Papaver species. These differences include the ycf1 gene and intergenic regions, such as rpoB-trnC, trnD-trnT, petA-psbJ, psbE-petL, and ccsA-ndhD. These regions are hypervariable regions, which can be used as specific DNA barcodes. This finding suggested that the chloroplast genome could be used as a powerful tool to resolve the phylogenetic positions and relationships of Papaveraceae. These results offer valuable information for future research in the identification of Papaver species and will benefit further investigations of these species.

  15. Global phylogenetic analysis of contemporary aleutian mink disease viruses (AMDVs)

    DEFF Research Database (Denmark)

    Ryt-Hansen, Pia; Hagberg, E. E.; Chriél, Mariann

    2017-01-01

    a strain originating from Sweden. In contrast, we did not identify any potential source for the other and more widespread outbreak strain. To the authors knowledge this is the first major global phylogenetic study of contemporary AMDV partial NS1 sequences. The study proved that partial NS1 sequencing can...

  16. A comparative phylogenetic analysis of full-length mariner elements

    Indian Academy of Sciences (India)

    Mariner like elements (MLEs) are widely distributed type II transposons with an open reading frame (ORF) for transposase. We studied comparative phylogenetic evolution and inverted terminal repeat (ITR) conservation of MLEs from Indian saturniid silkmoth, Antheraea mylitta with other full length MLEs submitted in the ...

  17. Evaluating the relationship between evolutionary divergence and phylogenetic accuracy in AFLP data sets.

    Science.gov (United States)

    García-Pereira, María Jesús; Caballero, Armando; Quesada, Humberto

    2010-05-01

    Using in silico amplified fragment length polymorphism (AFLP) fingerprints, we explore the relationship between sequence similarity and phylogeny accuracy to test when, in terms of genetic divergence, the quality of AFLP data becomes too low to be informative for a reliable phylogenetic reconstruction. We generated DNA sequences with known phylogenies using balanced and unbalanced trees with recent, uniform and ancient radiations, and average branch lengths (from the most internal node to the tip) ranging from 0.02 to 0.4 substitutions per site. The resulting sequences were used to emulate the AFLP procedure. Trees were estimated by maximum parsimony (MP), neighbor-joining (NJ), and minimum evolution (ME) methods from both DNA sequences and virtual AFLP fingerprints. The estimated trees were compared with the reference trees using a score that measures overall differences in both topology and relative branch length. As expected, the accuracy of AFLP-based phylogenies decreased dramatically in the more divergent data sets. Above a divergence of approximately 0.05, AFLP-based phylogenies were largely inaccurate irrespective of the distinct topology, radiation model, or phylogenetic method used. This value represents an upper bound of expected tree accuracy for data sets with a simple divergence history; AFLP data sets with a similar divergence but with unbalanced topologies and short ancestral branches produced much less accurate trees. The lack of homology of AFLP bands quickly increases with divergence and reaches its maximum value (100%) at a divergence of only 0.4. Low guanine-cytosine (GC) contents increase the number of nonhomologous bands in AFLP data sets and lead to less reliable trees. However, the effect of the lack of band homology on tree accuracy is surprisingly small relative to the negative impact due to the low information content of AFLP characters. Tree-building methods based on genetic distance displayed similar trends and outperformed parsimony

  18. A New Perspective on Polyploid Fragaria (Strawberry) Genome Composition Based on Large-Scale, Multi-Locus Phylogenetic Analysis

    OpenAIRE

    Yang, Yilong; Davis, Thomas M

    2017-01-01

    Abstract The subgenomic compositions of the octoploid (2n = 8× = 56) strawberry (Fragaria) species, including the economically important cultivated species Fragaria x ananassa, have been a topic of long-standing interest. Phylogenomic approaches utilizing next-generation sequencing technologies offer a new window into species relationships and the subgenomic compositions of polyploids. We have conducted a large-scale phylogenetic analysis of Fragaria (strawberry) species using the Fluidigm Ac...

  19. PHYLOGENETIC RELATIONSHIP OF THE RED TIDE DINOFLAGELLATE GYMNODINIUM BREVE TO OTHER MEMBERS OF THE GENERA GYMNODINIUM AND GYRODINIUM

    Science.gov (United States)

    Phylogenetic relationships between the red-tide dinoflagellate Gymnodinium breve and other members of the genera Gymnodinium and Gyrodinium have not been studied at the molecular level. G. breve is most noted for its production of brevetoxin, which has been linked to extensive f...

  20. The importance of species phylogenetic relationships and species traits for the intensity of plant-soil feedback

    Czech Academy of Sciences Publication Activity Database

    Münzbergová, Zuzana; Šurinová, Mária

    2015-01-01

    Roč. 6, č. 11 (2015), s. 1-16 ISSN 2150-8925 R&D Projects: GA ČR(CZ) GA15-11635S Institutional support: RVO:67985939 Keywords : phylogenetic relationships * species traits * plant-soil feedback Subject RIV: EF - Botanics Impact factor: 2.287, year: 2015

  1. [Identification and phylogenetic analysis of one strain of Lactobacillus delbrueckii subsp. bulgaricus separated from yoghourt].

    Science.gov (United States)

    Wang, Chuan; Zhang, Chaowu; Pei, Xiaofang; Liu, Hengchuan

    2007-11-01

    For being further applied and studied, one strain of Lactobacillus delbrueckii subsp. bulgaricus (wch9901) separated from yoghourt which had been identified by phenotype characteristic analysis was identified by 16S rDNA and phylogenetic analyzed. The 16S rDNA of wch9901 was amplified with the genomic DNA of wch9901 as template, and the conservative sequences of the 16S rDNA as primers. Inserted 16S rDNA amplified into clonal vector pGEM-T under the function of T4 DNA ligase to construct recombined plasmid pGEM-wch9901 16S rDNA. The recombined plasmid was identified by restriction enzyme digestion, and the eligible plasmid was presented to sequencing company for DNA sequencing. Nucleic acid sequence was blast in GenBank and phylogenetic tree was constructed using neighbor-joining method of distance methods by Mega3.1 soft. Results of blastn showed that the homology of 16S rDNA of wch9901 with the 16S rDNA of Lactobacillus delbrueckii subsp. bulgaricus strains was higher than 96%. On the phylogenetic tree, wch9901 formed a separate branch and located between Lactobacillus delbrueckii subsp. bulgaricus LGM2 evolution branch and another evolution branch which was composed of Lactobacillus delbrueckii subsp. bulgaricus DL2 evolution cluster and Lactobacillus delbrueckii subsp. bulgaricus JSQ evolution cluster. The distance between wch9901 evolution branch and Lactobacillus delbrueckii subsp. bulgaricus LGM2 evolution branch was the closest. wch9901 belonged to Lactobacillus delbrueckii subsp. bulgaricus. wch9901 showed the closest evolution relationship to Lactobacillus delbrueckii subsp. bulgaricus LGM2.

  2. Phylogenetic relationships and host range of Rhizobium spp. that nodulate Phaseolus vulgaris L.

    Science.gov (United States)

    Hernandez-Lucas, I; Segovia, L; Martinez-Romero, E; Pueppke, S G

    1995-07-01

    We determined the nucleotide sequences of 16S rRNA gene segments from five Rhizobium strains that have been isolated from tropical legume species. All share the capacity to nodulate Phaseolus vulgaris L., the common bean. Phylogenetic analysis confirmed that these strains are of two different chromosomal lineages. We defined the host ranges of two strains of Rhizobium etli and three strains of R. tropici, comparing them with those of the two most divergently related new strains. Twenty-two of the 43 tested legume species were nodulated by three or more of these strains. All seven strains have broad host ranges that include woody species such as Albizia lebbeck, Gliricidia maculata, and Leucaena leucocephala.

  3. Phylogenetic analysis of Tibetan mastiffs based on mitochondrial hypervariable region I.

    Science.gov (United States)

    Ren, Zhanjun; Chen, Huiling; Yang, Xuejiao; Zhang, Chengdong

    2017-03-01

    Recently, the number of Tibetan mastiffs, which is a precious germplasm resource and cultural heritage, is decreasing sharply. Therefore, the genetic diversity of Tibetan mastiffs needs to be studied to clarify its phylogenetics relationships and lay the foundation for resource protection, rational development and utilization of Tibetan mastiffs. We sequenced hypervariable region I of mitochondrial DNA (mtDNA) of 110 individuals from Tibet region and Gansu province. A total of 12 polymorphic sites were identified which defined eight haplotypes of which H4 and H8 were unique to Tibetan population with H8 being identified first. The haplotype diversity (Hd: 0.808), nucleotide diversity (Pi: 0.603%), the average number of nucleotide difference (K: 3.917) of Tibetan mastiffs from Gansu were higher than those from Tibet region (Hd: 0.794; Pi: 0.589%; K: 3.831), which revealed higher genetic diversity in Gansu. In terms of total population, the genetic variation was low. The median-joining network and phylogenetic tree based on the mtDNA hypervariable region I showed that Tibetan mastiffs originated from grey wolves, as the other domestic dogs and had different history of maternal origin. The mismatch distribution analysis and neutrality tests indicated that Tibetan mastiffs were in genetic equilibrium or in a population decline.

  4. Preliminary phylogenetic analysis of the Andean clade and the placement of new Colombian blueberries (Ericaceae, Vaccinieae

    Directory of Open Access Journals (Sweden)

    Paola Pedraza-Penalosa

    2015-04-01

    Full Text Available The blueberry tribe Vaccinieae (Ericaceae is particularly diverse in South America and underwent extensive radiation in Colombia where many endemics occur. Recent fieldwork in Colombia has resulted in valuable additions to the phylogeny and as well in the discovery of morphologically noteworthy new species that need to be phylogenetically placed before being named. This is particularly important, as the monophyly of many of the studied genera have not been confirmed. In order to advance our understanding of the relationships within neotropical Vaccinieae and advice the taxonomy of the new blueberry relatives, here we present the most comprehensive phylogenetic analysis for the Andean clade. Anthopterus, Demosthenesia, and Pellegrinia are among the putative Andean genera recovered as monophyletic, while other eight Andean genera were not. The analyses also showed that genera that have been traditionally widely defined are non-monophyletic and could be further split into more discrete groups. Four newly discovered Colombian Vaccinieae are placed in the monophyletic Satyria s.s. and the Psammisia I clade. Although these new species are endemic to the Colombian Western Cordillera and Chocó biogeographic region and three are not known outside of Las Orquídeas National Park, they do not form sister pairs.

  5. Phylogenetic relationships of cone snails endemic to Cabo Verde based on mitochondrial genomes.

    Science.gov (United States)

    Abalde, Samuel; Tenorio, Manuel J; Afonso, Carlos M L; Uribe, Juan E; Echeverry, Ana M; Zardoya, Rafael

    2017-11-25

    Due to their great species and ecological diversity as well as their capacity to produce hundreds of different toxins, cone snails are of interest to evolutionary biologists, pharmacologists and amateur naturalists alike. Taxonomic identification of cone snails still relies mostly on the shape, color, and banding patterns of the shell. However, these phenotypic traits are prone to homoplasy. Therefore, the consistent use of genetic data for species delimitation and phylogenetic inference in this apparently hyperdiverse group is largely wanting. Here, we reconstruct the phylogeny of the cones endemic to Cabo Verde archipelago, a well-known radiation of the group, using mitochondrial (mt) genomes. The reconstructed phylogeny grouped the analyzed species into two main clades, one including Kalloconus from West Africa sister to Trovaoconus from Cabo Verde and the other with a paraphyletic Lautoconus due to the sister group relationship of Africonus from Cabo Verde and Lautoconus ventricosus from Mediterranean Sea and neighboring Atlantic Ocean to the exclusion of Lautoconus endemic to Senegal (plus Lautoconus guanche from Mauritania, Morocco, and Canary Islands). Within Trovaoconus, up to three main lineages could be distinguished. The clade of Africonus included four main lineages (named I to IV), each further subdivided into two monophyletic groups. The reconstructed phylogeny allowed inferring the evolution of the radula in the studied lineages as well as biogeographic patterns. The number of cone species endemic to Cabo Verde was revised under the light of sequence divergence data and the inferred phylogenetic relationships. The sequence divergence between continental members of the genus Kalloconus and island endemics ascribed to the genus Trovaoconus is low, prompting for synonymization of the latter. The genus Lautoconus is paraphyletic. Lautoconus ventricosus is the closest living sister group of genus Africonus. Diversification of Africonus was in allopatry

  6. Phylogenetic analysis of canine distemper virus in domestic dogs in Nanjing, China.

    Science.gov (United States)

    Bi, Zhenwei; Wang, Yongshan; Wang, Xiaoli; Xia, Xingxia

    2015-02-01

    Canine distemper virus (CDV) infects a broad range of carnivores, including wild and domestic Canidae. The hemagglutinin gene, which encodes the attachment protein that determines viral tropism, has been widely used to determine the relationship between CDV strains of different lineages circulating worldwide. We determined the full-length H gene sequences of seven CDV field strains detected in domestic dogs in Nanjing, China. A phylogenetic analysis of the H gene sequences of CDV strains from different geographic regions and vaccine strains was performed. Four of the seven CDV strains were grouped in the same cluster of the Asia-1 lineage to which the vast majority of Chinese CDV strains belong, whereas the other three were clustered within the Asia-4 lineage, which has never been detected in China. This represents the first record of detection of strains of the Asia-4 lineage in China since this lineage was reported in Thailand in 2013.

  7. Isolation, Genome Phylogenetic Analysis and In vitro Rescue of a Newly Emerging Porcine Circovirus Type 2

    Directory of Open Access Journals (Sweden)

    Weijuan Zhu and Xiaofeng Ren*

    2012-05-01

    Full Text Available Porcine circovirus type 2 (PCV2 is the major causative agent of post-weaning multisystemic wasting syndrome (PMWS. Infection by PCV2 may cause heavy losses in pig industry. In this study, we report the isolation of a newly emerging PCV2 from northeastern China. The complete genome of the PCV2 isolate named PCV2-LJR contains 1766 nucleotides and was compared with reference sequences published in GenBank followed by topology analysis of the resulting phylogenetic tree. The data indicated that the prevalent PCV2 isolates in the northeastern China had close relationship, although various genotypes of PCV2 existed. In addition, by gene recombination and transfection techniques, the PCV2 infectious clone was achieved and was able to rescue virus in vitro determined by indirect immunofluorescence assay and PCR. The obtained biological materials may be used for biological characterization of PCV2.

  8. The origin and evolution of Basigin(BSG) gene: A comparative genomic and phylogenetic analysis.

    Science.gov (United States)

    Zhu, Xinyan; Wang, Shenglan; Shao, Mingjie; Yan, Jie; Liu, Fei

    2017-07-01

    Basigin (BSG), also known as extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), plays various fundamental roles in the intercellular recognition involved in immunologic phenomena, differentiation, and development. In this study, we aimed to compare the similarities and differences of BSG among organisms and explore possible evolutionary relationships based on the comparison result. We used the extensive BLAST tool to search the metazoan genomes, N-glycosylation sites, the transmembrane region and other functional sites. We then identified BSG homologs from genomic sequences and analyzed their phylogenetic relationships. We identified that BSG genes exist not only in the vertebrate metazoans but also in the invertebrate metazoans such as Amphioxus B. floridae, D. melanogaster, A. mellifera, S. japonicum, C. gigas, and T. patagoniensis. After sequence analysis, we confirmed that only vertebrate metazoans and Cephalochordate (amphioxus B. floridae) have the classic structure (a signal peptide, two Ig-like domains (IgC2 and IgI), a transmembrane region, and an intracellular domain). The invertebrate metazoans (excluding amphioxus B. floridae) lack the N-terminal signal peptides and IgC2 domain. We then generated a phylogenetic tree, genome organization comparison, and chromosomal disposition analysis based on the biological information obtained from the NCBI and Ensembl databases. Finally, we established the possible evolutionary scenario of the BSG gene, which showed the restricted exon rearrangement that has occurred during evolution, forming the present-day BSG gene. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences.

    Science.gov (United States)

    Macey, J Robert; Papenfuss, Theodore J; Kuehl, Jennifer V; Fourcade, H Mathew; Boore, Jeffrey L

    2004-10-01

    Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in Bipes biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with the block cob, trnT, trnP, as they are in birds.

  10. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences

    Energy Technology Data Exchange (ETDEWEB)

    Macey, J. Robert; Papenfuss, Theodore J.; Kuehl, Jennifer V.; Fourcade, H. Matthew; Boore, Jeffrey L.

    2004-05-19

    Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5,797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in B. biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with cob, trnT, trnP, as they are in birds.

  11. Data for constructing insect genome content matrices for phylogenetic analysis and functional annotation

    Directory of Open Access Journals (Sweden)

    Jeffrey Rosenfeld

    2016-03-01

    Full Text Available Twenty one fully sequenced and well annotated insect genomes were used to construct genome content matrices for phylogenetic analysis and functional annotation of insect genomes. To examine the role of e-value cutoff in ortholog determination we used scaled e-value cutoffs and a single linkage clustering approach.. The present communication includes (1 a list of the genomes used to construct the genome content phylogenetic matrices, (2 a nexus file with the data matrices used in phylogenetic analysis, (3 a nexus file with the Newick trees generated by phylogenetic analysis, (4 an excel file listing the Core (CORE genes and Unique (UNI genes found in five insect groups, and (5 a figure showing a plot of consistency index (CI versus percent of unannotated genes that are apomorphies in the data set for gene losses and gains and bar plots of gains and losses for four consistency index (CI cutoffs.

  12. Phylogenetic relationships among East African haplochromine fish as revealed by short interspersed elements (SINEs).

    Science.gov (United States)

    Terai, Yohey; Takezaki, Naoko; Mayer, Werner E; Tichy, Herbert; Takahata, Naoyuki; Klein, Jan; Okada, Norihiro

    2004-01-01

    Genomic DNA libraries were prepared from two endemic species of Lake Victoria haplochromine (cichlid) fish and used to isolate and characterize a set of short interspersed elements (SINEs). The distribution and sequences of the SINEs were used to infer phylogenetic relationships among East African haplochromines. The SINE-based classification divides the fish into four groups, which, in order of their divergence from a stem lineage, are the endemic Lake Tanganyika flock (group 1); fish of the nonendemic, monotypic, widely distributed genus Astatoreochromis (group 2); the endemic Lake Malawi flock (group 3); and group 4, which contains fish from widely dispersed East African localities including Lakes Victoria, Edward, George, Albert, and Rukwa, as well as many rivers. The group 4 haplochromines are characterized by a subset of polymorphic SINEs, each of which is present in some individuals and absent in others of the same population at a given locality, the same morphologically defined species, and the same mtDNA-defined haplogroup. SINE-defined group 4 contains six of the seven previously described mtDNA haplogroups. One of the polymorphic SINEs appears to be fixed in the endemic Lake Victoria flock; four others display the presence-or-absence polymorphism within the species of this flock. These findings have implications for the origin of Lake Victoria cichlids and for their founding population sizes.

  13. Phylogenetic relationships and evolutionary history of the greater horseshoe bat, Rhinolophus ferrumequinum, in Northeast Asia.

    Science.gov (United States)

    Liu, Tong; Sun, Keping; Park, Yung Chul; Feng, Jiang

    2016-01-01

    The greater horseshoe bat, Rhinolophus ferrumequinum , is an important model organism for studies on chiropteran phylogeographic patterns. Previous studies revealed the population history of R. ferrumequinum from Europe and most Asian regions, yet there continue to be arguments about their evolutionary process in Northeast Asia. In this study, we obtained mitochondrial DNA cyt b and D-loop data of R. ferrumequinum from Northeast China, South Korea and Japan to clarify their phylogenetic relationships and evolutionary process. Our results indicate a highly supported monophyletic group of Northeast Asian greater horseshoe bats, in which Japanese populations formed a single clade and clustered into the mixed branches of Northeast Chinese and South Korean populations. We infer that R. ferrumequinum in Northeast Asia originated in Northeast China and South Korea during a cold glacial period, while some ancestors likely arrived in Japan by flying or land bridge and subsequently adapted to the local environment. Consequently, during the warm Eemian interglaciation, the Korea Strait, between Japan and South Korea, became a geographical barrier to Japanese and inland populations, while the Changbai Mountains, between China and North Korea, did not play a significant role as a barrier between Northeast China and South Korea populations.

  14. Vertebrate hosts and phylogenetic relationships of amphibian trypanosomes from a potential invertebrate vector, Culex territans Walker (Diptera: Culicidae).

    Science.gov (United States)

    Bartlett-Healy, Kristen; Crans, Wayne; Gaugler, Randy

    2009-04-01

    The blood meals of field-collected female Culex territans (Diptera: Culicidae) were concurrently assayed for the presence of trypanosomes and for vertebrate host identification. We amplified vertebrate DNA in 42 of 119 females and made positive identification to the host species level in 29 of those samples. Of the 119 field-collected Cx. territans females, 24 were infected with trypanosomes. Phylogenetic analysis placed the trypanosomes in the amphibian portion of the aquatic clade of the Trypanosomatidae. These trypanosomes were isolated from Cx. territans females that had fed on the frog species Rana clamitans, R. catesbeiana, R. virgatipes, and Rana spp. Results support a potential new lineage of dipteran-transmitted amphibian trypanosomes may occur within the aquatic clade. The frequency in which female Cx. territans acquire trypanosomes, through diverse feeding habits, indicates a new relationship between amphibian trypanosomes and mosquitoes that has not been examined previously. Combining Trypanosoma species, invertebrate, and vertebrate hosts to existing phylogenies can elucidate trypanosome and host relationships.

  15. Phylogenetic Relationships of Cucullanidae (Nematoda), with Observations on Seuratoidea and the Monophyly of Cucullanus, Dichelyne and Truttaedacnitis.

    Science.gov (United States)

    Choudhury, Anindo; Nadler, Steven A

    2016-02-01

    The phylogenetic relationships of Cucullanidae were explored using near-complete sequences of the 18S rDNA (rRNA gene). Sequences (1,750-1,760 bp) were obtained from 7 species of Cucullanidae belonging to 3 genera, Cucullanus (2 spp.), Dichelyne (2 spp.), Truttaedacnitis (3 spp.), and 1 species of Quimperiidae ( Paraseuratum sp.). These sequences were aligned with those of 128 other nematode species available in GenBank, including 3 other cucullanids (Dichelyne mexicanus, Cucullanus robustus, and Cucullanus baylisi) and 2 non-cucullanid seuratoids (Paraquimperia africana, and Linstowinema sp.). Bayesian (BPP) and maximum likelihood (ML) analyses of 2 different datasets strongly supported a monophyletic Cucullanidae. Bayesian analysis placed this family as the sister group to a clade containing species of Diplogasterida, Strongylida, Rhabditida, and Tylenchida with very strong support. Neither BPP nor ML analyses recovered a close relationship of Cucullanidae to Ascaridida. None of the 3 non-cucullanid seuratoid species were sister to Cucullanidae, nor did they form a monophyletic group of their own, which questions the monophyly of Seuratoidea and the relationships among species within this superfamily. The 3 genera of cucullanids were also not monophyletic, although morphologically similar species such as the 2 species of Cucullanus from Neotropical catfishes and 2 species of Dichelyne from Nearctic ictalurid catfishes were sister taxa with strong support. The results were ambiguous with respect to the relationship of 2 Truttaedacnitis spp. in Nearctic freshwater fishes but do not support Truttaedacnitis heterodonti, a parasite of heterodontid sharks, as belonging to this genus. The study shows that all aspects of the conventional classification of Seuratoidea and its taxa should be scrutinized by even more extensive sampling across hosts and habitats.

  16. Multilocus sequence typing and phylogenetic analysis of Propionibacterium acnes

    DEFF Research Database (Denmark)

    Kilian, Mogens; Scholz, Christian F. P.; Lomholt, Hans B.

    2012-01-01

    Propionibacterium acnes is a commensal of human skin but is also implicated in the pathogenesis of acne vulgaris, in biofilm-associated infections of medical devices and endophthalmitis, and in infections of bone and dental root canals. Recent studies associate P. acnes with prostate cancer...... schemes were compared with reference to a phylogenetic tree based on 78 P. acnes genomes and their gene contents. Further support for a basically clonal population structure of P. acnes and a scenario of the global spread of epidemic clones of P. acnes was obtained. Compared to the Belfast scheme...

  17. Multilocus Sequence Typing (MLST) and Phylogenetic Analysis of Propionibacterium acnes

    DEFF Research Database (Denmark)

    Kilian, Mogens; Scholz, Christian; Lomholt, Hans B

    2011-01-01

    Propionibacterium acnes is a commensal of human skin but is also implicated in the pathogenesis of acne vulgaris and in biofilm-associated infections of medical devices and endophthalmitis, and in infections of bone and dental root canals. Recent studies associate P. acnes with prostate cancer...... with reference to a phylogenetic tree based on 78 P. acnes genomes and their gene contents. Further support for a basically clonal population structure of P. acnes and a scenario of global spread of epidemic clones of P. acnes was obtained. Compared with the Belfast scheme, the Aarhus MLST scheme (http...

  18. REFGEN and TREENAMER: Automated Sequence Data Handling for Phylogenetic Analysis in the Genomic Era

    Science.gov (United States)

    Leonard, Guy; Stevens, Jamie R.; Richards, Thomas A.

    2009-01-01

    The phylogenetic analysis of nucleotide sequences and increasingly that of amino acid sequences is used to address a number of biological questions. Access to extensive datasets, including numerous genome projects, means that standard phylogenetic analyses can include many hundreds of sequences. Unfortunately, most phylogenetic analysis programs do not tolerate the sequence naming conventions of genome databases. Managing large numbers of sequences and standardizing sequence labels for use in phylogenetic analysis programs can be a time consuming and laborious task. Here we report the availability of an online resource for the management of gene sequences recovered from public access genome databases such as GenBank. These web utilities include the facility for renaming every sequence in a FASTA alignment file, with each sequence label derived from a user-defined combination of the species name and/or database accession number. This facility enables the user to keep track of the branching order of the sequences/taxa during multiple tree calculations and re-optimisations. Post phylogenetic analysis, these webpages can then be used to rename every label in the subsequent tree files (with a user-defined combination of species name and/or database accession number). Together these programs drastically reduce the time required for managing sequence alignments and labelling phylogenetic figures. Additional features of our platform include the automatic removal of identical accession numbers (recorded in the report file) and generation of species and accession number lists for use in supplementary materials or figure legends. PMID:19812722

  19. REFGEN and TREENAMER: Automated Sequence Data Handling for Phylogenetic Analysis in the Genomic Era

    Directory of Open Access Journals (Sweden)

    Guy Leonard

    2009-01-01

    Full Text Available The phylogenetic analysis of nucleotide sequences and increasingly that of amino acid sequences is used to address a number of biological questions. Access to extensive datasets, including numerous genome projects, means that standard phylogenetic analyses can include many hundreds of sequences. Unfortunately, most phylogenetic analysis programs do not tolerate the sequence naming conventions of genome databases. Managing large numbers of sequences and standardizing sequence labels for use in phylogenetic analysis programs can be a time consuming and laborious task. Here we report the availability of an online resource for the management of gene sequences recovered from public access genome databases such as GenBank. These web utilities include the facility for renaming every sequence in a FASTA alignment fi le, with each sequence label derived from a user-defined combination of the species name and/or database accession number. This facility enables the user to keep track of the branching order of the sequences/taxa during multiple tree calculations and re-optimisations. Post phylogenetic analysis, these webpages can then be used to rename every label in the subsequent tree fi les (with a user-defined combination of species name and/or database accession number. Together these programs drastically reduce the time required for managing sequence alignments and labelling phylogenetic figures. Additional features of our platform include the automatic removal of identical accession numbers (recorded in the report file and generation of species and accession number lists for use in supplementary materials or figure legends.

  20. Discrimination and chemical phylogenetic study of seven species of Dendrobium using infrared spectroscopy combined with cluster analysis

    Science.gov (United States)

    Luo, Congpei; He, Tao; Chun, Ze

    2013-04-01

    Dendrobium is a commonly used and precious herb in Traditional Chinese Medicine. The high biodiversity of Dendrobium and the therapeutic needs require tools for the correct and fast discrimination of different Dendrobium species. This study investigates Fourier transform infrared spectroscopy followed by cluster analysis for discrimination and chemical phylogenetic study of seven Dendrobium species. Despite the general pattern of the IR spectra, different intensities, shapes, peak positions were found in the IR spectra of these samples, especially in the range of 1800-800 cm-1. The second derivative transformation and alcoholic extracting procedure obviously enlarged the tiny spectral differences among these samples. The results indicated each Dendrobium species had a characteristic IR spectra profile, which could be used to discriminate them. The similarity coefficients among the samples were analyzed based on their second derivative IR spectra, which ranged from 0.7632 to 0.9700, among the seven Dendrobium species, and from 0.5163 to 0.9615, among the ethanol extracts. A dendrogram was constructed based on cluster analysis the IR spectra for studying the chemical phylogenetic relationships among the samples. The results indicated that D. denneanum and D. crepidatum could be the alternative resources to substitute D. chrysotoxum, D. officinale and D. nobile which were officially recorded in Chinese Pharmacopoeia. In conclusion, with the advantages of high resolution, speediness and convenience, the experimental approach can successfully discriminate and construct the chemical phylogenetic relationships of the seven Dendrobium species.

  1. [Phylogenetic analysis of closely related Leuconostoc citreum species based on partial housekeeping genes].

    Science.gov (United States)

    Lv, Qiang; Chen, Ming; Xu, Haiyan; Song, Yuqin; Sun, Zhihong; Dan, Tong; Sun, Tiansong

    2013-07-04

    Using the 16S rRNA, dnaA, murC and pyrG gene sequences, we identified the phylogenetic relationship among closely related Leuconostoc citreum species. Seven Leu. citreum strains originally isolated from sourdough were characterized by PCR methods to amplify the dnaA, murC and pyrG gene sequences, which were determined to assess the suitability as phylogenetic markers. Then, we estimated the genetic distance and constructed the phylogenetic trees including 16S rRNA and above mentioned three housekeeping genes combining with published corresponding sequences. By comparing the phylogenetic trees, the topology of three housekeeping genes trees were consistent with that of 16S rRNA gene. The homology of closely related Leu. citreum species among dnaA, murC, pyrG and 16S rRNA gene sequences were different, ranged from75.5% to 97.2%, 50.2% to 99.7%, 65.0% to 99.8% and 98.5% 100%, respectively. The phylogenetic relationship of three housekeeping genes sequences were highly consistent with the results of 16S rRNA gene sequence, while the genetic distance of these housekeeping genes were extremely high than 16S rRNA gene. Consequently, the dnaA, murC and pyrG gene are suitable for classification and identification closely related Leu. citreum species.

  2. PHYLOGENETIC ANALYSIS WHITHIN THE PRISTIMANTIS UNISTRIGATUS (ANURA, CRAUGASTORIDAE GROUP BASED ON MORPHOLOGICAL CHARACTERS

    Directory of Open Access Journals (Sweden)

    JULIO MARIO HOYOS

    2014-06-01

    Full Text Available We present a phylogenetic analysis within the Pristimantis unistrigatus group (Anura, Craugastoridae of Colombia . Characters from the superficial muscles of the hands and feet as well as external characters were taken for analysis. Most of the muscle characters were observed directly, and some were taken from the literature. Similarly, the external ones were taken mostly from the original descriptions and others from the literature as well. Two matrices were constructed, as the species belonging to this group have changed in recent years with respect to the initially proposed when the group was defined. The results lead us to conclude that the group is not monophyletic, although there are some relationships that are worth to survey because they are kept in the very last cladograms obtained for both proposals. It is suggested that these last relationships should be explored in particular, and the overall group in general, increasing the number of characters and taxa that belong to P. unistrigatus. An open question we left is whether actually is worth to keep these informal taxonomic hierarchy called group within the genera of anurans.

  3. PHYTOCHEMICAL AND PHYLOGENETIC ANALYSIS OF Spondias(Anacardiaceae

    Directory of Open Access Journals (Sweden)

    Cristiane Pereira

    2015-07-01

    Full Text Available This paper describes the correlation between the phenolic composition and the molecular phylogenetic reconstruction of five Spondias species (Anacardiaceae. Two of these species (S. venulosa and Spondias sp. occur in rainforest areas and the other three are widely distributed in Brazil (S. dulcis, S.mombin, and S. purpurea. The flavonoid enriched fraction of the S. venulosa leaf extract also underwent a chemical study. The results indicate that the presence of flavonol 3-O-glycosides are a synapomorphic character of the studied American Spondias and the production of rhamnetin 3-O-rutinoside is a synapomorphy of the Atlantic forest species. This is the first report of flavonoids in S. venulosa, an endemic species from the Brazilian Atlantic rainforest.

  4. Genetic diversity and phylogenetic relationship of Indonesian Local goats using microsatellite DNA markers

    Directory of Open Access Journals (Sweden)

    M Syamsul Arifin Zein

    2012-03-01

    Full Text Available Genetic diversity is important information in the process of conservation and sustainable utilization of animal genetic resources. Thirteen microsatellite markers were used to estimate the degree of genetic diversity on five Indonesian local goats. Results showed the highest average allele diversity present in the locus MAF70 (5.6 ± 2.9, and the lowest was in the locus MAF035 (1.6 ± 0.6, the average number of alleles per locus was 6 ± 2.3. The lowest average alleles diversity present was in the Gembrong goat (2.2 ± 1.1 and the highest was in the Jawarandu goat (4.9 ± 2.2. There is a unique alleles at loci MCM527 and present in all Indonesian local goat with the highest allele frequency on Peranakan Etawa (37.2% and lowest in Gembrong goat (7.9%. H0 ranged from 0.372 ± 0.173 (Gembrong to 0.540 ± 0.204 (Peranakan Etawa, and HE ranging from 0.249 ± 0.196 (Gembrong to 0.540 ± 0.212 (Peranakan Etawa.The genetic differentiation for inbreeding among population (FIS, within population (FIT, and average genetic differention (FST were 0,0208 (2,08%, 0,1532 (15,32%, and 0,1352 (13,52%, respectively. Locus ILSTS029, BMS1494, MAF035 and INRA0132 had a low PIC value (PIC 0.5. Phylogenetic relationship was consistent with the history of its development based on Kacang goat except was for Gembrong Goat. This research information can be used for conservation strategies and breeding programs on each population of Indonesian local goat.

  5. Phylogenetic Relationships of the Fern Cyrtomium falcatum (Dryopteridaceae from Dokdo Island Based on Chloroplast Genome Sequencing

    Directory of Open Access Journals (Sweden)

    Gurusamy Raman

    2016-12-01

    Full Text Available Cyrtomium falcatum is a popular ornamental fern cultivated worldwide. Native to the Korean Peninsula, Japan, and Dokdo Island in the Sea of Japan, it is the only fern present on Dokdo Island. We isolated and characterized the chloroplast (cp genome of C. falcatum, and compared it with those of closely related species. The genes trnV-GAC and trnV-GAU were found to be present within the cp genome of C. falcatum, whereas trnP-GGG and rpl21 were lacking. Moreover, cp genomes of Cyrtomium devexiscapulae and Adiantum capillus-veneris lack trnP-GGG and rpl21, suggesting these are not conserved among angiosperm cp genomes. The deletion of trnR-UCG, trnR-CCG, and trnSeC in the cp genomes of C. falcatum and other eupolypod ferns indicates these genes are restricted to tree ferns, non-core leptosporangiates, and basal ferns. The C. falcatum cp genome also encoded ndhF and rps7, with GUG start codons that were only conserved in polypod ferns, and it shares two significant inversions with other ferns, including a minor inversion of the trnD-GUC region and an approximate 3 kb inversion of the trnG-trnT region. Phylogenetic analyses showed that Equisetum was found to be a sister clade to Psilotales-Ophioglossales with a 100% bootstrap (BS value. The sister relationship between Pteridaceae and eupolypods was also strongly supported by a 100% BS, but Bayesian molecular clock analyses suggested that C. falcatum diversified in the mid-Paleogene period (45.15 ± 4.93 million years ago and might have moved from Eurasia to Dokdo Island.

  6. Evolution of climatic niche specialization: a phylogenetic analysis in amphibians.

    Science.gov (United States)

    Bonetti, Maria Fernanda; Wiens, John J

    2014-11-22

    The evolution of climatic niche specialization has important implications for many topics in ecology, evolution and conservation. The climatic niche reflects the set of temperature and precipitation conditions where a species can occur. Thus, specialization to a limited set of climatic conditions can be important for understanding patterns of biogeography, species richness, community structure, allopatric speciation, spread of invasive species and responses to climate change. Nevertheless, the factors that determine climatic niche width (level of specialization) remain poorly explored. Here, we test whether species that occur in more extreme climates are more highly specialized for those conditions, and whether there are trade-offs between niche widths on different climatic niche axes (e.g. do species that tolerate a broad range of temperatures tolerate only a limited range of precipitation regimes?). We test these hypotheses in amphibians, using phylogenetic comparative methods and global-scale datasets, including 2712 species with both climatic and phylogenetic data. Our results do not support either hypothesis. Rather than finding narrower niches in more extreme environments, niches tend to be narrower on one end of a climatic gradient but wider on the other. We also find that temperature and precipitation niche breadths are positively related, rather than showing trade-offs. Finally, our results suggest that most amphibian species occur in relatively warm and dry environments and have relatively narrow climatic niche widths on both of these axes. Thus, they may be especially imperilled by anthropogenic climate change. © 2014 The Author(s) Published by the Royal Society. All rights reserved.

