WorldWideScience

Sample records for relationships phylogenetic analysis

  1. Phylogenetic diversity and relationships among species of genus ...

    African Journals Online (AJOL)

    Fifty six Nicotiana species were used to construct phylogenetic trees and to asses the genetic relationships between them. Genetic distances estimated from RAPD analysis was used to construct phylogenetic trees using Phylogenetic Inference Package (PHYLIP). Since phylogenetic relationships estimated for closely ...

  2. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    NIRAJ SINGH

    for phylogenetic analysis of Gladiolus and related taxa using combined datasets from chloroplast genome. The psbA–trnH ... phylogenetic relationships among cultivars could be useful for hybridization programmes for further improvement of the crop. [Singh N. ... breeding in nature, and exhibited diverse pollination mech-.

  3. Open Reading Frame Phylogenetic Analysis on the Cloud

    Directory of Open Access Journals (Sweden)

    Che-Lun Hung

    2013-01-01

    Full Text Available Phylogenetic analysis has become essential in researching the evolutionary relationships between viruses. These relationships are depicted on phylogenetic trees, in which viruses are grouped based on sequence similarity. Viral evolutionary relationships are identified from open reading frames rather than from complete sequences. Recently, cloud computing has become popular for developing internet-based bioinformatics tools. Biocloud is an efficient, scalable, and robust bioinformatics computing service. In this paper, we propose a cloud-based open reading frame phylogenetic analysis service. The proposed service integrates the Hadoop framework, virtualization technology, and phylogenetic analysis methods to provide a high-availability, large-scale bioservice. In a case study, we analyze the phylogenetic relationships among Norovirus. Evolutionary relationships are elucidated by aligning different open reading frame sequences. The proposed platform correctly identifies the evolutionary relationships between members of Norovirus.

  4. Molecular characterization and phylogenetic relationships among ...

    African Journals Online (AJOL)

    Molecular characterization and phylogenetic relationships among and within species of Phalaenopsis (Epidendroideae: Orchidaceae) based on RAPD analysis. ... Ph. parishii, Ph. labbi nepal, Ph. speciosa, Ph. lobbi yellow, Ph. venosa, Ph. hieroglyphica, and Ph. maculata; the third group consisted of Ph. minho princess, ...

  5. Conformation of phylogenetic relationship of Penaeidae shrimp based on morphometric and molecular investigations.

    Science.gov (United States)

    Rajakumaran, P; Vaseeharan, B; Jayakumar, R; Chidambara, R

    2014-01-01

    Understanding of accurate phylogenetic relationship among Penaeidae shrimp is important for academic and fisheries industry. The Morphometric and Randomly amplified polymorphic DNA (RAPD) analysis was used to make the phylogenetic relationsip among 13 Penaeidae shrimp. For morphometric analysis forty variables and total lengths of shrimp were measured for each species, and removed the effect of size variation. The size normalized values obtained was subjected to UPGMA (Unweighted Pair-Group Method with Arithmetic Mean) cluster analysis. For RAPD analysis, the four primers showed reliable differentiation between species, and used correlation coefficient between the DNA banding patterns of 13 Penaeidae species to construct UPGMA dendrogram. Phylogenetic relationship from morphometric and molecular analysis for Penaeidae species found to be congruent. We concluded that as the results from morphometry investigations concur with molecular one, phylogenetic relationship obtained for the studied Penaeidae are considered to be reliable.

  6. PHYLOGENETIC RELATIONSHIPS AMONGST 10 Durio SPECIES BASED ON PCR-RFLP ANALYSIS OF TWO CHLOROPLAST GENES

    Directory of Open Access Journals (Sweden)

    Panca J. Santoso

    2013-07-01

    Full Text Available Twenty seven species of Durio have been identified in Sabah and Sarawak, Malaysia, but their relationships have not been studied. This study was conducted to analyse phylogenetic relationships amongst 10 Durio species in Malaysia using PCR-RFLP on two chloroplast DNA genes, i.e. ndhC-trnV and rbcL. DNAs were extracted from young leaves of 11 accessions from 10 Durio species collected from the Tenom Agriculture Research Station, Sabah, and University Agriculture Park, Universiti Putra Malaysia. Two pairs of oligonucleotide primers, N1-N2 and rbcL1-rbcL2, were used to flank the target regions ndhC-trnV and rbcL. Eight restriction enzymes, HindIII, BsuRI, PstI, TaqI, MspI, SmaI, BshNI, and EcoR130I, were used to digest the amplicons. Based on the results of PCR-RFLP on ndhC-trnV gene, the 10 Durio species were grouped into five distinct clusters, and the accessions generally showed high variations. However, based on the results of PCR-RFLP on the rbcL gene, the species were grouped into three distinct clusters, and generally showed low variations. This means that ndhC-trnV gene is more reliable for phylogenetic analysis in lower taxonomic level of Durio species or for diversity analysis, while rbcL gene is reliable marker for phylogenetic analysis at higher taxonomic level. PCR-RFLP on the ndhC-trnV and rbcL genes could therefore be considered as useful markers to phylogenetic analysis amongst Durio species. These finding might be used for further molecular marker assisted in Durio breeding program.

  7. An attempt to reconstruct phylogenetic relationships within Caribbean nummulitids: simulating relationships and tracing character evolution

    Science.gov (United States)

    Eder, Wolfgang; Ives Torres-Silva, Ana; Hohenegger, Johann

    2017-04-01

    Phylogenetic analysis and trees based on molecular data are broadly applied and used to infer genetical and biogeographic relationship in recent larger foraminifera. Molecular phylogenetic is intensively used within recent nummulitids, however for fossil representatives these trees are only of minor informational value. Hence, within paleontological studies a phylogenetic approach through morphometric analysis is of much higher value. To tackle phylogenetic relationships within the nummulitid family, a much higher number of morphological character must be measured than are commonly used in biometric studies, where mostly parameters describing embryonic size (e.g., proloculus diameter, deuteroloculus diameter) and/or the marginal spiral (e.g., spiral diagrams, spiral indices) are studied. For this purpose 11 growth-independent and/or growth-invariant characters have been used to describe the morphological variability of equatorial thin sections of seven Carribbean nummulitid taxa (Nummulites striatoreticulatus, N. macgillavry, Palaeonummulites willcoxi, P.floridensis, P. soldadensis, P.trinitatensis and P.ocalanus) and one outgroup taxon (Ranikothalia bermudezi). Using these characters, phylogenetic trees were calculated using a restricted maximum likelihood algorithm (REML), and results are cross-checked by ordination and cluster analysis. Square-change parsimony method has been run to reconstruct ancestral states, as well as to simulate the evolution of the chosen characters along the calculated phylogenetic tree and, independent - contrast analysis was used to estimate confidence intervals. Based on these simulations, phylogenetic tendencies of certain characters proposed for nummulitids (e.g., Cope's rule or nepionic acceleration) can be tested, whether these tendencies are valid for the whole family or only for certain clades. At least, within the Carribean nummulitids, phylogenetic trends along some growth-independent characters of the embryo (e.g., first

  8. SICLE: a high-throughput tool for extracting evolutionary relationships from phylogenetic trees.

    Science.gov (United States)

    DeBlasio, Dan F; Wisecaver, Jennifer H

    2016-01-01

    We present the phylogeny analysis software SICLE (Sister Clade Extractor), an easy-to-use, high-throughput tool to describe the nearest neighbors to a node of interest in a phylogenetic tree as well as the support value for the relationship. The application is a command line utility that can be embedded into a phylogenetic analysis pipeline or can be used as a subroutine within another C++ program. As a test case, we applied this new tool to the published phylome of Salinibacter ruber, a species of halophilic Bacteriodetes, identifying 13 unique sister relationships to S. ruber across the 4,589 gene phylogenies. S. ruber grouped with bacteria, most often other Bacteriodetes, in the majority of phylogenies, but 91 phylogenies showed a branch-supported sister association between S. ruber and Archaea, an evolutionarily intriguing relationship indicative of horizontal gene transfer. This test case demonstrates how SICLE makes it possible to summarize the phylogenetic information produced by automated phylogenetic pipelines to rapidly identify and quantify the possible evolutionary relationships that merit further investigation. SICLE is available for free for noncommercial use at http://eebweb.arizona.edu/sicle/.

  9. SICLE: a high-throughput tool for extracting evolutionary relationships from phylogenetic trees

    Directory of Open Access Journals (Sweden)

    Dan F. DeBlasio

    2016-08-01

    Full Text Available We present the phylogeny analysis software SICLE (Sister Clade Extractor, an easy-to-use, high-throughput tool to describe the nearest neighbors to a node of interest in a phylogenetic tree as well as the support value for the relationship. The application is a command line utility that can be embedded into a phylogenetic analysis pipeline or can be used as a subroutine within another C++ program. As a test case, we applied this new tool to the published phylome of Salinibacter ruber, a species of halophilic Bacteriodetes, identifying 13 unique sister relationships to S. ruber across the 4,589 gene phylogenies. S. ruber grouped with bacteria, most often other Bacteriodetes, in the majority of phylogenies, but 91 phylogenies showed a branch-supported sister association between S. ruber and Archaea, an evolutionarily intriguing relationship indicative of horizontal gene transfer. This test case demonstrates how SICLE makes it possible to summarize the phylogenetic information produced by automated phylogenetic pipelines to rapidly identify and quantify the possible evolutionary relationships that merit further investigation. SICLE is available for free for noncommercial use at http://eebweb.arizona.edu/sicle/.

  10. Phylogenetic relationships of African sunbird-like warblers: Moho ...

    African Journals Online (AJOL)

    Phylogenetic relationships of African sunbird-like warblers: Moho ( Hypergerus atriceps ), Green Hylia ( Hylia prasina ) and Tit-hylia ( Pholidornis rushiae ) ... different points in avian evolution reduces the phylogenetic signal in molecular sequence data, making difficult the reconstruction of relationships among taxa resulting ...

  11. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    Navya

    2 attached at the base of tree as the diverging Iridaceae relative's lineage. Present study revealed that psbA-trnH region are useful in addressing questions of phylogenetic relationships among the Gladiolus cultivars, as these intergenic spacers are more variable and have more phylogenetically informative sites than the ...

  12. Phylogenetic versus functional signals in the evolution of form-function relationships in terrestrial vision.

    Science.gov (United States)

    Motani, Ryosuke; Schmitz, Lars

    2011-08-01

    Phylogeny is deeply pertinent to evolutionary studies. Traits that perform a body function are expected to be strongly influenced by physical "requirements" of the function. We investigated if such traits exhibit phylogenetic signals, and, if so, how phylogenetic noises bias quantification of form-function relationships. A form-function system that is strongly influenced by physics, namely the relationship between eye morphology and visual optics in amniotes, was used. We quantified the correlation between form (i.e., eye morphology) and function (i.e., ocular optics) while varying the level of phylogenetic bias removal through adjusting Pagel's λ. Ocular soft-tissue dimensions exhibited the highest correlation with ocular optics when 1% of phylogenetic bias expected from Brownian motion was removed (i.e., λ= 0.01); the value for hard-tissue data were 8%. A small degree of phylogenetic bias therefore exists in morphology despite of the stringent functional constraints. We also devised a phylogenetically informed discriminant analysis and recorded the effects of phylogenetic bias on this method using the same data. Use of proper λ values during phylogenetic bias removal improved misidentification rates in resulting classifications when prior probabilities were assumed to be equal. Even a small degree of phylogenetic bias affected the classification resulting from phylogenetically informed discriminant analysis. © 2011 The Author(s). Evolution© 2011 The Society for the Study of Evolution.

  13. The phylogenetic relationships among infraorders and superfamilies of Diptera based on morphological evidence

    DEFF Research Database (Denmark)

    Lambkin, Christine L.; Sinclair, Bradley J.; Pape, Thomas

    2013-01-01

    Members of the megadiverse insect order Diptera (flies) have successfully colonized all continents and nearly all habitats. There are more than 154 000 described fly species, representing 1012% of animal species. Elucidating the phylogenetic relationships of such a large component of global...... biodiversity is challenging, but significant advances have been made in the last few decades. Since Hennig first discussed the monophyly of major groupings, Diptera has attracted much study, but most researchers have used non-numerical qualitative methods to assess morphological data. More recently......, quantitative phylogenetic methods have been used on both morphological and molecular data. All previous quantitative morphological studies addressed narrower phylogenetic problems, often below the suborder or infraorder level. Here we present the first numerical analysis of phylogenetic relationships...

  14. Comparative analysis of DNA polymorphisms and phylogenetic relationships among Syzygium cumini Skeels based on phenotypic characters and RAPD technique.

    Science.gov (United States)

    Singh, Jitendra P; Singh, Ak; Bajpai, Anju; Ahmad, Iffat Zareen

    2014-01-01

    The Indian black berry (Syzygium cumini Skeels) has a great nutraceutical and medicinal properties. As in other fruit crops, the fruit characteristics are important attributes for differentiation were also determined for different accessions of S. cumini. The fruit weight, length, breadth, length: breadth ratio, pulp weight, pulp content, seed weight and pulp: seed ratio significantly varied in different accessions. Molecular characterization was carried out using PCR based RAPD technique. Out of 80 RAPD primers, only 18 primers produced stable polymorphisms that were used to examine the phylogenetic relationship. A sum of 207 loci were generated out of which 201 loci found polymorphic. The average genetic dissimilarity was 97 per cent among jamun accessions. The phylogenetic relationship was also determined by principal coordinates analysis (PCoA) that explained 46.95 per cent cumulative variance. The two-dimensional PCoA analysis showed grouping of the different accessions that were plotted into four sub-plots, representing clustering of accessions. The UPGMA (r = 0.967) and NJ (r = 0.987) dendrogram constructed based on the dissimilarity matrix revealed a good degree of fit with the cophenetic correlation value. The dendrogram grouped the accessions into three main clusters according to their eco-geographical regions which given useful insight into their phylogenetic relationships.

  15. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  16. Phylogenetic relationships of the lancelets of the genus ...

    African Journals Online (AJOL)

    phylogenetic relationships of the Branchiostoma lancelets from South (Xiamen) and North (Qingdao and Rizhao) China, and phylogenetic trees constructed also included the existing data from Japanese waters. The genetic distances of the lancelets between South and North China averaged 0.19, 0.21, and 0.17 based on ...

  17. Phylogenetic and biogeographic analysis of sphaerexochine trilobites.

    Directory of Open Access Journals (Sweden)

    Curtis R Congreve

    Full Text Available BACKGROUND: Sphaerexochinae is a speciose and widely distributed group of cheirurid trilobites. Their temporal range extends from the earliest Ordovician through the Silurian, and they survived the end Ordovician mass extinction event (the second largest mass extinction in Earth history. Prior to this study, the individual evolutionary relationships within the group had yet to be determined utilizing rigorous phylogenetic methods. Understanding these evolutionary relationships is important for producing a stable classification of the group, and will be useful in elucidating the effects the end Ordovician mass extinction had on the evolutionary and biogeographic history of the group. METHODOLOGY/PRINCIPAL FINDINGS: Cladistic parsimony analysis of cheirurid trilobites assigned to the subfamily Sphaerexochinae was conducted to evaluate phylogenetic patterns and produce a hypothesis of relationship for the group. This study utilized the program TNT, and the analysis included thirty-one taxa and thirty-nine characters. The results of this analysis were then used in a Lieberman-modified Brooks Parsimony Analysis to analyze biogeographic patterns during the Ordovician-Silurian. CONCLUSIONS/SIGNIFICANCE: The genus Sphaerexochus was found to be monophyletic, consisting of two smaller clades (one composed entirely of Ordovician species and another composed of Silurian and Ordovician species. By contrast, the genus Kawina was found to be paraphyletic. It is a basal grade that also contains taxa formerly assigned to Cydonocephalus. Phylogenetic patterns suggest Sphaerexochinae is a relatively distinctive trilobite clade because it appears to have been largely unaffected by the end Ordovician mass extinction. Finally, the biogeographic analysis yields two major conclusions about Sphaerexochus biogeography: Bohemia and Avalonia were close enough during the Silurian to exchange taxa; and during the Ordovician there was dispersal between Eastern Laurentia and

  18. Phenotypic diversity and phylogenetic relationship between the ...

    African Journals Online (AJOL)

    Phenotypic diversity and phylogenetic relationship between the Bakosi/Baweri and other pig breeds ( Sus scrofa Domesticus ) in the humid forest with monomodal rainfall agro-ecological zone of Cameroon.

  19. Analysis of plasmid genes by phylogenetic profiling and visualization of homology relationships using Blast2Network

    Directory of Open Access Journals (Sweden)

    Bazzicalupo Marco

    2008-12-01

    Full Text Available Abstract Background Phylogenetic methods are well-established bioinformatic tools for sequence analysis, allowing to describe the non-independencies of sequences because of their common ancestor. However, the evolutionary profiles of bacterial genes are often complicated by hidden paralogy and extensive and/or (multiple horizontal gene transfer (HGT events which make bifurcating trees often inappropriate. In this context, plasmid sequences are paradigms of network-like relationships characterizing the evolution of prokaryotes. Actually, they can be transferred among different organisms allowing the dissemination of novel functions, thus playing a pivotal role in prokaryotic evolution. However, the study of their evolutionary dynamics is complicated by the absence of universally shared genes, a prerequisite for phylogenetic analyses. Results To overcome such limitations we developed a bioinformatic package, named Blast2Network (B2N, allowing the automatic phylogenetic profiling and the visualization of homology relationships in a large number of plasmid sequences. The software was applied to the study of 47 completely sequenced plasmids coming from Escherichia, Salmonella and Shigella spps. Conclusion The tools implemented by B2N allow to describe and visualize in a new way some of the evolutionary features of plasmid molecules of Enterobacteriaceae; in particular it helped to shed some light on the complex history of Escherichia, Salmonella and Shigella plasmids and to focus on possible roles of unannotated proteins. The proposed methodology is general enough to be used for comparative genomic analyses of bacteria.

  20. Molecular cytogenetic (FISH and genome analysis of diploid wheatgrasses and their phylogenetic relationship.

    Directory of Open Access Journals (Sweden)

    Gabriella Linc

    Full Text Available This paper reports detailed FISH-based karyotypes for three diploid wheatgrass species Agropyron cristatum (L. Beauv., Thinopyrum bessarabicum (Savul.&Rayss A. Löve, Pseudoroegneria spicata (Pursh A. Löve, the supposed ancestors of hexaploid Thinopyrum intermedium (Host Barkworth & D.R.Dewey, compiled using DNA repeats and comparative genome analysis based on COS markers. Fluorescence in situ hybridization (FISH with repetitive DNA probes proved suitable for the identification of individual chromosomes in the diploid JJ, StSt and PP genomes. Of the seven microsatellite markers tested only the (GAAn trinucleotide sequence was appropriate for use as a single chromosome marker for the P. spicata AS chromosome. Based on COS marker analysis, the phylogenetic relationship between diploid wheatgrasses and the hexaploid bread wheat genomes was established. These findings confirmed that the J and E genomes are in neighbouring clusters.

  1. Atelinae phylogenetic relationships: the trichotomy revived?

    Science.gov (United States)

    Collins, A C

    2004-08-01

    This research examines phylogenetic relationships between members of the Atelinae subfamily (Alouatta, Ateles, Brachyteles, and Lagothrix), based on analysis of three genetic regions. Two loci, cytochrome c oxidase subunit II (COII) and the hypervariable I portion of the control region, are part of the mitochondrial genome. The other is a single-copy nuclear gene, Aldolase A Intron V. Analysis of these genetic regions provides support for tribe Alouattini containing the Alouatta species, while tribe Atelini contains the other three genera. However, these three genetic regions produce conflicting results for relationships among tribe Atelini members. Previous genetic studies supported grouping Brachyteles with Lagothrix, leaving Ateles in a separate subclade. The present data sets vary based on the genetic region analyzed and method of analysis suggesting all possible cladistic relationships. These results are more consistent with investigations of morphology and behavior among these primates. The primary cause of discrepancy between this study and previous genetic studies is postulated to reside in increased sampling in the present study of genetic variation among members of the Atelinae, specifically Ateles. The present study utilized samples of Ateles from all postulated species for this genetically variable primate, while previous studies used only one or two species of Ateles. This paper demonstrates that shifting relationships are produced when different species of Ateles are used to reconstruct phylogenies. This research concludes that a trichotomy should still be supported between members of tribe Atelini until further analyses, which include additional Atelinae haplotypes are conducted. Copyright 2003 Wiley-Liss, Inc.

  2. Phylogenetic relationships among vietnamese cocoa accessions using a non-coding region of the chloroplast dna

    International Nuclear Information System (INIS)

    Ha, L.T.V.; Dung, T.N.; Phuoc, P.H.D.

    2017-01-01

    Cocoa cultivation has increased in tropical areas around the world, including Vietnam, due to the high demand of cocoa beans for chocolate production. The genetic diversity of cocoa genotypes is recognized to be complex, however, their phylogenetic relationships need to be clarified. The present study aimed to classify the cocoa genotypes, that are imported and cultivated in Vietnam, based on a chloroplast DNA region. Sixty-three Vietnamese Cocoa accessions were collected from different regions in Southern Vietnam. Their phylogenetic relationships were identified using the universal primers c-B49317 and d-A49855 from the chloroplast DNA region. The sequences were situated in the trnL intron genes which are identify the closest terrestrial plant species of the chloroplast genome. DNA sequences were determined and subjected to an analysis of the phylogenetic relationship using the maximum evolution method. The genetic analysis showed clustering of 63 cocoa accessions in three groups: the domestically cultivated Trinitario group, the Indigenous cultivars, and the cultivations from Peru. The analyzed sequencing data also illustrated that the TD accessions and CT accessions were related genetically closed. Based on those results the genetic relation between PA and NA accessions was established as the hybrid origins of the TD and CT accessions. Some foreign accessions, including UIT, SCA and IMC accessions were confirmed of their genetic relationship. The present study is the first report of phylogenetic relationships of Vietnamese cocoa collections. The cocoa program in Vietnam has been in development for thirty years. (author)

  3. Phylogenetic relationships within the cyst-forming nematodes (Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of ribosomal DNA.

    Science.gov (United States)

    Subbotin, S A; Vierstraete, A; De Ley, P; Rowe, J; Waeyenberge, L; Moens, M; Vanfleteren, J R

    2001-10-01

    The ITS1, ITS2, and 5.8S gene sequences of nuclear ribosomal DNA from 40 taxa of the family Heteroderidae (including the genera Afenestrata, Cactodera, Heterodera, Globodera, Punctodera, Meloidodera, Cryphodera, and Thecavermiculatus) were sequenced and analyzed. The ITS regions displayed high levels of sequence divergence within Heteroderinae and compared to outgroup taxa. Unlike recent findings in root knot nematodes, ITS sequence polymorphism does not appear to complicate phylogenetic analysis of cyst nematodes. Phylogenetic analyses with maximum-parsimony, minimum-evolution, and maximum-likelihood methods were performed with a range of computer alignments, including elision and culled alignments. All multiple alignments and phylogenetic methods yielded similar basic structure for phylogenetic relationships of Heteroderidae. The cyst-forming nematodes are represented by six main clades corresponding to morphological characters and host specialization, with certain clades assuming different positions depending on alignment procedure and/or method of phylogenetic inference. Hypotheses of monophyly of Punctoderinae and Heteroderinae are, respectively, strongly and moderately supported by the ITS data across most alignments. Close relationships were revealed between the Avenae and the Sacchari groups and between the Humuli group and the species H. salixophila within Heteroderinae. The Goettingiana group occupies a basal position within this subfamily. The validity of the genera Afenestrata and Bidera was tested and is discussed based on molecular data. We conclude that ITS sequence data are appropriate for studies of relationships within the different species groups and less so for recovery of more ancient speciations within Heteroderidae. Copyright 2001 Academic Press.

  4. Phylogenetic relationship among Kenyan sorghum germplasms ...

    African Journals Online (AJOL)

    Mr Kiboi

    phylogenetic relationships based on 10 DNA fragments at AltSB loci with SbMATE, ORF9 and MITE primers. .... estimate the overall genetic diversity in Kenyan sorghum lines: Cheprot et al. 3529 ..... EARN project and Generation Challenge (GCP), ... genetics and molecular biology of plant aluminum resistance and toxicity.

  5. Mitochondrial DNA genomes organization and phylogenetic relationships analysis of eight anemonefishes (pomacentridae: amphiprioninae.

    Directory of Open Access Journals (Sweden)

    Jianlong Li

    Full Text Available Anemonefishes (Pomacentridae Amphiprioninae are a group of 30 valid coral reef fish species with their phylogenetic relationships still under debate. The eight available mitogenomes of anemonefishes were used to reconstruct the molecular phylogenetic tree; six were obtained from this study (Amphiprion clarkii, A. frenatus, A. percula, A. perideraion, A. polymnus and Premnas biaculeatus and two from GenBank (A. bicinctus and A. ocellaris. The seven Amphiprion species represent all four subgenera and P. biaculeatus is the only species from Premnas. The eight mitogenomes of anemonefishes encoded 13 protein-coding genes, two rRNA genes, 22 tRNA genes and two main non-coding regions, with the gene arrangement and translation direction basically identical to other typical vertebrate mitogenomes. Among the 13 protein-coding genes, A. ocellaris (AP006017 and A. percula (KJ174497 had the same length in ND5 with 1,866 bp, which were three nucleotides less than the other six anemonefishes. Both structures of ND5, however, could translate to amino acid successfully. Only four mitogenomes had the tandem repeats in D-loop; the tandem repeats were located in downstream after Conserved Sequence Block rather than the upstream and repeated in a simply way. The phylogenetic utility was tested with Bayesian and Maximum Likelihood methods using all 13 protein-coding genes. The results strongly supported that the subfamily Amphiprioninae was monophyletic and P. biaculeatus should be assigned to the genus Amphiprion. Premnas biaculeatus with the percula complex were revealed to be the ancient anemonefish species. The tree forms of ND1, COIII, ND4, Cytb, Cytb+12S rRNA, Cytb+COI and Cytb+COI+12S rRNA were similar to that 13 protein-coding genes, therefore, we suggested that the suitable single mitochondrial gene for phylogenetic analysis of anemonefishes maybe Cytb. Additional mitogenomes of anemonefishes with a combination of nuclear markers will be useful to

  6. Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae).

    Science.gov (United States)

    Carrizo García, Carolina; Barfuss, Michael H J; Sehr, Eva M; Barboza, Gloria E; Samuel, Rosabelle; Moscone, Eduardo A; Ehrendorfer, Friedrich

    2016-07-01

    Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum A clearly distinct early-diverging clade can be distinguished, centred in western-north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The diversification of Capsicum has culminated in the origin

  7. Phylogenetic relationships, diversification and expansion of chili peppers (Capsicum, Solanaceae)

    Science.gov (United States)

    Carrizo García, Carolina; Barfuss, Michael H. J.; Sehr, Eva M.; Barboza, Gloria E.; Samuel, Rosabelle; Moscone, Eduardo A.; Ehrendorfer, Friedrich

    2016-01-01

    Background and Aims Capsicum (Solanaceae), native to the tropical and temperate Americas, comprises the well-known sweet and hot chili peppers and several wild species. So far, only partial taxonomic and phylogenetic analyses have been done for the genus. Here, the phylogenetic relationships between nearly all taxa of Capsicum were explored to test the monophyly of the genus and to obtain a better knowledge of species relationships, diversification and expansion. Methods Thirty-four of approximately 35 Capsicum species were sampled. Maximum parsimony and Bayesian inference analyses were performed using two plastid markers (matK and psbA-trnH) and one single-copy nuclear gene (waxy). The evolutionary changes of nine key features were reconstructed following the parsimony ancestral states method. Ancestral areas were reconstructed through a Bayesian Markov chain Monte Carlo analysis. Key Results Capsicum forms a monophyletic clade, with Lycianthes as a sister group, following both phylogenetic approaches. Eleven well-supported clades (four of them monotypic) can be recognized within Capsicum, although some interspecific relationships need further analysis. A few features are useful to characterize different clades (e.g. fruit anatomy, chromosome base number), whereas some others are highly homoplastic (e.g. seed colour). The origin of Capsicum is postulated in an area along the Andes of western to north-western South America. The expansion of the genus has followed a clockwise direction around the Amazon basin, towards central and south-eastern Brazil, then back to western South America, and finally northwards to Central America. Conclusions New insights are provided regarding interspecific relationships, character evolution, and geographical origin and expansion of Capsicum. A clearly distinct early-diverging clade can be distinguished, centred in western–north-western South America. Subsequent rapid speciation has led to the origin of the remaining clades. The

  8. Different relationships between temporal phylogenetic turnover and phylogenetic similarity and in two forests were detected by a new null model.

    Science.gov (United States)

    Huang, Jian-Xiong; Zhang, Jian; Shen, Yong; Lian, Ju-yu; Cao, Hong-lin; Ye, Wan-hui; Wu, Lin-fang; Bin, Yue

    2014-01-01

    Ecologists have been monitoring community dynamics with the purpose of understanding the rates and causes of community change. However, there is a lack of monitoring of community dynamics from the perspective of phylogeny. We attempted to understand temporal phylogenetic turnover in a 50 ha tropical forest (Barro Colorado Island, BCI) and a 20 ha subtropical forest (Dinghushan in southern China, DHS). To obtain temporal phylogenetic turnover under random conditions, two null models were used. The first shuffled names of species that are widely used in community phylogenetic analyses. The second simulated demographic processes with careful consideration on the variation in dispersal ability among species and the variations in mortality both among species and among size classes. With the two models, we tested the relationships between temporal phylogenetic turnover and phylogenetic similarity at different spatial scales in the two forests. Results were more consistent with previous findings using the second null model suggesting that the second null model is more appropriate for our purposes. With the second null model, a significantly positive relationship was detected between phylogenetic turnover and phylogenetic similarity in BCI at a 10 m×10 m scale, potentially indicating phylogenetic density dependence. This relationship in DHS was significantly negative at three of five spatial scales. This could indicate abiotic filtering processes for community assembly. Using variation partitioning, we found phylogenetic similarity contributed to variation in temporal phylogenetic turnover in the DHS plot but not in BCI plot. The mechanisms for community assembly in BCI and DHS vary from phylogenetic perspective. Only the second null model detected this difference indicating the importance of choosing a proper null model.

  9. Genetic variation and phylogenetic relationship analysis of Jatropha curcas L. inferred from nrDNA ITS sequences.

    Science.gov (United States)

    Guo, Guo-Ye; Chen, Fang; Shi, Xiao-Dong; Tian, Yin-Shuai; Yu, Mao-Qun; Han, Xue-Qin; Yuan, Li-Chun; Zhang, Ying

    2016-01-01

    Genetic variation and phylogenetic relationships among 102 Jatropha curcas accessions from Asia, Africa, and the Americas were assessed using the internal transcribed spacer region of nuclear ribosomal DNA (nrDNA ITS). The average G+C content (65.04%) was considerably higher than the A+T (34.96%) content. The estimated genetic diversity revealed moderate genetic variation. The pairwise genetic divergences (GD) between haplotypes were evaluated and ranged from 0.000 to 0.017, suggesting a higher level of genetic differentiation in Mexican accessions than those of other regions. Phylogenetic relationships and intraspecific divergence were inferred by Bayesian inference (BI), maximum parsimony (MP), and median joining (MJ) network analysis and were generally resolved. The J. curcas accessions were consistently divided into three lineages, groups A, B, and C, which demonstrated distant geographical isolation and genetic divergence between American accessions and those from other regions. The MJ network analysis confirmed that Central America was the possible center of origin. The putative migration route suggested that J. curcas was distributed from Mexico or Brazil, via Cape Verde and then split into two routes. One route was dispersed to Spain, then migrated to China, eventually spreading to southeastern Asia, while the other route was dispersed to Africa, via Madagascar and migrated to China, later spreading to southeastern Asia. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  10. Assessment of phylogenetic sensitivity for reconstructing HIV-1 epidemiological relationships.

    Science.gov (United States)

    Beloukas, Apostolos; Magiorkinis, Emmanouil; Magiorkinis, Gkikas; Zavitsanou, Asimina; Karamitros, Timokratis; Hatzakis, Angelos; Paraskevis, Dimitrios

    2012-06-01

    Phylogenetic analysis has been extensively used as a tool for the reconstruction of epidemiological relations for research or for forensic purposes. It was our objective to assess the sensitivity of different phylogenetic methods and various phylogenetic programs to reconstruct epidemiological links among HIV-1 infected patients that is the probability to reveal a true transmission relationship. Multiple datasets (90) were prepared consisting of HIV-1 sequences in protease (PR) and partial reverse transcriptase (RT) sampled from patients with documented epidemiological relationship (target population), and from unrelated individuals (control population) belonging to the same HIV-1 subtype as the target population. Each dataset varied regarding the number, the geographic origin and the transmission risk groups of the sequences among the control population. Phylogenetic trees were inferred by neighbor-joining (NJ), maximum likelihood heuristics (hML) and Bayesian methods. All clusters of sequences belonging to the target population were correctly reconstructed by NJ and Bayesian methods receiving high bootstrap and posterior probability (PP) support, respectively. On the other hand, TreePuzzle failed to reconstruct or provide significant support for several clusters; high puzzling step support was associated with the inclusion of control sequences from the same geographic area as the target population. In contrary, all clusters were correctly reconstructed by hML as implemented in PhyML 3.0 receiving high bootstrap support. We report that under the conditions of our study, hML using PhyML, NJ and Bayesian methods were the most sensitive for the reconstruction of epidemiological links mostly from sexually infected individuals. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Phylogenetic comparative methods complement discriminant function analysis in ecomorphology.

    Science.gov (United States)

    Barr, W Andrew; Scott, Robert S

    2014-04-01

    In ecomorphology, Discriminant Function Analysis (DFA) has been used as evidence for the presence of functional links between morphometric variables and ecological categories. Here we conduct simulations of characters containing phylogenetic signal to explore the performance of DFA under a variety of conditions. Characters were simulated using a phylogeny of extant antelope species from known habitats. Characters were modeled with no biomechanical relationship to the habitat category; the only sources of variation were body mass, phylogenetic signal, or random "noise." DFA on the discriminability of habitat categories was performed using subsets of the simulated characters, and Phylogenetic Generalized Least Squares (PGLS) was performed for each character. Analyses were repeated with randomized habitat assignments. When simulated characters lacked phylogenetic signal and/or habitat assignments were random, ecomorphology. Copyright © 2013 Wiley Periodicals, Inc.

  12. Resolving ambiguity in the phylogenetic relationship of genotypes A, B, and C of hepatitis B virus

    Science.gov (United States)

    2013-01-01

    Background Hepatitis B virus (HBV) is an important infectious agent that causes widespread concern because billions of people are infected by at least 8 different HBV genotypes worldwide. However, reconstruction of the phylogenetic relationship between HBV genotypes is difficult. Specifically, the phylogenetic relationships among genotypes A, B, and C are not clear from previous studies because of the confounding effects of genotype recombination. In order to clarify the evolutionary relationships, a rigorous approach is required that can effectively explore genetic sequences with recombination. Result In the present study, phylogenetic relationship of the HBV genotypes was reconstructed using a consensus phylogeny of phylogenetic trees of HBV genome segments. Reliability of the reconstructed phylogeny was extensively evaluated in agreements of local phylogenies of genome segments. The reconstructed phylogenetic tree revealed that HBV genotypes B and C had a closer phylogenetic relationship than genotypes A and B or A and C. Evaluations showed the consensus method was capable to reconstruct reliable phylogenetic relationship in the presence of recombinants. Conclusion The consensus method implemented in this study provides an alternative approach for reconstructing reliable phylogenetic relationships for viruses with possible genetic recombination. Our approach revealed the phylogenetic relationships of genotypes A, B, and C of HBV. PMID:23758960

  13. Phylogenetic analysis of molecular and morphological data highlights uncertainty in the relationships of fossil and living species of Elopomorpha (Actinopterygii: Teleostei).

    Science.gov (United States)

    Dornburg, Alex; Friedman, Matt; Near, Thomas J

    2015-08-01

    Elopomorpha is one of the three main clades of living teleost fishes and includes a range of disparate lineages including eels, tarpons, bonefishes, and halosaurs. Elopomorphs were among the first groups of fishes investigated using Hennigian phylogenetic methods and continue to be the object of intense phylogenetic scrutiny due to their economic significance, diversity, and crucial evolutionary status as the sister group of all other teleosts. While portions of the phylogenetic backbone for Elopomorpha are consistent between studies, the relationships among Albula, Pterothrissus, Notacanthiformes, and Anguilliformes remain contentious and difficult to evaluate. This lack of phylogenetic resolution is problematic as fossil lineages are often described and placed taxonomically based on an assumed sister group relationship between Albula and Pterothrissus. In addition, phylogenetic studies using morphological data that sample elopomorph fossil lineages often do not include notacanthiform or anguilliform lineages, potentially introducing a bias toward interpreting fossils as members of the common stem of Pterothrissus and Albula. Here we provide a phylogenetic analysis of DNA sequences sampled from multiple nuclear genes that include representative taxa from Albula, Pterothrissus, Notacanthiformes and Anguilliformes. We integrate our molecular dataset with a morphological character matrix that spans both living and fossil elopomorph lineages. Our results reveal substantial uncertainty in the placement of Pterothrissus as well as all sampled fossil lineages, questioning the stability of the taxonomy of fossil Elopomorpha. However, despite topological uncertainty, our integration of fossil lineages into a Bayesian time calibrated framework provides divergence time estimates for the clade that are consistent with previously published age estimates based on the elopomorph fossil record and molecular estimates resulting from traditional node-dating methods. Copyright

  14. AFLP analysis of genetic diversity and phylogenetic relationships of Brassica oleracea in Ireland.

    Science.gov (United States)

    El-Esawi, Mohamed A; Germaine, Kieran; Bourke, Paula; Malone, Renee

    2016-01-01

    Brassica oleracea L. is one of the most economically important vegetable crop species of the genus Brassica L. This species is threatened in Ireland, without any prior reported genetic studies. The use of this species is being very limited due to its imprecise phylogeny and uncompleted genetic characterisation. The main objective of this study was to assess the genetic diversity and phylogenetic relationships of a set of 25 Irish B. oleracea accessions using the powerful amplified fragment length polymorphism (AFLP) technique. A total of 471 fragments were scored across all the 11 AFLP primer sets used, out of which 423 (89.8%) were polymorphic and could differentiate the accessions analysed. The dendrogram showed that cauliflowers were more closely related to cabbages than kales were, and accessions of some cabbage types were distributed among different clusters within cabbage subgroups. Approximately 33.7% of the total genetic variation was found among accessions, and 66.3% of the variation resided within accessions. The total genetic diversity (HT) and the intra-accessional genetic diversity (HS) were 0.251 and 0.156, respectively. This high level of variation demonstrates that the Irish B. oleracea accessions studied should be managed and conserved for future utilisation and exploitation in food and agriculture. In conclusion, this study addressed important phylogenetic questions within this species, and provided a new insight into the inclusion of four accessions of cabbages and kales in future breeding programs for improving varieties. AFLP markers were efficient for assessing genetic diversity and phylogenetic relationships in Irish B. oleracea species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  15. Assessing the relationships between phylogenetic and functional singularities in sharks (Chondrichthyes).

    Science.gov (United States)

    Cachera, Marie; Le Loc'h, François

    2017-08-01

    The relationships between diversity and ecosystem functioning have become a major focus of science. A crucial issue is to estimate functional diversity, as it is intended to impact ecosystem dynamics and stability. However, depending on the ecosystem, it may be challenging or even impossible to directly measure ecological functions and thus functional diversity. Phylogenetic diversity was recently under consideration as a proxy for functional diversity. Phylogenetic diversity is indeed supposed to match functional diversity if functions are conservative traits along evolution. However, in case of adaptive radiation and/or evolutive convergence, a mismatch may appear between species phylogenetic and functional singularities. Using highly threatened taxa, sharks, this study aimed to explore the relationships between phylogenetic and functional diversities and singularities. Different statistical computations were used in order to test both methodological issue (phylogenetic reconstruction) and overall a theoretical questioning: the predictive power of phylogeny for function diversity. Despite these several methodological approaches, a mismatch between phylogeny and function was highlighted. This mismatch revealed that (i) functions are apparently nonconservative in shark species, and (ii) phylogenetic singularity is not a proxy for functional singularity. Functions appeared to be not conservative along the evolution of sharks, raising the conservational challenge to identify and protect both phylogenetic and functional singular species. Facing the current rate of species loss, it is indeed of major importance to target phylogenetically singular species to protect genetic diversity and also functionally singular species in order to maintain particular functions within ecosystem.

  16. Phylogenetic Analysis Using Protein Mass Spectrometry.

    Science.gov (United States)

    Ma, Shiyong; Downard, Kevin M; Wong, Jason W H

    2017-01-01

    Through advances in molecular biology, comparative analysis of DNA sequences is currently the cornerstone in the study of molecular evolution and phylogenetics. Nevertheless, protein mass spectrometry offers some unique opportunities to enable phylogenetic analyses in organisms where DNA may be difficult or costly to obtain. To date, the methods of phylogenetic analysis using protein mass spectrometry can be classified into three categories: (1) de novo protein sequencing followed by classical phylogenetic reconstruction, (2) direct phylogenetic reconstruction using proteolytic peptide mass maps, and (3) mapping of mass spectral data onto classical phylogenetic trees. In this chapter, we provide a brief description of the three methods and the protocol for each method along with relevant tools and algorithms.

  17. Phylogenetically informed logic relationships improve detection of biological network organization

    Science.gov (United States)

    2011-01-01

    Background A "phylogenetic profile" refers to the presence or absence of a gene across a set of organisms, and it has been proven valuable for understanding gene functional relationships and network organization. Despite this success, few studies have attempted to search beyond just pairwise relationships among genes. Here we search for logic relationships involving three genes, and explore its potential application in gene network analyses. Results Taking advantage of a phylogenetic matrix constructed from the large orthologs database Roundup, we invented a method to create balanced profiles for individual triplets of genes that guarantee equal weight on the different phylogenetic scenarios of coevolution between genes. When we applied this idea to LAPP, the method to search for logic triplets of genes, the balanced profiles resulted in significant performance improvement and the discovery of hundreds of thousands more putative triplets than unadjusted profiles. We found that logic triplets detected biological network organization and identified key proteins and their functions, ranging from neighbouring proteins in local pathways, to well separated proteins in the whole pathway, and to the interactions among different pathways at the system level. Finally, our case study suggested that the directionality in a logic relationship and the profile of a triplet could disclose the connectivity between the triplet and surrounding networks. Conclusion Balanced profiles are superior to the raw profiles employed by traditional methods of phylogenetic profiling in searching for high order gene sets. Gene triplets can provide valuable information in detection of biological network organization and identification of key genes at different levels of cellular interaction. PMID:22172058

  18. Bryozoans are returning home: recolonization of freshwater ecosystems inferred from phylogenetic relationships.

    Science.gov (United States)

    Koletić, Nikola; Novosel, Maja; Rajević, Nives; Franjević, Damjan

    2015-01-01

    Bryozoans are aquatic invertebrates that inhabit all types of aquatic ecosystems. They are small animals that form large colonies by asexual budding. Colonies can reach the size of several tens of centimeters, while individual units within a colony are the size of a few millimeters. Each individual within a colony works as a separate zooid and is genetically identical to each other individual within the same colony. Most freshwater species of bryozoans belong to the Phylactolaemata class, while several species that tolerate brackish water belong to the Gymnolaemata class. Tissue samples for this study were collected in the rivers of Adriatic and Danube basin and in the wetland areas in the continental part of Croatia (Europe). Freshwater and brackish taxons of bryozoans were genetically analyzed for the purpose of creating phylogenetic relationships between freshwater and brackish taxons of the Phylactolaemata and Gymnolaemata classes and determining the role of brackish species in colonizing freshwater and marine ecosystems. Phylogenetic relationships inferred on the genes for 18S rRNA, 28S rRNA, COI, and ITS2 region confirmed Phylactolaemata bryozoans as radix bryozoan group. Phylogenetic analysis proved Phylactolaemata bryozoan's close relations with taxons from Phoronida phylum as well as the separation of the Lophopodidae family from other families within the Plumatellida genus. Comparative analysis of existing knowledge about the phylogeny of bryozoans and the expansion of known evolutionary hypotheses is proposed with the model of settlement of marine and freshwater ecosystems by the bryozoans group during their evolutionary past. In this case study, brackish bryozoan taxons represent a link for this ecological phylogenetic hypothesis. Comparison of brackish bryozoan species Lophopus crystallinus and Conopeum seurati confirmed a dual colonization of freshwater ecosystems throughout evolution of this group of animals.

  19. Phylogenetic relationships of Malaysia's pig-tailed macaque Macaca nemestrina based on D-loop region sequences

    Science.gov (United States)

    Abdul-Latiff M. A., B.; Ampeng, A.; Yaakop, S.; Md-Zain B., M.

    2014-09-01

    Phylogenetic relationships among Malaysian pig-tailed macaques have never been established even though the data are crucial in aiding conservation plan for the species. The aims of this study is to establish the phylogenetic relationships of Macaca nemestrina in Malaysia. A total of 21 genetic samples of M. nemestrina yielding 458 bp of D-loop sequences were used in phylogenetic analyses, in addition to one sample of M. fascicularis which was used as an outgroup. Sequence character analysis revealed that D-loop locus contains 23% parsimony informative character detected among the ingroups. Further analysis indicated a clear separation between populations originating from different regions; the Malay Peninsula populations are separated from Borneo Insular population; and Perak population formed a distinctive clade within Peninsular Malaysia populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo population was distinguished from Peninsula population (100% bootstrap value in the NJ, MP, 1.00 posterior probability in Bayesian trees). Perak's population was separated from other Peninsula populations (100% in NJ, 99% in MP and 1.00 in Bayesian). D-loop region of mtDNA is proven to be a suitable locus in studying the separation of M. nemestrina at population level. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  20. Phylogenetic analysis of the genus Hordeum using repetitive DNA sequences

    DEFF Research Database (Denmark)

    Svitashev, S.; Bryngelsson, T.; Vershinin, A.

    1994-01-01

    A set of six cloned barley (Hordeum vulgare) repetitive DNA sequences was used for the analysis of phylogenetic relationships among 31 species (46 taxa) of the genus Hordeum, using molecular hybridization techniques. In situ hybridization experiments showed dispersed organization of the sequences...

  1. The complete chloroplast genome sequence of Ampelopsis: gene organization, comparative analysis and phylogenetic relationships to other angiosperms

    Directory of Open Access Journals (Sweden)

    Gurusamy eRaman

    2016-03-01

    Full Text Available Ampelopsis brevipedunculata is an economically important plant that belongs to the Vitaceae family of angiosperms. The phylogenetic placement of Vitaceae is still unresolved. Recent phylogenetic studies suggested that it should be placed in various alternative families including Caryophyllaceae, asteraceae, Saxifragaceae, Dilleniaceae, or with the rest of the rosid families. However, these analyses provided weak supportive results because they were based on only one of several genes. Accordingly, complete chloroplast genome sequences are required to resolve the phylogenetic relationships among angiosperms. Recent phylogenetic analyses based on the complete chloroplast genome sequence suggested strong support for the position of Vitaceae as the earliest diverging lineage of rosids and placed it as a sister to the remaining rosids. These studies also revealed relationships among several major lineages of angiosperms; however, they highlighted the significance of taxon sampling for obtaining accurate phylogenies. In the present study, we sequenced the complete chloroplast genome of A. brevipedunculata and used these data to assess the relationships among 32 angiosperms, including 18 taxa of rosids. The Ampelopsis chloroplast genome is 161,090 bp in length, and includes a pair of inverted repeats of 26,394 bp that are separated by small and large single copy regions of 19,036 bp and 89,266 bp, respectively. The gene content and order of Ampelopsis is identical to many other unrearranged angiosperm chloroplast genomes, including Vitis and tobacco. A phylogenetic tree constructed based on 70 protein-coding genes of 33 angiosperms showed that both Saxifragales and Vitaceae diverged from the rosid clade and formed two clades with 100% bootstrap value. The position of the Vitaceae is sister to Saxifragales, and both are the basal and earliest diverging lineages. Moreover, Saxifragales forms a sister clade to Vitaceae of rosids. Overall, the results of

  2. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

    Science.gov (United States)

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

    1990-01-01

    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  3. The phylogenetic relationships of endemic Australasian trichostrongylin families (Nematoda: Strongylida) parasitic in marsupials and monotremes.

    Science.gov (United States)

    Chilton, Neil B; Huby-Chilton, Florence; Koehler, Anson V; Gasser, Robin B; Beveridge, Ian

    2015-10-01

    The phylogenetic relationships of the endemic (or largely endemic) Australasian trichostrongylin nematode families Herpetostrongylidae, Mackerrastrongylidae and Nicollinidae as well as endemic trichostrongylin nematodes currently placed in the families Trichostrongylidae and Molineidae were examined using the complete large subunit (28S) ribosomal RNA gene. The Herpetostrongylinae proved to be monophyletic. However, representatives of the Nicollinidae nested with the Herpetostrongylinae. The Mackerrastrongylidae was also a monophyletic group and included Peramelistrongylus, currently classified within the Trichostrongylidae. The Globocephaloidinae, currently considered to be a subfamily of the Herpetostrongylidae, was excluded from the family in the current analysis. Ollulanus and Libyostrongylus, included for the first time in a molecular phylogenetic analysis, were placed within the Trichostrongylidae. This study provided strong support for the Herpetostrongylidae (including within it the Nicollinidae, but excluding the Globocephaloidinae) and the Mackerrastrongylidae as monophyletic assemblages. Additional studies are required to resolve the relationships of the remaining endemic Australasian trichostrongylin genera.

  4. Phylogenetic relationships within and among Brassica species from ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-02

    May 2, 2008 ... Inappropriate tree reconstruction methods would pose a problem only in the basal relationships rather than in terminal taxa; the paraphyly observed in this study applied mostly to terminal taxa. This study recovered sufficient phylogenetic characters to separate accessions of the same species, making.

  5. Phylogenetic relationships of Hemiptera inferred from mitochondrial and nuclear genes.

    Science.gov (United States)

    Song, Nan; Li, Hu; Cai, Wanzhi; Yan, Fengming; Wang, Jianyun; Song, Fan

    2016-11-01

    Here, we reconstructed the Hemiptera phylogeny based on the expanded mitochondrial protein-coding genes and the nuclear 18S rRNA gene, separately. The differential rates of change across lineages may associate with long-branch attraction (LBA) effect and result in conflicting estimates of phylogeny from different types of data. To reduce the potential effects of systematic biases on inferences of topology, various data coding schemes, site removal method, and different algorithms were utilized in phylogenetic reconstruction. We show that the outgroups Phthiraptera, Thysanoptera, and the ingroup Sternorrhyncha share similar base composition, and exhibit "long branches" relative to other hemipterans. Thus, the long-branch attraction between these groups is suspected to cause the failure of recovering Hemiptera under the homogeneous model. In contrast, a monophyletic Hemiptera is supported when heterogeneous model is utilized in the analysis. Although higher level phylogenetic relationships within Hemiptera remain to be answered, consensus between analyses is beginning to converge on a stable phylogeny.

  6. Phylogenetic relationships of Malaysia's long-tailed macaques, Macaca fascicularis, based on cytochrome b sequences.

    Science.gov (United States)

    Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir

    2014-01-01

    Phylogenetic relationships among Malaysia's long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo's population was distinguished from Peninsula's population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia's M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  7. Genetic and phylogenetic analysis of ten Gobiidae species in China ...

    African Journals Online (AJOL)

    To study the genetic and phylogenetic relationship of gobioid fishes in China, the representatives of 10 gobioid fishes from 2 subfamilies in China were examined by amplified fragment length polymorphism (AFLP) analysis. We established 220 AFLP bands for 45 individuals from the 10 species, and the percentage of ...

  8. Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping

    2012-09-01

    To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

  9. Phylogenetic relationships of typical antbirds (Thamnophilidae and test of incongruence based on Bayes factors

    Directory of Open Access Journals (Sweden)

    Nylander Johan AA

    2004-07-01

    Full Text Available Abstract Background The typical antbirds (Thamnophilidae form a monophyletic and diverse family of suboscine passerines that inhabit neotropical forests. However, the phylogenetic relationships within this assemblage are poorly understood. Herein, we present a hypothesis of the generic relationships of this group based on Bayesian inference analyses of two nuclear introns and the mitochondrial cytochrome b gene. The level of phylogenetic congruence between the individual genes has been investigated utilizing Bayes factors. We also explore how changes in the substitution models affected the observed incongruence between partitions of our data set. Results The phylogenetic analysis supports both novel relationships, as well as traditional groupings. Among the more interesting novel relationship suggested is that the Terenura antwrens, the wing-banded antbird (Myrmornis torquata, the spot-winged antshrike (Pygiptila stellaris and the russet antshrike (Thamnistes anabatinus are sisters to all other typical antbirds. The remaining genera fall into two major clades. The first includes antshrikes, antvireos and the Herpsilochmus antwrens, while the second clade consists of most antwren genera, the Myrmeciza antbirds, the "professional" ant-following antbirds, and allied species. Our results also support previously suggested polyphyly of Myrmotherula antwrens and Myrmeciza antbirds. The tests of phylogenetic incongruence, using Bayes factors, clearly suggests that allowing the gene partitions to have separate topology parameters clearly increased the model likelihood. However, changing a component of the nucleotide substitution model had much higher impact on the model likelihood. Conclusions The phylogenetic results are in broad agreement with traditional classification of the typical antbirds, but some relationships are unexpected based on external morphology. In these cases their true affinities may have been obscured by convergent evolution and

  10. Relationships among North American and Japanese Laetiporus isolates inferred from molecular phylogenetics and single-spore incompatibility reactions

    Science.gov (United States)

    Mark T. Banik; Daniel L. Lindner; Yuko Ota; Tsutomu Hattori

    2010-01-01

    Relationships were investigated among North American and Japanese isolates of Laetiporus using phylogenetic analysis of ITS sequences and single-spore isolate incompatibility. Single-spore isolate pairings revealed no significant compatibility between North American and Japanese isolates. ITS analysis revealed 12 clades within the core ...

  11. Phylogenetic analyses of Vitis (Vitaceae) based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids.

    Science.gov (United States)

    Jansen, Robert K; Kaittanis, Charalambos; Saski, Christopher; Lee, Seung-Bum; Tomkins, Jeffrey; Alverson, Andrew J; Daniell, Henry

    2006-04-09

    The Vitaceae (grape) is an economically important family of angiosperms whose phylogenetic placement is currently unresolved. Recent phylogenetic analyses based on one to several genes have suggested several alternative placements of this family, including sister to Caryophyllales, asterids, Saxifragales, Dilleniaceae or to rest of rosids, though support for these different results has been weak. There has been a recent interest in using complete chloroplast genome sequences for resolving phylogenetic relationships among angiosperms. These studies have clarified relationships among several major lineages but they have also emphasized the importance of taxon sampling and the effects of different phylogenetic methods for obtaining accurate phylogenies. We sequenced the complete chloroplast genome of Vitis vinifera and used these data to assess relationships among 27 angiosperms, including nine taxa of rosids. The Vitis vinifera chloroplast genome is 160,928 bp in length, including a pair of inverted repeats of 26,358 bp that are separated by small and large single copy regions of 19,065 bp and 89,147 bp, respectively. The gene content and order of Vitis is identical to many other unrearranged angiosperm chloroplast genomes, including tobacco. Phylogenetic analyses using maximum parsimony and maximum likelihood were performed on DNA sequences of 61 protein-coding genes for two datasets with 28 or 29 taxa, including eight or nine taxa from four of the seven currently recognized major clades of rosids. Parsimony and likelihood phylogenies of both data sets provide strong support for the placement of Vitaceae as sister to the remaining rosids. However, the position of the Myrtales and support for the monophyly of the eurosid I clade differs between the two data sets and the two methods of analysis. In parsimony analyses, the inclusion of Gossypium is necessary to obtain trees that support the monophyly of the eurosid I clade. However, maximum likelihood analyses place

  12. Phylogenetic analyses of Vitis (Vitaceae based on complete chloroplast genome sequences: effects of taxon sampling and phylogenetic methods on resolving relationships among rosids

    Directory of Open Access Journals (Sweden)

    Alverson Andrew J

    2006-04-01

    Full Text Available Abstract Background The Vitaceae (grape is an economically important family of angiosperms whose phylogenetic placement is currently unresolved. Recent phylogenetic analyses based on one to several genes have suggested several alternative placements of this family, including sister to Caryophyllales, asterids, Saxifragales, Dilleniaceae or to rest of rosids, though support for these different results has been weak. There has been a recent interest in using complete chloroplast genome sequences for resolving phylogenetic relationships among angiosperms. These studies have clarified relationships among several major lineages but they have also emphasized the importance of taxon sampling and the effects of different phylogenetic methods for obtaining accurate phylogenies. We sequenced the complete chloroplast genome of Vitis vinifera and used these data to assess relationships among 27 angiosperms, including nine taxa of rosids. Results The Vitis vinifera chloroplast genome is 160,928 bp in length, including a pair of inverted repeats of 26,358 bp that are separated by small and large single copy regions of 19,065 bp and 89,147 bp, respectively. The gene content and order of Vitis is identical to many other unrearranged angiosperm chloroplast genomes, including tobacco. Phylogenetic analyses using maximum parsimony and maximum likelihood were performed on DNA sequences of 61 protein-coding genes for two datasets with 28 or 29 taxa, including eight or nine taxa from four of the seven currently recognized major clades of rosids. Parsimony and likelihood phylogenies of both data sets provide strong support for the placement of Vitaceae as sister to the remaining rosids. However, the position of the Myrtales and support for the monophyly of the eurosid I clade differs between the two data sets and the two methods of analysis. In parsimony analyses, the inclusion of Gossypium is necessary to obtain trees that support the monophyly of the eurosid I clade

  13. Evidence for a close phylogenetic relationship between Melissococcus pluton, the causative agent of European foulbrood disease, and the genus Enterococcus.

    Science.gov (United States)

    Cai, J; Collins, M D

    1994-04-01

    The 16S rRNA gene sequence of Melissococcus pluton, the causative agent of European foulbrood disease, was determined in order to investigate the phylogenetic relationships between this organism and other low-G + C-content gram-positive bacteria. A comparative sequence analysis revealed that M. pluton is a close phylogenetic relative of the genus Enterococcus.

  14. Nuclear and cpDNA sequences combined provide strong inference of higher phylogenetic relationships in the phlox family (Polemoniaceae).

    Science.gov (United States)

    Johnson, Leigh A; Chan, Lauren M; Weese, Terri L; Busby, Lisa D; McMurry, Samuel

    2008-09-01

    Members of the phlox family (Polemoniaceae) serve as useful models for studying various evolutionary and biological processes. Despite its biological importance, no family-wide phylogenetic estimate based on multiple DNA regions with complete generic sampling is available. Here, we analyze one nuclear and five chloroplast DNA sequence regions (nuclear ITS, chloroplast matK, trnL intron plus trnL-trnF intergeneric spacer, and the trnS-trnG, trnD-trnT, and psbM-trnD intergenic spacers) using parsimony and Bayesian methods, as well as assessments of congruence and long branch attraction, to explore phylogenetic relationships among 84 ingroup species representing all currently recognized Polemoniaceae genera. Relationships inferred from the ITS and concatenated chloroplast regions are similar overall. A combined analysis provides strong support for the monophyly of Polemoniaceae and subfamilies Acanthogilioideae, Cobaeoideae, and Polemonioideae. Relationships among subfamilies, and thus for the precise root of Polemoniaceae, remain poorly supported. Within the largest subfamily, Polemonioideae, four clades corresponding to tribes Polemonieae, Phlocideae, Gilieae, and Loeselieae receive strong support. The monogeneric Polemonieae appears sister to Phlocideae. Relationships within Polemonieae, Phlocideae, and Gilieae are mostly consistent between analyses and data permutations. Many relationships within Loeselieae remain uncertain. Overall, inferred phylogenetic relationships support a higher-level classification for Polemoniaceae proposed in 2000.

  15. Phylogenetic relationships of Malaysia’s long-tailed macaques, Macaca fascicularis, based on cytochrome b sequences

    Science.gov (United States)

    Abdul-Latiff, Muhammad Abu Bakar; Ruslin, Farhani; Fui, Vun Vui; Abu, Mohd-Hashim; Rovie-Ryan, Jeffrine Japning; Abdul-Patah, Pazil; Lakim, Maklarin; Roos, Christian; Yaakop, Salmah; Md-Zain, Badrul Munir

    2014-01-01

    Abstract Phylogenetic relationships among Malaysia’s long-tailed macaques have yet to be established, despite abundant genetic studies of the species worldwide. The aims of this study are to examine the phylogenetic relationships of Macaca fascicularis in Malaysia and to test its classification as a morphological subspecies. A total of 25 genetic samples of M. fascicularis yielding 383 bp of Cytochrome b (Cyt b) sequences were used in phylogenetic analysis along with one sample each of M. nemestrina and M. arctoides used as outgroups. Sequence character analysis reveals that Cyt b locus is a highly conserved region with only 23% parsimony informative character detected among ingroups. Further analysis indicates a clear separation between populations originating from different regions; the Malay Peninsula versus Borneo Insular, the East Coast versus West Coast of the Malay Peninsula, and the island versus mainland Malay Peninsula populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo’s population was distinguished from Peninsula’s population (99% and 100% bootstrap value in NJ and MP respectively and 1.00 posterior probability in Bayesian trees). The East coast population was separated from other Peninsula populations (64% in NJ, 66% in MP and 0.53 posterior probability in Bayesian). West coast populations were divided into 2 clades: the North-South (47%/54% in NJ, 26/26% in MP and 1.00/0.80 posterior probability in Bayesian) and Island-Mainland (93% in NJ, 90% in MP and 1.00 posterior probability in Bayesian). The results confirm the previous morphological assignment of 2 subspecies, M. f. fascicularis and M. f. argentimembris, in the Malay Peninsula. These populations should be treated as separate genetic entities in order to conserve the genetic diversity of Malaysia’s M. fascicularis. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations

  16. Phylogenetic relationships among populations of Pristurus rupestris Blanford,1874 (Sauria: Sphaerodactylidae) in southern Iran

    OpenAIRE

    YOUSOFI, SUGOL; POUYANI, ESKANDAR RASTEGAR; HOJATI, VIDA

    2015-01-01

    We examined intraspecific relationships of the subspecies Pristurus rupestris iranicus from the northern Persian Gulf area (Hormozgan, Bushehr, and Sistan and Baluchestan provinces). Phylogenetic relationships among these samples were estimated based on the mitochondrial cytochrome b gene. We used three methods of phylogenetic tree reconstruction (maximum likelihood, maximum parsimony, and Bayesian inference). The sampled populations were divided into 5 clades but exhibit little genetic diver...

  17. Phylogenetic relationships among species of Lutzomyia, subgenus Lutzomyia (Diptera: Psychodidae).

    Science.gov (United States)

    Pinto, Israel S; Filho, José D Andrade; Santos, Claudiney B; Falqueto, Aloísio; Leite, Yuri L R

    2010-01-01

    Lutzomyia França is the largest and most diverse sand fly genus in the New World and contains all the species involved in the transmission of American visceral leishmaniasis (AVL). Morphological characters were used to test the monophyly and to infer phylogenetic relationships among members of the Lutzomyia subgenus. Fifty-two morphological characters from male and female adult specimens belonging to 18 species of Lu. (Lutzomyia) were scored and analyzed. The resulting phylogeny confirms the monophyly of this subgenus and reveals four main internal clades. These four clades, however, do not support the classification of the subgenus in two series, longipalpis and cavernicola, because neither is necessarily monophyletic. Knowledge on phylogenetic relationships among these relevant vectors of AVL should be used as a tool for monitoring target taxa and a first step for establishing an early warning system for disease control.

  18. Molecular Phylogenetics: Concepts for a Newcomer.

    Science.gov (United States)

    Ajawatanawong, Pravech

    Molecular phylogenetics is the study of evolutionary relationships among organisms using molecular sequence data. The aim of this review is to introduce the important terminology and general concepts of tree reconstruction to biologists who lack a strong background in the field of molecular evolution. Some modern phylogenetic programs are easy to use because of their user-friendly interfaces, but understanding the phylogenetic algorithms and substitution models, which are based on advanced statistics, is still important for the analysis and interpretation without a guide. Briefly, there are five general steps in carrying out a phylogenetic analysis: (1) sequence data preparation, (2) sequence alignment, (3) choosing a phylogenetic reconstruction method, (4) identification of the best tree, and (5) evaluating the tree. Concepts in this review enable biologists to grasp the basic ideas behind phylogenetic analysis and also help provide a sound basis for discussions with expert phylogeneticists.

  19. phangorn: phylogenetic analysis in R.

    Science.gov (United States)

    Schliep, Klaus Peter

    2011-02-15

    phangorn is a package for phylogenetic reconstruction and analysis in the R language. Previously it was only possible to estimate phylogenetic trees with distance methods in R. phangorn, now offers the possibility of reconstructing phylogenies with distance based methods, maximum parsimony or maximum likelihood (ML) and performing Hadamard conjugation. Extending the general ML framework, this package provides the possibility of estimating mixture and partition models. Furthermore, phangorn offers several functions for comparing trees, phylogenetic models or splits, simulating character data and performing congruence analyses. phangorn can be obtained through the CRAN homepage http://cran.r-project.org/web/packages/phangorn/index.html. phangorn is licensed under GPL 2.

  20. [Comparative leaf anatomy and phylogenetic relationships of 11 species of Laeliinae with emphasis on Brassavola (Orchidaceae)].

    Science.gov (United States)

    Noguera-Savelli, Eliana; Jáuregui, Damelis

    2011-09-01

    Brassavola inhabits a wide altitude range and habitat types from Northern Mexico to Northern Argentina. Classification schemes in plants have normally used vegetative and floral characters, but when species are very similar, as in this genus, conflicts arise in species delimitation, and alternative methods should be applied. In this study we explored the taxonomic and phylogenetic value of the anatomical structure of leaves in Brassavola; as ingroup, seven species of Brassavola were considered, and as an outgroup Guarianthe skinneri, Laelia anceps, Rhyncholaelia digbyana and Rhyncholaelia glauca were evaluated. Leaf anatomical characters were studied in freehand cross sections of the middle portion with a light microscope. Ten vegetative anatomical characters were selected and coded for the phylogenetic analysis. Phylogenetic reconstruction was carried out under maximum parsimony using the program NONA through WinClada. Overall, Brassavola species reveal a wide variety of anatomical characters, many of them associated with xeromorphic plants: thick cuticle, hypodermis and cells of the mesophyll with spiral thickenings in the secondary wall. Moreover, mesophyll is either homogeneous or heterogeneous, often with extravascular bundles of fibers near the epidermis at both terete and flat leaves. All vascular bundles are collateral, arranged in more than one row in the mesophyll. The phylogenetic analysis did not resolve internal relationships of the genus; we obtained a polytomy, indicating that the anatomical characters by themselves have little phylogenetic value in Brassavola. We concluded that few anatomical characters are phylogenetically important; however, they would provide more support to elucidate the phylogenetic relantionships in the Orchidaceae and other plant groups if they are used in conjunction with morphological and/or molecular characters.

  1. Incompletely resolved phylogenetic trees inflate estimates of phylogenetic conservatism.

    Science.gov (United States)

    Davies, T Jonathan; Kraft, Nathan J B; Salamin, Nicolas; Wolkovich, Elizabeth M

    2012-02-01

    The tendency for more closely related species to share similar traits and ecological strategies can be explained by their longer shared evolutionary histories and represents phylogenetic conservatism. How strongly species traits co-vary with phylogeny can significantly impact how we analyze cross-species data and can influence our interpretation of assembly rules in the rapidly expanding field of community phylogenetics. Phylogenetic conservatism is typically quantified by analyzing the distribution of species values on the phylogenetic tree that connects them. Many phylogenetic approaches, however, assume a completely sampled phylogeny: while we have good estimates of deeper phylogenetic relationships for many species-rich groups, such as birds and flowering plants, we often lack information on more recent interspecific relationships (i.e., within a genus). A common solution has been to represent these relationships as polytomies on trees using taxonomy as a guide. Here we show that such trees can dramatically inflate estimates of phylogenetic conservatism quantified using S. P. Blomberg et al.'s K statistic. Using simulations, we show that even randomly generated traits can appear to be phylogenetically conserved on poorly resolved trees. We provide a simple rarefaction-based solution that can reliably retrieve unbiased estimates of K, and we illustrate our method using data on first flowering times from Thoreau's woods (Concord, Massachusetts, USA).

  2. [Telomere length and phylogenetic relationship of Baikal and Siberian planarians (Turbellaria, Tricladida)].

    Science.gov (United States)

    Koroleva, A G; Evtushenko, E V; Timoshkin, O A; Vershinin, A V; Kiril'chik, S V

    2013-01-01

    Dynamics of the telomeric DNA (tDNA) and the phylogeny of the Baikal and Siberian planarians have been studied based on the analysis of the 18S rDNA and beta-actin gene fragments. A relationship between tDNA and the planarians size has been demonstrated. Giant planarians with a minor exception have longer tDNA than little planarians. Phylogenetic affinity between the species that have the stretched tracks of tDNA, big size and similar habitats may indicate possible role of tDNA in the development of the indefinite regenerative capacity of planarians.

  3. Mitochondrial DNA sequence-based phylogenetic relationship ...

    Indian Academy of Sciences (India)

    cophaga ranges from 0.037–0.106 and 0.049–0.207 for COI and ND5 genes, respectively (tables 2 and 3). Analysis of genetic distance on the basis of sequence difference for both the mitochondrial genes shows very little genetic difference. The discrepancy in the phylogenetic trees based on individ- ual genes may be due ...

  4. Construction of phylogenetic trees by kernel-based comparative analysis of metabolic networks.

    Science.gov (United States)

    Oh, S June; Joung, Je-Gun; Chang, Jeong-Ho; Zhang, Byoung-Tak

    2006-06-06

    To infer the tree of life requires knowledge of the common characteristics of each species descended from a common ancestor as the measuring criteria and a method to calculate the distance between the resulting values of each measure. Conventional phylogenetic analysis based on genomic sequences provides information about the genetic relationships between different organisms. In contrast, comparative analysis of metabolic pathways in different organisms can yield insights into their functional relationships under different physiological conditions. However, evaluating the similarities or differences between metabolic networks is a computationally challenging problem, and systematic methods of doing this are desirable. Here we introduce a graph-kernel method for computing the similarity between metabolic networks in polynomial time, and use it to profile metabolic pathways and to construct phylogenetic trees. To compare the structures of metabolic networks in organisms, we adopted the exponential graph kernel, which is a kernel-based approach with a labeled graph that includes a label matrix and an adjacency matrix. To construct the phylogenetic trees, we used an unweighted pair-group method with arithmetic mean, i.e., a hierarchical clustering algorithm. We applied the kernel-based network profiling method in a comparative analysis of nine carbohydrate metabolic networks from 81 biological species encompassing Archaea, Eukaryota, and Eubacteria. The resulting phylogenetic hierarchies generally support the tripartite scheme of three domains rather than the two domains of prokaryotes and eukaryotes. By combining the kernel machines with metabolic information, the method infers the context of biosphere development that covers physiological events required for adaptation by genetic reconstruction. The results show that one may obtain a global view of the tree of life by comparing the metabolic pathway structures using meta-level information rather than sequence

  5. Construction of phylogenetic trees by kernel-based comparative analysis of metabolic networks

    Directory of Open Access Journals (Sweden)

    Chang Jeong-Ho

    2006-06-01

    Full Text Available Abstract Background To infer the tree of life requires knowledge of the common characteristics of each species descended from a common ancestor as the measuring criteria and a method to calculate the distance between the resulting values of each measure. Conventional phylogenetic analysis based on genomic sequences provides information about the genetic relationships between different organisms. In contrast, comparative analysis of metabolic pathways in different organisms can yield insights into their functional relationships under different physiological conditions. However, evaluating the similarities or differences between metabolic networks is a computationally challenging problem, and systematic methods of doing this are desirable. Here we introduce a graph-kernel method for computing the similarity between metabolic networks in polynomial time, and use it to profile metabolic pathways and to construct phylogenetic trees. Results To compare the structures of metabolic networks in organisms, we adopted the exponential graph kernel, which is a kernel-based approach with a labeled graph that includes a label matrix and an adjacency matrix. To construct the phylogenetic trees, we used an unweighted pair-group method with arithmetic mean, i.e., a hierarchical clustering algorithm. We applied the kernel-based network profiling method in a comparative analysis of nine carbohydrate metabolic networks from 81 biological species encompassing Archaea, Eukaryota, and Eubacteria. The resulting phylogenetic hierarchies generally support the tripartite scheme of three domains rather than the two domains of prokaryotes and eukaryotes. Conclusion By combining the kernel machines with metabolic information, the method infers the context of biosphere development that covers physiological events required for adaptation by genetic reconstruction. The results show that one may obtain a global view of the tree of life by comparing the metabolic pathway

  6. Sequence comparison and phylogenetic analysis of core gene of ...

    African Journals Online (AJOL)

    Phylogenetic analysis suggests that our sequences are clustered with sequences reported from Japan. This is the first phylogenetic analysis of HCV core gene from Pakistani population. Our sequences and sequences from Japan are grouped into same cluster in the phylogenetic tree. Sequence comparison and ...

  7. Soft-tissue anatomy of the extant hominoids: a review and phylogenetic analysis

    Science.gov (United States)

    Gibbs, S; Collard, M; Wood, B

    2002-01-01

    This paper reports the results of a literature search for information about the soft-tissue anatomy of the extant non-human hominoid genera, Pan, Gorilla, Pongo and Hylobates, together with the results of a phylogenetic analysis of these data plus comparable data for Homo. Information on the four extant non-human hominoid genera was located for 240 out of the 1783 soft-tissue structures listed in the Nomina Anatomica. Numerically these data are biased so that information about some systems (e.g. muscles) and some regions (e.g. the forelimb) are over-represented, whereas other systems and regions (e.g. the veins and the lymphatics of the vascular system, the head region) are either under-represented or not represented at all. Screening to ensure that the data were suitable for use in a phylogenetic analysis reduced the number of eligible soft-tissue structures to 171. These data, together with comparable data for modern humans, were converted into discontinuous character states suitable for phylogenetic analysis and then used to construct a taxon-by-character matrix. This matrix was used in two tests of the hypothesis that soft-tissue characters can be relied upon to reconstruct hominoid phylogenetic relationships. In the first, parsimony analysis was used to identify cladograms requiring the smallest number of character state changes. In the second, the phylogenetic bootstrap was used to determine the confidence intervals of the most parsimonious clades. The parsimony analysis yielded a single most parsimonious cladogram that matched the molecular cladogram. Similarly the bootstrap analysis yielded clades that were compatible with the molecular cladogram; a (Homo, Pan) clade was supported by 95% of the replicates, and a (Gorilla, Pan, Homo) clade by 96%. These are the first hominoid morphological data to provide statistically significant support for the clades favoured by the molecular evidence. PMID:11833653

  8. A comparative ZOO-FISH analysis in bats elucidates the phylogenetic relationships between Megachiroptera and five microchiropteran families.

    Science.gov (United States)

    Volleth, M; Heller, K G; Pfeiffer, R A; Hameister, H

    2002-01-01

    Fluorescence in-situ hybridization with human whole chromosome painting probes (WCPs) was applied to compare the karyotypes of members of five bat families. Twenty-five evolutionarily conserved units (ECUs) were identified by ZOO-FISH analysis. In 10 of these 25 ECUs, thorough GTG-band comparison revealed an identical banding pattern in all families studied. Differences in the remaining ECUs were used as characters to judge the phylogenetic relationships within Chiroptera. Close relationships were found between Rhinolophidae and Hipposideridae. Also closely related are the representatives of the yangochiropteran families Phyllostomidae (genus studied: Glossophaga, Volleth et al. 1999), Molossidae and Vespertilionidae. All microchiropteran species studied here share four common features not found in the megachiropteran species Eonycteris spelaea. Two of these are considered as derived characters with a high probability of parallel evolution. On the other hand, Eonycteris shares one common, probably derived feature with the rhinolophoid families Rhinolophidae and Hipposideridae and an additional one only with Hipposideridae. At the moment, the relationships between Yangochiroptera, Rhinolophoidea and Megachiroptera must be left in an unsolved trichotomy. Comparison of neighboring segment combinations found in Chiroptera with those found in other mammalian taxa revealed six synapomorphic features for Chiroptera. Therefore, for karyological reasons, monophyly of Chiroptera is strongly supported.

  9. Genome-wide analysis of SINA family in plants and their phylogenetic relationships.

    Science.gov (United States)

    Wang, Meng; Jin, Ying; Fu, Junjie; Zhu, Yun; Zheng, Jun; Hu, Jian; Wang, Guoying

    2008-06-01

    SINA genes in plants are part of a multigene family with 5 members in Arabidopsis thaliana, 10 members in Populus trichocarpa, 6 members in Oryza sativa, at least 6 members in Zea mays and at least 1 member in Physcomitrella patens. Six members in maize were confirmed by RT-PCR. All SINAs have one RING domain and one SINA domain. These two domains are highly conserved in plants. According to the motif organization and phylogenetic tree, SINA family members were divided into 2 groups. In addition, through semi-quantitative RT-PCR analysis of maize members and Digital Northern analysis of Arabidopsis and rice members, we found that the tissue expression patterns are more diverse in monocot than in Arabidopsis.

  10. Comparative phylogenetic analysis of intergenic spacers and small ...

    African Journals Online (AJOL)

    The phylogenetic analysis of test isolates included assessment of variation in sequences and length of IGS and SSU-rRNA genes with reference to 16 different microsporidian sequences. The results proved that IGS sequences have more variation than SSU-rRNA gene sequences. Analysis of phylogenetic trees reveal that ...

  11. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species.

    Science.gov (United States)

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Despite differences in morphology, the genera representing 'true citrus fruit trees' are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial 'species' of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between 'true citrus fruit trees' were clarified. Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the

  12. Phylogenetic reconstruction methods: an overview.

    Science.gov (United States)

    De Bruyn, Alexandre; Martin, Darren P; Lefeuvre, Pierre

    2014-01-01

    Initially designed to infer evolutionary relationships based on morphological and physiological characters, phylogenetic reconstruction methods have greatly benefited from recent developments in molecular biology and sequencing technologies with a number of powerful methods having been developed specifically to infer phylogenies from macromolecular data. This chapter, while presenting an overview of basic concepts and methods used in phylogenetic reconstruction, is primarily intended as a simplified step-by-step guide to the construction of phylogenetic trees from nucleotide sequences using fairly up-to-date maximum likelihood methods implemented in freely available computer programs. While the analysis of chloroplast sequences from various Vanilla species is used as an illustrative example, the techniques covered here are relevant to the comparative analysis of homologous sequences datasets sampled from any group of organisms.

  13. Assessment of genetic diversity and phylogenetic relationships of Korean native chicken breeds using microsatellite markers

    Directory of Open Access Journals (Sweden)

    Joo Hee Seo

    2017-10-01

    Full Text Available Objective This study was conducted to investigate the basic information on genetic structure and characteristics of Korean Native chickens (NC and foreign breeds through the analysis of the pure chicken populations and commercial chicken lines of the Hanhyup Company which are popular in the NC market, using the 20 microsatellite markers. Methods In this study, the genetic diversity and phylogenetic relationships of 445 NC from five different breeds (NC, Leghorn [LH], Cornish [CS], Rhode Island Red [RIR], and Hanhyup [HH] commercial line were investigated by performing genotyping using 20 microsatellite markers. Results The highest genetic distance was observed between RIR and LH (18.9%, whereas the lowest genetic distance was observed between HH and NC (2.7%. In the principal coordinates analysis (PCoA illustrated by the first component, LH was clearly separated from the other groups. The correspondence analysis showed close relationship among individuals belonging to the NC, CS, and HH lines. From the STRUCTURE program, the presence of 5 clusters was detected and it was found that the proportion of membership in the different clusters was almost comparable among the breeds with the exception of one breed (HH, although it was highest in LH (0.987 and lowest in CS (0.578. For the cluster 1 it was high in HH (0.582 and in CS (0.368, while for the cluster 4 it was relatively higher in HH (0.392 than other breeds. Conclusion Our study showed useful genetic diversity and phylogenetic relationship data that can be utilized for NC breeding and development by the commercial chicken industry to meet consumer demands.

  14. Phylogenetic inertia and Darwin's higher law.

    Science.gov (United States)

    Shanahan, Timothy

    2011-03-01

    The concept of 'phylogenetic inertia' is routinely deployed in evolutionary biology as an alternative to natural selection for explaining the persistence of characteristics that appear sub-optimal from an adaptationist perspective. However, in many of these contexts the precise meaning of 'phylogenetic inertia' and its relationship to selection are far from clear. After tracing the history of the concept of 'inertia' in evolutionary biology, I argue that treating phylogenetic inertia and natural selection as alternative explanations is mistaken because phylogenetic inertia is, from a Darwinian point of view, simply an expected effect of selection. Although Darwin did not discuss 'phylogenetic inertia,' he did assert the explanatory priority of selection over descent. An analysis of 'phylogenetic inertia' provides a perspective from which to assess Darwin's view. Copyright © 2010 Elsevier Ltd. All rights reserved.

  15. Phylogenetic relationships of Chaetomium isolates based on the ...

    African Journals Online (AJOL)

    Biotech Unit

    2013-02-27

    Feb 27, 2013 ... Phylogenetic analysis of Chaetomium species. The evolutionary history was inferred using the maximum parsimony method. The bootstrap consensus tree inferred from. 1000 replicates is taken to represent the evolutionary history of the taxa analyzed (Felsenstein, 1985). The MP tree was obtained using.

  16. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  17. Ultrastructure, biology, and phylogenetic relationships of kinorhyncha.

    Science.gov (United States)

    Neuhaus, Birger; Higgins, Robert P

    2002-07-01

    The article summarizes current knowledge mainly about the (functional) morphology and ultrastructure, but also about the biology, development, and evolution of the Kinorhyncha. The Kinorhyncha are microscopic, bilaterally symmetrical, exclusively free-living, benthic, marine animals and ecologically part of the meiofauna. They occur throughout the world from the intertidal to the deep sea, generally in sediments but sometimes associated with plants or other animals. From adult stages 141 species are known, but 38 species have been described from juvenile stages. The trunk is arranged into 11 segments as evidenced by cuticular plates, sensory spots, setae or spines, nervous system, musculature, and subcuticular glands. The ultrastructure of several organ systems and the postembryonic development are known for very few species. Almost no data are available about the embryology and only a single gene has been sequenced for a single species. The phylogenetic relationships within Kinorhyncha are unresolved. Priapulida, Loricifera, and Kinorhyncha are grouped together as Scalidophora, but arguments are found for every possible sistergroup relationship within this taxon. The recently published Ecdysozoa hypothesis suggests a closer relationship of the Scalidophora, Nematoda, Nematomorpha, Tardigrada, Onychophora, and Arthropoda.

  18. Comparative analyses of plastid genomes from fourteen Cornales species: inferences for phylogenetic relationships and genome evolution.

    Science.gov (United States)

    Fu, Chao-Nan; Li, Hong-Tao; Milne, Richard; Zhang, Ting; Ma, Peng-Fei; Yang, Jing; Li, De-Zhu; Gao, Lian-Ming

    2017-12-08

    The Cornales is the basal lineage of the asterids, the largest angiosperm clade. Phylogenetic relationships within the order were previously not fully resolved. Fifteen plastid genomes representing 14 species, ten genera and seven families of Cornales were newly sequenced for comparative analyses of genome features, evolution, and phylogenomics based on different partitioning schemes and filtering strategies. All plastomes of the 14 Cornales species had the typical quadripartite structure with a genome size ranging from 156,567 bp to 158,715 bp, which included two inverted repeats (25,859-26,451 bp) separated by a large single-copy region (86,089-87,835 bp) and a small single-copy region (18,250-18,856 bp) region. These plastomes encoded the same set of 114 unique genes including 31 transfer RNA, 4 ribosomal RNA and 79 coding genes, with an identical gene order across all examined Cornales species. Two genes (rpl22 and ycf15) contained premature stop codons in seven and five species respectively. The phylogenetic relationships among all sampled species were fully resolved with maximum support. Different filtering strategies (none, light and strict) of sequence alignment did not have an effect on these relationships. The topology recovered from coding and noncoding data sets was the same as for the whole plastome, regardless of filtering strategy. Moreover, mutational hotspots and highly informative regions were identified. Phylogenetic relationships among families and intergeneric relationships within family of Cornales were well resolved. Different filtering strategies and partitioning schemes do not influence the relationships. Plastid genomes have great potential to resolve deep phylogenetic relationships of plants.

  19. Functional & phylogenetic diversity of copepod communities

    Science.gov (United States)

    Benedetti, F.; Ayata, S. D.; Blanco-Bercial, L.; Cornils, A.; Guilhaumon, F.

    2016-02-01

    The diversity of natural communities is classically estimated through species identification (taxonomic diversity) but can also be estimated from the ecological functions performed by the species (functional diversity), or from the phylogenetic relationships among them (phylogenetic diversity). Estimating functional diversity requires the definition of specific functional traits, i.e., phenotypic characteristics that impact fitness and are relevant to ecosystem functioning. Estimating phylogenetic diversity requires the description of phylogenetic relationships, for instance by using molecular tools. In the present study, we focused on the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. First, we implemented a specific trait database for the most commonly-sampled and abundant copepod species of the Mediterranean Sea. Our database includes 191 species, described by seven traits encompassing diverse ecological functions: minimal and maximal body length, trophic group, feeding type, spawning strategy, diel vertical migration and vertical habitat. Clustering analysis in the functional trait space revealed that Mediterranean copepods can be gathered into groups that have different ecological roles. Second, we reconstructed a phylogenetic tree using the available sequences of 18S rRNA. Our tree included 154 of the analyzed Mediterranean copepod species. We used these two datasets to describe the functional and phylogenetic diversity of copepod surface communities in the Mediterranean Sea. The replacement component (turn-over) and the species richness difference component (nestedness) of the beta diversity indices were identified. Finally, by comparing various and complementary aspects of plankton diversity (taxonomic, functional, and phylogenetic diversity) we were able to gain a better understanding of the relationships among the zooplankton community, biodiversity, ecosystem function, and environmental forcing.

  20. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species

    Science.gov (United States)

    Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

    2013-01-01

    Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will

  1. Phylogenetic relationships between Sarcocystis species from reindeer and other Sarcocystidae deduced from ssu rRNA gene sequences

    DEFF Research Database (Denmark)

    Dahlgren, S.S.; Oliveira, Rodrigo Gouveia; Gjerde, B.

    2008-01-01

    any effect on previously inferred phylogenetic relationships within the Sarcocystidae. The complete small subunit (ssu) rRNA gene sequences of all six Sarcocystis species from reindeer were used in the phylogenetic analyses along with ssu rRNA gene sequences of 85 other members of the Coccidea. Trees...... the six species in phylogenetic analyses of the Sarcocystidae, and also to investigate the phylogenetic relationships between the species from reindeer and those from other hosts. The study also aimed at revealing whether the inclusion of six Sarcocystis species from the same intermediate host would have....... tarandivulpes, formed a sister group to other Sarcocystis species with a canine definitive host. The position of S. hardangeri on the tree suggested that it uses another type of definitive host than the other Sarcocystis species in this clade. Considering the geographical distribution and infection intensity...

  2. Re-visiting phylogenetic and taxonomic relationships in the genus Saga (Insecta: Orthoptera.

    Directory of Open Access Journals (Sweden)

    Balázs Kolics

    Full Text Available Twelve of the 13 bushcricket species of the Saga genus are bisexuals and diploids, except the parthenogenetic and tetraploid bush cricket, Saga pedo. Despite a continuous research effort stretching through the 1900s, the taxonomic relationships of the Saga species are still disputed. In this study, our primary aim was to reveal natural relationships of the European Saga species and three of their Asian relatives, with special attention to the problematic taxonomy of two subspecies: S. campbelli campbelli and S. c. gracilis. Following a phylogenetic analysis of eight species, a comprehensive study was carried out on the above three taxa by using acoustic and morphometric approaches in parallel. Our phylogenetic data showed that European Saga species evolved from a monophyletic lineage. The geographical transitional species S. cappadocica was positioned between European and Asian lineages supporting the idea that the European Saga lineage originated phylogeographically from the Asian clade. The above results showed better agreement with the morphological data than with earlier ones based either on karyology or acoustic information only. After reviewing our data, we concluded that Saga pedo has most likely evolved from S. c. gracilis and not from S. rammei or S. ephippigera, as proposed by earlier studies. S. c. gracilis shares the same ITS2 haplotype with S. pedo, indicating that the latter could have evolved from populations of the former, probably through whole genome duplication. Based on acoustic and morphometric differences, we propose to elevate the two subspecies, S. campbelli campbelli and S. c. gracilis, to species level status, as Saga gracilis Kis 1962, and Saga campbelli Uvarov 1921. The present work sets the stage for future genetic and experimental investigations of Saginae and highlights the need for additional comprehensive analysis involving more Asian Saga species.

  3. Re-visiting phylogenetic and taxonomic relationships in the genus Saga (Insecta: Orthoptera).

    Science.gov (United States)

    Kolics, Balázs; Ács, Zoltán; Chobanov, Dragan Petrov; Orci, Kirill Márk; Qiang, Lo Shun; Kovács, Balázs; Kondorosy, Előd; Decsi, Kincső; Taller, János; Specziár, András; Orbán, László; Müller, Tamás

    2012-01-01

    Twelve of the 13 bushcricket species of the Saga genus are bisexuals and diploids, except the parthenogenetic and tetraploid bush cricket, Saga pedo. Despite a continuous research effort stretching through the 1900s, the taxonomic relationships of the Saga species are still disputed. In this study, our primary aim was to reveal natural relationships of the European Saga species and three of their Asian relatives, with special attention to the problematic taxonomy of two subspecies: S. campbelli campbelli and S. c. gracilis. Following a phylogenetic analysis of eight species, a comprehensive study was carried out on the above three taxa by using acoustic and morphometric approaches in parallel. Our phylogenetic data showed that European Saga species evolved from a monophyletic lineage. The geographical transitional species S. cappadocica was positioned between European and Asian lineages supporting the idea that the European Saga lineage originated phylogeographically from the Asian clade. The above results showed better agreement with the morphological data than with earlier ones based either on karyology or acoustic information only. After reviewing our data, we concluded that Saga pedo has most likely evolved from S. c. gracilis and not from S. rammei or S. ephippigera, as proposed by earlier studies. S. c. gracilis shares the same ITS2 haplotype with S. pedo, indicating that the latter could have evolved from populations of the former, probably through whole genome duplication. Based on acoustic and morphometric differences, we propose to elevate the two subspecies, S. campbelli campbelli and S. c. gracilis, to species level status, as Saga gracilis Kis 1962, and Saga campbelli Uvarov 1921. The present work sets the stage for future genetic and experimental investigations of Saginae and highlights the need for additional comprehensive analysis involving more Asian Saga species.

  4. treespace: Statistical exploration of landscapes of phylogenetic trees.

    Science.gov (United States)

    Jombart, Thibaut; Kendall, Michelle; Almagro-Garcia, Jacob; Colijn, Caroline

    2017-11-01

    The increasing availability of large genomic data sets as well as the advent of Bayesian phylogenetics facilitates the investigation of phylogenetic incongruence, which can result in the impossibility of representing phylogenetic relationships using a single tree. While sometimes considered as a nuisance, phylogenetic incongruence can also reflect meaningful biological processes as well as relevant statistical uncertainty, both of which can yield valuable insights in evolutionary studies. We introduce a new tool for investigating phylogenetic incongruence through the exploration of phylogenetic tree landscapes. Our approach, implemented in the R package treespace, combines tree metrics and multivariate analysis to provide low-dimensional representations of the topological variability in a set of trees, which can be used for identifying clusters of similar trees and group-specific consensus phylogenies. treespace also provides a user-friendly web interface for interactive data analysis and is integrated alongside existing standards for phylogenetics. It fills a gap in the current phylogenetics toolbox in R and will facilitate the investigation of phylogenetic results. © 2017 The Authors. Molecular Ecology Resources Published by John Wiley & Sons Ltd.

  5. Genetic diversity and phylogenetic relationship in different genotypes of cotton for future breeding

    Directory of Open Access Journals (Sweden)

    Jehan

    2017-11-01

    Full Text Available Background: To make the plants well adapted and more resistant to diseases and other environmental stresses there is always a need to improve the quality of plant’s genome i.e. to increase its genetic diversity. Methods: In the present study six variety and six lines of cotton were investigated for their genetic diversity and phylogenetic relationship. For this purpose 35 different RAPD primers obtained from the Gene Link Technologies, USA were used. Results: Among 35 RAPD primers, 13 primers produced reproducible PCR bands while the rest failed to show any amplification product. Our results indicated that the total count of the reproducible bands was 670 and polymorphic loci were counted to be 442 which constitute 66% of total loci. Phylogenetic analysis revealed two major groups each consists of 7 and 5 genotypes respectively. Genotypes Lp1 and Tp4 were placed at maximum genetic distance and in separate groups and could be utilized for future cotton breeding. Conclusions: RAPD analysis is a cheaper and time saving technique for the determination of genetic diversity of different cotton genotypes. Cotton genotype Lp1 and Tp4 could be the best candidates for future breeding programs as both genotypes are genetically distant from each other.

  6. The complete mitochondrial genome of Pallisentis celatus (Acanthocephala) with phylogenetic analysis of acanthocephalans and rotifers.

    Science.gov (United States)

    Pan, Ting Shuang; Nie, Pin

    2013-07-01

    Acanthocephalans are a small group of obligate endoparasites. They and rotifers are recently placed in a group called Syndermata. However, phylogenetic relationships within classes of acanthocephalans, and between them and rotifers, have not been well resolved, possibly due to the lack of molecular data suitable for such analysis. In this study, the mitochondrial (mt) genome was sequenced from Pallisentis celatus (Van Cleave, 1928), an acanthocephalan in the class Eoacanthocephala, an intestinal parasite of rice-field eel, Monopterus albus (Zuiew, 1793), in China. The complete mt genome sequence of P. celatus is 13 855 bp long, containing 36 genes including 12 protein-coding genes, 22 transfer RNAs (tRNAs) and 2 ribosomal RNAs (rRNAs) as reported for other acanthocephalan species. All genes are encoded on the same strand and in the same direction. Phylogenetic analysis indicated that acanthocephalans are closely related with a clade containing bdelloids, which then correlates with the clade containing monogononts. The class Eoacanthocephala, containing P. celatus and Paratenuisentis ambiguus (Van Cleave, 1921) was closely related to the Palaeacanthocephala. It is thus indicated that acanthocephalans may be just clustered among groups of rotifers. However, the resolving of phylogenetic relationship among all classes of acanthocephalans and between them and rotifers may require further sampling and more molecular data.

  7. Phylogenetic and Diversity Analysis of Dactylis glomerata Subspecies Using SSR and IT-ISJ Markers.

    Science.gov (United States)

    Yan, Defei; Zhao, Xinxin; Cheng, Yajuan; Ma, Xiao; Huang, Linkai; Zhang, Xinquan

    2016-10-31

    The genus Dactylis , an important forage crop, has a wide geographical distribution in temperate regions. While this genus is thought to include a single species, Dactylis glomerata , this species encompasses many subspecies whose relationships have not been fully characterized. In this study, the genetic diversity and phylogenetic relationships of nine representative Dactylis subspecies were examined using SSR and IT-ISJ markers. In total, 21 pairs of SSR primers and 15 pairs of IT-ISJ primers were used to amplify 295 polymorphic bands with polymorphic rates of 100%. The average polymorphic information contents (PICs) of SSR and IT-ISJ markers were 0.909 and 0.780, respectively. The combined data of the two markers indicated a high level of genetic diversity among the nine D. glomerata subspecies, with a Nei's gene diversity index value of 0.283 and Shannon's diversity of 0.448. Preliminarily phylogenetic analysis results revealed that the 20 accessions could be divided into three groups (A, B, C). Furthermore, they could be divided into five clusters, which is similar to the structure analysis with K = 5. Phylogenetic placement in these three groups may be related to the distribution ranges and the climate types of the subspecies in each group. Group A contained eight accessions of four subspecies, originating from the west Mediterranean, while Group B contained seven accessions of three subspecies, originating from the east Mediterranean.

  8. Phylogenetic relationships in Peniocereus (Cactaceae) inferred from plastid DNA sequence data.

    Science.gov (United States)

    Arias, Salvador; Terrazas, Teresa; Arreola-Nava, Hilda J; Vázquez-Sánchez, Monserrat; Cameron, Kenneth M

    2005-10-01

    The phylogenetic relationships of Peniocereus (Cactaceae) species were studied using parsimony analyses of DNA sequence data. The plastid rpl16 and trnL-F regions were sequenced for 98 taxa including 17 species of Peniocereus, representatives from all genera of tribe Pachycereeae, four genera of tribe Hylocereeae, as well as from three additional outgroup genera of tribes Calymmantheae, Notocacteae, and Trichocereeae. Phylogenetic analyses support neither the monophyly of Peniocereus as currently circumscribed, nor the monophyly of tribe Pachycereeae since species of Peniocereus subgenus Pseudoacanthocereus are embedded within tribe Hylocereeae. Furthermore, these results show that the eight species of Peniocereus subgenus Peniocereus (Peniocereus sensu stricto) form a well-supported clade within subtribe Pachycereinae; P. serpentinus is also a member of this subtribe, but is sister to Bergerocactus. Moreover, Nyctocereus should be resurrected as a monotypic genus. Species of Peniocereus subgenus Pseudoacanthocereus are positioned among species of Acanthocereus within tribe Hylocereeae, indicating that they may be better classified within that genus. A number of morphological and anatomical characters, especially related to the presence or absence of dimorphic branches, are discussed to support these relationships.

  9. A phylogenetic analysis of normal modes evolution in enzymes and its relationship to enzyme function.

    Science.gov (United States)

    Lai, Jason; Jin, Jing; Kubelka, Jan; Liberles, David A

    2012-09-21

    Since the dynamic nature of protein structures is essential for enzymatic function, it is expected that functional evolution can be inferred from the changes in protein dynamics. However, dynamics can also diverge neutrally with sequence substitution between enzymes without changes of function. In this study, a phylogenetic approach is implemented to explore the relationship between enzyme dynamics and function through evolutionary history. Protein dynamics are described by normal mode analysis based on a simplified harmonic potential force field applied to the reduced C(α) representation of the protein structure while enzymatic function is described by Enzyme Commission numbers. Similarity of the binding pocket dynamics at each branch of the protein family's phylogeny was analyzed in two ways: (1) explicitly by quantifying the normal mode overlap calculated for the reconstructed ancestral proteins at each end and (2) implicitly using a diffusion model to obtain the reconstructed lineage-specific changes in the normal modes. Both explicit and implicit ancestral reconstruction identified generally faster rates of change in dynamics compared with the expected change from neutral evolution at the branches of potential functional divergences for the α-amylase, D-isomer-specific 2-hydroxyacid dehydrogenase, and copper-containing amine oxidase protein families. Normal mode analysis added additional information over just comparing the RMSD of static structures. However, the branch-specific changes were not statistically significant compared to background function-independent neutral rates of change of dynamic properties and blind application of the analysis would not enable prediction of changes in enzyme specificity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Estimating phylogenetic relationships despite discordant gene trees across loci: the species tree of a diverse species group of feather mites (Acari: Proctophyllodidae).

    Science.gov (United States)

    Knowles, Lacey L; Klimov, Pavel B

    2011-11-01

    With the increased availability of multilocus sequence data, the lack of concordance of gene trees estimated for independent loci has focused attention on both the biological processes producing the discord and the methodologies used to estimate phylogenetic relationships. What has emerged is a suite of new analytical tools for phylogenetic inference--species tree approaches. In contrast to traditional phylogenetic methods that are stymied by the idiosyncrasies of gene trees, approaches for estimating species trees explicitly take into account the cause of discord among loci and, in the process, provides a direct estimate of phylogenetic history (i.e. the history of species divergence, not divergence of specific loci). We illustrate the utility of species tree estimates with an analysis of a diverse group of feather mites, the pinnatus species group (genus Proctophyllodes). Discord among four sequenced nuclear loci is consistent with theoretical expectations, given the short time separating speciation events (as evident by short internodes relative to terminal branch lengths in the trees). Nevertheless, many of the relationships are well resolved in a Bayesian estimate of the species tree; the analysis also highlights ambiguous aspects of the phylogeny that require additional loci. The broad utility of species tree approaches is discussed, and specifically, their application to groups with high speciation rates--a history of diversification with particular prevalence in host/parasite systems where species interactions can drive rapid diversification.

  11. Phylogenetic relationships of Chaetomium isolates based on the ...

    African Journals Online (AJOL)

    Molecular characterization of 18 Chaetomium isolates collected from India based on the internal transcribed spacer (ITS) region of the rRNA gene sequences was done. Phylogenetic analysis of full length ITS region showed that Chaetomium globosum isolates, Cg1, Cg2, Cg6, Cg11 and Cg15, Chaetomium spp. isolates, ...

  12. Visualizing phylogenetic tree landscapes.

    Science.gov (United States)

    Wilgenbusch, James C; Huang, Wen; Gallivan, Kyle A

    2017-02-02

    Genomic-scale sequence alignments are increasingly used to infer phylogenies in order to better understand the processes and patterns of evolution. Different partitions within these new alignments (e.g., genes, codon positions, and structural features) often favor hundreds if not thousands of competing phylogenies. Summarizing and comparing phylogenies obtained from multi-source data sets using current consensus tree methods discards valuable information and can disguise potential methodological problems. Discovery of efficient and accurate dimensionality reduction methods used to display at once in 2- or 3- dimensions the relationship among these competing phylogenies will help practitioners diagnose the limits of current evolutionary models and potential problems with phylogenetic reconstruction methods when analyzing large multi-source data sets. We introduce several dimensionality reduction methods to visualize in 2- and 3-dimensions the relationship among competing phylogenies obtained from gene partitions found in three mid- to large-size mitochondrial genome alignments. We test the performance of these dimensionality reduction methods by applying several goodness-of-fit measures. The intrinsic dimensionality of each data set is also estimated to determine whether projections in 2- and 3-dimensions can be expected to reveal meaningful relationships among trees from different data partitions. Several new approaches to aid in the comparison of different phylogenetic landscapes are presented. Curvilinear Components Analysis (CCA) and a stochastic gradient decent (SGD) optimization method give the best representation of the original tree-to-tree distance matrix for each of the three- mitochondrial genome alignments and greatly outperformed the method currently used to visualize tree landscapes. The CCA + SGD method converged at least as fast as previously applied methods for visualizing tree landscapes. We demonstrate for all three mtDNA alignments that 3D

  13. Genetic variation and phylogenetic relationships of the ectomycorrhizal Floccularia luteovirens on the Qinghai-Tibet Plateau.

    Science.gov (United States)

    Xing, Rui; Gao, Qing-Bo; Zhang, Fa-Qi; Fu, Peng-Cheng; Wang, Jiu-Li; Yan, Hui-Ying; Chen, Shi-Long

    2017-08-01

    Floccularia luteovirens, as an ectomycorrhizal fungus, is widely distributed in the Qinghai-Tibet Plateau. As an edible fungus, it is famous for its unique flavor. Former studies mainly focus on the chemical composition and genetic structure of this species. However, the phylogenetic relationship between genotypes remains unknown. In this study, the genetic variation and phylogenetic relationship between the genotypes of F. luteovirens in Qinghai-Tibet Plateau was estimated through the analysis on two protein-coding genes (rpb1 and ef-1α) from 398 individuals collected from 24 wild populations. The sample covered the entire range of this species during all the growth seasons from 2011 to 2015. 13 genotypes were detected and moderate genetic diversity was revealed. Based on the results of network analysis, the maximum likelihood (ML), maximum parsimony (MP), and Bayesian inference (BI) analyses, the genotypes H-1, H-4, H-6, H-8, H-10, and H-11 were grouped into one clade. Additionally, a relatively higher genotype diversity (average h value is 0.722) and unique genotypes in the northeast edge of Qinghai- Tibet plateau have been found, combined with the results of mismatch analysis and neutrality tests indicated that Southeast Qinghai-Tibet plateau was a refuge for F. luteovirens during the historical geological or climatic events (uplifting of the Qinghai-Tibet Plateau or Last Glacial Maximum). Furthermore, the present distribution of the species on the Qinghai-Tibet plateau has resulted from the recent population expansion. Our findings provide a foundation for the future study of the evolutionary history and the speciation of this species.

  14. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera using nuclear encoded housekeeping genes.

    Directory of Open Access Journals (Sweden)

    Malcolm S Hill

    Full Text Available Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges.We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha, but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p, Myxospongiae(p, Spongillida(p, Haploscleromorpha(p (the marine haplosclerids and Democlavia(p. We found conflicting results concerning the relationships of Keratosa(p and Myxospongiae(p to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p+Spongillida(p+Democlavia(p. In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p are sister to Haploscleromorpha(p rather than part of Democlavia(p. Within Keratosa(p, we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p, Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p, Tetractinellida(p, composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis, was consistently revealed as the sister group to all other members of Democlavia(p. Within Tetractinellida(p, we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae, and polyphyly of Hadromerida and Halichondrida.These results, using an independent nuclear gene set, confirmed

  15. Reconstruction of family-level phylogenetic relationships within Demospongiae (Porifera) using nuclear encoded housekeeping genes.

    Science.gov (United States)

    Hill, Malcolm S; Hill, April L; Lopez, Jose; Peterson, Kevin J; Pomponi, Shirley; Diaz, Maria C; Thacker, Robert W; Adamska, Maja; Boury-Esnault, Nicole; Cárdenas, Paco; Chaves-Fonnegra, Andia; Danka, Elizabeth; De Laine, Bre-Onna; Formica, Dawn; Hajdu, Eduardo; Lobo-Hajdu, Gisele; Klontz, Sarah; Morrow, Christine C; Patel, Jignasa; Picton, Bernard; Pisani, Davide; Pohlmann, Deborah; Redmond, Niamh E; Reed, John; Richey, Stacy; Riesgo, Ana; Rubin, Ewelina; Russell, Zach; Rützler, Klaus; Sperling, Erik A; di Stefano, Michael; Tarver, James E; Collins, Allen G

    2013-01-01

    Demosponges are challenging for phylogenetic systematics because of their plastic and relatively simple morphologies and many deep divergences between major clades. To improve understanding of the phylogenetic relationships within Demospongiae, we sequenced and analyzed seven nuclear housekeeping genes involved in a variety of cellular functions from a diverse group of sponges. We generated data from each of the four sponge classes (i.e., Calcarea, Demospongiae, Hexactinellida, and Homoscleromorpha), but focused on family-level relationships within demosponges. With data for 21 newly sampled families, our Maximum Likelihood and Bayesian-based approaches recovered previously phylogenetically defined taxa: Keratosa(p), Myxospongiae(p), Spongillida(p), Haploscleromorpha(p) (the marine haplosclerids) and Democlavia(p). We found conflicting results concerning the relationships of Keratosa(p) and Myxospongiae(p) to the remaining demosponges, but our results strongly supported a clade of Haploscleromorpha(p)+Spongillida(p)+Democlavia(p). In contrast to hypotheses based on mitochondrial genome and ribosomal data, nuclear housekeeping gene data suggested that freshwater sponges (Spongillida(p)) are sister to Haploscleromorpha(p) rather than part of Democlavia(p). Within Keratosa(p), we found equivocal results as to the monophyly of Dictyoceratida. Within Myxospongiae(p), Chondrosida and Verongida were monophyletic. A well-supported clade within Democlavia(p), Tetractinellida(p), composed of all sampled members of Astrophorina and Spirophorina (including the only lithistid in our analysis), was consistently revealed as the sister group to all other members of Democlavia(p). Within Tetractinellida(p), we did not recover monophyletic Astrophorina or Spirophorina. Our results also reaffirmed the monophyly of order Poecilosclerida (excluding Desmacellidae and Raspailiidae), and polyphyly of Hadromerida and Halichondrida. These results, using an independent nuclear gene set

  16. PhyloSift: phylogenetic analysis of genomes and metagenomes.

    Science.gov (United States)

    Darling, Aaron E; Jospin, Guillaume; Lowe, Eric; Matsen, Frederick A; Bik, Holly M; Eisen, Jonathan A

    2014-01-01

    Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection. In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata. These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454).

  17. PhyloSift: phylogenetic analysis of genomes and metagenomes

    Directory of Open Access Journals (Sweden)

    Aaron E. Darling

    2014-01-01

    Full Text Available Like all organisms on the planet, environmental microbes are subject to the forces of molecular evolution. Metagenomic sequencing provides a means to access the DNA sequence of uncultured microbes. By combining DNA sequencing of microbial communities with evolutionary modeling and phylogenetic analysis we might obtain new insights into microbiology and also provide a basis for practical tools such as forensic pathogen detection.In this work we present an approach to leverage phylogenetic analysis of metagenomic sequence data to conduct several types of analysis. First, we present a method to conduct phylogeny-driven Bayesian hypothesis tests for the presence of an organism in a sample. Second, we present a means to compare community structure across a collection of many samples and develop direct associations between the abundance of certain organisms and sample metadata. Third, we apply new tools to analyze the phylogenetic diversity of microbial communities and again demonstrate how this can be associated to sample metadata.These analyses are implemented in an open source software pipeline called PhyloSift. As a pipeline, PhyloSift incorporates several other programs including LAST, HMMER, and pplacer to automate phylogenetic analysis of protein coding and RNA sequences in metagenomic datasets generated by modern sequencing platforms (e.g., Illumina, 454.

  18. Complete mitochondrial genomes elucidate phylogenetic relationships of the deep-sea octocoral families Coralliidae and Paragorgiidae

    Science.gov (United States)

    Figueroa, Diego F.; Baco, Amy R.

    2014-01-01

    In the past decade, molecular phylogenetic analyses of octocorals have shown that the current morphological taxonomic classification of these organisms needs to be revised. The latest phylogenetic analyses show that most octocorals can be divided into three main clades. One of these clades contains the families Coralliidae and Paragorgiidae. These families share several taxonomically important characters and it has been suggested that they may not be monophyletic; with the possibility of the Coralliidae being a derived branch of the Paragorgiidae. Uncertainty exists not only in the relationship of these two families, but also in the classification of the two genera that make up the Coralliidae, Corallium and Paracorallium. Molecular analyses suggest that the genus Corallium is paraphyletic, and it can be divided into two main clades, with the Paracorallium as members of one of these clades. In this study we sequenced the whole mitochondrial genome of five species of Paragorgia and of five species of Corallium to use in a phylogenetic analysis to achieve two main objectives; the first to elucidate the phylogenetic relationship between the Paragorgiidae and Coralliidae and the second to determine whether the genera Corallium and Paracorallium are monophyletic. Our results show that other members of the Coralliidae share the two novel mitochondrial gene arrangements found in a previous study in Corallium konojoi and Paracorallium japonicum; and that the Corallium konojoi arrangement is also found in the Paragorgiidae. Our phylogenetic reconstruction based on all the protein coding genes and ribosomal RNAs of the mitochondrial genome suggest that the Coralliidae are not a derived branch of the Paragorgiidae, but rather a monophyletic sister branch to the Paragorgiidae. While our manuscript was in review a study was published using morphological data and several fragments from mitochondrial genes to redefine the taxonomy of the Coralliidae. Paracorallium was subsumed

  19. Social Mating System and Sex-Biased Dispersal in Mammals and Birds: A Phylogenetic Analysis

    Science.gov (United States)

    Mabry, Karen E.; Shelley, Erin L.; Davis, Katie E.; Blumstein, Daniel T.; Van Vuren, Dirk H.

    2013-01-01

    The hypothesis that patterns of sex-biased dispersal are related to social mating system in mammals and birds has gained widespread acceptance over the past 30 years. However, two major complications have obscured the relationship between these two behaviors: 1) dispersal frequency and dispersal distance, which measure different aspects of the dispersal process, have often been confounded, and 2) the relationship between mating system and sex-biased dispersal in these vertebrate groups has not been examined using modern phylogenetic comparative methods. Here, we present a phylogenetic analysis of the relationship between mating system and sex-biased dispersal in mammals and birds. Results indicate that the evolution of female-biased dispersal in mammals may be more likely on monogamous branches of the phylogeny, and that females may disperse farther than males in socially monogamous mammalian species. However, we found no support for a relationship between social mating system and sex-biased dispersal in birds when the effects of phylogeny are taken into consideration. We caution that although there are larger-scale behavioral differences in mating system and sex-biased dispersal between mammals and birds, mating system and sex-biased dispersal are far from perfectly associated within these taxa. PMID:23483957

  20. Phylogenetic relationships and evolution of growth form in Cactaceae (Caryophyllales, Eudicotyledoneae).

    Science.gov (United States)

    Hernández-Hernández, Tania; Hernández, Héctor M; De-Nova, J Arturo; Puente, Raul; Eguiarte, Luis E; Magallón, Susana

    2011-01-01

    Cactaceae is one of the most charismatic plant families because of the extreme succulence and outstanding diversity of growth forms of its members. Although cacti are conspicuous elements of arid ecosystems in the New World and are model systems for ecological and anatomical studies, the high morphological convergence and scarcity of phenotypic synapomorphies make the evolutionary relationships and trends among lineages difficult to understand. We performed phylogenetic analyses implementing parsimony ratchet and likelihood methods, using a concatenated matrix with 6148 bp of plastid and nuclear markers (trnK/matK, matK, trnL-trnF, rpl16, and ppc). We included 224 species representing approximately 85% of the family's genera. Likelihood methods were used to perform an ancestral character reconstruction within Cactoideae, the richest subfamily in terms of morphological diversity and species number, to evaluate possible growth form evolutionary trends. Our phylogenetic results support previous studies showing the paraphyly of subfamily Pereskioideae and the monophyly of subfamilies Opuntioideae and Cactoideae. After the early divergence of Blossfeldia, Cactoideae splits into two clades: Cacteae, including North American globose and barrel-shaped members, and core Cactoideae, including the largest diversity of growth forms distributed throughout the American continent. Para- or polyphyly is persistent in different parts of the phylogeny. Main Cactoideae clades were found to have different ancestral growth forms, and convergence toward globose, arborescent, or columnar forms occurred in different lineages. Our study enabled us to provide a detailed hypothesis of relationships among cacti lineages and represents the most complete general phylogenetic framework available to understand evolutionary trends within Cactaceae.

  1. Phylogenetic Relationships of Five Asian Schilbid Genera Including Clupisoma (Siluriformes: Schilbeidae.

    Directory of Open Access Journals (Sweden)

    Jing Wang

    Full Text Available The phylogenetic relationships of Asian schilbid catfishes of the genera Clupisoma, Ailia, Horabagrus, Laides and Pseudeutropius are poorly understood, especially those of Clupisoma. Herein, we reconstruct the phylogeny of 38 species of catfishes belonging to 28 genera and 14 families using the concatenated mitochondrial genes COI, cytb, and 16S rRNA, as well as the nuclear genes RAG1 and RAG2. The resulting phylogenetic trees consistently place Clupisoma as the sister taxon of Laides, and the five representative Asian schilbid genera form two monophyletic groups with the relationships (Ailia (Laides, Clupisoma and (Horabagrus, Pseudeutropius. The so-called "Big Asia" lineage relates distantly to African schilbids. Independent analyses of the mitochondrial and nuclear DNA data yield differing trees for the two Asian schilbid groups. Analyses of the mitochondrial gene data support a sister-group relationship for (Ailia (Laides, Clupisoma and the Sisoroidea and a sister-taxon association of (Horabagrus, Pseudeutropius and the Bagridae. In contrast, analyses of the combined nuclear data indicate (Ailia (Laides, Clupisoma to be the sister group to (Horabagrus, Pseudeutropius. Our results indicate that the Horabagridae, recognized by some authors as consisting of Horabagrus, Pseudeutropius and Clupisoma does not include the latter genus. We formally erect a new family, Ailiidae fam. nov. for a monophyletic Asian group comprised of the genera Ailia, Laides and Clupisoma.

  2. Complete mitochondrial genome of threatened mahseer Tor tor (Hamilton 1822) and its phylogenetic relationship within Cyprinidae family.

    Science.gov (United States)

    Pavan-Kumar, A; Raman, Sudhanshu; Koringa, Prakash G; Patel, Namrata; Shah, Tejas; Singh, Rajeev K; Krishna, Gopal; Joshi, C G; Gireesh-Babu, P; Chaudhari, Aparna

    2016-12-01

    The mahseers (Tor, Neolissochilus and Naziritor) are an important group of fishes endemic to Asia with the conservation status of most species evaluated as threatened. Conservation plans to revive these declining wild populations are hindered by unstable taxonomy. Molecular phylogeny studies with mitochondrial genome have been successfully used to reconstruct the phylogenetic tree and to resolve taxonomic ambiguity. In the present study, complete mitochondrial genome of Tor tor has been sequenced using ion torrent next-generation sequencing platform with coverage of more than 1000 x. Comparative mitogenome analysis shows higher divergence value at ND1 gene than COI gene. Further, occurrence of a distinct genetic lineage of T. tor is revealed. The phylogenetic relationship among mahseer group has been defined as Neolissochilus hexagonolepis ((T. sinensis (T. putitora, T. tor), (T. khudree, T. tambroides)).

  3. A phylogenetic perspective on the individual species-area relationship in temperate and tropical tree communities.

    Science.gov (United States)

    Yang, Jie; Swenson, Nathan G; Cao, Min; Chuyong, George B; Ewango, Corneille E N; Howe, Robert; Kenfack, David; Thomas, Duncan; Wolf, Amy; Lin, Luxiang

    2013-01-01

    Ecologists have historically used species-area relationships (SARs) as a tool to understand the spatial distribution of species. Recent work has extended SARs to focus on individual-level distributions to generate individual species area relationships (ISARs). The ISAR approach quantifies whether individuals of a species tend have more or less species richness surrounding them than expected by chance. By identifying richness 'accumulators' and 'repellers', respectively, the ISAR approach has been used to infer the relative importance of abiotic and biotic interactions and neutrality. A clear limitation of the SAR and ISAR approaches is that all species are treated as evolutionarily independent and that a large amount of work has now shown that local tree neighborhoods exhibit non-random phylogenetic structure given the species richness. Here, we use nine tropical and temperate forest dynamics plots to ask: (i) do ISARs change predictably across latitude?; (ii) is the phylogenetic diversity in the neighborhood of species accumulators and repellers higher or lower than that expected given the observed species richness?; and (iii) do species accumulators, repellers distributed non-randomly on the community phylogenetic tree? The results indicate no clear trend in ISARs from the temperate zone to the tropics and that the phylogenetic diversity surrounding the individuals of species is generally only non-random on very local scales. Interestingly the distribution of species accumulators and repellers was non-random on the community phylogenies suggesting the presence of phylogenetic signal in the ISAR across latitude.

  4. TREEFINDER: a powerful graphical analysis environment for molecular phylogenetics

    Directory of Open Access Journals (Sweden)

    von Haeseler Arndt

    2004-06-01

    Full Text Available Abstract Background Most analysis programs for inferring molecular phylogenies are difficult to use, in particular for researchers with little programming experience. Results TREEFINDER is an easy-to-use integrative platform-independent analysis environment for molecular phylogenetics. In this paper the main features of TREEFINDER (version of April 2004 are described. TREEFINDER is written in ANSI C and Java and implements powerful statistical approaches for inferring gene tree and related analyzes. In addition, it provides a user-friendly graphical interface and a phylogenetic programming language. Conclusions TREEFINDER is a versatile framework for analyzing phylogenetic data across different platforms that is suited both for exploratory as well as advanced studies.

  5. Phylogenetic diversity and biodiversity indices on phylogenetic networks.

    Science.gov (United States)

    Wicke, Kristina; Fischer, Mareike

    2018-04-01

    In biodiversity conservation it is often necessary to prioritize the species to conserve. Existing approaches to prioritization, e.g. the Fair Proportion Index and the Shapley Value, are based on phylogenetic trees and rank species according to their contribution to overall phylogenetic diversity. However, in many cases evolution is not treelike and thus, phylogenetic networks have been developed as a generalization of phylogenetic trees, allowing for the representation of non-treelike evolutionary events, such as hybridization. Here, we extend the concepts of phylogenetic diversity and phylogenetic diversity indices from phylogenetic trees to phylogenetic networks. On the one hand, we consider the treelike content of a phylogenetic network, e.g. the (multi)set of phylogenetic trees displayed by a network and the so-called lowest stable ancestor tree associated with it. On the other hand, we derive the phylogenetic diversity of subsets of taxa and biodiversity indices directly from the internal structure of the network. We consider both approaches that are independent of so-called inheritance probabilities as well as approaches that explicitly incorporate these probabilities. Furthermore, we introduce our software package NetDiversity, which is implemented in Perl and allows for the calculation of all generalized measures of phylogenetic diversity and generalized phylogenetic diversity indices established in this note that are independent of inheritance probabilities. We apply our methods to a phylogenetic network representing the evolutionary relationships among swordtails and platyfishes (Xiphophorus: Poeciliidae), a group of species characterized by widespread hybridization. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Expressed sequence tags as a tool for phylogenetic analysis of placental mammal evolution.

    Directory of Open Access Journals (Sweden)

    Morgan Kullberg

    Full Text Available BACKGROUND: We investigate the usefulness of expressed sequence tags, ESTs, for establishing divergences within the tree of placental mammals. This is done on the example of the established relationships among primates (human, lagomorphs (rabbit, rodents (rat and mouse, artiodactyls (cow, carnivorans (dog and proboscideans (elephant. METHODOLOGY/PRINCIPAL FINDINGS: We have produced 2000 ESTs (1.2 mega bases from a marsupial mouse and characterized the data for their use in phylogenetic analysis. The sequences were used to identify putative orthologous sequences from whole genome projects. Although most ESTs stem from single sequence reads, the frequency of potential sequencing errors was found to be lower than allelic variation. Most of the sequences represented slowly evolving housekeeping-type genes, with an average amino acid distance of 6.6% between human and mouse. Positive Darwinian selection was identified at only a few single sites. Phylogenetic analyses of the EST data yielded trees that were consistent with those established from whole genome projects. CONCLUSIONS: The general quality of EST sequences and the general absence of positive selection in these sequences make ESTs an attractive tool for phylogenetic analysis. The EST approach allows, at reasonable costs, a fast extension of data sampling from species outside the genome projects.

  7. Applying phylogenetic analysis to viral livestock diseases: moving beyond molecular typing.

    Science.gov (United States)

    Olvera, Alex; Busquets, Núria; Cortey, Marti; de Deus, Nilsa; Ganges, Llilianne; Núñez, José Ignacio; Peralta, Bibiana; Toskano, Jennifer; Dolz, Roser

    2010-05-01

    Changes in livestock production systems in recent years have altered the presentation of many diseases resulting in the need for more sophisticated control measures. At the same time, new molecular assays have been developed to support the diagnosis of animal viral disease. Nucleotide sequences generated by these diagnostic techniques can be used in phylogenetic analysis to infer phenotypes by sequence homology and to perform molecular epidemiology studies. In this review, some key elements of phylogenetic analysis are highlighted, such as the selection of the appropriate neutral phylogenetic marker, the proper phylogenetic method and different techniques to test the reliability of the resulting tree. Examples are given of current and future applications of phylogenetic reconstructions in viral livestock diseases. Copyright 2009 Elsevier Ltd. All rights reserved.

  8. Molecular Phylogenetic: Organism Taxonomy Method Based on Evolution History

    Directory of Open Access Journals (Sweden)

    N.L.P Indi Dharmayanti

    2011-03-01

    Full Text Available Phylogenetic is described as taxonomy classification of an organism based on its evolution history namely its phylogeny and as a part of systematic science that has objective to determine phylogeny of organism according to its characteristic. Phylogenetic analysis from amino acid and protein usually became important area in sequence analysis. Phylogenetic analysis can be used to follow the rapid change of a species such as virus. The phylogenetic evolution tree is a two dimensional of a species graphic that shows relationship among organisms or particularly among their gene sequences. The sequence separation are referred as taxa (singular taxon that is defined as phylogenetically distinct units on the tree. The tree consists of outer branches or leaves that represents taxa and nodes and branch represent correlation among taxa. When the nucleotide sequence from two different organism are similar, they were inferred to be descended from common ancestor. There were three methods which were used in phylogenetic, namely (1 Maximum parsimony, (2 Distance, and (3 Maximum likehoood. Those methods generally are applied to construct the evolutionary tree or the best tree for determine sequence variation in group. Every method is usually used for different analysis and data.

  9. Phylogenetic relationships in Asarum: Effect of data partitioning and a revised classification.

    Science.gov (United States)

    Sinn, Brandon T; Kelly, Lawrence M; Freudenstein, John V

    2015-05-01

    Generic boundaries and infrageneric relationships among the charismatic temperate magnoliid Asarum sensu lato (Aristolochiaceae) have long been uncertain. Previous molecular phylogenetic analyses used either plastid or nuclear loci alone and varied greatly in their taxonomic implications for the genus. We analyzed additional molecular markers from the nuclear and plastid genomes, reevaluated the possibility of a derived loss of autonomous self-pollination, and investigated the topological effects of matrix-partitioning-scheme choice. We sequenced seven plastid regions and the nuclear ITS1-ITS2 region of 58 individuals representing all previously recognized Asarum s.l. segregate genera and the monotypic genus Saruma. Matrices were partitioned using common a priori partitioning schemes and PartitionFinder. Topologies that were recovered using a priori partitioning of matrices differed from those recovered using a PartitionFinder-selected scheme, and by analysis method. We recovered six monophyletic groups that we circumscribed into three subgenera and six sections. Putative fungal mimic characters served as synapomorphies only for subgenus Heterotropa. Subgenus Geotaenium, a new subgenus, was recovered as sister to the remainder of Asarum by ML analyses of highly partitioned datasets. Section Longistylis, also newly named, is sister to section Hexastylis. Our analyses do not unambiguously support a single origin for all fungal-mimicry characters. Topologies recovered through the analysis of PartitionFinder-optimized matrices can differ drastically from those inferred from a priori partitioned matrices, and by analytical method. We recommend that investigators evaluate the topological effects of matrix partitioning using multiple methods of phylogenetic reconstruction. © 2015 Botanical Society of America, Inc.