  7. Phylogenetic analysis, fumonisin production and pathogenicity of Fusarium fujikuroi strains isolated from rice in the Philippines.

    Science.gov (United States)

    Cruz, Alejandra; Marín, Patricia; González-Jaén, M Teresa; Aguilar, Kristel Grace I; Cumagun, Christian Joseph R

    2013-09-01

    Fusarium fujikuroi Nirenberg is a maize and rice pathogen causing important agricultural losses and produces fumonisins - mycotoxins which pose health risk to humans and farm animals. However, little information is available about the phylogenetics of this species and its ability to produce fumonisins in rice. We studied 32 strains isolated from rice in the Philippines and performed a phylogenetic analysis using the partial sequence of Elongation Factor 1 alpha (EF-1α) including isolates belonging to closely related species. Fumonisin B1 (FB1 ) production was analyzed in 7-day-old cultures grown in fumonisin-inducing medium by an enzyme-linked immunosorbent assay-based method and by real-time reverse transcriptase-polymerase chain reaction using primers for FUM1 gene, a key gene in fumonisin biosynthesis. Nucleotide diversities per site (π) were 0.00024 ± 0.00022 (standard deviation) for the 32 F. fujikuroi strains from the Philippines and 0.00189 ± 0.00143 for all 34 F. fujikuroi strains, respectively. F. fujikuroi isolates grouped into one cluster separated from the rest of isolates belonging to the closely related F. proliferatum and showed very low variability, irrespective of their geographic origin. The cluster containing strains of F. proliferatum showed higher intraspecific variability than F. fujikuroi. Thirteen of the 32 strains analyzed were FB1 producers (40.62%), with production ranging from 0.386 to 223.83 ppm. All isolates analyzed showed FUM1 gene expression above 1 and higher than the CT value of the non-template control sample. Both seedling stunting and elongation were induced by the isolates in comparison with the control. F. fujikuroi are distinct from F. proliferatum isolates based on phytogenetic analysis and are potential fumonisin producers because all are positive for FUM1 gene expression. No relationship between fumonisin production and pathogenicity could be observed. © 2013 Society of Chemical Industry.

  8. Tracking the Origin and Deciphering the Phylogenetic Relationship of Porcine Epidemic Diarrhea Virus in Ecuador

    Directory of Open Access Journals (Sweden)

    Maritza Barrera

    2017-01-01

    Full Text Available In 2010, new Chinese strains of porcine epidemic diarrhea virus (PEDV, clinically more severe than the classical strains, emerged. These strains were spread to United States in 2013 through an intercontinental transmission from China with further spreading across the world, evidencing the emergent nature of these strains. In the present study, an analysis of PEDV field sequences from Ecuador was conducted by comparing all the PEDV S gene sequences available in the GenBank database. Phylogenetic comparisons and Bayesian phylogeographic inference based on complete S gene sequences were also conducted to track the origin and putative route of PEDV. The sequence from the PED-outbreak in Ecuador was grouped into the clade II of PEDV genogroup 2a together with other sequences of isolates from Mexico, Canada, and United States. The phylogeographic study revealed the emergence of the Chinese PEDV strains, followed by spreading to US in 2013, from US to Korea, and later the introduction of PEDV to Canada, Mexico, and Ecuador directly from the US. The sources of imports of live swine in Ecuador in 2014 were mainly from Chile and US. Thus, this movement of pigs is suggested as the main way for introducing PEDV to Ecuador.

  9. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Directory of Open Access Journals (Sweden)

    Mohammad Bagher Javadi Nobandegani

    2015-01-01

    Full Text Available Phosphate solubilizing bacteria (PSB can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang oil palm field (University Putra Malaysia. Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta subdivision of Proteobacteria, one isolate was related to the Gama subdivision of Proteobacteria, and two isolates were related to the Firmicutes. Bacterial isolates of 6upmr, 2upmr, 19upmnr, 10upmr, and 24upmr were identified as Alcaligenes faecalis. Also, bacterial isolates of 20upmnr and 17upmnr were identified as Bacillus cereus and Vagococcus carniphilus, respectively, and bacterial isolates of 31upmr were identified as Serratia plymuthica. Molecular identification and characterization of oil palm strains as the specific phosphate solubilizer can reduce the time and cost of producing effective inoculate (biofertilizer in an oil palm field.

  10. Phylogenetic relationships of three new microsporidian isolates from the silkworm, Bombyx mori.

    Science.gov (United States)

    Nageswara Rao, S; Muthulakshmi, M; Kanginakudru, S; Nagaraju, J

    2004-07-01

    The pathogenicity, mode of transmission, tissue specificity of infection and the small subunit rRNA (SSU-rRNA) gene sequences of the three new microsporidian isolates from the silkworm Bombyx mori were studied. Out of the three, NIK-2r revealed life cycle features and SSU-rRNA gene sequence similar to Nosema bombycis, suggesting that it is N. bombycis. The other two, NIK-4m and NIK-3h, differed from each other as well as from N. bombycis. NIK-4m was highly pathogenic and did not show any vertical transmission, in accordance with the apparent lack of gonadal infection, whereas NIK-3h was less pathogenic and vertical transmission was not detected but could not be excluded. Phylogenetic analysis based on SSU-rRNA gene sequence placed NIK-3h and NIK-4m in a distinct clade that included almost all the Vairimorpha species and Nosema species that infect lepidopteran and non-lepidopteran hosts, while NIK-2r was included in a clade containing almost all the Nosema isolates that infect only lepidopteran hosts. Thus, we have presented molecular evidence that one of the three isolates is in fact the type species N. bombycis, while the other two isolates are Vairimorpha spp. There was distinct separation of microsporidian isolates infecting only lepidopteran hosts and those infecting lepidopteran and non-lepidopteran hosts, reflecting possible co-evolution of hosts and microsporidian isolates.

  11. Complete mitochondrial genome of Porzana fusca and Porzana pusilla and phylogenetic relationship of 16 Rallidae species.

    Science.gov (United States)

    Chen, Peng; Han, Yuqing; Zhu, Chaoying; Gao, Bin; Ruan, Luzhang

    2017-12-01

    The complete mitochondrial genome sequences of Porzana fusca and Porzana pusilla were determined. The two avian species share a high degree of homology in terms of mitochondrial genome organization and gene arrangement. Their corresponding mitochondrial genomes are 16,935 and 16,978 bp and consist of 37 genes and a control region. Their PCGs were both 11,365 bp long and have similar structure. Their tRNA gene sequences could be folded into canonical cloverleaf secondary structure, except for tRNA Ser (AGY) , which lost its "DHU" arm. Based on the concatenated nucleotide sequences of the complete mitochondrial DNA genes of 16 Rallidae species, reconstruction of phylogenetic trees and analysis of the molecular clock of P. fusca and P. pusilla indicated that these species from a sister group, which in turn are sister group to Rallina eurizonoides. The genus Gallirallus is a sister group to genus Lewinia, and these groups in turn are sister groups to genus Porphyrio. Moreover, molecular clock analyses suggested that the basal divergence of Rallidae could be traced back to 40.47 (41.46‒39.45) million years ago (Mya), and the divergence of Porzana occurred approximately 5.80 (15.16‒0.79) Mya.

  12. Principal component analysis and the locus of the Fréchet mean in the space of phylogenetic trees.

    Science.gov (United States)

    Nye, Tom M W; Tang, Xiaoxian; Weyenberg, Grady; Yoshida, Ruriko

    2017-12-01

    Evolutionary relationships are represented by phylogenetic trees, and a phylogenetic analysis of gene sequences typically produces a collection of these trees, one for each gene in the analysis. Analysis of samples of trees is difficult due to the multi-dimensionality of the space of possible trees. In Euclidean spaces, principal component analysis is a popular method of reducing high-dimensional data to a low-dimensional representation that preserves much of the sample's structure. However, the space of all phylogenetic trees on a fixed set of species does not form a Euclidean vector space, and methods adapted to tree space are needed. Previous work introduced the notion of a principal geodesic in this space, analogous to the first principal component. Here we propose a geometric object for tree space similar to the [Formula: see text]th principal component in Euclidean space: the locus of the weighted Fréchet mean of [Formula: see text] vertex trees when the weights vary over the [Formula: see text]-simplex. We establish some basic properties of these objects, in particular showing that they have dimension [Formula: see text], and propose algorithms for projection onto these surfaces and for finding the principal locus associated with a sample of trees. Simulation studies demonstrate that these algorithms perform well, and analyses of two datasets, containing Apicomplexa and African coelacanth genomes respectively, reveal important structure from the second principal components.

  13. Diversification of Scrophularia (Scrophulariaceae) in the Western Mediterranean and Macaronesia--phylogenetic relationships, reticulate evolution and biogeographic patterns.

    Science.gov (United States)

    Scheunert, Agnes; Heubl, Günther

    2014-01-01

    The flora of the Mediterranean region and Macaronesia is characterized by high levels of species diversity and endemism. We examined phylogenetic relationships of Scrophularia within one of its secondary centers of diversity located in the Iberian Peninsula and adjacent Macaronesia. In total, 65 ingroup accessions from 45 species, representing an almost complete sampling of the region, were analyzed using sequences from the internal transcribed spacer region (ITS) and the plastid trnQ-rps16 intergenic spacer. Phylogenetic relationships were inferred using Bayesian inference, maximum likelihood and statistical parsimony networking. Incongruence between datasets was assessed with statistical tests and displayed by split networks. Biogeographic inferences incorporating information from both markers (despite low resolution in some parts of the trees) and all incongruent taxa were accomplished with a novel combination of methods, using trees generated with the taxon duplication approach as input for Bayesian binary MCMC (BBM) analysis as implemented in RASP. Nuclear and chloroplast markers support a clade which comprises the majority of Iberian and Macaronesian species and consists of three subclades. Analyses of the substantial incongruence observed among markers indicate reticulate evolution and suggest that Scrophularia species diversity in this region is largely attributable to hybridization; a combination of both polyploidy and dysploidy in the karyotypic evolution of Western Mediterranean Scrophularia taxa is proposed. Our results provide support for an ancient hybridization event between two widespread lineages, which resulted in an allopolyploid ancestor of the Iberian - Macaronesian group with 2n=58 chromosomes. The ancestor then diverged into the three main lineages present in the Iberian Peninsula, Northern Africa and Macaronesia today. Subsequent interspecific hybridizations at different ploidy levels additionally generated new species. Presumably

  14. Phylogenetic relationships of the freshwater alga Boldia erythrosiphon (Compsopogonales, Rhodophyta) based on 18S rRNA gene sequences

    NARCIS (Netherlands)

    Holton, R.W; Boele-Bos, S.A.; Stam, W.T.

    The nuclear small-subunit ribosomal DNA sequence from the freshwater red alga Boldia erythrosiphon Herndon emend Howard et Parker was determined. Phylogenetic analysis confirms the positioning of this species within the bangiophycidean order of the Compsopogonales. The results strongly suggest that

  15. Genome-wide comparative analysis of phylogenetic trees: the prokaryotic forest of life.

    Science.gov (United States)

    Puigbò, Pere; Wolf, Yuri I; Koonin, Eugene V

    2012-01-01

    Genome-wide comparison of phylogenetic trees is becoming an increasingly common approach in evolutionary genomics, and a variety of approaches for such comparison have been developed. In this article, we present several methods for comparative analysis of large numbers of phylogenetic trees. To compare phylogenetic trees taking into account the bootstrap support for each internal branch, the Boot-Split Distance (BSD) method is introduced as an extension of the previously developed Split Distance method for tree comparison. The BSD method implements the straightforward idea that comparison of phylogenetic trees can be made more robust by treating tree splits differentially depending on the bootstrap support. Approaches are also introduced for detecting tree-like and net-like evolutionary trends in the phylogenetic Forest of Life (FOL), i.e., the entirety of the phylogenetic trees for conserved genes of prokaryotes. The principal method employed for this purpose includes mapping quartets of species onto trees to calculate the support of each quartet topology and so to quantify the tree and net contributions to the distances between species. We describe the application of these methods to analyze the FOL and the results obtained with these methods. These results support the concept of the Tree of Life (TOL) as a central evolutionary trend in the FOL as opposed to the traditional view of the TOL as a "species tree."

  16. Phylogenetic analysis reveals a high prevalence of Sporothrix brasiliensis in feline sporotrichosis outbreaks.

    Science.gov (United States)

    Rodrigues, Anderson Messias; de Melo Teixeira, Marcus; de Hoog, G Sybren; Schubach, Tânia Maria Pacheco; Pereira, Sandro Antonio; Fernandes, Geisa Ferreira; Bezerra, Leila Maria Lopes; Felipe, Maria Sueli; de Camargo, Zoilo Pires

    2013-01-01

    Sporothrix schenckii, previously assumed to be the sole agent of human and animal sporotrichosis, is in fact a species complex. Recently recognized taxa include S. brasiliensis, S. globosa, S. mexicana, and S. luriei, in addition to S. schenckii sensu stricto. Over the last decades, large epidemics of sporotrichosis occurred in Brazil due to zoonotic transmission, and cats were pointed out as key susceptible hosts. In order to understand the eco-epidemiology of feline sporotrichosis and its role in human sporotrichosis a survey was conducted among symptomatic cats. Prevalence and phylogenetic relationships among feline Sporothrix species were investigated by reconstructing their phylogenetic origin using the calmodulin (CAL) and the translation elongation factor-1 alpha (EF1α) loci in strains originated from Rio de Janeiro (RJ, n = 15), Rio Grande do Sul (RS, n = 10), Paraná (PR, n = 4), São Paulo (SP, n =3) and Minas Gerais (MG, n = 1). Our results showed that S. brasiliensis is highly prevalent among cats (96.9%) with sporotrichosis, while S. schenckii was identified only once. The genotype of Sporothrix from cats was found identical to S. brasiliensis from human sources confirming that the disease is transmitted by cats. Sporothrix brasiliensis presented low genetic diversity compared to its sister taxon S. schenckii. No evidence of recombination in S. brasiliensis was found by split decomposition or PHI-test analysis, suggesting that S. brasiliensis is a clonal species. Strains recovered in states SP, MG and PR share the genotype of the RJ outbreak, different from the RS clone. The occurrence of separate genotypes among strains indicated that the Brazilian S. brasiliensis epidemic has at least two distinct sources. We suggest that cats represent a major host and the main source of cat and human S. brasiliensis infections in Brazil.

  17. Phylogenetic Analysis of Canine Parvovirus VP2 Gene in China.

    Science.gov (United States)

    Yi, L; Tong, M; Cheng, Y; Song, W; Cheng, S

    2016-04-01

    In this study, a total of 37 samples (58.0%) were found through PCR assay to be positive for canine parvovirus (CPV) of 66 suspected faecal samples of dogs collected from various cities throughout China. Eight CPV isolates could be obtained in the CRFK cell line. The sequencing of the VP2 gene of CPV identified the predominant CPV strain as CPV-2a (Ser297Ala), with two CPV-2b (Ser297Ala). Sequence comparison revealed homologies of 99.3-99.9%, 99.9% and 99.3-99.7% within the CPV 2a isolates, within the CPV 2b isolates and between the CPV 2a and 2b isolates, respectively. In addition, several non-synonymous and synonymous mutations were also recorded. The phylogenetic tree revealed that most of the CPV strains from different areas in China were located in the formation of a large branch, which were grouped together along with the KU143-09 strain from Thailand and followed the same evolution. In this study, we provide an updated molecular characterization of CPV 2 circulation in China. © 2014 Blackwell Verlag GmbH.

  18. Phylogenetic analysis reveals multiple introductions of Cynodon species in Australia.

    Science.gov (United States)

    Jewell, M; Frère, C H; Harris-Shultz, K; Anderson, W F; Godwin, I D; Lambrides, C J

    2012-11-01

    The distinction between native and introduced flora within isolated land masses presents unique challenges. The geological and colonisation history of Australia, the world's largest island, makes it a valuable system for studying species endemism, introduction, and phylogeny. Using this strategy we investigated Australian cosmopolitan grasses belonging to the genus Cynodon. While it is believed that seven species of Cynodon are present in Australia, no genetic analyses have investigated the origin, diversity and phylogenetic history of Cynodon within Australia. To address this gap, 147 samples (92 from across Australia and 55 representing global distribution) were sequenced for a total of 3336bp of chloroplast DNA spanning six genes. Data showed the presence of at least six putatively introduced Cynodon species (C. transvaalensis, C. incompletus, C. hirsutus, C. radiatus, C. plectostachyus and C. dactylon) in Australia and suggested multiple recent introductions. C. plectostachyus, a species often confused with C. nlemfuensis, was not previously considered to be present in Australia. Most significantly, we identified two common haplotypes that formed a monophyletic clade diverging from previously identified Cynodon species. We hypothesise that these two haplotypes may represent a previously undescribed species of Cynodon. We provide further evidence that two Australian native species, Brachyachne tenella and B. convergens belong in the genus Cynodon and, therefore, argue for the taxonomic revision of the genus Cynodon. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. Recurrent hybridization and recent origin obscure phylogenetic relationships within the ‘white-headed’ gull (Larus sp.) complex

    Science.gov (United States)

    Sonsthagen, Sarah A.; Wilson, Robert E.; Chesser, Terry; Pons, Jean-Marc; Crochet, Pierre-Andre; Driscoll, Amy; Dove, Carla

    2016-01-01

    Species complexes that have undergone recent radiations are often characterized by extensive allele sharing due to recent ancestry and (or) introgressive hybridization. This can result in discordant evolutionary histories of genes and heterogeneous genomes, making delineating species limits difficult. Here we examine the phylogenetic relationships among a complex group of birds, the white-headed gulls (Aves: Laridae), which offer a unique window into the speciation process due to their recent evolutionary history and propensity to hybridize. Relationships were examined among 17 species (61 populations) using a multilocus approach, including mitochondrial and nuclear intron DNA sequences and microsatellite genotype information. Analyses of microsatellite and intron data resulted in some species-based groupings, although most species were not represented by a single cluster. Considerable allele and haplotype sharing among white-headed gull species was observed; no locus contained a species-specific clade. Despite this, our multilocus approach provided better resolution among some species than previous studies. Interestingly, most clades appear to correspond to geographic locality: our BEAST analysis recovered strong support for a northern European/Icelandic clade, a southern European/Russian clade, and a western North American/canus clade, with weak evidence for a high latitude clade spanning North America and northwestern Europe. This geographical structuring is concordant with behavioral observations of pervasive hybridization in areas of secondary contact. The extent of allele and haplotype sharing indicates that ecological and sexual selection are likely not strong enough to complete reproductive isolation within several species in the white-headed gull complex. This suggests that just a few genes are driving the speciation process.

  20. Phylogenetic relationships and acaricidal effects of Beauveria bassiana obtained from cattle farm soils against Rhipicephalus microplus.

    Science.gov (United States)

    Fernández-Salas, Agustin; Alonso Díaz, Miguel Angel; Alonso Morales, Rogelio Alejandro; Lezama-Gutierrez, Roberto; Cervantes-Chávez, José Antonio

    2018-03-16

    The objectives of the present study were to isolate Beauveria bassiana strains from cattle farms soils, to analyze the phylogenetic relationships among the isolated fungi strains, and to determine the acaricidal effect of B. bassiana isolates on Rhipicephalus microplus engorged ticks, resistant or susceptible to chemical acaricides. Six strains of Beauveria bassiana were obtained and isolated from cattle farms soils by Galleria bait method in Mexican tropics and the acaricidal effect was assessed against 2 populations of R. microplus ("Media Joya" resistant strain or "CLAR" susceptible strain to chemical acaricides) using the adult immersion test. The BbV03 strain produced an 86.7% and a 60% of mortality on resistant and susceptible ticks on day 20, respectively; whereas the mortality scored with the BbV04 strain was 66.7% and 53.5% on resistant and susceptible ticks at the same day, respectively. The BbV03 and BbV04 strains reduced egg-laying on both R. microplus populations. There were not statistical differences in the acaricidal effect of B. bassiana strains, between the R. microplus susceptible or resistant populations (P > 0.05). The BbV03 strain was the most virulent against R. microplus with a LC50 of 2 x 107 and a LC99 of 7 x 108 conidia/ml. We found that the 6 B. bassiana isolated were clustered into the same clade with other previously reported B. bassiana strains (from GenBank); however, they were separated into 3 different sub-clades. This study shows that some B. bassiana strains might be a promising coadjuvant alternative for biological tick control, including those that are resistant to chemical acaricides. Beauveria bassiana is present in the pastures of tropic cattle farms and there are genetic variations between members of the bassiana specie that are living in this ecosystem. This last showed that B. bassiana might play an important roll in the natural control of R. microplus at paddocks of cattle farms.

  1. Phylogenetic relationships of true butterflies (Lepidoptera: Papilionoidea) inferred from COI, 16S rRNA and EF-1α sequences.

    Science.gov (United States)

    Kim, Man Il; Wan, Xinlong; Kim, Min Jee; Jeong, Heon Cheon; Ahn, Neung-Ho; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2010-11-01

    The molecular phylogenetic relationships among true butterfly families (superfamily Papilionoidea) have been a matter of substantial controversy; this debate has led to several competing hypotheses. Two of the most compelling of those hypotheses involve the relationships of (Nymphalidae + Lycaenidae) + (Pieridae + Papilionidae) and (((Nymphalidae + Lycaenidae) + Pieridae) + Papilionidae). In this study, approximately 3,500 nucleotide sequences from cytochrome oxidase subunit I (COI), 16S ribosomal RNA (16S rRNA), and elongation factor-1 alpha (EF-1α) were sequenced from 83 species belonging to four true butterfly families, along with those of three outgroup species belonging to three lepidopteran superfamilies. These sequences were subjected to phylogenetic reconstruction via Bayesian Inference (BI), Maximum Likelihood (ML), and Maximum Parsimony (MP) algorithms. The monophyletic Pieridae and monophyletic Papilionidae evidenced good recovery in all analyses, but in some analyses, the monophylies of the Lycaenidae and Nymphalidae were hampered by the inclusion of single species of the lycaenid subfamily Miletinae and the nymphalid subfamily Danainae. Excluding those singletons, all phylogenetic analyses among the four true butterfly families clearly identified the Nymphalidae as the sister to the Lycaenidae and identified this group as a sister to the Pieridae, with the Papilionidae identified as the most basal linage to the true butterfly, thus supporting the hypothesis: (Papilionidae + (Pieridae + (Nymphalidae + Lycaenidae))).

  2. Genetic diversity and phylogenetic analysis of Tams1 of Theileria annulata isolates from three continents between 2000 and 2012.

    Science.gov (United States)

    Wang, Jiay; Yang, Xianyong; Wang, Yuge; Jing, Zhihong; Meng, Kai; Liu, Jianzhu; Guo, Huijun; Xu, Ruixue; Cheng, Ziqiang

    2014-01-01

    Theileria annulata, which is part of the Theileria sergenti/Theileria buffeli/Theileria orientalis group, preferentially infects cattle and results in high mortality and morbidity in the Mediterranean, Middle East, and Central Asia. The polypeptide Tams1 is an immunodominant major merozoite piroplasm surface antigen of T. annulata that could be used as a marker for epidemiological studies and phylogenetic analysis. In the present study, a total of 155 Tams1 sequences were investigated for genetic diversity and phylogenetic relationships through phylogenetic analysis. Results showed that the Tams1 sequences were divided into two major groups and that distribution for some isolates also exhibited geographic specificity. As targeting polymorphic genes for parasite detection may result in underestimation of infection, polymerase chain reaction (PCR) assay using two different probes targeting tams-1 genes of these two groups can be more credible. In addition, the direction of the spread of the disease was discovered to be from the Mediterranean or the tropical zone to the Eurasian peninsula, Middle East, Southern Asia, and Africa, particularly for Group 2. A similar occurrence was also found between the Ms1 gene of Theileria lestoquardi and the Tams1 gene of T. annulata, which explains cross-immunogenicity to a certain extent. However, no potential glycosylation site in the Tams1 of T. annulata was found in this study, which illustrated that instead of N-glycosylation, other modifications have more significant effects on the immunogenicity of the Tams1 protein.

  3. Detection, molecular typing and phylogenetic analysis of Leishmania isolated from cases of leishmaniasis among Syrian refugees in Lebanon

    Directory of Open Access Journals (Sweden)

    Tamara Salloum

    2016-06-01

    Two molecular typing methods of 39 FFPE Leishmania isolates were used: the ITS1-PCR RFLP and the nested ITS1-5.8S rDNA gene amplification followed by sequencing and phylogenetic analysis. The efficiency of these two techniques in Leishmania identification was compared and the phylogenetic relationships among these isolates were illustrated based on the neighbor-joining (NJ method. The results were statistically correlated with the parasitic index (PI. The DNA storage in formalin-fixed paraffin embedded (FFPE tissues was assessed as well. The parasites identified were all L. tropica as determined by both techniques. ITS1-5.8S rDNA gene based typing proved to be more sensitive in the detection of parasites (positive in 69.2% of the isolates as opposed to the ITS1-PCR RFLP method that was successful in identifying L. tropica in only 43.6% of the isolates. Sequencing and phylogenetic analysis revealed high levels of heterogeneity. A statistically significant correlation was observed between PI and the results of the nested ITS1-5.8S rDNA gene PCR. Genotyping at the species level is essential for monitoring the relative frequency of CL in the Mediterranean area that is correlated to three different Leishmania species (Leishmania infantum, Leishmania major and L. tropica, each characterized by distinct epidemiological features. The obtained results highlight the need to find a universally accepted diagnostic tool for Leishmania typing.

  4. Honey bee dopamine and octopamine receptors linked to intracellular calcium signaling have a close phylogenetic and pharmacological relationship.

    Directory of Open Access Journals (Sweden)

    Kyle T Beggs

    Full Text Available BACKGROUND: Three dopamine receptor genes have been identified that are highly conserved among arthropod species. One of these genes, referred to in honey bees as Amdop2, shows a close phylogenetic relationship to the a-adrenergic-like octopamine receptor family. In this study we examined in parallel the functional and pharmacological properties of AmDOP2 and the honey bee octopamine receptor, AmOA1. For comparison, pharmacological properties of the honey bee dopamine receptors AmDOP1 and AmDOP3, and the tyramine receptor AmTYR1, were also examined. METHODOLOGY/PRINCIPAL FINDINGS: Using HEK293 cells heterologously expressing honey bee biogenic amine receptors, we found that activation of AmDOP2 receptors, like AmOA1 receptors, initiates a rapid increase in intracellular calcium levels. We found no evidence of calcium signaling via AmDOP1, AmDOP3 or AmTYR1 receptors. AmDOP2- and AmOA1-mediated increases in intracellular calcium were inhibited by 10 µM edelfosine indicating a requirement for phospholipase C-β activity in this signaling pathway. Edelfosine treatment had no effect on AmDOP2- or AmOA1-mediated increases in intracellular cAMP. The synthetic compounds mianserin and epinastine, like cis-(Z-flupentixol and spiperone, were found to have significant antagonist activity on AmDOP2 receptors. All 4 compounds were effective antagonists also on AmOA1 receptors. Analysis of putative ligand binding sites offers a possible explanation for why epinastine acts as an antagonist at AmDOP2 receptors, but fails to block responses mediated via AmDOP1. CONCLUSIONS/SIGNIFICANCE: Our results indicate that AmDOP2, like AmOA1, is coupled not only to cAMP, but also to calcium-signalling and moreover, that the two signalling pathways are independent upstream of phospholipase C-β activity. The striking similarity between the pharmacological properties of these 2 receptors suggests an underlying conservation of structural properties related to receptor

  5. Phylogenetic relationships of Malayan gaur with other species of the genus Bos based on cytochrome b gene DNA sequences.

    Science.gov (United States)

    Rosli, M K A; Zakaria, S S; Syed-Shabthar, S M F; Zainal, Z Z; Shukor, M N; Mahani, M C; Abas-Mazni, O; Md-Zain, B M

    2011-03-22

    The Malayan gaur (Bos gaurus hubbacki) is one of the three subspecies of gaurs that can be found in Malaysia. We examined the phylogenetic relationships of this subspecies with other species of the genus Bos (B. javanicus, B. indicus, B. taurus, and B. grunniens). The sequence of a key gene, cytochrome b, was compared among 20 Bos species and the bongo antelope, used as an outgroup. Phylogenetic reconstruction was employed using neighbor joining and maximum parsimony in PAUP and Bayesian inference in MrBayes 3.1. All tree topologies indicated that the Malayan gaur is in its own monophyletic clade, distinct from other species of the genus Bos. We also found significant branching differences in the tree topologies between wild and domestic cattle.

  6. Sequencing and phylogenetic analysis of Herpes simplex virus type ...

    African Journals Online (AJOL)

    For determination of the genetic relationship of HSV-2 glycoprotein G gene (gG) in Iran with those in other countries, DNA fragment of 1100 bp corresponding to gG from six HSV-2 strains have been isolated from human infected sera samples in Iran, it was amplified in PCR system and was sequenced for determining ...

  7. Phylogenetic Analysis of Tibetan Mastiffs Based on Mitochondrial ...

    Indian Academy of Sciences (India)

    Navya

    and H8 were unique to Tibetan population with H8 being first identified. The haplotype ... relationship with humans, e.g. keeping house, accompanying and herding. ... At present, how to maintain and increase the genetic diversity of. Tibetan ...

  8. Biogeographic links between southern Atlantic Forest and western South America: Rediscovery, re-description, and phylogenetic relationships of two rare montane anole lizards from Brazil.

    Science.gov (United States)

    Prates, Ivan; Melo-Sampaio, Paulo Roberto; Drummond, Leandro de Oliveira; Teixeira, Mauro; Rodrigues, Miguel Trefaut; Carnaval, Ana Carolina

    2017-08-01

    Data on species ranges and phylogenetic relationships are key in historical biogeographical inference. In South America, our understanding of the evolutionary processes that underlie biodiversity patterns varies greatly across regions. Little is known, for instance, about the drivers of high endemism in the southern montane region of the Atlantic Rainforest. In this region, former biogeographic connections with other South American ecosystems have been invoked to explain the phylogenetic affinities of a number of endemic taxa. This may also be the case of the montane anole lizards Anolis nasofrontalis and A. pseudotigrinus, known from few specimens collected more than 40years ago. We combine new genetic data with published sequences of species in the Dactyloa clade of Anolis to investigate the phylogenetic relationships of A. nasofrontalis and A. pseudotigrinus, as well as estimate divergence times from their closest relatives. Based on newly sampled and previously overlooked specimens, we provide a taxonomic re-description of those two taxa. Our phylogenetic analysis recovered six main clades within Dactyloa, five of which were previously referred to as species series (aequatorialis, heterodermus, latifrons, punctatus, roquet). A sixth clade clustered A. nasofrontalis and A. pseudotigrinus with A. dissimilis from western Amazonia, A. calimae from the Andes, A. neblininus from the Guiana Shield, and two undescribed Andean taxa. We therefore define a sixth species series within Dactyloa: the neblininus series. Close phylogenetic relationships between highly disjunct, narrowly-distributed anoles suggest that patches of suitable habitat connected the southern Atlantic Forest to western South America during the Miocene, in agreement with the age of former connections between the central Andes and the Brazilian Shield as a result of Andean orogeny. The data also support the view of recurrent evolution (or loss) of a twig anole-like phenotype in mainland anoles, in

  9. Study on Phylogenetic Status of Javan Plover Bird (Charadrius, Charadriidae, Charadriiformes through DNA Barcoding Analysis

    Directory of Open Access Journals (Sweden)

    Hidayat Ashari

    2017-04-01

    Full Text Available Javan Plover named Charadrius javanicus is taxonomically under controversy and phylogenetically unresolved yet. Through an analysis of DNA barcode, this study aims (1 to confirm whether Javan Plover is separated species named Charadrius javanicus or a subspecies of C. alexandrinus which named C. a. javanicus and (2 to determine a relationship within this genus. Totally 666 bp DNA sequences of COI barcode gene were analyzed.  The results showed that a sequence divergence between Javan Plover and C. alexandrinus alexandrinus was only 1.2%, while sequence divergences between C.a.alexandrinus and others species, or between Javan Plover and others species were ranged from 9-12%.  Neighbour-joining (NJ and maximum-parsimony (MP analyses showed that all individuals of both Javan Plover and Kenith Plover were clustered together, and supported by 99 % and 100 % of bootstrap value in NJ and MP, respectively. This study tends to support the previous findings that Javan Plover was not a separated species named C. javanicus, but it was as a subspecies of C. alexandrinus; named C. a. javanicus. There were two groups of Plover in this study; (C. leschenaultii and C. javanicus + C.a.alexandrinus, and (C.dubius and C. melodus + C. semipalmatus. DNA barcoding analysis can give certainty taxonomic status of the bird. Then, this study has implication as a basic data that can be used to provide and support the planning of Javan plover conservation programs. 

  10. Using phylogenetic and ionomic relationships to predict the uptake of radionuclides by any plant species

    Energy Technology Data Exchange (ETDEWEB)

    Willey, Neil J.; Siasou, Eleni [Centre for Research In Biosciences, University of the West of England, Coldharbour Lane, Frenchay, Bristol BS16 1QY (United Kingdom)

    2014-07-01

    It is not practical to empirically derive soil-to-plant TFs for all soil-plant combinations that are important in radiological assessments, so predictions for a range of species on different soils types are frequently impossible because TFs are unknown. This severely hampers predictions of both doses to biota and of the contamination of a variety of food chains with radioisotopes. Compilations of TFs in themselves provide no fundamental understanding of the plant factors that control the soil-to-plant transfer of radionuclides and thus no method of prediction. We have developed methods for the meta-analyses of radionuclide transfer data that can be used to make predictions of the transfer of radionuclides into any plants species for which TFs do not exist based on an understand of the plant factors that control radionuclide uptake. There is no reason a priori to think that variation in TF should be constrained by species. The species is, essentially, a reproductive unit and variation in many plant traits, some of which might control radionuclide uptake, occurs at taxonomic levels above the species. In the last 15 years genomic information has transformed the understanding of the evolutionary relationships of the living world so that new 'trees of life' (phylogenies) are now available. Using a Residual Maximum Likelihood modeling procedure to compile a significant proportion of all existing TF data onto a single scale, we here present a synthesis of the influence of phylogeny on variation in soil-to-plant TFs for radioisotopes of Cs, Sr, Co, I, Tc, and S. We show that a significant proportion of variation in TF is associated with major branches of the phylogeny of angiosperms (flowering plants) so that knowledge of a species' position on the phylogeny can be used to make predictions of transfer relative to other species. These phylogenetically-based predictions of relative transfer to any species can be used to make absolute predictions to any species

  11. Molecular Phylogenetics: Concepts for a Newcomer.

    Science.gov (United States)

    Ajawatanawong, Pravech

    Molecular phylogenetics is the study of evolutionary relationships among organisms using molecular sequence data. The aim of this review is to introduce the important terminology and general concepts of tree reconstruction to biologists who lack a strong background in the field of molecular evolution. Some modern phylogenetic programs are easy to use because of their user-friendly interfaces, but understanding the phylogenetic algorithms and substitution models, which are based on advanced statistics, is still important for the analysis and interpretation without a guide. Briefly, there are five general steps in carrying out a phylogenetic analysis: (1) sequence data preparation, (2) sequence alignment, (3) choosing a phylogenetic reconstruction method, (4) identification of the best tree, and (5) evaluating the tree. Concepts in this review enable biologists to grasp the basic ideas behind phylogenetic analysis and also help provide a sound basis for discussions with expert phylogeneticists.

  12. Phylogenetic relationships in Epidendroideae (Orchidaceae), one of the great flowering plant radiations: progressive specialization and diversification.

    Science.gov (United States)

    Freudenstein, John V; Chase, Mark W

    2015-03-01

    The largest subfamily of orchids, Epidendroideae, represents one of the most significant diversifications among flowering plants in terms of pollination strategy, vegetative adaptation and number of species. Although many groups in the subfamily have been resolved, significant relationships in the tree remain unclear, limiting conclusions about diversification and creating uncertainty in the classification. This study brings together DNA sequences from nuclear, plastid and mitochrondrial genomes in order to clarify relationships, to test associations of key characters with diversification and to improve the classification. Sequences from seven loci were concatenated in a supermatrix analysis for 312 genera representing most of epidendroid diversity. Maximum-likelihood and parsimony analyses were performed on this matrix and on subsets of the data to generate trees and to investigate the effect of missing values. Statistical character-associated diversification analyses were performed. Likelihood and parsimony analyses yielded highly resolved trees that are in strong agreement and show significant support for many key clades. Many previously proposed relationships among tribes and subtribes are supported, and some new relationships are revealed. Analyses of subsets of the data suggest that the relatively high number of missing data for the full analysis is not problematic. Diversification analyses show that epiphytism is most strongly associated with diversification among epidendroids, followed by expansion into the New World and anther characters that are involved with pollinator specificity, namely early anther inflexion, cellular pollinium stalks and the superposed pollinium arrangement. All tested characters show significant association with speciation in Epidendroideae, suggesting that no single character accounts for the success of this group. Rather, it appears that a succession of key features appeared that have contributed to diversification, sometimes in

  13. Prediction and phylogenetic analysis of mammalian short interspersed elements (SINEs).

    Science.gov (United States)

    Rogozin, I B; Mayorov, V I; Lavrentieva, M V; Milanesi, L; Adkison, L R

    2000-09-01

    The presence of repetitive elements can create serious problems for sequence analysis, especially in the case of homology searches in nucleotide sequence databases. Repetitive elements should be treated carefully by using special programs and databases. In this paper, various aspects of SINE (short interspersed repetitive element) identification, analysis and evolution are discussed.