  10. Phylogenetic Analysis of the Bee Tribe Anthidiini | Combey | Journal ...

    African Journals Online (AJOL)

    The phylogenetic relationships among members of long tongue bee tribe Anthidiini (Megachilidae: Megachilinae) were investigated at the Department of Entomology and Wildlife, University of Cape Coast (Ghana) and the Agricultural Research Council, Pretoria (South Af-rica) from July, 2006 to May, 2007. Ten museums ...

  11. Possible sister groups and phylogenetic relationships among selected North Pacific and North Atlantic Rhodophyta

    Science.gov (United States)

    Lindstrom, Sandra C.

    1987-09-01

    Although the cool temperate (boreal) waters of the N. Pacific and N. Atlantic share many similar if not identical species, there have been few studies to test the identity of these species pairs. Whereas such tests are important from a taxonomic perspective, they tell us little if anything about biogeographic relationships. A more useful approach is one employing phylogenetic systematics (cladistics). The interpretation of phylogenetic diagrams (cladograms) in terms of biogeographic area relationships is explained. It is argued that cladistic analyses of taxa occurring in the cool temperate waters of the northern oceans can provide biogeographic tracks, which in turn can suggest the origins and migrations of species and possibly even floras. A number of cool temperate taxa that appear particularly amenable to this approach are discussed, including genera in the Palmariaceae, Corallinaceae, Dumontiaceae, Solieriaceae, Petrocelidaceae, Ceramiaceae and Rhodomelaceae.

  12. Phylogenetic Analysis of Petunia sensu Jussieu (Solanaceae) using Chloroplast DNA RFLP

    OpenAIRE

    ANDO, TOSHIO; KOKUBUN, HISASHI; WATANABE, HITOSHI; TANAKA, NORIO; YUKAWA, TOMOHISA; HASHIMOTO, GORO; MARCHESI, EDUARDO; SUÁREZ, ENRIQUE; BASUALDO, ISABEL L.

    2005-01-01

    • Background and Aims The phylogenetic relationships of Petunia sensu Jussieu (Petunia sensu Wijsman plus Calibrachoa) are unclear. This study aimed to resolve this uncertainty using molecular evidence.

  13. Phylogenetic Relationships and Evolutionary Patterns of the Order Collodaria (Radiolaria)

    Science.gov (United States)

    Ishitani, Yoshiyuki; Ujiié, Yurika; de Vargas, Colomban; Not, Fabrice; Takahashi, Kozo

    2012-01-01

    Collodaria are the only group of Radiolaria that has a colonial lifestyle. This group is potentially the most important plankton in the oligotrophic ocean because of its large biomass and the high primary productivity associated with the numerous symbionts inside a cell or colony. The evolution of Collodaria could thus be related to the changes in paleo-productivity that have affected organic carbon fixation in the oligotrophic ocean. However, the fossil record of Collodaria is insufficient to trace their abundance through geological time, because most collodarians do not have silicified shells. Recently, molecular phylogeny based on nuclear small sub-unit ribosomal DNA (SSU rDNA) confirmed Collodaria to be one of five orders of Radiolaria, though the relationship among collodarians is still unresolved because of inadequate taxonomic sampling. Our phylogenetic analysis has revealed four novel collodarian sequences, on the basis of which collodarians can be divided into four clades that correspond to taxonomic grouping at the family level: Thalassicollidae, Collozoidae, Collosphaeridae, and Collophidae. Comparison of the results of our phylogenetic analyses with the morphological characteristics of each collodarian family suggests that the first ancestral collodarians had a solitary lifestyle and left no silica deposits. The timing of events estimated from molecular divergence calculations indicates that naked collodarian lineages first appeared around 45.6 million years (Ma) ago, coincident with the diversification of diatoms in the pelagic oceans. Colonial collodarians appeared after the formation of the present ocean circulation system and the development of oligotrophic conditions in the equatorial Pacific (ca. 33.4 Ma ago). The divergence of colonial collodarians probably caused a shift in the efficiency of primary production during this period. PMID:22567112

  14. Phylogenetic relationships and evolutionary patterns of the order Collodaria (Radiolaria.

    Directory of Open Access Journals (Sweden)

    Yoshiyuki Ishitani

    Full Text Available Collodaria are the only group of Radiolaria that has a colonial lifestyle. This group is potentially the most important plankton in the oligotrophic ocean because of its large biomass and the high primary productivity associated with the numerous symbionts inside a cell or colony. The evolution of Collodaria could thus be related to the changes in paleo-productivity that have affected organic carbon fixation in the oligotrophic ocean. However, the fossil record of Collodaria is insufficient to trace their abundance through geological time, because most collodarians do not have silicified shells. Recently, molecular phylogeny based on nuclear small sub-unit ribosomal DNA (SSU rDNA confirmed Collodaria to be one of five orders of Radiolaria, though the relationship among collodarians is still unresolved because of inadequate taxonomic sampling. Our phylogenetic analysis has revealed four novel collodarian sequences, on the basis of which collodarians can be divided into four clades that correspond to taxonomic grouping at the family level: Thalassicollidae, Collozoidae, Collosphaeridae, and Collophidae. Comparison of the results of our phylogenetic analyses with the morphological characteristics of each collodarian family suggests that the first ancestral collodarians had a solitary lifestyle and left no silica deposits. The timing of events estimated from molecular divergence calculations indicates that naked collodarian lineages first appeared around 45.6 million years (Ma ago, coincident with the diversification of diatoms in the pelagic oceans. Colonial collodarians appeared after the formation of the present ocean circulation system and the development of oligotrophic conditions in the equatorial Pacific (ca. 33.4 Ma ago. The divergence of colonial collodarians probably caused a shift in the efficiency of primary production during this period.

  15. Delineation of Streptococcus dysgalactiae, its subspecies, and its clinical and phylogenetic relationship to Streptococcus pyogenes

    DEFF Research Database (Denmark)

    Jensen, Anders; Kilian, Mogens

    2011-01-01

    The close phylogenetic relationship of the important pathogen Streptococcus pneumoniae and several species of commensal streptococci, particularly Streptococcus mitis and Streptococcus pseudopneumoniae, and the recently demonstrated sharing of genes and phenotypic traits previously considered...

  16. The complete genome structure and phylogenetic relationship of infectious hematopoietic necrosis virus

    Science.gov (United States)

    Morzunov , Sergey P.; Winton, James R.; Nichol, Stuart T.

    1995-01-01

    Infectious hematopoietic necrosis virus (IHNV), a member of the family Rhabdoviridae, causes a severe disease with high mortality in salmonid fish. The nucleotide sequence (11, 131 bases) of the entire genome was determined for the pathogenic WRAC strain of IHNV from southern Idaho. This allowed detailed analysis of all 6 genes, the deduced amino acid sequences of their encoded proteins, and important control motifs including leader, trailer and gene junction regions. Sequence analysis revealed that the 6 virus genes are located along the genome in the 3′ to 5′ order: nucleocapsid (N), polymerase-associated phosphoprotein (P or M1), matrix protein (M or M2), surface glycoprotein (G), a unique non-virion protein (NV) and virus polymerase (L). The IHNV genome RNA was found to have highly complementary termini (15 of 16 nucleotides). The gene junction regions display the highly conserved sequence UCURUC(U)7RCCGUG(N)4CACR (in the vRNA sense), which includes the typical rhabdovirus transcription termination/polyadenylation signal and a novel putative transcription initiation signal. Phylogenetic analysis of M, G and L protein sequences allowed insights into the evolutionary and taxonomic relationship of rhabdoviruses of fish relative to those of insects or mammals, and a broader sense of the relationship of non-segmented negative-strand RNA viruses. Based on these data, a new genus, piscivirus, is proposed which will initially contain IHNV, viral hemorrhagic septicemia virus and Hirame rhabdovirus.

  17. Phylogenetic relationships and divergence dates of softshell turtles (Testudines: Trionychidae) inferred from complete mitochondrial genomes.

    Science.gov (United States)

    Li, H; Liu, J; Xiong, L; Zhang, H; Zhou, H; Yin, H; Jing, W; Li, J; Shi, Q; Wang, Y; Liu, J; Nie, L

    2017-05-01

    The softshell turtles (Trionychidae) are one of the most widely distributed reptile groups in the world, and fossils have been found on all continents except Antarctica. The phylogenetic relationships among members of this group have been previously studied; however, disagreements regarding its taxonomy, its phylogeography and divergence times are still poorly understood as well. Here, we present a comprehensive mitogenomic study of softshell turtles. We sequenced the complete mitochondrial genomes of 10 softshell turtles, in addition to the GenBank sequence of Dogania subplana, Lissemys punctata, Trionyx triunguis, which cover all extant genera within Trionychidae except for Cyclanorbis and Cycloderma. These data were combined with other mitogenomes of turtles for phylogenetic analyses. Divergence time calibration and ancestral reconstruction were calculated using BEAST and RASP software, respectively. Our phylogenetic analyses indicate that Trionychidae is the sister taxon of Carettochelyidae, and support the monophyly of Trionychinae and Cyclanorbinae, which is consistent with morphological data and molecular analysis. Our phylogenetic analyses have established a sister taxon relationship between the Asian Rafetus and the Asian Palea + Pelodiscus + Dogania + Nilssonia + Amyda, whereas a previous study grouped the Asian Rafetus with the American Apalone. The results of divergence time estimates and area ancestral reconstruction show that extant Trionychidae originated in Asia at around 108 million years ago (MA), and radiations mainly occurred during two warm periods, namely Late Cretaceous-Early Eocene and Oligocene. By combining the estimated divergence time and the reconstructed ancestral area of softshell turtles, we determined that the dispersal of softshell turtles out of Asia may have taken three routes. Furthermore, the times of dispersal seem to be in agreement with the time of the India-Asia collision and opening of the Bering Strait, which

  18. Phylogenetic relationships among Maloideae species

    Science.gov (United States)

    The Maloideae is a highly diverse sub-family of the Rosaceae containing several agronomically important species (Malus sp. and Pyrus sp.) and their wild relatives. Previous phylogenetic work within the group has revealed extensive intergeneric hybridization and polyploidization. In order to develop...

  19. Penicillium simile sp. nov. revealed by morphological and phylogenetic analysis.

    Science.gov (United States)

    Davolos, Domenico; Pietrangeli, Biancamaria; Persiani, Anna Maria; Maggi, Oriana

    2012-02-01

    The morphology of three phenetically identical Penicillium isolates, collected from the bioaerosol in a restoration laboratory in Italy, displayed macro- and microscopic characteristics that were similar though not completely ascribable to Penicillium raistrickii. For this reason, a phylogenetic approach based on DNA sequencing analysis was performed to establish both the taxonomic status and the evolutionary relationships of these three peculiar isolates in relation to previously described species of the genus Penicillium. We used four nuclear loci (both rRNA and protein coding genes) that have previously proved useful for the molecular investigation of taxa belonging to the genus Penicillium at various evolutionary levels. The internal transcribed spacer region (ITS1-5.8S-ITS2), domains D1 and D2 of the 28S rDNA, a region of the tubulin beta chain gene (benA) and part of the calmodulin gene (cmd) were amplified by PCR and sequenced. Analysis of the rRNA genes and of the benA and cmd sequence data indicates the presence of three isogenic isolates belonging to a genetically distinct species of the genus Penicillium, here described and named Penicillium simile sp. nov. (ATCC MYA-4591(T)  = CBS 129191(T)). This novel species is phylogenetically different from P. raistrickii and other related species of the genus Penicillium (e.g. Penicillium scabrosum), from which it can be distinguished on the basis of morphological trait analysis.

  20. [Phylogenetic analysis of closely related Leuconostoc citreum species based on partial housekeeping genes].

    Science.gov (United States)

    Lv, Qiang; Chen, Ming; Xu, Haiyan; Song, Yuqin; Sun, Zhihong; Dan, Tong; Sun, Tiansong

    2013-07-04

    Using the 16S rRNA, dnaA, murC and pyrG gene sequences, we identified the phylogenetic relationship among closely related Leuconostoc citreum species. Seven Leu. citreum strains originally isolated from sourdough were characterized by PCR methods to amplify the dnaA, murC and pyrG gene sequences, which were determined to assess the suitability as phylogenetic markers. Then, we estimated the genetic distance and constructed the phylogenetic trees including 16S rRNA and above mentioned three housekeeping genes combining with published corresponding sequences. By comparing the phylogenetic trees, the topology of three housekeeping genes trees were consistent with that of 16S rRNA gene. The homology of closely related Leu. citreum species among dnaA, murC, pyrG and 16S rRNA gene sequences were different, ranged from75.5% to 97.2%, 50.2% to 99.7%, 65.0% to 99.8% and 98.5% 100%, respectively. The phylogenetic relationship of three housekeeping genes sequences were highly consistent with the results of 16S rRNA gene sequence, while the genetic distance of these housekeeping genes were extremely high than 16S rRNA gene. Consequently, the dnaA, murC and pyrG gene are suitable for classification and identification closely related Leu. citreum species.

  1. A RAD-based phylogenetics for Orestias fishes from Lake Titicaca.

    Science.gov (United States)

    Takahashi, Tetsumi; Moreno, Edmundo

    2015-12-01

    The fish genus Orestias is endemic to the Andes highlands, and Lake Titicaca is the centre of the species diversity of the genus. Previous phylogenetic studies based on a single locus of mitochondrial and nuclear DNA strongly support the monophyly of a group composed of many of species endemic to the Lake Titicaca basin (the Lake Titicaca radiation), but the relationships among the species in the radiation remain unclear. Recently, restriction site-associated DNA (RAD) sequencing, which can produce a vast number of short sequences from various loci of nuclear DNA, has emerged as a useful way to resolve complex phylogenetic problems. To propose a new phylogenetic hypothesis of Orestias fishes of the Lake Titicaca radiation, we conducted a cluster analysis based on morphological similarities among fish samples and a molecular phylogenetic analysis based on RAD sequencing. From a morphological cluster analysis, we recognised four species groups in the radiation, and three of the four groups were resolved as monophyletic groups in maximum-likelihood trees based on RAD sequencing data. The other morphology-based group was not resolved as a monophyletic group in molecular phylogenies, and some members of the group were diverged from its sister group close to the root of the Lake Titicaca radiation. The evolution of these fishes is discussed from the phylogenetic relationships. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. The combination of phylogenetic analysis with epidemiological and serological data to track HIV-1 transmission in a sexual transmission case.

    Directory of Open Access Journals (Sweden)

    Min Chen

    Full Text Available To investigate the linkage of HIV transmission from a man to a woman through unprotected sexual contact without disclosing his HIV-positive status.Combined with epidemiological information and serological tests, phylogenetic analysis was used to test the a priori hypothesis of HIV transmission from the man to the woman. Control subjects, infected with HIV through heterosexual intercourse, from the same location were also sampled. Phylogenetic analyses were performed using the consensus gag, pol and env sequences obtained from blood samples of the man, the woman and the local control subjects. The env quasispecies of the man, the woman, and two controls were also obtained using single genome amplification and sequencing (SGA/S to explore the paraphyletic relationship by phylogenetic analysis.Epidemiological information and serological tests indicated that the man was infected with HIV-1 earlier than the woman. Phylogenetic analyses of the consensus sequences showed a monophyletic cluster for the man and woman in all three genomic regions. Furthermore, gag sequences of the man and woman shared a unique recombination pattern from subtype B and C, which was different from those of CRF07_BC or CRF08_BC observed in the local samples. These indicated that the viral sequences from the two subjects display a high level of similarity. Further, viral quasispecies from the man exhibited a paraphyletic relationship with those from the woman in the Bayesian and maximum-likelihood (ML phylogenetic trees of the env region, which supported the transmission direction from the man to the woman.In the context of epidemiological and serological evidence, the results of phylogenetic analyses support the transmission from the man to the woman.

  3. Host specificity and phylogenetic relationships of chicken and turkey parvoviruses

    Science.gov (United States)

    Previous reports indicate that the newly discovered chicken parvoviruses (ChPV) and turkey parvoviruses (TuPV) are very similar to each other, yet they represent different species within a new genus of Parvoviridae. Currently, strain classification is based on the phylogenetic analysis of a 561 bas...

  4. Phylogenetic relationships within and among Brassica species from ...

    African Journals Online (AJOL)

    Consequently, two potentially susceptible B. napus accessions were identified. The high polymorphic information content (PIC) and number of phylogenetically informative bands established RAPD as a useful tool for phylogenetic reconstruction, quantification of genetic diversity for conservation, cultivar classification and ...

  5. The complete mitochondrial genome of Sesarmops sinensis reveals gene rearrangements and phylogenetic relationships in Brachyura.

    Science.gov (United States)

    Tang, Bo-Ping; Xin, Zhao-Zhe; Liu, Yu; Zhang, Dai-Zhen; Wang, Zheng-Fei; Zhang, Hua-Bin; Chai, Xin-Yue; Zhou, Chun-Lin; Liu, Qiu-Ning

    2017-01-01

    Mitochondrial genome (mitogenome) is very important to understand molecular evolution and phylogenetics. Herein, in this study, the complete mitogenome of Sesarmops sinensis was reported. The mitogenome was 15,905 bp in size, and contained 13 protein-coding genes (PCGs), two ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, and a control region (CR). The AT skew and the GC skew are both negative in the mitogenomes of S. sinensis. The nucleotide composition of the S. sinensis mitogenome was also biased toward A + T nucleotides (75.7%). All tRNA genes displayed a typical mitochondrial tRNA cloverleaf structure, except for the trnS1 gene, which lacked a dihydroxyuridine arm. S. sinensis exhibits a novel rearrangement compared with the Pancrustacean ground pattern and other Brachyura species. Based on the 13 PCGs, the phylogenetic analysis showed that S. sinensis and Sesarma neglectum were clustered on one branch with high nodal support values, indicating that S. sinensis and S. neglectum have a sister group relationship. The group (S. sinensis + S. neglectum) was sister to (Parasesarmops tripectinis + Metopaulias depressus), suggesting that S. sinensis belongs to Grapsoidea, Sesarmidae. Phylogenetic trees based on amino acid sequences and nucleotide sequences of mitochondrial 13 PCGs using BI and ML respectively indicate that section Eubrachyura consists of four groups clearly. The resulting phylogeny supports the establishment of a separate subsection Potamoida. These four groups correspond to four subsections of Raninoida, Heterotremata, Potamoida, and Thoracotremata.

  6. Endosymbiosis In Statu Nascendi: Close Phylogenetic RelationshipBetween Obligately Endosymbiotic and Obligately Free-LivingPolynucleobacter Strains (Betaproteobacteria)

    Energy Technology Data Exchange (ETDEWEB)

    Vannini, Claudia; Pockl, Matthias; Petroni, Giulio; Wu, Qinglong; Lang, Elke; Stackebrandt, Erko; Schrallhammer, Martina; Richardson, PaulM.; Hahn, Martin W.

    2006-07-21

    Bacterial strains affiliated to the phylogenetically shallowsubcluster C (PnecC) of the 28 Polynucleobacter cluster, which ischaracterized by a minimal 16S rRNA gene sequence similarity of approx.98.5 percent, have been reported to occur as obligate endosymbionts of 30ciliates (Euplotes spp.), as well as to occur as free-living cells in thepelagic zone of freshwater habitats. We investigated if these two groupsof closely related bacteria represent 32 strains fundamentally differingin lifestyle, or if they simply represent different stages of afacultative endosymbiotic lifestyle. The phylogenetic analysis of 16SrRNA gene and 16S34 23S ITS sequences of five endosymbiont strains fromtwo different Euplotes species and 40 pure culture strains demonstratedhost-species-specific clustering of the endosymbiont 36 sequences withinthe PnecC subcluster. The sequences of the endosymbionts showedcharacteristics indicating an obligate endosymbiotic lifestyle.Cultivation experiments 38 revealed fundamental differences inphysiological adaptations, and determination of the genome sizesindicated a slight size reduction in endosymbiotic strains. We concludethat the 40 two groups of PnecC bacteria represent obligately free-livingand obligately endosymbiotic strains, respectively, and do not representdifferent stages of the same complex lifecycle. 42 These closely relatedstrains occupy completely separated ecological niches. To our bestknowledge, this is the closest phylogenetic relationship between obligateendosymbionts and 44 obligately free-living bacteria everrevealed.

  7. Phylogenetic Analysis of Phytophthora Species Based on Mitochondrial and Nuclear DNA Sequences

    NARCIS (Netherlands)

    Kroon, L.P.N.M.; Bakker, F.T.; Bosch, van den G.B.M.; Bonants, P.J.M.; Flier, W.G.

    2004-01-01

    A molecular phylogenetic analysis of the genus Phytophthora was performed, 113 isolates from 48 Phytophthora species were included in this analysis. Phylogenetic analyses were performed on regions of mitochondrial (cytochrome c oxidase subunit 1; NADH dehydrogenase subunit 1) and nuclear gene

  8. Phylogenetic Relationships of Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Gobioninae Inferred from Multiple Nuclear Gene Sequences

    Directory of Open Access Journals (Sweden)

    Keun-Yong Kim

    2013-01-01

    Full Text Available Gobionine species belonging to the genera Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Cyprinidae have been heavily studied because of problems on taxonomy, threats of extinction, invasion, and human health. Nucleotide sequences of three nuclear genes, that is, recombination activating protein gene 1 (rag1, recombination activating gene 2 (rag2, and early growth response 1 gene (egr1, from Pseudorasbora, Pseudopungtungia, and Pungtungia species residing in China, Japan, and Korea, were analyzed to elucidate their intergeneric and interspecific phylogenetic relationships. In the phylogenetic tree inferred from their multiple gene sequences, Pseudorasbora, Pseudopungtungia and Pungtungia species ramified into three phylogenetically distinct clades; the “tenuicorpa” clade composed of Pseudopungtungia tenuicorpa, the “parva” clade composed of all Pseudorasbora species/subspecies, and the “herzi” clade composed of Pseudopungtungia nigra, and Pungtungia herzi. The genus Pseudorasbora was recovered as monophyletic, while the genus Pseudopungtungia was recovered as polyphyletic. Our phylogenetic result implies the unstable taxonomic status of the genus Pseudopungtungia.

  9. [Irritable bowel syndrome: frequency and phylogenetic relationship of Blastocystis sp. from Mexican patients].

    Science.gov (United States)

    Ramírez-Miranda, M E; Jiménez-González, D E; Rodríguez-Campa, M E; González-Angulo, A; Hernández-Castellanos, R; Sara Arroyo-Escalante, A; Romero-Valdovinos, M; Martínez-Hernández, F; Flisser, A; Maravilla, P

    2011-01-01

    Recent studies reported increased presence of Blastocystis in patients with Irritable Bowel Syndrome (IBS) and an etiologic role has been proposed. The pathogenic role of Blastocystis is controversial, because it is frequently found not only in individuals with enteric symptoms but also in healthy and asymptomatic subjects. Furthermore, there are few studies of blastocistosis in Mexico. To assess the frequency of Blastocystis sp. in IBS patients using molecular techniques and to describe its phylogenetic relationship with sequences of other countries. IBS patients according to Rome III criteria were enrolled. In all patients evaluations included: colonoscopies, coproparasitoscopic studies, coproculture, fecal virus screening. PCR and sequencing for Blastocystis sp. were also performed. We recruited 11 men and 51 women with a mean age of 45.6 (SD ± 15.7) years. Eighty-six percent of the IBS patients presented a normal colonoscopy, 8% showed polyps and 6% diverticular disease. Blastocystis sp. was identified in 25% patients (all of them with normal colonoscopy), while two patients had Endolimax nana and Entamoeba histolytica/E. dispar, respectively. Phylogenetic analysis showed that major sequences of Mexican carriers clustered together with sequences of parasites from Japan and Denmark; furthermore, two sequences from IBS patients were grouped in a single cluster. Blastocystis sp. was identified in 25% of the IBS patients. Our data support the hypothesis of clonal lineages in distinct geographical areas in the world.

  10. BLAST-EXPLORER helps you building datasets for phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Claverie Jean-Michel

    2010-01-01

    Full Text Available Abstract Background The right sampling of homologous sequences for phylogenetic or molecular evolution analyses is a crucial step, the quality of which can have a significant impact on the final interpretation of the study. There is no single way for constructing datasets suitable for phylogenetic analysis, because this task intimately depends on the scientific question we want to address, Moreover, database mining softwares such as BLAST which are routinely used for searching homologous sequences are not specifically optimized for this task. Results To fill this gap, we designed BLAST-Explorer, an original and friendly web-based application that combines a BLAST search with a suite of tools that allows interactive, phylogenetic-oriented exploration of the BLAST results and flexible selection of homologous sequences among the BLAST hits. Once the selection of the BLAST hits is done using BLAST-Explorer, the corresponding sequence can be imported locally for external analysis or passed to the phylogenetic tree reconstruction pipelines available on the Phylogeny.fr platform. Conclusions BLAST-Explorer provides a simple, intuitive and interactive graphical representation of the BLAST results and allows selection and retrieving of the BLAST hit sequences based a wide range of criterions. Although BLAST-Explorer primarily aims at helping the construction of sequence datasets for further phylogenetic study, it can also be used as a standard BLAST server with enriched output. BLAST-Explorer is available at http://www.phylogeny.fr

  11. Supermatrix and species tree methods resolve phylogenetic relationships within the big cats, Panthera (Carnivora: Felidae).

    Science.gov (United States)

    Davis, Brian W; Li, Gang; Murphy, William J

    2010-07-01

    The pantherine lineage of cats diverged from the remainder of modern Felidae less than 11 million years ago and consists of the five big cats of the genus Panthera, the lion, tiger, jaguar, leopard, and snow leopard, as well as the closely related clouded leopard. A significant problem exists with respect to the precise phylogeny of these highly threatened great cats. Despite multiple publications on the subject, no two molecular studies have reconstructed Panthera with the same topology. These evolutionary relationships remain unresolved partially due to the recent and rapid radiation of pantherines in the Pliocene, individual speciation events occurring within less than 1 million years, and probable introgression between lineages following their divergence. We provide an alternative, highly supported interpretation of the evolutionary history of the pantherine lineage using novel and published DNA sequence data from the autosomes, both sex chromosomes and the mitochondrial genome. New sequences were generated for 39 single-copy regions of the felid Y chromosome, as well as four mitochondrial and four autosomal gene segments, totaling 28.7 kb. Phylogenetic analysis of these new data, combined with all published data in GenBank, highlighted the prevalence of phylogenetic disparities stemming either from the amplification of a mitochondrial to nuclear translocation event (numt), or errors in species identification. Our 47.6 kb combined dataset was analyzed as a supermatrix and with respect to individual partitions using maximum likelihood and Bayesian phylogenetic inference, in conjunction with Bayesian Estimation of Species Trees (BEST) which accounts for heterogeneous gene histories. Our results yield a robust consensus topology supporting the monophyly of lion and leopard, with jaguar sister to these species, as well as a sister species relationship of tiger and snow leopard. These results highlight new avenues for the study of speciation genomics and

  12. Phylogenetic groups among Klebsiella pneumoniae isolates from Brazil: relationship with antimicrobial resistance and origin.

    Science.gov (United States)

    de Melo, Maíra Espíndola Silva; Cabral, Adriane Borges; Maciel, Maria Amélia Vieira; da Silveira, Vera Magalhães; de Souza Lopes, Ana Catarina

    2011-05-01

    The objectives of this study were to determine the distribution of phylogenetic groups among Klebsiella pneumoniae isolates from Recife, Brazil and to assess the relationship between the groups and the isolation sites and resistance profile. Ninety four isolates of K. pneumoniae from hospital or community infections and from normal microbiota were analyzed by gyrA PCR-RFLP, antibiotic susceptibility, and adonitol fermentation. The results revealed the distinction of three phylogenetic groups, as it has also been reported in Europe, showing that these clusters are highly conserved within K. pneumoniae. Group KpI was dominantly represented by hospital and community isolates while groups KpII and KpIII displayed mainly normal microbiota isolates. The resistance to third generation cephalosporins, aztreonam, imipenem, amoxicillin/clavulanic acid, and streptomycin was only observed in KpI. The percentage of resistance was higher in KpI, followed by KpII and KpIII. The differences in the distribution of K. pneumoniae phylogenetic groups observed in this study suggest distinctive clinical and epidemiological characteristics among the three groups, which is important to understand the epidemiology of infections caused by this organism. This is the first study in Brazil on K. pneumoniae isolates from normal microbiota and community infections regarding the distribution of phylogenetic groups based on the gyrA gene.

  13. Comprehensive Phylogenetic Analysis of Bovine Non-aureus Staphylococci Species Based on Whole-Genome Sequencing

    Science.gov (United States)

    Naushad, Sohail; Barkema, Herman W.; Luby, Christopher; Condas, Larissa A. Z.; Nobrega, Diego B.; Carson, Domonique A.; De Buck, Jeroen

    2016-01-01

    Non-aureus staphylococci (NAS), a heterogeneous group of a large number of species and subspecies, are the most frequently isolated pathogens from intramammary infections in dairy cattle. Phylogenetic relationships among bovine NAS species are controversial and have mostly been determined based on single-gene trees. Herein, we analyzed phylogeny of bovine NAS species using whole-genome sequencing (WGS) of 441 distinct isolates. In addition, evolutionary relationships among bovine NAS were estimated from multilocus data of 16S rRNA, hsp60, rpoB, sodA, and tuf genes and sequences from these and numerous other single genes/proteins. All phylogenies were created with FastTree, Maximum-Likelihood, Maximum-Parsimony, and Neighbor-Joining methods. Regardless of methodology, WGS-trees clearly separated bovine NAS species into five monophyletic coherent clades. Furthermore, there were consistent interspecies relationships within clades in all WGS phylogenetic reconstructions. Except for the Maximum-Parsimony tree, multilocus data analysis similarly produced five clades. There were large variations in determining clades and interspecies relationships in single gene/protein trees, under different methods of tree constructions, highlighting limitations of using single genes for determining bovine NAS phylogeny. However, based on WGS data, we established a robust phylogeny of bovine NAS species, unaffected by method or model of evolutionary reconstructions. Therefore, it is now possible to determine associations between phylogeny and many biological traits, such as virulence, antimicrobial resistance, environmental niche, geographical distribution, and host specificity. PMID:28066335

  14. Discrimination and chemical phylogenetic study of seven species of Dendrobium using infrared spectroscopy combined with cluster analysis

    Science.gov (United States)

    Luo, Congpei; He, Tao; Chun, Ze

    2013-04-01

    Dendrobium is a commonly used and precious herb in Traditional Chinese Medicine. The high biodiversity of Dendrobium and the therapeutic needs require tools for the correct and fast discrimination of different Dendrobium species. This study investigates Fourier transform infrared spectroscopy followed by cluster analysis for discrimination and chemical phylogenetic study of seven Dendrobium species. Despite the general pattern of the IR spectra, different intensities, shapes, peak positions were found in the IR spectra of these samples, especially in the range of 1800-800 cm-1. The second derivative transformation and alcoholic extracting procedure obviously enlarged the tiny spectral differences among these samples. The results indicated each Dendrobium species had a characteristic IR spectra profile, which could be used to discriminate them. The similarity coefficients among the samples were analyzed based on their second derivative IR spectra, which ranged from 0.7632 to 0.9700, among the seven Dendrobium species, and from 0.5163 to 0.9615, among the ethanol extracts. A dendrogram was constructed based on cluster analysis the IR spectra for studying the chemical phylogenetic relationships among the samples. The results indicated that D. denneanum and D. crepidatum could be the alternative resources to substitute D. chrysotoxum, D. officinale and D. nobile which were officially recorded in Chinese Pharmacopoeia. In conclusion, with the advantages of high resolution, speediness and convenience, the experimental approach can successfully discriminate and construct the chemical phylogenetic relationships of the seven Dendrobium species.

  15. Molecular cytogenetic characterisation and phylogenetic analysis of the seven cultivated Vigna species (Fabaceae).

    Science.gov (United States)

    She, C-W; Jiang, X-H; Ou, L-J; Liu, J; Long, K-L; Zhang, L-H; Duan, W-T; Zhao, W; Hu, J-C

    2015-01-01

    The genomic organisation of the seven cultivated Vigna species, V. unguiculata, V. subterranea, V. angularis, V. umbellata, V. radiata, V. mungo and V. aconitifolia, was determined using sequential combined PI and DAPI (CPD) staining and dual-colour fluorescence in situ hybridisation (FISH) with 5S and 45S rDNA probes. For phylogenetic analyses, comparative genomic in situ hybridisation (cGISH) onto somatic chromosomes and sequence analysis of the internal transcribed spacer (ITS) of 45S rDNA were used. Quantitative karyotypes were established using chromosome measurements, fluorochrome bands and rDNA FISH signals. All species had symmetrical karyotypes composed of only metacentric or metacentric and submetacentric chromosomes. Distinct heterochromatin differentiation was revealed by CPD staining and DAPI counterstaining after FISH. The rDNA sites among all species differed in their number, location and size. cGISH of V. umbellata genomic DNA to the chromosomes of all species produced strong signals in all centromeric regions of V. umbellata and V. angularis, weak signals in all pericentromeric regions of V. aconitifolia, and CPD-banded proximal regions of V. mungo var. mungo. Molecular phylogenetic trees showed that V. angularis and V. umbellata were the closest relatives, and V. mungo and V. aconitifolia were relatively closely related; these species formed a group that was separated from another group comprising V. radiata, V. unguiculata ssp. sesquipedalis and V. subterranea. This result was consistent with the phylogenetic relationships inferred from the heterochromatin and cGISH patterns; thus, fluorochrome banding and cGISH are efficient tools for the phylogenetic analysis of Vigna species. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.

  16. A bootstrap based analysis pipeline for efficient classification of phylogenetically related animal miRNAs

    Directory of Open Access Journals (Sweden)

    Gu Xun

    2007-03-01

    Full Text Available Abstract Background Phylogenetically related miRNAs (miRNA families convey important information of the function and evolution of miRNAs. Due to the special sequence features of miRNAs, pair-wise sequence identity between miRNA precursors alone is often inadequate for unequivocally judging the phylogenetic relationships between miRNAs. Most of the current methods for miRNA classification rely heavily on manual inspection and lack measurements of the reliability of the results. Results In this study, we designed an analysis pipeline (the Phylogeny-Bootstrap-Cluster (PBC pipeline to identify miRNA families based on branch stability in the bootstrap trees derived from overlapping genome-wide miRNA sequence sets. We tested the PBC analysis pipeline with the miRNAs from six animal species, H. sapiens, M. musculus, G. gallus, D. rerio, D. melanogaster, and C. elegans. The resulting classification was compared with the miRNA families defined in miRBase. The two classifications were largely consistent. Conclusion The PBC analysis pipeline is an efficient method for classifying large numbers of heterogeneous miRNA sequences. It requires minimum human involvement and provides measurements of the reliability of the classification results.

  17. Introgression evidence and phylogenetic relationships among three (ParaMisgurnus species as revealed by mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Jakovlić I.

    2013-01-01

    Full Text Available The taxonomy of (ParaMisgurnus genera is still debated. We therefore used mitochondrial and nuclear DNA markers to analyze the phylogenetic relationships among Misgurnus anguillicaudatus, Paramisgurnus dabryanus and Misgurnus fossilis. Differing phylogenetic signals from mitochondrial and nuclear marker data suggest an introgression event in the history of M. anguillicaudatus and M. mohoity. No substantial genetic evidence was found that Paramisgurnus dabryanus should be classified as a separate genus.

  18. Diversity of Kale (Brassica oleracea var. sabellica): Glucosinolate Content and Phylogenetic Relationships.

    Science.gov (United States)

    Hahn, Christoph; Müller, Anja; Kuhnert, Nikolai; Albach, Dirk

    2016-04-27

    Recently, kale has become popular due to nutritive components beneficial for human health. It is an important source of phytochemicals such as glucosinolates that trigger associated cancer-preventive activity. However, nutritional value varies among glucosinolates and among cultivars. Here, we start a systematic determination of the content of five glucosinolates in 25 kale varieties and 11 non-kale Brassica oleracea cultivars by HPLC-DAD-ESI-MS(n) and compare the profiles with results from the analysis of SNPs derived from a KASP genotyping assay. Our results demonstrate that the glucosinolate levels differ markedly among varieties of different origin. Comparison of the phytochemical data with phylogenetic relationships revealed that the common name kale refers to at least three different groups. German, American, and Italian kales differ morphologically and phytochemically. Landraces do not show outstanding glucosinolate levels. Our results demonstrate the diversity of kale and the importance of preserving a broad genepool for future breeding purposes.

  19. Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria

    Science.gov (United States)

    Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.

    2003-01-01

    The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.

  20. Intraspecific relationship within the genus convolvulus l. inferred by rbcl gene using different phylogenetic approaches

    International Nuclear Information System (INIS)

    Kausar, S.; Qamarunnisa, S.

    2016-01-01

    A molecular systematics analysis was conducted using sequence data of chloroplast rbcL gene for the genus Convolvulus L., by distance and character based phylogenetic methods. Fifteen representative members from genus Convolvulus L., were included as in group whereas two members from a sister family Solanaceae were taken as out group to root the tree. Intraspecific relationships within Convolvulus were inferred by distance matrix, maximum parsimony and bayesian analysis. Transition/transversion ratio was also calculated and it was revealed that in the investigated Convolvulus species, transitional changes were more prevalent in rbcL gene. The nature of rbcL gene in the present study was observed to be conserved, as it does not show major variations between examined species. Distance matrix represented the minimal genetic variations between some species (C. glomeratus and C. pyrrhotrichus), thus exhibiting them as close relatives. The result of parsimonious and bayesian analysis revealed almost similar clades however maximum parsimony based tree was unable to establish relationship between some Convolvulus species. The bayesian inference method was found to be the method of choice for establishing intraspecific associations between Convolvulus species using rbcL data as it clearly defined the connections supported by posterior probability values. (author)

  1. Constructing phylogenetic trees using interacting pathways.

    Science.gov (United States)

    Wan, Peng; Che, Dongsheng

    2013-01-01

    Phylogenetic trees are used to represent evolutionary relationships among biological species or organisms. The construction of phylogenetic trees is based on the similarities or differences of their physical or genetic features. Traditional approaches of constructing phylogenetic trees mainly focus on physical features. The recent advancement of high-throughput technologies has led to accumulation of huge amounts of biological data, which in turn changed the way of biological studies in various aspects. In this paper, we report our approach of building phylogenetic trees using the information of interacting pathways. We have applied hierarchical clustering on two domains of organisms-eukaryotes and prokaryotes. Our preliminary results have shown the effectiveness of using the interacting pathways in revealing evolutionary relationships.

  2. Phylogenetic and recombination analysis of tomato spotted wilt virus.

    Directory of Open Access Journals (Sweden)

    Sen Lian

    Full Text Available Tomato spotted wilt virus (TSWV severely damages and reduces the yield of many economically important plants worldwide. In this study, we determined the whole-genome sequences of 10 TSWV isolates recently identified from various regions and hosts in Korea. Phylogenetic analysis of these 10 isolates as well as the three previously sequenced isolates indicated that the 13 Korean TSWV isolates could be divided into two groups reflecting either two different origins or divergences of Korean TSWV isolates. In addition, the complete nucleotide sequences for the 13 Korean TSWV isolates along with previously sequenced TSWV RNA segments from Korea and other countries were subjected to phylogenetic and recombination analysis. The phylogenetic analysis indicated that both the RNA L and RNA M segments of most Korean isolates might have originated in Western Europe and North America but that the RNA S segments for all Korean isolates might have originated in China and Japan. Recombination analysis identified a total of 12 recombination events among all isolates and segments and five recombination events among the 13 Korea isolates; among the five recombinants from Korea, three contained the whole RNA L segment, suggesting reassortment rather than recombination. Our analyses provide evidence that both recombination and reassortment have contributed to the molecular diversity of TSWV.

  3. Unraveling the phylogenetic relationships of the Eccoptochilinae, an enigmatic array of ordovician cheirurid trilobites.

    Directory of Open Access Journals (Sweden)

    I Wesley Gapp

    Full Text Available The Cheiruridae are a diverse group of trilobites and several subfamilies within the clade have been the focus of recent phylogenetic studies. This paper focuses on the relationships of one of those subfamilies, the Ordovician Eccoptochilinae. We analyze sixteen species from six genera within the traditionally defined group, using the pilekiid Anacheirurus frederici as an outgroup. To assess the monophyly of the Eccoptochilinae seven sphaerexochine species, Kawina arnoldi, Sphaerexochus arenosus, S. atacius, S. latifrons, S. mirus, S. parvus, and S. scabridus were included in the analysis as well. The results of this analysis show that the genus Eccoptochile represents a paraphyletic grade and species traditionally assigned to Parasphaerexochus and Skelipyx plot within Pseudosphaerexochus. Also, representative species of Sphaerexochinae plot within the traditionally defined Eccoptochilinae, suggesting Eccoptochilinae itself is paraphyletic. To resolve this, we propose all species of Pseudosphaerexochus be placed within Sphaerexochinae and Eccoptochilinae be restricted to a monotypic Eccoptochile clavigera.

  4. BioMatriX: Sequence analysis, structure visualization, phylogenetics ...

    African Journals Online (AJOL)

    bmx-biomatrix.blogspot.com) developed for biological science community to augment scientific research regarding genomics, proteomics, phylogenetics and linkage analysis in one platform. BioMatriX offers multi-functional services to perform ...

  5. Phylogenetic relationships of the Cochliopinae (Rissooidea: Hydrobiidae): an enigmatic group of aquatic gastropods.

    Science.gov (United States)

    Liu, H P; Hershler, R; Thompson, F G

    2001-10-01

    Phylogenetic analysis based on a partial sequence of the mitochondrial cytochrome c oxidase subunit I gene was performed for 26 representatives of the aquatic gastropod subfamily Cochliopinae, 6 additional members of the family Hydrobiidae, and outgroup species of the families Rissoidae and Pomatiopsidae. Maximum-parsimony analysis yielded a single shortest tree which resolved two monophyletic groups: (1) a clade containing all cochliopine taxa with the exception of Antroselates and (2) a clade composed of Antroselates and the hydrobiid genus Amnicola. The clade containing both of these monophyletic groups was depicted as more closely related to members of the family Pomatiopsidae than to other hydrobiid snails which were basally positioned in our topology. New anatomical evidence supports recognition of the cochliopine and Antroselates-Amnicola clades, and structure within the monophyletic group of cochliopines is largely congruent with genitalic characters. However, the close relationship between the Pomatiopsidae and these clades is in conflict with commonly accepted classifications and suggests that a widely accepted scenario for genitalic evolution in these snails is in need of further study. Copyright 2001 Academic Press.

  6. Undergraduate Students’ Difficulties in Reading and Constructing Phylogenetic Tree

    Science.gov (United States)

    Sa'adah, S.; Tapilouw, F. S.; Hidayat, T.

    2017-02-01

    Representation is a very important communication tool to communicate scientific concepts. Biologists produce phylogenetic representation to express their understanding of evolutionary relationships. The phylogenetic tree is visual representation depict a hypothesis about the evolutionary relationship and widely used in the biological sciences. Phylogenetic tree currently growing for many disciplines in biology. Consequently, learning about phylogenetic tree become an important part of biological education and an interesting area for biology education research. However, research showed many students often struggle with interpreting the information that phylogenetic trees depict. The purpose of this study was to investigate undergraduate students’ difficulties in reading and constructing a phylogenetic tree. The method of this study is a descriptive method. In this study, we used questionnaires, interviews, multiple choice and open-ended questions, reflective journals and observations. The findings showed students experiencing difficulties, especially in constructing a phylogenetic tree. The students’ responds indicated that main reasons for difficulties in constructing a phylogenetic tree are difficult to placing taxa in a phylogenetic tree based on the data provided so that the phylogenetic tree constructed does not describe the actual evolutionary relationship (incorrect relatedness). Students also have difficulties in determining the sister group, character synapomorphy, autapomorphy from data provided (character table) and comparing among phylogenetic tree. According to them building the phylogenetic tree is more difficult than reading the phylogenetic tree. Finding this studies provide information to undergraduate instructor and students to overcome learning difficulties of reading and constructing phylogenetic tree.

  7. The origin and evolution of Basigin(BSG) gene: A comparative genomic and phylogenetic analysis.

    Science.gov (United States)

    Zhu, Xinyan; Wang, Shenglan; Shao, Mingjie; Yan, Jie; Liu, Fei

    2017-07-01

    Basigin (BSG), also known as extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), plays various fundamental roles in the intercellular recognition involved in immunologic phenomena, differentiation, and development. In this study, we aimed to compare the similarities and differences of BSG among organisms and explore possible evolutionary relationships based on the comparison result. We used the extensive BLAST tool to search the metazoan genomes, N-glycosylation sites, the transmembrane region and other functional sites. We then identified BSG homologs from genomic sequences and analyzed their phylogenetic relationships. We identified that BSG genes exist not only in the vertebrate metazoans but also in the invertebrate metazoans such as Amphioxus B. floridae, D. melanogaster, A. mellifera, S. japonicum, C. gigas, and T. patagoniensis. After sequence analysis, we confirmed that only vertebrate metazoans and Cephalochordate (amphioxus B. floridae) have the classic structure (a signal peptide, two Ig-like domains (IgC2 and IgI), a transmembrane region, and an intracellular domain). The invertebrate metazoans (excluding amphioxus B. floridae) lack the N-terminal signal peptides and IgC2 domain. We then generated a phylogenetic tree, genome organization comparison, and chromosomal disposition analysis based on the biological information obtained from the NCBI and Ensembl databases. Finally, we established the possible evolutionary scenario of the BSG gene, which showed the restricted exon rearrangement that has occurred during evolution, forming the present-day BSG gene. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Mapping Phylogenetic Trees to Reveal Distinct Patterns of Evolution.

    Science.gov (United States)

    Kendall, Michelle; Colijn, Caroline

    2016-10-01

    Evolutionary relationships are frequently described by phylogenetic trees, but a central barrier in many fields is the difficulty of interpreting data containing conflicting phylogenetic signals. We present a metric-based method for comparing trees which extracts distinct alternative evolutionary relationships embedded in data. We demonstrate detection and resolution of phylogenetic uncertainty in a recent study of anole lizards, leading to alternate hypotheses about their evolutionary relationships. We use our approach to compare trees derived from different genes of Ebolavirus and find that the VP30 gene has a distinct phylogenetic signature composed of three alternatives that differ in the deep branching structure. phylogenetics, evolution, tree metrics, genetics, sequencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Phylogenetic analysis of hepatitis B virus in pakistan

    International Nuclear Information System (INIS)

    Baig, S.; Hasnain, N.U.

    2008-01-01

    To identify the distribution pattern of Hepatitis B Virus (HBV) genotype in a group of patients and to study its phylogenetic divergence. Two hundred and one HBV infected patients were genotyped for this study. All HbsAg positive individuals, either healthy carriers or suffering from conditions such as acute or chronic hepatitis, cirrhosis and hepatocellular carcinoma were included. Hepatitis B patients co-infected with other hepatic viruses were excluded. Hepatitis B virus DNA was extracted from serum, and subjected to a nested PCR, using the primers type-specific for genotype detection. Phylogenetic analysis was performed in the pre-S1 through S genes of HBV. The divergence was studied through 15 sequences of 967bp submitted to the DBJ/EMBL/GenBank databases accessible under accession number EF584640 through EF584654. Out of 201 patients tested, 156 were males and 45 were females. Genotype D was the predominant type found in 128 (64%) patients followed by A in 47 (23%) and mixed A/D in 26 (13%). Phylogenetic analysis confirmed the dominance of genotype D and subtype ayw2. There was dominance of genotype D subtype ayw2. It had a close resemblance with HBV strains that circulate in Iran, India and Japan. (author)

  10. Phylogenetic relationships in the "grossulariae" species group of the genus Aphis (Hemiptera: Sternorrhyncha: Aphididae): Molecular evidence

    DEFF Research Database (Denmark)

    Turcinaviciene, Jorga; Rakauskas, Rimantas; Pedersen, Bo Vest

    2006-01-01

    Phylogenetic relationships among Palaearctic Ribes and/or Onagraceae inhabiting Aphis species from five countries were examined using mitochondrial gene cytochrome oxidase I (CO-I) and nuclear gene elongation factor 1 a (EF-1a) sequences. There was no major conflict between the trees obtained fro...

  11. The importance of species phylogenetic relationships and species traits for the intensity of plant-soil feedback

    Czech Academy of Sciences Publication Activity Database

    Münzbergová, Zuzana; Šurinová, Mária

    2015-01-01

    Roč. 6, č. 11 (2015), s. 1-16 ISSN 2150-8925 R&D Projects: GA ČR(CZ) GA15-11635S Institutional support: RVO:67985939 Keywords : phylogenetic relationships * species traits * plant-soil feedback Subject RIV: EF - Botanics Impact factor: 2.287, year: 2015

  12. Phylogenetic Relationships of Citrus and Its Relatives Based on matK Gene Sequences

    Science.gov (United States)

    Penjor, Tshering; Uehara, Miki; Ide, Manami; Matsumoto, Natsumi; Matsumoto, Ryoji

    2013-01-01

    The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that “true citrus fruit trees” could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions, we have

  13. Phylogenetic relationships of citrus and its relatives based on matK gene sequences.

    Directory of Open Access Journals (Sweden)

    Tshering Penjor

    Full Text Available The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that "true citrus fruit trees" could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions

  14. Phylogenetic relationships of citrus and its relatives based on matK gene sequences.

    Science.gov (United States)

    Penjor, Tshering; Yamamoto, Masashi; Uehara, Miki; Ide, Manami; Matsumoto, Natsumi; Matsumoto, Ryoji; Nagano, Yukio

    2013-01-01

    The genus Citrus includes mandarin, orange, lemon, grapefruit and lime, which have high economic and nutritional value. The family Rutaceae can be divided into 7 subfamilies, including Aurantioideae. The genus Citrus belongs to the subfamily Aurantioideae. In this study, we sequenced the chloroplast matK genes of 135 accessions from 22 genera of Aurantioideae and analyzed them phylogenetically. Our study includes many accessions that have not been examined in other studies. The subfamily Aurantioideae has been classified into 2 tribes, Clauseneae and Citreae, and our current molecular analysis clearly discriminate Citreae from Clauseneae by using only 1 chloroplast DNA sequence. Our study confirms previous observations on the molecular phylogeny of Aurantioideae in many aspects. However, we have provided novel information on these genetic relationships. For example, inconsistent with the previous observation, and consistent with our preliminary study using the chloroplast rbcL genes, our analysis showed that Feroniella oblata is not nested in Citrus species and is closely related with Feronia limonia. Furthermore, we have shown that Murraya paniculata is similar to Merrillia caloxylon and is dissimilar to Murraya koenigii. We found that "true citrus fruit trees" could be divided into 2 subclusters. One subcluster included Citrus, Fortunella, and Poncirus, while the other cluster included Microcitrus and Eremocitrus. Compared to previous studies, our current study is the most extensive phylogenetic study of Citrus species since it includes 93 accessions. The results indicate that Citrus species can be classified into 3 clusters: a citron cluster, a pummelo cluster, and a mandarin cluster. Although most mandarin accessions belonged to the mandarin cluster, we found some exceptions. We also obtained the information on the genetic background of various species of acid citrus grown in Japan. Because the genus Citrus contains many important accessions, we have

  15. Phylogenetic relationships, character evolution, and taxonomic implications within the slipper lobsters (Crustacea: Decapoda: Scyllaridae).

    Science.gov (United States)

    Yang, Chien-Hui; Bracken-Grissom, Heather; Kim, Dohyup; Crandall, Keith A; Chan, Tin-Yam

    2012-01-01

    The slipper lobsters belong to the family Scyllaridae which contains a total of 20 genera and 89 species distributed across four subfamilies (Arctidinae, Ibacinae, Scyllarinae, and Theninae). We have collected nucleotide sequence data from regions of five different genes (16S, 18S, COI, 28S, H3) to estimate phylogenetic relationships among 54 species from the Scyllaridae with a focus on the species rich subfamily Scyllarinae. We have included in our analyses at least one representative from all 20 genera in the Scyllaridae and 35 of the 52 species within the Scyllarinae. Our resulting phylogenetic estimate shows the subfamilies are monophyletic, except for Ibacinae, which has paraphyletic relationships among genera. Many of the genera within the Scyllarinae form non-monophyletic groups, while the genera from all other subfamilies form well supported clades. We discuss the implications of this history on the evolution of morphological characters and ecological transitions (nearshore vs. offshore) within the slipper lobsters. Finally, we identify, through ancestral state character reconstructions, key morphological features diagnostic of the major clades of diversity within the Scyllaridae and relate this character evolution to current taxonomy and classification. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Species boundaries and phylogenetic relationships in the critically endangered Asian box turtle genus Cuora.

    Science.gov (United States)

    Spinks, Phillip Q; Thomson, Robert C; Zhang, YaPing; Che, Jing; Wu, Yonghua; Shaffer, H Bradley

    2012-06-01

    Turtles are currently the most endangered major clade of vertebrates on earth, and Asian box turtles (Cuora) are in catastrophic decline. Effective management of this diverse turtle clade has been hampered by human-mediated, and perhaps natural hybridization, resulting in discordance between mitochondrial and nuclear markers and confusion regarding species boundaries and phylogenetic relationships among hypothesized species of Cuora. Here, we present analyses of mitochondrial and nuclear DNA data for all 12 currently hypothesized species to resolve both species boundaries and phylogenetic relationships. Our 15-gene, 40-individual nuclear data set was frequently in conflict with our mitochondrial data set; based on its general concordance with published morphological analyses and the strength of 15 independent estimates of evolutionary history, we interpret the nuclear data as representing the most reliable estimate of species boundaries and phylogeny of Cuora. Our results strongly reiterate the necessity of using multiple nuclear markers for phylogeny and species delimitation in these animals, including any form of DNA "barcoding", and point to Cuora as an important case study where reliance on mitochondrial DNA can lead to incorrect species identification. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Biogeographic links between southern Atlantic Forest and western South America: Rediscovery, re-description, and phylogenetic relationships of two rare montane anole lizards from Brazil.

    Science.gov (United States)

    Prates, Ivan; Melo-Sampaio, Paulo Roberto; Drummond, Leandro de Oliveira; Teixeira, Mauro; Rodrigues, Miguel Trefaut; Carnaval, Ana Carolina

    2017-08-01

    Data on species ranges and phylogenetic relationships are key in historical biogeographical inference. In South America, our understanding of the evolutionary processes that underlie biodiversity patterns varies greatly across regions. Little is known, for instance, about the drivers of high endemism in the southern montane region of the Atlantic Rainforest. In this region, former biogeographic connections with other South American ecosystems have been invoked to explain the phylogenetic affinities of a number of endemic taxa. This may also be the case of the montane anole lizards Anolis nasofrontalis and A. pseudotigrinus, known from few specimens collected more than 40years ago. We combine new genetic data with published sequences of species in the Dactyloa clade of Anolis to investigate the phylogenetic relationships of A. nasofrontalis and A. pseudotigrinus, as well as estimate divergence times from their closest relatives. Based on newly sampled and previously overlooked specimens, we provide a taxonomic re-description of those two taxa. Our phylogenetic analysis recovered six main clades within Dactyloa, five of which were previously referred to as species series (aequatorialis, heterodermus, latifrons, punctatus, roquet). A sixth clade clustered A. nasofrontalis and A. pseudotigrinus with A. dissimilis from western Amazonia, A. calimae from the Andes, A. neblininus from the Guiana Shield, and two undescribed Andean taxa. We therefore define a sixth species series within Dactyloa: the neblininus series. Close phylogenetic relationships between highly disjunct, narrowly-distributed anoles suggest that patches of suitable habitat connected the southern Atlantic Forest to western South America during the Miocene, in agreement with the age of former connections between the central Andes and the Brazilian Shield as a result of Andean orogeny. The data also support the view of recurrent evolution (or loss) of a twig anole-like phenotype in mainland anoles, in

  18. Untangling hybrid phylogenetic signals: horizontal gene transfer and artifacts of phylogenetic reconstruction.

    Science.gov (United States)

    Beiko, Robert G; Ragan, Mark A

    2009-01-01

    Phylogenomic methods can be used to investigate the tangled evolutionary relationships among genomes. Building 'all the trees of all the genes' can potentially identify common pathways of horizontal gene transfer (HGT) among taxa at varying levels of phylogenetic depth. Phylogenetic affinities can be aggregated and merged with the information about genetic linkage and biochemical function to examine hypotheses of adaptive evolution via HGT. Additionally, the use of many genetic data sets increases the power of statistical tests for phylogenetic artifacts. However, large-scale phylogenetic analyses pose several challenges, including the necessary abandonment of manual validation techniques, the need to translate inferred phylogenetic discordance into inferred HGT events, and the challenges involved in aggregating results from search-based inference methods. In this chapter we describe a tree search procedure to recover the most parsimonious pathways of HGT, and examine some of the assumptions that are made by this method.

  19. A New Perspective on Polyploid Fragaria (Strawberry) Genome Composition Based on Large-Scale, Multi-Locus Phylogenetic Analysis

    OpenAIRE

    Yang, Yilong; Davis, Thomas M

    2017-01-01

    Abstract The subgenomic compositions of the octoploid (2n = 8× = 56) strawberry (Fragaria) species, including the economically important cultivated species Fragaria x ananassa, have been a topic of long-standing interest. Phylogenomic approaches utilizing next-generation sequencing technologies offer a new window into species relationships and the subgenomic compositions of polyploids. We have conducted a large-scale phylogenetic analysis of Fragaria (strawberry) species using the Fluidigm Ac...

  20. The phylogenetic relationships of basal archosauromorphs, with an emphasis on the systematics of proterosuchian archosauriforms

    Science.gov (United States)

    2016-01-01

    The early evolution of archosauromorphs during the Permo-Triassic constitutes an excellent empirical case study to shed light on evolutionary radiations in deep time and the timing and processes of recovery of terrestrial faunas after a mass extinction. However, macroevolutionary studies of early archosauromorphs are currently limited by poor knowledge of their phylogenetic relationships. In particular, one of the main early archosauromorph groups that need an exhaustive phylogenetic study is “Proterosuchia,” which as historically conceived includes members of both Proterosuchidae and Erythrosuchidae. A new data matrix composed of 96 separate taxa (several of them not included in a quantitative phylogenetic analysis before) and 600 osteological characters was assembled and analysed to generate a comprehensive higher-level phylogenetic hypothesis of basal archosauromorphs and shed light on the species-level interrelationships of taxa historically identified as proterosuchian archosauriforms. The results of the analysis using maximum parsimony include a polyphyletic “Prolacertiformes” and “Protorosauria,” in which the Permian Aenigmastropheus and Protorosaurus are the most basal archosauromorphs. The enigmatic choristoderans are either found as the sister-taxa of all other lepidosauromorphs or archosauromorphs, but consistently placed within Sauria. Prolacertids, rhynchosaurs, allokotosaurians and tanystropheids are the major successive sister clades of Archosauriformes. The Early Triassic Tasmaniosaurus is recovered as the sister-taxon of Archosauriformes. Proterosuchidae is unambiguosly restricted to five species that occur immediately after and before the Permo-Triassic boundary, thus implying that they are a short-lived “disaster” clade. Erythrosuchidae is composed of eight nominal species that occur during the Early and Middle Triassic. “Proterosuchia” is polyphyletic, in which erythrosuchids are more closely related to Euparkeria and more

  1. galaxie--CGI scripts for sequence identification through automated phylogenetic analysis.

    Science.gov (United States)

    Nilsson, R Henrik; Larsson, Karl-Henrik; Ursing, Björn M

    2004-06-12

    The prevalent use of similarity searches like BLAST to identify sequences and species implicitly assumes the reference database to be of extensive sequence sampling. This is often not the case, restraining the correctness of the outcome as a basis for sequence identification. Phylogenetic inference outperforms similarity searches in retrieving correct phylogenies and consequently sequence identities, and a project was initiated to design a freely available script package for sequence identification through automated Web-based phylogenetic analysis. Three CGI scripts were designed to facilitate qualified sequence identification from a Web interface. Query sequences are aligned to pre-made alignments or to alignments made by ClustalW with entries retrieved from a BLAST search. The subsequent phylogenetic analysis is based on the PHYLIP package for inferring neighbor-joining and parsimony trees. The scripts are highly configurable. A service installation and a version for local use are found at http://andromeda.botany.gu.se/galaxiewelcome.html and http://galaxie.cgb.ki.se

  2. A contribution to the understanding of phylogenetic relationships among species of the genus Octopus (Octopodidae: Cephalopoda

    Directory of Open Access Journals (Sweden)

    María Soledad Acosta-Jofré

    2011-11-01

    Full Text Available Many species of the genus Octopus are important resources for fisheries worldwide. Its approximately 200 species show a strong similarity in structural morphology and a wide diversity in skin coloration and patterning, behaviour and life strategies that have hampered the study of phylogenetic relationships. We used a Bayesian approach to estimate as yet unknown phylogenetic relationships among O. tehuelchus from the southwestern Atlantic, new specimens of O. mimus (Chile and Peru and other Octopus species, and used Bayes factors to test phylogenetic hypotheses. O. tehuelchus was more closely related to the genera Callistoctopus, Grimpella and Macroctopus than to Octopus, and therefore its generic placement may need a revision. O. vulgaris specimens from Costa Rica (Pacific Ocean and O. oculifer grouped with O. mimus. Bayes factors showed positive evidence in favor of this grouping and therefore these individuals could have been misidentified, being in fact O. mimus. O. vulgaris specimens from the Costa Rican Caribbean were more related to O. mimus than to other O. vulgaris and could represent a cryptic species. The remaining O. vulgaris clustered with O. tetricus. Bayes factors found strong evidence against the monophyly of O. vulgaris as currently defined, giving statistical support to the monophyly of an O. vulgaris s. str. + O. tetricus group proposed previously by other authors.

  3. Phylogenetic diversity analysis of Trichoderma species based on ...

    African Journals Online (AJOL)

    vi-4177/CSAU be assigned as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit ...

  4. Principal component analysis and the locus of the Fréchet mean in the space of phylogenetic trees.

    Science.gov (United States)

    Nye, Tom M W; Tang, Xiaoxian; Weyenberg, Grady; Yoshida, Ruriko

    2017-12-01

    Evolutionary relationships are represented by phylogenetic trees, and a phylogenetic analysis of gene sequences typically produces a collection of these trees, one for each gene in the analysis. Analysis of samples of trees is difficult due to the multi-dimensionality of the space of possible trees. In Euclidean spaces, principal component analysis is a popular method of reducing high-dimensional data to a low-dimensional representation that preserves much of the sample's structure. However, the space of all phylogenetic trees on a fixed set of species does not form a Euclidean vector space, and methods adapted to tree space are needed. Previous work introduced the notion of a principal geodesic in this space, analogous to the first principal component. Here we propose a geometric object for tree space similar to the [Formula: see text]th principal component in Euclidean space: the locus of the weighted Fréchet mean of [Formula: see text] vertex trees when the weights vary over the [Formula: see text]-simplex. We establish some basic properties of these objects, in particular showing that they have dimension [Formula: see text], and propose algorithms for projection onto these surfaces and for finding the principal locus associated with a sample of trees. Simulation studies demonstrate that these algorithms perform well, and analyses of two datasets, containing Apicomplexa and African coelacanth genomes respectively, reveal important structure from the second principal components.

  5. Phylogenetic paleobiogeography of Late Ordovician Laurentian brachiopods

    Directory of Open Access Journals (Sweden)

    Jennifer E. Bauer

    2014-12-01

    Full Text Available Phylogenetic biogeographic analysis of four brachiopod genera was used to uncover large-scale geologic drivers of Late Ordovician biogeographic differentiation in Laurentia. Previously generated phylogenetic hypotheses were converted into area cladograms, ancestral geographic ranges were optimized and speciation events characterized as via dispersal or vicariance, when possible. Area relationships were reconstructed using Lieberman-modified Brooks Parsimony Analysis. The resulting area cladograms indicate tectonic and oceanographic changes were the primary geologic drivers of biogeographic patterns within the focal taxa. The Taconic tectophase contributed to the separation of the Appalachian and Central basins as well as the two midcontinent basins, whereas sea level rise following the Boda Event promoted interbasinal dispersal. Three migration pathways into the Cincinnati Basin were recognized, which supports the multiple pathway hypothesis for the Richmondian Invasion.

  6. Phylogenetic analysis of Tibetan mastiffs based on mitochondrial hypervariable region I.

    Science.gov (United States)

    Ren, Zhanjun; Chen, Huiling; Yang, Xuejiao; Zhang, Chengdong

    2017-03-01

    Recently, the number of Tibetan mastiffs, which is a precious germplasm resource and cultural heritage, is decreasing sharply. Therefore, the genetic diversity of Tibetan mastiffs needs to be studied to clarify its phylogenetics relationships and lay the foundation for resource protection, rational development and utilization of Tibetan mastiffs. We sequenced hypervariable region I of mitochondrial DNA (mtDNA) of 110 individuals from Tibet region and Gansu province. A total of 12 polymorphic sites were identified which defined eight haplotypes of which H4 and H8 were unique to Tibetan population with H8 being identified first. The haplotype diversity (Hd: 0.808), nucleotide diversity (Pi: 0.603%), the average number of nucleotide difference (K: 3.917) of Tibetan mastiffs from Gansu were higher than those from Tibet region (Hd: 0.794; Pi: 0.589%; K: 3.831), which revealed higher genetic diversity in Gansu. In terms of total population, the genetic variation was low. The median-joining network and phylogenetic tree based on the mtDNA hypervariable region I showed that Tibetan mastiffs originated from grey wolves, as the other domestic dogs and had different history of maternal origin. The mismatch distribution analysis and neutrality tests indicated that Tibetan mastiffs were in genetic equilibrium or in a population decline.

  7. Ant-Based Phylogenetic Reconstruction (ABPR: A new distance algorithm for phylogenetic estimation based on ant colony optimization

    Directory of Open Access Journals (Sweden)

    Karla Vittori

    2008-12-01

    Full Text Available We propose a new distance algorithm for phylogenetic estimation based on Ant Colony Optimization (ACO, named Ant-Based Phylogenetic Reconstruction (ABPR. ABPR joins two taxa iteratively based on evolutionary distance among sequences, while also accounting for the quality of the phylogenetic tree built according to the total length of the tree. Similar to optimization algorithms for phylogenetic estimation, the algorithm allows exploration of a larger set of nearly optimal solutions. We applied the algorithm to four empirical data sets of mitochondrial DNA ranging from 12 to 186 sequences, and from 898 to 16,608 base pairs, and covering taxonomic levels from populations to orders. We show that ABPR performs better than the commonly used Neighbor-Joining algorithm, except when sequences are too closely related (e.g., population-level sequences. The phylogenetic relationships recovered at and above species level by ABPR agree with conventional views. However, like other algorithms of phylogenetic estimation, the proposed algorithm failed to recover expected relationships when distances are too similar or when rates of evolution are very variable, leading to the problem of long-branch attraction. ABPR, as well as other ACO-based algorithms, is emerging as a fast and accurate alternative method of phylogenetic estimation for large data sets.

  8. Undergraduate Students’ Initial Ability in Understanding Phylogenetic Tree

    Science.gov (United States)

    Sa'adah, S.; Hidayat, T.; Sudargo, Fransisca

    2017-04-01

    The Phylogenetic tree is a visual representation depicts a hypothesis about the evolutionary relationship among taxa. Evolutionary experts use this representation to evaluate the evidence for evolution. The phylogenetic tree is currently growing for many disciplines in biology. Consequently, learning about the phylogenetic tree has become an important part of biological education and an interesting area of biology education research. Skill to understanding and reasoning of the phylogenetic tree, (called tree thinking) is an important skill for biology students. However, research showed many students have difficulty in interpreting, constructing, and comparing among the phylogenetic tree, as well as experiencing a misconception in the understanding of the phylogenetic tree. Students are often not taught how to reason about evolutionary relationship depicted in the diagram. Students are also not provided with information about the underlying theory and process of phylogenetic. This study aims to investigate the initial ability of undergraduate students in understanding and reasoning of the phylogenetic tree. The research method is the descriptive method. Students are given multiple choice questions and an essay that representative by tree thinking elements. Each correct answer made percentages. Each student is also given questionnaires. The results showed that the undergraduate students’ initial ability in understanding and reasoning phylogenetic tree is low. Many students are not able to answer questions about the phylogenetic tree. Only 19 % undergraduate student who answered correctly on indicator evaluate the evolutionary relationship among taxa, 25% undergraduate student who answered correctly on indicator applying concepts of the clade, 17% undergraduate student who answered correctly on indicator determines the character evolution, and only a few undergraduate student who can construct the phylogenetic tree.

  9. Phylogenetic analysis of HSP70 and cyt b gene sequences for Chinese Leishmania isolates and ultrastructural characteristics of Chinese Leishmania sp.

    Science.gov (United States)

    Yuan, Dongmei; Qin, Hanxiao; Zhang, Jianguo; Liao, Lin; Chen, Qiwei; Chen, Dali; Chen, Jianping

    2017-02-01

    Leishmaniasis is a worldwide epidemic disease caused by the genus Leishmania, which is still endemic in the west and northwest areas of China. Some viewpoints of the traditional taxonomy of Chinese Leishmania have been challenged by recent phylogenetic researches based on different molecular markers. However, the taxonomic positions and phylogenetic relationships of Chinese Leishmania isolates remain controversial, which need for more data and further analysis. In this study, the heat shock protein 70 (HSP70) gene and cytochrome b (cyt b) gene were used for phylogenetic analysis of Chinese Leishmania isolates from patients, dogs, gerbils, and sand flies in different geographic origins. Besides, for the interesting Leishmania sp. in China, the ultrastructure of three Chinese Leishmania sp. strains (MHOM/CN/90/SC10H2, SD, GL) were observed by transmission electron microscopy. Bayesian trees from HSP70 and cyt b congruently indicated that the 14 Chinese Leishmania isolates belong to three Leishmania species including L. donovani complex, L. gerbilli, and L. (Sauroleishmania) sp. Their identity further confirmed that the undescribed Leishmania species causing visceral Leishmaniasis (VL) in China is closely related to L. tarentolae. The phylogenetic results from HSP70 also suggested the classification of subspecies within L. donovani complex: KXG-918, KXG-927, KXG-Liu, KXG-Xu, 9044, SC6, and KXG-65 belong to L. donovani; Cy, WenChuan, and 801 were proposed to be L. infantum. Through transmission electron microscopy, unexpectedly, the Golgi apparatus were not observed in SC10H2, SD, and GL, which was similar to previous reports of reptilian Leishmania. The statistical analysis of microtubule counts separated SC10H2, SD, and GL as one group from any other reference strain (L. donovani MHOM/IN/80/DD8; L. tropica MHOM/SU/74/K27; L. gerbilli MRHO/CN/60/GERBILLI). The ultrastructural characteristics of Leishmania sp. partly lend support to the phylogenetic inference that

  10. Data for constructing insect genome content matrices for phylogenetic analysis and functional annotation

    Directory of Open Access Journals (Sweden)

    Jeffrey Rosenfeld

    2016-03-01

    Full Text Available Twenty one fully sequenced and well annotated insect genomes were used to construct genome content matrices for phylogenetic analysis and functional annotation of insect genomes. To examine the role of e-value cutoff in ortholog determination we used scaled e-value cutoffs and a single linkage clustering approach.. The present communication includes (1 a list of the genomes used to construct the genome content phylogenetic matrices, (2 a nexus file with the data matrices used in phylogenetic analysis, (3 a nexus file with the Newick trees generated by phylogenetic analysis, (4 an excel file listing the Core (CORE genes and Unique (UNI genes found in five insect groups, and (5 a figure showing a plot of consistency index (CI versus percent of unannotated genes that are apomorphies in the data set for gene losses and gains and bar plots of gains and losses for four consistency index (CI cutoffs.

  11. Efficient parsimony-based methods for phylogenetic network reconstruction.

    Science.gov (United States)

    Jin, Guohua; Nakhleh, Luay; Snir, Sagi; Tuller, Tamir

    2007-01-15

    Phylogenies--the evolutionary histories of groups of organisms-play a major role in representing relationships among biological entities. Although many biological processes can be effectively modeled as tree-like relationships, others, such as hybrid speciation and horizontal gene transfer (HGT), result in networks, rather than trees, of relationships. Hybrid speciation is a significant evolutionary mechanism in plants, fish and other groups of species. HGT plays a major role in bacterial genome diversification and is a significant mechanism by which bacteria develop resistance to antibiotics. Maximum parsimony is one of the most commonly used criteria for phylogenetic tree inference. Roughly speaking, inference based on this criterion seeks the tree that minimizes the amount of evolution. In 1990, Jotun Hein proposed using this criterion for inferring the evolution of sequences subject to recombination. Preliminary results on small synthetic datasets. Nakhleh et al. (2005) demonstrated the criterion's application to phylogenetic network reconstruction in general and HGT detection in particular. However, the naive algorithms used by the authors are inapplicable to large datasets due to their demanding computational requirements. Further, no rigorous theoretical analysis of computing the criterion was given, nor was it tested on biological data. In the present work we prove that the problem of scoring the parsimony of a phylogenetic network is NP-hard and provide an improved fixed parameter tractable algorithm for it. Further, we devise efficient heuristics for parsimony-based reconstruction of phylogenetic networks. We test our methods on both synthetic and biological data (rbcL gene in bacteria) and obtain very promising results.

  12. Molecular characterization and phylogenetic relationships among microsporidian isolates infecting silkworm, Bombyx mori using small subunit rRNA (SSU-rRNA) gene sequence analysis.

    Science.gov (United States)

    Nath, B Surendra; Gupta, S K; Bajpai, A K

    2012-12-01

    The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect.

  13. Evolution of oil-producing trichomes in Sisyrinchium (Iridaceae): insights from the first comprehensive phylogenetic analysis of the genus

    Science.gov (United States)

    Chauveau, Olivier; Eggers, Lilian; Raquin, Christian; Silvério, Adriano; Brown, Spencer; Couloux, Arnaud; Cruaud, Corine; Kaltchuk-Santos, Eliane; Yockteng, Roxana; Souza-Chies, Tatiana T.; Nadot, Sophie

    2011-01-01

    Background and Aims Sisyrinchium (Iridaceae: Iridoideae: Sisyrinchieae) is one of the largest, most widespread and most taxonomically complex genera in Iridaceae, with all species except one native to the American continent. Phylogenetic relationships within the genus were investigated and the evolution of oil-producing structures related to specialized oil-bee pollination examined. Methods Phylogenetic analyses based on eight molecular markers obtained from 101 Sisyrinchium accessions representing 85 species were conducted in the first extensive phylogenetic analysis of the genus. Total evidence analyses confirmed the monophyly of the genus and retrieved nine major clades weakly connected to the subdivisions previously recognized. The resulting phylogenetic hypothesis was used to reconstruct biogeographical patterns, and to trace the evolutionary origin of glandular trichomes present in the flowers of several species. Key Results and Conclusions Glandular trichomes evolved three times independently in the genus. In two cases, these glandular trichomes are oil-secreting, suggesting that the corresponding flowers might be pollinated by oil-bees. Biogeographical patterns indicate expansions from Central America and the northern Andes to the subandean ranges between Chile and Argentina and to the extended area of the Paraná river basin. The distribution of oil-flower species across the phylogenetic trees suggests that oil-producing trichomes may have played a key role in the diversification of the genus, a hypothesis that requires future testing. PMID:21527419

  14. Phylogenetic relationships of the South American Doradoidea (Ostariophysi: Siluriformes

    Directory of Open Access Journals (Sweden)

    José L. O. Birindelli

    Full Text Available A phylogenetic analysis based on 311 morphological characters is presented for most species of the Doradidae, all genera of the Auchenipteridae, and representatives of 16 other catfish families. The hypothesis that was derived from the six most parsimonious trees support the monophyly of the South American Doradoidea (Doradidae plus Auchenipteridae, as well as the monophyly of the clade Doradoidea plus the African Mochokidae. In addition, the clade with Sisoroidea plus Aspredinidae was considered sister to Doradoidea plus Mochokidae. Within the Auchenipteridae, the results support the monophyly of the Centromochlinae and Auchenipterinae. The latter is composed of Tocantinsia, and four monophyletic units, two small with Asterophysusand Liosomadoras, and Pseudotatiaand Pseudauchenipterus, respectively, and two large ones with the remaining genera. Within the Doradidae, parsimony analysis recovered Wertheimeriaas sister to Kalyptodoras, composing a clade sister to all remaining doradids, which include Franciscodorasand two monophyletic groups: Astrodoradinae (plus Acanthodorasand Agamyxis and Doradinae (new arrangement. Wertheimerinae, new subfamily, is described for Kalyptodoras and Wertheimeria. Doradinae is corroborated as monophyletic and composed of four groups, one including Centrochirand Platydoras, the other with the large-size species of doradids (except Oxydoras, another with Orinocodoras, Rhinodoras, and Rhynchodoras, and another with Oxydorasplus all the fimbriate-barbel doradids. Based on the results, the species of Opsodoras are included in Hemidoras; and Tenellus, new genus, is described to include Nemadoras trimaculatus, N. leporhinusand Nemadoras ternetzi. Due to conflicting hypotheses of the phylogenetic position of Acanthodoras, Agamyxis, and Franciscodoras, these are considered as incertae sedisin Doradidae. All suprageneric taxa of the Doradoidea are diagnosed based on synapomorphic morphological characteristics.

  15. Characterization and phylogenetic analysis of α-gliadin gene ...

    Indian Academy of Sciences (India)

    Supplementary data: Characterization and phylogenetic analysis of α-gliadin gene sequences reveals significant genomic divergence in Triticeae species. Guang-Rong Li, Tao Lang, En-Nian Yang, Cheng Liu ... The MITE insertion at the 3 UTR is boxed. Figure 2. The secondary structure of MITE insertion in HM452949.

  16. Application of multigene phylogenetics and site-stripping to resolve intraordinal relationships in the Rhodymeniales (Rhodophyta).

    Science.gov (United States)

    Filloramo, Gina V; Saunders, Gary W

    2016-06-01

    Previous molecular assessments of the red algal order Rhodymeniales have confirmed its monophyly and distinguished the six currently recognized families (viz. Champiaceae, Faucheaceae, Fryeellaceae, Hymenocladiaceae, Lomentariaceae, and Rhodymeniaceae); however, relationships among most of these families have remained unresolved possibly as a result of substitution saturation at deeper phylogenetic nodes. The objective of the current study was to improve rhodymenialean systematics by increasing taxonomic representation and using a more robust multigene dataset of mitochondrial (COB, COI/COI-5P), nuclear (LSU, EF2) and plastid markers (psbA, rbcL). Additionally, we aimed to prevent phylogenetic inference problems associated with substitution saturation (particularly at the interfamilial nodes) by removing fast-evolving sites and analyzing a series of progressively more conservative alignments. The Rhodymeniales was resolved as two major lineages: (i) the Fryeellaceae as sister to the Faucheaceae and Lomentariaceae; and (ii) the Rhodymeniaceae allied to the Champiaceae and Hymenocladiaceae. Support at the interfamilial nodes was highest when 20% of variable sites were removed. Inclusion of Binghamiopsis, Chamaebotrys, and Minium, which were absent in previous phylogenetic investigations, established their phylogenetic affinities while assessment of two genera consistently polyphyletic in phylogenetic analyses, Erythrymenia and Lomentaria, resulted in the proposition of the novel genera Perbella and Fushitsunagia. The taxonomic position of Drouetia was reinvestigated with re-examination of holotype material of D. coalescens to clarify tetrasporangial development in this genus. In addition, we added three novel Australian species to Drouetia as a result of ongoing DNA barcoding assessments-D. aggregata sp. nov., D. scutellata sp. nov., and D. viridescens sp. nov. © 2016 Phycological Society of America.

  17. [Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

    Science.gov (United States)

    Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

    2002-06-01

    Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

  18. Measures of phylogenetic differentiation provide robust and complementary insights into microbial communities.

    Science.gov (United States)

    Parks, Donovan H; Beiko, Robert G

    2013-01-01

    High-throughput sequencing techniques have made large-scale spatial and temporal surveys of microbial communities routine. Gaining insight into microbial diversity requires methods for effectively analyzing and visualizing these extensive data sets. Phylogenetic β-diversity measures address this challenge by allowing the relationship between large numbers of environmental samples to be explored using standard multivariate analysis techniques. Despite the success and widespread use of phylogenetic β-diversity measures, an extensive comparative analysis of these measures has not been performed. Here, we compare 39 measures of phylogenetic β diversity in order to establish the relative similarity of these measures along with key properties and performance characteristics. While many measures are highly correlated, those commonly used within microbial ecology were found to be distinct from those popular within classical ecology, and from the recently recommended Gower and Canberra measures. Many of the measures are surprisingly robust to different rootings of the gene tree, the choice of similarity threshold used to define operational taxonomic units, and the presence of outlying basal lineages. Measures differ considerably in their sensitivity to rare organisms, and the effectiveness of measures can vary substantially under alternative models of differentiation. Consequently, the depth of sequencing required to reveal underlying patterns of relationships between environmental samples depends on the selected measure. Our results demonstrate that using complementary measures of phylogenetic β diversity can further our understanding of how communities are phylogenetically differentiated. Open-source software implementing the phylogenetic β-diversity measures evaluated in this manuscript is available at http://kiwi.cs.dal.ca/Software/ExpressBetaDiversity.

  19. A Consistent Phylogenetic Backbone for the Fungi

    Science.gov (United States)

    Ebersberger, Ingo; de Matos Simoes, Ricardo; Kupczok, Anne; Gube, Matthias; Kothe, Erika; Voigt, Kerstin; von Haeseler, Arndt

    2012-01-01

    The kingdom of fungi provides model organisms for biotechnology, cell biology, genetics, and life sciences in general. Only when their phylogenetic relationships are stably resolved, can individual results from fungal research be integrated into a holistic picture of biology. However, and despite recent progress, many deep relationships within the fungi remain unclear. Here, we present the first phylogenomic study of an entire eukaryotic kingdom that uses a consistency criterion to strengthen phylogenetic conclusions. We reason that branches (splits) recovered with independent data and different tree reconstruction methods are likely to reflect true evolutionary relationships. Two complementary phylogenomic data sets based on 99 fungal genomes and 109 fungal expressed sequence tag (EST) sets analyzed with four different tree reconstruction methods shed light from different angles on the fungal tree of life. Eleven additional data sets address specifically the phylogenetic position of Blastocladiomycota, Ustilaginomycotina, and Dothideomycetes, respectively. The combined evidence from the resulting trees supports the deep-level stability of the fungal groups toward a comprehensive natural system of the fungi. In addition, our analysis reveals methodologically interesting aspects. Enrichment for EST encoded data—a common practice in phylogenomic analyses—introduces a strong bias toward slowly evolving and functionally correlated genes. Consequently, the generalization of phylogenomic data sets as collections of randomly selected genes cannot be taken for granted. A thorough characterization of the data to assess possible influences on the tree reconstruction should therefore become a standard in phylogenomic analyses. PMID:22114356

  20. Monophyly of Archaeplastida supergroup and relationships among its lineages in the light of phylogenetic and phylogenomic studies. Are we close to a consensus?

    Directory of Open Access Journals (Sweden)

    Paweł Mackiewicz

    2014-12-01

    Full Text Available One of the key evolutionary events on the scale of the biosphere was an endosymbiosis between a heterotrophic eukaryote and a cyanobacterium, resulting in a primary plastid. Such an organelle is characteristic of three eukaryotic lineages, glaucophytes, red algae and green plants. The three groups are usually united under the common name Archaeplastida or Plantae in modern taxonomic classifications, which indicates they are considered monophyletic. The methods generally used to verify this monophyly are phylogenetic analyses. In this article we review up-to-date results of such analyses and discussed their inconsistencies. Although phylogenies of plastid genes suggest a single primary endosymbiosis, which is assumed to mean a common origin of the Archaeplastida, different phylogenetic trees based on nuclear markers show monophyly, paraphyly, polyphyly or unresolved topologies of Archaeplastida hosts. The difficulties in reconstructing host cell relationships could result from stochastic and systematic biases in data sets, including different substitution rates and patterns, gene paralogy and horizontal/endosymbiotic gene transfer into eukaryotic lineages, which attract Archaeplastida in phylogenetic trees. Based on results to date, it is neither possible to confirm nor refute alternative evolutionary scenarios to a single primary endosymbiosis. Nevertheless, if trees supporting monophyly are considered, relationships inferred among Archaeplastida lineages can be discussed. Phylogenetic analyses based on nuclear genes clearly show the earlier divergence of glaucophytes from red algae and green plants. Plastid genes suggest a more complicated history, but at least some studies are congruent with this concept. Additional research involving more representatives of glaucophytes and many understudied lineages of Eukaryota can improve inferring phylogenetic relationships related to the Archaeplastida. In addition, alternative approaches not directly

  1. REFGEN and TREENAMER: Automated Sequence Data Handling for Phylogenetic Analysis in the Genomic Era

    Science.gov (United States)

    Leonard, Guy; Stevens, Jamie R.; Richards, Thomas A.

    2009-01-01

    The phylogenetic analysis of nucleotide sequences and increasingly that of amino acid sequences is used to address a number of biological questions. Access to extensive datasets, including numerous genome projects, means that standard phylogenetic analyses can include many hundreds of sequences. Unfortunately, most phylogenetic analysis programs do not tolerate the sequence naming conventions of genome databases. Managing large numbers of sequences and standardizing sequence labels for use in phylogenetic analysis programs can be a time consuming and laborious task. Here we report the availability of an online resource for the management of gene sequences recovered from public access genome databases such as GenBank. These web utilities include the facility for renaming every sequence in a FASTA alignment file, with each sequence label derived from a user-defined combination of the species name and/or database accession number. This facility enables the user to keep track of the branching order of the sequences/taxa during multiple tree calculations and re-optimisations. Post phylogenetic analysis, these webpages can then be used to rename every label in the subsequent tree files (with a user-defined combination of species name and/or database accession number). Together these programs drastically reduce the time required for managing sequence alignments and labelling phylogenetic figures. Additional features of our platform include the automatic removal of identical accession numbers (recorded in the report file) and generation of species and accession number lists for use in supplementary materials or figure legends. PMID:19812722

  2. Phylogenetic Structure of Foliar Spectral Traits in Tropical Forest Canopies

    Directory of Open Access Journals (Sweden)

    Kelly M. McManus

    2016-02-01

    Full Text Available The Spectranomics approach to tropical forest remote sensing has established a link between foliar reflectance spectra and the phylogenetic composition of tropical canopy tree communities vis-à-vis the taxonomic organization of biochemical trait variation. However, a direct relationship between phylogenetic affiliation and foliar reflectance spectra of species has not been established. We sought to develop this relationship by quantifying the extent to which underlying patterns of phylogenetic structure drive interspecific variation among foliar reflectance spectra within three Neotropical canopy tree communities with varying levels of soil fertility. We interpreted the resulting spectral patterns of phylogenetic signal in the context of foliar biochemical traits that may contribute to the spectral-phylogenetic link. We utilized a multi-model ensemble to elucidate trait-spectral relationships, and quantified phylogenetic signal for spectral wavelengths and traits using Pagel’s lambda statistic. Foliar reflectance spectra showed evidence of phylogenetic influence primarily within the visible and shortwave infrared spectral regions. These regions were also selected by the multi-model ensemble as those most important to the quantitative prediction of several foliar biochemical traits. Patterns of phylogenetic organization of spectra and traits varied across sites and with soil fertility, indicative of the complex interactions between the environmental and phylogenetic controls underlying patterns of biodiversity.

  3. Comparative analysis of mitochondrial genomes of five aphid species (Hemiptera: Aphididae and phylogenetic implications.

    Directory of Open Access Journals (Sweden)

    Yuan Wang

    Full Text Available Insect mitochondrial genomes (mitogenomes are of great interest in exploring molecular evolution, phylogenetics and population genetics. Only two mitogenomes have been previously released in the insect group Aphididae, which consists of about 5,000 known species including some agricultural, forestry and horticultural pests. Here we report the complete 16,317 bp mitogenome of Cavariella salicicola and two nearly complete mitogenomes of Aphis glycines and Pterocomma pilosum. We also present a first comparative analysis of mitochondrial genomes of aphids. Results showed that aphid mitogenomes share conserved genomic organization, nucleotide and amino acid composition, and codon usage features. All 37 genes usually present in animal mitogenomes were sequenced and annotated. The analysis of gene evolutionary rate revealed the lowest and highest rates for COI and ATP8, respectively. A unique repeat region exclusively in aphid mitogenomes, which included variable numbers of tandem repeats in a lineage-specific manner, was highlighted for the first time. This region may have a function as another origin of replication. Phylogenetic reconstructions based on protein-coding genes and the stem-loop structures of control regions confirmed a sister relationship between Cavariella and pterocommatines. Current evidence suggest that pterocommatines could be formally transferred into Macrosiphini. Our paper also offers methodological instructions for obtaining other Aphididae mitochondrial genomes.

  4. Patterns of forest phylogenetic community structure across the United States and their possible forest health implications

    Science.gov (United States)

    Kevin M. Potter; Frank H. Koch

    2014-01-01

    The analysis of phylogenetic relationships among co-occurring tree species offers insights into the ecological organization of forest communities from an evolutionary perspective and, when employed regionally across thousands of plots, can assist in forest health assessment. Phylogenetic clustering of species, when species are more closely related than expected by...

  5. ["Long-branch Attraction" artifact in phylogenetic reconstruction].

    Science.gov (United States)

    Li, Yi-Wei; Yu, Li; Zhang, Ya-Ping

    2007-06-01

    Phylogenetic reconstruction among various organisms not only helps understand their evolutionary history but also reveal several fundamental evolutionary questions. Understanding of the evolutionary relationships among organisms establishes the foundation for the investigations of other biological disciplines. However, almost all the widely used phylogenetic methods have limitations which fail to eliminate systematic errors effectively, preventing the reconstruction of true organismal relationships. "Long-branch Attraction" (LBA) artifact is one of the most disturbing factors in phylogenetic reconstruction. In this review, the conception and analytic method as well as the avoidance strategy of LBA were summarized. In addition, several typical examples were provided. The approach to avoid and resolve LBA artifact has been discussed.

  6. Phylogenetic utility of ribosomal genes for reconstructing the phylogeny of five Chinese satyrine tribes (Lepidoptera, Nymphalidae

    Directory of Open Access Journals (Sweden)

    Mingsheng Yang

    2015-03-01

    Full Text Available Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA and four protein-coding genes (EF-1α, COI, COII and Cytb. We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML and Bayesian inference (BI trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa.

  7. Mitochondrial DNA sequence-based phylogenetic relationship of Trichiurus lepturus (Perciformes: Trichiuridae) from the Persian Gulf

    Science.gov (United States)

    Tamadoni Jahromi, S.; Mohd Noor, S. A.; Pirian, K.; Dehghani, R.; Nazemi, M.; Khazaali, A.

    2016-01-01

    In this study, mitochondrial DNA analysis using 16S ribosomal DNA (rDNA) was performed to investigate the phylogeny relationship of Trichiurus lepturus in the Persian Gulf compared to the other investigated area. The amplification of 16S rDNA resulted in a product of 600 bp in all samples. The results showed that the isolated strain belongs to T. lepturus showing 42 divergence sites among the same reported partial sequences of 16S rRNA gene from the other area (West Atlantic and Indo-Pacific area). Phylogeny results showed that all 18 haplotypes of the species clustered into five clades with reasonably high bootstrap support of values (>64%). Overall, the tree topology for both phylogenetic and phenetic trees for 16S rDNA was similar. Both trees exposed two major clusters, one wholly containing the haplotypes of the T. lepturus species belonging to Indo-Pacific area with two major sister groups including Persian Gulf specimen and the other cleared the Western Atlantic and Japan individuals clustered in another distinct clade supporting the differentiation between the two areas. Phylogenic relationship observed between the Persian Gulf and the other Indo-Pacific Individuals suggested homogeneity between two mentioned areas. PMID:27822250

  8. PHYLOGENETIC RELATIONSHIP OF THE RED TIDE DINOFLAGELLATE GYMNODINIUM BREVE TO OTHER MEMBERS OF THE GENERA GYMNODINIUM AND GYRODINIUM

    Science.gov (United States)

    Phylogenetic relationships between the red-tide dinoflagellate Gymnodinium breve and other members of the genera Gymnodinium and Gyrodinium have not been studied at the molecular level. G. breve is most noted for its production of brevetoxin, which has been linked to extensive f...

  9. The Complete Mitochondrial Genome of Corizus tetraspilus (Hemiptera: Rhopalidae) and Phylogenetic Analysis of Pentatomomorpha

    Science.gov (United States)

    Guo, Zhong-Long; Wang, Juan; Shen, Yu-Ying

    2015-01-01

    Insect mitochondrial genome (mitogenome) are the most extensively used genetic information for molecular evolution, phylogenetics and population genetics. Pentatomomorpha (>14,000 species) is the second largest infraorder of Heteroptera and of great economic importance. To better understand the diversity and phylogeny within Pentatomomorpha, we sequenced and annotated the complete mitogenome of Corizus tetraspilus (Hemiptera: Rhopalidae), an important pest of alfalfa in China. We analyzed the main features of the C. tetraspilus mitogenome, and provided a comparative analysis with four other Coreoidea species. Our results reveal that gene content, gene arrangement, nucleotide composition, codon usage, rRNA structures and sequences of mitochondrial transcription termination factor are conserved in Coreoidea. Comparative analysis shows that different protein-coding genes have been subject to different evolutionary rates correlated with the G+C content. All the transfer RNA genes found in Coreoidea have the typical clover leaf secondary structure, except for trnS1 (AGN) which lacks the dihydrouridine (DHU) arm and possesses a unusual anticodon stem (9 bp vs. the normal 5 bp). The control regions (CRs) among Coreoidea are highly variable in size, of which the CR of C. tetraspilus is the smallest (440 bp), making the C. tetraspilus mitogenome the smallest (14,989 bp) within all completely sequenced Coreoidea mitogenomes. No conserved motifs are found in the CRs of Coreoidea. In addition, the A+T content (60.68%) of the CR of C. tetraspilus is much lower than that of the entire mitogenome (74.88%), and is lowest among Coreoidea. Phylogenetic analyses based on mitogenomic data support the monophyly of each superfamily within Pentatomomorpha, and recognize a phylogenetic relationship of (Aradoidea + (Pentatomoidea + (Lygaeoidea + (Pyrrhocoroidea + Coreoidea)))). PMID:26042898

  10. Analysis of Acorus calamus chloroplast genome and its phylogenetic implications.

    Science.gov (United States)

    Goremykin, Vadim V; Holland, Barbara; Hirsch-Ernst, Karen I; Hellwig, Frank H

    2005-09-01

    Determining the phylogenetic relationships among the major lines of angiosperms is a long-standing problem, yet the uncertainty as to the phylogenetic affinity of these lines persists. While a number of studies have suggested that the ANITA (Amborella-Nymphaeales-Illiciales-Trimeniales-Aristolochiales) grade is basal within angiosperms, studies of complete chloroplast genome sequences also suggested an alternative tree, wherein the line leading to the grasses branches first among the angiosperms. To improve taxon sampling in the existing chloroplast genome data, we sequenced the chloroplast genome of the monocot Acorus calamus. We generated a concatenated alignment (89,436 positions for 15 taxa), encompassing almost all sequences usable for phylogeny reconstruction within spermatophytes. The data still contain support for both the ANITA-basal and grasses-basal hypotheses. Using simulations we can show that were the ANITA-basal hypothesis true, parsimony (and distance-based methods with many models) would be expected to fail to recover it. The self-evident explanation for this failure appears to be a long-branch attraction (LBA) between the clade of grasses and the out-group. However, this LBA cannot explain the discrepancies observed between tree topology recovered using the maximum likelihood (ML) method and the topologies recovered using the parsimony and distance-based methods when grasses are deleted. Furthermore, the fact that neither maximum parsimony nor distance methods consistently recover the ML tree, when according to the simulations they would be expected to, when the out-group (Pinus) is deleted, suggests that either the generating tree is not correct or the best symmetric model is misspecified (or both). We demonstrate that the tree recovered under ML is extremely sensitive to model specification and that the best symmetric model is misspecified. Hence, we remain agnostic regarding phylogenetic relationships among basal angiosperm lineages.

  11. REFGEN and TREENAMER: Automated Sequence Data Handling for Phylogenetic Analysis in the Genomic Era

    Directory of Open Access Journals (Sweden)

    Guy Leonard

    2009-01-01

    Full Text Available The phylogenetic analysis of nucleotide sequences and increasingly that of amino acid sequences is used to address a number of biological questions. Access to extensive datasets, including numerous genome projects, means that standard phylogenetic analyses can include many hundreds of sequences. Unfortunately, most phylogenetic analysis programs do not tolerate the sequence naming conventions of genome databases. Managing large numbers of sequences and standardizing sequence labels for use in phylogenetic analysis programs can be a time consuming and laborious task. Here we report the availability of an online resource for the management of gene sequences recovered from public access genome databases such as GenBank. These web utilities include the facility for renaming every sequence in a FASTA alignment fi le, with each sequence label derived from a user-defined combination of the species name and/or database accession number. This facility enables the user to keep track of the branching order of the sequences/taxa during multiple tree calculations and re-optimisations. Post phylogenetic analysis, these webpages can then be used to rename every label in the subsequent tree fi les (with a user-defined combination of species name and/or database accession number. Together these programs drastically reduce the time required for managing sequence alignments and labelling phylogenetic figures. Additional features of our platform include the automatic removal of identical accession numbers (recorded in the report file and generation of species and accession number lists for use in supplementary materials or figure legends.

  12. Phylogenetic relationships and evolutionary history of the reef fish family Labridae.

    Science.gov (United States)

    Westneat, Mark W; Alfaro, Michael E

    2005-08-01

    The family Labridae (including scarines and odacines) contains 82 genera and about 600 species of fishes that inhabit coastal and continental shelf waters in tropical and temperate oceans throughout the world. The Labridae (the wrasses) is the fifth largest fish family and second largest marine fish family, and is one of the most morphologically and ecologically diversified families of fishes in size, shape, and color. Labrid phylogeny is a long-standing problem in ichthyology that is part of the larger question of relationships within the suborder Labroidei. A phylogenetic analysis of labrids was conducted to investigate relationships among the six classical tribes of wrasses, the affinities of the wrasses to the parrotfishes (scarines), and the broad phylogenetic structure among labrid genera. Four gene fragments were sequenced from 98 fish species, including 84 labrid fishes and 14 outgroup taxa. Taxa were chosen from all major labrid clades and most major global ocean regions where labrid fishes exist, as well as cichlid, pomacentrid, and embiotocid outgroups. From the mitochondrial genome we sequenced portions of 12S rRNA (1000 bp) and 16S rRNA (585 bp), which were aligned by using a secondary structure model. From the nuclear genome, we sequenced part of the protein-coding genes RAG2 (846 bp) and Tmo4C4 (541 bp). Maximum likelihood, maximum parsimony, and Bayesian analyses on the resulting 2972 bp of DNA sequence produced similar topologies that confirm the monophyly of a family Labridae that includes the parrotfishes and butterfishes and strong support for many previously identified taxonomic subgroups. The tribe Hypsigenyini (hogfishes, tuskfishes) is the sister group to the remaining labrids and includes odacines and the chisel-tooth wrasse Pseudodax moluccanus, a species previously considered close to scarines. Cheilines and scarines are sister-groups, closely related to the temperate Labrini, and pseudocheilines and cheilines are split in all phylogenies

  13. galaxieEST: addressing EST identity through automated phylogenetic analysis.

    Science.gov (United States)

    Nilsson, R Henrik; Rajashekar, Balaji; Larsson, Karl-Henrik; Ursing, Björn M

    2004-07-05

    Research involving expressed sequence tags (ESTs) is intricately coupled to the existence of large, well-annotated sequence repositories. Comparatively complete and satisfactory annotated public sequence libraries are, however, available only for a limited range of organisms, rendering the absence of sequences and gene structure information a tangible problem for those working with taxa lacking an EST or genome sequencing project. Paralogous genes belonging to the same gene family but distinguished by derived characteristics are particularly prone to misidentification and erroneous annotation; high but incomplete levels of sequence similarity are typically difficult to interpret and have formed the basis of many unsubstantiated assumptions of orthology. In these cases, a phylogenetic study of the query sequence together with the most similar sequences in the database may be of great value to the identification process. In order to facilitate this laborious procedure, a project to employ automated phylogenetic analysis in the identification of ESTs was initiated. galaxieEST is an open source Perl-CGI script package designed to complement traditional similarity-based identification of EST sequences through employment of automated phylogenetic analysis. It uses a series of BLAST runs as a sieve to retrieve nucleotide and protein sequences for inclusion in neighbour joining and parsimony analyses; the output includes the BLAST output, the results of the phylogenetic analyses, and the corresponding multiple alignments. galaxieEST is available as an on-line web service for identification of fungal ESTs and for download / local installation for use with any organism group at http://galaxie.cgb.ki.se/galaxieEST.html. By addressing sequence relatedness in addition to similarity, galaxieEST provides an integrative view on EST origin and identity, which may prove particularly useful in cases where similarity searches return one or more pertinent, but not full, matches and

  14. A Molecular Assessment of Phylogenetic Relationships and LineageDiversification Within the Family Salamandridae (Amphibia, Caudata)

    Energy Technology Data Exchange (ETDEWEB)

    Weisrock, David W.; Papenfuss, Theodore J.; Macey, J. Robert; Litvinchuk, Spartak N.; Polymeni, Rosa; Ugurtas, Ismail H.; Zhao, Ermi; Larson, Allan

    2005-08-08

    Phylogenetic relationships among species of the salamanderfamily Salamandridae are investigated using nearly 3000 nucleotide basesof newly reported mitochondrial DNA sequence data from the mtDNA genicregion spanning the genes tRNALeu-COI. This study uses nearlycomprehensive species-level sampling to provide the first completephylogeny for the Salamandridae. Deep phylogenetic relationships amongthe three most divergent lineages in the family Salamandrina terdigitata,a clade comprising the "True" salamanders, and a clade comprising allnewts except S. terdigitata are difficult to resolve. However, mostrelationships within the latter two lineages are resolved with robustlevels of branch support. The genera Euproctus and Triturus arestatistically shown to be nonmonophyletic, instead each contains adiverse set of lineages positioned within the large newt clade. The genusParamesotriton is also resolve as a nonmonophyletic group, with the newlydescribed species P. laoensis constituting a divergent lineage placed ina sister position to clade containing all Pachytriton species and allremaining Paramesotriton species. Sequence divergences between P.laoensis and other Paramesotriton species are as great as those comparingP. laoensis and species of the genera Cynops and Pachytriton. Analyses oflineage diversification across the Salamandridae indicate that, despiteits exceptional diversity, lineage accumulation appears to have beenconstant across time, indicating that it does not represent a truespecies radiation.

  15. Phylogenetic system and zoogeography of the Plecoptera.

    Science.gov (United States)

    Zwick, P

    2000-01-01

    Information about the phylogenetic relationships of Plecoptera is summarized. The few characters supporting monophyly of the order are outlined. Several characters of possible significance for the search for the closest relatives of the stoneflies are discussed, but the sister-group of the order remains unknown. Numerous characters supporting the presently recognized phylogenetic system of Plecoptera are presented, alternative classifications are discussed, and suggestions for future studies are made. Notes on zoogeography are appended. The order as such is old (Permian fossils), but phylogenetic relationships and global distribution patterns suggest that evolution of the extant suborders started with the breakup of Pangaea. There is evidence of extensive recent speciation in all parts of the world.

  16. Vertebrate hosts and phylogenetic relationships of amphibian trypanosomes from a potential invertebrate vector, Culex territans Walker (Diptera: Culicidae).

    Science.gov (United States)

    Bartlett-Healy, Kristen; Crans, Wayne; Gaugler, Randy

    2009-04-01

    The blood meals of field-collected female Culex territans (Diptera: Culicidae) were concurrently assayed for the presence of trypanosomes and for vertebrate host identification. We amplified vertebrate DNA in 42 of 119 females and made positive identification to the host species level in 29 of those samples. Of the 119 field-collected Cx. territans females, 24 were infected with trypanosomes. Phylogenetic analysis placed the trypanosomes in the amphibian portion of the aquatic clade of the Trypanosomatidae. These trypanosomes were isolated from Cx. territans females that had fed on the frog species Rana clamitans, R. catesbeiana, R. virgatipes, and Rana spp. Results support a potential new lineage of dipteran-transmitted amphibian trypanosomes may occur within the aquatic clade. The frequency in which female Cx. territans acquire trypanosomes, through diverse feeding habits, indicates a new relationship between amphibian trypanosomes and mosquitoes that has not been examined previously. Combining Trypanosoma species, invertebrate, and vertebrate hosts to existing phylogenies can elucidate trypanosome and host relationships.

  17. Phylogenetic Information Content of Copepoda Ribosomal DNA Repeat Units: ITS1 and ITS2 Impact

    Science.gov (United States)

    Zagoskin, Maxim V.; Lazareva, Valentina I.; Grishanin, Andrey K.; Mukha, Dmitry V.

    2014-01-01

    The utility of various regions of the ribosomal repeat unit for phylogenetic analysis was examined in 16 species representing four families, nine genera, and two orders of the subclass Copepoda (Crustacea). Fragments approximately 2000 bp in length containing the ribosomal DNA (rDNA) 18S and 28S gene fragments, the 5.8S gene, and the internal transcribed spacer regions I and II (ITS1 and ITS2) were amplified and analyzed. The DAMBE (Data Analysis in Molecular Biology and Evolution) software was used to analyze the saturation of nucleotide substitutions; this test revealed the suitability of both the 28S gene fragment and the ITS1/ITS2 rDNA regions for the reconstruction of phylogenetic trees. Distance (minimum evolution) and probabilistic (maximum likelihood, Bayesian) analyses of the data revealed that the 28S rDNA and the ITS1 and ITS2 regions are informative markers for inferring phylogenetic relationships among families of copepods and within the Cyclopidae family and associated genera. Split-graph analysis of concatenated ITS1/ITS2 rDNA regions of cyclopoid copepods suggested that the Mesocyclops, Thermocyclops, and Macrocyclops genera share complex evolutionary relationships. This study revealed that the ITS1 and ITS2 regions potentially represent different phylogenetic signals. PMID:25215300

  18. Molecular and morphological analyses reveal phylogenetic relationships of stingrays focusing on the family Dasyatidae (Myliobatiformes.

    Directory of Open Access Journals (Sweden)

    Kean Chong Lim

    Full Text Available Elucidating the phylogenetic relationships of the current but problematic Dasyatidae (Order Myliobatiformes was the first priority of the current study. Here, we studied three molecular gene markers of 43 species (COI gene, 33 species (ND2 gene and 34 species (RAG1 gene of stingrays to draft out the phylogenetic tree of the order. Nine character states were identified and used to confirm the molecularly constructed phylogenetic trees. Eight or more clades (at different hierarchical level were identified for COI, ND2 and RAG1 genes in the Myliobatiformes including four clades containing members of the present Dasyatidae, thus rendering the latter non-monophyletic. The uncorrected p-distance between these four 'Dasytidae' clades when compared to the distance between formally known families confirmed that these four clades should be elevated to four separate families. We suggest a revision of the present classification, retaining the Dasyatidae (Dasyatis and Taeniurops species but adding three new families namely, Neotrygonidae (Neotrygon and Taeniura species, Himanturidae (Himantura species and Pastinachidae (Pastinachus species. Our result indicated the need to further review the classification of Dasyatis microps. By resolving the non-monophyletic problem, the suite of nine character states enables the natural classification of the Myliobatiformes into at least thirteen families based on morphology.

  19. The power and pitfalls of HIV phylogenetics in public health.

    Science.gov (United States)

    Brooks, James I; Sandstrom, Paul A

    2013-07-25

    Phylogenetics is the application of comparative studies of genetic sequences in order to infer evolutionary relationships among organisms. This tool can be used as a form of molecular epidemiology to enhance traditional population-level communicable disease surveillance. Phylogenetic study has resulted in new paradigms being created in the field of communicable diseases and this commentary aims to provide the reader with an explanation of how phylogenetics can be used in tracking infectious diseases. Special emphasis will be placed upon the application of phylogenetics as a tool to help elucidate HIV transmission patterns and the limitations to these methods when applied to forensic analysis. Understanding infectious disease epidemiology in order to prevent new transmissions is the sine qua non of public health. However, with increasing epidemiological resolution, there may be an associated potential loss of privacy to the individual. It is within this context that we aim to promote the discussion on how to use phylogenetics to achieve important public health goals, while at the same time protecting the rights of the individual.

  20. Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.

    Science.gov (United States)

    Wolf, P

    1997-10-01

    Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.

  1. PHYLOGENETIC ANALYSIS WHITHIN THE PRISTIMANTIS UNISTRIGATUS (ANURA, CRAUGASTORIDAE GROUP BASED ON MORPHOLOGICAL CHARACTERS

    Directory of Open Access Journals (Sweden)

    JULIO MARIO HOYOS

    2014-06-01

    Full Text Available We present a phylogenetic analysis within the Pristimantis unistrigatus group (Anura, Craugastoridae of Colombia . Characters from the superficial muscles of the hands and feet as well as external characters were taken for analysis. Most of the muscle characters were observed directly, and some were taken from the literature. Similarly, the external ones were taken mostly from the original descriptions and others from the literature as well. Two matrices were constructed, as the species belonging to this group have changed in recent years with respect to the initially proposed when the group was defined. The results lead us to conclude that the group is not monophyletic, although there are some relationships that are worth to survey because they are kept in the very last cladograms obtained for both proposals. It is suggested that these last relationships should be explored in particular, and the overall group in general, increasing the number of characters and taxa that belong to P. unistrigatus. An open question we left is whether actually is worth to keep these informal taxonomic hierarchy called group within the genera of anurans.

  2. Simultaneous analysis of five molecular markers provides a well-supported phylogenetic hypothesis for the living bony-tongue fishes (Osteoglossomorpha: Teleostei).

    Science.gov (United States)

    Lavoué, Sébastien; Sullivan, John P

    2004-10-01

    Fishes of the Superorder Osteoglossomorpha (the "bonytongues") constitute a morphologically heterogeneous group of basal teleosts, including highly derived subgroups such as African electric fishes, the African butterfly fish, and Old World knifefishes. Lack of consensus among hypotheses of osteoglossomorph relationships advanced during the past 30 years may be due in part to the difficulty of identifying shared derived characters among the morphologically differentiated extant families of this group. In this study, we present a novel phylogenetic hypothesis for this group, based on the analysis of more than 4000 characters from five molecular markers (the mitochondrial cytochrome b, 12S and 16S rRNA genes, and the nuclear genes RAG2 and MLL). Our taxonomic sampling includes one representative of each extant non-mormyrid osteoglossomorph genus, one representative for the monophyletic family Mormyridae, and four outgroup taxa within the basal Teleostei. Maximum parsimony analysis of combined and equally weighted characters from the five molecular markers and Bayesian analysis provide a single, well-supported, hypothesis of osteoglossomorph interrelationships and show the group to be monophyletic. The tree topology is the following: (Hiodon alosoides, (Pantodon buchholzi, (((Osteoglossum bicirrhosum, Scleropages sp.), (Arapaima gigas, Heterotis niloticus)), ((Gymnarchus niloticus, Ivindomyrus opdenboschi), ((Notopterus notopterus, Chitala ornata), (Xenomystus nigri, Papyrocranus afer)))))). We compare our results with previously published phylogenetic hypotheses based on morpho-anatomical data. Additionally, we explore the consequences of the long terminal branch length for the taxon Pantodon buchholzi in our phylogenetic reconstruction and we use the obtained phylogenetic tree to reconstruct the evolutionary history of electroreception in the Notopteroidei.

  3. PHYLOGENETIC RELATIONSHIPS AMONG VIETNAMESE COCOA ACCESSIONS USING A NON-CODING REGION OF THE CHLOROPLAST DNA

    OpenAIRE

    Lam Thi, Viet Ha; D.T., Khang; Everaert, Helena; T.N, Dung; P.H.D, Phuoc; H.T., Toan; Dewettinck, Koen; Messens, Kathy

    2017-01-01

    Cocoa (Theobroma cacao L.) cultivation has increased in tropical areas around the world, including Vietnam, due to the high demand of cocoa beans for chocolate production. The genetic diversity of cocoa genotypes is recognized to be complex, however, their phylogenetic relationships need to be clarified. The present study aimed to classify the cocoa genotypes that are imported and cultivated in Vietnam based on a chloroplast DNA region. Sixty-three Vietnamese Cocoa accessions were collected f...

  4. Improving the precision of the structure-function relationship by considering phylogenetic context.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available Understanding the relationship between protein structure and function is one of the foremost challenges in post-genomic biology. Higher conservation of structure could, in principle, allow researchers to extend current limitations of annotation. However, despite significant research in the area, a precise and quantitative relationship between biochemical function and protein structure has been elusive. Attempts to draw an unambiguous link have often been complicated by pleiotropy, variable transcriptional control, and adaptations to genomic context, all of which adversely affect simple definitions of function. In this paper, I report that integrating genomic information can be used to clarify the link between protein structure and function. First, I present a novel measure of functional proximity between protein structures (F-score. Then, using F-score and other entirely automatic methods measuring structure and phylogenetic similarity, I present a three-dimensional landscape describing their inter-relationship. The result is a "well-shaped" landscape that demonstrates the added value of considering genomic context in inferring function from structural homology. A generalization of methodology presented in this paper can be used to improve the precision of annotation of genes in current and newly sequenced genomes.

  5. Molecular phylogenetics and historical biogeography of Rhinolophus bats.

    Science.gov (United States)

    Stoffberg, Samantha; Jacobs, David S; Mackie, Iain J; Matthee, Conrad A

    2010-01-01

    The phylogenetic relationships within the horseshoe bats (genus Rhinolophus) are poorly resolved, particularly at deeper levels within the tree. We present a better-resolved phylogenetic hypothesis for 30 rhinolophid species based on parsimony and Bayesian analyses of the mitochondrial cytochrome b gene and three nuclear introns (TG, THY and PRKC1). Strong support was found for the existence of two geographic clades within the monophyletic Rhinolophidae: an African group and an Oriental assemblage. The relaxed Bayesian clock method indicated that the two rhinolophid clades diverged approximately 35 million years ago and results from Dispersal Vicariance (DIVA) analysis suggest that the horseshoe bats arose in Asia and subsequently dispersed into Europe and Africa.

  6. Phylogenetic relationships of true butterflies (Lepidoptera: Papilionoidea) inferred from COI, 16S rRNA and EF-1α sequences.

    Science.gov (United States)

    Kim, Man Il; Wan, Xinlong; Kim, Min Jee; Jeong, Heon Cheon; Ahn, Neung-Ho; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2010-11-01

    The molecular phylogenetic relationships among true butterfly families (superfamily Papilionoidea) have been a matter of substantial controversy; this debate has led to several competing hypotheses. Two of the most compelling of those hypotheses involve the relationships of (Nymphalidae + Lycaenidae) + (Pieridae + Papilionidae) and (((Nymphalidae + Lycaenidae) + Pieridae) + Papilionidae). In this study, approximately 3,500 nucleotide sequences from cytochrome oxidase subunit I (COI), 16S ribosomal RNA (16S rRNA), and elongation factor-1 alpha (EF-1α) were sequenced from 83 species belonging to four true butterfly families, along with those of three outgroup species belonging to three lepidopteran superfamilies. These sequences were subjected to phylogenetic reconstruction via Bayesian Inference (BI), Maximum Likelihood (ML), and Maximum Parsimony (MP) algorithms. The monophyletic Pieridae and monophyletic Papilionidae evidenced good recovery in all analyses, but in some analyses, the monophylies of the Lycaenidae and Nymphalidae were hampered by the inclusion of single species of the lycaenid subfamily Miletinae and the nymphalid subfamily Danainae. Excluding those singletons, all phylogenetic analyses among the four true butterfly families clearly identified the Nymphalidae as the sister to the Lycaenidae and identified this group as a sister to the Pieridae, with the Papilionidae identified as the most basal linage to the true butterfly, thus supporting the hypothesis: (Papilionidae + (Pieridae + (Nymphalidae + Lycaenidae))).

  7. Genetic variation analysis and relationships among environmental strains of Scedosporium apiospermum sensu stricto in Bangkok, Thailand.

    Directory of Open Access Journals (Sweden)

    Thanwa Wongsuk

    Full Text Available The Scedosporium apiospermum species complex is an emerging filamentous fungi that has been isolated from environment. It can cause a wide range of infections in both immunocompetent and immunocompromised individuals. We aimed to study the genetic variation and relationships between 48 strains of S. apiospermum sensu stricto isolated from soil in Bangkok, Thailand. For PCR, sequencing and phylogenetic analysis, we used the following genes: actin; calmodulin exons 3 and 4; the second largest subunit of the RNA polymerase II; ß-tubulin exon 2-4; manganese superoxide dismutase; internal transcribed spacer; transcription elongation factor 1α; and beta-tubulin exons 5 and 6. The present study is the first phylogenetic analysis of relationships among S. apiospermum sensu stricto in Thailand and South-east Asia. This result provides useful information for future epidemiological study and may be correlated to clinical manifestation.

  8. Bayesian models for comparative analysis integrating phylogenetic uncertainty

    Directory of Open Access Journals (Sweden)

    Villemereuil Pierre de

    2012-06-01

    Full Text Available Abstract Background Uncertainty in comparative analyses can come from at least two sources: a phylogenetic uncertainty in the tree topology or branch lengths, and b uncertainty due to intraspecific variation in trait values, either due to measurement error or natural individual variation. Most phylogenetic comparative methods do not account for such uncertainties. Not accounting for these sources of uncertainty leads to false perceptions of precision (confidence intervals will be too narrow and inflated significance in hypothesis testing (e.g. p-values will be too small. Although there is some application-specific software for fitting Bayesian models accounting for phylogenetic error, more general and flexible software is desirable. Methods We developed models to directly incorporate phylogenetic uncertainty into a range of analyses that biologists commonly perform, using a Bayesian framework and Markov Chain Monte Carlo analyses. Results We demonstrate applications in linear regression, quantification of phylogenetic signal, and measurement error models. Phylogenetic uncertainty was incorporated by applying a prior distribution for the phylogeny, where this distribution consisted of the posterior tree sets from Bayesian phylogenetic tree estimation programs. The models were analysed using simulated data sets, and applied to a real data set on plant traits, from rainforest plant species in Northern Australia. Analyses were performed using the free and open source software OpenBUGS and JAGS. Conclusions Incorporating phylogenetic uncertainty through an empirical prior distribution of trees leads to more precise estimation of regression model parameters than using a single consensus tree and enables a more realistic estimation of confidence intervals. In addition, models incorporating measurement errors and/or individual variation, in one or both variables, are easily formulated in the Bayesian framework. We show that BUGS is a useful, flexible

  9. Bayesian models for comparative analysis integrating phylogenetic uncertainty

    Science.gov (United States)

    2012-01-01

    Background Uncertainty in comparative analyses can come from at least two sources: a) phylogenetic uncertainty in the tree topology or branch lengths, and b) uncertainty due to intraspecific variation in trait values, either due to measurement error or natural individual variation. Most phylogenetic comparative methods do not account for such uncertainties. Not accounting for these sources of uncertainty leads to false perceptions of precision (confidence intervals will be too narrow) and inflated significance in hypothesis testing (e.g. p-values will be too small). Although there is some application-specific software for fitting Bayesian models accounting for phylogenetic error, more general and flexible software is desirable. Methods We developed models to directly incorporate phylogenetic uncertainty into a range of analyses that biologists commonly perform, using a Bayesian framework and Markov Chain Monte Carlo analyses. Results We demonstrate applications in linear regression, quantification of phylogenetic signal, and measurement error models. Phylogenetic uncertainty was incorporated by applying a prior distribution for the phylogeny, where this distribution consisted of the posterior tree sets from Bayesian phylogenetic tree estimation programs. The models were analysed using simulated data sets, and applied to a real data set on plant traits, from rainforest plant species in Northern Australia. Analyses were performed using the free and open source software OpenBUGS and JAGS. Conclusions Incorporating phylogenetic uncertainty through an empirical prior distribution of trees leads to more precise estimation of regression model parameters than using a single consensus tree and enables a more realistic estimation of confidence intervals. In addition, models incorporating measurement errors and/or individual variation, in one or both variables, are easily formulated in the Bayesian framework. We show that BUGS is a useful, flexible general purpose tool for

  10. Phylogenetic Inference of HIV Transmission Clusters

    Directory of Open Access Journals (Sweden)

    Vlad Novitsky

    2017-10-01

    Full Text Available Better understanding the structure and dynamics of HIV transmission networks is essential for designing the most efficient interventions to prevent new HIV transmissions, and ultimately for gaining control of the HIV epidemic. The inference of phylogenetic relationships and the interpretation of results rely on the definition of the HIV transmission cluster. The definition of the HIV cluster is complex and dependent on multiple factors, including the design of sampling, accuracy of sequencing, precision of sequence alignment, evolutionary models, the phylogenetic method of inference, and specified thresholds for cluster support. While the majority of studies focus on clusters, non-clustered cases could also be highly informative. A new dimension in the analysis of the global and local HIV epidemics is the concept of phylogenetically distinct HIV sub-epidemics. The identification of active HIV sub-epidemics reveals spreading viral lineages and may help in the design of targeted interventions.HIVclustering can also be affected by sampling density. Obtaining a proper sampling density may increase statistical power and reduce sampling bias, so sampling density should be taken into account in study design and in interpretation of phylogenetic results. Finally, recent advances in long-range genotyping may enable more accurate inference of HIV transmission networks. If performed in real time, it could both inform public-health strategies and be clinically relevant (e.g., drug-resistance testing.

  11. Contrasting HIV phylogenetic relationships and V3 loop protein similarities

    Energy Technology Data Exchange (ETDEWEB)

    Korber, B. (Los Alamos National Lab., NM (United States) Santa Fe Inst., NM (United States)); Myers, G. (Los Alamos National Lab., NM (United States))

    1992-01-01

    At least five distinct sequence subtypes of HIV-I can be identified from the major centers of the AMS pandemic. While it is too early to tell whether these subtypes are serologically or phenotypically similar or distinct in terms of properties such as pathogenicity and transmissibility, we can begin to investigate their potential for phenotypic divergence at the protein sequence level. Phylogenetic analysis of HIV DNA sequences is being widely used to examine lineages of different viral strains as they evolve and spread throughout the globe. We have identified five distinct HIV-1 subtypes (designated A-E), or clades, based on phylogenetic clustering patterns generated from genetic information from both the gag and envelope (env) genes from a spectrum of international isolates. Our initial observations concerning both HIV-1 and HIV-2 sequences indicate that conserved patterns in protein chemistry may indeed exist across distant lineages. Such patterns in V3 loop amino acid chemistry may be indicative of stable lineages or convergence within this highly variable, though functionally and immunologically critical, region. We think that there may be parallels between the apparently stable HIV-2 V3 lineage and the previously mentioned HIV-1 V3 loops which are very similar at the protein level despite being distant by cladistic analysis, and which do not possess the distinctive positively charged residues. Highly conserved V3 loop protein sequences are also encountered in SIVAGMs and CIVs (chimpanzee viral strains), which do not appear to be pathogenic in their wild-caught natural hosts.

  12. Contrasting HIV phylogenetic relationships and V3 loop protein similarities

    Energy Technology Data Exchange (ETDEWEB)

    Korber, B. [Los Alamos National Lab., NM (United States)]|[Santa Fe Inst., NM (United States); Myers, G. [Los Alamos National Lab., NM (United States)

    1992-12-31

    At least five distinct sequence subtypes of HIV-I can be identified from the major centers of the AMS pandemic. While it is too early to tell whether these subtypes are serologically or phenotypically similar or distinct in terms of properties such as pathogenicity and transmissibility, we can begin to investigate their potential for phenotypic divergence at the protein sequence level. Phylogenetic analysis of HIV DNA sequences is being widely used to examine lineages of different viral strains as they evolve and spread throughout the globe. We have identified five distinct HIV-1 subtypes (designated A-E), or clades, based on phylogenetic clustering patterns generated from genetic information from both the gag and envelope (env) genes from a spectrum of international isolates. Our initial observations concerning both HIV-1 and HIV-2 sequences indicate that conserved patterns in protein chemistry may indeed exist across distant lineages. Such patterns in V3 loop amino acid chemistry may be indicative of stable lineages or convergence within this highly variable, though functionally and immunologically critical, region. We think that there may be parallels between the apparently stable HIV-2 V3 lineage and the previously mentioned HIV-1 V3 loops which are very similar at the protein level despite being distant by cladistic analysis, and which do not possess the distinctive positively charged residues. Highly conserved V3 loop protein sequences are also encountered in SIVAGMs and CIVs (chimpanzee viral strains), which do not appear to be pathogenic in their wild-caught natural hosts.