  14. Phylogenetic relationships of the intercellular fish pathogen Ichthyophonus hoferi and fungi, choanoflagellates and the rosette agent

    DEFF Research Database (Denmark)

    Spanggaard, Bettina; Skouboe, P.; Rossen, L.

    1996-01-01

    Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus Ichthyoph......Ichthyophonus hoferi Plehn and Mulsow, 1911 is thought to be one of the few pathogenic fungal infections of marine fish. The result of an attack is severe epizootics in herring stocks with drastic reduction in the population as a consequence. The exact phylogenetic position of the genus...... Ichthyophonus is not known. In the present study, a combination of molecular data, ultrastructure and biochemical characters were utilized to investigate the phylogeny of I. hoferi. The genomic DNA encoding the small subunit ribosomal RNA (18S rRNA) was amplified and sequenced. Comparisons with other eukaryotic...

  15. A gateway for phylogenetic analysis powered by grid computing featuring GARLI 2.0.

    Science.gov (United States)

    Bazinet, Adam L; Zwickl, Derrick J; Cummings, Michael P

    2014-09-01

    We introduce molecularevolution.org, a publicly available gateway for high-throughput, maximum-likelihood phylogenetic analysis powered by grid computing. The gateway features a garli 2.0 web service that enables a user to quickly and easily submit thousands of maximum likelihood tree searches or bootstrap searches that are executed in parallel on distributed computing resources. The garli web service allows one to easily specify partitioned substitution models using a graphical interface, and it performs sophisticated post-processing of phylogenetic results. Although the garli web service has been used by the research community for over three years, here we formally announce the availability of the service, describe its capabilities, highlight new features and recent improvements, and provide details about how the grid system efficiently delivers high-quality phylogenetic results. © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

  16. Aujeszky's disease in red fox (Vulpes vulpes): phylogenetic analysis unravels an unexpected epidemiologic link.

    Science.gov (United States)

    Caruso, Claudio; Dondo, Alessandro; Cerutti, Francesco; Masoero, Loretta; Rosamilia, Alfonso; Zoppi, Simona; D'Errico, Valeria; Grattarola, Carla; Acutis, Pier Luigi; Peletto, Simone

    2014-07-01

    We describe Aujeszky's disease in a female of red fox (Vulpes vulpes). Although wild boar (Sus scrofa) would be the expected source of infection, phylogenetic analysis suggested a domestic rather than a wild source of virus, underscoring the importance of biosecurity measures in pig farms to prevent contact with wild animals.

  17. Phylogenetic analysis of of Sarcocystis nesbitti (Coccidia: Sarcocystidae) suggests a snake as its probable definitive host

    Science.gov (United States)

    Sarcocystis nesbitti was first described by Mandour in 1969 from rhesus monkey muscle. Its definitive host remains unknown. 18SrRNA gene of Sarcocystis nesbitti was amplified, sequenced, and subjected to phylogenetic analysis. Among those congeners available for comparison, it shares closest affinit...

  18. Molecular and phylogenetic analysis of Anaplasma spp. in sheep and goats from six provinces of China.

    Science.gov (United States)

    Zhang, Yan; Lv, Yali; Zhang, Feifei; Zhang, Wenjing; Wang, Jinhong; Cui, Yanyan; Wang, Rongjun; Jian, Fuchun; Zhang, Longxian; Ning, Changshen

    2016-12-30

    Members of the genus Anaplasma are important emerging tick-borne pathogens in both humans and animals in tropical and subtropical areas. Here, we investigated the presence of Anaplasma spp. in 621 sheep and 710 goats from six provinces of China. Polymerase chain reaction (PCR) and DNA sequencing were conducted to determine the prevalence of Anaplasma (A.) phagocytophilum, A. ovis and A. bovis targeting the 16S ribosomal RNA or the major surface protein 4 gene. PCR revealed Anaplasma in 39.0% (240/621) of sheep and 45.5% (323/710) of goats. The most frequently detected species was A. ovis (88/621, 14.2% for sheep; 129/710, 18.2% for goats), followed by A. bovis (60/621, 9.7% for sheep; 74/710, 10.4% for goats) and A. phagocytophilum (33/621, 5.3% for sheep; 15/710, 2.1% for goats). Additionally, eight sheep and 20 goats were found to be infected with three pathogens simultaneously. DNA sequencing confirmed the presence of these three Anaplasma species in the investigated areas, and phylogenetic analysis indicated that there was geographic segregation to a certain extent, as well as a relationship between the host and cluster of A. ovis. The results of the present study provide valuable data that helps understand the epidemiology of anaplasmosis in ruminants from China.

  19. Phylogenetic analysis of the grape family (Vitaceae) based on three chloroplast markers.

    Science.gov (United States)

    Soejima, Akiko; Wen, Jun

    2006-02-01

    Seventy-nine species representing 12 genera of Vitaceae were sequenced for the trnL-F spacer, 37 of which were subsequently sequenced for the atpB-rbcL spacer and the rps16 intron. Phylogenetic analysis of the combined data provided a fairly robust phylogeny for Vitaceae. Cayratia, Tetrastigma, and Cyphostemma form a clade. Cyphostemma and Tetrastigma are each monophyletic, and Cayratia may be paraphyletic. Ampelopsis is paraphyletic with the African Rhoicissus and the South American Cissus striata nested within it. The pinnately leaved Ampelopsis form a subclade, and the simple and palmately leaved Ameplopsis constitutes another with both subclades containing Asian and American species. Species of Cissus from Asia and Central America are monophyletic, but the South American C. striata does not group with other Cissus species. The Asian endemic Nothocissus and Pterisanthes form a clade with Asian Ampelocissus, and A. javalensis from Central America is sister to this clade. Vitis is monophyletic and forms a larger clade with Ampelocissus, Pterisanthes, and Nothocissus. The eastern Asian and North American disjunct Parthenocissus forms a clade with Yua austro-orientalis, a species of a small newly recognized genus from China to eastern Himalaya. Vitaceae show complex multiple intercontinental relationships within the northern hemisphere and between northern and southern hemispheres.

  20. Maternal phylogenetic relationships and genetic variation among Arabian horse populations using whole mitochondrial DNA D-loop sequencing.

    Science.gov (United States)

    Khanshour, Anas M; Cothran, Ernest Gus

    2013-09-13

    Maternal inheritance is an essential point in Arabian horse population genetics and strains classification. The mitochondrial DNA (mtDNA) sequencing is a highly informative tool to investigate maternal lineages. We sequenced the whole mtDNA D-loop of 251 Arabian horses to study the genetic diversity and phylogenetic relationships of Arabian populations and to examine the traditional strain classification system that depends on maternal family lines using native Arabian horses from the Middle East. The variability in the upstream region of the D-loop revealed additional differences among the haplotypes that had identical sequences in the hypervariable region 1 (HVR1). While the American-Arabians showed relatively low diversity, the Syrian population was the most variable and contained a very rare and old haplogroup. The Middle Eastern horses had major genetic contributions to the Western horses and there was no clear pattern of differentiation among all tested populations. Our results also showed that several individuals from different strains shared a single haplotype, and individuals from a single strain were represented in clearly separated haplogroups. The whole mtDNA D-loop sequence was more powerful for analysis of the maternal genetic diversity in the Arabian horses than using just the HVR1. Native populations from the Middle East, such as Syrians, could be suggested as a hot spot of genetic diversity and may help in understanding the evolution history of the Arabian horse breed. Most importantly, there was no evidence that the Arabian horse breed has clear subdivisions depending on the traditional maternal based strain classification system.

  1. Continuous osteological characters in the reconstruction of phylogenetic relationships of the six Euro-Mediterranean mullet species (Mugilidae).

    Science.gov (United States)

    Antović, Ivanka

    2013-09-01

    Sixty-three continuous osteological characters (18 skull continuous characters and the total length of neurocranium, 45 continuous characters of 15 elements of the viscerodermal skeleton) were analyzed and included in the reconstruction of phylogenetic relationships of the six Euro-Mediterranean mullet species from the South Adriatic Sea: Mugil cephalus Linnaeus, 1758; Liza saliens Risso, 1810; Liza aurata Risso, 1810; Liza ramada Risso, 1826; Chelon labrosus Risso, 1826 and Oedalechilus labeo Cuvier, 1829. The study reveals that Sphyraenidae was separated clearly from Mugilidae, C. labrosus and three Liza species form a common cluster (L. ramada and L. saliens being the closest), while O. labeo and M. cephalus cluster together.

  2. Phylogenetic relationships of leopard frogs (Rana pipiens complex) from an isolated coastal mountain range in southern Sonora, Mexico.

    Science.gov (United States)

    Pfeiler, E; Markow, T A

    2008-10-01

    Mitochondrial DNA sequence data from the control region and 12S rRNA in leopard frogs from the Sierra El Aguaje of southern Sonora, Mexico, together with GenBank sequences, were used to infer taxonomic identity and provide phylogenetic hypotheses for relationships with other members of the Rana pipiens complex. We show that frogs from the Sierra El Aguaje belong to the Rana berlandieri subgroup, or Scurrilirana clade, of the R. pipiens group, and are most closely related to Rana magnaocularis from Nayarit, Mexico. We also provide further evidence that Rana magnaocularis and R. yavapaiensis are close relatives.

  3. Spatial and temporal heterogeneity in high-grade serous ovarian cancer: a phylogenetic analysis.

    Directory of Open Access Journals (Sweden)

    Roland F Schwarz

    2015-02-01

    Full Text Available The major clinical challenge in the treatment of high-grade serous ovarian cancer (HGSOC is the development of progressive resistance to platinum-based chemotherapy. The objective of this study was to determine whether intra-tumour genetic heterogeneity resulting from clonal evolution and the emergence of subclonal tumour populations in HGSOC was associated with the development of resistant disease.Evolutionary inference and phylogenetic quantification of heterogeneity was performed using the MEDICC algorithm on high-resolution whole genome copy number profiles and selected genome-wide sequencing of 135 spatially and temporally separated samples from 14 patients with HGSOC who received platinum-based chemotherapy. Samples were obtained from the clinical CTCR-OV03/04 studies, and patients were enrolled between 20 July 2007 and 22 October 2009. Median follow-up of the cohort was 31 mo (interquartile range 22-46 mo, censored after 26 October 2013. Outcome measures were overall survival (OS and progression-free survival (PFS. There were marked differences in the degree of clonal expansion (CE between patients (median 0.74, interquartile range 0.66-1.15, and dichotimization by median CE showed worse survival in CE-high cases (PFS 12.7 versus 10.1 mo, p = 0.009; OS 42.6 versus 23.5 mo, p = 0.003. Bootstrap analysis with resampling showed that the 95% confidence intervals for the hazard ratios for PFS and OS in the CE-high group were greater than 1.0. These data support a relationship between heterogeneity and survival but do not precisely determine its effect size. Relapsed tissue was available for two patients in the CE-high group, and phylogenetic analysis showed that the prevalent clonal population at clinical recurrence arose from early divergence events. A subclonal population marked by a NF1 deletion showed a progressive increase in tumour allele fraction during chemotherapy.This study demonstrates that quantitative measures of intra

  4. Phylogenetic analysis of the genus Anabaena based on PCR ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-12-15

    Dec 15, 2009 ... LTRR2. 5'- CTA TCA GGG ATT GAA AG-3'. Rasmussen and. Svenning, 1998 on a 1% agarose gel containing 0.5 X TBE (Tris Borate-EDTA) and. 0.5 µg/ml ethidium bromide. Data analysis. Fingerprints generated from different Anabaena species were compared and all bands were scored. The presence or ...

  5. Phenotypic Microdiversity and Phylogenetic Signal Analysis of Traits Related to Social Interaction in Bacillus spp. from Sediment Communities.

    Science.gov (United States)

    Rodríguez-Torres, María Dolores; Islas-Robles, África; Gómez-Lunar, Zulema; Delaye, Luis; Hernández-González, Ismael; Souza, Valeria; Travisano, Michael; Olmedo-Álvarez, Gabriela

    2017-01-01

    Understanding the relationship between phylogeny and predicted traits is important to uncover the dimension of the predictive power of a microbial composition approach. Numerous works have addressed the taxonomic composition of bacteria in communities, but little is known about trait heterogeneity in closely related bacteria that co-occur in communities. We evaluated a sample of 467 isolates from the Churince water system of the Cuatro Cienegas Basin (CCB), enriched for Bacillus spp. The 16S rRNA gene revealed a random distribution of taxonomic groups within this genus among 11 sampling sites. A subsample of 141 Bacillus spp. isolates from sediment, with seven well-represented species was chosen to evaluate the heterogeneity and the phylogenetic signal of phenotypic traits that are known to diverge within small clades, such as substrate utilization, and traits that are conserved deep in the lineage, such as prototrophy, swarming and biofilm formation. We were especially interested in evaluating social traits, such as swarming and biofilm formation, for which cooperation is needed to accomplish a multicellular behavior and for which there is little information from natural communities. The phylogenetic distribution of traits, evaluated by the Purvis and Fritz's D statistics approached a Brownian model of evolution. Analysis of the phylogenetic relatedness of the clusters of members sharing the trait using consenTRAIT algorithm, revealed more clustering and deeper phylogenetic signal for prototrophy, biofilm and swimming compared to the data obtained for substrate utilization. The explanation to the observed Brownian evolution of social traits could be either loss due to complete dispensability or to compensated trait loss due to the availability of public goods. Since many of the evaluated traits can be considered to be collective action traits, such as swarming, motility and biofilm formation, the observed microdiversity within taxonomic groups might be explained

  6. Molecular characterization and phylogenetic analysis of Fasciola gigantica from Nigeria.

    Science.gov (United States)

    Ichikawa-Seki, Madoka; Tokashiki, Minami; Opara, Maxwell Nwachukwu; Iroh, Gabriel; Hayashi, Kei; Kumar, Uday Mohanta; Itagaki, Tadashi

    2017-02-01

    Fasciola gigantica is considered the major pathogen causing fasciolosis in Africa; however, molecular characterization of this fluke has not been adequately elucidated. It is important to scientifically elucidate the dispersal history of F. gigantica by analyzing its genetic diversity. Fasciola flukes from Nigeria were analyzed using nuclear and mitochondrial DNA markers. A total of 172 Fasciola flukes collected from cattle were identified as F. gigantica because they displayed the F. gigantica fragment pattern in multiplex PCR for the nuclear marker, phosphoenolpyruvate carboxykinase (pepck). In total, 70 haplotypes were detected from Nigerian F. gigantica on the basis of the concatenated sequence of mitochondrial NADH dehydrogenase subunit 1 (nad1) and cytochrome c oxidase 1 (cox1). The index of neutrality (Fu's Fs) suggests rapid expansion of the Nigerian F. gigantica population. Although four haplogroups, Nigeria 1A, 1B, 2A, and 2B, were detected from Nigerian F. gigantica, a climate-specific genetic structure was not observed among F. gigantica populations from three agro-climatic regions (Sahel, Savannah, and Forest). This is probably because of the frequent transportation of livestock from one part of the country to the other. Nigeria 1A and 1B had close relationships with the Egyptian population of F. gigantica, whereas Nigeria 2A and 2B were comparatively related to the Zambian population. No haplotype was shared among the three countries, and it therefore is difficult to estimate the dispersal route of F. gigantica within the African continent. Copyright © 2016. Published by Elsevier Ireland Ltd.

  7. Higher level phylogenetic relationships within the bamboos (Poaceae: Bambusoideae) based on five plastid markers.

    Science.gov (United States)

    Kelchner, Scot A

    2013-05-01

    Bamboos are large perennial grasses of temperate and tropical forests worldwide. Two general growth forms exist: the economically and ecologically important woody bamboos (tribes Arundinarieae and Bambuseae), and the understory herbaceous bamboos (tribe Olyreae). Evolutionary relationships among the 1400+described species have been difficult to resolve with confidence. Comparative analysis of bamboo plastid (chloroplast) DNA has revealed three to five major lineages that show distinct biogeographic distributions. Taxon sampling across tribes and subtribes has been incomplete and most published data sets include a relatively small number of nucleotide characters. Branching order among lineages is often poorly supported, and in more than one study herbaceous bamboos form a clade within the woody bamboos. In this paper, the Bamboo Phylogeny Group presents the most complete phylogeny estimation to date of bamboo tribes and subtribes using 6.7 kb of coding and noncoding sequence data and 37 microstructural characters from the chloroplast genome. Quality of data is assessed, as is the possibility of long branch attraction, the degree of character conflict at key nodes in the tree, and the legitimacy of three alternative hypotheses of relationship. Four major plastid lineages are recognized: temperate woody, paleotropical woody, neotropical woody, and herbaceous bamboos. Woody bamboos are resolved as paraphyletic with respect to Olyreae but SH tests cannot reject monophyly of woody species (Arundinarieae+Bambuseae). Published by Elsevier Inc.

  8. First phylogenetic analysis of Ehrlichia canis in dogs and ticks from Mexico. Preliminary study

    Directory of Open Access Journals (Sweden)

    Carolina G. Sosa-Gutiérrez

    2016-09-01

    Full Text Available Objective. Phylogenetic characterization of Ehrlichia canis in dogs naturally infected and ticks, diagnosed by PCR and sequencing of 16SrRNA gene; compare different isolates found in American countries. Materials and methods. Were collected Blood samples from 139 dogs with suggestive clinical manifestations of this disease and they were infested with ticks; part of 16SrRNA gene was sequenced and aligned, with 17 sequences reported in American countries. Two phylogenetic trees were constructed using the Maximum likelihood method, and Maximum parsimony. Results. They were positive to E. canis 25/139 (18.0% dogs and 29/139 (20.9% ticks. The clinical manifestations presented were fever, fatigue, depression and vomiting. Rhipicephalus sanguineus Dermacentor variabilis and Haemaphysalis leporis-palustris ticks were positive for E. canis. Phylogenetic analysis showed that the sequences of dogs and ticks in Mexico form a third group diverging of sequences from South America and USA. Conclusions. This is the first phylogenetic analysis of E. canis in Mexico. There are differences in the sequences of Mexico with those reported in South America and USA. This research lays the foundation for further study of genetic variability.

  9. Co-circulating serotypes in a dengue fever outbreak: Differential hematological profiles and phylogenetic relationships among viruses.

    Science.gov (United States)

    Carmo, Andreia Moreira Dos Santos; Suzuki, Rodrigo Buzinaro; Cabral, Aline Diniz; Costa, Renata Torres da; Massari, Gabriela Pena; Riquena, Michele Marcondes; Fracasso, Helio Augusto Alves; Eterovic, Andre; Marcili, Arlei; Sperança, Márcia Aparecida

    2017-05-01

    Dengue virus, represented by four distinct, genetically diverse serotypes, is the etiologic agent of asymptomatic to severe hemorrhagic diseases. The spatiotemporal dynamics of dengue serotypes and its association to specific diseases vary among the different regions worldwide. By 2007, and in São Paulo State, Brazil, dengue-case concentration in urban centers had changed to increased incidence in small- and medium-sized towns, the case of Marília. The aim of this article was to distinguish dengue serotypes circulating during the 2007 Marília outbreak and define their association to demographic and hematological patient profiles, as well as the phylogenetic relationships among the different viruses. PCR amplicons corresponding to the junction of capsid and dengue pre-membrane encoding genes, obtained from dengue serologically positive patients, were sequenced. Hematological and demographic data of patients with different Dengue serotypes were evaluated by univariate and bivariate statistics. Dengue PCR sequences were used in phylogenetic relationships analyzed for maximum parsimony. Molecular typing confirmed co-circulation of the dengue serotypes 1 (DENV1) and 3 (DENV3), which presented divergent correlation patterns with regard to hematological descriptors. The increase in atypical lymphocytes, a likely indication of virus load, could be significantly associated to a decrease in leukocyte counts in the DENV3 group and platelet in the DENV1. Phylogenetic reconstitution revealed the introduction of DENV1 from northern Brazil and local divergence of DENV3 by either microevolution or viral introduction from other geographical regions or both. Dengue dynamics showed regional molecular-epidemiologic specificity, which has important implications for introduction of vaccines, disease management, and transmission control. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Phylogenetic analysis of P5 P-type ATPases, a eukaryotic lineage of secretory pathway pumps

    DEFF Research Database (Denmark)

    Møller, Annette; Asp, Torben; Holm, Preben Bach

    2008-01-01

    prokaryotic genome. Based on a protein alignment we could group the P5 ATPases into two subfamilies, P5A and P5B that, based on the number of negative charges in conserved trans-membrane segment 4, are likely to have different ion specificities. P5A ATPases are present in all eukaryotic genomes sequenced so......Eukaryotes encompass a remarkable variety of organisms and unresolved lineages. Different phylogenetic analyses have lead to conflicting conclusions as to the origin and associations between lineages and species. In this work, we investigated evolutionary relationship of a family of cation pumps...... exclusive for the secretory pathway of eukaryotes by combining the identification of lineage-specific genes with phylogenetic evolution of common genes. Sequences of P5 ATPases, which are regarded to be cation pumps in the endoplasmic reticulum (ER), were identified in all eukaryotic lineages but not in any...

  11. A phylogenetic analysis of rissooidean and cingulopsoidean families (Gastropoda: Caenogastropoda).

    Science.gov (United States)

    Criscione, Francesco; Ponder, Winston Frank

    2013-03-01

    The Rissooidea is one of the largest and most diverse molluscan superfamilies, with 23 recognized Recent families including marine, freshwater and terrestrial members. The Cingulopsoidea are a group of three marine families previously included within the Rissooidea. A previous molecular analysis including two rissooideans and one cingulopsoidean, indicated the possibility that the Rissooidea is at least diphyletic. We use new molecular data to investigate the polyphyly of Rissooidea and test the monophyly of Cingulopsoidea with a greatly increased taxon set. This study includes the greatest sampling to date with 43 species of 14 families of Rissooidea and all families of Cingulopsoidea. Bayesian and maximum likelihood analyses of 16S and 28S show that there are two major clades encompassing taxa previously included in Rissooidea. These are the Rissooidea s.s. containing Rissoidae and Barleeiidae and the Truncatelloidea containing Anabathridae, Assimineidae, Falsicingulidae, Truncatellidae, Pomatiopsidae, Hydrobiidae s.l., Hydrococcidae, Stenothyridae, Calopiidae, Clenchiellidae, Caecidae, Tornidae, and Iravadiidae. Rissoidae is not monophyletic, with Lironoba grouping with Emblanda (Emblandidae) and Rissoina forming a separate clade with Barleeiidae. Iravadiidae is not monophyletic, with Nozeba being sister to the Tornidae. Tatea, usually included within Hydrobiidae, is distinct from that family and Nodulus, previously included in Anabathridae, groups with the hydrobiids. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Phylogenetic analysis of Hungarian goose parvovirus isolates and vaccine strains.

    Science.gov (United States)

    Tatár-Kis, Tímea; Mató, Tamás; Markos, Béla; Palya, Vilmos

    2004-08-01

    Polymerase chain reaction and sequencing were used to analyse goose parvovirus field isolates and vaccine strains. Two fragments of the genome were amplified. Fragment "A" represents a region of VP3 gene, while fragment "B" represents a region upstream of the VP3 gene, encompassing part of the VP1 gene. In the region of fragment "A" the deduced amino acid sequence of the strains was identical, therefore differentiation among strains could be done only at the nucleotide level, which resulted in the formation of three groups: Hungarian, West-European and Asian strains. In the region of fragment "B", separation of groups could be done by both nucleotide and deduced amino acid sequence level. The nucleotide sequences resulted in the same groups as for fragment "A" but with a different clustering pattern among the Hungarian strains. Within the "Hungarian" group most of the recent field isolates fell into one cluster, very closely related or identical to each other, indicating a very slow evolutionary change. The attenuated strains and field isolates from 1979/80 formed a separate cluster. When vaccine strains and field isolates were compared, two specific amino acid differences were found that can be considered as possible markers for vaccinal strains. Sequence analysis of fragment "B" seems to be a suitable method for differentiation of attenuated vaccine strains from virulent strains. Copyright 2004 Houghton Trust Ltd

  13. Phylogenetic inertia and Darwin's higher law.

    Science.gov (United States)

    Shanahan, Timothy

    2011-03-01

    The concept of 'phylogenetic inertia' is routinely deployed in evolutionary biology as an alternative to natural selection for explaining the persistence of characteristics that appear sub-optimal from an adaptationist perspective. However, in many of these contexts the precise meaning of 'phylogenetic inertia' and its relationship to selection are far from clear. After tracing the history of the concept of 'inertia' in evolutionary biology, I argue that treating phylogenetic inertia and natural selection as alternative explanations is mistaken because phylogenetic inertia is, from a Darwinian point of view, simply an expected effect of selection. Although Darwin did not discuss 'phylogenetic inertia,' he did assert the explanatory priority of selection over descent. An analysis of 'phylogenetic inertia' provides a perspective from which to assess Darwin's view. Copyright © 2010 Elsevier Ltd. All rights reserved.

  14. Phylogenetic analysis of the lux operon distinguishes two evolutionarily distinct clades of Photobacterium leiognathi.

    Science.gov (United States)

    Ast, Jennifer C; Dunlap, Paul V

    2004-05-01

    The luminous marine bacterium Photobacterium mandapamensis was synonymized several years ago with Photobacterium leiognathi based on a high degree of phenotypic and genetic similarity. To test the possibility that P. leiognathi as now formulated, however, actually contains two distinct bacterial groups reflecting the earlier identification of P. mandapamensis and P. leiognathi as separate species, we compared P. leiognathi strains isolated from light-organ symbiosis with leiognathid fishes (i.e., ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1) with strains from seawater originally described as P. mandapamensis and later synonymized as P. leiognathi (i.e., ATCC 27561(T) and ATCC 33981) and certain strains initially identified as P. leiognathi (i.e., PL-721, PL-741, 554). Analysis of the 16S rRNA and gyrB genes did not resolve distinct clades, affirming a close relationship among these strains. However, strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 were found to bear a luxF gene in the lux operon ( luxABFE), whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 lack this gene ( luxABE). Phylogenetic analysis of the luxAB(F)E region confirmed this distinction. Furthermore, ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 all produced a higher level of luminescence on high-salt medium, as previously described for PL-721, whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 all produced a higher level of luminescence on low-salt medium, a characteristic of P. leiognathi from leiognathid fish light organs. These results demonstrate that P. leiognathi contains two evolutionarily and phenotypically distinct clades, P. leiognathi subsp. leiognathi (strains ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1), and P. leiognathi subsp. mandapamensis (strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554).

  15. Complete genome sequencing and phylogenetic analysis of dengue type 1 virus isolated from Jeddah, Saudi Arabia.

    Science.gov (United States)

    Azhar, Esam I; Hashem, Anwar M; El-Kafrawy, Sherif A; Abol-Ela, Said; Abd-Alla, Adly M M; Sohrab, Sayed Sartaj; Farraj, Suha A; Othman, Norah A; Ben-Helaby, Huda G; Ashshi, Ahmed; Madani, Tariq A; Jamjoom, Ghazi

    2015-01-16

    Dengue viruses (DENVs) are mosquito-borne viruses which can cause disease ranging from mild fever to severe dengue infection. These viruses are endemic in several tropical and subtropical regions. Multiple outbreaks of DENV serotypes 1, 2 and 3 (DENV-1, DENV-2 and DENV-3) have been reported from the western region in Saudi Arabia since 1994. Strains from at least two genotypes of DENV-1 (Asia and America/Africa genotypes) have been circulating in western Saudi Arabia until 2006. However, all previous studies reported from Saudi Arabia were based on partial sequencing data of the envelope (E) gene without any reports of full genome sequences for any DENV serotypes circulating in Saudi Arabia. Here, we report the isolation and the first complete genome sequence of a DENV-1 strain (DENV-1-Jeddah-1-2011) isolated from a patient from Jeddah, Saudi Arabia in 2011. Whole genome sequence alignment and phylogenetic analysis showed high similarity between DENV-1-Jeddah-1-2011 strain and D1/H/IMTSSA/98/606 isolate (Asian genotype) reported from Djibouti in 1998. Further analysis of the full envelope gene revealed a close relationship between DENV-1-Jeddah-1-2011 strain and isolates reported between 2004-2006 from Jeddah as well as recent isolates from Somalia, suggesting the widespread of the Asian genotype in this region. These data suggest that strains belonging to the Asian genotype might have been introduced into Saudi Arabia long before 2004 most probably by African pilgrims and continued to circulate in western Saudi Arabia at least until 2011. Most importantly, these results indicate that pilgrims from dengue endemic regions can play an important role in the spread of new DENVs in Saudi Arabia and the rest of the world. Therefore, availability of complete genome sequences would serve as a reference for future epidemiological studies of DENV-1 viruses.

  16. Prokaryotic diversity, composition structure, and phylogenetic analysis of microbial communities in leachate sediment ecosystems.

    Science.gov (United States)

    Liu, Jingjing; Wu, Weixiang; Chen, Chongjun; Sun, Faqian; Chen, Yingxu

    2011-09-01

    In order to obtain insight into the prokaryotic diversity and community in leachate sediment, a culture-independent DNA-based molecular phylogenetic approach was performed with archaeal and bacterial 16S rRNA gene clone libraries derived from leachate sediment of an aged landfill. A total of 59 archaeal and 283 bacterial rDNA phylotypes were identified in 425 archaeal and 375 bacterial analyzed clones. All archaeal clones distributed within two archaeal phyla of the Euryarchaeota and Crenarchaeota, and well-defined methanogen lineages, especially Methanosaeta spp., are the most numerically dominant species of the archaeal community. Phylogenetic analysis of the bacterial library revealed a variety of pollutant-degrading and biotransforming microorganisms, including 18 distinct phyla. A substantial fraction of bacterial clones showed low levels of similarity with any previously documented sequences and thus might be taxonomically new. Chemical characteristics and phylogenetic inferences indicated that (1) ammonium-utilizing bacteria might form consortia to alleviate or avoid the negative influence of high ammonium concentration on other microorganisms, and (2) members of the Crenarchaeota found in the sediment might be involved in ammonium oxidation. This study is the first to report the composition of the microbial assemblages and phylogenetic characteristics of prokaryotic populations extant in leachate sediment. Additional work on microbial activity and contaminant biodegradation remains to be explored.

  17. Phylogenetic Analysis of Seven WRKY Genes across the Palm Subtribe Attaleinae (Arecaceae) Identifies Syagrus as Sister Group of the Coconut

    Science.gov (United States)

    Meerow, Alan W.; Noblick, Larry; Borrone, James W.; Couvreur, Thomas L. P.; Mauro-Herrera, Margarita; Hahn, William J.; Kuhn, David N.; Nakamura, Kyoko; Oleas, Nora H.; Schnell, Raymond J.

    2009-01-01

    Background The Cocoseae is one of 13 tribes of Arecaceae subfam. Arecoideae, and contains a number of palms with significant economic importance, including the monotypic and pantropical Cocos nucifera L., the coconut, the origins of which have been one of the “abominable mysteries” of palm systematics for decades. Previous studies with predominantly plastid genes weakly supported American ancestry for the coconut but ambiguous sister relationships. In this paper, we use multiple single copy nuclear loci to address the phylogeny of the Cocoseae subtribe Attaleinae, and resolve the closest extant relative of the coconut. Methodology/Principal Findings We present the results of combined analysis of DNA sequences of seven WRKY transcription factor loci across 72 samples of Arecaceae tribe Cocoseae subtribe Attaleinae, representing all genera classified within the subtribe, and three outgroup taxa with maximum parsimony, maximum likelihood, and Bayesian approaches, producing highly congruent and well-resolved trees that robustly identify the genus Syagrus as sister to Cocos and resolve novel and well-supported relationships among the other genera of the Attaleinae. We also address incongruence among the gene trees with gene tree reconciliation analysis, and assign estimated ages to the nodes of our tree. Conclusions/Significance This study represents the as yet most extensive phylogenetic analyses of Cocoseae subtribe Attaleinae. We present a well-resolved and supported phylogeny of the subtribe that robustly indicates a sister relationship between Cocos and Syagrus. This is not only of biogeographic interest, but will also open fruitful avenues of inquiry regarding evolution of functional genes useful for crop improvement. Establishment of two major clades of American Attaleinae occurred in the Oligocene (ca. 37 MYBP) in Eastern Brazil. The divergence of Cocos from Syagrus is estimated at 35 MYBP. The biogeographic and morphological congruence that we see for

  18. Piscine reovirus: Genomic and molecular phylogenetic analysis from farmed and wild salmonids collected on the Canada/US Pacific Coast

    Science.gov (United States)

    Siah, Ahmed; Morrison, Diane B.; Fringuelli, Elena; Savage, Paul S.; Richmond, Zina; Purcell, Maureen K.; Johns, Robert; Johnson, Stewart C.; Sakasida, Sonja M.

    2015-01-01

    Piscine reovirus (PRV) is a double stranded non-enveloped RNA virus detected in farmed and wild salmonids. This study examined the phylogenetic relationships among different PRV sequence types present in samples from salmonids in Western Canada and the US, including Alaska (US), British Columbia (Canada) and Washington State (US). Tissues testing positive for PRV were partially sequenced for segment S1, producing 71 sequences that grouped into 10 unique sequence types. Sequence analysis revealed no identifiable geographical or temporal variation among the sequence types. Identical sequence types were found in fish sampled in 2001, 2005 and 2014. In addition, PRV positive samples from fish derived from Alaska, British Columbia and Washington State share identical sequence types. Comparative analysis of the phylogenetic tree indicated that Canada/US Pacific Northwest sequences formed a subgroup with some Norwegian sequence types (group II), distinct from other Norwegian and Chilean sequences (groups I, III and IV). Representative PRV positive samples from farmed and wild fish in British Columbia and Washington State were subjected to genome sequencing using next generation sequencing methods. Individual analysis of each of the 10 partial segments indicated that the Canadian and US PRV sequence types clustered separately from available whole genome sequences of some Norwegian and Chilean sequences for all segments except the segment S4. In summary, PRV was genetically homogenous over a large geographic distance (Alaska to Washington State), and the sequence types were relatively stable over a 13 year period.

  19. Assessing the Goodness of Fit of Phylogenetic Comparative Methods: A Meta-Analysis and Simulation Study.

    Directory of Open Access Journals (Sweden)

    Dwueng-Chwuan Jhwueng

    Full Text Available Phylogenetic comparative methods (PCMs have been applied widely in analyzing data from related species but their fit to data is rarely assessed.Can one determine whether any particular comparative method is typically more appropriate than others by examining comparative data sets?I conducted a meta-analysis of 122 phylogenetic data sets found by searching all papers in JEB, Blackwell Synergy and JSTOR published in 2002-2005 for the purpose of assessing the fit of PCMs. The number of species in these data sets ranged from 9 to 117.I used the Akaike information criterion to compare PCMs, and then fit PCMs to bivariate data sets through REML analysis. Correlation estimates between two traits and bootstrapped confidence intervals of correlations from each model were also compared.For phylogenies of less than one hundred taxa, the Independent Contrast method and the independent, non-phylogenetic models provide the best fit.For bivariate analysis, correlations from different PCMs are qualitatively similar so that actual correlations from real data seem to be robust to the PCM chosen for the analysis. Therefore, researchers might apply the PCM they believe best describes the evolutionary mechanisms underlying their data.

  20. Phylogenetic Relationships between Four Salix L. Species Based on DArT Markers

    Directory of Open Access Journals (Sweden)

    Jerzy A. Przyborowski

    2013-12-01

    Full Text Available The objectives of this study were to evaluate the usefulness of DArT markers in genotypic identification of willow species and describe genetic relationships between four willow species: Salix viminalis, S. purpurea, S. alba and S. triandra. The experimental plant material comprised 53 willow genotypes of these four species, which are popularly grown in Poland. DArT markers seem to identify Salix species with a high degree of accuracy. As a result, the examined species were divided into four distinct groups which corresponded to the four analyzed species. In our study, we observed that S. triandra was very different genetically from the other species, including S. alba which is generally classified into the same subgenus of Salix. The above corroborates the findings of other authors who relied on molecular methods to reveal that the classification of S. triandra to the subgenus Salix was erroneous. The Principal Coordinate Analysis (PCoA and the neighbor-joining dendrogram also confirmed the clear division of the studied willow genotypes into four clusters corresponding to individual species. This confirmed the usefulness of DArT markers in taxonomic analyses and identification of willow species.

  1. Analysis of complete mitochondrial genome sequences increases phylogenetic resolution of bears (Ursidae, a mammalian family that experienced rapid speciation

    Directory of Open Access Journals (Sweden)

    Ryder Oliver A

    2007-10-01

    Full Text Available Abstract Background Despite the small number of ursid species, bear phylogeny has long been a focus of study due to their conservation value, as all bear genera have been classified as endangered at either the species or subspecies level. The Ursidae family represents a typical example of rapid evolutionary radiation. Previous analyses with a single mitochondrial (mt gene or a small number of mt genes either provide weak support or a large unresolved polytomy for ursids. We revisit the contentious relationships within Ursidae by analyzing complete mt genome sequences and evaluating the performance of both entire mt genomes and constituent mtDNA genes in recovering a phylogeny of extremely recent speciation events. Results This mitochondrial genome-based phylogeny provides strong evidence that the spectacled bear diverged first, while within the genus Ursus, the sloth bear is the sister taxon of all the other five ursines. The latter group is divided into the brown bear/polar bear and the two black bears/sun bear assemblages. These findings resolve the previous conflicts between trees using partial mt genes. The ability of different categories of mt protein coding genes to recover the correct phylogeny is concordant with previous analyses for taxa with deep divergence times. This study provides a robust Ursidae phylogenetic framework for future validation by additional independent evidence, and also has significant implications for assisting in the resolution of other similarly difficult phylogenetic investigations. Conclusion Identification of base composition bias and utilization of the combined data of whole mitochondrial genome sequences has allowed recovery of a strongly supported phylogeny that is upheld when using multiple alternative outgroups for the Ursidae, a mammalian family that underwent a rapid radiation since the mid- to late Pliocene. It remains to be seen if the reliability of mt genome analysis will hold up in studies of other

  2. Complete Mitochondrial Genome of the Red Fox (Vuples vuples) and Phylogenetic Analysis with Other Canid Species.

    Science.gov (United States)

    Zhong, Hua-Ming; Zhang, Hong-Hai; Sha, Wei-Lai; Zhang, Cheng-De; Chen, Yu-Cai

    2010-04-01

    The whole mitochondrial genome sequence of red fox (Vuples vuples) was determined. It had a total length of 16 723 bp. As in most mammal mitochondrial genome, it contained 13 protein coding genes, two ribosome RNA genes, 22 transfer RNA genes and one control region. The base composition was 31.3% A, 26.1% C, 14.8% G and 27.8% T, respectively. The codon usage of red fox, arctic fox, gray wolf, domestic dog and coyote followed the same pattern except for an unusual ATT start codon, which initiates the NADH dehydrogenase subunit 3 gene in the red fox. A long tandem repeat rich in AC was found between conserved sequence block 1 and 2 in the control region. In order to confirm the phylogenetic relationships of red fox to other canids, phylogenetic trees were reconstructed by neighbor-joining and maximum parsimony methods using 12 concatenated heavy-strand protein-coding genes. The result indicated that arctic fox was the sister group of red fox and they both belong to the red fox-like clade in family Canidae, while gray wolf, domestic dog and coyote belong to wolf-like clade. The result was in accordance with existing phylogenetic results.

  3. Phylogenetic analysis of New Zealand earthworms (Oligochaeta: Megascolecidae) reveals ancient clades and cryptic taxonomic diversity.

    Science.gov (United States)

    Buckley, Thomas R; James, Sam; Allwood, Julia; Bartlam, Scott; Howitt, Robyn; Prada, Diana

    2011-01-01

    We have constructed the first ever phylogeny for the New Zealand earthworm fauna (Megascolecinae and Acanthodrilinae) including representatives from other major continental regions. Bayesian and maximum likelihood phylogenetic trees were constructed from 427 base pairs from the mitochondrial large subunit (16S) rRNA gene and 661 base pairs from the nuclear large subunit (28S) rRNA gene. Within the Acanthodrilinae we were able to identify a number of well-supported clades that were restricted to continental landmasses. Estimates of nodal support for these major clades were generally high, but relationships among clades were poorly resolved. The phylogenetic analyses revealed several independent lineages in New Zealand, some of which had a comparable phylogenetic depth to monophyletic groups sampled from Madagascar, Africa, North America and Australia. These results are consistent with at least some of these clades having inhabited New Zealand since rifting from Gondwana in the Late Cretaceous. Within the New Zealand Acanthodrilinae, major clades tended to be restricted to specific regions of New Zealand, with the central North Island and Cook Strait representing major biogeographic boundaries. Our field surveys of New Zealand and subsequent identification has also revealed extensive cryptic taxonomic diversity with approximately 48 new species sampled in addition to the 199 species recognized by previous authors. Our results indicate that further survey and taxonomic work is required to establish a foundation for future biogeographic and ecological research on this vitally important component of the New Zealand biota. Copyright © 2010 Elsevier Inc. All rights reserved.

  4. Short communication. Genotyping and phylogenetic analysis of bovine viral diarrhea virus (BVDV) isolates in Kosovo

    OpenAIRE

    Izedin Goga; Kristaq Berxholi; Beqe Hulaj; Driton Sylejmani; Boris Yakobson; Yehuda Stram

    2014-01-01

    Three serum samples positive in Antigen ELISA BVDV have been tested to characterise genetic diversity of bovine viral diarrhea virus (BVDV) in Kosovo. Samples were obtained in 2011 from heifers and were amplified by reverse transcription-polymerase chain reaction, sequenced and analysed by computer-assisted phylogenetic analysis. Amplified products and nucleotide sequence showed that all 3 isolates belonged to BVDV 1 genotype and 1b sub genotype. These results enrich the extant knowledge of B...

  5. Phylogenetic Analysis of Dengue Virus in Bangkalan, Madura Island, East Java Province, Indonesia.

    Science.gov (United States)

    Sucipto, Teguh Hari; Kotaki, Tomohiro; Mulyatno, Kris Cahyo; Churrotin, Siti; Labiqah, Amaliah; Soegijanto, Soegeng; Kameoka, Masanori

    2018-01-01

    Dengue virus (DENV) infection is a major health issue in tropical and subtropical areas. Indonesia is one of the biggest dengue endemic countries in the world. In the present study, the phylogenetic analysis of DENV in Bangkalan, Madura Island, Indonesia, was performed in order to obtain a clearer understanding of its dynamics in this country. A total of 359 blood samples from dengue-suspected patients were collected between 2012 and 2014. Serotyping was conducted using a multiplex Reverse Transcriptase-Polymerase Chain Reaction and a phylogenetic analysis of E gene sequences was performed using the Bayesian Markov chain Monte Carlo (MCMC) method. 17 out of 359 blood samples (4.7%) were positive for the isolation of DENV. Serotyping and the phylogenetic analysis revealed the predominance of DENV-1 genotype I (9/17, 52.9%), followed by DENV-2 Cosmopolitan type (7/17, 41.2%) and DENV-3 genotype I (1/17, 5.9%) . DENV-4 was not isolated. The Madura Island isolates showed high nucleotide similarity to other Indonesian isolates, indicating frequent virus circulation in Indonesia. The results of the present study highlight the importance of continuous viral surveillance in dengue endemic areas in order to obtain a clearer understanding of the dynamics of DENV in Indonesia.

  6. New insights on the phylogenetic relationships among the traditional Philodendron subgenera and the other groups of the Homalomena clade (Araceae).

    Science.gov (United States)

    Vasconcelos, Santelmo; Soares, Maria de Lourdes; Sakuragui, Cássia M; Croat, Thomas B; Oliveira, Guilherme; Benko-Iseppon, Ana M

    2018-05-19

    Philodendron (Araceae) is one of the largest Neotropical plant genera, with approximately 500 species and at least 1000 species predicted. There is a considerable ecological diversity in the group, although most species occur in the humid forests of tropical America. Despite being relatively well-studied in taxonomic analyses, the relationships among the traditional morphological groups of the genus are not well-established, mainly regarding the three traditional subgenera, referred here as Philodendron sensu lato (s.l.), P. subg. Pteromischum, P. subg. Philodendron and P. subg. Meconostigma, which was recently recognized as a separate genus, Thaumatophyllum. Therefore, the present work evaluates the phylogenetic position and the monophyly of Philodendron s.l. and its three main subdivisions, and the sister groups within the Homalomena clade, which also includes the Neotropical genus Adelonema, the two Asian genera Homalomena and Furtadoa, and the two African genera Cercestis and Culcasia, by means of molecular phylogenetic approaches including chloroplast DNA (atpF-atpH, rpl32-trnL, trnQ-5'-rps16 and trnV-ndhC) and nuclear (ITS2) markers. The monophyly of Philodendron s.l. and its three lineages is confirmed and our analyses corroborate previous morphologic data indicating Thaumatophyllum as sister to the clade formed by P. subg. Pteromischum and P. subg. Philodendron. Copyright © 2018 Elsevier Inc. All rights reserved.

  7. Phylogenetic relationships among zooxanthellae (Symbiodinium) associated to excavating sponges (Cliona spp.) reveal an unexpected lineage in the Caribbean.

    Science.gov (United States)

    Granados, C; Camargo, C; Zea, S; Sánchez, J A

    2008-11-01

    Phylogenetic relationships of symbiotic dinoflagellate lineages, distributed in all tropical and subtropical seas, suggest strategies for long distance dispersal but at the same time strong host specialization. Zooxanthellae (Symbiodinium: Dinophyta), which are associated to diverse shallow-water cnidarians, also engage in symbioses with some sponge species of the genus Cliona. In the Caribbean, zooxanthellae-bearing Cliona has recently become abundant due to global warming, overfishing, and algae abundance. Using molecular techniques, the symbionts from five excavating species (Clionacaribbaea, C. tenuis, C. varians, C. aprica and C. laticavicola) from the southern and southwestern Caribbean were surveyed. Several DNA sequence regions were used in order to confirm zooxanthellae identity; 18S rDNA, domain V of chloroplast large subunit (cp23S), internal transcribed spacer 2 (ITS2), and ITS2 secondary structure. Sequence analyses corroborated the presence of three zooxanthellae clades: A, B, and G. Presence of clades A and B in common boring sponges of the Caribbean fit with the general pattern of the province. The discovery of clade G for the first time in any organism of the Atlantic Ocean leads us to consider this unusual finding as a phylogenetic relict through common ancestors of sponge clades or an invasion of the sponge from the Indo-Pacific.

  8. The amino acid sequences of two alpha chains of hemoglobins from Komodo dragon Varanus komodoensis and phylogenetic relationships of amniotes.

    Science.gov (United States)

    Fushitani, K; Higashiyama, K; Moriyama, E N; Imai, K; Hosokawa, K

    1996-09-01

    To elucidate phylogenetic relationships among amniotes and the evolution of alpha globins, hemoglobins were analyzed from the Komodo dragon (Komodo monitor lizard) Varanus komodoensis, the world's largest extant lizard, inhabiting Komodo Islands, Indonesia. Four unique globin chains (alpha A, alpha D, beta B, and beta C) were isolated in an equal molar ratio by high performance liquid chromatography from the hemolysate. The amino acid sequences of two alpha chains were determined. The alpha D chain has a glutamine at E7 as does an alpha chain of a snake, Liophis miliaris, but the alpha A chain has a histidine at E7 like the majority of hemoglobins. Phylogenetic analyses of 19 globins including two alpha chains of Komodo dragon and ones from representative amniotes showed the following results: (1) The a chains of squamates (snakes and lizards), which have a glutamine at E7, are clustered with the embryonic alpha globin family, which typically includes the alpha D chain from birds; (2) birds form a sister group with other reptiles but not with mammals; (3) the genes for embryonic and adult types of alpha globins were possibly produced by duplication of the ancestral alpha gene before ancestral amniotes diverged, indicating that each of the present amniotes might carry descendants of the two types of alpha globin genes; (4) squamates first split off from the ancestor of other reptiles and birds.

  9. Unveiling the Identity of Wenwan Walnuts and Phylogenetic Relationships of Asian Juglans Species Using Restriction Site-Associated DNA-Sequencing

    Directory of Open Access Journals (Sweden)

    Xian-Yun Mu

    2017-10-01

    Full Text Available Juglans species have considerable ecological and economic value worldwide. In China, Wenwan walnuts have been collected by aristocrats and noblemen for more than 2000 years. As a diversity center of Asian Juglans, five species are widely distributed in China. The most famous of these is Mahetao (J. hopeiensis, which is an uncharacterized species that is mostly cultivated. Wild J. hopeiensis individuals are very rare and are endemic to Hebei Province. Because of the minimal variations in previously used molecular markers and the heterogeneity between chloroplast and nuclear genomes, determining the phylogenetic relationships among the Juglans species has been challenging, and has hindered subsequent evolutionary inferences. In this study, we collected enough materials for both cultivated and wild Mahetao to construct well-resolved phylogenetic trees for Asian Juglans species. We used a high-throughput genome-wide restriction site-associated DNA sequencing method. Consequently, the identity of J. hopeiensis has been clearly resolved. Our results indicate that J. hopeiensis is a hybrid of J. regia and J. mandshurica. However, J. hopeiensis, J. regia and J. sigillata should be considered as a single species from section Juglans. Additionally, J. ailantifolia, J. cathayensis, and J. mandshurica likely represent one species from section Cardiocaryon according to morphological and molecular studies. These results are supported by population structure analysis and morphological comparison. We propose that J. hopeiensis trees growing in the wild should be conserved because of the economic value of their nuts. These trees may be of particular importance to impoverished communities. Furthermore, they may serve as a valuable genetic resource relevant for enhancing the production of edible walnuts. The 2b-RAD method is a viable option for future phylogenetic studies of Juglans species as well as other plant species.

  10. Phylogenetic relationships in the Festuca-Lolium complex (Loliinae; Poaceae: New insights from chloroplast sequences

    Directory of Open Access Journals (Sweden)

    Yajuan Cheng

    2016-07-01

    Full Text Available The species within the Lolium/Festuca grass complex have dispersed and colonized large areas of temperate global grasslands both naturally and by human intervention. The species within this grass complex represent some of the most important grass species both for amenity and agricultural use worldwide. There has been renewed interest by grass breeders in producing hybrid combinations between these species and several countries now market Festulolium varieties as a combination of genes from both genera. The two genera have been differentiated by their inflorescence structure, but controversy has surrounded the taxonomic classification of the Lolium-Festuca complex species for several decades. In order to better understand the complexities within the Lolium/Festuca complex and their genetic background, the phylogeny of important examplers from the Lolium-Festuca complex were reconstructed. In total 40 taxa representing the Festuca and Lolium species with Vulpia myuros and Brachypodium distachyon as outgroups were sampled, using two noncoding intergenic spacers (trnQ-rps16, trnH-psbA and one coding gene (rbcL. Maximum parsimony (MP, Bayesian inference (BI analyses based on each partition and combined plastid DNA dataset, and median-jointing network analysis were employed. The outcomes strongly suggested that the subgen. Schedonorus has a close relationship to Lolium, and it is also proposed to move the sect. Leucopoa from subgen. Leucopoa to Subgen. Schedonorus and to separate sect. Breviaristatae from the subgen. Leucopoa. We found that F. californica could be a lineage of hybrid origin because of its intermediate placement between the broad-leaved and fine-leaved clade.

  11. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Whole genome sequence phylogenetic analysis of four Mexican rabies viruses isolated from cattle.

    Science.gov (United States)

    Bárcenas-Reyes, I; Loza-Rubio, E; Cantó-Alarcón, G J; Luna-Cozar, J; Enríquez-Vázquez, A; Barrón-Rodríguez, R J; Milián-Suazo, F

    2017-08-01

    Phylogenetic analysis of the rabies virus in molecular epidemiology has been traditionally performed on partial sequences of the genome, such as the N, G, and P genes; however, that approach raises concerns about the discriminatory power compared to whole genome sequencing. In this study we characterized four strains of the rabies virus isolated from cattle in Querétaro, Mexico by comparing the whole genome sequence to that of strains from the American, European and Asian continents. Four cattle brain samples positive to rabies and characterized as AgV11, genotype 1, were used in the study. A cDNA sequence was generated by reverse transcription PCR (RT-PCR) using oligo dT. cDNA samples were sequenced in an Illumina NextSeq 500 platform. The phylogenetic analysis was performed with MEGA 6.0. Minimum evolution phylogenetic trees were constructed with the Neighbor-Joining method and bootstrapped with 1000 replicates. Three large and seven small clusters were formed with the 26 sequences used. The largest cluster grouped strains from different species in South America: Brazil, and the French Guyana. The second cluster grouped five strains from Mexico. A Mexican strain reported in a different study was highly related to our four strains, suggesting common source of infection. The phylogenetic analysis shows that the type of host is different for the different regions in the American Continent; rabies is more related to bats. It was concluded that the rabies virus in central Mexico is genetically stable and that it is transmitted by the vampire bat Desmodus rotundus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Phylogenetic relationships of seven previously unclassified viruses within the family Rhabdoviridae using partial nucleoprotein gene sequences.

    Science.gov (United States)

    Kuzmin, I V; Hughes, G J; Rupprecht, C E

    2006-08-01

    Partial nucleoprotein (N) gene sequences of the rhabdoviruses Obodhiang (OBOV), Kotonkon (KOTV), Rochambeau (RBUV), Kern canyon (KCV), Mount Elgon bat (MEBV), Kolongo (KOLV) and Sandjimba (SJAV) were generated and their phylogenetic positions within the family Rhabdoviridae were determined. Both OBOV and KOTV were placed within the genus Ephemerovirus. RBUV was joined to the same cluster, but more distantly. MEBV and KCV were grouped into a monophyletic cluster (putative genus) with Oita virus (OITAV). These three viruses, originating from different regions of the world, were all isolated from insectivorous bats and may be specific for these mammals. African avian viruses KOLV and SJAV were joined to each other and formed another clade at the genus level. Further, they were grouped with the recently characterized rhabdovirus Tupaia virus (TRV). Although the genetic distance was great, the grouping was supported by consistent bootstrap values. This observation suggests that viruses of this group may be distributed widely in the Old World. Non-synonymous/synonymous substitution ratio estimations (dN/dS) using a partial N gene fragment (241 codons) for the three rhabdovirus genera revealed contrasting patterns of evolution, where dN/dS values follow the pattern Ephemerovirus > Vesiculovirus > Lyssavirus. The magnitude of this ratio corresponds well with the number of negatively selected codons. The accumulation of dS appears evenly distributed along the gene fragment for all three genera. These estimations demonstrated clearly that lyssaviruses are subjected to the strongest constraints against amino acid substitutions, probably related to their particular niche and unique pathobiology.

  14. Genetic characterization, molecular epidemiology, and phylogenetic relationships of insect-specific viruses in the taxon Negevirus.

    Science.gov (United States)

    Nunes, Marcio R T; Contreras-Gutierrez, María Angélica; Guzman, Hilda; Martins, Livia C; Barbirato, Mayla Feitoza; Savit, Chelsea; Balta, Victoria; Uribe, Sandra; Vivero, Rafael; Suaza, Juan David; Oliveira, Hamilton; Nunes Neto, Joaquin P; Carvalho, Valeria L; da Silva, Sandro Patroca; Cardoso, Jedson F; de Oliveira, Rodrigo Santo; da Silva Lemos, Poliana; Wood, Thomas G; Widen, Steven G; Vasconcelos, Pedro F C; Fish, Durland; Vasilakis, Nikos; Tesh, Robert B

    2017-04-01

    The recently described taxon Negevirus is comprised of a diverse group of insect-specific viruses isolated from mosquitoes and phlebotomine sandflies. In this study, a comprehensive genetic characterization, molecular, epidemiological and evolutionary analyses were conducted on nearly full-length sequences of 91 new negevirus isolates obtained in Brazil, Colombia, Peru, Panama, USA and Nepal. We demonstrated that these arthropod restricted viruses are clustered in two major phylogenetic groups with origins related to three plant virus genera (Cilevirus, Higrevirus and Blunevirus). Molecular analyses demonstrated that specific host correlations are not present with most negeviruses; instead, high genetic variability, wide host-range, and cross-species transmission were noted. The data presented here also revealed the existence of five novel insect-specific viruses falling into two arthropod-restrictive virus taxa, previously proposed as distinct genera, designated Nelorpivirus and Sandewavirus. Our results provide a better understanding of the molecular epidemiology, evolution, taxonomy and stability of this group of insect-restricted viruses. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Coptobrycon bilineatus (Ellis, 1911 (Characiformes: Characidae: redescription and comments on its phylogenetic relationships

    Directory of Open Access Journals (Sweden)

    Francisco Langeani

    Full Text Available Coptobrycon bilineatus (Ellis, 1911 is redescribed on the basis of specimens from the District of Paranapiacaba, Municipality of Santo André, upper rio Tietê, and additional ones recently collected in a small coastal river system of Serra do Mar, very near the headwaters of the rio Tietê. The genus was compared to other Characidae lacking a supraorbital, and it seems to be more phylogenetically related to Grundulus based on the possession of various putative apomorphic character states related to: the absence of a rhinosphenoid and fourth, fifth (sometimes and sixth infraorbitals; nasal pores separated; nares with up to six nasal lamellae; cephalic laterosensory system poorly developed on supraorbital and infraorbital series; and a globose scapula. Furthermore, Coptobrycon and Grundulus are characterized by the absence of the adipose fin, of the supraorbital laterosensory series on the parietal, and of the humeral spot, and by the reduction of lateral musculature in front of the first pleural rib and between the first and second pleural ribs. Biogeographic comments are also provided.

  16. Diversity of 16S-23S rDNA internal transcribed spacer (ITS reveals phylogenetic relationships in Burkholderia pseudomallei and its near-neighbors.

    Directory of Open Access Journals (Sweden)

    Andrew P Liguori

    Full Text Available Length polymorphisms within the 16S-23S ribosomal DNA internal transcribed spacer (ITS have been described as stable genetic markers for studying bacterial phylogenetics. In this study, we used these genetic markers to investigate phylogenetic relationships in Burkholderia pseudomallei and its near-relative species. B. pseudomallei is known as one of the most genetically recombined bacterial species. In silico analysis of multiple B. pseudomallei genomes revealed approximately four homologous rRNA operons and ITS length polymorphisms therein. We characterized ITS distribution using PCR and analyzed via a high-throughput capillary electrophoresis in 1,191 B. pseudomallei strains. Three major ITS types were identified, two of which were commonly found in most B. pseudomallei strains from the endemic areas, whereas the third one was significantly correlated with worldwide sporadic strains. Interestingly, mixtures of the two common ITS types were observed within the same strains, and at a greater incidence in Thailand than Australia suggesting that genetic recombination causes the ITS variation within species, with greater recombination frequency in Thailand. In addition, the B. mallei ITS type was common to B. pseudomallei, providing further support that B. mallei is a clone of B. pseudomallei. Other B. pseudomallei near-neighbors possessed unique and monomorphic ITS types. Our data shed light on evolutionary patterns of B. pseudomallei and its near relative species.

  17. Phylogenetic Characterization of Encephalitozoon Romaleae (Microsporidia) from a Grasshopper Host: Relationship to Encephalitozoon spp. Infecting Humans

    Science.gov (United States)

    Encephalitozoon species are the most common microsporidian pathogens of humans and domesticated animals. We recently discovered a new microsporidium, Encephalitozoon romaleae, infecting the eastern lubber grasshopper Romalea microptera. To understand its evolutionary relationships, we compared par...

  18. Phylogenetic analysis of several Thermus strains from Rehai of Tengchong, Yunnan, China.

    Science.gov (United States)

    Lin, Lianbing; Zhang, Jie; Wei, Yunlin; Chen, Chaoyin; Peng, Qian

    2005-10-01

    Several Thermus strains were isolated from 10 hot springs of the Rehai geothermal area in Tengchong, Yunnan province. The diversity of Thermus strains was examined by sequencing the 16S rRNA genes and comparing their sequences. Phylogenetic analysis showed that the 16S rDNA sequences from the Rehai geothermal isolates form four branches in the phylogenetic tree and had greater than 95.9% similarity in the phylogroup. Secondary structure comparison also indicated that the 16S rRNA from the Rehai geothermal isolates have unique secondary structure characteristics in helix 6, helix 9, and helix 10 (reference to Escherichia coli). This research is the first attempt to reveal the diversity of Thermus strains that are distributed in the Rehai geothermal area.

  19. Molecular cloning, phylogenetic analysis and heat shock response of Babesia gibsoni heat shock protein 90.

    Science.gov (United States)

    Yamasaki, Masahiro; Tsuboi, Yoshihiro; Taniyama, Yusuke; Uchida, Naohiro; Sato, Reeko; Nakamura, Kensuke; Ohta, Hiroshi; Takiguchi, Mitsuyoshi

    2016-09-01

    The Babesia gibsoni heat shock protein 90 (BgHSP90) gene was cloned and sequenced. The length of the gene was 2,610 bp with two introns. This gene was amplified from cDNA corresponding to full length coding sequence (CDS) with an open reading frame of 2,148 bp. A phylogenetic analysis of the CDS of HSP90 gene showed that B. gibsoni was most closely related to B. bovis and Babesia sp. BQ1/Lintan and lies within a phylogenetic cluster of protozoa. Moreover, mRNA transcription profile for BgHSP90 exposed to high temperature were examined by quantitative real-time reverse transcription-polymerase chain reaction. BgHSP90 levels were elevated when the parasites were incubated at 43°C for 1 hr.

  20. DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.

    Science.gov (United States)

    Eernisse, D J

    1992-04-01

    DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.

  1. [Phylogenetic analysis of genomes of Vibrio cholerae strains isolated on the territory of Rostov region].

    Science.gov (United States)

    Kuleshov, K V; Markelov, M L; Dedkov, V G; Vodop'ianov, A S; Kermanov, A V; Pisanov, R V; Kruglikov, V D; Mazrukho, A B; Maleev, V V; Shipulin, G A

    2013-01-01

    Determination of origin of 2 Vibrio cholerae strains isolated on the territory of Rostov region by using full genome sequencing data. Toxigenic strain 2011 EL- 301 V. cholerae 01 El Tor Inaba No. 301 (ctxAB+, tcpA+) and nontoxigenic strain V. cholerae O1 Ogawa P- 18785 (ctxAB-, tcpA+) were studied. Sequencing was carried out on the MiSeq platform. Phylogenetic analysis of the genomes obtained was carried out based on comparison of conservative part of the studied and 54 previously sequenced genomes. 2011EL-301 strain genome was presented by 164 contigs with an average coverage of 100, N50 parameter was 132 kb, for strain P- 18785 - 159 contigs with a coverage of69, N50 - 83 kb. The contigs obtained for strain 2011 EL-301 were deposited in DDBJ/EMBL/GenBank databases with access code AJFN02000000, for strain P-18785 - ANHS00000000. 716 protein-coding orthologous genes were detected. Based on phylogenetic analysis strain P- 18785 belongs to PG-1 subgroup (a group of predecessor strains of the 7th pandemic). Strain 2011EL-301 belongs to groups of strains of the 7th pandemic and is included into the cluster with later isolates that are associated with cases of cholera in South Africa and cases of import of cholera to the USA from Pakistan. The data obtained allows to establish phylogenetic connections with V cholerae strains isolated earlier.

  2. galaxie--CGI scripts for sequence identification through automated phylogenetic analysis.

    Science.gov (United States)

    Nilsson, R Henrik; Larsson, Karl-Henrik; Ursing, Björn M

    2004-06-12

    The prevalent use of similarity searches like BLAST to identify sequences and species implicitly assumes the reference database to be of extensive sequence sampling. This is often not the case, restraining the correctness of the outcome as a basis for sequence identification. Phylogenetic inference outperforms similarity searches in retrieving correct phylogenies and consequently sequence identities, and a project was initiated to design a freely available script package for sequence identification through automated Web-based phylogenetic analysis. Three CGI scripts were designed to facilitate qualified sequence identification from a Web interface. Query sequences are aligned to pre-made alignments or to alignments made by ClustalW with entries retrieved from a BLAST search. The subsequent phylogenetic analysis is based on the PHYLIP package for inferring neighbor-joining and parsimony trees. The scripts are highly configurable. A service installation and a version for local use are found at http://andromeda.botany.gu.se/galaxiewelcome.html and http://galaxie.cgb.ki.se

  3. Visualizing phylogenetic tree landscapes.

    Science.gov (United States)

    Wilgenbusch, James C; Huang, Wen; Gallivan, Kyle A

    2017-02-02

    Genomic-scale sequence alignments are increasingly used to infer phylogenies in order to better understand the processes and patterns of evolution. Different partitions within these new alignments (e.g., genes, codon positions, and structural features) often favor hundreds if not thousands of competing phylogenies. Summarizing and comparing phylogenies obtained from multi-source data sets using current consensus tree methods discards valuable information and can disguise potential methodological problems. Discovery of efficient and accurate dimensionality reduction methods used to display at once in 2- or 3- dimensions the relationship among these competing phylogenies will help practitioners diagnose the limits of current evolutionary models and potential problems with phylogenetic reconstruction methods when analyzing large multi-source data sets. We introduce several dimensionality reduction methods to visualize in 2- and 3-dimensions the relationship among competing phylogenies obtained from gene partitions found in three mid- to large-size mitochondrial genome alignments. We test the performance of these dimensionality reduction methods by applying several goodness-of-fit measures. The intrinsic dimensionality of each data set is also estimated to determine whether projections in 2- and 3-dimensions can be expected to reveal meaningful relationships among trees from different data partitions. Several new approaches to aid in the comparison of different phylogenetic landscapes are presented. Curvilinear Components Analysis (CCA) and a stochastic gradient decent (SGD) optimization method give the best representation of the original tree-to-tree distance matrix for each of the three- mitochondrial genome alignments and greatly outperformed the method currently used to visualize tree landscapes. The CCA + SGD method converged at least as fast as previously applied methods for visualizing tree landscapes. We demonstrate for all three mtDNA alignments that 3D

  4. Veronica: Chemical characters for the support of phylogenetic relationships based on nuclear ribosomal and plastid DNA sequence data

    DEFF Research Database (Denmark)

    Albach, Dirk C.; Jensen, Søren Rosendal; Özgökce, Fevzi

    2005-01-01

    Molecular phylogenetic analyses have revealed many relationships in Veronica (Plantaginaceae) never anticipated before. However, phytochemical characters show good congruence with DNA-based analyses. We have analysed a combined data set of 49 species and subspecies derived from the nuclear...... are monophyletic sister groups with the annual species consecutive sisters to them. All species of Veronica that contain cornoside are found in this subgenus, although some species seem to have secondarily lost the ability to produce this compound. Subgenera Pocilla and Pentasepalae are well supported sister...... species in the genus analysed to date to contain melittoside and globularifolin. Subgenus Pentasepalae appears to be a clade of diverse lineages from southwestern Asia and a single European clade. Species shown to have 6-hydroxyflavones do not form a monophyletic group. Subgenus Pseudolysimachium seems...

  5. Phylogenetic relationships of hexaploid large-sized barbs (genus Labeobarbus, Cyprinidae) based on mtDNA data.

    Science.gov (United States)

    Tsigenopoulos, Costas S; Kasapidis, Panagiotis; Berrebi, Patrick

    2010-08-01

    The phylogenetic relationships among species of the Labeobarbus genus (Teleostei, Cyprinidae) which comprises large body-sized hexaploid taxa were inferred using complete cytochrome b mitochondrial gene sequences. Molecular data suggest two main evolutionary groups which roughly correspond to a Northern (Middle East and Northwest Africa) and a sub-Saharan lineage. The splitting of the African hexaploids from their Asian ancestors and their subsequent diversification on the African continent occurred in the Late Miocene, a period in which other cyprinins also invaded Africa and radiated in the Mediterranean region. Finally, systematic implications of these results to the taxonomic validity of genera or subgenera such as Varicorhinus, Kosswigobarbus, Carasobarbus and Capoeta are further discussed. Copyright 2010 Elsevier Inc. All rights reserved.

  6. Phylogenetic relationships and generic delimitation in Inuleae subtribe Inulinae (Asteraceae) based on ITS and cpDNA sequence data

    DEFF Research Database (Denmark)

    Englund, Marcus; Pornpongrungrueng, Pimwadee; Gustafsson, Mats

    2009-01-01

    Phylogenetic relationships in Inuleae subtribe Inulinae (Asteraceae) were investigated. DNA sequence data from three chloroplast regions (ndhF, trnL-F and psbA-trnH) and the nuclear ribosomal internal transcribed spacer (ITS) region were analysed separately and in combination using parsimony...... and Bayesian inference. A total of 163 ingroup taxa were included, of which 60 were sampled for all four markers. Conflicts between chloroplast and nuclear data were assessed using partitioned Bremer support (PBS). Rather than averaging PBS over several trees from constrained searches, individual trees were...... considered by evaluating PBS ranges. Criteria to be used in the detection of a significant conflict between data partitions are proposed. Three nodes in the total data tree were found to encompass significant conflict that could result from ancient hybridization. Neither of the large, heterogeneous...

  7. Probing the phylogenetic relationships of a few newly recorded intertidal zoanthids of Gujarat coast (India) with mtDNA COI sequences.

    Science.gov (United States)

    Joseph, Sneha; Poriya, Paresh; Kundu, Rahul

    2016-11-01

    The present study reports the phylogenetic relationship of six zoanthid species belonging to three genera, Isaurus, Palythoa, and Zoanthus identified using systematic computational analysis of mtDNA gene sequences. All six species are first recorded from the coasts of Kathiawar Peninsula, India. Genus: Isaurus is represented by Isaurus tuberculatus, genus Zoanthus is represented by Zoanthus kuroshio and Zoanthus sansibaricus, while genus Palythoa is represented by Palythoa tuberculosa, P. sp. JVK-2006 and Palythoa heliodiscus. Results of the present study revealed that among the various species observed along the coastline, a minimum of 99% sequence divergence and a maximum of 96% sequence divergence were seen. An interspecific divergence of 1-4% and negligible intraspecific divergence was observed. These results not only highlighted the efficiency of the COI gene region in species identification but also demonstrated the genetic variability of zoanthids along the Saurashtra coastline of the west coast of India.

  8. Chloroplast genes as genetic markers for inferring patterns of change, maternal ancestry and phylogenetic relationships among Eleusine species.

    Science.gov (United States)

    Agrawal, Renuka; Agrawal, Nitin; Tandon, Rajesh; Raina, Soom Nath

    2014-01-01

    Assessment of phylogenetic relationships is an important component of any successful crop improvement programme, as wild relatives of the crop species often carry agronomically beneficial traits. Since its domestication in East Africa, Eleusine coracana (2n = 4x = 36), a species belonging to the genus Eleusine (x = 8, 9, 10), has held a prominent place in the semi-arid regions of India, Nepal and Africa. The patterns of variation between the cultivated and wild species reported so far and the interpretations based upon them have been considered primarily in terms of nuclear events. We analysed, for the first time, the phylogenetic relationship between finger millet (E. coracana) and its wild relatives by species-specific chloroplast deoxyribonucleic acid (cpDNA) polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and chloroplast simple sequence repeat (cpSSR) markers/sequences. Restriction fragment length polymorphism of the seven amplified chloroplast genes/intergenic spacers (trnK, psbD, psaA, trnH-trnK, trnL-trnF, 16S and trnS-psbC), nucleotide sequencing of the chloroplast trnK gene and chloroplast microsatellite polymorphism were analysed in all nine known species of Eleusine. The RFLP of all seven amplified chloroplast genes/intergenic spacers and trnK gene sequences in the diploid (2n = 16, 18, 20) and allotetraploid (2n = 36, 38) species resulted in well-resolved phylogenetic trees with high bootstrap values. Eleusine coracana, E. africana, E. tristachya, E. indica and E. kigeziensis did not show even a single change in restriction site. Eleusine intermedia and E. floccifolia were also shown to have identical cpDNA fragment patterns. The cpDNA diversity in Eleusine multiflora was found to be more extensive than that of the other eight species. The trnK gene sequence data complemented the results obtained by PCR-RFLP. The maternal lineage of all three allotetraploid species (AABB, AADD) was the same, with E. indica being the

  9. Phylogenetic analysis of HSP70 and cyt b gene sequences for Chinese Leishmania isolates and ultrastructural characteristics of Chinese Leishmania sp.

    Science.gov (United States)

    Yuan, Dongmei; Qin, Hanxiao; Zhang, Jianguo; Liao, Lin; Chen, Qiwei; Chen, Dali; Chen, Jianping

    2017-02-01

    Leishmaniasis is a worldwide epidemic disease caused by the genus Leishmania, which is still endemic in the west and northwest areas of China. Some viewpoints of the traditional taxonomy of Chinese Leishmania have been challenged by recent phylogenetic researches based on different molecular markers. However, the taxonomic positions and phylogenetic relationships of Chinese Leishmania isolates remain controversial, which need for more data and further analysis. In this study, the heat shock protein 70 (HSP70) gene and cytochrome b (cyt b) gene were used for phylogenetic analysis of Chinese Leishmania isolates from patients, dogs, gerbils, and sand flies in different geographic origins. Besides, for the interesting Leishmania sp. in China, the ultrastructure of three Chinese Leishmania sp. strains (MHOM/CN/90/SC10H2, SD, GL) were observed by transmission electron microscopy. Bayesian trees from HSP70 and cyt b congruently indicated that the 14 Chinese Leishmania isolates belong to three Leishmania species including L. donovani complex, L. gerbilli, and L. (Sauroleishmania) sp. Their identity further confirmed that the undescribed Leishmania species causing visceral Leishmaniasis (VL) in China is closely related to L. tarentolae. The phylogenetic results from HSP70 also suggested the classification of subspecies within L. donovani complex: KXG-918, KXG-927, KXG-Liu, KXG-Xu, 9044, SC6, and KXG-65 belong to L. donovani; Cy, WenChuan, and 801 were proposed to be L. infantum. Through transmission electron microscopy, unexpectedly, the Golgi apparatus were not observed in SC10H2, SD, and GL, which was similar to previous reports of reptilian Leishmania. The statistical analysis of microtubule counts separated SC10H2, SD, and GL as one group from any other reference strain (L. donovani MHOM/IN/80/DD8; L. tropica MHOM/SU/74/K27; L. gerbilli MRHO/CN/60/GERBILLI). The ultrastructural characteristics of Leishmania sp. partly lend support to the phylogenetic inference that

  10. The evolution of giant flightless birds and novel phylogenetic relationships for extinct fowl (Aves, Galloanseres)

    Science.gov (United States)

    Worthy, Trevor H.; Degrange, Federico J.; Handley, Warren D.; Lee, Michael S. Y.