  13. Phylogenetic analysis of anemone fishes of the Persian Gulf using ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-06-17

    Jun 17, 2008 ... genetic diversity among samples was investigated by phylogenetic analysis. Results show that there is ... more about the living organisms found in this region. Many marine ... Kish (modified from Pous et al., 2004). Table 2.

  14. Co-circulating serotypes in a dengue fever outbreak: Differential hematological profiles and phylogenetic relationships among viruses.

    Science.gov (United States)

    Carmo, Andreia Moreira Dos Santos; Suzuki, Rodrigo Buzinaro; Cabral, Aline Diniz; Costa, Renata Torres da; Massari, Gabriela Pena; Riquena, Michele Marcondes; Fracasso, Helio Augusto Alves; Eterovic, Andre; Marcili, Arlei; Sperança, Márcia Aparecida

    2017-05-01

    Dengue virus, represented by four distinct, genetically diverse serotypes, is the etiologic agent of asymptomatic to severe hemorrhagic diseases. The spatiotemporal dynamics of dengue serotypes and its association to specific diseases vary among the different regions worldwide. By 2007, and in São Paulo State, Brazil, dengue-case concentration in urban centers had changed to increased incidence in small- and medium-sized towns, the case of Marília. The aim of this article was to distinguish dengue serotypes circulating during the 2007 Marília outbreak and define their association to demographic and hematological patient profiles, as well as the phylogenetic relationships among the different viruses. PCR amplicons corresponding to the junction of capsid and dengue pre-membrane encoding genes, obtained from dengue serologically positive patients, were sequenced. Hematological and demographic data of patients with different Dengue serotypes were evaluated by univariate and bivariate statistics. Dengue PCR sequences were used in phylogenetic relationships analyzed for maximum parsimony. Molecular typing confirmed co-circulation of the dengue serotypes 1 (DENV1) and 3 (DENV3), which presented divergent correlation patterns with regard to hematological descriptors. The increase in atypical lymphocytes, a likely indication of virus load, could be significantly associated to a decrease in leukocyte counts in the DENV3 group and platelet in the DENV1. Phylogenetic reconstitution revealed the introduction of DENV1 from northern Brazil and local divergence of DENV3 by either microevolution or viral introduction from other geographical regions or both. Dengue dynamics showed regional molecular-epidemiologic specificity, which has important implications for introduction of vaccines, disease management, and transmission control. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Genetic Diversity and Phylogenetic Analysis of the Iranian Leishmania Parasites Based on HSP70 Gene PCR-RFLP and Sequence Analysis.

    Science.gov (United States)

    Nemati, Sara; Fazaeli, Asghar; Hajjaran, Homa; Khamesipour, Ali; Anbaran, Mohsen Falahati; Bozorgomid, Arezoo; Zarei, Fatah

    2017-08-01

    Despite the broad distribution of leishmaniasis among Iranians and animals across the country, little is known about the genetic characteristics of the causative agents. Applying both HSP70 PCR-RFLP and sequence analyses, this study aimed to evaluate the genetic diversity and phylogenetic relationships among Leishmania spp. isolated from Iranian endemic foci and available reference strains. A total of 36 Leishmania isolates from almost all districts across the country were genetically analyzed for the HSP70 gene using both PCR-RFLP and sequence analysis. The original HSP70 gene sequences were aligned along with homologous Leishmania sequences retrieved from NCBI, and subjected to the phylogenetic analysis. Basic parameters of genetic diversity were also estimated. The HSP70 PCR-RFLP presented 3 different electrophoretic patterns, with no further intraspecific variation, corresponding to 3 Leishmania species available in the country, L. tropica, L. major, and L. infantum. Phylogenetic analyses presented 5 major clades, corresponding to 5 species complexes. Iranian lineages, including L. major, L. tropica, and L. infantum, were distributed among 3 complexes L. major, L. tropica, and L. donovani. However, within the L. major and L. donovani species complexes, the HSP70 phylogeny was not able to distinguish clearly between the L. major and L. turanica isolates, and between the L. infantum, L. donovani, and L. chagasi isolates, respectively. Our results indicated that both HSP70 PCR-RFLP and sequence analyses are medically applicable tools for identification of Leishmania species in Iranian patients. However, the reduced genetic diversity of the target gene makes it inevitable that its phylogeny only resolves the major groups, namely, the species complexes.

  16. Disentangling the phylogenetic and ecological components of spider phenotypic variation.

    Science.gov (United States)

    Gonçalves-Souza, Thiago; Diniz-Filho, José Alexandre Felizola; Romero, Gustavo Quevedo

    2014-01-01

    An understanding of how the degree of phylogenetic relatedness influences the ecological similarity among species is crucial to inferring the mechanisms governing the assembly of communities. We evaluated the relative importance of spider phylogenetic relationships and ecological niche (plant morphological variables) to the variation in spider body size and shape by comparing spiders at different scales: (i) between bromeliads and dicot plants (i.e., habitat scale) and (ii) among bromeliads with distinct architectural features (i.e., microhabitat scale). We partitioned the interspecific variation in body size and shape into phylogenetic (that express trait values as expected by phylogenetic relationships among species) and ecological components (that express trait values independent of phylogenetic relationships). At the habitat scale, bromeliad spiders were larger and flatter than spiders associated with the surrounding dicots. At this scale, plant morphology sorted out close related spiders. Our results showed that spider flatness is phylogenetically clustered at the habitat scale, whereas it is phylogenetically overdispersed at the microhabitat scale, although phylogenic signal is present in both scales. Taken together, these results suggest that whereas at the habitat scale selective colonization affect spider body size and shape, at fine scales both selective colonization and adaptive evolution determine spider body shape. By partitioning the phylogenetic and ecological components of phenotypic variation, we were able to disentangle the evolutionary history of distinct spider traits and show that plant architecture plays a role in the evolution of spider body size and shape. We also discussed the relevance in considering multiple scales when studying phylogenetic community structure.

  17. Genetic divergence and phylogenetic relationships in grey mullets (Teleostei: Mugilidae) based on PCR-RFLP analysis of mtDNA segments.

    Science.gov (United States)

    Papasotiropoulos, V; Klossa-Kilia, E; Kilias, G; Alahiotis, S

    2002-04-01

    The genetic differentiation and phylogenetic relationships among five species of the Mugilidae family (Mugil cephalus, Chelon labrosus, Liza aurata, Liza ramada, and Liza saliens) were investigated at the mtDNA level, on samples taken from Messolongi lagoon-Greece. RFLP analysis of three PCR-amplified mtDNA gene segments (12s rRNA, 16s rRNA, and CO I) was used. Ten, eight, and nine restriction enzymes were found to have at least one recognition site at 12s rRNA, 16s rRNA, and CO I genes, respectively. Several fragment patterns were revealed to be species-specific, and thus they could be useful in species taxonomy as diagnostic markers, as well as for further evolutionary studies. Seven different haplotypes were detected. The greatest amount of genetic differentiation was observed at the interspecific level, while little variation was revealed at the intraspecific level. The highest values of nucleotide sequence divergence were observed between M. cephalus and all the other species, while the lowest was found between C. labrosus and L. saliens. Dendrograms obtained by the three different methods (UPGMA, Neighbor-Joining, and Dollo parsimony), were found to exhibit in all cases the same topology. According to this, the most distinct species is M. cephalus, while the other species are clustered in two separate groups, thefirst one containing L. aurata and L. ramada, the other L. saliens and C. labrosus. This last clustering makes the monophyletic origin of the genus Liza questionable.

  18. Enumerating all maximal frequent subtrees in collections of phylogenetic trees.

    Science.gov (United States)

    Deepak, Akshay; Fernández-Baca, David

    2014-01-01

    A common problem in phylogenetic analysis is to identify frequent patterns in a collection of phylogenetic trees. The goal is, roughly, to find a subset of the species (taxa) on which all or some significant subset of the trees agree. One popular method to do so is through maximum agreement subtrees (MASTs). MASTs are also used, among other things, as a metric for comparing phylogenetic trees, computing congruence indices and to identify horizontal gene transfer events. We give algorithms and experimental results for two approaches to identify common patterns in a collection of phylogenetic trees, one based on agreement subtrees, called maximal agreement subtrees, the other on frequent subtrees, called maximal frequent subtrees. These approaches can return subtrees on larger sets of taxa than MASTs, and can reveal new common phylogenetic relationships not present in either MASTs or the majority rule tree (a popular consensus method). Our current implementation is available on the web at https://code.google.com/p/mfst-miner/. Our computational results confirm that maximal agreement subtrees and all maximal frequent subtrees can reveal a more complete phylogenetic picture of the common patterns in collections of phylogenetic trees than maximum agreement subtrees; they are also often more resolved than the majority rule tree. Further, our experiments show that enumerating maximal frequent subtrees is considerably more practical than enumerating ordinary (not necessarily maximal) frequent subtrees.

  19. Detecting Network Communities: An Application to Phylogenetic Analysis

    Science.gov (United States)

    Andrade, Roberto F. S.; Rocha-Neto, Ivan C.; Santos, Leonardo B. L.; de Santana, Charles N.; Diniz, Marcelo V. C.; Lobão, Thierry Petit; Goés-Neto, Aristóteles; Pinho, Suani T. R.; El-Hani, Charbel N.

    2011-01-01

    This paper proposes a new method to identify communities in generally weighted complex networks and apply it to phylogenetic analysis. In this case, weights correspond to the similarity indexes among protein sequences, which can be used for network construction so that the network structure can be analyzed to recover phylogenetically useful information from its properties. The analyses discussed here are mainly based on the modular character of protein similarity networks, explored through the Newman-Girvan algorithm, with the help of the neighborhood matrix . The most relevant networks are found when the network topology changes abruptly revealing distinct modules related to the sets of organisms to which the proteins belong. Sound biological information can be retrieved by the computational routines used in the network approach, without using biological assumptions other than those incorporated by BLAST. Usually, all the main bacterial phyla and, in some cases, also some bacterial classes corresponded totally (100%) or to a great extent (>70%) to the modules. We checked for internal consistency in the obtained results, and we scored close to 84% of matches for community pertinence when comparisons between the results were performed. To illustrate how to use the network-based method, we employed data for enzymes involved in the chitin metabolic pathway that are present in more than 100 organisms from an original data set containing 1,695 organisms, downloaded from GenBank on May 19, 2007. A preliminary comparison between the outcomes of the network-based method and the results of methods based on Bayesian, distance, likelihood, and parsimony criteria suggests that the former is as reliable as these commonly used methods. We conclude that the network-based method can be used as a powerful tool for retrieving modularity information from weighted networks, which is useful for phylogenetic analysis. PMID:21573202

  20. Genome-wide comparative analysis of phylogenetic trees: the prokaryotic forest of life.

    Science.gov (United States)

    Puigbò, Pere; Wolf, Yuri I; Koonin, Eugene V

    2012-01-01

    Genome-wide comparison of phylogenetic trees is becoming an increasingly common approach in evolutionary genomics, and a variety of approaches for such comparison have been developed. In this article, we present several methods for comparative analysis of large numbers of phylogenetic trees. To compare phylogenetic trees taking into account the bootstrap support for each internal branch, the Boot-Split Distance (BSD) method is introduced as an extension of the previously developed Split Distance method for tree comparison. The BSD method implements the straightforward idea that comparison of phylogenetic trees can be made more robust by treating tree splits differentially depending on the bootstrap support. Approaches are also introduced for detecting tree-like and net-like evolutionary trends in the phylogenetic Forest of Life (FOL), i.e., the entirety of the phylogenetic trees for conserved genes of prokaryotes. The principal method employed for this purpose includes mapping quartets of species onto trees to calculate the support of each quartet topology and so to quantify the tree and net contributions to the distances between species. We describe the application of these methods to analyze the FOL and the results obtained with these methods. These results support the concept of the Tree of Life (TOL) as a central evolutionary trend in the FOL as opposed to the traditional view of the TOL as a "species tree."

  1. Towards an integrated phylogenetic classification of the Tremellomycetes.

    Science.gov (United States)

    Liu, X-Z; Wang, Q-M; Göker, M; Groenewald, M; Kachalkin, A V; Lumbsch, H T; Millanes, A M; Wedin, M; Yurkov, A M; Boekhout, T; Bai, F-Y

    2015-06-01

    Families and genera assigned to Tremellomycetes have been mainly circumscribed by morphology and for the yeasts also by biochemical and physiological characteristics. This phenotype-based classification is largely in conflict with molecular phylogenetic analyses. Here a phylogenetic classification framework for the Tremellomycetes is proposed based on the results of phylogenetic analyses from a seven-genes dataset covering the majority of tremellomycetous yeasts and closely related filamentous taxa. Circumscriptions of the taxonomic units at the order, family and genus levels recognised were quantitatively assessed using the phylogenetic rank boundary optimisation (PRBO) and modified general mixed Yule coalescent (GMYC) tests. In addition, a comprehensive phylogenetic analysis on an expanded LSU rRNA (D1/D2 domains) gene sequence dataset covering as many as available teleomorphic and filamentous taxa within Tremellomycetes was performed to investigate the relationships between yeasts and filamentous taxa and to examine the stability of undersampled clades. Based on the results inferred from molecular data and morphological and physiochemical features, we propose an updated classification for the Tremellomycetes. We accept five orders, 17 families and 54 genera, including seven new families and 18 new genera. In addition, seven families and 17 genera are emended and one new species name and 185 new combinations are proposed. We propose to use the term pro tempore or pro tem. in abbreviation to indicate the species names that are temporarily maintained.

  2. Molecular phylogenetic reconstruction of the endemic Asian salamander family Hynobiidae (Amphibia, Caudata).

    Science.gov (United States)

    Weisrock, David W; Macey, J Robert; Matsui, Masafumi; Mulcahy, Daniel G; Papenfuss, Theodore J

    2013-01-01

    The salamander family Hynobiidae contains over 50 species and has been the subject of a number of molecular phylogenetic investigations aimed at reconstructing branches across the entire family. In general, studies using the greatest amount of sequence data have used reduced taxon sampling, while the study with the greatest taxon sampling has used a limited sequence data set. Here, we provide insights into the phylogenetic history of the Hynobiidae using both dense taxon sampling and a large mitochondrial DNA sequence data set. We report exclusive new mitochondrial DNA data of 2566 aligned bases (with 151 excluded sites, of included sites 1157 are variable with 957 parsimony informative). This is sampled from two genic regions encoding a 12S-16S region (the 3' end of 12S rRNA, tRNA(VAI), and the 5' end of 16S rRNA), and a ND2-COI region (ND2, tRNA(Trp), tRNA(Ala), tRNA(Asn), the origin for light strand replication--O(L), tRNA(Cys), tRNAT(Tyr), and the 5' end of COI). Analyses using parsimony, Bayesian, and maximum likelihood optimality criteria produce similar phylogenetic trees, with discordant branches generally receiving low levels of branch support. Monophyly of the Hynobiidae is strongly supported across all analyses, as is the sister relationship and deep divergence between the genus Onychodactylus with all remaining hynobiids. Within this latter grouping our phylogenetic results identify six clades that are relatively divergent from one another, but for which there is minimal support for their phylogenetic placement. This includes the genus Batrachuperus, the genus Hynobius, the genus Pachyhynobius, the genus Salamandrella, a clade containing the genera Ranodon and Paradactylodon, and a clade containing the genera Liua and Pseudohynobius. This latter clade receives low bootstrap support in the parsimony analysis, but is consistent across all three analytical methods. Our results also clarify a number of well-supported relationships within the larger

  3. Revealing pancrustacean relationships: phylogenetic analysis of ribosomal protein genes places Collembola (springtails) in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers.

    Science.gov (United States)

    Timmermans, M J T N; Roelofs, D; Mariën, J; van Straalen, N M

    2008-03-12

    In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length), of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  4. A program to compute the soft Robinson-Foulds distance between phylogenetic networks.

    Science.gov (United States)

    Lu, Bingxin; Zhang, Louxin; Leong, Hon Wai

    2017-03-14

    Over the past two decades, phylogenetic networks have been studied to model reticulate evolutionary events. The relationships among phylogenetic networks, phylogenetic trees and clusters serve as the basis for reconstruction and comparison of phylogenetic networks. To understand these relationships, two problems are raised: the tree containment problem, which asks whether a phylogenetic tree is displayed in a phylogenetic network, and the cluster containment problem, which asks whether a cluster is represented at a node in a phylogenetic network. Both the problems are NP-complete. A fast exponential-time algorithm for the cluster containment problem on arbitrary networks is developed and implemented in C. The resulting program is further extended into a computer program for fast computation of the Soft Robinson-Foulds distance between phylogenetic networks. Two computer programs are developed for facilitating reconstruction and validation of phylogenetic network models in evolutionary and comparative genomics. Our simulation tests indicated that they are fast enough for use in practice. Additionally, the distribution of the Soft Robinson-Foulds distance between phylogenetic networks is demonstrated to be unlikely normal by our simulation data.

  5. Phylogenetic relationships among the species of the genus testudo (Testudines : Testudinidae) inferred from mitochondrial 12S rRNA gene sequences

    NARCIS (Netherlands)

    van der Kuyl, Antoinette C.; Ph Ballasina, Donato L.; Dekker, John T.; Maas, Jolanda; Willemsen, Ronald E.; Goudsmit, Jaap

    2002-01-01

    To test phylogenetic relationships within the genus Testudo (Testudines: Testudinidae), we have sequenced a fragment of the mitochondrial (mt) 12S rRNA gene of 98 tortoise specimens belonging to the genera Testudo, Indotestudo, and Geochelone. Maximum likelihood and neighbor-joining methods identify

  6. Detection, molecular typing and phylogenetic analysis of Leishmania isolated from cases of leishmaniasis among Syrian refugees in Lebanon

    Directory of Open Access Journals (Sweden)

    Tamara Salloum

    2016-06-01

    Two molecular typing methods of 39 FFPE Leishmania isolates were used: the ITS1-PCR RFLP and the nested ITS1-5.8S rDNA gene amplification followed by sequencing and phylogenetic analysis. The efficiency of these two techniques in Leishmania identification was compared and the phylogenetic relationships among these isolates were illustrated based on the neighbor-joining (NJ method. The results were statistically correlated with the parasitic index (PI. The DNA storage in formalin-fixed paraffin embedded (FFPE tissues was assessed as well. The parasites identified were all L. tropica as determined by both techniques. ITS1-5.8S rDNA gene based typing proved to be more sensitive in the detection of parasites (positive in 69.2% of the isolates as opposed to the ITS1-PCR RFLP method that was successful in identifying L. tropica in only 43.6% of the isolates. Sequencing and phylogenetic analysis revealed high levels of heterogeneity. A statistically significant correlation was observed between PI and the results of the nested ITS1-5.8S rDNA gene PCR. Genotyping at the species level is essential for monitoring the relative frequency of CL in the Mediterranean area that is correlated to three different Leishmania species (Leishmania infantum, Leishmania major and L. tropica, each characterized by distinct epidemiological features. The obtained results highlight the need to find a universally accepted diagnostic tool for Leishmania typing.

  7. Phylogenetic community structure: temporal variation in fish assemblage

    OpenAIRE

    Santorelli, Sergio; Magnusson, William; Ferreira, Efrem; Caramaschi, Erica; Zuanon, Jansen; Amadio, Sidnéia

    2014-01-01

    Hypotheses about phylogenetic relationships among species allow inferences about the mechanisms that affect species coexistence. Nevertheless, most studies assume that phylogenetic patterns identified are stable over time. We used data on monthly samples of fish from a single lake over 10 years to show that the structure in phylogenetic assemblages varies over time and conclusions depend heavily on the time scale investigated. The data set was organized in guild structures and temporal scales...

  8. On the information content of discrete phylogenetic characters.

    Science.gov (United States)

    Bordewich, Magnus; Deutschmann, Ina Maria; Fischer, Mareike; Kasbohm, Elisa; Semple, Charles; Steel, Mike

    2017-12-16

    Phylogenetic inference aims to reconstruct the evolutionary relationships of different species based on genetic (or other) data. Discrete characters are a particular type of data, which contain information on how the species should be grouped together. However, it has long been known that some characters contain more information than others. For instance, a character that assigns the same state to each species groups all of them together and so provides no insight into the relationships of the species considered. At the other extreme, a character that assigns a different state to each species also conveys no phylogenetic signal. In this manuscript, we study a natural combinatorial measure of the information content of an individual character and analyse properties of characters that provide the maximum phylogenetic information, particularly, the number of states such a character uses and how the different states have to be distributed among the species or taxa of the phylogenetic tree.

  9. Phylogenetic comparative methods on phylogenetic networks with reticulations.

    Science.gov (United States)

    Bastide, Paul; Solís-Lemus, Claudia; Kriebel, Ricardo; Sparks, K William; Ané, Cécile

    2018-04-25

    The goal of Phylogenetic Comparative Methods (PCMs) is to study the distribution of quantitative traits among related species. The observed traits are often seen as the result of a Brownian Motion (BM) along the branches of a phylogenetic tree. Reticulation events such as hybridization, gene flow or horizontal gene transfer, can substantially affect a species' traits, but are not modeled by a tree. Phylogenetic networks have been designed to represent reticulate evolution. As they become available for downstream analyses, new models of trait evolution are needed, applicable to networks. One natural extension of the BM is to use a weighted average model for the trait of a hybrid, at a reticulation point. We develop here an efficient recursive algorithm to compute the phylogenetic variance matrix of a trait on a network, in only one preorder traversal of the network. We then extend the standard PCM tools to this new framework, including phylogenetic regression with covariates (or phylogenetic ANOVA), ancestral trait reconstruction, and Pagel's λ test of phylogenetic signal. The trait of a hybrid is sometimes outside of the range of its two parents, for instance because of hybrid vigor or hybrid depression. These two phenomena are rather commonly observed in present-day hybrids. Transgressive evolution can be modeled as a shift in the trait value following a reticulation point. We develop a general framework to handle such shifts, and take advantage of the phylogenetic regression view of the problem to design statistical tests for ancestral transgressive evolution in the evolutionary history of a group of species. We study the power of these tests in several scenarios, and show that recent events have indeed the strongest impact on the trait distribution of present-day taxa. We apply those methods to a dataset of Xiphophorus fishes, to confirm and complete previous analysis in this group. All the methods developed here are available in the Julia package PhyloNetworks.

  10. Analysis of complete mitochondrial genome sequences increases phylogenetic resolution of bears (Ursidae, a mammalian family that experienced rapid speciation

    Directory of Open Access Journals (Sweden)

    Ryder Oliver A

    2007-10-01

    Full Text Available Abstract Background Despite the small number of ursid species, bear phylogeny has long been a focus of study due to their conservation value, as all bear genera have been classified as endangered at either the species or subspecies level. The Ursidae family represents a typical example of rapid evolutionary radiation. Previous analyses with a single mitochondrial (mt gene or a small number of mt genes either provide weak support or a large unresolved polytomy for ursids. We revisit the contentious relationships within Ursidae by analyzing complete mt genome sequences and evaluating the performance of both entire mt genomes and constituent mtDNA genes in recovering a phylogeny of extremely recent speciation events. Results This mitochondrial genome-based phylogeny provides strong evidence that the spectacled bear diverged first, while within the genus Ursus, the sloth bear is the sister taxon of all the other five ursines. The latter group is divided into the brown bear/polar bear and the two black bears/sun bear assemblages. These findings resolve the previous conflicts between trees using partial mt genes. The ability of different categories of mt protein coding genes to recover the correct phylogeny is concordant with previous analyses for taxa with deep divergence times. This study provides a robust Ursidae phylogenetic framework for future validation by additional independent evidence, and also has significant implications for assisting in the resolution of other similarly difficult phylogenetic investigations. Conclusion Identification of base composition bias and utilization of the combined data of whole mitochondrial genome sequences has allowed recovery of a strongly supported phylogeny that is upheld when using multiple alternative outgroups for the Ursidae, a mammalian family that underwent a rapid radiation since the mid- to late Pliocene. It remains to be seen if the reliability of mt genome analysis will hold up in studies of other

  11. Analysis of Fatty Acid and Growth Profiles in Ten Shewanella spp. to Associate Phylogenetic Relationships

    Science.gov (United States)

    2015-10-25

    microorganisms from the same genus using physiological responses. To understand these changes, a shift in fatty acid length distributions and growth of...phylogenetically dissimilar microorganisms from the same genus using physiological responses. To understand these changes, a shift in fatty acid length...region contaminated with metals: relation with ecological characteristics and soil respiration. J. Biorem. Biodegrad . 6, 1000274/1000271-1000274

  12. Enumerating all maximal frequent subtrees in collections of phylogenetic trees

    Science.gov (United States)

    2014-01-01

    Background A common problem in phylogenetic analysis is to identify frequent patterns in a collection of phylogenetic trees. The goal is, roughly, to find a subset of the species (taxa) on which all or some significant subset of the trees agree. One popular method to do so is through maximum agreement subtrees (MASTs). MASTs are also used, among other things, as a metric for comparing phylogenetic trees, computing congruence indices and to identify horizontal gene transfer events. Results We give algorithms and experimental results for two approaches to identify common patterns in a collection of phylogenetic trees, one based on agreement subtrees, called maximal agreement subtrees, the other on frequent subtrees, called maximal frequent subtrees. These approaches can return subtrees on larger sets of taxa than MASTs, and can reveal new common phylogenetic relationships not present in either MASTs or the majority rule tree (a popular consensus method). Our current implementation is available on the web at https://code.google.com/p/mfst-miner/. Conclusions Our computational results confirm that maximal agreement subtrees and all maximal frequent subtrees can reveal a more complete phylogenetic picture of the common patterns in collections of phylogenetic trees than maximum agreement subtrees; they are also often more resolved than the majority rule tree. Further, our experiments show that enumerating maximal frequent subtrees is considerably more practical than enumerating ordinary (not necessarily maximal) frequent subtrees. PMID:25061474

  13. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation.

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-12-07

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE , a biosynthesis gene cluster of γ-PGA, and pgdS , a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  14. Time spans and spacers : Molecular phylogenetic explorations in the Cladophora complex (Chlorophyta) from the perspective of rDNA gene and spacer sequences

    NARCIS (Netherlands)

    Bakker, Frederik Theodoor

    1995-01-01

    In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be

  15. Phylogenetic congruence between subtropical trees and their associated fungi

    NARCIS (Netherlands)

    Liu, Xubing; Liang, Minxia; Etienne, Rampal S.; Gilbert, Gregory S; Yu, Shixiao

    2016-01-01

    Recent studies have detected phylogenetic signals in pathogen-host networks for both soil-borne and leaf-infecting fungi, suggesting that pathogenic fungi may track or coevolve with their preferred hosts. However, a phylogenetically concordant relationship between multiple hosts and multiple fungi

  16. Phylogenetic relationship and Fourier-transform infrared spectroscopy-derived lipid determinants of lifespan parameters in the Saccharomyces cerevisiae yeast.

    Science.gov (United States)

    Molon, Mateusz; Zebrowski, Jacek

    2017-06-01

    Yeast ageing has been gaining much attention in gerontology research, yet the process itself is still not entirely clear. One of the constraints related to the use of the Saccharomyces cerevisiae yeast in studies is the ambiguity of the results concerning ageing determinants for different genetic backgrounds. In this paper, we compare reproductive potentials and lifespans of seven widely used haploid laboratory strains differing in daughter cells production capabilities and highlight the importance of choosing an appropriate genotype for the studies on ageing. Moreover, we show here links between post-reproductive lifespan and lipid metabolism, as well as between reproductive potential, reproductive lifespan and phylogenetic relationship. Using FTIR spectroscopy that generated a biochemical fingerprint of cells, coupled with chemometrics, we found that the band of carbonyl (C = O) stretching vibration discriminates the strains according to post-reproductive lifespan. The results indicated that prolonged post-reproductive lifespan was associated with relatively lower amount of fatty acids esterified to phospholipids compared to a free acid pool, thus implying phospholipid metabolism for the post-reproductive lifespan of yeast. In addition, phylogenetic analysis showed a correlation between nucleotide similarity and the reproductive potential or reproductive lifespan, but not to the longevity expressed in time units. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Phylogenetic analysis of fungal ABC transporters.

    Science.gov (United States)

    Kovalchuk, Andriy; Driessen, Arnold J M

    2010-03-16

    The superfamily of ABC proteins is among the largest known in nature. Its members are mainly, but not exclusively, involved in the transport of a broad range of substrates across biological membranes. Many contribute to multidrug resistance in microbial pathogens and cancer cells. The diversity of ABC proteins in fungi is comparable with those in multicellular animals, but so far fungal ABC proteins have barely been studied. We performed a phylogenetic analysis of the ABC proteins extracted from the genomes of 27 fungal species from 18 orders representing 5 fungal phyla thereby covering the most important groups. Our analysis demonstrated that some of the subfamilies of ABC proteins remained highly conserved in fungi, while others have undergone a remarkable group-specific diversification. Members of the various fungal phyla also differed significantly in the number of ABC proteins found in their genomes, which is especially reduced in the yeast S. cerevisiae and S. pombe. Data obtained during our analysis should contribute to a better understanding of the diversity of the fungal ABC proteins and provide important clues about their possible biological functions.

  18. Phylogeny and phylogenetic classification of the antbirds, ovenbirds, woodcreepers, and allies (Aves: Passeriformes: Infraorder Furnariides)

    Science.gov (United States)

    Moyle, R.G.; Chesser, R.T.; Brumfield, R.T.; Tello, J.G.; Marchese, D.J.; Cracraft, J.

    2009-01-01

    The infraorder Furnariides is a diverse group of suboscine passerine birds comprising a substantial component of the Neotropical avifauna. The included species encompass a broad array of morphologies and behaviours, making them appealing for evolutionary studies, but the size of the group (ca. 600 species) has limited well-sampled higher-level phylogenetic studies. Using DNA sequence data from the nuclear RAG-1 and RAG-2 exons, we undertook a phylogenetic analysis of the Furnariides sampling 124 (more than 88%) of the genera. Basal relationships among family-level taxa differed depending on phylogenetic method, but all topologies had little nodal support, mirroring the results from earlier studies in which discerning relationships at the base of the radiation was also difficult. In contrast, branch support for family-rank taxa and for many relationships within those clades was generally high. Our results support the Melanopareidae and Grallariidae as distinct from the Rhinocryptidae and Formicariidae, respectively. Within the Furnariides our data contradict some recent phylogenetic hypotheses and suggest that further study is needed to resolve these discrepancies. Of the few genera represented by multiple species, several were not monophyletic, indicating that additional systematic work remains within furnariine families and must include dense taxon sampling. We use this study as a basis for proposing a new phylogenetic classification for the group and in the process erect new family-group names for clades having high branch support across methods. ?? 2009 The Willi Hennig Society.

  19. Molecular identification and phylogenetic study of Demodex caprae.

    Science.gov (United States)

    Zhao, Ya-E; Cheng, Juan; Hu, Li; Ma, Jun-Xian

    2014-10-01

    The DNA barcode has been widely used in species identification and phylogenetic analysis since 2003, but there have been no reports in Demodex. In this study, to obtain an appropriate DNA barcode for Demodex, molecular identification of Demodex caprae based on mitochondrial cox1 was conducted. Firstly, individual adults and eggs of D. caprae were obtained for genomic DNA (gDNA) extraction; Secondly, mitochondrial cox1 fragment was amplified, cloned, and sequenced; Thirdly, cox1 fragments of D. caprae were aligned with those of other Demodex retrieved from GenBank; Finally, the intra- and inter-specific divergences were computed and the phylogenetic trees were reconstructed to analyze phylogenetic relationship in Demodex. Results obtained from seven 429-bp fragments of D. caprae showed that sequence identities were above 99.1% among three adults and four eggs. The intraspecific divergences in D. caprae, Demodex folliculorum, Demodex brevis, and Demodex canis were 0.0-0.9, 0.5-0.9, 0.0-0.2, and 0.0-0.5%, respectively, while the interspecific divergences between D. caprae and D. folliculorum, D. canis, and D. brevis were 20.3-20.9, 21.8-23.0, and 25.0-25.3, respectively. The interspecific divergences were 10 times higher than intraspecific ones, indicating considerable barcoding gap. Furthermore, the phylogenetic trees showed that four Demodex species gathered separately, representing independent species; and Demodex folliculorum gathered with canine Demodex, D. caprae, and D. brevis in sequence. In conclusion, the selected 429-bp mitochondrial cox1 gene is an appropriate DNA barcode for molecular classification, identification, and phylogenetic analysis of Demodex. D. caprae is an independent species and D. folliculorum is closer to D. canis than to D. caprae or D. brevis.

  20. Phylogenetic analysis of West Nile virus, Nuevo Leon State, Mexico.

    Science.gov (United States)

    Blitvich, Bradley J; Fernández-Salas, Ildefonso; Contreras-Cordero, Juan F; Loroño-Pino, María A; Marlenee, Nicole L; Díaz, Francisco J; González-Rojas, José I; Obregón-Martínez, Nelson; Chiu-García, Jorge A; Black, William C; Beaty, Barry J

    2004-07-01

    West Nile virus RNA was detected in brain tissue from a horse that died in June 2003 in Nuevo Leon State, Mexico. Nucleotide sequencing and phylogenetic analysis of the premembrane and envelope genes showed that the virus was most closely related to West Nile virus isolates collected in Texas in 2002.

  1. [Identification and phylogenetic analysis of one strain of Lactobacillus delbrueckii subsp. bulgaricus separated from yoghourt].

    Science.gov (United States)

    Wang, Chuan; Zhang, Chaowu; Pei, Xiaofang; Liu, Hengchuan

    2007-11-01

    For being further applied and studied, one strain of Lactobacillus delbrueckii subsp. bulgaricus (wch9901) separated from yoghourt which had been identified by phenotype characteristic analysis was identified by 16S rDNA and phylogenetic analyzed. The 16S rDNA of wch9901 was amplified with the genomic DNA of wch9901 as template, and the conservative sequences of the 16S rDNA as primers. Inserted 16S rDNA amplified into clonal vector pGEM-T under the function of T4 DNA ligase to construct recombined plasmid pGEM-wch9901 16S rDNA. The recombined plasmid was identified by restriction enzyme digestion, and the eligible plasmid was presented to sequencing company for DNA sequencing. Nucleic acid sequence was blast in GenBank and phylogenetic tree was constructed using neighbor-joining method of distance methods by Mega3.1 soft. Results of blastn showed that the homology of 16S rDNA of wch9901 with the 16S rDNA of Lactobacillus delbrueckii subsp. bulgaricus strains was higher than 96%. On the phylogenetic tree, wch9901 formed a separate branch and located between Lactobacillus delbrueckii subsp. bulgaricus LGM2 evolution branch and another evolution branch which was composed of Lactobacillus delbrueckii subsp. bulgaricus DL2 evolution cluster and Lactobacillus delbrueckii subsp. bulgaricus JSQ evolution cluster. The distance between wch9901 evolution branch and Lactobacillus delbrueckii subsp. bulgaricus LGM2 evolution branch was the closest. wch9901 belonged to Lactobacillus delbrueckii subsp. bulgaricus. wch9901 showed the closest evolution relationship to Lactobacillus delbrueckii subsp. bulgaricus LGM2.

  2. Phylogenetic relationships of the glycoprotein gene of bovine ephemeral fever virus isolated from mainland China, Taiwan, Japan, Turkey, Israel and Australia

    Directory of Open Access Journals (Sweden)

    Zheng Fuying

    2012-11-01

    Full Text Available Abstract Background The glycoprotein (G gene sequences of bovine ephemeral fever virus (BEFV strains derived from mainland China have not been compared with those of the isolates from other countries or areas. Therefore, the G genes of four BEFV isolates obtained from mainland China were amplified and sequenced. A phylogenetic tree was constructed in order to compare and analyze the genetic relationships of the BEFV isolates derived from mainland China and different countries and areas. Results The complete BEFV G gene was successfully amplified and sequenced from four isolates that originated from mainland China. A total of fifty-one BEFV strains were analyzed based on the G gene sequence and were found to be highly conserved. A phylogenetic tree showed that the isolates were grouped into three distinct lineages depending on their source of origin. The antigenic sites of G1, G2 and G3 are conserved among the isolates, except for several substitutions in a few strains. Conclusions The phylogenetic relationships of the BEFV isolates that originated from mainland China, Taiwan, Japan, Turkey, Israel and Australia were closely related to their source of origin, while the antigenic sites G1, G2 and G3 are conserved among the BEFV isolates used in this work.

  3. Consequences of recombination on traditional phylogenetic analysis

    DEFF Research Database (Denmark)

    Schierup, M H; Hein, J

    2000-01-01

    We investigate the shape of a phylogenetic tree reconstructed from sequences evolving under the coalescent with recombination. The motivation is that evolutionary inferences are often made from phylogenetic trees reconstructed from population data even though recombination may well occur (mt......DNA or viral sequences) or does occur (nuclear sequences). We investigate the size and direction of biases when a single tree is reconstructed ignoring recombination. Standard software (PHYLIP) was used to construct the best phylogenetic tree from sequences simulated under the coalescent with recombination....... With recombination present, the length of terminal branches and the total branch length are larger, and the time to the most recent common ancestor smaller, than for a tree reconstructed from sequences evolving with no recombination. The effects are pronounced even for small levels of recombination that may...

  4. Revealing pancrustacean relationships: Phylogenetic analysis of ribosomal protein genes places Collembola (springtails in a monophyletic Hexapoda and reinforces the discrepancy between mitochondrial and nuclear DNA markers

    Directory of Open Access Journals (Sweden)

    Mariën J

    2008-03-01

    Full Text Available Abstract Background In recent years, several new hypotheses on phylogenetic relations among arthropods have been proposed on the basis of DNA sequences. One of the challenged hypotheses is the monophyly of hexapods. This discussion originated from analyses based on mitochondrial DNA datasets that, due to an unusual positioning of Collembola, suggested that the hexapod body plan evolved at least twice. Here, we re-evaluate the position of Collembola using ribosomal protein gene sequences. Results In total 48 ribosomal proteins were obtained for the collembolan Folsomia candida. These 48 sequences were aligned with sequence data on 35 other ecdysozoans. Each ribosomal protein gene was available for 25% to 86% of the taxa. However, the total sequence information was unequally distributed over the taxa and ranged between 4% and 100%. A concatenated dataset was constructed (5034 inferred amino acids in length, of which ~66% of the positions were filled. Phylogenetic tree reconstructions, using Maximum Likelihood, Maximum Parsimony, and Bayesian methods, resulted in a topology that supports monophyly of Hexapoda. Conclusion Although ribosomal proteins in general may not evolve independently, they once more appear highly valuable for phylogenetic reconstruction. Our analyses clearly suggest that Hexapoda is monophyletic. This underpins the inconsistency between nuclear and mitochondrial datasets when analyzing pancrustacean relationships. Caution is needed when applying mitochondrial markers in deep phylogeny.

  5. A Distance Measure for Genome Phylogenetic Analysis

    Science.gov (United States)

    Cao, Minh Duc; Allison, Lloyd; Dix, Trevor

    Phylogenetic analyses of species based on single genes or parts of the genomes are often inconsistent because of factors such as variable rates of evolution and horizontal gene transfer. The availability of more and more sequenced genomes allows phylogeny construction from complete genomes that is less sensitive to such inconsistency. For such long sequences, construction methods like maximum parsimony and maximum likelihood are often not possible due to their intensive computational requirement. Another class of tree construction methods, namely distance-based methods, require a measure of distances between any two genomes. Some measures such as evolutionary edit distance of gene order and gene content are computational expensive or do not perform well when the gene content of the organisms are similar. This study presents an information theoretic measure of genetic distances between genomes based on the biological compression algorithm expert model. We demonstrate that our distance measure can be applied to reconstruct the consensus phylogenetic tree of a number of Plasmodium parasites from their genomes, the statistical bias of which would mislead conventional analysis methods. Our approach is also used to successfully construct a plausible evolutionary tree for the γ-Proteobacteria group whose genomes are known to contain many horizontally transferred genes.

  6. Genetic diversity and phylogenetic analysis of Tams1 of Theileria annulata isolates from three continents between 2000 and 2012.

    Science.gov (United States)

    Wang, Jiay; Yang, Xianyong; Wang, Yuge; Jing, Zhihong; Meng, Kai; Liu, Jianzhu; Guo, Huijun; Xu, Ruixue; Cheng, Ziqiang

    2014-01-01

    Theileria annulata, which is part of the Theileria sergenti/Theileria buffeli/Theileria orientalis group, preferentially infects cattle and results in high mortality and morbidity in the Mediterranean, Middle East, and Central Asia. The polypeptide Tams1 is an immunodominant major merozoite piroplasm surface antigen of T. annulata that could be used as a marker for epidemiological studies and phylogenetic analysis. In the present study, a total of 155 Tams1 sequences were investigated for genetic diversity and phylogenetic relationships through phylogenetic analysis. Results showed that the Tams1 sequences were divided into two major groups and that distribution for some isolates also exhibited geographic specificity. As targeting polymorphic genes for parasite detection may result in underestimation of infection, polymerase chain reaction (PCR) assay using two different probes targeting tams-1 genes of these two groups can be more credible. In addition, the direction of the spread of the disease was discovered to be from the Mediterranean or the tropical zone to the Eurasian peninsula, Middle East, Southern Asia, and Africa, particularly for Group 2. A similar occurrence was also found between the Ms1 gene of Theileria lestoquardi and the Tams1 gene of T. annulata, which explains cross-immunogenicity to a certain extent. However, no potential glycosylation site in the Tams1 of T. annulata was found in this study, which illustrated that instead of N-glycosylation, other modifications have more significant effects on the immunogenicity of the Tams1 protein.

  7. Assessment of phylogenetic relationship of rare plant species collected from Saudi Arabia using internal transcribed spacer sequences of nuclear ribosomal DNA.

    Science.gov (United States)

    Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A

    2013-03-11

    The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.

  8. The phylogenetics of succession can guide restoration

    DEFF Research Database (Denmark)

    Shooner, Stephanie; Chisholm, Chelsea Lee; Davies, T. Jonathan

    2015-01-01

    Phylogenetic tools have increasingly been used in community ecology to describe the evolutionary relationships among co-occurring species. In studies of succession, such tools may allow us to identify the evolutionary lineages most suited for particular stages of succession and habitat...... rehabilitation. However, to date, these two applications have been largely separate. Here, we suggest that information on phylogenetic community structure might help to inform community restoration strategies following major disturbance. Our study examined phylogenetic patterns of succession based...... for species sorting along abiotic gradients (slope and aspect) on the mine sites that had been abandoned for the longest. Synthesis and applications. Understanding the trajectory of succession is critical for restoration efforts. Our results suggest that early colonizers represent a phylogenetically random...

  9. First phylogenetic analysis of Ehrlichia canis in dogs and ticks from Mexico. Preliminary study

    Directory of Open Access Journals (Sweden)

    Carolina G. Sosa-Gutiérrez

    2016-09-01

    Full Text Available Objective. Phylogenetic characterization of Ehrlichia canis in dogs naturally infected and ticks, diagnosed by PCR and sequencing of 16SrRNA gene; compare different isolates found in American countries. Materials and methods. Were collected Blood samples from 139 dogs with suggestive clinical manifestations of this disease and they were infested with ticks; part of 16SrRNA gene was sequenced and aligned, with 17 sequences reported in American countries. Two phylogenetic trees were constructed using the Maximum likelihood method, and Maximum parsimony. Results. They were positive to E. canis 25/139 (18.0% dogs and 29/139 (20.9% ticks. The clinical manifestations presented were fever, fatigue, depression and vomiting. Rhipicephalus sanguineus Dermacentor variabilis and Haemaphysalis leporis-palustris ticks were positive for E. canis. Phylogenetic analysis showed that the sequences of dogs and ticks in Mexico form a third group diverging of sequences from South America and USA. Conclusions. This is the first phylogenetic analysis of E. canis in Mexico. There are differences in the sequences of Mexico with those reported in South America and USA. This research lays the foundation for further study of genetic variability.

  10. Phylogenetic incongruence in E. coli O104: understanding the evolutionary relationships of emerging pathogens in the face of homologous recombination.

    Directory of Open Access Journals (Sweden)

    Weilong Hao

    Full Text Available Escherichia coli O104:H4 was identified as an emerging pathogen during the spring and summer of 2011 and was responsible for a widespread outbreak that resulted in the deaths of 50 people and sickened over 4075. Traditional phenotypic and genotypic assays, such as serotyping, pulsed field gel electrophoresis (PFGE, and multilocus sequence typing (MLST, permit identification and classification of bacterial pathogens, but cannot accurately resolve relationships among genotypically similar but pathotypically different isolates. To understand the evolutionary origins of E. coli O104:H4, we sequenced two strains isolated in Ontario, Canada. One was epidemiologically linked to the 2011 outbreak, and the second, unrelated isolate, was obtained in 2010. MLST analysis indicated that both isolates are of the same sequence type (ST678, but whole-genome sequencing revealed differences in chromosomal and plasmid content. Through comprehensive phylogenetic analysis of five O104:H4 ST678 genomes, we identified 167 genes in three gene clusters that have undergone homologous recombination with distantly related E. coli strains. These recombination events have resulted in unexpectedly high sequence diversity within the same sequence type. Failure to recognize or adjust for homologous recombination can result in phylogenetic incongruence. Understanding the extent of homologous recombination among different strains of the same sequence type may explain the pathotypic differences between the ON2010 and ON2011 strains and help shed new light on the emergence of this new pathogen.

  11. Universal artifacts affect the branching of phylogenetic trees, not universal scaling laws.

    Science.gov (United States)

    Altaba, Cristian R

    2009-01-01

    The superficial resemblance of phylogenetic trees to other branching structures allows searching for macroevolutionary patterns. However, such trees are just statistical inferences of particular historical events. Recent meta-analyses report finding regularities in the branching pattern of phylogenetic trees. But is this supported by evidence, or are such regularities just methodological artifacts? If so, is there any signal in a phylogeny? In order to evaluate the impact of polytomies and imbalance on tree shape, the distribution of all binary and polytomic trees of up to 7 taxa was assessed in tree-shape space. The relationship between the proportion of outgroups and the amount of imbalance introduced with them was assessed applying four different tree-building methods to 100 combinations from a set of 10 ingroup and 9 outgroup species, and performing covariance analyses. The relevance of this analysis was explored taking 61 published phylogenies, based on nucleic acid sequences and involving various taxa, taxonomic levels, and tree-building methods. All methods of phylogenetic inference are quite sensitive to the artifacts introduced by outgroups. However, published phylogenies appear to be subject to a rather effective, albeit rather intuitive control against such artifacts. The data and methods used to build phylogenetic trees are varied, so any meta-analysis is subject to pitfalls due to their uneven intrinsic merits, which translate into artifacts in tree shape. The binary branching pattern is an imposition of methods, and seldom reflects true relationships in intraspecific analyses, yielding artifactual polytomies in short trees. Above the species level, the departure of real trees from simplistic random models is caused at least by two natural factors--uneven speciation and extinction rates; and artifacts such as choice of taxa included in the analysis, and imbalance introduced by outgroups and basal paraphyletic taxa. This artifactual imbalance accounts

  12. Molecular Phylogenetics: Mathematical Framework and Unsolved Problems

    Science.gov (United States)

    Xia, Xuhua

    Phylogenetic relationship is essential in dating evolutionary events, reconstructing ancestral genes, predicting sites that are important to natural selection, and, ultimately, understanding genomic evolution. Three categories of phylogenetic methods are currently used: the distance-based, the maximum parsimony, and the maximum likelihood method. Here, I present the mathematical framework of these methods and their rationales, provide computational details for each of them, illustrate analytically and numerically the potential biases inherent in these methods, and outline computational challenges and unresolved problems. This is followed by a brief discussion of the Bayesian approach that has been recently used in molecular phylogenetics.

  13. Revised phylogenetic analysis of the Aetosauria (Archosauria: Pseudosuchia; assessing the effects of incongruent morphological character sets

    Directory of Open Access Journals (Sweden)

    William G. Parker

    2016-01-01

    Full Text Available Aetosauria is an early-diverging clade of pseudosuchians (crocodile-line archosaurs that had a global distribution and high species diversity as a key component of various Late Triassic terrestrial faunas. It is one of only two Late Triassic clades of large herbivorous archosaurs, and thus served a critical ecological role. Nonetheless, aetosaur phylogenetic relationships are still poorly understood, owing to an overreliance on osteoderm characters, which are often poorly constructed and suspected to be highly homoplastic. A new phylogenetic analysis of the Aetosauria, comprising 27 taxa and 83 characters, includes more than 40 new characters that focus on better sampling the cranial and endoskeletal regions, and represents the most comprenhensive phylogeny of the clade to date. Parsimony analysis recovered three most parsimonious trees; the strict consensus of these trees finds an Aetosauria that is divided into two main clades: Desmatosuchia, which includes the Desmatosuchinae and the Stagonolepidinae, and Aetosaurinae, which includes the Typothoracinae. As defined Desmatosuchinae now contains Neoaetosauroides engaeus and several taxa that were previously referred to the genus Stagonolepis, and a new clade, Desmatosuchini, is erected for taxa more closely related to Desmatosuchus. Overall support for some clades is still weak, and Partitioned Bremer Support (PBS is applied for the first time to a strictly morphological dataset demonstrating that this weak support is in part because of conflict in the phylogenetic signals of cranial versus postcranial characters. PBS helps identify homoplasy among characters from various body regions, presumably the result of convergent evolution within discrete anatomical modules. It is likely that at least some of this character conflict results from different body regions evolving at different rates, which may have been under different selective pressures.

  14. Molecular Phylogenetic Screening of Withania somnifera Relative From Indonesia Based on Internal Transcribed Spacer Region

    Directory of Open Access Journals (Sweden)

    Topik Hidayat

    2016-04-01

    Full Text Available Withania somnifera (family Solanaceae, known commonly as Ashwaganda, is one of the important medicinal plants, and recent studies reported that Withanone, one of the chemical components in this plant, has ability to kill cancer cell. Because of endemic state of this plant to South Asia, exploring plant species under the same family which grow well in Indonesia has been of interest. The purpose of this study was to screen the Indonesian plant which has strong phylogenetic relationship with Ashwaganda. Thus, phylogenetic analysis using DNA sequences of internal transcribed spacer (ITS region was conducted. Thus, 19 species of Solanaceae and two species of Convolvulaceae as outgroup were examined. Five ITS regions of Ashwaganda retrieved from GenBank were included in the phylogenetic analysis. Parsimony analysis showed that Indonesia Solanaceae comprises seven groups which is consistent with the global Solanaceae relationship as previously reported. Furthermore, our study revealed that two species, Physalis angulata and Physalis peruviana, are relative to W. somnifera. Morphologically, they share characters of flower and fruit. This result indicated that these two species are potential to have similar chemical properties as Ashwaganda, thus we can have new variants of Withanone originated from Indonesia with similar effect.

  15. Phylogenetic relationships of Malayan gaur with other species of the genus Bos based on cytochrome b gene DNA sequences.

    Science.gov (United States)

    Rosli, M K A; Zakaria, S S; Syed-Shabthar, S M F; Zainal, Z Z; Shukor, M N; Mahani, M C; Abas-Mazni, O; Md-Zain, B M

    2011-03-22

    The Malayan gaur (Bos gaurus hubbacki) is one of the three subspecies of gaurs that can be found in Malaysia. We examined the phylogenetic relationships of this subspecies with other species of the genus Bos (B. javanicus, B. indicus, B. taurus, and B. grunniens). The sequence of a key gene, cytochrome b, was compared among 20 Bos species and the bongo antelope, used as an outgroup. Phylogenetic reconstruction was employed using neighbor joining and maximum parsimony in PAUP and Bayesian inference in MrBayes 3.1. All tree topologies indicated that the Malayan gaur is in its own monophyletic clade, distinct from other species of the genus Bos. We also found significant branching differences in the tree topologies between wild and domestic cattle.

  16. Bias in phylogenetic reconstruction of vertebrate rhodopsin sequences.

    Science.gov (United States)

    Chang, B S; Campbell, D L

    2000-08-01

    Two spurious nodes were found in phylogenetic analyses of vertebrate rhodopsin sequences in comparison with well-established vertebrate relationships. These spurious reconstructions were well supported in bootstrap analyses and occurred independently of the method of phylogenetic analysis used (parsimony, distance, or likelihood). Use of this data set of vertebrate rhodopsin sequences allowed us to exploit established vertebrate relationships, as well as the considerable amount known about the molecular evolution of this gene, in order to identify important factors contributing to the spurious reconstructions. Simulation studies using parametric bootstrapping indicate that it is unlikely that the spurious nodes in the parsimony analyses are due to long branches or other topological effects. Rather, they appear to be due to base compositional bias at third positions, codon bias, and convergent evolution at nucleotide positions encoding the hydrophobic residues isoleucine, leucine, and valine. LogDet distance methods, as well as maximum-likelihood methods which allow for nonstationary changes in base composition, reduce but do not entirely eliminate support for the spurious resolutions. Inclusion of five additional rhodopsin sequences in the phylogenetic analyses largely corrected one of the spurious reconstructions while leaving the other unaffected. The additional sequences not only were more proximal to the corrected node, but were also found to have intermediate levels of base composition and codon bias as compared with neighboring sequences on the tree. This study shows that the spurious reconstructions can be corrected either by excluding third positions, as well as those encoding the amino acids Ile, Val, and Leu (which may not be ideal, as these sites can contain useful phylogenetic signal for other parts of the tree), or by the addition of sequences that reduce problems associated with convergent evolution.

  17. Phylogenetic Paleoecology: Tree-Thinking and Ecology in Deep Time.

    Science.gov (United States)

    Lamsdell, James C; Congreve, Curtis R; Hopkins, Melanie J; Krug, Andrew Z; Patzkowsky, Mark E

    2017-06-01

    The new and emerging field of phylogenetic paleoecology leverages the evolutionary relationships among species to explain temporal and spatial changes in species diversity, abundance, and distribution in deep time. This field is poised for rapid progress as knowledge of the evolutionary relationships among fossil species continues to expand. In particular, this approach will lend new insights to many of the longstanding questions in evolutionary biology, such as: the relationships among character change, ecology, and evolutionary rates; the processes that determine the evolutionary relationships among species within communities and along environmental gradients; and the phylogenetic signal underlying ecological selectivity in background and mass extinctions and in major evolutionary radiations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Phylogenetic analysis of canine distemper virus in domestic dogs in Nanjing, China.

    Science.gov (United States)

    Bi, Zhenwei; Wang, Yongshan; Wang, Xiaoli; Xia, Xingxia

    2015-02-01

    Canine distemper virus (CDV) infects a broad range of carnivores, including wild and domestic Canidae. The hemagglutinin gene, which encodes the attachment protein that determines viral tropism, has been widely used to determine the relationship between CDV strains of different lineages circulating worldwide. We determined the full-length H gene sequences of seven CDV field strains detected in domestic dogs in Nanjing, China. A phylogenetic analysis of the H gene sequences of CDV strains from different geographic regions and vaccine strains was performed. Four of the seven CDV strains were grouped in the same cluster of the Asia-1 lineage to which the vast majority of Chinese CDV strains belong, whereas the other three were clustered within the Asia-4 lineage, which has never been detected in China. This represents the first record of detection of strains of the Asia-4 lineage in China since this lineage was reported in Thailand in 2013.

  19. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Science.gov (United States)

    Hsueh, Yi-Huang; Huang, Kai-Yao; Kunene, Sikhumbuzo Charles; Lee, Tzong-Yi

    2017-01-01

    Poly-γ-glutamic acid (γ-PGA) is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production. PMID:29215550

  20. Phylogenetic relationship among East Asian species of the Stegana genus group (Diptera, Drosophilidae).

    Science.gov (United States)

    Li, Tong; Gao, Jian-jun; Lu, Jin-ming; Ji, Xing-lai; Chen, Hong-wei

    2013-01-01

    The phylogenetic relationship among 27 East Asian species of the Stegana genus group was reconstructed using DNA sequences of mitochondrial (COI and ND2) and nuclear (28S) genes. The results lent support to the current generic/subgeneric taxonomic classification in the genus group with the exceptions of the paraphyly of the genus Parastegana and the subgenus Oxyphortica in the genus Stegana. The ancestral areas and divergence times in the genus group were reconstructed/estimated, and accordingly, the biogeographical history of this important clade was discussed. It was proposed that, the evolution of the plant family Fagaceae, especially Quercus, may have played a certain role in facilitating the diversification of the Stegana genus group. Copyright © 2012 Elsevier Inc. All rights reserved.

  1. Poly-γ-glutamic Acid Synthesis, Gene Regulation, Phylogenetic Relationships, and Role in Fermentation

    Directory of Open Access Journals (Sweden)

    Yi-Huang Hsueh

    2017-12-01

    Full Text Available Poly-γ-glutamic acid (γ-PGA is a biodegradable biopolymer produced by several bacteria, including Bacillus subtilis and other Bacillus species; it has good biocompatibility, is non-toxic, and has various potential biological applications in the food, pharmaceutical, cosmetic, and other industries. In this review, we have described the mechanisms of γ-PGA synthesis and gene regulation, its role in fermentation, and the phylogenetic relationships among various pgsBCAE, a biosynthesis gene cluster of γ-PGA, and pgdS, a degradation gene of γ-PGA. We also discuss potential applications of γ-PGA and highlight the established genetic recombinant bacterial strains that produce high levels of γ-PGA, which can be useful for large-scale γ-PGA production.

  2. Morphometric relationship, phylogenetic correlation, and character evolution in the species-rich genus Aphis (Hemiptera: Aphididae.

    Directory of Open Access Journals (Sweden)

    Hyojoong Kim

    2010-07-01

    Full Text Available The species-rich genus Aphis consists of more than 500 species, many of them host-specific on a wide range of plants, yet very similar in general appearance due to convergence toward particular morphological types. Most species have been historically clustered into four main phenotypic groups (gossypii, craccivora, fabae, and spiraecola groups. To confirm the morphological hypotheses between these groups and to examine the characteristics that determine them, multivariate morphometric analyses were performed using 28 characters measured/counted from 40 species. To infer whether the morphological relationships are correlated with the genetic relationships, we compared the morphometric dataset with a phylogeny reconstructed from the combined dataset of three mtDNA and one nuclear DNA regions.Based on a comparison of morphological and molecular datasets, we confirmed morphological reduction or regression in the gossypii group unlike in related groups. Most morphological characteristics of the gossypii group were less variable than for the other groups. Due to these, the gossypii group could be morphologically well separated from the craccivora, fabae, and spiraecola groups. In addition, the correlation of the rates of evolution between morphological and DNA datasets was highly significant in their diversification.The morphological separation between the gossypii group and the other species-groups are congruent with their phylogenetic relationships. Analysis of trait evolution revealed that the morphological traits found to be significant based on the morphometric analyses were confidently correlated with the phylogeny. The dominant patterns of trait evolution resulting in increased rates of short branches and temporally later evolution are likely suitable for the modality of Aphis speciation because they have adapted species-specifically, rapidly, and more recently on many different host plants.

  3. Phylogenetic relationship of Hepatozoon blood parasites found in snakes from Africa, America and Asia.

    Science.gov (United States)

    Haklová, B; Majláthová, V; Majláth, I; Harris, D J; Petrilla, V; Litschka-Koen, T; Oros, M; Peťko, B

    2014-03-01

    The blood parasites from the genus Hepatozoon Miller, 1908 (Apicomplexa: Adeleida: Hepatozoidae) represent the most common intracellular protozoan parasites found in snakes. In the present study, we examined 209 individuals of snakes, from different zoogeographical regions (Africa, America, Asia and Europe), for the occurrence of blood parasites using both molecular and microscopic examination methods, and assess phylogenetic relationships of all Hepatozoon parasites from snakes for the first time. In total, 178 blood smears obtained from 209 individuals, representing 40 species, were examined, from which Hepatozoon unicellular parasites were found in 26 samples (14·6% prevalence). Out of 180 samples tested by molecular method polymerase chain reaction (PCR), the presence of parasites was observed in 21 individuals (prevalence 11·6%): 14 snakes from Africa belonging to six genera (Dendroaspis, Dispholidus, Mehelya, Naja, Philothamnus and Python), five snakes from Asia from the genus Morelia and two snakes from America, from two genera (Coluber and Corallus). The intensity of infection varied from one to 1433 infected cells per 10 000 erythrocytes. Results of phylogenetic analyses (Bayesian and Maximum Likelihood) revealed the existence of five haplotypes divided into four main lineages. The present data also indicate neither geographical pattern of studied Hepatozoon sp., nor congruency in the host association.

  4. Exploring the relationship between sequence similarity and accurate phylogenetic trees.

    Science.gov (United States)

    Cantarel, Brandi L; Morrison, Hilary G; Pearson, William

    2006-11-01

    We have characterized the relationship between accurate phylogenetic reconstruction and sequence similarity, testing whether high levels of sequence similarity can consistently produce accurate evolutionary trees. We generated protein families with known phylogenies using a modified version of the PAML/EVOLVER program that produces insertions and deletions as well as substitutions. Protein families were evolved over a range of 100-400 point accepted mutations; at these distances 63% of the families shared significant sequence similarity. Protein families were evolved using balanced and unbalanced trees, with ancient or recent radiations. In families sharing statistically significant similarity, about 60% of multiple sequence alignments were 95% identical to true alignments. To compare recovered topologies with true topologies, we used a score that reflects the fraction of clades that were correctly clustered. As expected, the accuracy of the phylogenies was greatest in the least divergent families. About 88% of phylogenies clustered over 80% of clades in families that shared significant sequence similarity, using Bayesian, parsimony, distance, and maximum likelihood methods. However, for protein families with short ancient branches (ancient radiation), only 30% of the most divergent (but statistically significant) families produced accurate phylogenies, and only about 70% of the second most highly conserved families, with median expectation values better than 10(-60), produced accurate trees. These values represent upper bounds on expected tree accuracy for sequences with a simple divergence history; proteins from 700 Giardia families, with a similar range of sequence similarities but considerably more gaps, produced much less accurate trees. For our simulated insertions and deletions, correct multiple sequence alignments did not perform much better than those produced by T-COFFEE, and including sequences with expressed sequence tag-like sequencing errors did not

  5. A phylogenetic transform enhances analysis of compositional microbiota data.

    Science.gov (United States)

    Silverman, Justin D; Washburne, Alex D; Mukherjee, Sayan; David, Lawrence A

    2017-02-15

    Surveys of microbial communities (microbiota), typically measured as relative abundance of species, have illustrated the importance of these communities in human health and disease. Yet, statistical artifacts commonly plague the analysis of relative abundance data. Here, we introduce the PhILR transform, which incorporates microbial evolutionary models with the isometric log-ratio transform to allow off-the-shelf statistical tools to be safely applied to microbiota surveys. We demonstrate that analyses of community-level structure can be applied to PhILR transformed data with performance on benchmarks rivaling or surpassing standard tools. Additionally, by decomposing distance in the PhILR transformed space, we identified neighboring clades that may have adapted to distinct human body sites. Decomposing variance revealed that covariation of bacterial clades within human body sites increases with phylogenetic relatedness. Together, these findings illustrate how the PhILR transform combines statistical and phylogenetic models to overcome compositional data challenges and enable evolutionary insights relevant to microbial communities.