    2017-10-01

    The extinct dromornithids, gastornithids and phorusrhacids are among the most spectacular birds to have ever lived, with some giants exceeding 500 kg. The affinities and evolution of these and other related extinct birds remain contentious, with previous phylogenetic analyses being affected by widespread convergence and limited taxon sampling. We address these problems using both parsimony and tip-dated Bayesian approaches on an expansive taxon set that includes all key extinct flightless and flighted (e.g. Vegavis and lithornithids) forms, an extensive array of extant fowl (Galloanseres), representative Neoaves and palaeognaths. The Paleogene volant Lithornithidae are recovered as stem palaeognaths in the Bayesian analyses. The Galloanseres comprise four clades inferred to have diverged in the Late Cretaceous on Gondwana. In addition to Anseriformes and Galliformes, we recognize a robust new clade (Gastornithiformes) for the giant flightless Dromornithidae (Australia) and Gastornithidae (Eurasia, North America). This clade exhibits parallels to ratite palaeognaths in that flight presumably was lost and giant size attained multiple times. A fourth clade is represented by the Cretaceous Vegavis (Antarctica), which was strongly excluded from Anseriformes; thus, a crucial molecular calibration point needs to be reconsidered. The presbyornithids Wilaru (Australia) and Presbyornis (Northern Hemisphere) are robustly found to be the sister group to Anatoidea (Anseranatidae + Anatidae), a relatively more basal position than hitherto recognized. South America's largest bird, Brontornis, is not a galloansere, but a member of Neoaves related to Cariamiformes; therefore, giant Galloanseres remain unknown from this continent. Trait analyses showed that while gigantism and flightlessness evolved repeatedly in groups, diet is constrained by phylogeny: all giant Galloanseres and palaeognaths are herbivores or mainly herbivorous, and giant neoavians are zoophagous or omnivorous.

  11. The complete mitochondrial genome of Somanniathelphusa boyangensis and phylogenetic analysis of Genus Somanniathelphusa (Crustacea: Decapoda: Parathelphusidae.

    Directory of Open Access Journals (Sweden)

    Xin-Nan Jia

    Full Text Available In this study, the authors first obtained the mitochondrial genome of Somanniathelphusa boyangensis. The results showed that the mitochondrial genome is 17,032bp in length, included 13 protein-coding genes, 2 rRNAs genes, 22 tRNAs genes and 1 putative control region, and it has the characteristics of the metazoan mitochondrial genome A+T bias. All tRNA genes display the typical clover-leaf secondary structure except tRNASer(AGN, which has lost the dihydroxyuridine arm. The GenBank database contains the mitochondrial genomes of representatives of approximately 22 families of Brachyura, comprising 56 species, including 4 species of freshwater crab. The authors established the phylogenetic relationships using the maximum likelihood and Bayesian inference methods. The phylogenetic relationship indicated that the molecular taxonomy of S. boyangensis is consistent with current morphological classification, and Parathelphusidae and Potamidae are derived within the freshwater clade or as part of it. In addition, the authors used the COX1 sequence of Somanniathelphusa in GenBank and the COX1 sequence of S. boyangensis to estimated the divergence time of this genus. The result displayed that the divergence time of Somanniathelphusa qiongshanensis is consistent with the separation of Hainan Island from mainland China in the Beibu Gulf, and the divergence time for Somanniathelphusa taiwanensis and Somanniathelphusa amoyensis is consistent with the separation of Taiwan Province from Mainland China at Fujian Province. These data indicate that geologic events influenced speciation of the genus Somanniathelphusa.

  12. Molecular identification and phylogenetic analysis of Wuchereria bancrofti from human blood samples in Egypt.

    Science.gov (United States)

    Abdel-Shafi, Iman R; Shoieb, Eman Y; Attia, Samar S; Rubio, José M; Ta-Tang, Thuy-Huong; El-Badry, Ayman A

    2017-03-01

    Lymphatic filariasis (LF) is a serious vector-borne health problem, and Wuchereria bancrofti (W.b) is the major cause of LF worldwide and is focally endemic in Egypt. Identification of filarial infection using traditional morphologic and immunological criteria can be difficult and lead to misdiagnosis. The aim of the present study was molecular detection of W.b in residents in endemic areas in Egypt, sequence variance analysis, and phylogenetic analysis of W.b DNA. Collected blood samples from residents in filariasis endemic areas in five governorates were subjected to semi-nested PCR targeting repeated DNA sequence, for detection of W.b DNA. PCR products were sequenced; subsequently, a phylogenetic analysis of the obtained sequences was performed. Out of 300 blood samples, W.b DNA was identified in 48 (16%). Sequencing analysis confirmed PCR results identifying only W.b species. Sequence alignment and phylogenetic analysis indicated genetically distinct clusters of W.b among the study population. Study results demonstrated that the semi-nested PCR proved to be an effective diagnostic tool for accurate and rapid detection of W.b infections in nano-epidemics and is applicable for samples collected in the daytime as well as the night time. PCR products sequencing and phylogenitic analysis revealed three different nucleotide sequences variants. Further genetic studies of W.b in Egypt and other endemic areas are needed to distinguish related strains and the various ecological as well as drug effects exerted on them to support W.b elimination.

  13. Karyotypic evolution and phylogenetic relationships in the order Chiroptera as revealed by G-banding comparison and chromosome painting.

    Science.gov (United States)

    Ao, Lei; Mao, Xiuguang; Nie, Wenhui; Gu, Xiaoming; Feng, Qing; Wang, Jinhuan; Su, Weiting; Wang, Yingxiang; Volleth, Marianne; Yang, Fengtang

    2007-01-01

    Bats are a unique but enigmatic group of mammals and have a world-wide distribution. The phylogenetic relationships of extant bats are far from being resolved. Here, we investigated the karyotypic relationships of representative species from four families of the order Chiroptera by comparative chromosome painting and banding. A complete set of painting probes derived from flow-sorted chromosomes of Myotis myotis (family Vespertilionidae) were hybridized onto metaphases of Cynopterus sphinx (2n = 34, family Pteropodidae), Rhinolophus sinicus (2n=36, family Rhinolophidae) and Aselliscus stoliczkanus (2n=30, family Hipposideridae) and delimited 27, 30 and 25 conserved chromosomal segments in the three genomes, respectively. The results substantiate that Robertsonian translocation is the main mode of chromosome evolution in the order Chiroptera, with extensive conservation of whole chromosomal arms. The use of M. myotis (2n=44) probes has enabled the integration of C. sphinx, R. sinicus and A. stoliczkanus chromosomes into the previously established comparative maps between human and Eonycteris spelaea (2n=36), Rhinolophus mehelyi (2n=58), Hipposideros larvatus (2n=32), and M. myotis. Our results provide the first cytogenetic signature rearrangement that supports the grouping of Pteropodidae and Rhinolophoidea in a common clade (i.e. Pteropodiformes or Yinpterochiroptera) and thus improve our understanding on the karyotypic relationships and genome phylogeny of these bat species.

  14. A New Perspective on Polyploid Fragaria (Strawberry) Genome Composition Based on Large-Scale, Multi-Locus Phylogenetic Analysis.

    Science.gov (United States)

    Yang, Yilong; Davis, Thomas M

    2017-12-01

    The subgenomic compositions of the octoploid (2n = 8× = 56) strawberry (Fragaria) species, including the economically important cultivated species Fragaria x ananassa, have been a topic of long-standing interest. Phylogenomic approaches utilizing next-generation sequencing technologies offer a new window into species relationships and the subgenomic compositions of polyploids. We have conducted a large-scale phylogenetic analysis of Fragaria (strawberry) species using the Fluidigm Access Array system and 454 sequencing platform. About 24 single-copy or low-copy nuclear genes distributed across the genome were amplified and sequenced from 96 genomic DNA samples representing 16 Fragaria species from diploid (2×) to decaploid (10×), including the most extensive sampling of octoploid taxa yet reported. Individual gene trees were constructed by different tree-building methods. Mosaic genomic structures of diploid Fragaria species consisting of sequences at different phylogenetic positions were observed. Our findings support the presence in octoploid species of genetic signatures from at least five diploid ancestors (F. vesca, F. iinumae, F. bucharica, F. viridis, and at least one additional allele contributor of unknown identity), and questions the extent to which distinct subgenomes are preserved over evolutionary time in the allopolyploid Fragaria species. In addition, our data support divergence between the two wild octoploid species, F. virginiana and F. chiloensis. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. An autochthonous case of hepatitis C virus genotype 5a in Brazil: phylogenetic analysis

    DEFF Research Database (Denmark)

    Ribeiro, L.C.; Souto, F.J.D.; do Espirito-Santo, M.P.

    2009-01-01

    Genotype 5 of hepatitis C virus (HCV) has been rarely identified in South America. A female of African descent who never left Brazil was found to be infected by this genotype in Mato Grosso state, Central Brazil. The patient denied drug injections and revealed that she had received blood...... transfusions several years before. One of her blood donors was identified and tested negative for anti-HCV and HCV RNA, as were her husband and offspring. Phylogenetic analysis of the E1 and NS5B regions confirmed that this HCV strain belonged to genotype 5a. However, the E1 region analysis indicates that our...

  16. Are Ichthyosporea animals or fungi? Bayesian phylogenetic analysis of elongation factor 1alpha of Ichthyophonus irregularis.

    Science.gov (United States)

    Ragan, Mark A; Murphy, Colleen A; Rand, Thomas G

    2003-12-01

    Ichthyosporea is a recently recognized group of morphologically simple eukaryotes, many of which cause disease in aquatic organisms. Ribosomal RNA sequence analyses place Ichthyosporea near the divergence of the animal and fungal lineages, but do not allow resolution of its exact phylogenetic position. Some of the best evidence for a specific grouping of animals and fungi (Opisthokonta) has come from elongation factor 1alpha, not only phylogenetic analysis of sequences but also the presence or absence of short insertions and deletions. We sequenced the EF-1alpha gene from the ichthyosporean parasite Ichthyophonus irregularis and determined its phylogenetic position using neighbor-joining, parsimony and Bayesian methods. We also sequenced EF-1alpha genes from four chytrids to provide broader representation within fungi. Sequence analyses and the presence of a characteristic 12 amino acid insertion strongly indicate that I. irregularis is a member of Opisthokonta, but do not resolve whether I. irregularis is a specific relative of animals or of fungi. However, the EF-1alpha of I. irregularis exhibits a two amino acid deletion heretofore reported only among fungi.

  17. Orders out of chaos--molecular phylogenetics reveals the complexity of shark and stingray tapeworm relationships.

    Science.gov (United States)

    Caira, Janine N; Jensen, Kirsten; Waeschenbach, Andrea; Olson, Peter D; Littlewood, D Timothy J

    2014-01-01

    elasmobranch cestodes. Across analyses, the sister group to the clade of "terrestrial" cestode orders was found to be an elasmobranch-hosted genus, as was the sister to the freshwater fish- and tetrapod-hosted Proteocephalidea. Whilst further data are required to resolve outstanding nomenclatural and phylogenetic issues, the present analyses contribute significantly to an understanding of the evolutionary radiation of the entire Cestoda. Clearly, elasmobranch tapeworms comprise the backbone of cestode phylogeny. Copyright © 2013 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  18. A new subtype of hepatitis C virus genotype 1: complete genome and phylogenetic relationships of an Equatorial Guinea isolate.

    Science.gov (United States)

    Bracho, Maria Alma; Carrillo-Cruz, Francy Yolima; Ortega, Enrique; Moya, Andrés; González-Candelas, Fernando

    2006-06-01

    Hepatitis C virus (HCV) is the leading cause of chronic liver disease and is associated with hepatocellular carcinoma. However, there have been few studies on the distribution and genetic diversity of HCV isolates in non-developed countries. Here, the complete genome sequence of an HCV genotype 1 isolate from Equatorial Guinea is reported, the first complete HCV-1 genome of African origin. Phylogenetic analysis revealed that this sequence always grouped with sequences of genotype 1, but did not group clearly with any subtype described so far. An analysis of partial NS5B gene sequences with additional sequences of African origin also failed to find close similarities between the new sequence and any previously known isolate. Genetic divergence of the coding region of this new sequence with respect to the recognized subtypes of HCV-1 ranged from 20 to 22%. It is proposed that this isolate is a representative of a new, distinct variant of HCV subtype 1.

  19. A Closer Look at Bacteroides: Phylogenetic Relationship and Genomic Implications of a Life in the Human Gut

    DEFF Research Database (Denmark)

    Karlsson, Fredrik H.; Ussery, David; Nielsen, Jens

    2011-01-01

    The human gut is extremely densely inhabited by bacteria mainly from two phyla, Bacteroidetes and Firmicutes, and there is a great interest in analyzing whole-genome sequences for these species because of their relation to human health and disease. Here, we do whole-genome comparison of 105...... of extracytoplasmic function σ factors (ECF σ factors) and two component systems for extracellular signal transduction compared to other Bacteroidetes/Chlorobi species. A whole-genome phylogenetic analysis shows a very little difference between the Parabacteroides and Bacteroides genera. Further analysis shows...... of members of the Bacteroidetes/Chlorobi phylum by whole genome comparison. Gut living Bacteroides have an enriched set of glycan, vitamin, and cofactor enzymes important for diet digestion....

  20. A family history of DUX4: phylogenetic analysis of DUXA, B, C and Duxbl reveals the ancestral DUX gene

    Directory of Open Access Journals (Sweden)

    Hewitt Jane E

    2010-11-01

    Full Text Available Abstract Background DUX4 is causally involved in the molecular pathogenesis of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD. It has previously been proposed to have arisen by retrotransposition of DUXC, one of four known intron-containing DUX genes. Here, we investigate the evolutionary history of this multi-member double-homeobox gene family in eutherian mammals. Results Our analysis of the DUX family shows the distribution of different homologues across the mammalian class, including events of secondary loss. Phylogenetic comparison, analysis of gene structures and information from syntenic regions confirm the paralogous relationship of Duxbl and DUXB and characterize their relationship with DUXA and DUXC. We further identify Duxbl pseudogene orthologues in primates. A survey of non-mammalian genomes identified a single-homeobox gene (sDUX as a likely representative homologue of the mammalian DUX ancestor before the homeobox duplication. Based on the gene structure maps, we suggest a possible mechanism for the generation of the DUX gene structure. Conclusions Our study underlines how secondary loss of orthologues can obscure the true ancestry of individual gene family members. Their relationships should be considered when interpreting the relevance of functional data from DUX4 homologues such as Dux and Duxbl to FSHD.

  1. Phylogenetic reconstruction methods: an overview.

    Science.gov (United States)

    De Bruyn, Alexandre; Martin, Darren P; Lefeuvre, Pierre

    2014-01-01

    Initially designed to infer evolutionary relationships based on morphological and physiological characters, phylogenetic reconstruction methods have greatly benefited from recent developments in molecular biology and sequencing technologies with a number of powerful methods having been developed specifically to infer phylogenies from macromolecular data. This chapter, while presenting an overview of basic concepts and methods used in phylogenetic reconstruction, is primarily intended as a simplified step-by-step guide to the construction of phylogenetic trees from nucleotide sequences using fairly up-to-date maximum likelihood methods implemented in freely available computer programs. While the analysis of chloroplast sequences from various Vanilla species is used as an illustrative example, the techniques covered here are relevant to the comparative analysis of homologous sequences datasets sampled from any group of organisms.

  2. Phylogenetic relationships of geckos of the genus Nactus and their relatives (Squamata: Gekkonidae

    Directory of Open Access Journals (Sweden)

    Todd R. Jackman

    2008-05-01

    Full Text Available We employed nuclear and mitochondrial DNA sequence data to investigate relationships within the gekkonid genus Nactus and between Nactus and other gekkonid genera. Nuclear (RAG-1, PDC and mitochondrial (ND2 data provide strong support for conflicting patterns of relationship among bisexual New Guinean species of Nactus and the unisexual oceanic form N. pelagicus. This may be explained by an ancient mitochondrial introgression event between N. sphaerodactylodes and N. vankampeni, a recent selective sweep of mitochondrial DNA throughout N. vankampeni, and gene conflict stemming from the hybrid event that gave rise to N. pelagicus. Strong support from all data partitions is obtained for the sister group relationship of Nactus to a clade consisting of the Australian Heteronotia and the Southeast Asian Dixonius. Putative synapomorphies of the Nactus/Heteronotia/Dixonius clade include the reduction of the second phalanx of digit IV of the manus and the presence of regular rows of keeled (sometimes multicarinate dorsal tubercles on the dorsum. Nactus and Heteronotia both include parthenogenetic species formed via hybridogenesis. This is rare among geckos, and vertebrates in general, and at some level may also be synapomorphic. Dixonius is not known to have any all-female species, but “D. siamensis” consists of multiple chromosome “races” that mirror morphologically cryptic, but karyotypically distinct, species in the other two genera. The strong support for the Nactus/Heteronotia/Dixonius clade demonstrates that the leaf-toed digital morphology of Dixonius has evolved multiple times within the Gekkonidae and suggests that superficial digital morphology may be misleading with respect to gekkonid suprageneric relationships.

  3. Integration of morphological data sets for phylogenetic analysis of Amniota: the importance of integumentary characters and increased taxonomic sampling.

    Science.gov (United States)

    Hill, Robert V

    2005-08-01

    Several mutually exclusive hypotheses have been advanced to explain the phylogenetic position of turtles among amniotes. Traditional morphology-based analyses place turtles among extinct anapsids (reptiles with a solid skull roof), whereas more recent studies of both morphological and molecular data support an origin of turtles from within Diapsida (reptiles with a doubly fenestrated skull roof). Evaluation of these conflicting hypotheses has been hampered by nonoverlapping taxonomic samples and the exclusion of significant taxa from published analyses. Furthermore, although data from soft tissues and anatomical systems such as the integument may be particularly relevant to this problem, they are often excluded from large-scale analyses of morphological systematics. Here, conflicting hypotheses of turtle relationships are tested by (1) combining published data into a supermatrix of morphological characters to address issues of character conflict and missing data; (2) increasing taxonomic sampling by more than doubling the number of operational taxonomic units to test internal relationships within suprageneric ingroup taxa; and (3) increasing character sampling by approximately 25% by adding new data on the osteology and histology of the integument, an anatomical system that has been historically underrepresented in morphological systematics. The morphological data set assembled here represents the largest yet compiled for Amniota. Reevaluation of character data from prior studies of amniote phylogeny favors the hypothesis that turtles indeed have diapsid affinities. Addition of new ingroup taxa alone leads to a decrease in overall phylogenetic resolution, indicating that existing characters used for amniote phylogeny are insufficient to explain the evolution of more highly nested taxa. Incorporation of new data from the soft and osseous components of the integument, however, helps resolve relationships among both basal and highly nested amniote taxa. Analysis of a

  4. The emergence of lobsters: phylogenetic relationships, morphological evolution and divergence time comparisons of an ancient group (decapoda: achelata, astacidea, glypheidea, polychelida).

    Science.gov (United States)

    Bracken-Grissom, Heather D; Ahyong, Shane T; Wilkinson, Richard D; Feldmann, Rodney M; Schweitzer, Carrie E; Breinholt, Jesse W; Bendall, Matthew; Palero, Ferran; Chan, Tin-Yam; Felder, Darryl L; Robles, Rafael; Chu, Ka-Hou; Tsang, Ling-Ming; Kim, Dohyup; Martin, Joel W; Crandall, Keith A

    2014-07-01

    Lobsters are a ubiquitous and economically important group of decapod crustaceans that include the infraorders Polychelida, Glypheidea, Astacidea and Achelata. They include familiar forms such as the spiny, slipper, clawed lobsters and crayfish and unfamiliar forms such as the deep-sea and "living fossil" species. The high degree of morphological diversity among these infraorders has led to a dynamic classification and conflicting hypotheses of evolutionary relationships. In this study, we estimated phylogenetic relationships among the major groups of all lobster families and 94% of the genera using six genes (mitochondrial and nuclear) and 195 morphological characters across 173 species of lobsters for the most comprehensive sampling to date. Lobsters were recovered as a non-monophyletic assemblage in the combined (molecular + morphology) analysis. All families were monophyletic, with the exception of Cambaridae, and 7 of 79 genera were recovered as poly- or paraphyletic. A rich fossil history coupled with dense taxon coverage allowed us to estimate and compare divergence times and origins of major lineages using two drastically different approaches. Age priors were constructed and/or included based on fossil age information or fossil discovery, age, and extant species count data. Results from the two approaches were largely congruent across deep to shallow taxonomic divergences across major lineages. The origin of the first lobster-like decapod (Polychelida) was estimated in the Devonian (∼409-372 Ma) with all infraorders present in the Carboniferous (∼353-318 Ma). Fossil calibration subsampling studies examined the influence of sampling density (number of fossils) and placement (deep, middle, and shallow) on divergence time estimates. Results from our study suggest including at least 1 fossil per 10 operational taxonomic units (OTUs) in divergence dating analyses. [Dating; decapods; divergence; lobsters; molecular; morphology; phylogenetics.]. © The

  5. Phylogenetic relationships in three species of canine Demodex mite based on partial sequences of mitochondrial 16S rDNA.

    Science.gov (United States)

    Sastre, Natalia; Ravera, Ivan; Villanueva, Sergio; Altet, Laura; Bardagí, Mar; Sánchez, Armand; Francino, Olga; Ferrer, Lluís

    2012-12-01

    The historical classification of Demodex mites has been based on their hosts and morphological features. Genome sequencing has proved to be a very effective taxonomic tool in phylogenetic studies and has been applied in the classification of Demodex. Mitochondrial 16S rDNA has been demonstrated to be an especially useful marker to establish phylogenetic relationships. To amplify and sequence a segment of the mitochondrial 16S rDNA from Demodex canis and Demodex injai, as well as from the short-bodied mite called, unofficially, D. cornei and to determine their genetic proximity. Demodex mites were examined microscopically and classified as Demodex folliculorum (one sample), D. canis (four samples), D. injai (two samples) or the short-bodied species D. cornei (three samples). DNA was extracted, and a 338 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of the four D. canis mites were identical and shared 99.6 and 97.3% identity with two D. canis sequences available at GenBank. The sequences of the D. cornei isolates were identical and showed 97.8, 98.2 and 99.6% identity with the D. canis isolates. The sequences of the two D. injai isolates were also identical and showed 76.6% identity with the D. canis sequence. Demodex canis and D. injai are two different species, with a genetic distance of 23.3%. It would seem that the short-bodied Demodex mite D. cornei is a morphological variant of D. canis. © 2012 The Authors. Veterinary Dermatology © 2012 ESVD and ACVD.

  6. Analysis of complete mitochondrial genomes from extinct and extant rhinoceroses reveals lack of phylogenetic resolution

    Science.gov (United States)

    Willerslev, Eske; Gilbert, M Thomas P; Binladen, Jonas; Ho, Simon YW; Campos, Paula F; Ratan, Aakrosh; Tomsho, Lynn P; da Fonseca, Rute R; Sher, Andrei; Kuznetsova, Tatanya V; Nowak-Kemp, Malgosia; Roth, Terri L; Miller, Webb; Schuster, Stephan C

    2009-01-01

    Background The scientific literature contains many examples where DNA sequence analyses have been used to provide definitive answers to phylogenetic problems that traditional (non-DNA based) approaches alone have failed to resolve. One notable example concerns the rhinoceroses, a group for which several contradictory phylogenies were proposed on the basis of morphology, then apparently resolved using mitochondrial DNA fragments. Results In this study we report the first complete mitochondrial genome sequences of the extinct ice-age woolly rhinoceros (Coelodonta antiquitatis), and the threatened Javan (Rhinoceros sondaicus), Sumatran (Dicerorhinus sumatrensis), and black (Diceros bicornis) rhinoceroses. In combination with the previously published mitochondrial genomes of the white (Ceratotherium simum) and Indian (Rhinoceros unicornis) rhinoceroses, this data set putatively enables reconstruction of the rhinoceros phylogeny. While the six species cluster into three strongly supported sister-pairings: (i) The black/white, (ii) the woolly/Sumatran, and (iii) the Javan/Indian, resolution of the higher-level relationships has no statistical support. The phylogenetic signal from individual genes is highly diffuse, with mixed topological support from different genes. Furthermore, the choice of outgroup (horse vs tapir) has considerable effect on reconstruction of the phylogeny. The lack of resolution is suggestive of a hard polytomy at the base of crown-group Rhinocerotidae, and this is supported by an investigation of the relative branch lengths. Conclusion Satisfactory resolution of the rhinoceros phylogeny may not be achievable without additional analyses of substantial amounts of nuclear DNA. This study provides a compelling demonstration that, in spite of substantial sequence length, there are significant limitations with single-locus phylogenetics. We expect further examples of this to appear as next-generation, large-scale sequencing of complete mitochondrial

  7. Analysis of complete mitochondrial genomes from extinct and extant rhinoceroses reveals lack of phylogenetic resolution

    Directory of Open Access Journals (Sweden)

    Nowak-Kemp Malgosia

    2009-05-01

    Full Text Available Abstract Background The scientific literature contains many examples where DNA sequence analyses have been used to provide definitive answers to phylogenetic problems that traditional (non-DNA based approaches alone have failed to resolve. One notable example concerns the rhinoceroses, a group for which several contradictory phylogenies were proposed on the basis of morphology, then apparently resolved using mitochondrial DNA fragments. Results In this study we report the first complete mitochondrial genome sequences of the extinct ice-age woolly rhinoceros (Coelodonta antiquitatis, and the threatened Javan (Rhinoceros sondaicus, Sumatran (Dicerorhinus sumatrensis, and black (Diceros bicornis rhinoceroses. In combination with the previously published mitochondrial genomes of the white (Ceratotherium simum and Indian (Rhinoceros unicornis rhinoceroses, this data set putatively enables reconstruction of the rhinoceros phylogeny. While the six species cluster into three strongly supported sister-pairings: (i The black/white, (ii the woolly/Sumatran, and (iii the Javan/Indian, resolution of the higher-level relationships has no statistical support. The phylogenetic signal from individual genes is highly diffuse, with mixed topological support from different genes. Furthermore, the choice of outgroup (horse vs tapir has considerable effect on reconstruction of the phylogeny. The lack of resolution is suggestive of a hard polytomy at the base of crown-group Rhinocerotidae, and this is supported by an investigation of the relative branch lengths. Conclusion Satisfactory resolution of the rhinoceros phylogeny may not be achievable without additional analyses of substantial amounts of nuclear DNA. This study provides a compelling demonstration that, in spite of substantial sequence length, there are significant limitations with single-locus phylogenetics. We expect further examples of this to appear as next-generation, large-scale sequencing of complete

  8. Studying the evolutionary relationships and phylogenetic trees of 21 groups of tRNA sequences based on complex networks.

    Science.gov (United States)

    Wei, Fangping; Chen, Bowen

    2012-03-01

    To find out the evolutionary relationships among different tRNA sequences of 21 amino acids, 22 networks are constructed. One is constructed from whole tRNAs, and the other 21 networks are constructed from the tRNAs which carry the same amino acids. A new method is proposed such that the alignment scores of any two amino acids groups are determined by the average degree and the average clustering coefficient of their networks. The anticodon feature of isolated tRNA and the phylogenetic trees of 21 group networks are discussed. We find that some isolated tRNA sequences in 21 networks still connect with other tRNAs outside their group, which reflects the fact that those tRNAs might evolve by intercrossing among these 21 groups. We also find that most anticodons among the same cluster are only one base different in the same sites when S ≥ 70, and they stay in the same rank in the ladder of evolutionary relationships. Those observations seem to agree on that some tRNAs might mutate from the same ancestor sequences based on point mutation mechanisms.

  9. Molecular phylogenetic and expression analysis of the complete WRKY transcription factor family in maize.

    Science.gov (United States)

    Wei, Kai-Fa; Chen, Juan; Chen, Yan-Feng; Wu, Ling-Juan; Xie, Dao-Xin

    2012-04-01

    The WRKY transcription factors function in plant growth and development, and response to the biotic and abiotic stresses. Although many studies have focused on the functional identification of the WRKY transcription factors, much less is known about molecular phylogenetic and global expression analysis of the complete WRKY family in maize. In this study, we identified 136 WRKY proteins coded by 119 genes in the B73 inbred line from the complete genome and named them in an orderly manner. Then, a comprehensive phylogenetic analysis of five species was performed to explore the origin and evolutionary patterns of these WRKY genes, and the result showed that gene duplication is the major driving force for the origin of new groups and subgroups and functional divergence during evolution. Chromosomal location analysis of maize WRKY genes indicated that 20 gene clusters are distributed unevenly in the genome. Microarray-based expression analysis has revealed that 131 WRKY transcripts encoded by 116 genes may participate in the regulation of maize growth and development. Among them, 102 transcripts are stably expressed with a coefficient of variation (CV) value of WRKY genes with the CV value of >15% are further analysed to discover new organ- or tissue-specific genes. In addition, microarray analyses of transcriptional responses to drought stress and fungal infection showed that maize WRKY proteins are involved in stress responses. All these results contribute to a deep probing into the roles of WRKY transcription factors in maize growth and development and stress tolerance.

  10. Phylogenetic analysis at deep timescales: unreliable gene trees, bypassed hidden support, and the coalescence/concatalescence conundrum.

    Science.gov (United States)

    Gatesy, John; Springer, Mark S

    2014-11-01

    Large datasets are required to solve difficult phylogenetic problems that are deep in the Tree of Life. Currently, two divergent systematic methods are commonly applied to such datasets: the traditional supermatrix approach (= concatenation) and "shortcut" coalescence (= coalescence methods wherein gene trees and the species tree are not co-estimated). When applied to ancient clades, these contrasting frameworks often produce congruent results, but in recent phylogenetic analyses of Placentalia (placental mammals), this is not the case. A recent series of papers has alternatively disputed and defended the utility of shortcut coalescence methods at deep phylogenetic scales. Here, we examine this exchange in the context of published phylogenomic data from Mammalia; in particular we explore two critical issues - the delimitation of data partitions ("genes") in coalescence analysis and hidden support that emerges with the combination of such partitions in phylogenetic studies. Hidden support - increased support for a clade in combined analysis of all data partitions relative to the support evident in separate analyses of the various data partitions, is a hallmark of the supermatrix approach and a primary rationale for concatenating all characters into a single matrix. In the most extreme cases of hidden support, relationships that are contradicted by all gene trees are supported when all of the genes are analyzed together. A valid fear is that shortcut coalescence methods might bypass or distort character support that is hidden in individual loci because small gene fragments are analyzed in isolation. Given the extensive systematic database for Mammalia, the assumptions and applicability of shortcut coalescence methods can be assessed with rigor to complement a small but growing body of simulation work that has directly compared these methods to concatenation. We document several remarkable cases of hidden support in both supermatrix and coalescence paradigms and argue

  11. [Phylogenetic relationships among the genera of Taxodiaceae and Cupressaceae from 28S rDNA sequences].

    Science.gov (United States)

    Li, Chun-Xiang; Yang, Qun

    2003-03-01

    DNA sequences from 28S rDNA were used to assess relationships between and within traditional Taxodiaceae and Cupressaceae s.s. The MP tree and NJ tree generally are similar to one another. The results show that Taxodiaceae and Cupressaceae s.s. form a monophyletic conifer lineage excluding Sciadopitys. In the Taxodiaceae-Cupressaceae s.s. monophyletic group, the Taxodiaceae is paraphyletic. Taxodium, Glyptostrobus and Cryptomeria forming a clade(Taxodioideae), in which Glyptostrobus and Taxodium are closely related and sister to Cryptomeria; Sequoia, Sequoiadendron and Metasequoia are closely related to each other, forming another clade (Sequoioideae), in which Sequoia and Sequoiadendron are closely related and sister to Metasequoia; the seven genera of Cupressaceae s.s. are found to be closely related to form a monophyletic lineage (Cupressoideae). These results are basically similar to analyses from chloroplast gene data. But the relationships among Taiwania, Sequoioideae, Taxodioideae, and Cupressoideae remain unclear because of the slow evolution rate of 28S rDNA, which might best be answered by sequencing more rapidly evolving nuclear genes.

  12. Phylogenetic analysis of Newcastle disease viruses isolated from commercial poultry in Mozambique, 2011 to 2016

    International Nuclear Information System (INIS)

    Mapaco, L.P.; Monjane, I.V.A.; Nhamusso, A.E.; Viljoen, G.J; Dundon, W.G.; Achá, S.J.

    2016-01-01

    Full text: The complete sequence of the fusion (F) protein gene from eleven Newcastle disease viruses (NDV) isolated from commercial poultry in Mozambique between 2011 and 2016 has been generated. The F gene cleavage site motif for all eleven isolates was 112RRRKRF117 indicating that the viruses are virulent. A phylogenetic analysis using the full F gene sequence revealed that the viruses clustered within genotype VIIh and showed a higher similarity to NDVs from South Africa, China and Southeast Asia than to viruses previously described in Mozambique in 1994 to 1995 and 2005. The characterization of these new NDVs has important implications for Newcastle disease management and control in Mozambique. (author)

  13. Phylogenetic analysis of Monascus and new species from honey, pollen and nests of stingless bees

    DEFF Research Database (Denmark)

    Barbosa, R. N.; Leong, Su-lin L.; Vinnere-Pettersson, O.

    2017-01-01

    on this polyphasic approach, the genus Monascus is resolved in nine species, including three new species associated with stingless bees (M. flavipigmentosus sp. nov., M. mellicola sp. nov., M. recifensis sp. nov., M. argentinensis, M. floridanus, M. lunisporas, M. pallens, M. purpureus, M. ruber), and split in two...... new sections (section Floridani sect. nov., section Rubri sect. nov.). Phylogenetic analysis showed that the xerophile Monascus eremophilus does not belong in Monascus and monophyly in Monascus is restored with the transfer of M. eremophilus to Penicillium (P. eremophilum comb. nov.). A list...

  14. Short communication. Genotyping and phylogenetic analysis of bovine viral diarrhea virus (BVDV isolates in Kosovo

    Directory of Open Access Journals (Sweden)

    Izedin Goga

    2014-03-01

    Full Text Available Three serum samples positive in Antigen ELISA BVDV have been tested to characterise genetic diversity of bovine viral diarrhea virus (BVDV in Kosovo. Samples were obtained in 2011 from heifers and were amplified by reverse transcription-polymerase chain reaction, sequenced and analysed by computer-assisted phylogenetic analysis. Amplified products and nucleotide sequence showed that all 3 isolates belonged to BVDV 1 genotype and 1b sub genotype. These results enrich the extant knowledge of BVDV and represent the first documented data about Kosovo BVDV isolates.

  15. Phylogenetic relationships among the species of the genus testudo (Testudines : Testudinidae) inferred from mitochondrial 12S rRNA gene sequences

    NARCIS (Netherlands)

    van der Kuyl, Antoinette C.; Ph Ballasina, Donato L.; Dekker, John T.; Maas, Jolanda; Willemsen, Ronald E.; Goudsmit, Jaap

    2002-01-01

    To test phylogenetic relationships within the genus Testudo (Testudines: Testudinidae), we have sequenced a fragment of the mitochondrial (mt) 12S rRNA gene of 98 tortoise specimens belonging to the genera Testudo, Indotestudo, and Geochelone. Maximum likelihood and neighbor-joining methods identify

  16. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

    Science.gov (United States)

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

    2010-01-01

    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  17. Phylogenetic relationships of the cultivated neotropical palm Bactris gasipaes (arecaceae) with its wild relatives inferred from chloroplast and nuclear DNA polymorphisms

    NARCIS (Netherlands)

    Couvreur, T.L.P.; Hahn, K.; Granville, de J.J.; Pham, J.L.; Ludena, B.; Pintaud, J.C.

    2007-01-01

    Peach palm (Bactris gasipaes Kunth.) is the only Neotropical palm domesticated since pre-Columbian times. It plays an important role not only at the local level due to its very nutritious fruits, but also in the international market for its gourmet palm heart. Phylogenetic relationships of the peach

  18. Phylogenetic analysis of Escherichia coli isolates from healthy and diarrhoeic calves in Mashhad, Iran

    Directory of Open Access Journals (Sweden)

    M. Barzan

    2017-03-01

    Full Text Available Escherichia coli is a normal inhabitant of the gastrointestinal tract of vertebrates. Certain Escherichia coli strains have been associated with neonatal diarrhoea in ruminants. These strains can be assigned to one of the four main phylogenetic groups, A, B1, B2 and D. Several studies have shown the rela-tionship between phylogeny and pathogenicity of E. coli, a great deal can be obtained by determining the phylogroup of unknown E. coli strains. In this study, we aimed to evaluate the influence of diar-rhoea on the genetic composition of E. coli populations isolated from calves. A total of 80 Es-cherichia coli isolates were obtained from healthy and diarrhoeic calves. Phylogenetic grouping was done based on the Clermont triplex PCR method using primers targeted at three genetic markers, chuA, yjaA and TspE4.C2. According to our results, phylogenetic group A strains was the most prevalent in both healthy (37.5% and diarrhoeic calves (55%. Group B1 contained 27.5% of isolates in healthy calves, followed by group B2 (17.5%, and group D (7.5%. Also, four isolates from healthy calves were not included in the major phylogenetic groups or subgroups. A total of 14% and 4% of isolates from diarrhoeic calves beloned to phylogroups B2 and D respectively. Although no isolate from diarrhoeic calves was found to belong to group B1, there was no significant difference between healthy and diarrhoeic calves for other phylogroups. There was not a dramatic shift in E. coli phylogroup/subgroup due to occurrence of diarrhoea in calves, except for phylogroup B1 which was higher in healthy calves. This can be due to the difference in secretions of digestive system in diarrhoeic calves which can prevent the conditions for instability of Escherichia coli isolates of phy-logroup B1. The majority of isolates from both healthy and diarrhoeic calves belonged to non-pathogenic phylogentic group A and B1.