  6. Inferring 'weak spots' in phylogenetic trees: application to mosasauroid nomenclature.

    Science.gov (United States)

    Madzia, Daniel; Cau, Andrea

    2017-01-01

    Mosasauroid squamates represented the apex predators within the Late Cretaceous marine and occasionally also freshwater ecosystems. Proper understanding of the origin of their ecological adaptations or paleobiogeographic dispersals requires adequate knowledge of their phylogeny. The studies assessing the position of mosasauroids on the squamate evolutionary tree and their origins have long given conflicting results. The phylogenetic relationships within Mosasauroidea, however, have experienced only little changes throughout the last decades. Considering the substantial improvements in the development of phylogenetic methodology that have undergone in recent years, resulting, among others, in numerous alterations in the phylogenetic hypotheses of other fossil amniotes, we test the robustness in our understanding of mosasauroid beginnings and their evolutionary history. We re-examined a data set that results from modifications assembled in the course of the last 20 years and performed multiple parsimony analyses and Bayesian tip-dating analysis. Following the inferred topologies and the 'weak spots' in the phylogeny of mosasauroids, we revise the nomenclature of the 'traditionally' recognized mosasauroid clades, to acknowledge the overall weakness among branches and the alternative topologies suggested previously, and discuss several factors that might have an impact on the differing phylogenetic hypotheses and their statistical support.

  7. Phylogenetic relationships of the Orang Asli and Iban of Malaysia based on maternal markers.

    Science.gov (United States)

    Ang, K C; Leow, J W H; Yeap, W K; Hood, S; Mahani, M C; Md-Zain, B M

    2011-04-12

    Malaysia remains as a crossroad of different cultures and peoples, and it has long been recognized that studying its population history can provide crucial insight into the prehistory of Southeast Asia as a whole. The earliest inhabitants were the Orang Asli in Peninsular Malaysia and the indigenous groups in Sabah and Sarawak. Although they were the earliest migrants in this region, these tribes are divided geographically by the South China Sea. We analyzed DNA sequences of 18 Orang Asli using mitochondrial DNA extracted from blood samples, each representing one sub-tribe, and from five Sarawakian Iban. Mitochondrial DNA was extracted from hair samples in order to examine relationships with the main ethnic groups in Malaysia. The D-loop region and cytochrome b genes were used as the candidate loci. Phylogenetic relationships were investigated using maximum parsimony and neighbor joining algorithms, and each tree was subjected to bootstrap analysis with 1000 replicates. Analyses of the HVS I region showed that the Iban are not a distinct group from the Orang Asli; they form a sub-clade within the Orang Asli. Based on the cytochrome b gene, the Iban clustered with the Orang Asli in the same clade. We found evidence for considerable gene flow between Orang Asli and Iban. We concluded that the Orang Asli, Iban and the main ethnic groups of Malaysia are probably derived from a common ancestor. This is in agreement with a single-route migration theory, but it does not dismiss a two-route migration theory.

  8. Evolution of the brain and phylogenetic development of Mrican ...

    African Journals Online (AJOL)

    Evolution of the brain and phylogenetic development of Mrican Bovidae. Henriette Oboussier. Zoological Institute and Museum, University of Hamburg. Evidence drawn from the study of 270 brains of 54 species and subspecies of African Bovidae makes it possible to base phylogenetic relationships on the similarities in the ...

  9. Unveiling the Identity of Wenwan Walnuts and Phylogenetic Relationships of Asian Juglans Species Using Restriction Site-Associated DNA-Sequencing

    Directory of Open Access Journals (Sweden)

    Xian-Yun Mu

    2017-10-01

    Full Text Available Juglans species have considerable ecological and economic value worldwide. In China, Wenwan walnuts have been collected by aristocrats and noblemen for more than 2000 years. As a diversity center of Asian Juglans, five species are widely distributed in China. The most famous of these is Mahetao (J. hopeiensis, which is an uncharacterized species that is mostly cultivated. Wild J. hopeiensis individuals are very rare and are endemic to Hebei Province. Because of the minimal variations in previously used molecular markers and the heterogeneity between chloroplast and nuclear genomes, determining the phylogenetic relationships among the Juglans species has been challenging, and has hindered subsequent evolutionary inferences. In this study, we collected enough materials for both cultivated and wild Mahetao to construct well-resolved phylogenetic trees for Asian Juglans species. We used a high-throughput genome-wide restriction site-associated DNA sequencing method. Consequently, the identity of J. hopeiensis has been clearly resolved. Our results indicate that J. hopeiensis is a hybrid of J. regia and J. mandshurica. However, J. hopeiensis, J. regia and J. sigillata should be considered as a single species from section Juglans. Additionally, J. ailantifolia, J. cathayensis, and J. mandshurica likely represent one species from section Cardiocaryon according to morphological and molecular studies. These results are supported by population structure analysis and morphological comparison. We propose that J. hopeiensis trees growing in the wild should be conserved because of the economic value of their nuts. These trees may be of particular importance to impoverished communities. Furthermore, they may serve as a valuable genetic resource relevant for enhancing the production of edible walnuts. The 2b-RAD method is a viable option for future phylogenetic studies of Juglans species as well as other plant species.

  10. Phylogenetic relationships in Solanaceae and related species based on cpDNA sequence from plastid trnE-trnT region

    Directory of Open Access Journals (Sweden)

    Danila Montewka Melotto-Passarin

    2008-01-01

    Full Text Available Intergenic spacers of chloroplast DNA (cpDNA are very useful in phylogenetic and population genetic studiesof plant species, to study their potential integration in phylogenetic analysis. The non-coding trnE-trnT intergenic spacer ofcpDNA was analyzed to assess the nucleotide sequence polymorphism of 16 Solanaceae species and to estimate its ability tocontribute to the resolution of phylogenetic studies of this group. Multiple alignments of DNA sequences of trnE-trnT intergenicspacer made the identification of nucleotide variability in this region possible and the phylogeny was estimated by maximumparsimony and rooted with Convolvulaceae Ipomoea batatas, the most closely related family. Besides, this intergenic spacerwas tested for the phylogenetic ability to differentiate taxonomic levels. For this purpose, species from four other families wereanalyzed and compared with Solanaceae species. Results confirmed polymorphism in the trnE-trnT region at different taxonomiclevels.

  11. Conus pennaceus : a phylogenetic analysis of the Mozambican ...

    African Journals Online (AJOL)

    The genus Conus has over 500 species and is the most species-rich taxon of marine invertebrates. Based on mitochondrial DNA, this study focuses on the phylogenetics of Conus, particularly the pennaceus complex collected along the Mozambican coast. Phylogenetic trees based on both the 16S and the 12S ribosomal ...

  12. Phylogenetic Analysis of Dengue Virus in Bangkalan, Madura Island, East Java Province, Indonesia.

    Science.gov (United States)

    Sucipto, Teguh Hari; Kotaki, Tomohiro; Mulyatno, Kris Cahyo; Churrotin, Siti; Labiqah, Amaliah; Soegijanto, Soegeng; Kameoka, Masanori

    2018-01-01

    Dengue virus (DENV) infection is a major health issue in tropical and subtropical areas. Indonesia is one of the biggest dengue endemic countries in the world. In the present study, the phylogenetic analysis of DENV in Bangkalan, Madura Island, Indonesia, was performed in order to obtain a clearer understanding of its dynamics in this country. A total of 359 blood samples from dengue-suspected patients were collected between 2012 and 2014. Serotyping was conducted using a multiplex Reverse Transcriptase-Polymerase Chain Reaction and a phylogenetic analysis of E gene sequences was performed using the Bayesian Markov chain Monte Carlo (MCMC) method. 17 out of 359 blood samples (4.7%) were positive for the isolation of DENV. Serotyping and the phylogenetic analysis revealed the predominance of DENV-1 genotype I (9/17, 52.9%), followed by DENV-2 Cosmopolitan type (7/17, 41.2%) and DENV-3 genotype I (1/17, 5.9%) . DENV-4 was not isolated. The Madura Island isolates showed high nucleotide similarity to other Indonesian isolates, indicating frequent virus circulation in Indonesia. The results of the present study highlight the importance of continuous viral surveillance in dengue endemic areas in order to obtain a clearer understanding of the dynamics of DENV in Indonesia.

  13. A Universal Phylogenetic Tree.

    Science.gov (United States)

    Offner, Susan

    2001-01-01

    Presents a universal phylogenetic tree suitable for use in high school and college-level biology classrooms. Illustrates the antiquity of life and that all life is related, even if it dates back 3.5 billion years. Reflects important evolutionary relationships and provides an exciting way to learn about the history of life. (SAH)

  14. Phylogenetic reconstruction of endophytic fungal isolates using internal transcribed spacer 2 (ITS2) region.

    Science.gov (United States)

    GokulRaj, Kathamuthu; Sundaresan, Natesan; Ganeshan, Enthai Jagan; Rajapriya, Pandi; Muthumary, Johnpaul; Sridhar, Jayavel; Pandi, Mohan

    2014-01-01

    Endophytic fungi are inhabitants of plants, living most part of their lifecycle asymptomatically which mainly confer protection and ecological advantages to the host plant. In this present study, 48 endophytic fungi were isolated from the leaves of three medicinal plants and characterized based on ITS2 sequence - secondary structure analysis. ITS2 secondary structures were elucidated with minimum free energy method (MFOLD version 3.1) and consensus structure of each genus was generated by 4SALE. ProfDistS was used to generate ITS2 sequence structure based phylogenetic tree respectively. Our elucidated isolates were belonging to Ascomycetes family, representing 5 orders and 6 genera. Colletotrichum/Glomerella spp., Diaporthae/Phomopsis spp., and Alternaria spp., were predominantly observed while Cochliobolus sp., Cladosporium sp., and Emericella sp., were represented by singletons. The constructed phylogenetic tree has well resolved monophyletic groups with >50% bootstrap value support. Secondary structures based fungal systematics improves not only the stability; it also increases the precision of phylogenetic inference. Above ITS2 based phylogenetic analysis was performed for our 48 isolates along with sequences of known ex-types taken from GenBank which confirms the efficiency of the proposed method. Further, we propose it as superlative marker for reconstructing phylogenetic relationships at different taxonomic levels due to their lesser length.

  15. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    Science.gov (United States)

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

  16. Phylogenetic relationships of the cultivated neotropical palm Bactris gasipaes (arecaceae) with its wild relatives inferred from chloroplast and nuclear DNA polymorphisms

    NARCIS (Netherlands)

    Couvreur, T.L.P.; Hahn, K.; Granville, de J.J.; Pham, J.L.; Ludena, B.; Pintaud, J.C.

    2007-01-01

    Peach palm (Bactris gasipaes Kunth.) is the only Neotropical palm domesticated since pre-Columbian times. It plays an important role not only at the local level due to its very nutritious fruits, but also in the international market for its gourmet palm heart. Phylogenetic relationships of the peach

  17. Whole genome sequence phylogenetic analysis of four Mexican rabies viruses isolated from cattle.

    Science.gov (United States)

    Bárcenas-Reyes, I; Loza-Rubio, E; Cantó-Alarcón, G J; Luna-Cozar, J; Enríquez-Vázquez, A; Barrón-Rodríguez, R J; Milián-Suazo, F

    2017-08-01

    Phylogenetic analysis of the rabies virus in molecular epidemiology has been traditionally performed on partial sequences of the genome, such as the N, G, and P genes; however, that approach raises concerns about the discriminatory power compared to whole genome sequencing. In this study we characterized four strains of the rabies virus isolated from cattle in Querétaro, Mexico by comparing the whole genome sequence to that of strains from the American, European and Asian continents. Four cattle brain samples positive to rabies and characterized as AgV11, genotype 1, were used in the study. A cDNA sequence was generated by reverse transcription PCR (RT-PCR) using oligo dT. cDNA samples were sequenced in an Illumina NextSeq 500 platform. The phylogenetic analysis was performed with MEGA 6.0. Minimum evolution phylogenetic trees were constructed with the Neighbor-Joining method and bootstrapped with 1000 replicates. Three large and seven small clusters were formed with the 26 sequences used. The largest cluster grouped strains from different species in South America: Brazil, and the French Guyana. The second cluster grouped five strains from Mexico. A Mexican strain reported in a different study was highly related to our four strains, suggesting common source of infection. The phylogenetic analysis shows that the type of host is different for the different regions in the American Continent; rabies is more related to bats. It was concluded that the rabies virus in central Mexico is genetically stable and that it is transmitted by the vampire bat Desmodus rotundus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Ultrafast Approximation for Phylogenetic Bootstrap

    NARCIS (Netherlands)

    Bui Quang Minh, [No Value; Nguyen, Thi; von Haeseler, Arndt

    Nonparametric bootstrap has been a widely used tool in phylogenetic analysis to assess the clade support of phylogenetic trees. However, with the rapidly growing amount of data, this task remains a computational bottleneck. Recently, approximation methods such as the RAxML rapid bootstrap (RBS) and

  19. Phylogenetic tree based on complete genomes using fractal and correlation analyses without sequence alignment

    Directory of Open Access Journals (Sweden)

    Zu-Guo Yu

    2006-06-01

    Full Text Available The complete genomes of living organisms have provided much information on their phylogenetic relationships. Similarly, the complete genomes of chloroplasts have helped resolve the evolution of this organelle in photosynthetic eukaryotes. In this review, we describe two algorithms to construct phylogenetic trees based on the theories of fractals and dynamic language using complete genomes. These algorithms were developed by our research group in the past few years. Our distance-based phylogenetic tree of 109 prokaryotes and eukaryotes agrees with the biologists' "tree of life" based on the 16S-like rRNA genes in a majority of basic branchings and most lower taxa. Our phylogenetic analysis also shows that the chloroplast genomes are separated into two major clades corresponding to chlorophytes s.l. and rhodophytes s.l. The interrelationships among the chloroplasts are largely in agreement with the current understanding on chloroplast evolution.

  20. Trophic phylogenetics: evolutionary influences on body size, feeding, and species associations in grassland arthropods.

    Science.gov (United States)

    Lind, Eric M; Vincent, John B; Weiblen, George D; Cavender-Bares, Jeannine; Borer, Elizabeth T

    2015-04-01

    Contemporary animal-plant interactions such as herbivory are widely understood to be shaped by evolutionary history. Yet questions remain about the role of plant phylogenetic diversity in generating and maintaining herbivore diversity, and whether evolutionary relatedness of producers might predict the composition of consumer communities. We tested for evidence of evolutionary associations among arthropods and the plants on which they were found, using phylogenetic analysis of naturally occurring arthropod assemblages sampled from a plant-diversity manipulation experiment. Considering phylogenetic relationships among more than 900 arthropod consumer taxa and 29 plant species in the experiment, we addressed several interrelated questions. First, our results support the hypothesis that arthropod functional traits such as body size and trophic role are phylogenetically conserved in community ecological samples. Second, herbivores tended to cooccur with closer phylogenetic relatives than would be expected at random, whereas predators and parasitoids did not show phylogenetic association patterns. Consumer specialization, as measured by association through time with monocultures of particular host plant species, showed significant phylogenetic signal, although the. strength of this association varied among plant species. Polycultures of phylogenetically dissimilar plant species supported more phylogenetically dissimilar consumer communities than did phylogenetically similar polycultures. Finally, we separated the effects of plant species richness and relatedness in predicting the phylogenetic distribution of the arthropod assemblages in this experiment. The phylogenetic diversity of plant communities predicted the phylogenetic diversity of herbivore communities even after accounting for plant species richness. The phylogenetic diversity of secondary consumers differed by guild, with predator phylogenetic diversity responding to herbivore relatedness, while parasitoid

  1. Arthropod phylogenetics in light of three novel millipede (myriapoda: diplopoda mitochondrial genomes with comments on the appropriateness of mitochondrial genome sequence data for inferring deep level relationships.

    Directory of Open Access Journals (Sweden)

    Michael S Brewer

    Full Text Available BACKGROUND: Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. RESULTS: The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly. As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. CONCLUSIONS: The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic

  2. Arthropod phylogenetics in light of three novel millipede (myriapoda: diplopoda) mitochondrial genomes with comments on the appropriateness of mitochondrial genome sequence data for inferring deep level relationships.

    Science.gov (United States)

    Brewer, Michael S; Swafford, Lynn; Spruill, Chad L; Bond, Jason E

    2013-01-01

    Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly). As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic signal renders the resulting tree topologies as suspect

  3. The Nothoaspis amazoniensis Complete Mitogenome: A Comparative and Phylogenetic Analysis

    Directory of Open Access Journals (Sweden)

    Paulo H. C. Lima

    2018-03-01

    Full Text Available The molecular biology era, together with morphology, molecular phylogenetics, bioinformatics, and high-throughput sequencing technologies, improved the taxonomic identification of Argasidae family members, especially when considering specimens at different development stages, which remains a great difficulty for acarologists. These tools could provide important data and insights on the history and evolutionary relationships of argasids. To better understand these relationships, we sequenced and assembled the first complete mitochondrial genome of Nothoaspis amazoniensis. We used phylogenomics to identify the evolutionary history of this species of tick, comparing the data obtained with 26 complete mitochondrial sequences available in biological databases. The results demonstrated the absence of genetic rearrangements, high similarity and identity, and a close organizational link between the mitogenomes of N. amazoniensis and other argasids analyzed. In addition, the mitogenome had a monophyletic cladistic taxonomic arrangement, encompassed by representatives of the Afrotropical and Neotropical regions, with specific parasitism in bats, which may be indicative of an evolutionary process of cospeciation between vectors and the host.

  4. Phylogenetic trees in bioinformatics

    Energy Technology Data Exchange (ETDEWEB)

    Burr, Tom L [Los Alamos National Laboratory

    2008-01-01

    Genetic data is often used to infer evolutionary relationships among a collection of viruses, bacteria, animal or plant species, or other operational taxonomic units (OTU). A phylogenetic tree depicts such relationships and provides a visual representation of the estimated branching order of the OTUs. Tree estimation is unique for several reasons, including: the types of data used to represent each OTU; the use ofprobabilistic nucleotide substitution models; the inference goals involving both tree topology and branch length, and the huge number of possible trees for a given sample of a very modest number of OTUs, which implies that fmding the best tree(s) to describe the genetic data for each OTU is computationally demanding. Bioinformatics is too large a field to review here. We focus on that aspect of bioinformatics that includes study of similarities in genetic data from multiple OTUs. Although research questions are diverse, a common underlying challenge is to estimate the evolutionary history of the OTUs. Therefore, this paper reviews the role of phylogenetic tree estimation in bioinformatics, available methods and software, and identifies areas for additional research and development.

  5. Phylogenetic relationships of Scomberomorus commerson using sequence analysis of the mtDNA D-loop region in the Persian Gulf, Oman Sea and Arabian Sea

    Directory of Open Access Journals (Sweden)

    Ana Mansourkiaei

    2016-04-01

    Full Text Available Abstract Narrow-barred Spanish mackerel, Scomberomorus commerson, is an epipelagic and migratory species of family Scombridae which have a significant role in terms of ecology and fishery. 100 samples were collected from the Persian Gulf, Oman Sea and Arabian Sea. Part of their dorsal fins was snipped and transferred to micro-tubes containing ethanol; then, DNAs were extracted and HRM-Real Time PCR was performed to designate representative specimens for sequencing. Phylogenetic relationships of S. commerson from Persian Gulf, Oman Sea and Arabian Sea were investigated using sequence data of mitochondrial DNA D-loop region. None clustered Neighbor Joining tree indicated the proximity amid S. commerson in four sites. As numbers demonstrated in sequence analyses of mitochondrial DNA D-Loop region a sublimely high degree of genetic similarity among S. commerson from the Persian Gulf and Oman Sea were perceived, thereafter, having one stock structure of S. commerson in four regions were proved, and this approximation can be merely justified by their migration process along the coasts of Oman Sea and Persian Gulf. Therefore, the assessment of distribution patterns of 20 haplotypes in the constructed phylogenetic tree using mtDNA D-Loop sequences ascertained that no significant clustering according to the sampling sites was concluded.

  6. Multigene analysis of lophophorate and chaetognath phylogenetic relationships.

    Science.gov (United States)

    Helmkampf, Martin; Bruchhaus, Iris; Hausdorf, Bernhard

    2008-01-01

    Maximum likelihood and Bayesian inference analyses of seven concatenated fragments of nuclear-encoded housekeeping genes indicate that Lophotrochozoa is monophyletic, i.e., the lophophorate groups Bryozoa, Brachiopoda and Phoronida are more closely related to molluscs and annelids than to Deuterostomia or Ecdysozoa. Lophophorates themselves, however, form a polyphyletic assemblage. The hypotheses that they are monophyletic and more closely allied to Deuterostomia than to Protostomia can be ruled out with both the approximately unbiased test and the expected likelihood weights test. The existence of Phoronozoa, a putative clade including Brachiopoda and Phoronida, has also been rejected. According to our analyses, phoronids instead share a more recent common ancestor with bryozoans than with brachiopods. Platyhelminthes is the sister group of Lophotrochozoa. Together these two constitute Spiralia. Although Chaetognatha appears as the sister group of Priapulida within Ecdysozoa in our analyses, alternative hypothesis concerning chaetognath relationships could not be rejected.

  7. [A phylogenetic analysis of plant communities of Teberda Biosphere Reserve].

    Science.gov (United States)

    Shulakov, A A; Egorov, A V; Onipchenko, V G

    2016-01-01

    Phylogenetic analysis of communities is based on the comparison of distances on the phylogenetic tree between species of a community under study and those distances in random samples taken out of local flora. It makes it possible to determine to what extent a community composition is formed by more closely related species (i.e., "clustered") or, on the opposite, it is more even and includes species that are less related with each other. The first case is usually interpreted as a result of strong influence caused by abiotic factors, due to which species with similar ecology, a priori more closely related, would remain: In the second case, biotic factors, such as competition, may come to the fore and lead to forming a community out of distant clades due to divergence of their ecological niches: The aim of this' study Was Ad explore the phylogenetic structure in communities of the northwestern Caucasus at two spatial scales - the scale of area from 4 to 100 m2 and the smaller scale within a community. The list of local flora of the alpine belt has been composed using the database of geobotanic descriptions carried out in Teberda Biosphere Reserve at true altitudes exceeding.1800 m. It includes 585 species of flowering plants belonging to 57 families. Basal groups of flowering plants are.not represented in the list. At the scale of communities of three classes, namely Thlaspietea rotundifolii - commumties formed on screes and pebbles, Calluno-Ulicetea - alpine meadow, and Mulgedio-Aconitetea subalpine meadows, have not demonstrated significant distinction of phylogenetic structure. At intra level, for alpine meadows the larger share of closely related species. (clustered community) is detected. Significantly clustered happen to be those communities developing on rocks (class Asplenietea trichomanis) and alpine (class Juncetea trifidi). At the same time, alpine lichen proved to have even phylogenetic structure at the small scale. Alpine (class Salicetea herbaceae) that

  8. Evolutionary relationships among Astroviridae

    NARCIS (Netherlands)

    Lukashov, Vladimir V.; Goudsmit, Jaap

    2002-01-01

    To study the evolutionary relationships among astroviruses, all available sequences for members of the family Astroviridae were collected. Phylogenetic analysis distinguished two deep-rooted groups: one comprising mammalian astroviruses, with ovine astrovirus being an outlier, and the other

  9. Quartet-net: a quartet-based method to reconstruct phylogenetic networks.

    Science.gov (United States)

    Yang, Jialiang; Grünewald, Stefan; Wan, Xiu-Feng

    2013-05-01

    Phylogenetic networks can model reticulate evolutionary events such as hybridization, recombination, and horizontal gene transfer. However, reconstructing such networks is not trivial. Popular character-based methods are computationally inefficient, whereas distance-based methods cannot guarantee reconstruction accuracy because pairwise genetic distances only reflect partial information about a reticulate phylogeny. To balance accuracy and computational efficiency, here we introduce a quartet-based method to construct a phylogenetic network from a multiple sequence alignment. Unlike distances that only reflect the relationship between a pair of taxa, quartets contain information on the relationships among four taxa; these quartets provide adequate capacity to infer a more accurate phylogenetic network. In applications to simulated and biological data sets, we demonstrate that this novel method is robust and effective in reconstructing reticulate evolutionary events and it has the potential to infer more accurate phylogenetic distances than other conventional phylogenetic network construction methods such as Neighbor-Joining, Neighbor-Net, and Split Decomposition. This method can be used in constructing phylogenetic networks from simple evolutionary events involving a few reticulate events to complex evolutionary histories involving a large number of reticulate events. A software called "Quartet-Net" is implemented and available at http://sysbio.cvm.msstate.edu/QuartetNet/.

  10. New insights into the phylogenetic relationships, character evolution, and phytogeographic patterns of Calceolaria (Calceolariaceae).

    Science.gov (United States)

    Cosacov, Andrea; Sérsic, Alicia N; Sosa, Victoria; De-Nova, J Arturo; Nylinder, Stephan; Cocucci, Andrea A

    2009-12-01

    Biogeographical patterns and diversification processes in Andean and Patagonian flora are not yet well understood. Calceolaria is a highly diversified genus of these areas, representing one of the most specialized plant-pollinator systems because flowers produce nonvolatile oils, a very unusual floral reward. Phylogenetic analyses with molecular (ITS and matK) and morphological characters from 103 Calceolaria species were conducted to examine relationships, to understand biogeographic patterns, and to detect evolutionary patterns of floral and ecological characters. Total evidence analysis retrieved three major clades, which strongly correspond to the three previously recognized subgenera, although only subgenus Rosula was retrieved as a monophyletic group. A single historical event explains the expansion from the southern to central Andes, while different parallel evolutionary lines show a northward expansion from the central to northern Andes across the Huancabamba Deflection, an important geographical barrier in northern Peru. Polyploidy, acquisition of elaiophores, and a nototribic pollination mechanism are key aspects of the evolutionary history of Calceolaria. Pollination interactions were more frequently established with Centris than with Chalepogenus oil-collecting bee species. The repeated loss of the oil gland and shifts to pollen as the only reward suggest an evolutionary tendency from highly to moderately specialized pollination systems.

  11. Phylogenetic analysis at deep timescales: unreliable gene trees, bypassed hidden support, and the coalescence/concatalescence conundrum.

    Science.gov (United States)

    Gatesy, John; Springer, Mark S

    2014-11-01

    Large datasets are required to solve difficult phylogenetic problems that are deep in the Tree of Life. Currently, two divergent systematic methods are commonly applied to such datasets: the traditional supermatrix approach (= concatenation) and "shortcut" coalescence (= coalescence methods wherein gene trees and the species tree are not co-estimated). When applied to ancient clades, these contrasting frameworks often produce congruent results, but in recent phylogenetic analyses of Placentalia (placental mammals), this is not the case. A recent series of papers has alternatively disputed and defended the utility of shortcut coalescence methods at deep phylogenetic scales. Here, we examine this exchange in the context of published phylogenomic data from Mammalia; in particular we explore two critical issues - the delimitation of data partitions ("genes") in coalescence analysis and hidden support that emerges with the combination of such partitions in phylogenetic studies. Hidden support - increased support for a clade in combined analysis of all data partitions relative to the support evident in separate analyses of the various data partitions, is a hallmark of the supermatrix approach and a primary rationale for concatenating all characters into a single matrix. In the most extreme cases of hidden support, relationships that are contradicted by all gene trees are supported when all of the genes are analyzed together. A valid fear is that shortcut coalescence methods might bypass or distort character support that is hidden in individual loci because small gene fragments are analyzed in isolation. Given the extensive systematic database for Mammalia, the assumptions and applicability of shortcut coalescence methods can be assessed with rigor to complement a small but growing body of simulation work that has directly compared these methods to concatenation. We document several remarkable cases of hidden support in both supermatrix and coalescence paradigms and argue

  12. Phylogenetic Relationships of Cucullanidae (Nematoda), with Observations on Seuratoidea and the Monophyly of Cucullanus, Dichelyne and Truttaedacnitis.

    Science.gov (United States)

    Choudhury, Anindo; Nadler, Steven A

    2016-02-01

    The phylogenetic relationships of Cucullanidae were explored using near-complete sequences of the 18S rDNA (rRNA gene). Sequences (1,750-1,760 bp) were obtained from 7 species of Cucullanidae belonging to 3 genera, Cucullanus (2 spp.), Dichelyne (2 spp.), Truttaedacnitis (3 spp.), and 1 species of Quimperiidae ( Paraseuratum sp.). These sequences were aligned with those of 128 other nematode species available in GenBank, including 3 other cucullanids (Dichelyne mexicanus, Cucullanus robustus, and Cucullanus baylisi) and 2 non-cucullanid seuratoids (Paraquimperia africana, and Linstowinema sp.). Bayesian (BPP) and maximum likelihood (ML) analyses of 2 different datasets strongly supported a monophyletic Cucullanidae. Bayesian analysis placed this family as the sister group to a clade containing species of Diplogasterida, Strongylida, Rhabditida, and Tylenchida with very strong support. Neither BPP nor ML analyses recovered a close relationship of Cucullanidae to Ascaridida. None of the 3 non-cucullanid seuratoid species were sister to Cucullanidae, nor did they form a monophyletic group of their own, which questions the monophyly of Seuratoidea and the relationships among species within this superfamily. The 3 genera of cucullanids were also not monophyletic, although morphologically similar species such as the 2 species of Cucullanus from Neotropical catfishes and 2 species of Dichelyne from Nearctic ictalurid catfishes were sister taxa with strong support. The results were ambiguous with respect to the relationship of 2 Truttaedacnitis spp. in Nearctic freshwater fishes but do not support Truttaedacnitis heterodonti, a parasite of heterodontid sharks, as belonging to this genus. The study shows that all aspects of the conventional classification of Seuratoidea and its taxa should be scrutinized by even more extensive sampling across hosts and habitats.

  13. Transcriptional and phylogenetic analysis of five complete ambystomatid salamander mitochondrial genomes.

    Science.gov (United States)

    Samuels, Amy K; Weisrock, David W; Smith, Jeramiah J; France, Katherine J; Walker, John A; Putta, Srikrishna; Voss, S Randal

    2005-04-11

    We report on a study that extended mitochondrial transcript information from a recent EST project to obtain complete mitochondrial genome sequence for 5 tiger salamander complex species (Ambystoma mexicanum, A. t. tigrinum, A. andersoni, A. californiense, and A. dumerilii). We describe, for the first time, aspects of mitochondrial transcription in a representative amphibian, and then use complete mitochondrial sequence data to examine salamander phylogeny at both deep and shallow levels of evolutionary divergence. The available mitochondrial ESTs for A. mexicanum (N=2481) and A. t. tigrinum (N=1205) provided 92% and 87% coverage of the mitochondrial genome, respectively. Complete mitochondrial sequences for all species were rapidly obtained by using long distance PCR and DNA sequencing. A number of genome structural characteristics (base pair length, base composition, gene number, gene boundaries, codon usage) were highly similar among all species and to other distantly related salamanders. Overall, mitochondrial transcription in Ambystoma approximated the pattern observed in other vertebrates. We inferred from the mapping of ESTs onto mtDNA that transcription occurs from both heavy and light strand promoters and continues around the entire length of the mtDNA, followed by post-transcriptional processing. However, the observation of many short transcripts corresponding to rRNA genes indicates that transcription may often terminate prematurely to bias transcription of rRNA genes; indeed an rRNA transcription termination signal sequence was observed immediately following the 16S rRNA gene. Phylogenetic analyses of salamander family relationships consistently grouped Ambystomatidae in a clade containing Cryptobranchidae and Hynobiidae, to the exclusion of Salamandridae. This robust result suggests a novel alternative hypothesis because previous studies have consistently identified Ambystomatidae and Salamandridae as closely related taxa. Phylogenetic analyses of tiger

  14. Molecular identification and phylogenetic analysis of Wuchereria bancrofti from human blood samples in Egypt.

    Science.gov (United States)

    Abdel-Shafi, Iman R; Shoieb, Eman Y; Attia, Samar S; Rubio, José M; Ta-Tang, Thuy-Huong; El-Badry, Ayman A

    2017-03-01

    Lymphatic filariasis (LF) is a serious vector-borne health problem, and Wuchereria bancrofti (W.b) is the major cause of LF worldwide and is focally endemic in Egypt. Identification of filarial infection using traditional morphologic and immunological criteria can be difficult and lead to misdiagnosis. The aim of the present study was molecular detection of W.b in residents in endemic areas in Egypt, sequence variance analysis, and phylogenetic analysis of W.b DNA. Collected blood samples from residents in filariasis endemic areas in five governorates were subjected to semi-nested PCR targeting repeated DNA sequence, for detection of W.b DNA. PCR products were sequenced; subsequently, a phylogenetic analysis of the obtained sequences was performed. Out of 300 blood samples, W.b DNA was identified in 48 (16%). Sequencing analysis confirmed PCR results identifying only W.b species. Sequence alignment and phylogenetic analysis indicated genetically distinct clusters of W.b among the study population. Study results demonstrated that the semi-nested PCR proved to be an effective diagnostic tool for accurate and rapid detection of W.b infections in nano-epidemics and is applicable for samples collected in the daytime as well as the night time. PCR products sequencing and phylogenitic analysis revealed three different nucleotide sequences variants. Further genetic studies of W.b in Egypt and other endemic areas are needed to distinguish related strains and the various ecological as well as drug effects exerted on them to support W.b elimination.

  15. Assessing the Goodness of Fit of Phylogenetic Comparative Methods: A Meta-Analysis and Simulation Study.

    Directory of Open Access Journals (Sweden)

    Dwueng-Chwuan Jhwueng

    Full Text Available Phylogenetic comparative methods (PCMs have been applied widely in analyzing data from related species but their fit to data is rarely assessed.Can one determine whether any particular comparative method is typically more appropriate than others by examining comparative data sets?I conducted a meta-analysis of 122 phylogenetic data sets found by searching all papers in JEB, Blackwell Synergy and JSTOR published in 2002-2005 for the purpose of assessing the fit of PCMs. The number of species in these data sets ranged from 9 to 117.I used the Akaike information criterion to compare PCMs, and then fit PCMs to bivariate data sets through REML analysis. Correlation estimates between two traits and bootstrapped confidence intervals of correlations from each model were also compared.For phylogenies of less than one hundred taxa, the Independent Contrast method and the independent, non-phylogenetic models provide the best fit.For bivariate analysis, correlations from different PCMs are qualitatively similar so that actual correlations from real data seem to be robust to the PCM chosen for the analysis. Therefore, researchers might apply the PCM they believe best describes the evolutionary mechanisms underlying their data.

  16. Comparison of Boolean analysis and standard phylogenetic methods using artificially evolved and natural mt-tRNA sequences from great apes.

    Science.gov (United States)

    Ari, Eszter; Ittzés, Péter; Podani, János; Thi, Quynh Chi Le; Jakó, Eena

    2012-04-01

    Boolean analysis (or BOOL-AN; Jakó et al., 2009. BOOL-AN: A method for comparative sequence analysis and phylogenetic reconstruction. Mol. Phylogenet. Evol. 52, 887-97.), a recently developed method for sequence comparison uses the Iterative Canonical Form of Boolean functions. It considers sequence information in a way entirely different from standard phylogenetic methods (i.e. Maximum Parsimony, Maximum-Likelihood, Neighbor-Joining, and Bayesian analysis). The performance and reliability of Boolean analysis were tested and compared with the standard phylogenetic methods, using artificially evolved - simulated - nucleotide sequences and the 22 mitochondrial tRNA genes of the great apes. At the outset, we assumed that the phylogeny of Hominidae is generally well established, and the guide tree of artificial sequence evolution can also be used as a benchmark. These offer a possibility to compare and test the performance of different phylogenetic methods. Trees were reconstructed by each method from 2500 simulated sequences and 22 mitochondrial tRNA sequences. We also introduced a special re-sampling method for Boolean analysis on permuted sequence sites, the P-BOOL-AN procedure. Considering the reliability values (branch support values of consensus trees and Robinson-Foulds distances) we used for simulated sequence trees produced by different phylogenetic methods, BOOL-AN appeared as the most reliable method. Although the mitochondrial tRNA sequences of great apes are relatively short (59-75 bases long) and the ratio of their constant characters is about 75%, BOOL-AN, P-BOOL-AN and the Bayesian approach produced the same tree-topology as the established phylogeny, while the outcomes of Maximum Parsimony, Maximum-Likelihood and Neighbor-Joining methods were equivocal. We conclude that Boolean analysis is a promising alternative to existing methods of sequence comparison for phylogenetic reconstruction and congruence analysis. Copyright © 2012 Elsevier Inc. All

  17. Contribution of WUSCHEL-related homeobox (WOX genes to identify the phylogenetic relationships among Petunia species

    Directory of Open Access Journals (Sweden)

    Ana Lúcia Anversa Segatto

    Full Text Available Abstract Developmental genes are believed to contribute to major changes during plant evolution, from infrageneric to higher levels. Due to their putative high sequence conservation, developmental genes are rarely used as molecular markers, and few studies including these sequences at low taxonomic levels exist. WUSCHEL-related homeobox genes (WOX are transcription factors exclusively present in plants and are involved in developmental processes. In this study, we characterized the infrageneric genetic variation of Petunia WOX genes. We obtained phylogenetic relationships consistent with other phylogenies based on nuclear markers, but with higher statistical support, resolution in terminals, and compatibility with flower morphological changes.

  18. Phylogenetic relationships of Palaearctic Formica species (Hymenoptera, Formicidae based on mitochondrial cytochrome B sequences.

    Directory of Open Access Journals (Sweden)

    Anna V Goropashnaya

    Full Text Available Ants of genus Formica demonstrate variation in social organization and represent model species for ecological, behavioral, evolutionary studies and testing theoretical implications of the kin selection theory. Subgeneric division of the Formica ants based on morphology has been questioned and remained unclear after an allozyme study on genetic differentiation between 13 species representing all subgenera was conducted. In the present study, the phylogenetic relationships within the genus were examined using mitochondrial DNA sequences of the cytochrome b and a part of the NADH dehydrogenase subunit 6. All 23 Formica species sampled in the Palaearctic clustered according to the subgeneric affiliation except F. uralensis that formed a separate phylogenetic group. Unlike Coptoformica and Formica s. str., the subgenus Serviformica did not form a tight cluster but more likely consisted of a few small clades. The genetic distances between the subgenera were around 10%, implying approximate divergence time of 5 Myr if we used the conventional insect divergence rate of 2% per Myr. Within-subgenus divergence estimates were 6.69% in Serviformica, 3.61% in Coptoformica, 1.18% in Formica s. str., which supported our previous results on relatively rapid speciation in the latter subgenus. The phylogeny inferred from DNA sequences provides a necessary framework against which the evolution of social traits can be compared. We discuss implications of inferred phylogeny for the evolution of social traits.

  19. Orthology prediction at scalable resolution by phylogenetic tree analysis

    NARCIS (Netherlands)

    Heijden, R.T.J.M. van der; Snel, B.; Noort, V. van; Huynen, M.A.

    2007-01-01

    BACKGROUND: Orthology is one of the cornerstones of gene function prediction. Dividing the phylogenetic relations between genes into either orthologs or paralogs is however an oversimplification. Already in two-species gene-phylogenies, the complicated, non-transitive nature of phylogenetic

  20. A format for phylogenetic placements.

    Directory of Open Access Journals (Sweden)

    Frederick A Matsen

    Full Text Available We have developed a unified format for phylogenetic placements, that is, mappings of environmental sequence data (e.g., short reads into a phylogenetic tree. We are motivated to do so by the growing number of tools for computing and post-processing phylogenetic placements, and the lack of an established standard for storing them. The format is lightweight, versatile, extensible, and is based on the JSON format, which can be parsed by most modern programming languages. Our format is already implemented in several tools for computing and post-processing parsimony- and likelihood-based phylogenetic placements and has worked well in practice. We believe that establishing a standard format for analyzing read placements at this early stage will lead to a more efficient development of powerful and portable post-analysis tools for the growing applications of phylogenetic placement.

  1. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum

    Science.gov (United States)

    Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

    2017-01-01

    Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the

  2. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum.

    Directory of Open Access Journals (Sweden)

    Xiuqing Zhang

    Full Text Available Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality

  3. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    PARUL BANERJEE

    c Indian Academy of Sciences. RESEARCH ARTICLE. The Drosophila bipectinata species complex: phylogenetic relationship among different members based on chromosomal variations. PARUL BANERJEE and BASHISTH N. SINGH. ∗. Genetics Laboratory, Department of Zoology, Banaras Hindu University, Varanasi ...

  4. Phylogenetic analysis of Attalea (Arecaceae): insights on the historical biogeography of a recently diversified Neotropical plant group

    Science.gov (United States)

    Technical Abstract Here we present a dated phylogenetic tree of the neotropical palm genus Attalea (Arecaceae). We used six orthologs from the nuclear WRKY gene family across 98 accessions to address relationships among species and biogeographic hypotheses. Here we found that the formerly recognized...

  5. A program for verification of phylogenetic network models.

    Science.gov (United States)

    Gunawan, Andreas D M; Lu, Bingxin; Zhang, Louxin

    2016-09-01

    Genetic material is transferred in a non-reproductive manner across species more frequently than commonly thought, particularly in the bacteria kingdom. On one hand, extant genomes are thus more properly considered as a fusion product of both reproductive and non-reproductive genetic transfers. This has motivated researchers to adopt phylogenetic networks to study genome evolution. On the other hand, a gene's evolution is usually tree-like and has been studied for over half a century. Accordingly, the relationships between phylogenetic trees and networks are the basis for the reconstruction and verification of phylogenetic networks. One important problem in verifying a network model is determining whether or not certain existing phylogenetic trees are displayed in a phylogenetic network. This problem is formally called the tree containment problem. It is NP-complete even for binary phylogenetic networks. We design an exponential time but efficient method for determining whether or not a phylogenetic tree is displayed in an arbitrary phylogenetic network. It is developed on the basis of the so-called reticulation-visible property of phylogenetic networks. A C-program is available for download on http://www.math.nus.edu.sg/∼matzlx/tcp_package matzlx@nus.edu.sg Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. Detection and phylogenetic analysis of bacteriophage WO in spiders (Araneae).

    Science.gov (United States)

    Yan, Qian; Qiao, Huping; Gao, Jin; Yun, Yueli; Liu, Fengxiang; Peng, Yu

    2015-11-01

    Phage WO is a bacteriophage found in Wolbachia. Herein, we represent the first phylogenetic study of WOs that infect spiders (Araneae). Seven species of spiders (Araneus alternidens, Nephila clavata, Hylyphantes graminicola, Prosoponoides sinensis, Pholcus crypticolens, Coleosoma octomaculatum, and Nurscia albofasciata) from six families were infected by Wolbachia and WO, followed by comprehensive sequence analysis. Interestingly, WO could be only detected Wolbachia-infected spiders. The relative infection rates of those seven species of spiders were 75, 100, 88.9, 100, 62.5, 72.7, and 100 %, respectively. Our results indicated that both Wolbachia and WO were found in three different body parts of N. clavata, and WO could be passed to the next generation of H. graminicola by vertical transmission. There were three different sequences for WO infected in A. alternidens and two different WO sequences from C. octomaculatum. Only one sequence of WO was found for the other five species of spiders. The discovered sequence of WO ranged from 239 to 311 bp. Phylogenetic tree was generated using maximum likelihood (ML) based on the orf7 gene sequences. According to the phylogenetic tree, WOs in N. clavata and H. graminicola were clustered in the same group. WOs from A. alternidens (WAlt1) and C. octomaculatum (WOct2) were closely related to another clade, whereas WO in P. sinensis was classified as a sole cluster.

  7. Preliminary phylogenetic analysis of the Andean clade and the placement of new Colombian blueberries (Ericaceae, Vaccinieae

    Directory of Open Access Journals (Sweden)

    Paola Pedraza-Penalosa

    2015-04-01

    Full Text Available The blueberry tribe Vaccinieae (Ericaceae is particularly diverse in South America and underwent extensive radiation in Colombia where many endemics occur. Recent fieldwork in Colombia has resulted in valuable additions to the phylogeny and as well in the discovery of morphologically noteworthy new species that need to be phylogenetically placed before being named. This is particularly important, as the monophyly of many of the studied genera have not been confirmed. In order to advance our understanding of the relationships within neotropical Vaccinieae and advice the taxonomy of the new blueberry relatives, here we present the most comprehensive phylogenetic analysis for the Andean clade. Anthopterus, Demosthenesia, and Pellegrinia are among the putative Andean genera recovered as monophyletic, while other eight Andean genera were not. The analyses also showed that genera that have been traditionally widely defined are non-monophyletic and could be further split into more discrete groups. Four newly discovered Colombian Vaccinieae are placed in the monophyletic Satyria s.s. and the Psammisia I clade. Although these new species are endemic to the Colombian Western Cordillera and Chocó biogeographic region and three are not known outside of Las Orquídeas National Park, they do not form sister pairs.

  8. A gateway for phylogenetic analysis powered by grid computing featuring GARLI 2.0.

    Science.gov (United States)

    Bazinet, Adam L; Zwickl, Derrick J; Cummings, Michael P

    2014-09-01

    We introduce molecularevolution.org, a publicly available gateway for high-throughput, maximum-likelihood phylogenetic analysis powered by grid computing. The gateway features a garli 2.0 web service that enables a user to quickly and easily submit thousands of maximum likelihood tree searches or bootstrap searches that are executed in parallel on distributed computing resources. The garli web service allows one to easily specify partitioned substitution models using a graphical interface, and it performs sophisticated post-processing of phylogenetic results. Although the garli web service has been used by the research community for over three years, here we formally announce the availability of the service, describe its capabilities, highlight new features and recent improvements, and provide details about how the grid system efficiently delivers high-quality phylogenetic results. © The Author(s) 2014. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

  9. Exploring Phylogenetic Relationships within Myriapoda and the Effects of Matrix Composition and Occupancy on Phylogenomic Reconstruction.

    Science.gov (United States)

    Fernández, Rosa; Edgecombe, Gregory D; Giribet, Gonzalo

    2016-09-01

    Myriapods, including the diverse and familiar centipedes and millipedes, are one of the dominant terrestrial arthropod groups. Although molecular evidence has shown that Myriapoda is monophyletic, its internal phylogeny remains contentious and understudied, especially when compared to those of Chelicerata and Hexapoda. Until now, efforts have focused on taxon sampling (e.g., by including a handful of genes from many species) or on maximizing matrix size (e.g., by including hundreds or thousands of genes in just a few species), but a phylogeny maximizing sampling at both levels remains elusive. In this study, we analyzed 40 Illumina transcriptomes representing 3 of the 4 myriapod classes (Diplopoda, Chilopoda, and Symphyla); 25 transcriptomes were newly sequenced to maximize representation at the ordinal level in Diplopoda and at the family level in Chilopoda. Ten supermatrices were constructed to explore the effect of several potential phylogenetic biases (e.g., rate of evolution, heterotachy) at 3 levels of gene occupancy per taxon (50%, 75%, and 90%). Analyses based on maximum likelihood and Bayesian mixture models retrieved monophyly of each myriapod class, and resulted in 2 alternative phylogenetic positions for Symphyla, as sister group to Diplopoda + Chilopoda, or closer to Diplopoda, the latter hypothesis having been traditionally supported by morphology. Within centipedes, all orders were well supported, but 2 deep nodes remained in conflict in the different analyses despite dense taxon sampling at the family level. Relationships among centipede orders in all analyses conducted with the most complete matrix (90% occupancy) are at odds not only with the sparser but more gene-rich supermatrices (75% and 50% supermatrices) and with the matrices optimizing phylogenetic informativeness or most conserved genes, but also with previous hypotheses based on morphology, development, or other molecular data sets. Our results indicate that a high percentage of ribosomal

  10. Biometrical studies upon hominoid teeth: the coefficient of variation, sexual dimorphism and questions of phylogenetic relationship.

    Science.gov (United States)

    Blumenberg, B

    1985-01-01

    Sexual dimorphism as a function of variation in hominoid tooth metrics has been investigated for four groups of taxa: Recent great apes (two subfamilies), Dryopiths (one subfamily), Ramapiths (one subfamily) and hominids (one family). Gorilla, and to a lesser extent Pan, appear characterized by very high levels of sexual dimorphism and meet several criteria for statistical outliers. Recent great apes are the only group exhibiting consistently high levels of sexual dimorphism. Ramapiths are the only group characterized by low levels of sexual dimorphism and their relative canine length is most similar to Dryopiths. Both Dryopiths and hominids contain taxa with low and intermediate levels of sexual dimorphism. The Gingerich and Shoeninger hypothesis relating coefficients of variation to occlusal complexity is supported. Non-parametric statistics suggest that homogeneity of coefficient of variation profiles over most of the tooth row is characteristic of only the Dryopiths and a composite data set composed of the Dryopith plus Ramapith tooth measurements. Oxnard's model for the multifactorial basis of multiple sexual dimorphisms is also supported. The Dryopith and hominid patterns of sexual dimorphism are similar, an observation that suggests phylogenetic relationship. At the taxonomic level of subfamily or family, sexual dimorphism is a character of cladistic usefulness and possible phylogenetic valence. Assuming that breeding system and sexual dimorphism are functional correlates as many workers suggest, then Ramapithecus sp. China, Sivapithecus indicus and possibly Australopithecus boisei are good candidates for having possessed monogamous breeding/social structures. All Dryopith taxa, S. sivalensis, Sivapithecus sp. China, A. afarensis, Homo habilis and H. erectus emerge as the best candidates for having possessed a polygynous breeding/social structure. No biometrical affinities of Ramapiths with hominids can be demonstrated and some phylogenetic relationship with

  11. Human parainfluenza virus type 2 hemagglutinin-neuramindase gene: sequence and phylogenetic analysis of the Saudi strain Riyadh 105/2009

    Directory of Open Access Journals (Sweden)

    Almajhdi Fahad N

    2012-12-01

    Full Text Available Abstract Background Although human parainfluenza type 2 (HPIV-2 virus is an important respiratory pathogen, a little is known about strains circulating in Saudi Arabia. Findings Among 180 nasopharyngeal aspirates collected from suspected cases in Riyadh, only one sample (0.56% was confirmed HPIV-2 positive by nested RT-PCR. The sample that was designated Riyadh 105/2009 was used for sequencing and phylogenetic analysis of the most variable virus gene; the haemagglutinin-neuramindase (HN. Comparison of HN gene of Riyadh 105/2009 strain and the relevant sequences available in GenBank revealed a strong relationship with Oklahoma-94-2009 strain. Phylogenetic analysis indicated four different clusters of HPIV-2 strains (G1-4. Twenty-three amino acid substitutions were recorded for Riyadh 105/2009, from which four are unique. The majority of substitutions (n=18 had changed their amino acids characteristics. By analyzing the effect of the recorded substitutions on the protein function using SIFT program, only two located at positions 360 and 571 were predicted to be deleterious. Conclusions The presented changes of Riyadh 105/2009 strain may possess potential effect on the protein structure and/or function level. This is the first report that describes partial characterization of Saudi HPIV-2 strain.

  12. Predicting rates of interspecific interaction from phylogenetic trees.

    Science.gov (United States)

    Nuismer, Scott L; Harmon, Luke J

    2015-01-01

    Integrating phylogenetic information can potentially improve our ability to explain species' traits, patterns of community assembly, the network structure of communities, and ecosystem function. In this study, we use mathematical models to explore the ecological and evolutionary factors that modulate the explanatory power of phylogenetic information for communities of species that interact within a single trophic level. We find that phylogenetic relationships among species can influence trait evolution and rates of interaction among species, but only under particular models of species interaction. For example, when interactions within communities are mediated by a mechanism of phenotype matching, phylogenetic trees make specific predictions about trait evolution and rates of interaction. In contrast, if interactions within a community depend on a mechanism of phenotype differences, phylogenetic information has little, if any, predictive power for trait evolution and interaction rate. Together, these results make clear and testable predictions for when and how evolutionary history is expected to influence contemporary rates of species interaction. © 2014 John Wiley & Sons Ltd/CNRS.

  13. Phylogenetic Analysis of Seven WRKY Genes across the Palm Subtribe Attaleinae (Arecaceae) Identifies Syagrus as Sister Group of the Coconut

    Science.gov (United States)

    Meerow, Alan W.; Noblick, Larry; Borrone, James W.; Couvreur, Thomas L. P.; Mauro-Herrera, Margarita; Hahn, William J.; Kuhn, David N.; Nakamura, Kyoko; Oleas, Nora H.; Schnell, Raymond J.

    2009-01-01

    Background The Cocoseae is one of 13 tribes of Arecaceae subfam. Arecoideae, and contains a number of palms with significant economic importance, including the monotypic and pantropical Cocos nucifera L., the coconut, the origins of which have been one of the “abominable mysteries” of palm systematics for decades. Previous studies with predominantly plastid genes weakly supported American ancestry for the coconut but ambiguous sister relationships. In this paper, we use multiple single copy nuclear loci to address the phylogeny of the Cocoseae subtribe Attaleinae, and resolve the closest extant relative of the coconut. Methodology/Principal Findings We present the results of combined analysis of DNA sequences of seven WRKY transcription factor loci across 72 samples of Arecaceae tribe Cocoseae subtribe Attaleinae, representing all genera classified within the subtribe, and three outgroup taxa with maximum parsimony, maximum likelihood, and Bayesian approaches, producing highly congruent and well-resolved trees that robustly identify the genus Syagrus as sister to Cocos and resolve novel and well-supported relationships among the other genera of the Attaleinae. We also address incongruence among the gene trees with gene tree reconciliation analysis, and assign estimated ages to the nodes of our tree. Conclusions/Significance This study represents the as yet most extensive phylogenetic analyses of Cocoseae subtribe Attaleinae. We present a well-resolved and supported phylogeny of the subtribe that robustly indicates a sister relationship between Cocos and Syagrus. This is not only of biogeographic interest, but will also open fruitful avenues of inquiry regarding evolution of functional genes useful for crop improvement. Establishment of two major clades of American Attaleinae occurred in the Oligocene (ca. 37 MYBP) in Eastern Brazil. The divergence of Cocos from Syagrus is estimated at 35 MYBP. The biogeographic and morphological congruence that we see for

  14. Host-range phylogenetic grouping of capripoxviruses. Genetic typing of CaPVs

    International Nuclear Information System (INIS)

    Le Goff, C.; Chadeyras, A.; Libeau, G.; Albina, E.; Fakhfakh, E.; Hammami, S.; Elexpeter Aba Adulugba; Diallo, A.

    2005-01-01

    Because of their close relationship, specific identification of the CaPVs genus inside the Poxviridae family relies mainly on molecular tools rather than on classical serology. We describe the suitability of the G protein-coupled chemokine receptor (GPCR), for host range phylogenetic grouping. The analysis of 26 CaPVs shows 3 tight genetic clusters consisting of goatpox virus (GPV), lumpy skin disease virus (LSDV), and sheeppox virus (SPV). (author)

  15. Description of new mitochondrial genomes (Spodoptera litura, Noctuoidea and Cnaphalocrocis medinalis, Pyraloidea) and phylogenetic reconstruction of Lepidoptera with the comment on optimization schemes.

    Science.gov (United States)

    Wan, Xinlong; Kim, Min Jee; Kim, Iksoo

    2013-11-01

    We newly sequenced mitochondrial genomes of Spodoptera litura and Cnaphalocrocis medinalis belonging to Lepidoptera to obtain further insight into mitochondrial genome evolution in this group and investigated the influence of optimal strategies on phylogenetic reconstruction of Lepidoptera. Estimation of p-distances of each mitochondrial gene for available taxonomic levels has shown the highest value in ND6, whereas the lowest values in COI and COII at the nucleotide level, suggesting different utility of each gene for different hierarchical group when individual genes are utilized for phylogenetic analysis. Phylogenetic analyses mainly yielded the relationships (((((Bombycoidea + Geometroidea) + Noctuoidea) + Pyraloidea) + Papilionoidea) + Tortricoidea), evidencing the polyphyly of Macrolepidoptera. The Noctuoidea concordantly recovered the familial relationships (((Arctiidae + Lymantriidae) + Noctuidae) + Notodontidae). The tests of optimality strategies, such as exclusion of third codon positions, inclusion of rRNA and tRNA genes, data partitioning, RY recoding approach, and recoding nucleotides into amino acids suggested that the majority of the strategies did not substantially alter phylogenetic topologies or nodal supports, except for the sister relationship between Lycaenidae and Pieridae only in the amino acid dataset, which was in contrast to the sister relationship between Lycaenidae and Nymphalidae in Papilionoidea in the remaining datasets.

  16. Phenotypic Microdiversity and Phylogenetic Signal Analysis of Traits Related to Social Interaction in Bacillus spp. from Sediment Communities.

    Science.gov (United States)

    Rodríguez-Torres, María Dolores; Islas-Robles, África; Gómez-Lunar, Zulema; Delaye, Luis; Hernández-González, Ismael; Souza, Valeria; Travisano, Michael; Olmedo-Álvarez, Gabriela

    2017-01-01

    Understanding the relationship between phylogeny and predicted traits is important to uncover the dimension of the predictive power of a microbial composition approach. Numerous works have addressed the taxonomic composition of bacteria in communities, but little is known about trait heterogeneity in closely related bacteria that co-occur in communities. We evaluated a sample of 467 isolates from the Churince water system of the Cuatro Cienegas Basin (CCB), enriched for Bacillus spp. The 16S rRNA gene revealed a random distribution of taxonomic groups within this genus among 11 sampling sites. A subsample of 141 Bacillus spp. isolates from sediment, with seven well-represented species was chosen to evaluate the heterogeneity and the phylogenetic signal of phenotypic traits that are known to diverge within small clades, such as substrate utilization, and traits that are conserved deep in the lineage, such as prototrophy, swarming and biofilm formation. We were especially interested in evaluating social traits, such as swarming and biofilm formation, for which cooperation is needed to accomplish a multicellular behavior and for which there is little information from natural communities. The phylogenetic distribution of traits, evaluated by the Purvis and Fritz's D statistics approached a Brownian model of evolution. Analysis of the phylogenetic relatedness of the clusters of members sharing the trait using consenTRAIT algorithm, revealed more clustering and deeper phylogenetic signal for prototrophy, biofilm and swimming compared to the data obtained for substrate utilization. The explanation to the observed Brownian evolution of social traits could be either loss due to complete dispensability or to compensated trait loss due to the availability of public goods. Since many of the evaluated traits can be considered to be collective action traits, such as swarming, motility and biofilm formation, the observed microdiversity within taxonomic groups might be explained

  17. Evaluating the relationship between evolutionary divergence and phylogenetic accuracy in AFLP data sets.

    Science.gov (United States)

    García-Pereira, María Jesús; Caballero, Armando; Quesada, Humberto

    2010-05-01

    Using in silico amplified fragment length polymorphism (AFLP) fingerprints, we explore the relationship between sequence similarity and phylogeny accuracy to test when, in terms of genetic divergence, the quality of AFLP data becomes too low to be informative for a reliable phylogenetic reconstruction. We generated DNA sequences with known phylogenies using balanced and unbalanced trees with recent, uniform and ancient radiations, and average branch lengths (from the most internal node to the tip) ranging from 0.02 to 0.4 substitutions per site. The resulting sequences were used to emulate the AFLP procedure. Trees were estimated by maximum parsimony (MP), neighbor-joining (NJ), and minimum evolution (ME) methods from both DNA sequences and virtual AFLP fingerprints. The estimated trees were compared with the reference trees using a score that measures overall differences in both topology and relative branch length. As expected, the accuracy of AFLP-based phylogenies decreased dramatically in the more divergent data sets. Above a divergence of approximately 0.05, AFLP-based phylogenies were largely inaccurate irrespective of the distinct topology, radiation model, or phylogenetic method used. This value represents an upper bound of expected tree accuracy for data sets with a simple divergence history; AFLP data sets with a similar divergence but with unbalanced topologies and short ancestral branches produced much less accurate trees. The lack of homology of AFLP bands quickly increases with divergence and reaches its maximum value (100%) at a divergence of only 0.4. Low guanine-cytosine (GC) contents increase the number of nonhomologous bands in AFLP data sets and lead to less reliable trees. However, the effect of the lack of band homology on tree accuracy is surprisingly small relative to the negative impact due to the low information content of AFLP characters. Tree-building methods based on genetic distance displayed similar trends and outperformed parsimony

  18. A multi-locus plastid phylogenetic analysis of the pantropical genus Diospyros (Ebenaceae), with an emphasis on the radiation and biogeographic origins of the New Caledonian endemic species.

    Science.gov (United States)

    Duangjai, Sutee; Samuel, Rosabelle; Munzinger, Jérôme; Forest, Félix; Wallnöfer, Bruno; Barfuss, Michael H J; Fischer, Gunter; Chase, Mark W

    2009-09-01

    We aimed to clarify phylogenetic relationships within the pantropical genus Diospyros (Ebenaceae sensulato), and ascertain biogeographical patterns in the New Caledonian endemic species. We used DNA sequences from eight plastid regions (rbcL, atpB, matK, ndhF, trnK intron, trnL intron, trnL-trnF spacer, and trnS-trnG spacer) and included 149 accessions representing 119 Diospyros species in our analysis. Results from this study confirmed the monophyly of Diospyros with good support and provided a clearer picture of the relationships within the genus than in previous studies. Evidence from phylogenetic analyses suggests that Diospyros colonized New Caledonia multiple times. The four lineages of Diospyros in New Caledonia also differ in their degree of diversification. The molecular data indicate that one lineage is paleoendemic and derived from an ancient Australian species. The other three lineages are more closely related to several Southeast Asian species; two of them are neoendemics, and one has radiated rapidly and recently.