  19. Pachyseris inattesa sp. n. (Cnidaria, Anthozoa, Scleractinia): A new reef coral species from the red sea and its phylogenetic relationships

    KAUST Repository

    Terraneo, Tullia I.; Berumen, Michael L.; Arrigoni, Roberto; Waheed, Zarinah; Bouwmeester, Jessica; Caragnano, Annalisa; Stefani, Fabrizio; Benzoni, Francesca

    2014-01-01

    A new scleractinian coral species, Pachyseris inattesa sp. n., is described from the Red Sea. Despite a superficial resemblance with some species in the agariciid genus Leptoseris with which it has been previously confused, P. inattesa sp. n. has micro-morphological characters typical of the genus Pachyseris. This genus, once part of the Agariciidae, is comprised of five extant species and is widely distributed throughout the tropical Indo-Pacific. It is currently incertae sedis as a result of recent molecular analysis and appears to be closely related to the Euphylliidae. A molecular phylogenetic reconstruction including P. inattesa sp. n., the genus type species P. rugosa, and P. speciosa, all present in the Red Sea, was performed using the mitochondrial intergenic spacer between COI and 16S-rRNA. The results confirm that P. inattesa sp. n. is a monophyletic lineage closely related to the other Pachyseris species examined. © Tullia I. Terraneo et al.

  20. Pachyseris inattesa sp. n. (Cnidaria, Anthozoa, Scleractinia): A new reef coral species from the red sea and its phylogenetic relationships

    KAUST Repository

    Terraneo, Tullia I.

    2014-08-13

    A new scleractinian coral species, Pachyseris inattesa sp. n., is described from the Red Sea. Despite a superficial resemblance with some species in the agariciid genus Leptoseris with which it has been previously confused, P. inattesa sp. n. has micro-morphological characters typical of the genus Pachyseris. This genus, once part of the Agariciidae, is comprised of five extant species and is widely distributed throughout the tropical Indo-Pacific. It is currently incertae sedis as a result of recent molecular analysis and appears to be closely related to the Euphylliidae. A molecular phylogenetic reconstruction including P. inattesa sp. n., the genus type species P. rugosa, and P. speciosa, all present in the Red Sea, was performed using the mitochondrial intergenic spacer between COI and 16S-rRNA. The results confirm that P. inattesa sp. n. is a monophyletic lineage closely related to the other Pachyseris species examined. © Tullia I. Terraneo et al.

  1. Phylogenetic relationships in Solanaceae and related species based on cpDNA sequence from plastid trnE-trnT region

    Directory of Open Access Journals (Sweden)

    Danila Montewka Melotto-Passarin

    2008-01-01

    Full Text Available Intergenic spacers of chloroplast DNA (cpDNA are very useful in phylogenetic and population genetic studiesof plant species, to study their potential integration in phylogenetic analysis. The non-coding trnE-trnT intergenic spacer ofcpDNA was analyzed to assess the nucleotide sequence polymorphism of 16 Solanaceae species and to estimate its ability tocontribute to the resolution of phylogenetic studies of this group. Multiple alignments of DNA sequences of trnE-trnT intergenicspacer made the identification of nucleotide variability in this region possible and the phylogeny was estimated by maximumparsimony and rooted with Convolvulaceae Ipomoea batatas, the most closely related family. Besides, this intergenic spacerwas tested for the phylogenetic ability to differentiate taxonomic levels. For this purpose, species from four other families wereanalyzed and compared with Solanaceae species. Results confirmed polymorphism in the trnE-trnT region at different taxonomiclevels.

  2. Phylogenetic relationships and timing of diversification in gonorynchiform fishes inferred using nuclear gene DNA sequences (Teleostei: Ostariophysi).

    Science.gov (United States)

    Near, Thomas J; Dornburg, Alex; Friedman, Matt

    2014-11-01

    The Gonorynchiformes are the sister lineage of the species-rich Otophysi and provide important insights into the diversification of ostariophysan fishes. Phylogenies of gonorynchiforms inferred using morphological characters and mtDNA gene sequences provide differing resolutions with regard to the sister lineage of all other gonorynchiforms (Chanos vs. Gonorynchus) and support for monophyly of the two miniaturized lineages Cromeria and Grasseichthys. In this study the phylogeny and divergence times of gonorynchiforms are investigated with DNA sequences sampled from nine nuclear genes and a published morphological character matrix. Bayesian phylogenetic analyses reveal substantial congruence among individual gene trees with inferences from eight genes placing Gonorynchus as the sister lineage to all other gonorynchiforms. Seven gene trees resolve Cromeria and Grasseichthys as a clade, supporting previous inferences using morphological characters. Phylogenies resulting from either concatenating the nuclear genes, performing a multispecies coalescent species tree analysis, or combining the morphological and nuclear gene DNA sequences resolve Gonorynchus as the living sister lineage of all other gonorynchiforms, strongly support the monophyly of Cromeria and Grasseichthys, and resolve a clade containing Parakneria, Cromeria, and Grasseichthys. The morphological dataset, which includes 13 gonorynchiform fossil taxa that range in age from Early Cretaceous to Eocene, was analyzed in combination with DNA sequences from the nine nuclear genes and a relaxed molecular clock to estimate times of evolutionary divergence. This "tip dating" strategy accommodates uncertainty in the phylogenetic resolution of fossil taxa that provide calibration information in the relaxed molecular clock analysis. The estimated age of the most recent common ancestor (MRCA) of living gonorynchiforms is slightly older than estimates from previous node dating efforts, but the molecular tip dating

  3. GapCoder automates the use of indel characters in phylogenetic analysis.

    Science.gov (United States)

    Young, Nelson D; Healy, John

    2003-02-19

    Several ways of incorporating indels into phylogenetic analysis have been suggested. Simple indel coding has two strengths: (1) biological realism and (2) efficiency of analysis. In the method, each indel with different start and/or end positions is considered to be a separate character. The presence/absence of these indel characters is then added to the data set. We have written a program, GapCoder to automate this procedure. The program can input PIR format aligned datasets, find the indels and add the indel-based characters. The output is a NEXUS format file, which includes a table showing what region each indel characters is based on. If regions are excluded from analysis, this table makes it easy to identify the corresponding indel characters for exclusion. Manual implementation of the simple indel coding method can be very time-consuming, especially in data sets where indels are numerous and/or overlapping. GapCoder automates this method and is therefore particularly useful during procedures where phylogenetic analyses need to be repeated many times, such as when different alignments are being explored or when various taxon or character sets are being explored. GapCoder is currently available for Windows from http://www.home.duq.edu/~youngnd/GapCoder.

  4. Genetic characterization and phylogenetic analysis of porcine circovirus type 2 (PCV2) in Serbia.

    Science.gov (United States)

    Savic, Bozidar; Milicevic, Vesna; Jakic-Dimic, Dobrila; Bojkovski, Jovan; Prodanovic, Radisa; Kureljusic, Branislav; Potkonjak, Aleksandar; Savic, Borivoje

    2012-01-01

    Porcine circovirus type 2 (PCV2) is the main causative agent of postweaning multisystemic wasting syndrome (PMWS). To characterize and determine the genetic diversity of PCV2 in the porcine population of Serbia, nucleotide and deduced amino acid sequences of the open reading frame 2 (ORF2) of PCV2 collected from the tissues of pigs that either had died as a result of PMWS or did not exhibit disease symptoms were analyzed. Sequencing and phylogenetic analysis showed considerable diversity among PCV2 ORF2 sequences and the existence of two main PCV2 genotypes, PCV2b and PCV2a, with at least three clusters, 1A/B, 1C and 2D. In order to provide further proof that the 1C strain is circulating in the porcine population, the whole viral genome of one PCV2 isolate was sequenced. Genotyping and phylogenetic analysis using the entire viral genome sequences confirmed that there was a PMWS-associated 1C strain emerging in Serbia. Our analysis also showed that PCV2b is dominant in the porcine population, and that it is exclusively associated with PMWS occurrences in the country. These data constitute a useful basis for further epidemiological studies regarding the heterogeneity of PCV2 strains on the European continent.

  5. Phylogenetic analysis of Gossypium L. using restriction fragment length polymorphism of repeated sequences.

    Science.gov (United States)

    Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin

    2015-10-01

    Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.

  6. Monophyly of Archaeplastida supergroup and relationships among its lineages in the light of phylogenetic and phylogenomic studies. Are we close to a consensus?

    Directory of Open Access Journals (Sweden)

    Paweł Mackiewicz

    2014-12-01

    Full Text Available One of the key evolutionary events on the scale of the biosphere was an endosymbiosis between a heterotrophic eukaryote and a cyanobacterium, resulting in a primary plastid. Such an organelle is characteristic of three eukaryotic lineages, glaucophytes, red algae and green plants. The three groups are usually united under the common name Archaeplastida or Plantae in modern taxonomic classifications, which indicates they are considered monophyletic. The methods generally used to verify this monophyly are phylogenetic analyses. In this article we review up-to-date results of such analyses and discussed their inconsistencies. Although phylogenies of plastid genes suggest a single primary endosymbiosis, which is assumed to mean a common origin of the Archaeplastida, different phylogenetic trees based on nuclear markers show monophyly, paraphyly, polyphyly or unresolved topologies of Archaeplastida hosts. The difficulties in reconstructing host cell relationships could result from stochastic and systematic biases in data sets, including different substitution rates and patterns, gene paralogy and horizontal/endosymbiotic gene transfer into eukaryotic lineages, which attract Archaeplastida in phylogenetic trees. Based on results to date, it is neither possible to confirm nor refute alternative evolutionary scenarios to a single primary endosymbiosis. Nevertheless, if trees supporting monophyly are considered, relationships inferred among Archaeplastida lineages can be discussed. Phylogenetic analyses based on nuclear genes clearly show the earlier divergence of glaucophytes from red algae and green plants. Plastid genes suggest a more complicated history, but at least some studies are congruent with this concept. Additional research involving more representatives of glaucophytes and many understudied lineages of Eukaryota can improve inferring phylogenetic relationships related to the Archaeplastida. In addition, alternative approaches not directly

  7. Phylogenetic relationships of Vepris (Rutaceae inferred from chloroplast, nuclear, and morphological data.

    Directory of Open Access Journals (Sweden)

    Cynthia M Morton

    Full Text Available The tribe Toddalieae Hook. F. (Rutaceae has been controversial since its inception by Bentham and Hooker. The nine taxa examined, Acronychia J.R. & G.Foster, Diphasia Pierre, Diphasiopsis Mendonca, Fagaropsis Mildbr.ex. Siebenl., Oricia Pierre, Teclea Delile, Toddaliopsis Engl., Toddalia Juss. and Vepris Comm. ex. A. Juss, have been recognized under the tribe Toddalieae or Tribes Acronychia, Phellodendron and Toddalia. More recently Araliopsis Engl., Diphasia, Diphasiopsis, Oricia, Teclea, and Toddaliopsis have been incorporated into the genus Vepris, while Toddalia and Fagaropsis have continued to be recognized as closely related. For this study, sequence data of one non-coding chloroplast region (trnL-F and one nuclear region (ITS and various morphological characters, based on Mziray's taxonomic studies were examined to try to elucidate these relationships. This study found that the taxa Diphasia, Diphasiopsis, Oricia, Teclea, Toddaliopsis, Vepris, Toddalia eugeniifolia Engl. and Toddalia glomerata F. Hoffm. form a monophyletic group. Due to the amount of intrageneric and intraspecific variation, species delimitations were difficult to determine; however, these genera should be united into Vepris. The analyses also confirmed that Toddalia asiatica (L. Lam., Zanthoxylon sp. and Fagaropsis angolensis (Engl. H.M. Gardner are the closest relatives to this group.

  8. Phylogenetic relationships among Lactuca (Asteraceae) species and related genera based on ITS-1 DNA sequences.

    Science.gov (United States)

    Koopman, W J; Guetta, E; van de Wiel, C C; Vosman, B; van den Berg, R G

    1998-11-01

    Internal transcribed spacer (ITS-1) sequences from 97 accessions representing 23 species of Lactuca and related genera were determined and used to evaluate species relationships of Lactuca sensu lato (s.l.). The ITS-1 phylogenies, calculated using PAUP and PHYLIP, correspond better to the classification of Feráková than to other classifications evaluated, although the inclusion of sect. Lactuca subsect. Cyanicae is not supported. Therefore, exclusion of subsect. Cyanicae from Lactuca sensu Feráková is proposed. The amended genus contains the entire gene pool (sensu Harlan and De Wet) of cultivated lettuce (Lactuca sativa). The position of the species in the amended classification corresponds to their position in the lettuce gene pool. In the ITS-1 phylogenies, a clade with L. sativa, L. serriola, L. dregeana, L. altaica, and L. aculeata represents the primary gene pool. L. virosa and L. saligna, branching off closest to this clade, encompass the secondary gene pool. L. virosa is possibly of hybrid origin. The primary and secondary gene pool species are classified in sect. Lactuca subsect. Lactuca. The species L. quercina, L. viminea, L. sibirica, and L. tatarica, branching off next, represent the tertiary gene pool. They are classified in Lactuca sect. Lactucopsis, sect. Phaenixopus, and sect. Mulgedium, respectively. L. perennis and L. tenerrima, classified in sect. Lactuca subsect. Cyanicae, form clades with species from related genera and are not part of the lettuce gene pool.

  9. Identification and phylogenetic analysis of heme synthesis genes in trypanosomatids and their bacterial endosymbionts.

    Directory of Open Access Journals (Sweden)

    João M P Alves

    Full Text Available It has been known for decades that some insect-infecting trypanosomatids can survive in culture without heme supplementation while others cannot, and that this capability is associated with the presence of a betaproteobacterial endosymbiont in the flagellate's cytoplasm. However, the specific mechanisms involved in this process remained obscure. In this work, we sequence and phylogenetically analyze the heme pathway genes from the symbionts and from their hosts, as well as from a number of heme synthesis-deficient Kinetoplastida. Our results show that the enzymes responsible for synthesis of heme are encoded on the symbiont genomes and produced in close cooperation with the flagellate host. Our evidence suggests that this synergistic relationship is the end result of a history of extensive gene loss and multiple lateral gene transfer events in different branches of the phylogeny of the Trypanosomatidae.

  10. Phylogenetic analysis of rabbit haemorrhagic disease virus (RHDV) strains isolated in Poland.

    Science.gov (United States)

    Fitzner, Andrzej; Niedbalski, Wieslaw

    2017-10-01

    The aim of this study was to characterise the nucleotide and amino acid sequence of complete genomes (7.5 kb) from RHDV strains isolated in Poland and estimate the genetic variability in different elements of the viral RNA. In addition, the sequence of Polish RHDV isolates isolated from 1988-2015 was compared with the sequences of other European RHDV, including the RHDVa and RHDV2/RHDVb subtypes. The complete sequence was developed by the compilation of partial nucleotide sequences. This sequence consisted of approximately 7428 nucleotides. For comparison of nucleotide sequences and the development of phylogenetic trees of Polish RHDV isolates and reference RHDV strains representing the main phylogenetic groups of classical RHDV, RHDVa and RHDV2 as well as the non-pathogenic rabbit lagovirus RCV, the BLAST software with blastn and MEGA6 with neighbour-joining method was applied. The complete nucleotide sequence of Polish isolates of RHDV has also been entered into GenBank. For comparative analysis, nineteen complete sequences representing the main RHDV genetic types available in GenBank were used. The results of phylogenetic analysis of Polish RHDV strains reveals the presence of three classical RHDV genogroups (G2, G4 and G5) and an RHDVa variant (G6). The oldest RHDV isolates (KGM 1988, PD 1989 and MAL 1994) belong to genogroup G2. It can be assumed that the elimination of these strains from the environment probably occurred at the turn of 1994 and 1995. Genogroup G2 was replaced by the phylogenetically younger BLA 1994 and OPO 2004 strains from genogroup G4, which probably originated from the G3 lineage, represented by the Italian strains BS89. The last representatives of classical RHDV in Poland are isolates GSK 1988 and ZD0 2000 from genogroup G5. A single clade contains the Polish RHDV strains from 2004-2015 (GRZ 2004, KRY 2004, L145 2004, W147 2005, SKO 2013, GLE 2013, RED1 2013, STR 2012, STR2 2013, STR 2014, BIE 2015) identified as RHDVa, which clustered

  11. PyElph - a software tool for gel images analysis and phylogenetics

    Directory of Open Access Journals (Sweden)

    Pavel Ana Brânduşa

    2012-01-01

    Full Text Available Abstract Background This paper presents PyElph, a software tool which automatically extracts data from gel images, computes the molecular weights of the analyzed molecules or fragments, compares DNA patterns which result from experiments with molecular genetic markers and, also, generates phylogenetic trees computed by five clustering methods, using the information extracted from the analyzed gel image. The software can be successfully used for population genetics, phylogenetics, taxonomic studies and other applications which require gel image analysis. Researchers and students working in molecular biology and genetics would benefit greatly from the proposed software because it is free, open source, easy to use, has a friendly Graphical User Interface and does not depend on specific image acquisition devices like other commercial programs with similar functionalities do. Results PyElph software tool is entirely implemented in Python which is a very popular programming language among the bioinformatics community. It provides a very friendly Graphical User Interface which was designed in six steps that gradually lead to the results. The user is guided through the following steps: image loading and preparation, lane detection, band detection, molecular weights computation based on a molecular weight marker, band matching and finally, the computation and visualization of phylogenetic trees. A strong point of the software is the visualization component for the processed data. The Graphical User Interface provides operations for image manipulation and highlights lanes, bands and band matching in the analyzed gel image. All the data and images generated in each step can be saved. The software has been tested on several DNA patterns obtained from experiments with different genetic markers. Examples of genetic markers which can be analyzed using PyElph are RFLP (Restriction Fragment Length Polymorphism, AFLP (Amplified Fragment Length Polymorphism, RAPD

  12. Co-Inheritance Analysis within the Domains of Life Substantially Improves Network Inference by Phylogenetic Profiling.

    Directory of Open Access Journals (Sweden)

    Junha Shin

    Full Text Available Phylogenetic profiling, a network inference method based on gene inheritance profiles, has been widely used to construct functional gene networks in microbes. However, its utility for network inference in higher eukaryotes has been limited. An improved algorithm with an in-depth understanding of pathway evolution may overcome this limitation. In this study, we investigated the effects of taxonomic structures on co-inheritance analysis using 2,144 reference species in four query species: Escherichia coli, Saccharomyces cerevisiae, Arabidopsis thaliana, and Homo sapiens. We observed three clusters of reference species based on a principal component analysis of the phylogenetic profiles, which correspond to the three domains of life-Archaea, Bacteria, and Eukaryota-suggesting that pathways inherit primarily within specific domains or lower-ranked taxonomic groups during speciation. Hence, the co-inheritance pattern within a taxonomic group may be eroded by confounding inheritance patterns from irrelevant taxonomic groups. We demonstrated that co-inheritance analysis within domains substantially improved network inference not only in microbe species but also in the higher eukaryotes, including humans. Although we observed two sub-domain clusters of reference species within Eukaryota, co-inheritance analysis within these sub-domain taxonomic groups only marginally improved network inference. Therefore, we conclude that co-inheritance analysis within domains is the optimal approach to network inference with the given reference species. The construction of a series of human gene networks with increasing sample sizes of the reference species for each domain revealed that the size of the high-accuracy networks increased as additional reference species genomes were included, suggesting that within-domain co-inheritance analysis will continue to expand human gene networks as genomes of additional species are sequenced. Taken together, we propose that co

  13. Phylogenetic relationships and genetic diversity of the Polypedates leucomystax complex in Thailand

    Directory of Open Access Journals (Sweden)

    Kittisak Buddhachat

    2018-01-01

    Full Text Available Taxonomic uncertainty of the Asian tree frog Polypedates leucomystax complex presents the challenging task of inferring its biogeographical history. Here, we describe its dispersion and the genetic relationships among different populations in Thailand, where we connect the population of the P. leucomystax complex of the Sunda Islands to the Indochina (mainland population based on analyses of 266 sequences of the mitochondrial cytochrome c oxidase subunit I (COI gene. Our maternal genealogy implies that there are four well-supported lineages in Thailand, consisting of Northern A (clade A: Polypedates sp., Nan (clade B: P. cf. impresus, Southern (clade C: P. cf. leucomystax and Northern D (clade D: P. cf. megacephalus, with Bayesian posterior probability >0.9. Phylogeny and haplotype networks indicate that clades A, B and D are sympatric. In contrast, clade C (P. cf. leucomystax and clade D (P. cf. megacephalus are genetically divergent due to the geographical barrier of the Isthmus of Kra, resulting in an allopatric distribution. Climatic conditions, in particular differences in rainfall on each side of the Isthmus of Kra, may play an important role in limiting the immigration of both clades. For the within-populations of either clades C or D, there was no significant correlation between geographic and genetic distance by the isolation-by-distance test, indicating intraspecific-dispersal of each clade. Population expansion occurred in clade C, whereas clade D showed a constant population. Taken together, the P. leucomystax complex in South East Asia may have diversified under climatic pressure, leading to allopatric and/or sympatric speciation.

  14. Phylogenetic analysis in Myrcia section Aulomyrcia and inferences on plant diversity in the Atlantic rainforest.

    Science.gov (United States)

    Staggemeier, Vanessa Graziele; Diniz-Filho, José Alexandre Felizola; Forest, Félix; Lucas, Eve

    2015-04-01

    Myrcia section Aulomyrcia includes ∼120 species that are endemic to the Neotropics and disjunctly distributed in the moist Amazon and Atlantic coastal forests of Brazil. This paper presents the first comprehensive phylogenetic study of this group and this phylogeny is used as a basis to evaluate recent classification systems and to test alternative hypotheses associated with the history of this clade. Fifty-three taxa were sampled out of the 120 species currently recognized, plus 40 outgroup taxa, for one nuclear marker (ribosomal internal transcribed spacer) and four plastid markers (psbA-trnH, trnL-trnF, trnQ-rpS16 and ndhF). The relationships were reconstructed based on Bayesian and maximum likelihood analyses. Additionally, a likelihood approach, 'geographic state speciation and extinction', was used to estimate region- dependent rates of speciation, extinction and dispersal, comparing historically climatic stable areas (refugia) and unstable areas. Maximum likelihood and Bayesian inferences indicate that Myrcia and Marlierea are polyphyletic, and the internal groupings recovered are characterized by combinations of morphological characters. Phylogenetic relationships support a link between Amazonian and north-eastern species and between north-eastern and south-eastern species. Lower extinction rates within glacial refugia suggest that these areas were important in maintaining diversity in the Atlantic forest biodiversity hotspot. This study provides a robust phylogenetic framework to address important ecological questions for Myrcia s.l. within an evolutionary context, and supports the need to unite taxonomically the two traditional genera Myrcia and Marlierea in an expanded Myrcia s.l. Furthermore, this study offers valuable insights into the diversification of plant species in the highly impacted Atlantic forest of South America; evidence is presented that the lowest extinction rates are found inside refugia and that range expansion from unstable areas

  15. Transcriptional and phylogenetic analysis of five complete ambystomatid salamander mitochondrial genomes.

    Science.gov (United States)

    Samuels, Amy K; Weisrock, David W; Smith, Jeramiah J; France, Katherine J; Walker, John A; Putta, Srikrishna; Voss, S Randal

    2005-04-11

    We report on a study that extended mitochondrial transcript information from a recent EST project to obtain complete mitochondrial genome sequence for 5 tiger salamander complex species (Ambystoma mexicanum, A. t. tigrinum, A. andersoni, A. californiense, and A. dumerilii). We describe, for the first time, aspects of mitochondrial transcription in a representative amphibian, and then use complete mitochondrial sequence data to examine salamander phylogeny at both deep and shallow levels of evolutionary divergence. The available mitochondrial ESTs for A. mexicanum (N=2481) and A. t. tigrinum (N=1205) provided 92% and 87% coverage of the mitochondrial genome, respectively. Complete mitochondrial sequences for all species were rapidly obtained by using long distance PCR and DNA sequencing. A number of genome structural characteristics (base pair length, base composition, gene number, gene boundaries, codon usage) were highly similar among all species and to other distantly related salamanders. Overall, mitochondrial transcription in Ambystoma approximated the pattern observed in other vertebrates. We inferred from the mapping of ESTs onto mtDNA that transcription occurs from both heavy and light strand promoters and continues around the entire length of the mtDNA, followed by post-transcriptional processing. However, the observation of many short transcripts corresponding to rRNA genes indicates that transcription may often terminate prematurely to bias transcription of rRNA genes; indeed an rRNA transcription termination signal sequence was observed immediately following the 16S rRNA gene. Phylogenetic analyses of salamander family relationships consistently grouped Ambystomatidae in a clade containing Cryptobranchidae and Hynobiidae, to the exclusion of Salamandridae. This robust result suggests a novel alternative hypothesis because previous studies have consistently identified Ambystomatidae and Salamandridae as closely related taxa. Phylogenetic analyses of tiger

  16. Phylogenetic analysis of Attalea (Arecaceae): insights on the historical biogeography of a recently diversified Neotropical plant group

    Science.gov (United States)

    Technical Abstract Here we present a dated phylogenetic tree of the neotropical palm genus Attalea (Arecaceae). We used six orthologs from the nuclear WRKY gene family across 98 accessions to address relationships among species and biogeographic hypotheses. Here we found that the formerly recognized...

  17. Molecular phylogenetic analysis of Enterobius vermicularis and development of an 18S ribosomal DNA-targeted diagnostic PCR.

    Science.gov (United States)

    Zelck, Ulrike E; Bialek, Ralf; Weiss, Michael

    2011-04-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed.

  18. Molecular Phylogenetic Analysis of Enterobius vermicularis and Development of an 18S Ribosomal DNA-Targeted Diagnostic PCR▿

    Science.gov (United States)

    Zelck, Ulrike E.; Bialek, Ralf; Weiß, Michael

    2011-01-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed. PMID:21248085

  19. Integrated Automatic Workflow for Phylogenetic Tree Analysis Using Public Access and Local Web Services.

    Science.gov (United States)

    Damkliang, Kasikrit; Tandayya, Pichaya; Sangket, Unitsa; Pasomsub, Ekawat

    2016-11-28

    At the present, coding sequence (CDS) has been discovered and larger CDS is being revealed frequently. Approaches and related tools have also been developed and upgraded concurrently, especially for phylogenetic tree analysis. This paper proposes an integrated automatic Taverna workflow for the phylogenetic tree inferring analysis using public access web services at European Bioinformatics Institute (EMBL-EBI) and Swiss Institute of Bioinformatics (SIB), and our own deployed local web services. The workflow input is a set of CDS in the Fasta format. The workflow supports 1,000 to 20,000 numbers in bootstrapping replication. The workflow performs the tree inferring such as Parsimony (PARS), Distance Matrix - Neighbor Joining (DIST-NJ), and Maximum Likelihood (ML) algorithms of EMBOSS PHYLIPNEW package based on our proposed Multiple Sequence Alignment (MSA) similarity score. The local web services are implemented and deployed into two types using the Soaplab2 and Apache Axis2 deployment. There are SOAP and Java Web Service (JWS) providing WSDL endpoints to Taverna Workbench, a workflow manager. The workflow has been validated, the performance has been measured, and its results have been verified. Our workflow's execution time is less than ten minutes for inferring a tree with 10,000 replicates of the bootstrapping numbers. This paper proposes a new integrated automatic workflow which will be beneficial to the bioinformaticians with an intermediate level of knowledge and experiences. All local services have been deployed at our portal http://bioservices.sci.psu.ac.th.

  20. Analysis of Domain Architecture and Phylogenetics of Family 2 Glycoside Hydrolases (GH2.

    Directory of Open Access Journals (Sweden)

    David Talens-Perales

    Full Text Available In this work we report a detailed analysis of the topology and phylogenetics of family 2 glycoside hydrolases (GH2. We distinguish five topologies or domain architectures based on the presence and distribution of protein domains defined in Pfam and Interpro databases. All of them share a central TIM barrel (catalytic module with two β-sandwich domains (non-catalytic at the N-terminal end, but differ in the occurrence and nature of additional non-catalytic modules at the C-terminal region. Phylogenetic analysis was based on the sequence of the Pfam Glyco_hydro_2_C catalytic module present in most GH2 proteins. Our results led us to propose a model in which evolutionary diversity of GH2 enzymes is driven by the addition of different non-catalytic domains at the C-terminal region. This model accounts for the divergence of β-galactosidases from β-glucuronidases, the diversification of β-galactosidases with different transglycosylation specificities, and the emergence of bicistronic β-galactosidases. This study also allows the identification of groups of functionally uncharacterized protein sequences with potential biotechnological interest.

  1. Molecular typing of canine parvovirus from Sulaimani, Iraq and phylogenetic analysis using partial VP2 gene

    Directory of Open Access Journals (Sweden)

    M.O.Baba Sheikh

    2017-09-01

    Full Text Available Canine parvovirus (CPV remains the most significant viral cause of haemorrhagic enteritis and bloody diarrhoea in puppies over the age of 12 weeks. The objective of the present study was to detect and genotype CPV-2 by polymerase chain reaction (PCR and to perform phylogenetic analysis using partial VP2 gene sequences. We analysed eight faecal samples of unvaccinated dogs with signs of vomiting and bloody diarrhoea during the period from December 2013 to May 2014 in different locations in Sulaimani, Kurdistan, Iraq. After PCR detection, we found that all viral sequences in our study were CPV-2b variants, which differed genetically by 0.8% to 3.6% from five commercially available vaccines. Alignment between eight nucleotides of field virus sequences showed 95% to 99.5% similarity. The phylogenetic analysis for the 8 field sequences formed two distinct clusters with two sequences belonging to strains from China and Thailand and the other six – with a strain from Egypt. Molecular characterisation and CPV typing are crucial in epidemiological studies for future prevention and control of the disease.

  2. Identification and phylogenetic analysis of novel cytochrome P450 1A genes from ungulate species.

    Science.gov (United States)

    Darwish, Wageh Sobhy; Kawai, Yusuke; Ikenaka, Yoshinori; Yamamoto, Hideaki; Muroya, Tarou; Ishizuka, Mayumi

    2010-09-01

    As part of an ongoing effort to understand the biological response of wild and domestic ungulates to different environmental pollutants such as dioxin-like compounds, cDNAs encoding for CYP1A1 and CYP1A2 were cloned and characterized. Four novel CYP1A cDNA fragments from the livers of four wild ungulates (elephant, hippopotamus, tapir and deer) were identified. Three fragments from hippopotamus, tapir and deer were classified as CYP1A2, and the other fragment from elephant was designated as CYP1A1/2. The deduced amino acid sequences of these fragment CYP1As showed identities ranging from 76 to 97% with other animal CYP1As. The phylogenetic analysis of these fragments showed that both elephant and hippopotamus CYP1As made separate branches, while tapir and deer CYP1As were located beside that of horse and cattle respectively in the phylogenetic tree. Analysis of dN/dS ratio among the identified CYP1As indicated that odd toed ungulate CYP1A2s were exposed to different selection pressure.

  3. Confirmation of a novel siadenovirus species detected in raptors: partial sequence and phylogenetic analysis.

    Science.gov (United States)

    Kovács, Endre R; Benko, Mária

    2009-03-01

    Partial genome characterisation of a novel adenovirus, found recently in organ samples of multiple species of dead birds of prey, was carried out by sequence analysis of PCR-amplified DNA fragments. The virus, named as raptor adenovirus 1 (RAdV-1), has originally been detected by a nested PCR method with consensus primers targeting the adenoviral DNA polymerase gene. Phylogenetic analysis with the deduced amino acid sequence of the small PCR product has implied a new siadenovirus type present in the samples. Since virus isolation attempts remained unsuccessful, further characterisation of this putative novel siadenovirus was carried out with the use of PCR on the infected organ samples. The DNA sequence of the central genome part of RAdV-1, encompassing nine full (pTP, 52K, pIIIa, III, pVII, pX, pVI, hexon, protease) and two partial (DNA polymerase and DBP) genes and exceeding 12 kb pairs in size, was determined. Phylogenetic tree reconstructions, based on several genes, unambiguously confirmed the preliminary classification of RAdV-1 as a new species within the genus Siadenovirus. Further study of RAdV-1 is of interest since it represents a rare adenovirus genus of yet undetermined host origin.

  4. Phylogenetic analysis of Demodex caprae based on mitochondrial 16S rDNA sequence.

    Science.gov (United States)

    Zhao, Ya-E; Hu, Li; Ma, Jun-Xian

    2013-11-01

    Demodex caprae infests the hair follicles and sebaceous glands of goats worldwide, which not only seriously impairs goat farming, but also causes a big economic loss. However, there are few reports on the DNA level of D. caprae. To reveal the taxonomic position of D. caprae within the genus Demodex, the present study conducted phylogenetic analysis of D. caprae based on mt16S rDNA sequence data. D. caprae adults and eggs were obtained from a skin nodule of the goat suffering demodicidosis. The mt16S rDNA sequences of individual mite were amplified using specific primers, and then cloned, sequenced, and aligned. The sequence divergence, genetic distance, and transition/transversion rate were computed, and the phylogenetic trees in Demodex were reconstructed. Results revealed the 339-bp partial sequences of six D. caprae isolates were obtained, and the sequence identity was 100% among isolates. The pairwise divergences between D. caprae and Demodex canis or Demodex folliculorum or Demodex brevis were 22.2-24.0%, 24.0-24.9%, and 22.9-23.2%, respectively. The corresponding average genetic distances were 2.840, 2.926, and 2.665, and the average transition/transversion rates were 0.70, 0.55, and 0.54, respectively. The divergences, genetic distances, and transition/transversion rates of D. caprae versus the other three species all reached interspecies level. The five phylogenetic trees all presented that D. caprae clustered with D. brevis first, and then with D. canis, D. folliculorum, and Demodex injai in sequence. In conclusion, D. caprae is an independent species, and it is closer to D. brevis than to D. canis, D. folliculorum, or D. injai.

  5. Using genes as characters and a parsimony analysis to explore the phylogenetic position of turtles.

    Directory of Open Access Journals (Sweden)

    Bin Lu

    Full Text Available The phylogenetic position of turtles within the vertebrate tree of life remains controversial. Conflicting conclusions from different studies are likely a consequence of systematic error in the tree construction process, rather than random error from small amounts of data. Using genomic data, we evaluate the phylogenetic position of turtles with both conventional concatenated data analysis and a "genes as characters" approach. Two datasets were constructed, one with seven species (human, opossum, zebra finch, chicken, green anole, Chinese pond turtle, and western clawed frog and 4584 orthologous genes, and the second with four additional species (soft-shelled turtle, Nile crocodile, royal python, and tuatara but only 1638 genes. Our concatenated data analysis strongly supported turtle as the sister-group to archosaurs (the archosaur hypothesis, similar to several recent genomic data based studies using similar methods. When using genes as characters and gene trees as character-state trees with equal weighting for each gene, however, our parsimony analysis suggested that turtles are possibly sister-group to diapsids, archosaurs, or lepidosaurs. None of these resolutions were strongly supported by bootstraps. Furthermore, our incongruence analysis clearly demonstrated that there is a large amount of inconsistency among genes and most of the conflict relates to the placement of turtles. We conclude that the uncertain placement of turtles is a reflection of the true state of nature. Concatenated data analysis of large and heterogeneous datasets likely suffers from systematic error and over-estimates of confidence as a consequence of a large number of characters. Using genes as characters offers an alternative for phylogenomic analysis. It has potential to reduce systematic error, such as data heterogeneity and long-branch attraction, and it can also avoid problems associated with computation time and model selection. Finally, treating genes as

  6. Using Genes as Characters and a Parsimony Analysis to Explore the Phylogenetic Position of Turtles

    Science.gov (United States)

    Lu, Bin; Yang, Weizhao; Dai, Qiang; Fu, Jinzhong

    2013-01-01

    The phylogenetic position of turtles within the vertebrate tree of life remains controversial. Conflicting conclusions from different studies are likely a consequence of systematic error in the tree construction process, rather than random error from small amounts of data. Using genomic data, we evaluate the phylogenetic position of turtles with both conventional concatenated data analysis and a “genes as characters” approach. Two datasets were constructed, one with seven species (human, opossum, zebra finch, chicken, green anole, Chinese pond turtle, and western clawed frog) and 4584 orthologous genes, and the second with four additional species (soft-shelled turtle, Nile crocodile, royal python, and tuatara) but only 1638 genes. Our concatenated data analysis strongly supported turtle as the sister-group to archosaurs (the archosaur hypothesis), similar to several recent genomic data based studies using similar methods. When using genes as characters and gene trees as character-state trees with equal weighting for each gene, however, our parsimony analysis suggested that turtles are possibly sister-group to diapsids, archosaurs, or lepidosaurs. None of these resolutions were strongly supported by bootstraps. Furthermore, our incongruence analysis clearly demonstrated that there is a large amount of inconsistency among genes and most of the conflict relates to the placement of turtles. We conclude that the uncertain placement of turtles is a reflection of the true state of nature. Concatenated data analysis of large and heterogeneous datasets likely suffers from systematic error and over-estimates of confidence as a consequence of a large number of characters. Using genes as characters offers an alternative for phylogenomic analysis. It has potential to reduce systematic error, such as data heterogeneity and long-branch attraction, and it can also avoid problems associated with computation time and model selection. Finally, treating genes as characters

  7. Karyotype evolution and phylogenetic relationships of hamsters (Cricetidae, Muroidea, Rodentia) inferred from chromosomal painting and banding comparison.

    Science.gov (United States)

    Romanenko, Svetlana A; Volobouev, Vitaly T; Perelman, Polina L; Lebedev, Vladimir S; Serdukova, Natalya A; Trifonov, Vladimir A; Biltueva, Larisa S; Nie, Wenhui; O'Brien, Patricia C M; Bulatova, Nina Sh; Ferguson-Smith, Malcolm A; Yang, Fengtang; Graphodatsky, Alexander S

    2007-01-01

    The evolutionary success of rodents of the superfamily Muroidea makes this taxon the most interesting for evolution studies, including study at the chromosomal level. Chromosome-specific painting probes from the Chinese hamster and the Syrian (golden) hamster were used to delimit homologous chromosomal segments among 15 hamster species from eight genera: Allocricetulus, Calomyscus, Cricetulus, Cricetus, Mesocricetus, Peromyscus, Phodopus and Tscherskia (Cricetidae, Muroidea, Rodentia). Based on results of chromosome painting and G-banding, comparative maps between 20 rodent species have been established. The integrated maps demonstrate a high level of karyotype conservation among species in the Cricetus group (Cricetus, Cricetulus, Allocricetulus) with Tscherskia as its sister group. Species within the genera Mesocricetus and Phodopus also show a high degree of chromosomal conservation. Our results substantiate many of the conclusions suggested by other data and strengthen the topology of the Muroidea phylogenetic tree through the inclusion of genome-wide chromosome rearrangements. The derivation of the muroids karyotypes from the putative ancestral state involved centric fusions, fissions, addition of heterochromatic arms and a great number of inversions. Our results provide further insights into the karyotype relationships of all species investigated.

  8. Mitochondrial haplotype distribution and phylogenetic relationship of an endangered species Reeve's turtle (Mauremys reevesii in East Asia

    Directory of Open Access Journals (Sweden)

    Hong-Shik Oh

    2017-03-01

    Full Text Available This study was examined to reveal haplotype distribution and phylogenetic relationship using mitochondrial DNA CYTB gene sequences of Reeve’s turtle (Mauremys reevesii of East Asia. CYTB sequences of Reeve’s turtles were divided into 6 haplotypes (Hap01–Hap06. Chinese turtles were found in Hap01, Hap02, Hap04, and Hap05, and Hap01 was the highest frequency of 85.0%. Korean Turtles were found in Hap01, Hap03, Hap04, and Hap05, and Hap03 was the highest frequency of 52.1%. Although there was no haplotype which includes only the CYTB sequence exclusive for Reeve’s turtles of Korea, since no CYTB sequence of China was found in Hap03, it would be possible that Hap03 turtles of Korea are separated from those of China. The haplotypes of Reeve’s turtles of East Asia were monophyletic, which indicated that they had been evolved from a single maternal lineage, but went through local evolution after geographical migration and isolation in East Asia.

  9. Molecular characterization and phylogenetic relationship of wild type 1 poliovirus strains circulating across Pakistan and Afghanistan bordering areas during 2010-2012.

    Directory of Open Access Journals (Sweden)

    Shahzad Shaukat

    Full Text Available Pakistan and Afghanistan share a long uncontrolled border with extensive population movement on both sides. Wild poliovirus transmission has never been interrupted in this block due to war against terrorism, poor public health infrastructure, misconceptions about polio vaccines and inadequate immunization activities. All these issues complicate the eradication operations and reinforce the complexity of wiping out poliomyelitis from this region. This study illustrates the origins and routes of cross-border wild poliovirus type 1 (WPV1 transmission during 2010-2012 between Pakistan and Afghanistan. Sequence analyses were conducted based on complete VP1 capsid protein sequences for WPV1 study strains to determine the origin of poliovirus genetic lineages and their evolutionary relationships. Phylogenetic tree was constructed from VP1 gene sequences applying Maximum Likelihood method using Kimura 2- parameter model in MEGA program v 5.0. A total of 72 (14.3% out of 502 wild-type 1 polioviruses were found circulating in border areas of both countries during 2010-2012. Molecular phylogenetic analysis classified these strains in to two sub-genotypes with four clusters and 18 lineages. Genetic data confirmed that the most of WPV1 lineages (12; 66.6% were transmitted from Pakistan to Afghanistan. However, the genetic diversity was significantly reduced during 2012 as most of the lineages were completely eliminated. In conclusion, Pakistan-Afghanistan block has emerged as a single poliovirus reservoir sharing the multiple poliovirus lineages due to uncontrolled movement of people across the borders between two countries. If it is neglected, it can jeopardize the extensive global efforts done so-far to eradicate the poliovirus infection. Our data will be helpful to devise the preventive strategies for effective control of wild poliovirus transmission in this region.

  10. The phylogenetic relationships of insectivores with special reference to the lesser hedgehog tenrec as inferred from the complete sequence of their mitochondrial genome.

    Science.gov (United States)

    Nikaido, Masato; Cao, Ying; Okada, Norihiro; Hasegawa, Masami

    2003-02-01

    The complete mitochondrial genome of a lesser hedgehog tenrec Echinops telfairi was determined in this study. It is an endemic African insectivore that is found specifically in Madagascar. The tenrec's back is covered with hedgehog-like spines. Unlike other spiny mammals, such as spiny mice, spiny rats, spiny dormice and porcupines, lesser hedgehog tenrecs look amazingly like true hedgehogs (Erinaceidae). However, they are distinguished morphologically from hedgehogs by the absence of a jugal bone. We determined the complete sequence of the mitochondrial genome of a lesser hedgehog tenrec and analyzed the results phylogenetically to determine the relationships between the tenrec and other insectivores (moles, shrews and hedgehogs), as well as the relationships between the tenrec and endemic African mammals, classified as Afrotheria, that have recently been shown by molecular analysis to be close relatives of the tenrec. Our data confirmed the afrotherian status of the tenrec, and no direct relation was recovered between the tenrec and the hedgehog. Comparing our data with those of others, we found that within-species variations in the mitochondrial DNA of lesser hedgehog tenrecs appear to be the largest recognized to date among mammals, apart from orangutans, which might be interesting from the view point of evolutionary history of tenrecs on Madagascar.

  11. [Analysis of phylogenetic criteria for estimation of the rank of taxa in methane-oxidizing bacteria].

    Science.gov (United States)

    Romanovskaia, V A; Rokitko, P V

    2011-01-01

    To determine a possibility of application of phylogenetic criteria for estimating the taxa rank, the intra- and interspecies, as well as intergeneric relatedness of methanotrophs on the basis of 16S rRNA gene sequences was estimated. We used sequences of 16S rRNA genes of the studied isolates of obligate methanotrophs which have been deposited in UCM (Ukrainian Collection of Microorganisms), and of type strains of other obligate methanotrophs species (from GenBank database). It is shown, that the levels of interspecies and intergeneric relatedness in different families of methanotrophs are not identical, and therefore they can be used for differentiation of taxa only within one family. The carried out analysis has shown, that it is necessary to reconsider taxonomic position: (1) of two phenotypically similar species of Methylomonas (M. aurantiaca and M. fodinarum), similarity of 16S rRNA genes which is 99.4%, similarity of their total DNA--up to 80% that rather testifies to strain differences, than to species differences; (2) of species Methylomicrobium agile and M album which are phylogenetically more related to genus Methylobacter (97% of affinity), than Methylomicrobium (94% of affinity); (3) of genera of the family Beijerinckiaceae (Methylocella and Methylocapsa), and also genera of the family Methylocystaceae (Methylosinus and Methylocystis), whereas high level of relatedness (97% and more) of these bacteria with other methanotrophic genera (within one family) practically corresponds to a range of relatedness of species (within some genera) in the family Methylococcaceae. When determining phylogenetic criteria which can characterize the ranks of taxa, it was revealed, that the levels of interspecies relatedness of methanotrophic genera of the families Methylocystaceae and Beijerinckiaceae (97.8-99.1% and 97.8%, accordingly) considerably exceed the level of genera formation in the family Methylococcaceae (94.0-98.2%) and, moreover, approach the value of

  12. Development of a multiplex real-time PCR assay for phylogenetic analysis of Uropathogenic Escherichia coli.

    Science.gov (United States)

    Hasanpour, Mojtaba; Najafi, Akram

    2017-06-01

    Uropathogenic Escherichia coli (UPEC) is among major pathogens causing 80-90% of all episodes of urinary tract infections (UTIs). Recently, E. coli strains are divided into eight main phylogenetic groups including A, B1, B2, C, D, E, F, and clade I. This study was aimed to develop a rapid, sensitive, and specific multiplex real time PCR method capable of detecting phylogenetic groups of E. coli strains. This study was carried out on E. coli strains (isolated from the patient with UTI) in which the presence of all seven target genes had been confirmed in our previous phylogenetic study. An EvaGreen-based singleplex and multiplex real-time PCR with melting curve analysis was designed for simultaneous detection and differentiation of these genes. The primers were selected mainly based on the production of amplicons with melting temperatures (T m ) ranging from 82°C to 93°C and temperature difference of more than 1.5°C between each peak.The multiplex real-time PCR assays that have been developed in the present study were successful in detecting the eight main phylogenetic groups. Seven distinct melting peaks were discriminated, with Tm value of 93±0.8 for arpA, 89.2±0.1for chuA, 86.5±0.1 for yjaA, 82.3±0.2 for TspE4C2, 87.8±0.1for trpAgpC, 85.4±0.6 for arpAgpE genes, and 91±0.5 for the internal control. To our knowledge, this study is the first melting curve-based real-time PCR assay developed for simultaneous and discrete detection of these seven target genes. Our findings showed that this assay has the potential to be a rapid, reliable and cost-effective alternative for routine phylotyping of E. coli strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Identification and phylogenetic analysis of Tityus pachyurus and Tityus obscurus novel putative Na+-channel scorpion toxins.

    Directory of Open Access Journals (Sweden)

    Jimmy A Guerrero-Vargas

    Full Text Available Colombia and Brazil are affected by severe cases of scorpionism. In Colombia the most dangerous accidents are caused by Tityus pachyurus that is widely distributed around this country. In the Brazilian Amazonian region scorpion stings are a common event caused by Tityus obscurus. The main objective of this work was to perform the molecular cloning of the putative Na(+-channel scorpion toxins (NaScTxs from T. pachyurus and T. obscurus venom glands and to analyze their phylogenetic relationship with other known NaScTxs from Tityus species.cDNA libraries from venom glands of these two species were constructed and five nucleotide sequences from T. pachyurus were identified as putative modulators of Na(+-channels, and were named Tpa4, Tpa5, Tpa6, Tpa7 and Tpa8; the latter being the first anti-insect excitatory β-class NaScTx in Tityus scorpion venom to be described. Fifteen sequences from T. obscurus were identified as putative NaScTxs, among which three had been previously described, and the others were named To4 to To15. The peptides Tpa4, Tpa5, Tpa6, To6, To7, To9, To10 and To14 are closely related to the α-class NaScTxs, whereas Tpa7, Tpa8, To4, To8, To12 and To15 sequences are more related to the β-class NaScTxs. To5 is possibly an arthropod specific toxin. To11 and To13 share sequence similarities with both α and β NaScTxs. By means of phylogenetic analysis using the Maximum Parsimony method and the known NaScTxs from Tityus species, these toxins were clustered into 14 distinct groups.This communication describes new putative NaScTxs from T. pachyurus and T. obscurus and their phylogenetic analysis. The results indicate clear geographic separation between scorpions of Tityus genus inhabiting the Amazonian and Mountain Andes regions and those distributed over the Southern of the Amazonian rainforest. Based on the consensus sequences for the different clusters, a new nomenclature for the NaScTxs is proposed.

  14. In vitro and in silico cloning of Xenopus laevis SOD2 cDNA and its phylogenetic analysis.

    Science.gov (United States)

    Purrello, Michele; Di Pietro, Cinzia; Ragusa, Marco; Pulvirenti, Alfredo; Giugno, Rosalba; Di Pietro, Valentina; Emmanuele, Giovanni; Travali, Salvo; Scalia, Marina; Shasha, Dennis; Ferro, Alfredo

    2005-02-01

    By using the methodology of both wet and dry biology (i.e., RT-PCR and cycle sequencing, and biocomputational technology, respectively) and the data obtained through the Genome Projects, we have cloned Xenopus laevis SOD2 (MnSOD) cDNA and determined its nucleotide sequence. These data and the deduced protein primary structure were compared with all the other SOD2 nucleotide and amino acid sequences from eukaryotes and prokaryotes, published in public databases. The analysis was performed by using both Clustal W, a well known and widely used program for sequence analysis, and AntiClustAl, a new algorithm recently created and implemented by our group. Our results demonstrate a very high conservation of the enzyme amino acid sequence during evolution, which proves a close structure-function relationship. This is to be expected for very ancient molecules endowed with critical biological functions, performed through a specific structural organization. The nucleotide sequence conservation is less pronounced: this too was foreseeable, due to neutral mutations and to the species-specific codon usage. The data obtained by using AntiClustAl are comparable with those produced with Clustal W, which validates this algorithm as an important new tool for biocomputational analysis. Finally, it is noteworthy that evolutionary trees, drawn by using all the available data on SOD2 nucleotide sequences and amino acid and either Clustal W or AntiClustAl, are comparable to those obtained through phylogenetic analysis based on fossil records.

  15. The performance of the Congruence Among Distance Matrices (CADM test in phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Lapointe François-Joseph

    2011-03-01

    Full Text Available Abstract Background CADM is a statistical test used to estimate the level of Congruence Among Distance Matrices. It has been shown in previous studies to have a correct rate of type I error and good power when applied to dissimilarity matrices and to ultrametric distance matrices. Contrary to most other tests of incongruence used in phylogenetic analysis, the null hypothesis of the CADM test assumes complete incongruence of the phylogenetic trees instead of congruence. In this study, we performed computer simulations to assess the type I error rate and power of the test. It was applied to additive distance matrices representing phylogenies and to genetic distance matrices obtained from nucleotide sequences of different lengths that were simulated on randomly generated trees of varying sizes, and under different evolutionary conditions. Results Our results showed that the test has an accurate type I error rate and good power. As expected, power increased with the number of objects (i.e., taxa, the number of partially or completely congruent matrices and the level of congruence among distance matrices. Conclusions Based on our results, we suggest that CADM is an excellent candidate to test for congruence and, when present, to estimate its level in phylogenomic studies where numerous genes are analysed simultaneously.

  16. MulRF: a software package for phylogenetic analysis using multi-copy gene trees.

    Science.gov (United States)

    Chaudhary, Ruchi; Fernández-Baca, David; Burleigh, John Gordon

    2015-02-01

    MulRF is a platform-independent software package for phylogenetic analysis using multi-copy gene trees. It seeks the species tree that minimizes the Robinson-Foulds (RF) distance to the input trees using a generalization of the RF distance to multi-labeled trees. The underlying generic tree distance measure and fast running time make MulRF useful for inferring phylogenies from large collections of gene trees, in which multiple evolutionary processes as well as phylogenetic error may contribute to gene tree discord. MulRF implements several features for customizing the species tree search and assessing the results, and it provides a user-friendly graphical user interface (GUI) with tree visualization. The species tree search is implemented in C++ and the GUI in Java Swing. MulRF's executable as well as sample datasets and manual are available at http://genome.cs.iastate.edu/CBL/MulRF/, and the source code is available at https://github.com/ruchiherself/MulRFRepo. ruchic@ufl.edu Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  17. Molecular characterization and phylogenetic analysis of small ruminant lentiviruses isolated from Canadian sheep and goats

    Directory of Open Access Journals (Sweden)

    Bertoni Giuseppe

    2011-06-01

    Full Text Available Abstract Background Small Ruminant Lentiviruses (SRLV are widespread in Canadian sheep and goats and represent an important health issue in these animals. There is however no data about the genetic diversity of Caprine Arthritis Encephalitis Virus (CAEV or Maedi Visna Virus (MVV in this country. Findings We performed a molecular and phylogenetic analysis of sheep and goat lentiviruses from a small geographic area in Canada using long sequences from the gag region of 30 infected sheep and 36 infected goats originating from 14 different flocks. Pairwise DNA distance and phylogenetic analyses revealed that all SRLV sequences obtained from sheep clustered tightly with prototypical Maedi visna sequences from America. Similarly, all SRLV strains obtained from goats clustered tightly with prototypical US CAEV-Cork strain. Conclusions The data reported in this study suggests that Canadian and US SRLV strains share common origins. In addition, the molecular data failed to bring to light any evidence of past cross species transmission between sheep and goats, which is consistent with the type of farming practiced in this part of the country where single species flocks predominate and where opportunities of cross species transmissions are proportionately low.

  18. Molecular and phylogenetic analysis of HIV-1 variants circulating in Italy

    Directory of Open Access Journals (Sweden)

    Sbreglia Costanza

    2008-10-01

    Full Text Available Abstract Objective The continuous identification of HIV-1 non-B subtypes and recombinant forms in Italy indicates the need of constant molecular epidemiology survey of genetic forms circulating and transmitted in the resident population. Methods The distribution of HIV-1 subtypes has been evaluated in 25 seropositive individuals residing in Italy, most of whom were infected through a sexual route during the 1995–2005 period. Each sample has been characterized by detailed molecular and phylogenetic analyses. Results 18 of the 25 samples were positive at HIV-1 PCR amplification. Three samples showed a nucleotide divergence compatible with a non-B subtype classification. The phylogenetic analysis, performed on both HIV-1 env and gag regions, confirms the molecular sub-typing prediction, given that 1 sample falls into the C subtype and 2 into the G subtype. The B subtype isolates show high levels of intra-subtype nucleotide divergence, compatible with a long-lasting epidemic and a progressive HIV-1 molecular diversification. Conclusion The Italian HIV-1 epidemic is still mostly attributable to the B subtype, regardless the transmission route, which shows an increasing nucleotide heterogeneity. Heterosexual transmission and the interracial blending, however, are slowly introducing novel HIV-1 subtypes. Therefore, a molecular monitoring is needed to follow the constant evolution of the HIV-1 epidemic.

  19. The performance of the Congruence Among Distance Matrices (CADM) test in phylogenetic analysis

    Science.gov (United States)

    2011-01-01

    Background CADM is a statistical test used to estimate the level of Congruence Among Distance Matrices. It has been shown in previous studies to have a correct rate of type I error and good power when applied to dissimilarity matrices and to ultrametric distance matrices. Contrary to most other tests of incongruence used in phylogenetic analysis, the null hypothesis of the CADM test assumes complete incongruence of the phylogenetic trees instead of congruence. In this study, we performed computer simulations to assess the type I error rate and power of the test. It was applied to additive distance matrices representing phylogenies and to genetic distance matrices obtained from nucleotide sequences of different lengths that were simulated on randomly generated trees of varying sizes, and under different evolutionary conditions. Results Our results showed that the test has an accurate type I error rate and good power. As expected, power increased with the number of objects (i.e., taxa), the number of partially or completely congruent matrices and the level of congruence among distance matrices. Conclusions Based on our results, we suggest that CADM is an excellent candidate to test for congruence and, when present, to estimate its level in phylogenomic studies where numerous genes are analysed simultaneously. PMID:21388552

  20. Phylogenetic analysis of feline immunodeficiency virus strains from naturally infected cats in Belgium and The Netherlands.

    Science.gov (United States)

    Roukaerts, Inge D M; Theuns, Sebastiaan; Taffin, Elien R L; Daminet, Sylvie; Nauwynck, Hans J

    2015-01-22

    Feline immunodeficiency virus (FIV) is a major pathogen in feline populations worldwide, with seroprevalences up to 26%. Virus strains circulating in domestic cats are subdivided into different phylogenetic clades (A-E), based on the genetic diversity of the V3-V4 region of the env gene. In this report, a phylogenetic analysis of the V3-V4 env region, and a variable region in the gag gene was made for 36 FIV strains isolated in Belgium and The Netherlands. All newly generated gag sequences clustered together with previously known clade A FIV viruses, confirming the dominance of clade A viruses in Northern Europe. The same was true for the obtained env sequences, with only one sample of an unknown env subtype. Overall, the genetic diversity of FIV strains sequenced in this report was low. This indicates a relatively recent introduction of FIV in Belgium and The Netherlands. However, the sample with an unknown env subtype indicates that new introductions of FIV from unknown origin do occur and this will likely increase genetic variability in time. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Phylogenetic analysis of West Nile virus isolated in Italy in 2008.

    Science.gov (United States)

    Savini, G; Monaco, F; Calistri, P; Lelli, R

    2008-11-27

    In Italy the first occurrence of West Nile virus (WNV) infection was reported in Tuscany region during the late summer of 1998. In August 2008, the WNV infection re-emerged in Italy, in areas surrounding the Po river delta, and involving three regions Lombardy, Emilia Romagna and Veneto. WNV was isolated from blood and organs samples of one horse, one donkey, one pigeon (Columba livia) and three magpies (Pica pica). The phylogenetic analysis of the isolates, conducted on 255 bp in the region coding for the E protein, indicates that these isolates belong to the lineage I among the European strains. According to the analysis, both the 1998 and 2008 Italian strains as well as isolates from Romania, Russia, Senegal and Kenya fell in the same sub-cluster.

  2. Phylogenetic analysis of the sharpshooter genus Subrasaca Young, 1977 (Hemiptera, Cicadellidae, Cicadellini)

    Science.gov (United States)

    da Silva, Roberta dos Santos; Mejdalani, Gabriel; Cavichioli, Rodney R.

    2015-01-01

    Abstract The South American sharpshooter genus Subrasaca comprises 14 species. Some species of this genus are quite common in the Brazilian Atlantic Rainforest. In this paper, a phylogenetic analysis of Subrasaca, based on a matrix of 20 terminal taxa and 72 morphological characters of the head, thorax, and male and female genitalia, is presented. The analysis yielded six equally most parsimonious trees (197 steps, CI = 0.6091, RI = 0.5722, and RC = 0.3486). The results suggest that Subrasaca is a monophyletic taxon, although the genus branch is not robust. The clade showing the highest bootstrap and Bremer scores is formed by species with longitudinal dark brown to black stripes on the forewings (Subrasaca bimaculata, Subrasaca constricta, Subrasaca curvovittata, and Subrasaca flavolineata), followed by Subrasaca atronasa + Subrasaca austera. PMID:25829841

  3. Phylogenetic analysis of Bacillus subtilis strains applicable to natto (fermented soybean) production.

    Science.gov (United States)

    Kubo, Yuji; Rooney, Alejandro P; Tsukakoshi, Yoshiki; Nakagawa, Rikio; Hasegawa, Hiromasa; Kimura, Keitarou

    2011-09-01

    Spore-forming Bacillus strains that produce extracellular poly-γ-glutamic acid were screened for their application to natto (fermented soybean food) fermentation. Among the 424 strains, including Bacillus subtilis and B. amyloliquefaciens, which we isolated from rice straw, 59 were capable of fermenting natto. Biotin auxotrophism was tightly linked to natto fermentation. A multilocus nucleotide sequence of six genes (rpoB, purH, gyrA, groEL, polC, and 16S rRNA) was used for phylogenetic analysis, and amplified fragment length polymorphism (AFLP) analysis was also conducted on the natto-fermenting strains. The ability to ferment natto was inferred from the two principal components of the AFLP banding pattern, and natto-fermenting strains formed a tight cluster within the B. subtilis subsp. subtilis group.

  4. Phylogenetic Analysis of Bacillus subtilis Strains Applicable to Natto (Fermented Soybean) Production ▿

    Science.gov (United States)

    Kubo, Yuji; Rooney, Alejandro P.; Tsukakoshi, Yoshiki; Nakagawa, Rikio; Hasegawa, Hiromasa; Kimura, Keitarou

    2011-01-01

    Spore-forming Bacillus strains that produce extracellular poly-γ-glutamic acid were screened for their application to natto (fermented soybean food) fermentation. Among the 424 strains, including Bacillus subtilis and B. amyloliquefaciens, which we isolated from rice straw, 59 were capable of fermenting natto. Biotin auxotrophism was tightly linked to natto fermentation. A multilocus nucleotide sequence of six genes (rpoB, purH, gyrA, groEL, polC, and 16S rRNA) was used for phylogenetic analysis, and amplified fragment length polymorphism (AFLP) analysis was also conducted on the natto-fermenting strains. The ability to ferment natto was inferred from the two principal components of the AFLP banding pattern, and natto-fermenting strains formed a tight cluster within the B. subtilis subsp. subtilis group. PMID:21764950

  5. XplorSeq: a software environment for integrated management and phylogenetic analysis of metagenomic sequence data.

    Science.gov (United States)

    Frank, Daniel N

    2008-10-07

    Advances in automated DNA sequencing technology have accelerated the generation of metagenomic DNA sequences, especially environmental ribosomal RNA gene (rDNA) sequences. As the scale of rDNA-based studies of microbial ecology has expanded, need has arisen for software that is capable of managing, annotating, and analyzing the plethora of diverse data accumulated in these projects. XplorSeq is a software package that facilitates the compilation, management and phylogenetic analysis of DNA sequences. XplorSeq was developed for, but is not limited to, high-throughput analysis of environmental rRNA gene sequences. XplorSeq integrates and extends several commonly used UNIX-based analysis tools by use of a Macintosh OS-X-based graphical user interface (GUI). Through this GUI, users may perform basic sequence import and assembly steps (base-calling, vector/primer trimming, contig assembly), perform BLAST (Basic Local Alignment and Search Tool; 123) searches of NCBI and local databases, create multiple sequence alignments, build phylogenetic trees, assemble Operational Taxonomic Units, estimate biodiversity indices, and summarize data in a variety of formats. Furthermore, sequences may be annotated with user-specified meta-data, which then can be used to sort data and organize analyses and reports. A document-based architecture permits parallel analysis of sequence data from multiple clones or amplicons, with sequences and other data stored in a single file. XplorSeq should benefit researchers who are engaged in analyses of environmental sequence data, especially those with little experience using bioinformatics software. Although XplorSeq was developed for management of rDNA sequence data, it can be applied to most any sequencing project. The application is available free of charge for non-commercial use at http://vent.colorado.edu/phyloware.

  6. Genetic Diversity and Phylogenetic Analysis of the Iranian Leishmania Parasites Based on HSP70 Gene PCR-RFLP and Sequence Analysis.

    Science.gov (United States)

    Nemati, Sara; Fazaeli, Asghar; Hajjaran, Homa; Khamesipour, Ali; Anbaran, Mohsen Falahati; Bozorgomid, Arezoo; Zarei, Fatah

    2017-08-01

    Despite the broad distribution of leishmaniasis among Iranians and animals across the country, little is known about the genetic characteristics of the causative agents. Applying both HSP70 PCR-RFLP and sequence analyses, this study aimed to evaluate the genetic diversity and phylogenetic relationships among Leishmania spp. isolated from Iranian endemic foci and available reference strains. A total of 36 Leishmania isolates from almost all districts across the country were genetically analyzed for the HSP70 gene using both PCR-RFLP and sequence analysis. The original HSP70 gene sequences were aligned along with homologous Leishmania sequences retrieved from NCBI, and subjected to the phylogenetic analysis. Basic parameters of genetic diversity were also estimated. The HSP70 PCR-RFLP presented 3 different electrophoretic patterns, with no further intraspecific variation, corresponding to 3 Leishmania species available in the country, L. tropica, L. major, and L. infantum. Phylogenetic analyses presented 5 major clades, corresponding to 5 species complexes. Iranian lineages, including L. major, L. tropica, and L. infantum, were distributed among 3 complexes L. major, L. tropica, and L. donovani. However, within the L. major and L. donovani species complexes, the HSP70 phylogeny was not able to distinguish clearly between the L. major and L. turanica isolates, and between the L. infantum, L. donovani, and L. chagasi isolates, respectively. Our results indicated that both HSP70 PCR-RFLP and sequence analyses are medically applicable tools for identification of Leishmania species in Iranian patients. However, the reduced genetic diversity of the target gene makes it inevitable that its phylogeny only resolves the major groups, namely, the species complexes.

  7. Characterization of the complete mitochondrial genome of Acanthoscelides obtectus (Coleoptera: Chrysomelidae: Bruchinae) with phylogenetic analysis.

    Science.gov (United States)

    Yao, Jie; Yang, Hong; Dai, Renhuai

    2017-10-01

    Acanthoscelides obtectus is a common species of the subfamily Bruchinae and a worldwide-distributed seed-feeding beetle. The complete mitochondrial genome of A. obtectus is 16,130 bp in length with an A + T content of 76.4%. It contains a positive AT skew and a negative GC skew. The mitogenome of A. obtectus contains 13 protein-coding genes (PCGs), 22 tRNA genes, two rRNA genes and a non-coding region (D-loop). All PCGs start with an ATN codon, and seven (ND3, ATP6, COIII, ND3, ND4L, ND6, and Cytb) of them terminate with TAA, while the remaining five (COI, COII, ND1, ND4, and ND5) terminate with a single T, ATP8 terminates with TGA. Except tRNA Ser , the secondary structures of 21 tRNAs that can be folded into a typical clover-leaf structure were identified. The secondary structures of lrRNA and srRNA were also predicted in this study. There are six domains with 48 helices in lrRNA and three domains with 32 helices in srRNA. The control region of A. obtectus is 1354 bp in size with the highest A + T content (83.5%) in a mitochondrial gene. Thirteen PCGs in 19 species have been used to infer their phylogenetic relationships. Our results show that A. obtectus belongs to the family Chrysomelidae (subfamily-Bruchinae). This is the first study on phylogenetic analyses involving the mitochondrial genes of A. obtectus and could provide basic data for future studies of mitochondrial genome diversities and the evolution of related insect lineages.

  8. Phylogenetic relationships of Semaphore geckos (Squamata: Sphaerodactylidae: Pristurus) with an assessment of the taxonomy of Pristurus rupestris.

    Science.gov (United States)

    Badiane, Arnaud; Garcia-Porta, Joan; Červenka, Jan; Kratochvíl, Lukáš; Sindaco, Roberto; Robinson, Michael D; Morales, Hernan; Mazuch, Tomáš; Price, Thomas; Amat, Fèlix; Shobrak, Mohammed Y; Wilms, Thomas; Simó-Riudalbas, Marc; Ahmadzadeh, Faraham; Papenfuss, Theodore J; Cluchier, Alexandre; Viglione, Julien; Carranza, Salvador

    2014-07-09

    A molecular phylogeny of the sphaerodactylid geckos of the genus Pristurus is inferred based on an alignment of 1845 base pairs (bp) of concatenated mitochondrial (12S) and nuclear (acm4, cmos, rag1 and rag2) genes for 80 individuals, representing 18 of the 23-26 species, and the three subspecies of P. rupestris. The results indicate that P. rupestris is polyphyletic and includes two highly divergent clades: the eastern clade, found in coastal Iran and throughout the Hajar Mountain range in northern Oman and eastern UAE; and the western clade, distributed from central coastal Oman, through Yemen, Saudi Arabia and north to southern Jordan. Inferred haplotype networks for the four nuclear genes show that the eastern and western clades of "P. rupestris" are highly differentiated and do not share any alleles. Moreover, although the two clades are differentiated by a morphological multivariate analysis, no one character or set of characters was found to be diagnostic. Based on the molecular analysis of specimens from the type locality of P. rupestris rupestris, the name P. rupestris is applied to the eastern clade. The name that should apply to the western clade cannot be clarified until morphological and genetic data for "P. rupestris" is available from the vicinity of Bosaso, Somalia, and therefore we refer to it as Pristurus sp. 1. The phylogenetic tree of Pristurus supports the hypothesis that P. celerrimus is sister to all the other species in the analyses and that the Socotra Archipelago was independently colonized a minimum of two times.

  9. Morphological re-description and phylogenetic relationship of five myxosporean species of the family Myxobolidae infecting Nile tilapia.

    Science.gov (United States)

    Abdel-Gaber, Rewaida; Abdel-Ghaffar, Fathy; Maher, Sherein; El-Mallah, Al-Mahy; Al Quraishy, Saleh; Mehlhorn, Heinz

    2017-05-11

    Freshwater fish have a major economic and nutritional importance worldwide. Myxosporeans are highly dangerous parasites that infect different fish species, causing severe damage to a large number of economically important species, especially in aquaculture. We conducted a survey of myxosporean parasites infecting Nile tilapia Oreochromis niloticus (Perciformes: Cichlidae) collected from different localities along the River Nile passing through Giza province, Egypt. Out of 100 fish specimens collected, 45 were found to be naturally infected with these parasites in the region of the trunk kidney. Light microscopic examination revealed the presence of 5 distinct myxosporean species belonging to 2 different genera, viz. Myxobolus and Triangula, belonging to the family Myxobolidae; all 5 species have been previously described. Morphological characteristics, host specificity and geographical distribution, tissue tropism, and molecular analysis of the partial sequence of small subunit ribosomal DNA gene revealed that the recovered myxosporean species described herein were genetically distinct from other myxozoan species but had 95% sequence similarity to M. cerebralis. Also, phylogenetic analysis placed the present myxosporean species in the freshwater Myxobolus clade, which is a sister group of freshwater Myxobolus/Henneguya species.

  10. Phylogenetic analysis of bacterial and archaeal arsC gene sequences suggests an ancient, common origin for arsenate reductase

    Directory of Open Access Journals (Sweden)

    Dugas Sandra L

    2003-07-01

    Full Text Available Abstract Background The ars gene system provides arsenic resistance for a variety of microorganisms and can be chromosomal or plasmid-borne. The arsC gene, which codes for an arsenate reductase is essential for arsenate resistance and transforms arsenate into arsenite, which is extruded from the cell. A survey of GenBank shows that arsC appears to be phylogenetically widespread both in organisms with known arsenic resistance and those organisms that have been sequenced as part of whole genome projects. Results Phylogenetic analysis of aligned arsC sequences shows broad similarities to the established 16S rRNA phylogeny, with separation of bacterial, archaeal, and subsequently eukaryotic arsC genes. However, inconsistencies between arsC and 16S rRNA are apparent for some taxa. Cyanobacteria and some of the γ-Proteobacteria appear to possess arsC genes that are similar to those of Low GC Gram-positive Bacteria, and other isolated taxa possess arsC genes that would not be expected based on known evolutionary relationships. There is no clear separation of plasmid-borne and chromosomal arsC genes, although a number of the Enterobacteriales (γ-Proteobacteria possess similar plasmid-encoded arsC sequences. Conclusion The overall phylogeny of the arsenate reductases suggests a single, early origin of the arsC gene and subsequent sequence divergence to give the distinct arsC classes that exist today. Discrepancies between 16S rRNA and arsC phylogenies support the role of horizontal gene transfer (HGT in the evolution of arsenate reductases, with a number of instances of HGT early in bacterial arsC evolution. Plasmid-borne arsC genes are not monophyletic suggesting multiple cases of chromosomal-plasmid exchange and subsequent HGT. Overall, arsC phylogeny is complex and is likely the result of a number of evolutionary mechanisms.

  11. Phylogenetic Tree Analysis of the Cold-Hot Nature of Traditional Chinese Marine Medicine for Possible Anticancer Activity

    Directory of Open Access Journals (Sweden)

    Xianjun Fu

    2017-01-01

    Full Text Available Traditional Chinese Marine Medicine (TCMM represents one of the medicinal resources for research and development of novel anticancer drugs. In this study, to investigate the presence of anticancer activity (AA displayed by cold or hot nature of TCMM, we analyzed the association relationship and the distribution regularity of TCMMs with different nature (613 TCMMs originated from 1,091 species of marine organisms via association rules mining and phylogenetic tree analysis. The screened association rules were collected from three taxonomy groups: (1 Bacteria superkingdom, Phaeophyceae class, Fucales order, Sargassaceae family, and Sargassum genus; (2 Viridiplantae kingdom, Streptophyta phylum, Malpighiales class, and Rhizophoraceae family; (3 Holothuroidea class, Aspidochirotida order, and Holothuria genus. Our analyses showed that TCMMs with closer taxonomic relationship were more likely to possess anticancer bioactivity. We found that the cluster pattern of marine organisms with reported AA tended to cluster with cold nature TCMMs. Moreover, TCMMs with salty-cold nature demonstrated properties for softening hard mass and removing stasis to treat cancers, and species within Metazoa or Viridiplantae kingdom of cold nature were more likely to contain AA properties. We propose that TCMMs from these marine groups may enable focused bioprospecting for discovery of novel anticancer drugs derived from marine bioresources.