  19. Phylogenetic resolution and habitat specificity of members of the Photobacterium phosphoreum species group.

    Science.gov (United States)

    Ast, Jennifer C; Dunlap, Paul V

    2005-10-01

    Substantial ambiguity exists regarding the phylogenetic status of facultatively psychrophilic luminous bacteria identified as Photobacterium phosphoreum, a species thought to be widely distributed in the world's oceans and believed to be the specific bioluminescent light-organ symbiont of several deep-sea fishes. Members of the P. phosphoreum species group include luminous and non-luminous strains identified phenotypically from a variety of different habitats as well as phylogenetically defined lineages that appear to be evolutionarily distinct. To resolve this ambiguity and to begin developing a meaningful knowledge of the geographic distributions, habitats and symbiotic relationships of bacteria in the P. phosphoreum species group, we carried out a multilocus, fine-scale phylogenetic analysis based on sequences of the 16S rRNA, gyrB and luxABFE genes of many newly isolated luminous strains from symbiotic and saprophytic habitats, together with previously isolated luminous and non-luminous strains identified as P. phosphoreum from these and other habitats. Parsimony analysis unambiguously resolved three evolutionarily distinct clades, phosphoreum, iliopiscarium and kishitanii. The tight phylogenetic clustering within these clades and the distinct separation between them indicates they are different species, P. phosphoreum, Photobacterium iliopiscarium and the newly recognized 'Photobacterium kishitanii'. Previously reported non-luminous strains, which had been identified phenotypically as P. phosphoreum, resolved unambiguously as P. iliopiscarium, and all examined deep-sea fishes (specimens of families Chlorophthalmidae, Macrouridae, Moridae, Trachichthyidae and Acropomatidae) were found to harbour 'P. kishitanii', not P. phosphoreum, in their light organs. This resolution revealed also that 'P. kishitanii' is cosmopolitan in its geographic distribution. Furthermore, the lack of phylogenetic variation within 'P. kishitanii' indicates that this facultatively

  20. Evolutionary history determines how plant productivity responds to phylogenetic diversity and species richness

    Directory of Open Access Journals (Sweden)

    Mark A. Genung

    2014-03-01

    Full Text Available The relationship between biodiversity and ecosystem function has received a great deal of attention in ecological research and recent results, from re-analyses, suggest that ecosystem function improves with increases in phylogenetic diversity. However, many of these results have been generalized across a range of different species and clades, and plants with different evolutionary histories could display different relationships between biodiversity and ecosystem function. To experimentally test this hypothesis, we manipulated species richness and phylogenetic diversity using 26 species from two subgenera of the genus Eucalyptus (subgenus Eucalyptus and subgenus Symphyomyrtus. We found that plant biomass (a measurement of ecosystem function sometimes, but not always, responded to increases in species richness and phylogenetic diversity. Specifically, Symphyomyrtus plants showed a positive response while no comparable effect was observed for Eucalyptus plants, showing that responses to biodiversity can vary across different phylogenetic groups. Our results show that the impacts of evolutionary history may complicate the relationship between the diversity of plant communities and plant biomass.

  1. Orthology prediction at scalable resolution by phylogenetic tree analysis

    Directory of Open Access Journals (Sweden)

    Huynen Martijn A

    2007-03-01

    Full Text Available Abstract Background Orthology is one of the cornerstones of gene function prediction. Dividing the phylogenetic relations between genes into either orthologs or paralogs is however an oversimplification. Already in two-species gene-phylogenies, the complicated, non-transitive nature of phylogenetic relations results in inparalogs and outparalogs. For situations with more than two species we lack semantics to specifically describe the phylogenetic relations, let alone to exploit them. Published procedures to extract orthologous groups from phylogenetic trees do not allow identification of orthology at various levels of resolution, nor do they document the relations between the orthologous groups. Results We introduce "levels of orthology" to describe the multi-level nature of gene relations. This is implemented in a program LOFT (Levels of Orthology From Trees that assigns hierarchical orthology numbers to genes based on a phylogenetic tree. To decide upon speciation and gene duplication events in a tree LOFT can be instructed either to perform classical species-tree reconciliation or to use the species overlap between partitions in the tree. The hierarchical orthology numbers assigned by LOFT effectively summarize the phylogenetic relations between genes. The resulting high-resolution orthologous groups are depicted in colour, facilitating visual inspection of (large trees. A benchmark for orthology prediction, that takes into account the varying levels of orthology between genes, shows that the phylogeny-based high-resolution orthology assignments made by LOFT are reliable. Conclusion The "levels of orthology" concept offers high resolution, reliable orthology, while preserving the relations between orthologous groups. A Windows as well as a preliminary Java version of LOFT is available from the LOFT website http://www.cmbi.ru.nl/LOFT.

  2. The influence of molecular markers and methods on inferring the phylogenetic relationships between the representatives of the Arini (parrots, Psittaciformes), determined on the basis of their complete mitochondrial genomes.

    Science.gov (United States)

    Urantowka, Adam Dawid; Kroczak, Aleksandra; Mackiewicz, Paweł

    2017-07-14

    Conures are a morphologically diverse group of Neotropical parrots classified as members of the tribe Arini, which has recently been subjected to a taxonomic revision. The previously broadly defined Aratinga genus of this tribe has been split into the 'true' Aratinga and three additional genera, Eupsittula, Psittacara and Thectocercus. Popular markers used in the reconstruction of the parrots' phylogenies derive from mitochondrial DNA. However, current phylogenetic analyses seem to indicate conflicting relationships between Aratinga and other conures, and also among other Arini members. Therefore, it is not clear if the mtDNA phylogenies can reliably define the species tree. The inconsistencies may result from the variable evolution rate of the markers used or their weak phylogenetic signal. To resolve these controversies and to assess to what extent the phylogenetic relationships in the tribe Arini can be inferred from mitochondrial genomes, we compared representative Arini mitogenomes as well as examined the usefulness of the individual mitochondrial markers and the efficiency of various phylogenetic methods. Single molecular markers produced inconsistent tree topologies, while different methods offered various topologies even for the same marker. A significant disagreement in these tree topologies occurred for cytb, nd2 and nd6 genes, which are commonly used in parrot phylogenies. The strongest phylogenetic signal was found in the control region and RNA genes. However, these markers cannot be used alone in inferring Arini phylogenies because they do not provide fully resolved trees. The most reliable phylogeny of the parrots under study is obtained only on the concatenated set of all mitochondrial markers. The analyses established significantly resolved relationships within the former Aratinga representatives and the main genera of the tribe Arini. Such mtDNA phylogeny can be in agreement with the species tree, owing to its match with synapomorphic features in

  3. Molecular phylogenetic analysis of Enterobius vermicularis and development of an 18S ribosomal DNA-targeted diagnostic PCR.

    Science.gov (United States)

    Zelck, Ulrike E; Bialek, Ralf; Weiss, Michael

    2011-04-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed.

  4. GapCoder automates the use of indel characters in phylogenetic analysis.

    Science.gov (United States)

    Young, Nelson D; Healy, John

    2003-02-19

    Several ways of incorporating indels into phylogenetic analysis have been suggested. Simple indel coding has two strengths: (1) biological realism and (2) efficiency of analysis. In the method, each indel with different start and/or end positions is considered to be a separate character. The presence/absence of these indel characters is then added to the data set. We have written a program, GapCoder to automate this procedure. The program can input PIR format aligned datasets, find the indels and add the indel-based characters. The output is a NEXUS format file, which includes a table showing what region each indel characters is based on. If regions are excluded from analysis, this table makes it easy to identify the corresponding indel characters for exclusion. Manual implementation of the simple indel coding method can be very time-consuming, especially in data sets where indels are numerous and/or overlapping. GapCoder automates this method and is therefore particularly useful during procedures where phylogenetic analyses need to be repeated many times, such as when different alignments are being explored or when various taxon or character sets are being explored. GapCoder is currently available for Windows from http://www.home.duq.edu/~youngnd/GapCoder.

  5. Phylogenetic relationships of hexaploid large-sized barbs (genus Labeobarbus, Cyprinidae) based on mtDNA data.

    Science.gov (United States)

    Tsigenopoulos, Costas S; Kasapidis, Panagiotis; Berrebi, Patrick

    2010-08-01

    The phylogenetic relationships among species of the Labeobarbus genus (Teleostei, Cyprinidae) which comprises large body-sized hexaploid taxa were inferred using complete cytochrome b mitochondrial gene sequences. Molecular data suggest two main evolutionary groups which roughly correspond to a Northern (Middle East and Northwest Africa) and a sub-Saharan lineage. The splitting of the African hexaploids from their Asian ancestors and their subsequent diversification on the African continent occurred in the Late Miocene, a period in which other cyprinins also invaded Africa and radiated in the Mediterranean region. Finally, systematic implications of these results to the taxonomic validity of genera or subgenera such as Varicorhinus, Kosswigobarbus, Carasobarbus and Capoeta are further discussed. Copyright 2010 Elsevier Inc. All rights reserved.

  6. Diversification of Scrophularia (Scrophulariaceae) in the Western Mediterranean and Macaronesia--phylogenetic relationships, reticulate evolution and biogeographic patterns.

    Science.gov (United States)

    Scheunert, Agnes; Heubl, Günther

    2014-01-01

    The flora of the Mediterranean region and Macaronesia is characterized by high levels of species diversity and endemism. We examined phylogenetic relationships of Scrophularia within one of its secondary centers of diversity located in the Iberian Peninsula and adjacent Macaronesia. In total, 65 ingroup accessions from 45 species, representing an almost complete sampling of the region, were analyzed using sequences from the internal transcribed spacer region (ITS) and the plastid trnQ-rps16 intergenic spacer. Phylogenetic relationships were inferred using Bayesian inference, maximum likelihood and statistical parsimony networking. Incongruence between datasets was assessed with statistical tests and displayed by split networks. Biogeographic inferences incorporating information from both markers (despite low resolution in some parts of the trees) and all incongruent taxa were accomplished with a novel combination of methods, using trees generated with the taxon duplication approach as input for Bayesian binary MCMC (BBM) analysis as implemented in RASP. Nuclear and chloroplast markers support a clade which comprises the majority of Iberian and Macaronesian species and consists of three subclades. Analyses of the substantial incongruence observed among markers indicate reticulate evolution and suggest that Scrophularia species diversity in this region is largely attributable to hybridization; a combination of both polyploidy and dysploidy in the karyotypic evolution of Western Mediterranean Scrophularia taxa is proposed. Our results provide support for an ancient hybridization event between two widespread lineages, which resulted in an allopolyploid ancestor of the Iberian - Macaronesian group with 2n=58 chromosomes. The ancestor then diverged into the three main lineages present in the Iberian Peninsula, Northern Africa and Macaronesia today. Subsequent interspecific hybridizations at different ploidy levels additionally generated new species. Presumably

  7. Unrealistic phylogenetic trees may improve phylogenetic footprinting.

    Science.gov (United States)

    Nettling, Martin; Treutler, Hendrik; Cerquides, Jesus; Grosse, Ivo

    2017-06-01

    The computational investigation of DNA binding motifs from binding sites is one of the classic tasks in bioinformatics and a prerequisite for understanding gene regulation as a whole. Due to the development of sequencing technologies and the increasing number of available genomes, approaches based on phylogenetic footprinting become increasingly attractive. Phylogenetic footprinting requires phylogenetic trees with attached substitution probabilities for quantifying the evolution of binding sites, but these trees and substitution probabilities are typically not known and cannot be estimated easily. Here, we investigate the influence of phylogenetic trees with different substitution probabilities on the classification performance of phylogenetic footprinting using synthetic and real data. For synthetic data we find that the classification performance is highest when the substitution probability used for phylogenetic footprinting is similar to that used for data generation. For real data, however, we typically find that the classification performance of phylogenetic footprinting surprisingly increases with increasing substitution probabilities and is often highest for unrealistically high substitution probabilities close to one. This finding suggests that choosing realistic model assumptions might not always yield optimal predictions in general and that choosing unrealistically high substitution probabilities close to one might actually improve the classification performance of phylogenetic footprinting. The proposed PF is implemented in JAVA and can be downloaded from https://github.com/mgledi/PhyFoo. : martin.nettling@informatik.uni-halle.de. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

  8. PALM: a paralleled and integrated framework for phylogenetic inference with automatic likelihood model selectors.

    Directory of Open Access Journals (Sweden)

    Shu-Hwa Chen

    Full Text Available BACKGROUND: Selecting an appropriate substitution model and deriving a tree topology for a given sequence set are essential in phylogenetic analysis. However, such time consuming, computationally intensive tasks rely on knowledge of substitution model theories and related expertise to run through all possible combinations of several separate programs. To ensure a thorough and efficient analysis and avert tedious manipulations of various programs, this work presents an intuitive framework, the phylogenetic reconstruction with automatic likelihood model selectors (PALM, with convincing, updated algorithms and a best-fit model selection mechanism for seamless phylogenetic analysis. METHODOLOGY: As an integrated framework of ClustalW, PhyML, MODELTEST, ProtTest, and several in-house programs, PALM evaluates the fitness of 56 substitution models for nucleotide sequences and 112 substitution models for protein sequences with scores in various criteria. The input for PALM can be either sequences in FASTA format or a sequence alignment file in PHYLIP format. To accelerate the computing of maximum likelihood and bootstrapping, this work integrates MPICH2/PhyML, PalmMonitor and Palm job controller across several machines with multiple processors and adopts the task parallelism approach. Moreover, an intuitive and interactive web component, PalmTree, is developed for displaying and operating the output tree with options of tree rooting, branches swapping, viewing the branch length values, and viewing bootstrapping score, as well as removing nodes to restart analysis iteratively. SIGNIFICANCE: The workflow of PALM is straightforward and coherent. Via a succinct, user-friendly interface, researchers unfamiliar with phylogenetic analysis can easily use this server to submit sequences, retrieve the output, and re-submit a job based on a previous result if some sequences are to be deleted or added for phylogenetic reconstruction. PALM results in an inference of

  9. On the Quirks of Maximum Parsimony and Likelihood on Phylogenetic Networks

    OpenAIRE

    Bryant, Christopher; Fischer, Mareike; Linz, Simone; Semple, Charles

    2015-01-01

    Maximum parsimony is one of the most frequently-discussed tree reconstruction methods in phylogenetic estimation. However, in recent years it has become more and more apparent that phylogenetic trees are often not sufficient to describe evolution accurately. For instance, processes like hybridization or lateral gene transfer that are commonplace in many groups of organisms and result in mosaic patterns of relationships cannot be represented by a single phylogenetic tree. This is why phylogene...

  10. Phylogenetic relationships of cone snails endemic to Cabo Verde based on mitochondrial genomes.

    Science.gov (United States)

    Abalde, Samuel; Tenorio, Manuel J; Afonso, Carlos M L; Uribe, Juan E; Echeverry, Ana M; Zardoya, Rafael

    2017-11-25

    Due to their great species and ecological diversity as well as their capacity to produce hundreds of different toxins, cone snails are of interest to evolutionary biologists, pharmacologists and amateur naturalists alike. Taxonomic identification of cone snails still relies mostly on the shape, color, and banding patterns of the shell. However, these phenotypic traits are prone to homoplasy. Therefore, the consistent use of genetic data for species delimitation and phylogenetic inference in this apparently hyperdiverse group is largely wanting. Here, we reconstruct the phylogeny of the cones endemic to Cabo Verde archipelago, a well-known radiation of the group, using mitochondrial (mt) genomes. The reconstructed phylogeny grouped the analyzed species into two main clades, one including Kalloconus from West Africa sister to Trovaoconus from Cabo Verde and the other with a paraphyletic Lautoconus due to the sister group relationship of Africonus from Cabo Verde and Lautoconus ventricosus from Mediterranean Sea and neighboring Atlantic Ocean to the exclusion of Lautoconus endemic to Senegal (plus Lautoconus guanche from Mauritania, Morocco, and Canary Islands). Within Trovaoconus, up to three main lineages could be distinguished. The clade of Africonus included four main lineages (named I to IV), each further subdivided into two monophyletic groups. The reconstructed phylogeny allowed inferring the evolution of the radula in the studied lineages as well as biogeographic patterns. The number of cone species endemic to Cabo Verde was revised under the light of sequence divergence data and the inferred phylogenetic relationships. The sequence divergence between continental members of the genus Kalloconus and island endemics ascribed to the genus Trovaoconus is low, prompting for synonymization of the latter. The genus Lautoconus is paraphyletic. Lautoconus ventricosus is the closest living sister group of genus Africonus. Diversification of Africonus was in allopatry

  11. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences.

    Science.gov (United States)

    Macey, J Robert; Papenfuss, Theodore J; Kuehl, Jennifer V; Fourcade, H Mathew; Boore, Jeffrey L

    2004-10-01

    Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in Bipes biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with the block cob, trnT, trnP, as they are in birds.

  12. Phylogenetic relationships among amphisbaenian reptiles based on complete mitochondrial genomic sequences

    Energy Technology Data Exchange (ETDEWEB)

    Macey, J. Robert; Papenfuss, Theodore J.; Kuehl, Jennifer V.; Fourcade, H. Matthew; Boore, Jeffrey L.

    2004-05-19

    Complete mitochondrial genomic sequences are reported from 12 members in the four families of the reptile group Amphisbaenia. Analysis of 11,946 aligned nucleotide positions (5,797 informative) produces a robust phylogenetic hypothesis. The family Rhineuridae is basal and Bipedidae is the sister taxon to the Amphisbaenidae plus Trogonophidae. Amphisbaenian reptiles are surprisingly old, predating the breakup of Pangaea 200 million years before present, because successive basal taxa (Rhineuridae and Bipedidae) are situated in tectonic regions of Laurasia and nested taxa (Amphisbaenidae and Trogonophidae) are found in Gondwanan regions. Thorough sampling within the Bipedidae shows that it is not tectonic movement of Baja California away from the Mexican mainland that is primary in isolating Bipes species, but rather that primary vicariance occurred between northern and southern groups. Amphisbaenian families show parallel reduction in number of limbs and Bipes species exhibit parallel reduction in number of digits. A measure is developed for comparing the phylogenetic information content of various genes. A synapomorphic trait defining the Bipedidae is a shift from the typical vertebrate mitochondrial gene arrangement to the derived state of trnE and nad6. In addition, a tandem duplication of trnT and trnP is observed in B. biporus with a pattern of pseudogene formation that varies among populations. The first case of convergent rearrangement of the mitochondrial genome among animals demonstrated by complete genomic sequences is reported. Relative to most vertebrates, the Rhineuridae has the block nad6, trnE switched in order with cob, trnT, trnP, as they are in birds.

  13. Folding and unfolding phylogenetic trees and networks.

    Science.gov (United States)

    Huber, Katharina T; Moulton, Vincent; Steel, Mike; Wu, Taoyang

    2016-12-01

    Phylogenetic networks are rooted, labelled directed acyclic graphswhich are commonly used to represent reticulate evolution. There is a close relationship between phylogenetic networks and multi-labelled trees (MUL-trees). Indeed, any phylogenetic network N can be "unfolded" to obtain a MUL-tree U(N) and, conversely, a MUL-tree T can in certain circumstances be "folded" to obtain aphylogenetic network F(T) that exhibits T. In this paper, we study properties of the operations U and F in more detail. In particular, we introduce the class of stable networks, phylogenetic networks N for which F(U(N)) is isomorphic to N, characterise such networks, and show that they are related to the well-known class of tree-sibling networks. We also explore how the concept of displaying a tree in a network N can be related to displaying the tree in the MUL-tree U(N). To do this, we develop aphylogenetic analogue of graph fibrations. This allows us to view U(N) as the analogue of the universal cover of a digraph, and to establish a close connection between displaying trees in U(N) and reconciling phylogenetic trees with networks.

  14. Molecular Phylogenetic Analysis of Enterobius vermicularis and Development of an 18S Ribosomal DNA-Targeted Diagnostic PCR▿

    Science.gov (United States)

    Zelck, Ulrike E.; Bialek, Ralf; Weiß, Michael

    2011-01-01

    We genetically characterized pinworms obtained from 37 children from different regions of Germany and established new species-specific molecular diagnostic tools. No ribosomal DNA diversity was found; the phylogenetic position of Enterobius vermicularis within the Oxyurida order and its close relationship to the Ascaridida and Spirurida orders was confirmed. PMID:21248085

  15. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    [Banerjee P. and Singh B. N. 2017 The Drosophila bipectinata species complex: phylogenetic relationship among different members based on chromosomal variations. J. Genet. 96, 97–107]. Introduction ..... loops touch the chromocenter and in our microphotograph. (depicting both the arms) too, the involvement of chromo-.

  16. Phylogenetic analysis of several Thermus strains from Rehai of Tengchong, Yunnan, China.

    Science.gov (United States)

    Lin, Lianbing; Zhang, Jie; Wei, Yunlin; Chen, Chaoyin; Peng, Qian

    2005-10-01

    Several Thermus strains were isolated from 10 hot springs of the Rehai geothermal area in Tengchong, Yunnan province. The diversity of Thermus strains was examined by sequencing the 16S rRNA genes and comparing their sequences. Phylogenetic analysis showed that the 16S rDNA sequences from the Rehai geothermal isolates form four branches in the phylogenetic tree and had greater than 95.9% similarity in the phylogroup. Secondary structure comparison also indicated that the 16S rRNA from the Rehai geothermal isolates have unique secondary structure characteristics in helix 6, helix 9, and helix 10 (reference to Escherichia coli). This research is the first attempt to reveal the diversity of Thermus strains that are distributed in the Rehai geothermal area.

  17. Integration of morphological data sets for phylogenetic analysis of Amniota: the importance of integumentary characters and increased taxonomic sampling.

    Science.gov (United States)

    Hill, Robert V

    2005-08-01

    Several mutually exclusive hypotheses have been advanced to explain the phylogenetic position of turtles among amniotes. Traditional morphology-based analyses place turtles among extinct anapsids (reptiles with a solid skull roof), whereas more recent studies of both morphological and molecular data support an origin of turtles from within Diapsida (reptiles with a doubly fenestrated skull roof). Evaluation of these conflicting hypotheses has been hampered by nonoverlapping taxonomic samples and the exclusion of significant taxa from published analyses. Furthermore, although data from soft tissues and anatomical systems such as the integument may be particularly relevant to this problem, they are often excluded from large-scale analyses of morphological systematics. Here, conflicting hypotheses of turtle relationships are tested by (1) combining published data into a supermatrix of morphological characters to address issues of character conflict and missing data; (2) increasing taxonomic sampling by more than doubling the number of operational taxonomic units to test internal relationships within suprageneric ingroup taxa; and (3) increasing character sampling by approximately 25% by adding new data on the osteology and histology of the integument, an anatomical system that has been historically underrepresented in morphological systematics. The morphological data set assembled here represents the largest yet compiled for Amniota. Reevaluation of character data from prior studies of amniote phylogeny favors the hypothesis that turtles indeed have diapsid affinities. Addition of new ingroup taxa alone leads to a decrease in overall phylogenetic resolution, indicating that existing characters used for amniote phylogeny are insufficient to explain the evolution of more highly nested taxa. Incorporation of new data from the soft and osseous components of the integument, however, helps resolve relationships among both basal and highly nested amniote taxa. Analysis of a

  18. Phylogenetic trees

    OpenAIRE

    Baños, Hector; Bushek, Nathaniel; Davidson, Ruth; Gross, Elizabeth; Harris, Pamela E.; Krone, Robert; Long, Colby; Stewart, Allen; Walker, Robert

    2016-01-01

    We introduce the package PhylogeneticTrees for Macaulay2 which allows users to compute phylogenetic invariants for group-based tree models. We provide some background information on phylogenetic algebraic geometry and show how the package PhylogeneticTrees can be used to calculate a generating set for a phylogenetic ideal as well as a lower bound for its dimension. Finally, we show how methods within the package can be used to compute a generating set for the join of any two ideals.

  19. Time spans and spacers: Molecular phylogenetic explorations in the Cladophora complex (Chlorophyta) from the perspective of rDNA gene and spacer sequences

    OpenAIRE

    Bakker, Frederik Theodoor

    1995-01-01

    In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be paraphyletic with respect to Cladophora species and includes several genera shich werde traditionally ascribed to the Siphonocladales (Chapter 3). ... Zie: Summary/Samenvatting

  20. Phylogenetic relationships of the freshwater alga Boldia erythrosiphon (Compsopogonales, Rhodophyta) based on 18S rRNA gene sequences

    NARCIS (Netherlands)

    Holton, R.W; Boele-Bos, S.A.; Stam, W.T.

    The nuclear small-subunit ribosomal DNA sequence from the freshwater red alga Boldia erythrosiphon Herndon emend Howard et Parker was determined. Phylogenetic analysis confirms the positioning of this species within the bangiophycidean order of the Compsopogonales. The results strongly suggest that

  1. Phylogenetic analysis of methanogens from the bovine rumen

    Directory of Open Access Journals (Sweden)

    Forster Robert J

    2001-05-01

    Full Text Available Abstract Background Interest in methanogens from ruminants has resulted from the role of methane in global warming and from the fact that cattle typically lose 6 % of ingested energy as methane. Several species of methanogens have been isolated from ruminants. However they are difficult to culture, few have been consistently found in high numbers, and it is likely that major species of rumen methanogens are yet to be identified. Results Total DNA from clarified bovine rumen fluid was amplified using primers specific for Archaeal 16S rRNA gene sequences (rDNA. Phylogenetic analysis of 41 rDNA sequences identified three clusters of methanogens. The largest cluster contained two distinct subclusters with rDNA sequences similar to Methanobrevibacter ruminantium 16S rDNA. A second cluster contained sequences related to 16S rDNA from Methanosphaera stadtmanae, an organism not previously described in the rumen. The third cluster contained rDNA sequences that may form a novel group of rumen methanogens. Conclusions The current set of 16S rRNA hybridization probes targeting methanogenic Archaea does not cover the phylogenetic diversity present in the rumen and possibly other gastro-intestinal tract environments. New probes and quantitative PCR assays are needed to determine the distribution of the newly identified methanogen clusters in rumen microbial communities.

  2. Chloroplast genes as genetic markers for inferring patterns of change, maternal ancestry and phylogenetic relationships among Eleusine species.

    Science.gov (United States)

    Agrawal, Renuka; Agrawal, Nitin; Tandon, Rajesh; Raina, Soom Nath

    2014-01-01

    Assessment of phylogenetic relationships is an important component of any successful crop improvement programme, as wild relatives of the crop species often carry agronomically beneficial traits. Since its domestication in East Africa, Eleusine coracana (2n = 4x = 36), a species belonging to the genus Eleusine (x = 8, 9, 10), has held a prominent place in the semi-arid regions of India, Nepal and Africa. The patterns of variation between the cultivated and wild species reported so far and the interpretations based upon them have been considered primarily in terms of nuclear events. We analysed, for the first time, the phylogenetic relationship between finger millet (E. coracana) and its wild relatives by species-specific chloroplast deoxyribonucleic acid (cpDNA) polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and chloroplast simple sequence repeat (cpSSR) markers/sequences. Restriction fragment length polymorphism of the seven amplified chloroplast genes/intergenic spacers (trnK, psbD, psaA, trnH-trnK, trnL-trnF, 16S and trnS-psbC), nucleotide sequencing of the chloroplast trnK gene and chloroplast microsatellite polymorphism were analysed in all nine known species of Eleusine. The RFLP of all seven amplified chloroplast genes/intergenic spacers and trnK gene sequences in the diploid (2n = 16, 18, 20) and allotetraploid (2n = 36, 38) species resulted in well-resolved phylogenetic trees with high bootstrap values. Eleusine coracana, E. africana, E. tristachya, E. indica and E. kigeziensis did not show even a single change in restriction site. Eleusine intermedia and E. floccifolia were also shown to have identical cpDNA fragment patterns. The cpDNA diversity in Eleusine multiflora was found to be more extensive than that of the other eight species. The trnK gene sequence data complemented the results obtained by PCR-RFLP. The maternal lineage of all three allotetraploid species (AABB, AADD) was the same, with E. indica being the

  3. Efficient FPT Algorithms for (Strict) Compatibility of Unrooted Phylogenetic Trees.

    Science.gov (United States)

    Baste, Julien; Paul, Christophe; Sau, Ignasi; Scornavacca, Celine

    2017-04-01

    In phylogenetics, a central problem is to infer the evolutionary relationships between a set of species X; these relationships are often depicted via a phylogenetic tree-a tree having its leaves labeled bijectively by elements of X and without degree-2 nodes-called the "species tree." One common approach for reconstructing a species tree consists in first constructing several phylogenetic trees from primary data (e.g., DNA sequences originating from some species in X), and then constructing a single phylogenetic tree maximizing the "concordance" with the input trees. The obtained tree is our estimation of the species tree and, when the input trees are defined on overlapping-but not identical-sets of labels, is called "supertree." In this paper, we focus on two problems that are central when combining phylogenetic trees into a supertree: the compatibility and the strict compatibility problems for unrooted phylogenetic trees. These problems are strongly related, respectively, to the notions of "containing as a minor" and "containing as a topological minor" in the graph community. Both problems are known to be fixed parameter tractable in the number of input trees k, by using their expressibility in monadic second-order logic and a reduction to graphs of bounded treewidth. Motivated by the fact that the dependency on k of these algorithms is prohibitively large, we give the first explicit dynamic programming algorithms for solving these problems, both running in time [Formula: see text], where n is the total size of the input.

  4. Piscine reovirus: Genomic and molecular phylogenetic analysis from farmed and wild salmonids collected on the Canada/US Pacific Coast

    Science.gov (United States)

    Siah, Ahmed; Morrison, Diane B.; Fringuelli, Elena; Savage, Paul S.; Richmond, Zina; Purcell, Maureen K.; Johns, Robert; Johnson, Stewart C.; Sakasida, Sonja M.

    2015-01-01

    Piscine reovirus (PRV) is a double stranded non-enveloped RNA virus detected in farmed and wild salmonids. This study examined the phylogenetic relationships among different PRV sequence types present in samples from salmonids in Western Canada and the US, including Alaska (US), British Columbia (Canada) and Washington State (US). Tissues testing positive for PRV were partially sequenced for segment S1, producing 71 sequences that grouped into 10 unique sequence types. Sequence analysis revealed no identifiable geographical or temporal variation among the sequence types. Identical sequence types were found in fish sampled in 2001, 2005 and 2014. In addition, PRV positive samples from fish derived from Alaska, British Columbia and Washington State share identical sequence types. Comparative analysis of the phylogenetic tree indicated that Canada/US Pacific Northwest sequences formed a subgroup with some Norwegian sequence types (group II), distinct from other Norwegian and Chilean sequences (groups I, III and IV). Representative PRV positive samples from farmed and wild fish in British Columbia and Washington State were subjected to genome sequencing using next generation sequencing methods. Individual analysis of each of the 10 partial segments indicated that the Canadian and US PRV sequence types clustered separately from available whole genome sequences of some Norwegian and Chilean sequences for all segments except the segment S4. In summary, PRV was genetically homogenous over a large geographic distance (Alaska to Washington State), and the sequence types were relatively stable over a 13 year period.

  5. Probing the phylogenetic relationships of a few newly recorded intertidal zoanthids of Gujarat coast (India) with mtDNA COI sequences.

    Science.gov (United States)

    Joseph, Sneha; Poriya, Paresh; Kundu, Rahul

    2016-11-01

    The present study reports the phylogenetic relationship of six zoanthid species belonging to three genera, Isaurus, Palythoa, and Zoanthus identified using systematic computational analysis of mtDNA gene sequences. All six species are first recorded from the coasts of Kathiawar Peninsula, India. Genus: Isaurus is represented by Isaurus tuberculatus, genus Zoanthus is represented by Zoanthus kuroshio and Zoanthus sansibaricus, while genus Palythoa is represented by Palythoa tuberculosa, P. sp. JVK-2006 and Palythoa heliodiscus. Results of the present study revealed that among the various species observed along the coastline, a minimum of 99% sequence divergence and a maximum of 96% sequence divergence were seen. An interspecific divergence of 1-4% and negligible intraspecific divergence was observed. These results not only highlighted the efficiency of the COI gene region in species identification but also demonstrated the genetic variability of zoanthids along the Saurashtra coastline of the west coast of India.

  6. A family history of DUX4: phylogenetic analysis of DUXA, B, C and Duxbl reveals the ancestral DUX gene

    Directory of Open Access Journals (Sweden)

    Hewitt Jane E

    2010-11-01

    Full Text Available Abstract Background DUX4 is causally involved in the molecular pathogenesis of the neuromuscular disorder facioscapulohumeral muscular dystrophy (FSHD. It has previously been proposed to have arisen by retrotransposition of DUXC, one of four known intron-containing DUX genes. Here, we investigate the evolutionary history of this multi-member double-homeobox gene family in eutherian mammals. Results Our analysis of the DUX family shows the distribution of different homologues across the mammalian class, including events of secondary loss. Phylogenetic comparison, analysis of gene structures and information from syntenic regions confirm the paralogous relationship of Duxbl and DUXB and characterize their relationship with DUXA and DUXC. We further identify Duxbl pseudogene orthologues in primates. A survey of non-mammalian genomes identified a single-homeobox gene (sDUX as a likely representative homologue of the mammalian DUX ancestor before the homeobox duplication. Based on the gene structure maps, we suggest a possible mechanism for the generation of the DUX gene structure. Conclusions Our study underlines how secondary loss of orthologues can obscure the true ancestry of individual gene family members. Their relationships should be considered when interpreting the relevance of functional data from DUX4 homologues such as Dux and Duxbl to FSHD.

  7. Ixodes ricinus tick lipocalins: identification, cloning, phylogenetic analysis and biochemical characterization.

    Directory of Open Access Journals (Sweden)

    Jérôme Beaufays

    Full Text Available BACKGROUND: During their blood meal, ticks secrete a wide variety of proteins that interfere with their host's defense mechanisms. Among these proteins, lipocalins play a major role in the modulation of the inflammatory response. METHODOLOGY/PRINCIPAL FINDINGS: Screening a cDNA library in association with RT-PCR and RACE methodologies allowed us to identify 14 new lipocalin genes in the salivary glands of the Ixodes ricinus hard tick. A computational in-depth structural analysis confirmed that LIRs belong to the lipocalin family. These proteins were called LIR for "Lipocalin from I. ricinus" and numbered from 1 to 14 (LIR1 to LIR14. According to their percentage identity/similarity, LIR proteins may be assigned to 6 distinct phylogenetic groups. The mature proteins have calculated pM and pI varying from 21.8 kDa to 37.2 kDa and from 4.45 to 9.57 respectively. In a western blot analysis, all recombinant LIRs appeared as a series of thin bands at 50-70 kDa, suggesting extensive glycosylation, which was experimentally confirmed by treatment with N-glycosidase F. In addition, the in vivo expression analysis of LIRs in I. ricinus, examined by RT-PCR, showed homogeneous expression profiles for certain phylogenetic groups and relatively heterogeneous profiles for other groups. Finally, we demonstrated that LIR6 codes for a protein that specifically binds leukotriene B4. CONCLUSIONS/SIGNIFICANCE: This work confirms that, regarding their biochemical properties, expression profile, and sequence signature, lipocalins in Ixodes hard tick genus, and more specifically in the Ixodes ricinus species, are segregated into distinct phylogenetic groups suggesting potential distinct function. This was particularly demonstrated by the ability of LIR6 to scavenge leukotriene B4. The other LIRs did not bind any of the ligands tested, such as 5-hydroxytryptamine, ADP, norepinephrine, platelet activating factor, prostaglandins D2 and E2, and finally leukotrienes B4 and C

  8. Phylogenetic relationships among Neoechinorhynchus species (Acanthocephala: Neoechinorhynchidae) from North-East Asia based on molecular data.

    Science.gov (United States)

    Malyarchuk, Boris; Derenko, Miroslava; Mikhailova, Ekaterina; Denisova, Galina

    2014-02-01

    Phylogenetic and statistical analyses of DNA sequences of two genes, cytochrome oxidase subunit 1 (cox 1) of the mitochondrial DNA and 18S subunit of the nuclear ribosomal RNA (18S rRNA), was used to characterize Neoechinorhynchus species from fishes collected in different localities of North-East Asia. It has been found that four species can be clearly recognized using molecular markers-Neoechinorhynchus tumidus, Neoechinorhynchus beringianus, Neoechinorhynchus simansularis and Neoechinorhynchus salmonis. 18S sequences ascribed to Neoechinorhynchus crassus specimens from North-East Asia were identical to those of N. tumidus, but differed substantially from North American N. crassus. We renamed North-East Asian N. crassus specimens to N. sp., although the possibility that they represent a subspecies of N. tumidus cannot be excluded, taking into account a relatively small distance between cox 1 sequences of North-East Asian specimens of N. crassus and N. tumidus. Maximum likelihood, maximum parsimony and Bayesian inference analyses were performed for phylogeny reconstruction. All the phylogenetic trees showed that North-East Asian species of Neoechinorhynchus analyzed in this study represent independent clades, with the only exception of N. tumidus and N. sp. for 18S data. Phylogenetic analysis has shown that the majority of species sampled (N. tumidus+N. sp., N. simansularis and N. beringianus) are probably very closely related, while N. salmonis occupies separate position in the trees, possibly indicating a North American origin of this species. © 2013.

  9. Re-Evaluation of Phylogenetic Relationships among Species of the Mangrove Genus Avicennia from Indo-West Pacific Based on Multilocus Analyses.

    Science.gov (United States)

    Li, Xinnian; Duke, Norman C; Yang, Yuchen; Huang, Lishi; Zhu, Yuxiang; Zhang, Zhang; Zhou, Renchao; Zhong, Cairong; Huang, Yelin; Shi, Suhua

    2016-01-01

    Avicennia L. (Avicenniaceae), one of the most diverse mangrove genera, is distributed widely in tropical and subtropical intertidal zones worldwide. Five species of Avicennia in the Indo-West Pacific region have been previously described. However, their phylogenetic relationships were determined based on morphological and allozyme data. To enhance our understanding of evolutionary patterns in the clade, we carried out a molecular phylogenetic study using wide sampling and multiple loci. Our results support two monophyletic clades across all species worldwide in Avicennia: an Atlantic-East Pacific (AEP) lineage and an Indo-West Pacific (IWP) lineage. This split is in line with biogeographic distribution of the clade. Focusing on the IWP branch, we reconstructed a detailed phylogenetic tree based on sequences from 25 nuclear genes. The results identified three distinct subclades, (1) A. rumphiana and A. alba, (2) A. officinalis and A. integra, and (3) the A. marina complex, with high bootstrap support. The results strongly corresponded to two morphological traits in floral structure: stigma position in relation to the anthers and style length. Using Bayesian dating methods we estimated diversification of the IWP lineage was dated to late Miocene (c. 6.0 million years ago) and may have been driven largely by the fluctuating sea levels since that time.

  10. Re-Evaluation of Phylogenetic Relationships among Species of the Mangrove Genus Avicennia from Indo-West Pacific Based on Multilocus Analyses.

    Directory of Open Access Journals (Sweden)

    Xinnian Li

    Full Text Available Avicennia L. (Avicenniaceae, one of the most diverse mangrove genera, is distributed widely in tropical and subtropical intertidal zones worldwide. Five species of Avicennia in the Indo-West Pacific region have been previously described. However, their phylogenetic relationships were determined based on morphological and allozyme data. To enhance our understanding of evolutionary patterns in the clade, we carried out a molecular phylogenetic study using wide sampling and multiple loci. Our results support two monophyletic clades across all species worldwide in Avicennia: an Atlantic-East Pacific (AEP lineage and an Indo-West Pacific (IWP lineage. This split is in line with biogeographic distribution of the clade. Focusing on the IWP branch, we reconstructed a detailed phylogenetic tree based on sequences from 25 nuclear genes. The results identified three distinct subclades, (1 A. rumphiana and A. alba, (2 A. officinalis and A. integra, and (3 the A. marina complex, with high bootstrap support. The results strongly corresponded to two morphological traits in floral structure: stigma position in relation to the anthers and style length. Using Bayesian dating methods we estimated diversification of the IWP lineage was dated to late Miocene (c. 6.0 million years ago and may have been driven largely by the fluctuating sea levels since that time.

  11. Phylogenetic representativeness: a new method for evaluating taxon sampling in evolutionary studies

    Directory of Open Access Journals (Sweden)

    Passamonti Marco

    2010-04-01

    Full Text Available Abstract Background Taxon sampling is a major concern in phylogenetic studies. Incomplete, biased, or improper taxon sampling can lead to misleading results in reconstructing evolutionary relationships. Several theoretical methods are available to optimize taxon choice in phylogenetic analyses. However, most involve some knowledge about the genetic relationships of the group of interest (i.e., the ingroup, or even a well-established phylogeny itself; these data are not always available in general phylogenetic applications. Results We propose a new method to assess taxon sampling developing Clarke and Warwick statistics. This method aims to measure the "phylogenetic representativeness" of a given sample or set of samples and it is based entirely on the pre-existing available taxonomy of the ingroup, which is commonly known to investigators. Moreover, our method also accounts for instability and discordance in taxonomies. A Python-based script suite, called PhyRe, has been developed to implement all analyses we describe in this paper. Conclusions We show that this method is sensitive and allows direct discrimination between representative and unrepresentative samples. It is also informative about the addition of taxa to improve taxonomic coverage of the ingroup. Provided that the investigators' expertise is mandatory in this field, phylogenetic representativeness makes up an objective touchstone in planning phylogenetic studies.

  12. A phylogenetic analysis of the grape genus (Vitis L.) reveals broad reticulation and concurrent diversification during neogene and quaternary climate change.

    Science.gov (United States)

    Wan, Yizhen; Schwaninger, Heidi R; Baldo, Angela M; Labate, Joanne A; Zhong, Gan-Yuan; Simon, Charles J

    2013-07-05

    Grapes are one of the most economically important fruit crops. There are about 60 species in the genus Vitis. The phylogenetic relationships among these species are of keen interest for the conservation and use of this germplasm. We selected 309 accessions from 48 Vitis species,varieties, and outgroups, examined ~11 kb (~3.4 Mb total) of aligned nuclear DNA sequences from 27 unlinked genes in a phylogenetic context, and estimated divergence times based on fossil calibrations. Vitis formed a strongly supported clade. There was substantial support for species and less for the higher-level groupings (series). As estimated from extant taxa, the crown age of Vitis was 28 Ma and the divergence of subgenera (Vitis and Muscadinia) occurred at ~18 Ma. Higher clades in subgenus Vitis diverged 16 - 5 Ma with overlapping confidence intervals, and ongoing divergence formed extant species at 12 - 1.3 Ma. Several species had species-specific SNPs. NeighborNet analysis showed extensive reticulation at the core of subgenus Vitis representing the deeper nodes, with extensive reticulation radiating outward. Fitch Parsimony identified North America as the origin of the most recent common ancestor of extant Vitis species. Phylogenetic patterns suggested origination of the genus in North America, fragmentation of an ancestral range during the Miocene, formation of extant species in the late Miocene-Pleistocene, and differentiation of species in the context of Pliocene-Quaternary tectonic and climatic change. Nuclear SNPs effectively resolved relationships at and below the species level in grapes and rectified several misclassifications of accessions in the repositories. Our results challenge current higher-level classifications, reveal the abundance of genetic diversity in the genus that is potentially available for crop improvement, and provide a valuable resource for species delineation, germplasm conservation and use.

  13. Phylogenetic analysis, genetic diversity and relationships between the recently segregated species of Corynandra and Cleoserrata from the genus Cleome using DNA barcoding and molecular markers.

    Science.gov (United States)

    Tamboli, Asif Shabodin; Patil, Swapnil Mahadeo; Gholave, Avinash Ramchandra; Kadam, Suhas Kishor; Kotibhaskar, Shreya Vijaykumar; Yadav, Shrirang Ramchandra; Govindwar, Sanjay Prabhu

    2016-01-01

    Cleome is the largest genus in the family Cleomaceae and it is known for its various medicinal properties. Recently, some species from the Cleome genus (Cleome viscosa, Cleome chelidonii, Cleome felina and Cleome speciosa) are split into genera Corynandra (Corynandra viscosa, Corynandra chelidonii, Corynandra felina), and Cleoserrata (Cleoserrata speciosa). The objective of this study was to obtain DNA barcodes for these species for their accurate identification and determining phylogenetic relationships. Out of 10 screened barcoding regions, rbcL, matK and ITS1 regions showed higher PCR efficiency and sequencing success. This study added matK, rbcL and ITS1 barcodes for the identification of Corynandra chelidonii, Corynandra felina, Cleome simplicifolia and Cleome aspera species in existing barcode data. Corynandra chelidonii and Corynandra felina species belong to the Corynandra genus, but they are not grouped with the Corynandra viscosa species, however clustered with the Cleome species. Molecular marker analysis showed 100% polymorphism among the studied plant samples. Diversity indices for molecular markers were ranged from He=0.1115-0.1714 and I=0.2268-0.2700, which indicates a significant amount of genetic diversity among studied species. Discrimination of the Cleome and Corynandra species from Cleoserrata speciosa was obtained by two RAPD primers (OPA-4 and RAPD-17) and two ISSR primers (ISSR-1 and ISSR-2). RAPD and ISSR markers are useful for the genetic characterization of these studied species. The present investigation will be helpful to understand the relationships of Cleome lineages with Corynandra and Cleoserrata species. Copyright © 2016 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  14. Complete mitochondrial genomes reveal phylogeny relationship and evolutionary history of the family Felidae.

    Science.gov (United States)

    Zhang, W Q; Zhang, M H

    2013-09-03

    Many mitochondrial DNA sequences are used to estimate phylogenetic relationships among animal taxa and perform molecular phylogenetic evolution analysis. With the continuous development of sequencing technology, numerous mitochondrial sequences have been released in public databases, especially complete mitochondrial DNA sequences. Using multiple sequences is better than using single sequences for phylogenetic analysis of animals because multiple sequences have sufficient information for evolutionary process reconstruction. Therefore, we performed phylogenetic analyses of 14 species of Felidae based on complete mitochondrial genome sequences, with Canis familiaris as an outgroup, using neighbor joining, maximum likelihood, maximum parsimony, and Bayesian inference methods. The consensus phylogenetic trees supported the monophyly of Felidae, and the family could be divided into 2 subfamilies, Felinae and Pantherinae. The genus Panthera and species tigris were also studied in detail. Meanwhile, the divergence of this family was estimated by phylogenetic analysis using the Bayesian method with a relaxed molecular clock, and the results shown were consistent with previous studies. In summary, the evolution of Felidae was reconstructed by phylogenetic analysis based on mitochondrial genome sequences. The described method may be broadly applicable for phylogenetic analyses of anima taxa.

  15. Phylogenetic analysis of P5 P-type ATPases, a eukaryotic lineage of secretory pathway pumps

    DEFF Research Database (Denmark)

    Møller, Annette; Asp, Torben; Holm, Preben Bach

    2008-01-01

    prokaryotic genome. Based on a protein alignment we could group the P5 ATPases into two subfamilies, P5A and P5B that, based on the number of negative charges in conserved trans-membrane segment 4, are likely to have different ion specificities. P5A ATPases are present in all eukaryotic genomes sequenced so......Eukaryotes encompass a remarkable variety of organisms and unresolved lineages. Different phylogenetic analyses have lead to conflicting conclusions as to the origin and associations between lineages and species. In this work, we investigated evolutionary relationship of a family of cation pumps...... exclusive for the secretory pathway of eukaryotes by combining the identification of lineage-specific genes with phylogenetic evolution of common genes. Sequences of P5 ATPases, which are regarded to be cation pumps in the endoplasmic reticulum (ER), were identified in all eukaryotic lineages but not in any...

  16. Complete Mitochondrial Genome of the Red Fox (Vuples vuples) and Phylogenetic Analysis with Other Canid Species.

    Science.gov (United States)

    Zhong, Hua-Ming; Zhang, Hong-Hai; Sha, Wei-Lai; Zhang, Cheng-De; Chen, Yu-Cai

    2010-04-01

    The whole mitochondrial genome sequence of red fox (Vuples vuples) was determined. It had a total length of 16 723 bp. As in most mammal mitochondrial genome, it contained 13 protein coding genes, two ribosome RNA genes, 22 transfer RNA genes and one control region. The base composition was 31.3% A, 26.1% C, 14.8% G and 27.8% T, respectively. The codon usage of red fox, arctic fox, gray wolf, domestic dog and coyote followed the same pattern except for an unusual ATT start codon, which initiates the NADH dehydrogenase subunit 3 gene in the red fox. A long tandem repeat rich in AC was found between conserved sequence block 1 and 2 in the control region. In order to confirm the phylogenetic relationships of red fox to other canids, phylogenetic trees were reconstructed by neighbor-joining and maximum parsimony methods using 12 concatenated heavy-strand protein-coding genes. The result indicated that arctic fox was the sister group of red fox and they both belong to the red fox-like clade in family Canidae, while gray wolf, domestic dog and coyote belong to wolf-like clade. The result was in accordance with existing phylogenetic results.

  17. Analysis of Comparative Sequence and Genomic Data to Verify Phylogenetic Relationship and Explore a New Subfamily of Bacterial Lipases.

    Directory of Open Access Journals (Sweden)

    Malihe Masomian

    Full Text Available Thermostable and organic solvent-tolerant enzymes have significant potential in a wide range of synthetic reactions in industry due to their inherent stability at high temperatures and their ability to endure harsh organic solvents. In this study, a novel gene encoding a true lipase was isolated by construction of a genomic DNA library of thermophilic Aneurinibacillus thermoaerophilus strain HZ into Escherichia coli plasmid vector. Sequence analysis revealed that HZ lipase had 62% identity to putative lipase from Bacillus pseudomycoides. The closely characterized lipases to the HZ lipase gene are from thermostable Bacillus and Geobacillus lipases belonging to the subfamily I.5 with ≤ 57% identity. The amino acid sequence analysis of HZ lipase determined a conserved pentapeptide containing the active serine, GHSMG and a Ca(2+-binding motif, GCYGSD in the enzyme. Protein structure modeling showed that HZ lipase consisted of an α/β hydrolase fold and a lid domain. Protein sequence alignment, conserved regions analysis, clustal distance matrix and amino acid composition illustrated differences between HZ lipase and other thermostable lipases. Phylogenetic analysis revealed that this lipase represented a new subfamily of family I of bacterial true lipases, classified as family I.9. The HZ lipase was expressed under promoter Plac using IPTG and was characterized. The recombinant enzyme showed optimal activity at 65 °C and retained ≥ 97% activity after incubation at 50 °C for 1h. The HZ lipase was stable in various polar and non-polar organic solvents.

  18. Diversity of 16S-23S rDNA internal transcribed spacer (ITS reveals phylogenetic relationships in Burkholderia pseudomallei and its near-neighbors.

    Directory of Open Access Journals (Sweden)

    Andrew P Liguori

    Full Text Available Length polymorphisms within the 16S-23S ribosomal DNA internal transcribed spacer (ITS have been described as stable genetic markers for studying bacterial phylogenetics. In this study, we used these genetic markers to investigate phylogenetic relationships in Burkholderia pseudomallei and its near-relative species. B. pseudomallei is known as one of the most genetically recombined bacterial species. In silico analysis of multiple B. pseudomallei genomes revealed approximately four homologous rRNA operons and ITS length polymorphisms therein. We characterized ITS distribution using PCR and analyzed via a high-throughput capillary electrophoresis in 1,191 B. pseudomallei strains. Three major ITS types were identified, two of which were commonly found in most B. pseudomallei strains from the endemic areas, whereas the third one was significantly correlated with worldwide sporadic strains. Interestingly, mixtures of the two common ITS types were observed within the same strains, and at a greater incidence in Thailand than Australia suggesting that genetic recombination causes the ITS variation within species, with greater recombination frequency in Thailand. In addition, the B. mallei ITS type was common to B. pseudomallei, providing further support that B. mallei is a clone of B. pseudomallei. Other B. pseudomallei near-neighbors possessed unique and monomorphic ITS types. Our data shed light on evolutionary patterns of B. pseudomallei and its near relative species.

  19. Prokaryotic diversity, composition structure, and phylogenetic analysis of microbial communities in leachate sediment ecosystems.

    Science.gov (United States)

    Liu, Jingjing; Wu, Weixiang; Chen, Chongjun; Sun, Faqian; Chen, Yingxu

    2011-09-01

    In order to obtain insight into the prokaryotic diversity and community in leachate sediment, a culture-independent DNA-based molecular phylogenetic approach was performed with archaeal and bacterial 16S rRNA gene clone libraries derived from leachate sediment of an aged landfill. A total of 59 archaeal and 283 bacterial rDNA phylotypes were identified in 425 archaeal and 375 bacterial analyzed clones. All archaeal clones distributed within two archaeal phyla of the Euryarchaeota and Crenarchaeota, and well-defined methanogen lineages, especially Methanosaeta spp., are the most numerically dominant species of the archaeal community. Phylogenetic analysis of the bacterial library revealed a variety of pollutant-degrading and biotransforming microorganisms, including 18 distinct phyla. A substantial fraction of bacterial clones showed low levels of similarity with any previously documented sequences and thus might be taxonomically new. Chemical characteristics and phylogenetic inferences indicated that (1) ammonium-utilizing bacteria might form consortia to alleviate or avoid the negative influence of high ammonium concentration on other microorganisms, and (2) members of the Crenarchaeota found in the sediment might be involved in ammonium oxidation. This study is the first to report the composition of the microbial assemblages and phylogenetic characteristics of prokaryotic populations extant in leachate sediment. Additional work on microbial activity and contaminant biodegradation remains to be explored.

  20. Phylogenetic signal dissection identifies the root of starfishes.

    Directory of Open Access Journals (Sweden)

    Roberto Feuda

    Full Text Available Relationships within the class Asteroidea have remained controversial for almost 100 years and, despite many attempts to resolve this problem using molecular data, no consensus has yet emerged. Using two nuclear genes and a taxon sampling covering the major asteroid clades we show that non-phylogenetic signal created by three factors--Long Branch Attraction, compositional heterogeneity and the use of poorly fitting models of evolution--have confounded accurate estimation of phylogenetic relationships. To overcome the effect of this non-phylogenetic signal we analyse the data using non-homogeneous models, site stripping and the creation of subpartitions aimed to reduce or amplify the systematic error, and calculate Bayes Factor support for a selection of previously suggested topological arrangements of asteroid orders. We show that most of the previous alternative hypotheses are not supported in the most reliable data partitions, including the previously suggested placement of either Forcipulatida or Paxillosida as sister group to the other major branches. The best-supported solution places Velatida as the sister group to other asteroids, and the implications of this finding for the morphological evolution of asteroids are presented.

  1. Phylogenetic relationships of Erysimum (Brassicaceae from the Baetic Mountains (SE Iberian Peninsula

    Directory of Open Access Journals (Sweden)

    Abdelaziz, Mohamed

    2014-06-01

    Full Text Available The Baetic mountains, located in the southern Iberian Peninsula, is a major hotspot of biodiversity in the Mediterranean Basin, constituting one of the most important glacial refugia for vascular plants in Europe. Despite their relatively limited extension, the Baetic Mountains contain almost 50% of the total endemic Erysimum species in the Iberian Peninsula. The broadly distributed Erysimum genus has diversified profusely in the Mediterranean region, with more than a hundred species described in the area, out of a total of c. 200 species included in the genus. We used two plastid DNA regions (ndhF and trnT-L and one nuclear DNA region (ITS1-5.8S rDNA-ITS2, with 3,556 bp total length, to carry out phylogenetic analysis by Bayesian inference, maximum likelihood and maximum parsimony, in order to explore the evolutionary relationships between the Erysimum species inhabiting these ranges. Analyses of concatenated sequences from the two genomes identified two main clades with no overlap in species composition so that samples from the same species fell within the same major clade. The phylogenetic relationships depicted by those two clades do not give support to the E. nevadense group, previously proposed on taxonomic grounds. In addition, our results indicated recurrent changes in flower colour in the Baetic Erysimum species although, alternatively, reticulate evolution, which is suggested by incongruent position of taxa in the different trees, may have also affected this trait.Las cordilleras Béticas, localizadas en el sudeste de la Península Ibérica, representan una importante zona para la biodiversidad de la cuenca mediterránea, constituyendo uno de los refugios glaciares más destacados de plantas vasculares en Europa. A pesar de su extensión relativamente limitada, las cordilleras Béticas albergan casi el 50% del total de las especies endémicas de Erysimum de la Península Ibérica. Erysimum es un género ampliamente distribuido, que se

  2. Identification and phylogenetic analysis of Tityus pachyurus and Tityus obscurus novel putative Na+-channel scorpion toxins.

    Directory of Open Access Journals (Sweden)

    Jimmy A Guerrero-Vargas

    Full Text Available Colombia and Brazil are affected by severe cases of scorpionism. In Colombia the most dangerous accidents are caused by Tityus pachyurus that is widely distributed around this country. In the Brazilian Amazonian region scorpion stings are a common event caused by Tityus obscurus. The main objective of this work was to perform the molecular cloning of the putative Na(+-channel scorpion toxins (NaScTxs from T. pachyurus and T. obscurus venom glands and to analyze their phylogenetic relationship with other known NaScTxs from Tityus species.cDNA libraries from venom glands of these two species were constructed and five nucleotide sequences from T. pachyurus were identified as putative modulators of Na(+-channels, and were named Tpa4, Tpa5, Tpa6, Tpa7 and Tpa8; the latter being the first anti-insect excitatory β-class NaScTx in Tityus scorpion venom to be described. Fifteen sequences from T. obscurus were identified as putative NaScTxs, among which three had been previously described, and the others were named To4 to To15. The peptides Tpa4, Tpa5, Tpa6, To6, To7, To9, To10 and To14 are closely related to the α-class NaScTxs, whereas Tpa7, Tpa8, To4, To8, To12 and To15 sequences are more related to the β-class NaScTxs. To5 is possibly an arthropod specific toxin. To11 and To13 share sequence similarities with both α and β NaScTxs. By means of phylogenetic analysis using the Maximum Parsimony method and the known NaScTxs from Tityus species, these toxins were clustered into 14 distinct groups.This communication describes new putative NaScTxs from T. pachyurus and T. obscurus and their phylogenetic analysis. The results indicate clear geographic separation between scorpions of Tityus genus inhabiting the Amazonian and Mountain Andes regions and those distributed over the Southern of the Amazonian rainforest. Based on the consensus sequences for the different clusters, a new nomenclature for the NaScTxs is proposed.

  3. Phylogenetic inferences of Atelinae (Platyrrhini) based on multi-directional chromosome painting in Brachyteles arachnoides, Ateles paniscus paniscus and Ateles b. marginatus.

    Science.gov (United States)

    de Oliveira, E H C; Neusser, M; Pieczarka, J C; Nagamachi, C; Sbalqueiro, I J; Müller, S

    2005-01-01

    We performed multi-directional chromosome painting in a comparative cytogenetic study of the three Atelinae species Brachyteles arachnoides, Ateles paniscus paniscus and Ateles belzebuth marginatus, in order to reconstruct phylogenetic relationships within this Platyrrhini subfamily. Comparative chromosome maps between these species were established by multi-color fluorescence in situ hybridization (FISH) employing human, Saguinus oedipus and Lagothrix lagothricha chromosome-specific probes. The three species included in this study and four previously analyzed species from all four Atelinae genera were subjected to a phylogenetic analysis on the basis of a data matrix comprised of 82 discrete chromosome characters. The results confirmed that Atelinae represent a monophyletic clade with a putative ancestral karyotype of 2n = 62 chromosomes. Phylogenetic analysis revealed an evolutionary branching sequence [Alouatta [Brachyteles [Lagothrix and Ateles

  4. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

    Science.gov (United States)

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

    2010-01-01

    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  5. Continuous osteological characters in the reconstruction of phylogenetic relationships of the six Euro-Mediterranean mullet species (Mugilidae).

    Science.gov (United States)

    Antović, Ivanka

    2013-09-01

    Sixty-three continuous osteological characters (18 skull continuous characters and the total length of neurocranium, 45 continuous characters of 15 elements of the viscerodermal skeleton) were analyzed and included in the reconstruction of phylogenetic relationships of the six Euro-Mediterranean mullet species from the South Adriatic Sea: Mugil cephalus Linnaeus, 1758; Liza saliens Risso, 1810; Liza aurata Risso, 1810; Liza ramada Risso, 1826; Chelon labrosus Risso, 1826 and Oedalechilus labeo Cuvier, 1829. The study reveals that Sphyraenidae was separated clearly from Mugilidae, C. labrosus and three Liza species form a common cluster (L. ramada and L. saliens being the closest), while O. labeo and M. cephalus cluster together.

  6. Let's jump in: A phylogenetic study of the great basin springfishes and poolfishes, Crenichthys and Empetrichthys (Cyprinodontiformes: Goodeidae.

    Directory of Open Access Journals (Sweden)

    D Cooper Campbell

    Full Text Available North America's Great Basin has long been of interest to biologists due to its high level of organismal endemicity throughout its endorheic watersheds. One example of such a group is the subfamily Empetricthyinae. In this paper, we analyzed the relationships of the Empetrichtyinae and assessed the validity of the subspecies designations given by Williams and Wilde within the group using concatenated phylogenetic tree estimation and species tree estimation. Samples from 19 populations were included covering the entire distribution of the three extant species of Empetricthyinae-Crenichthys nevadae, Crenichthys baileyi and Empetricthys latos. Three nuclear introns (S8 intron 4, S7 intron 1, and P0 intron 1 and one mitochondrial gene (Cytb were sequenced for phylogenetic analysis. Using these sequences, we generated two separate hypotheses of the evolutionary relationships of Empetrichtyinae- one based on the mitochondrial data and one based on the nuclear data using Bayesian phylogenetics. Haplotype networks were also generated to look at the relationships of the populations within Empetrichthyinae. After comparing the two phylogenetic hypotheses, species trees were generated using *BEAST with the nuclear data to further test the validity of the subspecies within Empetrichthyinae. The mitochondrial analyses supported four lineages within C. baileyi and 2 within C. nevadae. The concatenated nuclear tree was more conserved, supporting one clade and an unresolved polytomy in both species. The species tree analysis supported the presence of two species within both C. baileyi and C. nevadae. Based on the results of these analyses, the subspecies designations of Williams and Wilde are not valid, rather a conservative approach suggests there are two species within C. nevadae and two species within C. baileyi. No structure was found for E. latos or the populations of Empetricthyinae. This study represents one of many demonstrating the invalidity of

  7. Phylogenetic analysis reveals a high prevalence of Sporothrix brasiliensis in feline sporotrichosis outbreaks.

    Science.gov (United States)

    Rodrigues, Anderson Messias; de Melo Teixeira, Marcus; de Hoog, G Sybren; Schubach, Tânia Maria Pacheco; Pereira, Sandro Antonio; Fernandes, Geisa Ferreira; Bezerra, Leila Maria Lopes; Felipe, Maria Sueli; de Camargo, Zoilo Pires

    2013-01-01

    Sporothrix schenckii, previously assumed to be the sole agent of human and animal sporotrichosis, is in fact a species complex. Recently recognized taxa include S. brasiliensis, S. globosa, S. mexicana, and S. luriei, in addition to S. schenckii sensu stricto. Over the last decades, large epidemics of sporotrichosis occurred in Brazil due to zoonotic transmission, and cats were pointed out as key susceptible hosts. In order to understand the eco-epidemiology of feline sporotrichosis and its role in human sporotrichosis a survey was conducted among symptomatic cats. Prevalence and phylogenetic relationships among feline Sporothrix species were investigated by reconstructing their phylogenetic origin using the calmodulin (CAL) and the translation elongation factor-1 alpha (EF1α) loci in strains originated from Rio de Janeiro (RJ, n = 15), Rio Grande do Sul (RS, n = 10), Paraná (PR, n = 4), São Paulo (SP, n =3) and Minas Gerais (MG, n = 1). Our results showed that S. brasiliensis is highly prevalent among cats (96.9%) with sporotrichosis, while S. schenckii was identified only once. The genotype of Sporothrix from cats was found identical to S. brasiliensis from human sources confirming that the disease is transmitted by cats. Sporothrix brasiliensis presented low genetic diversity compared to its sister taxon S. schenckii. No evidence of recombination in S. brasiliensis was found by split decomposition or PHI-test analysis, suggesting that S. brasiliensis is a clonal species. Strains recovered in states SP, MG and PR share the genotype of the RJ outbreak, different from the RS clone. The occurrence of separate genotypes among strains indicated that the Brazilian S. brasiliensis epidemic has at least two distinct sources. We suggest that cats represent a major host and the main source of cat and human S. brasiliensis infections in Brazil.