  12. Ixodes ricinus tick lipocalins: identification, cloning, phylogenetic analysis and biochemical characterization.

    Directory of Open Access Journals (Sweden)

    Jérôme Beaufays

    Full Text Available BACKGROUND: During their blood meal, ticks secrete a wide variety of proteins that interfere with their host's defense mechanisms. Among these proteins, lipocalins play a major role in the modulation of the inflammatory response. METHODOLOGY/PRINCIPAL FINDINGS: Screening a cDNA library in association with RT-PCR and RACE methodologies allowed us to identify 14 new lipocalin genes in the salivary glands of the Ixodes ricinus hard tick. A computational in-depth structural analysis confirmed that LIRs belong to the lipocalin family. These proteins were called LIR for "Lipocalin from I. ricinus" and numbered from 1 to 14 (LIR1 to LIR14. According to their percentage identity/similarity, LIR proteins may be assigned to 6 distinct phylogenetic groups. The mature proteins have calculated pM and pI varying from 21.8 kDa to 37.2 kDa and from 4.45 to 9.57 respectively. In a western blot analysis, all recombinant LIRs appeared as a series of thin bands at 50-70 kDa, suggesting extensive glycosylation, which was experimentally confirmed by treatment with N-glycosidase F. In addition, the in vivo expression analysis of LIRs in I. ricinus, examined by RT-PCR, showed homogeneous expression profiles for certain phylogenetic groups and relatively heterogeneous profiles for other groups. Finally, we demonstrated that LIR6 codes for a protein that specifically binds leukotriene B4. CONCLUSIONS/SIGNIFICANCE: This work confirms that, regarding their biochemical properties, expression profile, and sequence signature, lipocalins in Ixodes hard tick genus, and more specifically in the Ixodes ricinus species, are segregated into distinct phylogenetic groups suggesting potential distinct function. This was particularly demonstrated by the ability of LIR6 to scavenge leukotriene B4. The other LIRs did not bind any of the ligands tested, such as 5-hydroxytryptamine, ADP, norepinephrine, platelet activating factor, prostaglandins D2 and E2, and finally leukotrienes B4 and C

  13. Phylogenetic trees

    OpenAIRE

    Baños, Hector; Bushek, Nathaniel; Davidson, Ruth; Gross, Elizabeth; Harris, Pamela E.; Krone, Robert; Long, Colby; Stewart, Allen; Walker, Robert

    2016-01-01

    We introduce the package PhylogeneticTrees for Macaulay2 which allows users to compute phylogenetic invariants for group-based tree models. We provide some background information on phylogenetic algebraic geometry and show how the package PhylogeneticTrees can be used to calculate a generating set for a phylogenetic ideal as well as a lower bound for its dimension. Finally, we show how methods within the package can be used to compute a generating set for the join of any two ideals.

  14. Complete Plastid Genome Sequencing of Four Tilia Species (Malvaceae: A Comparative Analysis and Phylogenetic Implications.

    Directory of Open Access Journals (Sweden)

    Jie Cai

    Full Text Available Tilia is an ecologically and economically important genus in the family Malvaceae. However, there is no complete plastid genome of Tilia sequenced to date, and the taxonomy of Tilia is difficult owing to frequent hybridization and polyploidization. A well-supported interspecific relationships of this genus is not available due to limited informative sites from the commonly used molecular markers. We report here the complete plastid genome sequences of four Tilia species determined by the Illumina technology. The Tilia plastid genome is 162,653 bp to 162,796 bp in length, encoding 113 unique genes and a total number of 130 genes. The gene order and organization of the Tilia plastid genome exhibits the general structure of angiosperms and is very similar to other published plastid genomes of Malvaceae. As other long-lived tree genera, the sequence divergence among the four Tilia plastid genomes is very low. And we analyzed the nucleotide substitution patterns and the evolution of insertions and deletions in the Tilia plastid genomes. Finally, we build a phylogeny of the four sampled Tilia species with high supports using plastid phylogenomics, suggesting that it is an efficient way to resolve the phylogenetic relationships of this genus.

  15. Phylogenetic analysis of some Newcastle disease virus isolates from the Sudan

    Directory of Open Access Journals (Sweden)

    N.A. Elmardi

    2016-06-01

    Full Text Available A reverse transcription-polymerase chain reaction (RT-PCR was used to amplify 1412 bp of the fusion protein gene (F gene of four Newcastle disease virus (NDV isolates; two velogenic (TY-1/90 and DIK-90 and two lentogenic isolates (Dongla 88/1 and GD.S.1. Following sequencing, nucleotide sequences were annotated and 894 bp were compared phylogenetically with those from strains previously reported in the Sudan and the virus strains published on the GenBank. It could be demonstrated that TY-1/90 and DIK-90 strains belong to the genotype VI of NDV and are in close genetic relationship to sub- genotype VIb. TY-1/90 and DIK-90 strains were observed to be genetically unrelated to the earlier Sudanese isolates of 1970/80s and the late of 2000s suggesting a different origin. The close genetic relationship to the European and African pigeon paramyxovirus type 1 (PPMV-1 suggests a common ancestor. Dongola, GD.S.1 strains were classified into genotype II that comprises non-pathogenic lentogenic NDV strains. The present genetic classification of NDV isolates of the Sudan provides valuable information on genotypes of NDV. Further molecular epidemiological investigations of the recent outbreaks of Newcastle disease in the Sudan are needed in order to improve the efficiency of control strategies and vaccine development.

  16. Phylogenetic diversity and biodiversity indices on phylogenetic networks.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-04-01

    In biodiversity conservation it is often necessary to prioritize the species to conserve. Existing approaches to prioritization, e.g. the Fair Proportion Index and the Shapley Value, are based on phylogenetic trees and rank species according to their contribution to overall phylogenetic diversity. However, in many cases evolution is not treelike and thus, phylogenetic networks have been developed as a generalization of phylogenetic trees, allowing for the representation of non-treelike evolutionary events, such as hybridization. Here, we extend the concepts of phylogenetic diversity and phylogenetic diversity indices from phylogenetic trees to phylogenetic networks. On the one hand, we consider the treelike content of a phylogenetic network, e.g. the (multi)set of phylogenetic trees displayed by a network and the so-called lowest stable ancestor tree associated with it. On the other hand, we derive the phylogenetic diversity of subsets of taxa and biodiversity indices directly from the internal structure of the network. We consider both approaches that are independent of so-called inheritance probabilities as well as approaches that explicitly incorporate these probabilities. Furthermore, we introduce our software package NetDiversity, which is implemented in Perl and allows for the calculation of all generalized measures of phylogenetic diversity and generalized phylogenetic diversity indices established in this note that are independent of inheritance probabilities. We apply our methods to a phylogenetic network representing the evolutionary relationships among swordtails and platyfishes (Xiphophorus: Poeciliidae), a group of species characterized by widespread hybridization. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Arthropod phylogenetics in light of three novel millipede (myriapoda: diplopoda) mitochondrial genomes with comments on the appropriateness of mitochondrial genome sequence data for inferring deep level relationships.

    Science.gov (United States)

    Brewer, Michael S; Swafford, Lynn; Spruill, Chad L; Bond, Jason E

    2013-01-01

    Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly). As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic signal renders the resulting tree topologies as suspect

  18. Arthropod phylogenetics in light of three novel millipede (myriapoda: diplopoda mitochondrial genomes with comments on the appropriateness of mitochondrial genome sequence data for inferring deep level relationships.

    Directory of Open Access Journals (Sweden)

    Michael S Brewer

    Full Text Available BACKGROUND: Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. RESULTS: The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly. As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. CONCLUSIONS: The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic

  19. Phylogenetic relationships and biogeography of the groundwater-dwelling amphipod genus Pseudoniphargus (Crustacea), with emphasis on the Iberian species

    NARCIS (Netherlands)

    Notenboom, Jos

    1988-01-01

    Numerical phylogenetic methods are applied in order to arrive at synapomorphic similarities between species of the stygobiont amphipod genus Pseudoniphargus. Character polarity is assessed by comparison with the relevant outgroups Parapseudoniphargus and Allomelita, within a cluster of presumedly

  20. Short segment search method for phylogenetic analysis using nested sliding windows

    Science.gov (United States)

    Iskandar, A. A.; Bustamam, A.; Trimarsanto, H.

    2017-10-01

    To analyze phylogenetics in Bioinformatics, coding DNA sequences (CDS) segment is needed for maximal accuracy. However, analysis by CDS cost a lot of time and money, so a short representative segment by CDS, which is envelope protein segment or non-structural 3 (NS3) segment is necessary. After sliding window is implemented, a better short segment than envelope protein segment and NS3 is found. This paper will discuss a mathematical method to analyze sequences using nested sliding window to find a short segment which is representative for the whole genome. The result shows that our method can find a short segment which more representative about 6.57% in topological view to CDS segment than an Envelope segment or NS3 segment.

  1. Isolation and phylogenetic analysis of canine distemper virus among domestic dogs in Vietnam.

    Science.gov (United States)

    Nguyen, Dung Van; Suzuki, Junko; Minami, Shohei; Yonemitsu, Kenzo; Nagata, Nao; Kuwata, Ryusei; Shimoda, Hiroshi; Vu, Chien Kim; Truong, Thuy Quoc; Maeda, Ken

    2017-01-20

    Canine distemper virus (CDV) is one of the most serious pathogens found in many species of carnivores, including domestic dogs. In this study, hemagglutinin (H) genes were detected in five domestic Vietnamese dogs with diarrhea, and two CDVs were successfully isolated from dogs positive for H genes. The complete genome of one isolate, CDV/dog/HCM/33/140816, was determined. Phylogenetic analysis showed that all Vietnamese CDVs belonged to the Asia-1 genotype. In addition, the H proteins of Vietnamese CDV strains were the most homologous to those of Chinese CDVs (98.4% to 99.3% identity). These results indicated that the Asia-1 genotype of CDV was the predominant genotype circulating among the domestic dog population in Vietnam and that transboundary transmission of CDV has occurred between Vietnam and China.

  2. Phylogenetic analysis to define feline immunodeficiency virus subtypes in 31 domestic cats in South Africa

    Directory of Open Access Journals (Sweden)

    R. Kann

    2006-06-01

    Full Text Available Feline immunodeficiency virus (FIV, a lentivirus, is an important pathogen of domestic cats around the world and has many similarities to human immunodeficiency virus (HIV. A characteristic of these lentiviruses is their extensive genetic diversity, which has been an obstacle in the development of successful vaccines. Of the FIV genes, the envelope gene is the most variable and sequence differences in a portion of this gene have been used to define 5 FIV subtypes (A, B, C, D and E. In this study, the proviral DNA sequence of the V3-V5 region of the envelope gene was determined in blood samples from 31 FIV positive cats from 4 different regions of South Africa. Phylogenetic analysis demonstrated the presence of both subtypes A and C, with subtype A predominating. These findings contribute to the understanding of the genetic diversity of FIV.

  3. Sequencing, description and phylogenetic analysis of the mitochondrial genome of Sarcocheilichthys sinensis sinensis (Cypriniformes: Cyprinidae).

    Science.gov (United States)

    Li, Chen; He, Liping; Chen, Chong; Cai, Lingchao; Chen, Pingping; Yang, Shoubao

    2016-01-01

    Sarcocheilichthys sinensis sinensis (Bleeker, 1871), is a small benthopelagic freshwater species with high nutritional and ornamental value. In this study, the complete mitochondrial genome of S. sinensis sinensis was determined; the phylogenetic analysis with another individual and closely related species of Sarcocheilichthys fishes was carried out. The complete mitogenome of S. sinensis sinensis was 16683 bp in length, consist of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and 2 non-coding regions: (D-loop and OL). It indicated that D-loop, ND2, and CytB may be appropriate molecular markers for studying population genetics and conservation biology of Sarcocheilichthys fishes.

  4. Isolation and Phylogenetic Analysis of Thermophile Community Within Tanjung Sakti Hot Spring, South Sumatera, Indonesia

    Directory of Open Access Journals (Sweden)

    Heni Yohandini

    2015-07-01

    Full Text Available A community of thermophiles within Tanjung Sakti Hot Spring (South Sumatera have been cultivated and identified based on 16S ribosomal RNA gene sequence. The hot spring has temperature 80 °C–91 °C and pH 7–8. We used a simple method for culturing the microbes, by enriching the spring water with nutrient broth media. Phylogenetic analysis showed that the method could recover microbes, which clustered within four distinct taxonomic groups: Anoxybacillus, Geobacillus, Brevibacillus, and Bacillus. These microbes closely related to Anoxybacillus rupiensis, Anoxybacillus flavithermus, Geobacillus pallidus, Brevibacillus thermoruber, Bacillus licheniformis, and Bacillus thermoamylovorans. The 16S ribosomal RNA gene sequence of one isolate only had 96% similarity with Brevibacillus sequence in GenBank.

  5. Multiple alignment analysis on phylogenetic tree of the spread of SARS epidemic using distance method

    Science.gov (United States)

    Amiroch, S.; Pradana, M. S.; Irawan, M. I.; Mukhlash, I.

    2017-09-01

    Multiple Alignment (MA) is a particularly important tool for studying the viral genome and determine the evolutionary process of the specific virus. Application of MA in the case of the spread of the Severe acute respiratory syndrome (SARS) epidemic is an interesting thing because this virus epidemic a few years ago spread so quickly that medical attention in many countries. Although there has been a lot of software to process multiple sequences, but the use of pairwise alignment to process MA is very important to consider. In previous research, the alignment between the sequences to process MA algorithm, Super Pairwise Alignment, but in this study used a dynamic programming algorithm Needleman wunchs simulated in Matlab. From the analysis of MA obtained and stable region and unstable which indicates the position where the mutation occurs, the system network topology that produced the phylogenetic tree of the SARS epidemic distance method, and system area networks mutation.

  6. Comparative myology of the unicornfishes, Naso (Acanthuridae, Percomorpha), with implications for phylogenetic analysis.

    Science.gov (United States)

    Borden, W Calvin

    1999-02-01

    Striated muscles of 15 species of unicornfishes (Naso, Acanthuridae) are described in detail. Of 93 muscles dissected, only five demonstrate intrageneric variation, providing only ten characters suitable for phylogenetic analysis. Thus, myology appears to be highly conservative at the species level and has been so for approximately 50-55 million years in this particular group of fishes. Furthermore, myology is static relative to osteology in Naso and at any taxonomic rank within fishes, implying osteology provides a larger but not necessarily more valuable data source for systematic studies. Although important for their epistomological value, these descriptions provide a basis for further studies ranging from functional, comparative, and systematic analyses, ultimately with the potential to address questions of historical ecology (i.e., speciation, adaptation, coevolution) within Naso. J. Morphol. 239:191-224, 1999. © 1999 Wiley-Liss, Inc. Copyright © 1999 Wiley-Liss, Inc.

  7. Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.

    Science.gov (United States)

    Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng

    2017-07-01

    The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.

  8. Phylogenetic relationships within Echinococcus and Taenia tapeworms (Cestoda: Taeniidae): an inference from nuclear protein-coding genes.

    Science.gov (United States)

    Knapp, Jenny; Nakao, Minoru; Yanagida, Tetsuya; Okamoto, Munehiro; Saarma, Urmas; Lavikainen, Antti; Ito, Akira

    2011-12-01

    The family Taeniidae of tapeworms is composed of two genera, Echinococcus and Taenia, which obligately parasitize mammals including humans. Inferring phylogeny via molecular markers is the only way to trace back their evolutionary histories. However, molecular dating approaches are lacking so far. Here we established new markers from nuclear protein-coding genes for RNA polymerase II second largest subunit (rpb2), phosphoenolpyruvate carboxykinase (pepck) and DNA polymerase delta (pold). Bayesian inference and maximum likelihood analyses of the concatenated gene sequences allowed us to reconstruct phylogenetic trees for taeniid parasites. The tree topologies clearly demonstrated that Taenia is paraphyletic and that the clade of Echinococcus oligarthrus and Echinococcusvogeli is sister to all other members of Echinococcus. Both species are endemic in Central and South America, and their definitive hosts originated from carnivores that immigrated from North America after the formation of the Panamanian land bridge about 3 million years ago (Ma). A time-calibrated phylogeny was estimated by a Bayesian relaxed-clock method based on the assumption that the most recent common ancestor of E. oligarthrus and E. vogeli existed during the late Pliocene (3.0 Ma). The results suggest that a clade of Taenia including human-pathogenic species diversified primarily in the late Miocene (11.2 Ma), whereas Echinococcus started to diversify later, in the end of the Miocene (5.8 Ma). Close genetic relationships among the members of Echinococcus imply that the genus is a young group in which speciation and global radiation occurred rapidly. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. Genetic Diversity and Phylogenetic Relationships of Cytochrome C Oxidase Subunit I in Cimex hemipterus (Hemiptera: Cimicidae) Populations in Malaysia.

    Science.gov (United States)

    Seri Masran, Siti Nor Ain; Ab Majid, Abdul Hafiz

    2017-07-01

    The tropical bed bug is scientifically recognized as a significant public health problem. While there is an increased awareness about their resurgence by medical and life science committees, efficient bed bug management still remains unresolved. The solution may soon arise, as information about bed bugs' infestation dynamics and systematics are becoming more distinguishable. Recent developments in studies about bed bugs are based on molecular intervention by determining their genetic variation and phylogeography. The aim of this study is to assess the phylogenetic relationships and genetic diversity among the populations of tropical bed bugs inhabiting Malaysia. A molecular genotyping study was conducted with 22 tropical bed bug populations composed of three individuals per population. The mitochondrial (COI) gene was used as a marker. The data obtained were analyzed using the T-Coffee, ClustalX, MEGA 6.0, and PAUP software. The results showed one main monophyletic clade that consisted of two groups: Ch01 and Ch02. Ch02 consists of samples from the Bandar Hilir population, differing from the other populations studied by one singleton base. However, as there were no changes in the amino acid, this singleton genetic variation was considered to have no effect on genetic differentiation. Ch01 shows similarity with some sequence of Cimex hemipterus (F.) from Thailand, suggesting an international diversity connection. The disparity index apparently suggests that all isolates are homogeneous populations and are supported by the low value of the mean pairwise distance between isolates. This study will increase the knowledge about phylogeographic diversity of tropical bed bug in Malaysia. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. Coalescent-Based Analyses of Genomic Sequence Data Provide a Robust Resolution of Phylogenetic Relationships among Major Groups of Gibbons

    Science.gov (United States)

    Shi, Cheng-Min; Yang, Ziheng

    2018-01-01

    Abstract The phylogenetic relationships among extant gibbon species remain unresolved despite numerous efforts using morphological, behavorial, and genetic data and the sequencing of whole genomes. A major challenge in reconstructing the gibbon phylogeny is the radiative speciation process, which resulted in extremely short internal branches in the species phylogeny and extensive incomplete lineage sorting with extensive gene-tree heterogeneity across the genome. Here, we analyze two genomic-scale data sets, with ∼10,000 putative noncoding and exonic loci, respectively, to estimate the species tree for the major groups of gibbons. We used the Bayesian full-likelihood method bpp under the multispecies coalescent model, which naturally accommodates incomplete lineage sorting and uncertainties in the gene trees. For comparison, we included three heuristic coalescent-based methods (mp-est, SVDQuartets, and astral) as well as concatenation. From both data sets, we infer the phylogeny for the four extant gibbon genera to be (Hylobates, (Nomascus, (Hoolock, Symphalangus))). We used simulation guided by the real data to evaluate the accuracy of the methods used. Astral, while not as efficient as bpp, performed well in estimation of the species tree even in presence of excessive incomplete lineage sorting. Concatenation, mp-est and SVDQuartets were unreliable when the species tree contains very short internal branches. Likelihood ratio test of gene flow suggests a small amount of migration from Hylobates moloch to H. pileatus, while cross-genera migration is absent or rare. Our results highlight the utility of coalescent-based methods in addressing challenging species tree problems characterized by short internal branches and rampant gene tree-species tree discordance. PMID:29087487

  11. Phylogenetic relationship of the Brazilian isolates of the rat lungworm Angiostrongylus cantonensis (Nematoda: Metastrongylidae employing mitochondrial COI gene sequence data

    Directory of Open Access Journals (Sweden)

    Monte Tainá CC

    2012-11-01

    Full Text Available Abstract Background The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode’s main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI gene sequences. Methods The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. Results The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8 from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. Conclusion The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions.

  12. Phylogenetic relationship of the Brazilian isolates of the rat lungworm Angiostrongylus cantonensis (Nematoda: Metastrongylidae) employing mitochondrial COI gene sequence data

    Science.gov (United States)

    2012-01-01

    Background The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode’s main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI) gene sequences. Methods The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. Results The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8) from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. Conclusion The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions. PMID:23130987

  13. Phylogenetic relationship of the Brazilian isolates of the rat lungworm Angiostrongylus cantonensis (Nematoda: Metastrongylidae) employing mitochondrial COI gene sequence data.

    Science.gov (United States)

    Monte, Tainá C C; Simões, Raquel O; Oliveira, Ana Paula M; Novaes, Clodoaldo F; Thiengo, Silvana C; Silva, Alexandre J; Estrela, Pedro C; Maldonado, Arnaldo

    2012-11-06

    The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode's main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI) gene sequences. The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8) from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions.

  14. Reconstruction of phylogenetic relationships in a highly reticulate group with deep coalescence and recent speciation (Hieracium, Asteraceae).

    Science.gov (United States)

    Krak, K; Caklová, P; Chrtek, J; Fehrer, J

    2013-02-01

    Phylogeny reconstruction based on multiple unlinked markers is often hampered by incongruent gene trees, especially in closely related species complexes with high degrees of hybridization and polyploidy. To investigate the particular strengths and limitations of chloroplast DNA (cpDNA), low-copy nuclear and multicopy nuclear markers for elucidating the evolutionary history of such groups, we focus on Hieracium s.str., a predominantly apomictic genus combining the above-mentioned features. Sequences of the trnV-ndhC and trnT-trnL intergenic spacers were combined for phylogenetic analyses of cpDNA. Part of the highly variable gene for squalene synthase (sqs) was applied as a low-copy nuclear marker. Both gene trees were compared with previous results based on the multicopy external transcribed spacer (ETS) of the nuclear ribosomal DNA. The power of the different markers to detect hybridization varied, but they largely agreed on particular hybrid and allopolyploid origins. The same crown groups of species were recognizable in each dataset, but basal relationships were strongly incongruent among cpDNA, sqs and ETS trees. The ETS tree was considered as the best approximation of the species tree. Both cpDNA and sqs trees showed basal polytomies as well as merging or splitting of species groups of non-hybrid taxa. These patterns can be best explained by a rapid diversification of the genus with ancestral polymorphism and incomplete lineage sorting. A hypothetical scenario of Hieracium speciation based on all available (including non-molecular) evidence is depicted. Incorporation of seemingly contradictory information helped to better understand species origins and evolutionary patterns in this notoriously difficult agamic complex.

  15. Phylogenetic analysis of 23S rRNA gene sequences of some ...

    African Journals Online (AJOL)

    Tuoyo Aghomotsegin

    2016-08-31

    Aug 31, 2016 ... ... bacteria that can establish a symbiotic relationship with the roots of leguminous plants ... The bacterial cultures of isolates were grown in Yeast Extract ... determined by counting the number of colonies formed. Data analysis.

  16. Phylogenetic analysis of cercospora and mycosphaerella based on the internal transcribed spacer region of ribosomal DNA.

    Science.gov (United States)

    Goodwin, S B; Dunkle, L D; Zismann, V L

    2001-07-01

    ABSTRACT Most of the 3,000 named species in the genus Cercospora have no known sexual stage, although a Mycosphaerella teleomorph has been identified for a few. Mycosphaerella is an extremely large and important genus of plant pathogens, with more than 1,800 named species and at least 43 associated anamorph genera. The goal of this research was to perform a large-scale phylogenetic analysis to test hypotheses about the past evolutionary history of Cercospora and Mycosphaerella. Based on the phylogenetic analysis of internal transcribed spacer (ITS) sequence data (ITS1, 5.8S rRNA gene, ITS2), the genus Mycosphaerella is monophyletic. In contrast, many anamorph genera within Mycosphaerella were polyphyletic and were not useful for grouping species. One exception was Cercospora, which formed a highly supported monophyletic group. Most Cercospora species from cereal crops formed a subgroup within the main Cercospora cluster. Only species within the Cercospora cluster produced the toxin cercosporin, suggesting that the ability to produce this compound had a single evolutionary origin. Intraspecific variation for 25 taxa in the Mycosphaerella clade averaged 1.7 nucleotides (nts) in the ITS region. Thus, isolates with ITS sequences that differ by two or more nucleotides may be distinct species. ITS sequences of groups I and II of the gray leaf spot pathogen Cercospora zeae-maydis differed by 7 nts and clearly represent different species. There were 6.5 nt differences on average between the ITS sequences of the sorghum pathogen Cercospora sorghi and the maize pathogen Cercospora sorghi var. maydis, indicating that the latter is a separate species and not simply a variety of Cercospora sorghi. The large monophyletic Mycosphaerella cluster contained a number of anamorph genera with no known teleomorph associations. Therefore, the number of anamorph genera related to Mycosphaerella may be much larger than suspected previously.

  17. Identification, expression and phylogenetic analysis of EgG1Y162 from Echinococcus granulosus

    Science.gov (United States)

    Zhang, Fengbo; Ma, Xiumin; Zhu, Yuejie; Wang, Hongying; Liu, Xianfei; Zhu, Min; Ma, Haimei; Wen, Hao; Fan, Haining; Ding, Jianbing

    2014-01-01

    Objective: This study was to clone, identify and analyze the characteristics of egG1Y162 gene from Echinococcus granulosus. Methods: Genomic DNA and total RNAs were extracted from four different developmental stages of protoscolex, germinal layer, adult and egg of Echinococcus granulosus, respectively. Fluorescent quantitative PCR was used for analyzing the expression of egG1Y162 gene. Prokaryotic expression plasmid of pET41a-EgG1Y162 was constructed to express recombinant His-EgG1Y162 antigen. Western blot analysis was performed to detect antigenicity of EgG1Y162 antigen. Gene sequence, amino acid alignment and phylogenetic tree of EgG1Y162 were analyzed by BLAST, online Spidey and MEGA4 software, respectively. Results: EgG1Y162 gene was expressed in four developmental stages of Echinococcus granulosus. And, egG1Y162 gene expression was the highest in the adult stage, with the relative value of 19.526, significantly higher than other three stages. Additionally, Western blot analysis revealed that EgG1Y162 recombinant protein had good reaction with serum samples from Echinococcus granulosus infected human and dog. Moreover, EgG1Y162 antigen was phylogenetically closest to EmY162 antigen, with the similarity over 90%. Conclusion: Our study identified EgG1Y162 antigen in Echinococcus granulosus for the first time. EgG1Y162 antigen had a high similarity with EmY162 antigen, with the genetic differences mainly existing in the intron region. And, EgG1Y162 recombinant protein showed good antigenicity. PMID:25337206

  18. Detection and phylogenetic analysis of infectious pancreatic necrosis virus in Chile.

    Science.gov (United States)

    Tapia, D; Eissler, Y; Torres, P; Jorquera, E; Espinoza, J C; Kuznar, J

    2015-10-27

    Infectious pancreatic necrosis virus (IPNV) is the etiological agent of a highly contagious disease that is endemic to salmon farming in Chile and causes great economic losses to the industry. Here we compared different diagnostic methods to detect IPNV in field samples, including 3 real-time reverse transcription PCR (qRT-PCR) assays, cell culture isolation, and indirect fluorescent antibody test (IFAT). Additionally, we performed a phylogenetic analysis to investigate the genogroups prevailing in Chile, as well as their geographic distribution and virulence. The 3 qRT-PCR assays used primers that targeted regions of the VP2 and VP1 genes of the virus and were tested in 46 samples, presenting a fair agreement within their results. All samples were positive for at least 2 of the qRT-PCR assays, 29 were positive for cell culture, and 23 for IFAT, showing less sensitivity for these latter 2 methods. For the phylogenetic analysis, portions of 1180 and 523 bp of the VP2 region of segment A were amplified by RT-PCR, sequenced and compared with sequences from reference strains and from isolates reported by previous studies carried out in Chile. Most of the sequenced isolates belonged to genogroup 5 (European origin), and 5 were classified within genogroup 1 (American origin). Chilean isolates formed clusters within each of the genogroups found, evidencing a clear differentiation from the reference strains. To our knowledge, this is the most extensive study completed for IPNV in Chile, covering isolates from sea- and freshwater salmon farms and showing a high prevalence of this virus in the country.

  19. Identification, expression and phylogenetic analysis of EgG1Y162 from Echinococcus granulosus.

    Science.gov (United States)

    Zhang, Fengbo; Ma, Xiumin; Zhu, Yuejie; Wang, Hongying; Liu, Xianfei; Zhu, Min; Ma, Haimei; Wen, Hao; Fan, Haining; Ding, Jianbing

    2014-01-01

    This study was to clone, identify and analyze the characteristics of egG1Y162 gene from Echinococcus granulosus. Genomic DNA and total RNAs were extracted from four different developmental stages of protoscolex, germinal layer, adult and egg of Echinococcus granulosus, respectively. Fluorescent quantitative PCR was used for analyzing the expression of egG1Y162 gene. Prokaryotic expression plasmid of pET41a-EgG1Y162 was constructed to express recombinant His-EgG1Y162 antigen. Western blot analysis was performed to detect antigenicity of EgG1Y162 antigen. Gene sequence, amino acid alignment and phylogenetic tree of EgG1Y162 were analyzed by BLAST, online Spidey and MEGA4 software, respectively. EgG1Y162 gene was expressed in four developmental stages of Echinococcus granulosus. And, egG1Y162 gene expression was the highest in the adult stage, with the relative value of 19.526, significantly higher than other three stages. Additionally, Western blot analysis revealed that EgG1Y162 recombinant protein had good reaction with serum samples from Echinococcus granulosus infected human and dog. Moreover, EgG1Y162 antigen was phylogenetically closest to EmY162 antigen, with the similarity over 90%. Our study identified EgG1Y162 antigen in Echinococcus granulosus for the first time. EgG1Y162 antigen had a high similarity with EmY162 antigen, with the genetic differences mainly existing in the intron region. And, EgG1Y162 recombinant protein showed good antigenicity.

  20. Assessment of phylogenetic relationship of rare plant species collected from Saudi Arabia using internal transcribed spacer sequences of nuclear ribosomal DNA.

    Science.gov (United States)

    Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A

    2013-03-11

    The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.

  1. Simultaneous analysis of five molecular markers provides a well-supported phylogenetic hypothesis for the living bony-tongue fishes (Osteoglossomorpha: Teleostei).

    Science.gov (United States)

    Lavoué, Sébastien; Sullivan, John P

    2004-10-01

    Fishes of the Superorder Osteoglossomorpha (the "bonytongues") constitute a morphologically heterogeneous group of basal teleosts, including highly derived subgroups such as African electric fishes, the African butterfly fish, and Old World knifefishes. Lack of consensus among hypotheses of osteoglossomorph relationships advanced during the past 30 years may be due in part to the difficulty of identifying shared derived characters among the morphologically differentiated extant families of this group. In this study, we present a novel phylogenetic hypothesis for this group, based on the analysis of more than 4000 characters from five molecular markers (the mitochondrial cytochrome b, 12S and 16S rRNA genes, and the nuclear genes RAG2 and MLL). Our taxonomic sampling includes one representative of each extant non-mormyrid osteoglossomorph genus, one representative for the monophyletic family Mormyridae, and four outgroup taxa within the basal Teleostei. Maximum parsimony analysis of combined and equally weighted characters from the five molecular markers and Bayesian analysis provide a single, well-supported, hypothesis of osteoglossomorph interrelationships and show the group to be monophyletic. The tree topology is the following: (Hiodon alosoides, (Pantodon buchholzi, (((Osteoglossum bicirrhosum, Scleropages sp.), (Arapaima gigas, Heterotis niloticus)), ((Gymnarchus niloticus, Ivindomyrus opdenboschi), ((Notopterus notopterus, Chitala ornata), (Xenomystus nigri, Papyrocranus afer)))))). We compare our results with previously published phylogenetic hypotheses based on morpho-anatomical data. Additionally, we explore the consequences of the long terminal branch length for the taxon Pantodon buchholzi in our phylogenetic reconstruction and we use the obtained phylogenetic tree to reconstruct the evolutionary history of electroreception in the Notopteroidei.

  2. A multi-locus plastid phylogenetic analysis of the pantropical genus Diospyros (Ebenaceae), with an emphasis on the radiation and biogeographic origins of the New Caledonian endemic species

    OpenAIRE

    Duangjai, S.; Samuel, R.; Munzinger, Jérôme; Forest, F.; Wallnofer, B.; Barfuss, M.H.J.; Fischer, G.; Chase, M. W.

    2009-01-01

    We aimed to clarify phylogenetic relationships within the pantropical genus Diospyros (Ebenaceae sensu lato), and ascertain biogeographical patterns in the New Caledonian endemic species. We used DNA sequences from eight plastid regions (rbcL, atpB, matK, ndhF, trnK intron, trnL intron, trnL-trnF spacer, and trnS-trnG spacer) and included 149 accessions representing 119 Diospyros species in our analysis. Results from this study confirmed the monophyly of Diospyros with good support and provid...

  3. Phylogenetic analysis of local-scale tree soil associations in a lowland moist tropical forest.

    Directory of Open Access Journals (Sweden)

    Laura A Schreeg

    Full Text Available BACKGROUND: Local plant-soil associations are commonly studied at the species-level, while associations at the level of nodes within a phylogeny have been less well explored. Understanding associations within a phylogenetic context, however, can improve our ability to make predictions across systems and can advance our understanding of the role of evolutionary history in structuring communities. METHODOLOGY/PRINCIPAL FINDINGS: Here we quantified evolutionary signal in plant-soil associations using a DNA sequence-based community phylogeny and several soil variables (e.g., extractable phosphorus, aluminum and manganese, pH, and slope as a proxy for soil water. We used published plant distributional data from the 50-ha plot on Barro Colorado Island (BCI, Republic of Panamá. Our results suggest some groups of closely related species do share similar soil associations. Most notably, the node shared by Myrtaceae and Vochysiaceae was associated with high levels of aluminum, a potentially toxic element. The node shared by Apocynaceae was associated with high extractable phosphorus, a nutrient that could be limiting on a taxon specific level. The node shared by the large group of Laurales and Magnoliales was associated with both low extractable phosphorus and with steeper slope. Despite significant node-specific associations, this study detected little to no phylogeny-wide signal. We consider the majority of the 'traits' (i.e., soil variables evaluated to fall within the category of ecological traits. We suggest that, given this category of traits, phylogeny-wide signal might not be expected while node-specific signals can still indicate phylogenetic structure with respect to the variable of interest. CONCLUSIONS: Within the BCI forest dynamics plot, distributions of some plant taxa are associated with local-scale differences in soil variables when evaluated at individual nodes within the phylogenetic tree, but they are not detectable by phylogeny

  4. An improved model for whole genome phylogenetic analysis by Fourier transform.

    Science.gov (United States)

    Yin, Changchuan; Yau, Stephen S-T

    2015-10-07

    and demonstrates that the improved DFT dissimilarity measure is an efficient and effective similarity measure of DNA sequences. Due to its high efficiency and accuracy, the proposed DFT similarity measure is successfully applied on phylogenetic analysis for individual genes and large whole bacterial genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Climate and life-history evolution in evening primroses (Oenothera, Onagraceae): a phylogenetic comparative analysis.

    Science.gov (United States)

    Evans, Margaret E K; Hearn, David J; Hahn, William J; Spangle, Jennifer M; Venable, D Lawrence

    2005-09-01

    Evolutionary ecologists have long sought to understand the conditions under which perennial (iteroparous) versus annual (semelparous) plant life histories are favored. We evaluated the idea that aridity and variation in the length of droughts should favor the evolution of an annual life history, both by decreasing adult survival and by increasing the potential for high seedling survival via reduced plant cover. We calculated phylogenetically independent contrasts of climate with respect to life history in a clade of winter-establishing evening primroses (sections Anogra and Kleinia; Oenothera; Onagraceae), which includes seven annuals, 12 perennials, and two variable taxa. Climate variables were quantified from long-term records at weather stations near collection localities. To explicitly account for phylogenetic uncertainty, contrasts were calculated on a random sample of phylogenetic trees from the posterior distribution of a Bayesian analysis of DNA sequence data. Statements of association are based on comparing the per-tree mean contrast, which has a null expectation of zero, to a set of per-tree mean contrasts calculated on the same trees, after randomizing the climate data. As predicted, increased annual aridity, increased annual potential evapotranspiration, and decreased annual precipitation were associated with transitions to the annual habit, but these trends were not significantly different from the null pattern. Transitions to the annual habit were not significantly associated with increases in one measure of aridity in summer nor with increased summer drought, but they were associated with significantly increased maximum summer temperatures. In winter, increased aridity and decreased precipitation were significantly associated with transitions to the annual habit. Changes in life history were not significantly associated with changes in the coefficient of variation of precipitation, either on an annual or seasonal (summer vs. winter) basis. Though we

  6. Clinical features and phylogenetic analysis of Coxsackievirus A9 in Northern Taiwan in 2011

    Directory of Open Access Journals (Sweden)

    Huang Yi-Chuan

    2013-01-01

    Full Text Available Abstract Background Coxsackievirus A9 (CA9 was one of the most prevalent serotype of enteroviral infections in Taiwan in 2011. After several patient series were reported in the 1960s and 1970s, few studies have focused on the clinical manifestations of CA9 infections. Our study explores and deepens the current understanding of CA9. Methods We analyzed the clinical presentations of 100 culture-proven CA9-infected patients in 2011 by reviewing their medical records and depicted the CA9 phylogenetic tree. Results Of the 100 patients with culture-proven CA9 infections, the mean (SD age was 4.6 (3.4 years and the male to female ratio was 1.9. For clinical manifestations, 96 patients (96% had fever and the mean (SD duration of fever was 5.9 (3.4 days. Sixty one patients (61% developed a skin rash, and the predominant pattern was a generalized non-itchy maculopapular rash without vesicular changes. While most patients showed injected throat, oral ulcers were found in only 19 cases (19%, among whom, 6 were diagnosed as herpangina. Complicated cases included: aseptic meningitis (n=8, bronchopneumonia (n=6, acute cerebellitis (n=1, and polio-like syndrome (n=1. Phylogenetic analysis for current CA9 strains is closest to the CA9 isolate 27-YN-2008 from the border area of mainland China and Myanmar. Conclusions The most common feature of CA9 during the 2011 epidemic in Taiwan is generalized febrile exanthema rather than herpangina or hand, foot, and mouth disease. Given that prolonged fever and some complications are possible, caution should be advised in assessing patients as well as in predicting the clinical course.