  8. PyElph - a software tool for gel images analysis and phylogenetics

    Directory of Open Access Journals (Sweden)

    Pavel Ana Brânduşa

    2012-01-01

    Full Text Available Abstract Background This paper presents PyElph, a software tool which automatically extracts data from gel images, computes the molecular weights of the analyzed molecules or fragments, compares DNA patterns which result from experiments with molecular genetic markers and, also, generates phylogenetic trees computed by five clustering methods, using the information extracted from the analyzed gel image. The software can be successfully used for population genetics, phylogenetics, taxonomic studies and other applications which require gel image analysis. Researchers and students working in molecular biology and genetics would benefit greatly from the proposed software because it is free, open source, easy to use, has a friendly Graphical User Interface and does not depend on specific image acquisition devices like other commercial programs with similar functionalities do. Results PyElph software tool is entirely implemented in Python which is a very popular programming language among the bioinformatics community. It provides a very friendly Graphical User Interface which was designed in six steps that gradually lead to the results. The user is guided through the following steps: image loading and preparation, lane detection, band detection, molecular weights computation based on a molecular weight marker, band matching and finally, the computation and visualization of phylogenetic trees. A strong point of the software is the visualization component for the processed data. The Graphical User Interface provides operations for image manipulation and highlights lanes, bands and band matching in the analyzed gel image. All the data and images generated in each step can be saved. The software has been tested on several DNA patterns obtained from experiments with different genetic markers. Examples of genetic markers which can be analyzed using PyElph are RFLP (Restriction Fragment Length Polymorphism, AFLP (Amplified Fragment Length Polymorphism, RAPD

  9. [Genome-wide identification, phylogenetic analysis and expression profiling of the WOX family genes in Solanum lycopersicum].

    Science.gov (United States)

    Li, Xiao-xu; Liu, Cheng; Li, Wei; Zhang, Zeng-lin; Gao, Xiao-ming; Zhou, Hui; Guo, Yong-feng

    2016-05-01

    Members of the plant-specific WOX transcription factor family have been reported to play important roles in cell to cell communication as well as other physiological and developmental processes. In this study, ten members of the WOX transcription factor family were identified in Solanum lycopersicum with HMMER. Neighbor-joining phylogenetic tree, maximum-likelihood tree and Bayesian-inference tree were constructed and similar topologies were shown using the protein sequences of the homeodomain. Phylogenetic study revealed that the 25 WOX family members from Arabidopsis and tomato fall into three clades and nine subfamilies. The patterns of exon-intron structures and organization of conserved domains in Arabidopsis and tomato were consistent based on the phylogenetic results. Transcriptome analysis showed that the expression patterns of SlWOXs were different in different tissue types. Gene Ontology (GO) analysis suggested that, as transcription factors, the SlWOX family members could be involved in a number of biological processes including cell to cell communication and tissue development. Our results are useful for future studies on WOX family members in tomato and other plant species.

  10. Ecosystem Functions across Trophic Levels Are Linked to Functional and Phylogenetic Diversity

    Science.gov (United States)

    Thompson, Patrick L.; Davies, T. Jonathan; Gonzalez, Andrew

    2015-01-01

    In experimental systems, it has been shown that biodiversity indices based on traits or phylogeny can outperform species richness as predictors of plant ecosystem function. However, it is unclear whether this pattern extends to the function of food webs in natural ecosystems. Here we tested whether zooplankton functional and phylogenetic diversity explains the functioning of 23 natural pond communities. We used two measures of ecosystem function: (1) zooplankton community biomass and (2) phytoplankton abundance (Chl a). We tested for diversity-ecosystem function relationships within and across trophic levels. We found a strong correlation between zooplankton diversity and ecosystem function, whereas local environmental conditions were less important. Further, the positive diversity-ecosystem function relationships were more pronounced for measures of functional and phylogenetic diversity than for species richness. Zooplankton and phytoplankton biomass were best predicted by different indices, suggesting that the two functions are dependent upon different aspects of diversity. Zooplankton community biomass was best predicted by zooplankton trait-based functional richness, while phytoplankton abundance was best predicted by zooplankton phylogenetic diversity. Our results suggest that the positive relationship between diversity and ecosystem function can extend across trophic levels in natural environments, and that greater insight into variation in ecosystem function can be gained by combining functional and phylogenetic diversity measures. PMID:25693188

  11. Polytomy identification in microbial phylogenetic reconstruction

    Directory of Open Access Journals (Sweden)

    Lin Guan

    2011-12-01

    Full Text Available Abstract Background A phylogenetic tree, showing ancestral relations among organisms, is commonly represented as a rooted tree with sets of bifurcating branches (dichotomies for simplicity, although polytomies (multifurcating branches may reflect more accurate evolutionary relationships. To represent the true evolutionary relationships, it is important to systematically identify the polytomies from a bifurcating tree and generate a taxonomy-compatible multifurcating tree. For this purpose we propose a novel approach, "PolyPhy", which would classify a set of bifurcating branches of a phylogenetic tree into a set of branches with dichotomies and polytomies by considering genome distances among genomes and tree topological properties. Results PolyPhy employs a machine learning technique, BLR (Bayesian logistic regression classifier, to identify possible bifurcating subtrees as polytomies from the trees resulted from ComPhy. Other than considering genome-scale distances between all pairs of species, PolyPhy also takes into account different properties of tree topology between dichotomy and polytomy, such as long-branch retraction and short-branch contraction, and quantifies these properties into comparable rates among different sub-branches. We extract three tree topological features, 'LR' (Leaf rate, 'IntraR' (Intra-subset branch rate and 'InterR' (Inter-subset branch rate, all of which are calculated from bifurcating tree branch sets for classification. We have achieved F-measure (balanced measure between precision and recall of 81% with about 0.9 area under the curve (AUC of ROC. Conclusions PolyPhy is a fast and robust method to identify polytomies from phylogenetic trees based on genome-wide inference of evolutionary relationships among genomes. The software package and test data can be downloaded from http://digbio.missouri.edu/ComPhy/phyloTreeBiNonBi-1.0.zip.

  12. Discovery of Conservation and Diversification of miR171 Genes by Phylogenetic Analysis based on Global Genomes

    Directory of Open Access Journals (Sweden)

    Xudong Zhu

    2015-07-01

    Full Text Available The microRNA171 (miR171 family is widely distributed and highly conserved in a range of species and plays critical roles in regulating plant growth and development through repressing expression of ( transcription factors. However, information on the evolutionary conservation and functional diversification of the miRNA171 family members remains scanty. We reconstructed the phylogenetic relationships among miR171 precursor and mature sequences so as to investigate the extent and degree of evolutionary conservation of miR171 in (L. Heynh. (ath, grape ( L. (vvi, poplar ( Torr. & A.Gray ex Hook. (ptc, and rice ( L. (osa. Despite strong conservation of over 80%, some mature miR171 sequences, such as , and and , -, and -, have undergone critical sequence variation, leading to functional diversification, since they target non gene transcript(s. Phylogenetic analyses revealed a combination of old ancestral relationships and recent lineage-specific diversification in the miR171 family within the four model plants. The -regulatory motifs on the upstream promoter sequences of genes were highly divergent and shared some similar elements, indicating their possible contribution to the functional variation observed within the miR171 family. This study will buttress our understanding of the functional differentiation of miRNAs and the relationships of miRNA–target pairs based on the evolutionary history of genes.

  13. Phylogenetic relationships of leopard frogs (Rana pipiens complex) from an isolated coastal mountain range in southern Sonora, Mexico.

    Science.gov (United States)

    Pfeiler, E; Markow, T A

    2008-10-01

    Mitochondrial DNA sequence data from the control region and 12S rRNA in leopard frogs from the Sierra El Aguaje of southern Sonora, Mexico, together with GenBank sequences, were used to infer taxonomic identity and provide phylogenetic hypotheses for relationships with other members of the Rana pipiens complex. We show that frogs from the Sierra El Aguaje belong to the Rana berlandieri subgroup, or Scurrilirana clade, of the R. pipiens group, and are most closely related to Rana magnaocularis from Nayarit, Mexico. We also provide further evidence that Rana magnaocularis and R. yavapaiensis are close relatives.

  14. Estimating phylogenetic trees from genome-scale data.

    Science.gov (United States)

    Liu, Liang; Xi, Zhenxiang; Wu, Shaoyuan; Davis, Charles C; Edwards, Scott V

    2015-12-01

    The heterogeneity of signals in the genomes of diverse organisms poses challenges for traditional phylogenetic analysis. Phylogenetic methods known as "species tree" methods have been proposed to directly address one important source of gene tree heterogeneity, namely the incomplete lineage sorting that occurs when evolving lineages radiate rapidly, resulting in a diversity of gene trees from a single underlying species tree. Here we review theory and empirical examples that help clarify conflicts between species tree and concatenation methods, and misconceptions in the literature about the performance of species tree methods. Considering concatenation as a special case of the multispecies coalescent model helps explain differences in the behavior of the two methods on phylogenomic data sets. Recent work suggests that species tree methods are more robust than concatenation approaches to some of the classic challenges of phylogenetic analysis, including rapidly evolving sites in DNA sequences and long-branch attraction. We show that approaches, such as binning, designed to augment the signal in species tree analyses can distort the distribution of gene trees and are inconsistent. Computationally efficient species tree methods incorporating biological realism are a key to phylogenetic analysis of whole-genome data. © 2015 New York Academy of Sciences.

  15. Phylogenetic analysis of rabbit haemorrhagic disease virus (RHDV) strains isolated in Poland.

    Science.gov (United States)

    Fitzner, Andrzej; Niedbalski, Wieslaw

    2017-10-01

    The aim of this study was to characterise the nucleotide and amino acid sequence of complete genomes (7.5 kb) from RHDV strains isolated in Poland and estimate the genetic variability in different elements of the viral RNA. In addition, the sequence of Polish RHDV isolates isolated from 1988-2015 was compared with the sequences of other European RHDV, including the RHDVa and RHDV2/RHDVb subtypes. The complete sequence was developed by the compilation of partial nucleotide sequences. This sequence consisted of approximately 7428 nucleotides. For comparison of nucleotide sequences and the development of phylogenetic trees of Polish RHDV isolates and reference RHDV strains representing the main phylogenetic groups of classical RHDV, RHDVa and RHDV2 as well as the non-pathogenic rabbit lagovirus RCV, the BLAST software with blastn and MEGA6 with neighbour-joining method was applied. The complete nucleotide sequence of Polish isolates of RHDV has also been entered into GenBank. For comparative analysis, nineteen complete sequences representing the main RHDV genetic types available in GenBank were used. The results of phylogenetic analysis of Polish RHDV strains reveals the presence of three classical RHDV genogroups (G2, G4 and G5) and an RHDVa variant (G6). The oldest RHDV isolates (KGM 1988, PD 1989 and MAL 1994) belong to genogroup G2. It can be assumed that the elimination of these strains from the environment probably occurred at the turn of 1994 and 1995. Genogroup G2 was replaced by the phylogenetically younger BLA 1994 and OPO 2004 strains from genogroup G4, which probably originated from the G3 lineage, represented by the Italian strains BS89. The last representatives of classical RHDV in Poland are isolates GSK 1988 and ZD0 2000 from genogroup G5. A single clade contains the Polish RHDV strains from 2004-2015 (GRZ 2004, KRY 2004, L145 2004, W147 2005, SKO 2013, GLE 2013, RED1 2013, STR 2012, STR2 2013, STR 2014, BIE 2015) identified as RHDVa, which clustered

  16. Isolation, Genome Phylogenetic Analysis and In vitro Rescue of a Newly Emerging Porcine Circovirus Type 2

    Directory of Open Access Journals (Sweden)

    Weijuan Zhu and Xiaofeng Ren*

    2012-05-01

    Full Text Available Porcine circovirus type 2 (PCV2 is the major causative agent of post-weaning multisystemic wasting syndrome (PMWS. Infection by PCV2 may cause heavy losses in pig industry. In this study, we report the isolation of a newly emerging PCV2 from northeastern China. The complete genome of the PCV2 isolate named PCV2-LJR contains 1766 nucleotides and was compared with reference sequences published in GenBank followed by topology analysis of the resulting phylogenetic tree. The data indicated that the prevalent PCV2 isolates in the northeastern China had close relationship, although various genotypes of PCV2 existed. In addition, by gene recombination and transfection techniques, the PCV2 infectious clone was achieved and was able to rescue virus in vitro determined by indirect immunofluorescence assay and PCR. The obtained biological materials may be used for biological characterization of PCV2.

  17. Recurrent hybridization and recent origin obscure phylogenetic relationships within the ‘white-headed’ gull (Larus sp.) complex

    Science.gov (United States)

    Sonsthagen, Sarah A.; Wilson, Robert E.; Chesser, Terry; Pons, Jean-Marc; Crochet, Pierre-Andre; Driscoll, Amy; Dove, Carla

    2016-01-01

    Species complexes that have undergone recent radiations are often characterized by extensive allele sharing due to recent ancestry and (or) introgressive hybridization. This can result in discordant evolutionary histories of genes and heterogeneous genomes, making delineating species limits difficult. Here we examine the phylogenetic relationships among a complex group of birds, the white-headed gulls (Aves: Laridae), which offer a unique window into the speciation process due to their recent evolutionary history and propensity to hybridize. Relationships were examined among 17 species (61 populations) using a multilocus approach, including mitochondrial and nuclear intron DNA sequences and microsatellite genotype information. Analyses of microsatellite and intron data resulted in some species-based groupings, although most species were not represented by a single cluster. Considerable allele and haplotype sharing among white-headed gull species was observed; no locus contained a species-specific clade. Despite this, our multilocus approach provided better resolution among some species than previous studies. Interestingly, most clades appear to correspond to geographic locality: our BEAST analysis recovered strong support for a northern European/Icelandic clade, a southern European/Russian clade, and a western North American/canus clade, with weak evidence for a high latitude clade spanning North America and northwestern Europe. This geographical structuring is concordant with behavioral observations of pervasive hybridization in areas of secondary contact. The extent of allele and haplotype sharing indicates that ecological and sexual selection are likely not strong enough to complete reproductive isolation within several species in the white-headed gull complex. This suggests that just a few genes are driving the speciation process.

  18. Extended molecular phylogenetics and revised systematics of Malagasy scincine lizards.

    Science.gov (United States)

    Erens, Jesse; Miralles, Aurélien; Glaw, Frank; Chatrou, Lars W; Vences, Miguel

    2017-02-01

    Among the endemic biota of Madagascar, skinks are a diverse radiation of lizards that exhibit a striking ecomorphological variation, and could provide an interesting system to study body-form evolution in squamate reptiles. We provide a new phylogenetic hypothesis for Malagasy skinks of the subfamily Scincinae based on an extended molecular dataset comprising 8060bp from three mitochondrial and nine nuclear loci. Our analysis also increases taxon sampling of the genus Amphiglossus by including 16 out of 25 nominal species. Additionally, we examined whether the molecular phylogenetic patterns coincide with morphological differentiation in the species currently assigned to this genus. Various methods of inference recover a mostly strongly supported phylogeny with three main clades of Amphiglossus. However, relationships among these three clades and the limb-reduced genera Grandidierina, Voeltzkowia and Pygomeles remain uncertain. Supported by a variety of morphological differences (predominantly related to the degree of body elongation), but considering the remaining phylogenetic uncertainty, we propose a redefinition of Amphiglossus into three different genera (Amphiglossus sensu stricto, Flexiseps new genus, and Brachyseps new genus) to remove the non-monophyly of Amphiglossus sensu lato and to facilitate future studies on this fascinating group of lizards. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Phylogenetic affinity of tree shrews to Glires is attributed to fast evolution rate.

    Science.gov (United States)

    Lin, Jiannan; Chen, Guangfeng; Gu, Liang; Shen, Yuefeng; Zheng, Meizhu; Zheng, Weisheng; Hu, Xinjie; Zhang, Xiaobai; Qiu, Yu; Liu, Xiaoqing; Jiang, Cizhong

    2014-02-01

    Previous phylogenetic analyses have led to incongruent evolutionary relationships between tree shrews and other suborders of Euarchontoglires. What caused the incongruence remains elusive. In this study, we identified 6845 orthologous genes between seventeen placental mammals. Tree shrews and Primates were monophyletic in the phylogenetic trees derived from the first or/and second codon positions whereas tree shrews and Glires formed a monophyly in the trees derived from the third or all codon positions. The same topology was obtained in the phylogeny inference using the slowly and fast evolving genes, respectively. This incongruence was likely attributed to the fast substitution rate in tree shrews and Glires. Notably, sequence GC content only was not informative to resolve the controversial phylogenetic relationships between tree shrews, Glires, and Primates. Finally, estimation in the confidence of the tree selection strongly supported the phylogenetic affiliation of tree shrews to Primates as a monophyly. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Inferring phylogenetic trees from the knowledge of rare evolutionary events.

    Science.gov (United States)

    Hellmuth, Marc; Hernandez-Rosales, Maribel; Long, Yangjing; Stadler, Peter F

    2018-06-01

    Rare events have played an increasing role in molecular phylogenetics as potentially homoplasy-poor characters. In this contribution we analyze the phylogenetic information content from a combinatorial point of view by considering the binary relation on the set of taxa defined by the existence of a single event separating two taxa. We show that the graph-representation of this relation must be a tree. Moreover, we characterize completely the relationship between the tree of such relations and the underlying phylogenetic tree. With directed operations such as tandem-duplication-random-loss events in mind we demonstrate how non-symmetric information constrains the position of the root in the partially reconstructed phylogeny.

  1. Linear programming model to construct phylogenetic network for 16S rRNA sequences of photosynthetic organisms and influenza viruses.

    Science.gov (United States)

    Mathur, Rinku; Adlakha, Neeru

    2014-06-01

    Phylogenetic trees give the information about the vertical relationships of ancestors and descendants but phylogenetic networks are used to visualize the horizontal relationships among the different organisms. In order to predict reticulate events there is a need to construct phylogenetic networks. Here, a Linear Programming (LP) model has been developed for the construction of phylogenetic network. The model is validated by using data sets of chloroplast of 16S rRNA sequences of photosynthetic organisms and Influenza A/H5N1 viruses. Results obtained are in agreement with those obtained by earlier researchers.

  2. Phylogenetic analysis and taxonomic revision of Physodactylinae (Coleoptera, Elateridae

    Directory of Open Access Journals (Sweden)

    Simone Policena Rosa

    2014-01-01

    Full Text Available A phylogeny based on male morphological characters and taxonomic revision of the Physodactylinae genera are presented. The phylogenetic analysis based on 66 male characters resulted in the polyphyly of Physodactylinae which comprises four independent lineages. Oligostethius and Idiotropia from Africa were found to be sister groups. Teslasena from Brazil was corroborated as belonging to Cardiophorinae clade. The South American genera Physodactylus and Dactylophysus were found to be sister groups and phylogenetically related to Heterocrepidius species. The Oriental Toxognathus resulted as sister group of that clade plus (Dicrepidius ramicornis (Lissomus sp, Physorhynus erythrocephalus. Taxonomic revisions include diagnoses and redescriptions of genera and distributional records and illustrations of species. Key to species of Teslasena, Toxognathus, Dactylophysus and Physodactylus are also provided. Teslasena lucasi is synonymized with T. femoralis. A new species of Dactylophysus is described, D. hirtus sp. nov., and lectotypes are designated to non-conspecific D. mendax sensu Fleutiaux and Heterocrepidius mendax Candèze. Physodactylus niger is removed from synonymy under P. oberthuri; P. carreti is synonymized with P. niger; P. obesus and P. testaceus are synonymized with P. sulcatus. Nine new species are described in Physodactylus: P. asper sp. nov., P. brunneus sp. nov., P. chassaini sp. nov., P. flavifrons sp. nov., P. girardi sp. nov., P. gounellei sp. nov., P. latithorax sp. nov., P. patens sp. nov. and P. tuberculatus sp. nov.

  3. Complete mitochondrial genome of four pheretimoid earthworms (Clitellata: Oligochaeta) and their phylogenetic reconstruction.

    Science.gov (United States)

    Zhang, Liangliang; Jiang, Jibao; Dong, Yan; Qiu, Jiangping

    2015-12-15

    Among oligochaetes, the Pheretima complex within the Megascolecidae is a major earthworm group. Recently, however, the systematics of the Pheretima complex based on morphology are challenged by molecular studies. Since little comparative analysis of earthworm complete mitochondrial genomes has been reported yet, we sequenced mitogenomes of four pheretimoid earthworm species to explore their phylogenetic relationships. The general earthworm genomic features are also found in four earthworms: all genes transcribed from the same strand, the same initiation codon ATG for each PCGs, and conserved structures of RNA genes. Interestingly we find an extra potential tRNA-leucine (CUN) in Amynthas longisiphonus. The earthworm mitochondrial ATP8 exhibits the highest evolutionary rate, while the gene CO1 evolves slowest. Phylogenetic analysis based on protein-coding genes (PCGs) strongly supports the monophyly of the Clitellata, Hirudinea, Oligochaeta, Megascolecidae and Pheretima complex. Our analysis, however, reveals non-monophyly within the genara Amynthas and Metaphire. Thus the generic divisions based on morphology in the Pheretima complex should be reconsidered. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Phylogenetics of the Phlebotomine Sand Fly Group Verrucarum (Diptera: Psychodidae: Lutzomyia)

    Science.gov (United States)

    Cohnstaedt, Lee W.; Beati, Lorenza; Caceres, Abraham G.; Ferro, Cristina; Munstermann, Leonard E.

    2011-01-01

    Within the sand fly genus Lutzomyia, the Verrucarum species group contains several of the principal vectors of American cutaneous leishmaniasis and human bartonellosis in the Andean region of South America. The group encompasses 40 species for which the taxonomic status, phylogenetic relationships, and role of each species in disease transmission remain unresolved. Mitochondrial cytochrome c oxidase I (COI) phylogenetic analysis of a 667-bp fragment supported the morphological classification of the Verrucarum group into series. Genetic sequences from seven species were grouped in well-supported monophyletic lineages. Four species, however, clustered in two paraphyletic lineages that indicate conspecificity—the Lutzomyia longiflocosa–Lutzomyia sauroida pair and the Lutzomyia quasitownsendi–Lutzomyia torvida pair. COI sequences were also evaluated as a taxonomic tool based on interspecific genetic variability within the Verrucarum group and the intraspecific variability of one of its members, Lutzomyia verrucarum, across its known distribution. PMID:21633028

  5. Phylogenetics of the phlebotomine sand fly group Verrucarum (Diptera: Psychodidae: Lutzomyia).

    Science.gov (United States)

    Cohnstaedt, Lee W; Beati, Lorenza; Caceres, Abraham G; Ferro, Cristina; Munstermann, Leonard E

    2011-06-01

    Within the sand fly genus Lutzomyia, the Verrucarum species group contains several of the principal vectors of American cutaneous leishmaniasis and human bartonellosis in the Andean region of South America. The group encompasses 40 species for which the taxonomic status, phylogenetic relationships, and role of each species in disease transmission remain unresolved. Mitochondrial cytochrome c oxidase I (COI) phylogenetic analysis of a 667-bp fragment supported the morphological classification of the Verrucarum group into series. Genetic sequences from seven species were grouped in well-supported monophyletic lineages. Four species, however, clustered in two paraphyletic lineages that indicate conspecificity--the Lutzomyia longiflocosa-Lutzomyia sauroida pair and the Lutzomyia quasitownsendi-Lutzomyia torvida pair. COI sequences were also evaluated as a taxonomic tool based on interspecific genetic variability within the Verrucarum group and the intraspecific variability of one of its members, Lutzomyia verrucarum, across its known distribution.

  6. Phylogenetic relationships of rollers (Coraciidae) based on complete mitochondrial genomes and fifteen nuclear genes.

    Science.gov (United States)

    Johansson, Ulf S; Irestedt, Martin; Qu, Yanhua; Ericson, Per G P

    2018-04-06

    The rollers (Coraciidae) constitute a relative small avian family with ca. 12 species distributed in Africa, western and southern Eurasia, and eastern Australia. In this study we examine the phylogenetic relationships of all species currently recognized in the family, including two taxa whose taxonomic status is currently contested. By using shotgun sequencing on degraded DNA from museum study skins we have been able to recover complete mitochondrial genomes as well as 15 nuclear genes for in total 16 taxa. The gene sequences were analyzed both concatenated in a maximum likelihood framework as well in a species tree approach using MP-EST. The different analytical approaches yield similar, highly supported trees and support the current division of the rollers into two genera, Coracias and Eurystomus. The only conflict relates to the placement of the Blue-bellied Roller (C. cyanogaster), where the mitochondrial, and the concatenated nuclear and mitochondrial data set, place this taxon as sister to the other Coracias species, whereas nuclear data and the species tree analysis place it as the sister taxon of C. naevia and C. spatulatus. All analyses place the Eurasian roller (C. garrulus) with the two African species, Abyssinian Roller (C. abyssinica) and Liliac-breasted Roller (C. caudatus), and place this clade as the sister group to the Asian Coracias rollers. In addition, our results support a sister group relationship between the morphologically rather dissimilar Purple Roller (C. naevia) and Racquet-tailed Roller (C. spatulatus) and also support the division of Eurystomus in an African and an Asian clade. However, within the Asian clade the Azure Roller (E. azureus) from Halmahera appears to be nested within the Dollarbird (E. orientalis), indicating that that this taxon is a morphological divergent, but a rather recent offshoot, of the widespread Dollarbird. Similarly, the Purple-winged Roller (C. temminickii) from Sulawesi group together with C. benghalensis

  7. Phylogenetic relationships and host range of Rhizobium spp. that nodulate Phaseolus vulgaris L.

    Science.gov (United States)

    Hernandez-Lucas, I; Segovia, L; Martinez-Romero, E; Pueppke, S G

    1995-07-01

    We determined the nucleotide sequences of 16S rRNA gene segments from five Rhizobium strains that have been isolated from tropical legume species. All share the capacity to nodulate Phaseolus vulgaris L., the common bean. Phylogenetic analysis confirmed that these strains are of two different chromosomal lineages. We defined the host ranges of two strains of Rhizobium etli and three strains of R. tropici, comparing them with those of the two most divergently related new strains. Twenty-two of the 43 tested legume species were nodulated by three or more of these strains. All seven strains have broad host ranges that include woody species such as Albizia lebbeck, Gliricidia maculata, and Leucaena leucocephala.

  8. Statistical assignment of DNA sequences using Bayesian phylogenetics

    DEFF Research Database (Denmark)

    Terkelsen, Kasper Munch; Boomsma, Wouter Krogh; Huelsenbeck, John P.

    2008-01-01

    We provide a new automated statistical method for DNA barcoding based on a Bayesian phylogenetic analysis. The method is based on automated database sequence retrieval, alignment, and phylogenetic analysis using a custom-built program for Bayesian phylogenetic analysis. We show on real data...... that the method outperforms Blast searches as a measure of confidence and can help eliminate 80% of all false assignment based on best Blast hit. However, the most important advance of the method is that it provides statistically meaningful measures of confidence. We apply the method to a re......-analysis of previously published ancient DNA data and show that, with high statistical confidence, most of the published sequences are in fact of Neanderthal origin. However, there are several cases of chimeric sequences that are comprised of a combination of both Neanderthal and modern human DNA....

  9. Analysis of Domain Architecture and Phylogenetics of Family 2 Glycoside Hydrolases (GH2.

    Directory of Open Access Journals (Sweden)

    David Talens-Perales

    Full Text Available In this work we report a detailed analysis of the topology and phylogenetics of family 2 glycoside hydrolases (GH2. We distinguish five topologies or domain architectures based on the presence and distribution of protein domains defined in Pfam and Interpro databases. All of them share a central TIM barrel (catalytic module with two β-sandwich domains (non-catalytic at the N-terminal end, but differ in the occurrence and nature of additional non-catalytic modules at the C-terminal region. Phylogenetic analysis was based on the sequence of the Pfam Glyco_hydro_2_C catalytic module present in most GH2 proteins. Our results led us to propose a model in which evolutionary diversity of GH2 enzymes is driven by the addition of different non-catalytic domains at the C-terminal region. This model accounts for the divergence of β-galactosidases from β-glucuronidases, the diversification of β-galactosidases with different transglycosylation specificities, and the emergence of bicistronic β-galactosidases. This study also allows the identification of groups of functionally uncharacterized protein sequences with potential biotechnological interest.

  10. Phylogenetic study of Theileria lestoquardi based on 18SrRNA gene Isolated from sheep in the middle region of Iraq

    Directory of Open Access Journals (Sweden)

    M.J.A. Alkhaled

    2016-12-01

    Full Text Available Theileriosis is parasitic infection causes by obligate intracellular protozoa of the genus Theileria. T. lestoquardi is the most virulent species in sheep and goats which causes a severe disease with a high morbidity and mortality rate. In this study the phylogenetic relationships between two local isolate of T. lestoquardi and nine T. lestoquardi global isolates as well as Babesia ovis out-group isolate were analyzed using the 18S rRNA gene sequence. The multiple sequence alignment analysis and neighbor joining phylogenetic tree analysis were performed by using ClustalW multiple sequence alignment online based analysis of 1098bp 18S rRNA gene was amplified by polymerase chain reaction. Phylogenetic analysis results of these gene sequences revealed that T. lestoquardi local isolates were closely related to T. lestoquardi Iran isolate (JQ917458.1 and two Iraq Kurdistan isolates (KC778786.1 and KC778785.1 more than other countries. This study represents the first report on the use of molecular phylogeny to classify T. lestoquardi obtained in Middle Region of Iraq.

  11. Phylogenetic analysis of Gossypium L. using restriction fragment length polymorphism of repeated sequences.

    Science.gov (United States)

    Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin

    2015-10-01

    Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.

  12. DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.

    Science.gov (United States)

    Eernisse, D J

    1992-04-01

    DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.

  13. Large-Scale Genomic Analysis of Codon Usage in Dengue Virus and Evaluation of Its Phylogenetic Dependence

    Science.gov (United States)

    Lara-Ramírez, Edgar E.; Salazar, Ma Isabel; López-López, María de Jesús; Salas-Benito, Juan Santiago; Sánchez-Varela, Alejandro

    2014-01-01

    The increasing number of dengue virus (DENV) genome sequences available allows identifying the contributing factors to DENV evolution. In the present study, the codon usage in serotypes 1–4 (DENV1–4) has been explored for 3047 sequenced genomes using different statistics methods. The correlation analysis of total GC content (GC) with GC content at the three nucleotide positions of codons (GC1, GC2, and GC3) as well as the effective number of codons (ENC, ENCp) versus GC3 plots revealed mutational bias and purifying selection pressures as the major forces influencing the codon usage, but with distinct pressure on specific nucleotide position in the codon. The correspondence analysis (CA) and clustering analysis on relative synonymous codon usage (RSCU) within each serotype showed similar clustering patterns to the phylogenetic analysis of nucleotide sequences for DENV1–4. These clustering patterns are strongly related to the virus geographic origin. The phylogenetic dependence analysis also suggests that stabilizing selection acts on the codon usage bias. Our analysis of a large scale reveals new feature on DENV genomic evolution. PMID:25136631

  14. The emergence of lobsters: phylogenetic relationships, morphological evolution and divergence time comparisons of an ancient group (decapoda: achelata, astacidea, glypheidea, polychelida).

    Science.gov (United States)

    Bracken-Grissom, Heather D; Ahyong, Shane T; Wilkinson, Richard D; Feldmann, Rodney M; Schweitzer, Carrie E; Breinholt, Jesse W; Bendall, Matthew; Palero, Ferran; Chan, Tin-Yam; Felder, Darryl L; Robles, Rafael; Chu, Ka-Hou; Tsang, Ling-Ming; Kim, Dohyup; Martin, Joel W; Crandall, Keith A

    2014-07-01

    Lobsters are a ubiquitous and economically important group of decapod crustaceans that include the infraorders Polychelida, Glypheidea, Astacidea and Achelata. They include familiar forms such as the spiny, slipper, clawed lobsters and crayfish and unfamiliar forms such as the deep-sea and "living fossil" species. The high degree of morphological diversity among these infraorders has led to a dynamic classification and conflicting hypotheses of evolutionary relationships. In this study, we estimated phylogenetic relationships among the major groups of all lobster families and 94% of the genera using six genes (mitochondrial and nuclear) and 195 morphological characters across 173 species of lobsters for the most comprehensive sampling to date. Lobsters were recovered as a non-monophyletic assemblage in the combined (molecular + morphology) analysis. All families were monophyletic, with the exception of Cambaridae, and 7 of 79 genera were recovered as poly- or paraphyletic. A rich fossil history coupled with dense taxon coverage allowed us to estimate and compare divergence times and origins of major lineages using two drastically different approaches. Age priors were constructed and/or included based on fossil age information or fossil discovery, age, and extant species count data. Results from the two approaches were largely congruent across deep to shallow taxonomic divergences across major lineages. The origin of the first lobster-like decapod (Polychelida) was estimated in the Devonian (∼409-372 Ma) with all infraorders present in the Carboniferous (∼353-318 Ma). Fossil calibration subsampling studies examined the influence of sampling density (number of fossils) and placement (deep, middle, and shallow) on divergence time estimates. Results from our study suggest including at least 1 fossil per 10 operational taxonomic units (OTUs) in divergence dating analyses. [Dating; decapods; divergence; lobsters; molecular; morphology; phylogenetics.]. © The

  15. Some limitations of public sequence data for phylogenetic inference (in plants).

    Science.gov (United States)

    Hinchliff, Cody E; Smith, Stephen Andrew

    2014-01-01

    The GenBank database contains essentially all of the nucleotide sequence data generated for published molecular systematic studies, but for the majority of taxa these data remain sparse. GenBank has value for phylogenetic methods that leverage data-mining and rapidly improving computational methods, but the limits imposed by the sparse structure of the data are not well understood. Here we present a tree representing 13,093 land plant genera--an estimated 80% of extant plant diversity--to illustrate the potential of public sequence data for broad phylogenetic inference in plants, and we explore the limits to inference imposed by the structure of these data using theoretical foundations from phylogenetic data decisiveness. We find that despite very high levels of missing data (over 96%), the present data retain the potential to inform over 86.3% of all possible phylogenetic relationships. Most of these relationships, however, are informed by small amounts of data--approximately half are informed by fewer than four loci, and more than 99% are informed by fewer than fifteen. We also apply an information theoretic measure of branch support to assess the strength of phylogenetic signal in the data, revealing many poorly supported branches concentrated near the tips of the tree, where data are sparse and the limiting effects of this sparseness are stronger. We argue that limits to phylogenetic inference and signal imposed by low data coverage may pose significant challenges for comprehensive phylogenetic inference at the species level. Computational requirements provide additional limits for large reconstructions, but these may be overcome by methodological advances, whereas insufficient data coverage can only be remedied by additional sampling effort. We conclude that public databases have exceptional value for modern systematics and evolutionary biology, and that a continued emphasis on expanding taxonomic and genomic coverage will play a critical role in developing

  16. Phylogenetic analysis of the grape family (Vitaceae) based on three chloroplast markers.

    Science.gov (United States)

    Soejima, Akiko; Wen, Jun

    2006-02-01

    Seventy-nine species representing 12 genera of Vitaceae were sequenced for the trnL-F spacer, 37 of which were subsequently sequenced for the atpB-rbcL spacer and the rps16 intron. Phylogenetic analysis of the combined data provided a fairly robust phylogeny for Vitaceae. Cayratia, Tetrastigma, and Cyphostemma form a clade. Cyphostemma and Tetrastigma are each monophyletic, and Cayratia may be paraphyletic. Ampelopsis is paraphyletic with the African Rhoicissus and the South American Cissus striata nested within it. The pinnately leaved Ampelopsis form a subclade, and the simple and palmately leaved Ameplopsis constitutes another with both subclades containing Asian and American species. Species of Cissus from Asia and Central America are monophyletic, but the South American C. striata does not group with other Cissus species. The Asian endemic Nothocissus and Pterisanthes form a clade with Asian Ampelocissus, and A. javalensis from Central America is sister to this clade. Vitis is monophyletic and forms a larger clade with Ampelocissus, Pterisanthes, and Nothocissus. The eastern Asian and North American disjunct Parthenocissus forms a clade with Yua austro-orientalis, a species of a small newly recognized genus from China to eastern Himalaya. Vitaceae show complex multiple intercontinental relationships within the northern hemisphere and between northern and southern hemispheres.

  17. An evaluation of phylogenetic informativeness profiles and the molecular phylogeny of diplazontinae (Hymenoptera, Ichneumonidae).

    Science.gov (United States)

    Klopfstein, Seraina; Kropf, Christian; Quicke, Donald L J

    2010-03-01

    How to quantify the phylogenetic information content of a data set is a longstanding question in phylogenetics, influencing both the assessment of data quality in completed studies and the planning of future phylogenetic projects. Recently, a method has been developed that profiles the phylogenetic informativeness (PI) of a data set through time by linking its site-specific rates of change to its power to resolve relationships at different timescales. Here, we evaluate the performance of this method in the case of 2 standard genetic markers for phylogenetic reconstruction, 28S ribosomal RNA and cytochrome oxidase subunit 1 (CO1) mitochondrial DNA, with maximum parsimony, maximum likelihood, and Bayesian analyses of relationships within a group of parasitoid wasps (Hymenoptera: Ichneumonidae, Diplazontinae). Retrieving PI profiles of the 2 genes from our own and from 3 additional data sets, we find that the method repeatedly overestimates the performance of the more quickly evolving CO1 compared with 28S. We explore possible reasons for this bias, including phylogenetic uncertainty, violation of the molecular clock assumption, model misspecification, and nonstationary nucleotide composition. As none of these provides a sufficient explanation of the observed discrepancy, we use simulated data sets, based on an idealized setting, to show that the optimum evolutionary rate decreases with increasing number of taxa. We suggest that this relationship could explain why the formula derived from the 4-taxon case overrates the performance of higher versus lower rates of evolution in our case and that caution should be taken when the method is applied to data sets including more than 4 taxa.

  18. YBYRÁ facilitates comparison of large phylogenetic trees.

    Science.gov (United States)

    Machado, Denis Jacob

    2015-07-01

    The number and size of tree topologies that are being compared by phylogenetic systematists is increasing due to technological advancements in high-throughput DNA sequencing. However, we still lack tools to facilitate comparison among phylogenetic trees with a large number of terminals. The "YBYRÁ" project integrates software solutions for data analysis in phylogenetics. It comprises tools for (1) topological distance calculation based on the number of shared splits or clades, (2) sensitivity analysis and automatic generation of sensitivity plots and (3) clade diagnoses based on different categories of synapomorphies. YBYRÁ also provides (4) an original framework to facilitate the search for potential rogue taxa based on how much they affect average matching split distances (using MSdist). YBYRÁ facilitates comparison of large phylogenetic trees and outperforms competing software in terms of usability and time efficiency, specially for large data sets. The programs that comprises this toolkit are written in Python, hence they do not require installation and have minimum dependencies. The entire project is available under an open-source licence at http://www.ib.usp.br/grant/anfibios/researchSoftware.html .

  19. Increasing phylogenetic resolution at low taxonomic levels using massively parallel sequencing of chloroplast genomes

    Directory of Open Access Journals (Sweden)

    Cronn Richard

    2009-12-01

    Full Text Available Abstract Background Molecular evolutionary studies share the common goal of elucidating historical relationships, and the common challenge of adequately sampling taxa and characters. Particularly at low taxonomic levels, recent divergence, rapid radiations, and conservative genome evolution yield limited sequence variation, and dense taxon sampling is often desirable. Recent advances in massively parallel sequencing make it possible to rapidly obtain large amounts of sequence data, and multiplexing makes extensive sampling of megabase sequences feasible. Is it possible to efficiently apply massively parallel sequencing to increase phylogenetic resolution at low taxonomic levels? Results We reconstruct the infrageneric phylogeny of Pinus from 37 nearly-complete chloroplast genomes (average 109 kilobases each of an approximately 120 kilobase genome generated using multiplexed massively parallel sequencing. 30/33 ingroup nodes resolved with ≥ 95% bootstrap support; this is a substantial improvement relative to prior studies, and shows massively parallel sequencing-based strategies can produce sufficient high quality sequence to reach support levels originally proposed for the phylogenetic bootstrap. Resampling simulations show that at least the entire plastome is necessary to fully resolve Pinus, particularly in rapidly radiating clades. Meta-analysis of 99 published infrageneric phylogenies shows that whole plastome analysis should provide similar gains across a range of plant genera. A disproportionate amount of phylogenetic information resides in two loci (ycf1, ycf2, highlighting their unusual evolutionary properties. Conclusion Plastome sequencing is now an efficient option for increasing phylogenetic resolution at lower taxonomic levels in plant phylogenetic and population genetic analyses. With continuing improvements in sequencing capacity, the strategies herein should revolutionize efforts requiring dense taxon and character sampling

  20. Early-branching euteleost relationships: areas of congruence between concatenation and coalescent model inferences

    Directory of Open Access Journals (Sweden)

    Matthew A. Campbell

    2017-09-01

    Full Text Available Phylogenetic inference based on evidence from DNA sequences has led to significant strides in the development of a stable and robustly supported framework for the vertebrate tree of life. To date, the bulk of those advances have relied on sequence data from a small number of genome regions that have proven unable to produce satisfactory answers to consistently recalcitrant phylogenetic questions. Here, we re-examine phylogenetic relationships among early-branching euteleostean fish lineages classically grouped in the Protacanthopterygii using DNA sequence data surrounding ultraconserved elements. We report and examine a dataset of thirty-four OTUs with 17,957 aligned characters from fifty-three nuclear loci. Phylogenetic analysis is conducted in concatenated, joint gene trees and species tree estimation and summary coalescent frameworks. All analytical frameworks yield supporting evidence for existing hypotheses of relationship for the placement of Lepidogalaxias salamandroides, monophyly of the Stomiatii and the presence of an esociform + salmonid clade. Lepidogalaxias salamandroides and the Esociformes + Salmoniformes are successive sister lineages to all other euteleosts in the majority of analyses. The concatenated and joint gene trees and species tree analysis types produce high support values for this arrangement. However, inter-relationships of Argentiniformes, Stomiatii and Neoteleostei remain uncertain as they varied by analysis type while receiving strong and contradictory indices of support. Topological differences between analysis types are also apparent within the otomorph and the percomorph taxa in the data set. Our results identify concordant areas with strong support for relationships within and between early-branching euteleost lineages but they also reveal limitations in the ability of larger datasets to conclusively resolve other aspects of that phylogeny.

  1. Early-branching euteleost relationships: areas of congruence between concatenation and coalescent model inferences.

    Science.gov (United States)

    Campbell, Matthew A; Alfaro, Michael E; Belasco, Max; López, J Andrés

    2017-01-01

    Phylogenetic inference based on evidence from DNA sequences has led to significant strides in the development of a stable and robustly supported framework for the vertebrate tree of life. To date, the bulk of those advances have relied on sequence data from a small number of genome regions that have proven unable to produce satisfactory answers to consistently recalcitrant phylogenetic questions. Here, we re-examine phylogenetic relationships among early-branching euteleostean fish lineages classically grouped in the Protacanthopterygii using DNA sequence data surrounding ultraconserved elements. We report and examine a dataset of thirty-four OTUs with 17,957 aligned characters from fifty-three nuclear loci. Phylogenetic analysis is conducted in concatenated, joint gene trees and species tree estimation and summary coalescent frameworks. All analytical frameworks yield supporting evidence for existing hypotheses of relationship for the placement of Lepidogalaxias salamandroides , monophyly of the Stomiatii and the presence of an esociform + salmonid clade. Lepidogalaxias salamandroides and the Esociformes + Salmoniformes are successive sister lineages to all other euteleosts in the majority of analyses. The concatenated and joint gene trees and species tree analysis types produce high support values for this arrangement. However, inter-relationships of Argentiniformes, Stomiatii and Neoteleostei remain uncertain as they varied by analysis type while receiving strong and contradictory indices of support. Topological differences between analysis types are also apparent within the otomorph and the percomorph taxa in the data set. Our results identify concordant areas with strong support for relationships within and between early-branching euteleost lineages but they also reveal limitations in the ability of larger datasets to conclusively resolve other aspects of that phylogeny.

  2. Spatial and temporal heterogeneity in high-grade serous ovarian cancer: a phylogenetic analysis.

    Directory of Open Access Journals (Sweden)

    Roland F Schwarz

    2015-02-01

    Full Text Available The major clinical challenge in the treatment of high-grade serous ovarian cancer (HGSOC is the development of progressive resistance to platinum-based chemotherapy. The objective of this study was to determine whether intra-tumour genetic heterogeneity resulting from clonal evolution and the emergence of subclonal tumour populations in HGSOC was associated with the development of resistant disease.Evolutionary inference and phylogenetic quantification of heterogeneity was performed using the MEDICC algorithm on high-resolution whole genome copy number profiles and selected genome-wide sequencing of 135 spatially and temporally separated samples from 14 patients with HGSOC who received platinum-based chemotherapy. Samples were obtained from the clinical CTCR-OV03/04 studies, and patients were enrolled between 20 July 2007 and 22 October 2009. Median follow-up of the cohort was 31 mo (interquartile range 22-46 mo, censored after 26 October 2013. Outcome measures were overall survival (OS and progression-free survival (PFS. There were marked differences in the degree of clonal expansion (CE between patients (median 0.74, interquartile range 0.66-1.15, and dichotimization by median CE showed worse survival in CE-high cases (PFS 12.7 versus 10.1 mo, p = 0.009; OS 42.6 versus 23.5 mo, p = 0.003. Bootstrap analysis with resampling showed that the 95% confidence intervals for the hazard ratios for PFS and OS in the CE-high group were greater than 1.0. These data support a relationship between heterogeneity and survival but do not precisely determine its effect size. Relapsed tissue was available for two patients in the CE-high group, and phylogenetic analysis showed that the prevalent clonal population at clinical recurrence arose from early divergence events. A subclonal population marked by a NF1 deletion showed a progressive increase in tumour allele fraction during chemotherapy.This study demonstrates that quantitative measures of intra

  3. On the quirks of maximum parsimony and likelihood on phylogenetic networks.

    Science.gov (United States)

    Bryant, Christopher; Fischer, Mareike; Linz, Simone; Semple, Charles

    2017-03-21

    Maximum parsimony is one of the most frequently-discussed tree reconstruction methods in phylogenetic estimation. However, in recent years it has become more and more apparent that phylogenetic trees are often not sufficient to describe evolution accurately. For instance, processes like hybridization or lateral gene transfer that are commonplace in many groups of organisms and result in mosaic patterns of relationships cannot be represented by a single phylogenetic tree. This is why phylogenetic networks, which can display such events, are becoming of more and more interest in phylogenetic research. It is therefore necessary to extend concepts like maximum parsimony from phylogenetic trees to networks. Several suggestions for possible extensions can be found in recent literature, for instance the softwired and the hardwired parsimony concepts. In this paper, we analyze the so-called big parsimony problem under these two concepts, i.e. we investigate maximum parsimonious networks and analyze their properties. In particular, we show that finding a softwired maximum parsimony network is possible in polynomial time. We also show that the set of maximum parsimony networks for the hardwired definition always contains at least one phylogenetic tree. Lastly, we investigate some parallels of parsimony to different likelihood concepts on phylogenetic networks. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Phylogenetic relationships among anuran trypanosomes as revealed by riboprinting.

    Science.gov (United States)

    Clark, C G; Martin, D S; Diamond, L S

    1995-01-01

    Twenty trypanosome isolates from Anura (frogs and toads) assigned to several species were characterized by riboprinting-restriction enzyme digestion of polymerase chain reaction amplified small subunit ribosomal RNA genes. Restriction site polymorphisms allowed distinction of all the recognized species and no intraspecific variation in riboprint patterns was detected. Phylogenetic reconstruction using parsimony and distance estimates based on restriction fragment comigration showed Trypanosoma chattoni to be only distantly related to the other species, while T. ranarum and T. fallisi appear to be sister taxa despite showing non-overlapping host specificities.

  5. Comprehensive untargeted metabolomics of Lychnnophorinae subtribe (Asteraceae: Vernonieae) in a phylogenetic context.

    Science.gov (United States)

    Martucci, Maria Elvira Poleti; Loeuille, Benoit; Pirani, José Rubens; Gobbo-Neto, Leonardo

    2018-01-01

    Members of the subtribe Lychnophorinae occur mostly within the Cerrado domain of the Brazilian Central Plateau. The relationships between its 11 genera, as well as between Lychnophorinae and other subtribes belonging to the tribe Vernonieae, have recently been investigated upon a phylogeny based on molecular and morphological data. We report the use of a comprehensive untargeted metabolomics approach, combining HPLC-MS and GC-MS data, followed by multivariate analyses aiming to assess the congruence between metabolomics data and the phylogenetic hypothesis, as well as its potential as a chemotaxonomic tool. We analyzed 78 species by UHPLC-MS and GC-MS in both positive and negative ionization modes. The metabolic profiles obtained for these species were treated in MetAlign and in MSClust and the matrices generated were used in SIMCA for hierarchical cluster analyses, principal component analyses and orthogonal partial least square discriminant analysis. The results showed that metabolomic analyses are mostly congruent with the phylogenetic hypothesis especially at lower taxonomic levels (Lychnophora or Eremanthus). Our results confirm that data generated using metabolomics provide evidence for chemotaxonomical studies, especially for phylogenetic inference of the Lychnophorinae subtribe and insight into the evolution of the secondary metabolites of this group.

  6. Phylogenetic analysis in Myrcia section Aulomyrcia and inferences on plant diversity in the Atlantic rainforest.

    Science.gov (United States)

    Staggemeier, Vanessa Graziele; Diniz-Filho, José Alexandre Felizola; Forest, Félix; Lucas, Eve

    2015-04-01

    Myrcia section Aulomyrcia includes ∼120 species that are endemic to the Neotropics and disjunctly distributed in the moist Amazon and Atlantic coastal forests of Brazil. This paper presents the first comprehensive phylogenetic study of this group and this phylogeny is used as a basis to evaluate recent classification systems and to test alternative hypotheses associated with the history of this clade. Fifty-three taxa were sampled out of the 120 species currently recognized, plus 40 outgroup taxa, for one nuclear marker (ribosomal internal transcribed spacer) and four plastid markers (psbA-trnH, trnL-trnF, trnQ-rpS16 and ndhF). The relationships were reconstructed based on Bayesian and maximum likelihood analyses. Additionally, a likelihood approach, 'geographic state speciation and extinction', was used to estimate region- dependent rates of speciation, extinction and dispersal, comparing historically climatic stable areas (refugia) and unstable areas. Maximum likelihood and Bayesian inferences indicate that Myrcia and Marlierea are polyphyletic, and the internal groupings recovered are characterized by combinations of morphological characters. Phylogenetic relationships support a link between Amazonian and north-eastern species and between north-eastern and south-eastern species. Lower extinction rates within glacial refugia suggest that these areas were important in maintaining diversity in the Atlantic forest biodiversity hotspot. This study provides a robust phylogenetic framework to address important ecological questions for Myrcia s.l. within an evolutionary context, and supports the need to unite taxonomically the two traditional genera Myrcia and Marlierea in an expanded Myrcia s.l. Furthermore, this study offers valuable insights into the diversification of plant species in the highly impacted Atlantic forest of South America; evidence is presented that the lowest extinction rates are found inside refugia and that range expansion from unstable areas

  7. Phylogenetic Analyses of Armillaria Reveal at Least 15 Phylogenetic Lineages in China, Seven of Which Are Associated with Cultivated Gastrodia elata.

    Directory of Open Access Journals (Sweden)

    Ting Guo

    Full Text Available Fungal species of Armillaria, which can act as plant pathogens and/or symbionts of the Chinese traditional medicinal herb Gastrodia elata ("Tianma", are ecologically and economically important and have consequently attracted the attention of mycologists. However, their taxonomy has been highly dependent on morphological characterization and mating tests. In this study, we phylogenetically analyzed Chinese Armillaria samples using the sequences of the internal transcribed spacer region, translation elongation factor-1 alpha gene and beta-tubulin gene. Our data revealed at least 15 phylogenetic lineages of Armillaria from China, of which seven were newly discovered and two were recorded from China for the first time. Fourteen Chinese biological species of Armillaria, which were previously defined based on mating tests, could be assigned to the 15 phylogenetic lineages identified herein. Seven of the 15 phylogenetic lineages were found to be disjunctively distributed in different continents of the Northern Hemisphere, while eight were revealed to be endemic to certain continents. In addition, we found that seven phylogenetic lineages of Armillaria were used for the cultivation of Tianma, only two of which had been recorded to be associated with Tianma previously. We also illustrated that G. elata f. glauca ("Brown Tianma" and G. elata f. elata ("Red Tianma", two cultivars of Tianma grown in different regions of China, form symbiotic relationships with different phylogenetic lineages of Armillaria. These findings should aid the development of Tianma cultivation in China.

  8. A multi-locus plastid phylogenetic analysis of the pantropical genus Diospyros (Ebenaceae), with an emphasis on the radiation and biogeographic origins of the New Caledonian endemic species

    OpenAIRE

    Duangjai, S.; Samuel, R.; Munzinger, Jérôme; Forest, F.; Wallnofer, B.; Barfuss, M.H.J.; Fischer, G.; Chase, M. W.

    2009-01-01

    We aimed to clarify phylogenetic relationships within the pantropical genus Diospyros (Ebenaceae sensu lato), and ascertain biogeographical patterns in the New Caledonian endemic species. We used DNA sequences from eight plastid regions (rbcL, atpB, matK, ndhF, trnK intron, trnL intron, trnL-trnF spacer, and trnS-trnG spacer) and included 149 accessions representing 119 Diospyros species in our analysis. Results from this study confirmed the monophyly of Diospyros with good support and provid...

  9. Phylogenetic analysis, subcellular localization, and expression patterns of RPD3/HDA1 family histone deacetylases in plants

    OpenAIRE

    Alinsug, Malona V; Yu, Chun-Wei; Wu, Keqiang

    2009-01-01

    Abstract Background Although histone deacetylases from model organisms have been previously identified, there is no clear basis for the classification of histone deacetylases under the RPD3/HDA1 superfamily, particularly on plants. Thus, this study aims to reconstruct a phylogenetic tree to determine evolutionary relationships between RPD3/HDA1 histone deacetylases from six different plants representing dicots with Arabidopsis thaliana, Populus trichocarpa, and Pinus taeda, monocots with Oryz...

  10. NGS combined with phylogenetic analysis to detect HIV-1 dual infection in Romanian people who inject drugs.

    Science.gov (United States)

    Popescu, Bogdan; Banica, Leontina; Nicolae, Ionelia; Radu, Eugen; Niculescu, Iulia; Abagiu, Adrian; Otelea, Dan; Paraschiv, Simona

    2018-04-04

    Dual HIV infections are possible and likely in people who inject drugs (PWID). Thirty-eight newly diagnosed patients, 19 PWID and 19 heterosexually HIV infected were analysed. V2-V3 loop of HIV-1 env gene was sequenced on the NGS platform 454 GSJunior (Roche). HIV-1 dual/multiple infections were identified in five PWID. For three of these patients, the reconstructed variants belonged to pure F1 subtype and CRF14_BG strains according to phylogenetic analysis. New recombinant forms between these parental strains were identified in two PWID samples. NGS data can provide, with the help of phylogenetic analysis, important insights about the intra-host sub-population structure. Copyright © 2018. Published by Elsevier Masson SAS.

  11. Phylogenetic analysis of Escherichia coli isolates from healthy and diarrhoeic calves in Mashhad, Iran

    Directory of Open Access Journals (Sweden)

    M. Barzan

    2017-03-01

    Full Text Available Escherichia coli is a normal inhabitant of the gastrointestinal tract of vertebrates. Certain Escherichia coli strains have been associated with neonatal diarrhoea in ruminants. These strains can be assigned to one of the four main phylogenetic groups, A, B1, B2 and D. Several studies have shown the rela-tionship between phylogeny and pathogenicity of E. coli, a great deal can be obtained by determining the phylogroup of unknown E. coli strains. In this study, we aimed to evaluate the influence of diar-rhoea on the genetic composition of E. coli populations isolated from calves. A total of 80 Es-cherichia coli isolates were obtained from healthy and diarrhoeic calves. Phylogenetic grouping was done based on the Clermont triplex PCR method using primers targeted at three genetic markers, chuA, yjaA and TspE4.C2. According to our results, phylogenetic group A strains was the most prevalent in both healthy (37.5% and diarrhoeic calves (55%. Group B1 contained 27.5% of isolates in healthy calves, followed by group B2 (17.5%, and group D (7.5%. Also, four isolates from healthy calves were not included in the major phylogenetic groups or subgroups. A total of 14% and 4% of isolates from diarrhoeic calves beloned to phylogroups B2 and D respectively. Although no isolate from diarrhoeic calves was found to belong to group B1, there was no significant difference between healthy and diarrhoeic calves for other phylogroups. There was not a dramatic shift in E. coli phylogroup/subgroup due to occurrence of diarrhoea in calves, except for phylogroup B1 which was higher in healthy calves. This can be due to the difference in secretions of digestive system in diarrhoeic calves which can prevent the conditions for instability of Escherichia coli isolates of phy-logroup B1. The majority of isolates from both healthy and diarrhoeic calves belonged to non-pathogenic phylogentic group A and B1.

  12. Phylogenetic inference in Rafflesiales: the influence of rate heterogeneity and horizontal gene transfer

    Directory of Open Access Journals (Sweden)

    Vidal-Russell Romina

    2004-10-01

    Full Text Available Abstract Background The phylogenetic relationships among the holoparasites of Rafflesiales have remained enigmatic for over a century. Recent molecular phylogenetic studies using the mitochondrial matR gene placed Rafflesia, Rhizanthes and Sapria (Rafflesiaceae s. str. in the angiosperm order Malpighiales and Mitrastema (Mitrastemonaceae in Ericales. These phylogenetic studies did not, however, sample two additional groups traditionally classified within Rafflesiales (Apodantheaceae and Cytinaceae. Here we provide molecular phylogenetic evidence using DNA sequence data from mitochondrial and nuclear genes for representatives of all genera in Rafflesiales. Results Our analyses indicate that the phylogenetic affinities of the large-flowered clade and Mitrastema, ascertained using mitochondrial matR, are congruent with results from nuclear SSU rDNA when these data are analyzed using maximum likelihood and Bayesian methods. The relationship of Cytinaceae to Malvales was recovered in all analyses. Relationships between Apodanthaceae and photosynthetic angiosperms varied depending upon the data partition: Malvales (3-gene, Cucurbitales (matR or Fabales (atp1. The latter incongruencies suggest that horizontal gene transfer (HGT may be affecting the mitochondrial gene topologies. The lack of association between Mitrastema and Ericales using atp1 is suggestive of HGT, but greater sampling within eudicots is needed to test this hypothesis further. Conclusions Rafflesiales are not monophyletic but composed of three or four independent lineages (families: Rafflesiaceae, Mitrastemonaceae, Apodanthaceae and Cytinaceae. Long-branch attraction appears to be misleading parsimony analyses of nuclear small-subunit rDNA data, but model-based methods (maximum likelihood and Bayesian analyses recover a topology that is congruent with the mitochondrial matR gene tree, thus providing compelling evidence for organismal relationships. Horizontal gene transfer appears to

  13. Phylogenetic turnover during subtropical forest succession across environmental and phylogenetic scales.

    Science.gov (United States)

    Purschke, Oliver; Michalski, Stefan G; Bruelheide, Helge; Durka, Walter

    2017-12-01

    Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic turnover across phylogenetic scales, accounting for covariation with environmental differences. We compared phylogenetic turnover, at the species- and individual-level, within and between five successional stages, representing woody plant communities in a subtropical forest chronosequence. We decomposed turnover at different phylogenetic depths and assessed its covariation with between-plot abiotic differences. Phylogenetic turnover between stages was low relative to species turnover and was not explained by abiotic differences. However, within the late-successional stages, there was high presence-/absence-based turnover (clustering) that occurred deep in the phylogeny and covaried with environmental differentiation. Our results support a deterministic model of community assembly where (i) phylogenetic composition is constrained through successional time, but (ii) toward late succession, species sorting into preferred habitats according to niche traits that are conserved deep in phylogeny, becomes increasingly important.

  14. Aujeszky's disease in red fox (Vulpes vulpes): phylogenetic analysis unravels an unexpected epidemiologic link.

    Science.gov (United States)

    Caruso, Claudio; Dondo, Alessandro; Cerutti, Francesco; Masoero, Loretta; Rosamilia, Alfonso; Zoppi, Simona; D'Errico, Valeria; Grattarola, Carla; Acutis, Pier Luigi; Peletto, Simone

    2014-07-01

    We describe Aujeszky's disease in a female of red fox (Vulpes vulpes). Although wild boar (Sus scrofa) would be the expected source of infection, phylogenetic analysis suggested a domestic rather than a wild source of virus, underscoring the importance of biosecurity measures in pig farms to prevent contact with wild animals.

  15. HIV forensics: pitfalls and acceptable standards in the use of phylogenetic analysis as evidence in criminal investigations of HIV transmission.

    Science.gov (United States)

    Bernard, E J; Azad, Y; Vandamme, A M; Weait, M; Geretti, A M

    2007-09-01

    Phylogenetic analysis - the study of the genetic relatedness between HIV strains - has recently been used in criminal prosecutions as evidence of responsibility for HIV transmission. In these trials, the expert opinion of virologists has been of critical importance. Phylogenetic analysis of HIV gene sequences is complex and its findings do not achieve the levels of certainty obtained with the forensic analysis of human DNA. Although two individuals may carry HIV strains that are closely related, these will not necessarily be unique to the two parties and could extend to other persons within the same transmission network. For forensic purposes, phylogenetic analysis should be conducted under strictly controlled conditions by laboratories with relevant expertise applying rigorous methods. It is vitally important to include the right controls, which should be epidemiologically and temporally relevant to the parties under investigation. Use of inappropriate controls can exaggerate any relatedness between the virus strains of the complainant and defendant as being strikingly unique. It will be often difficult to obtain the relevant controls. If convenient but less appropriate controls are used, interpretation of the findings should be tempered accordingly. Phylogenetic analysis cannot prove that HIV transmission occurred directly between two individuals. However, it can exonerate individuals by demonstrating that the defendant carries a virus strain unrelated to that of the complainant. Expert witnesses should acknowledge the limitations of the inferences that might be made and choose the correct language in both written and verbal testimony.

  16. Marine turtle mitogenome phylogenetics and evolution

    DEFF Research Database (Denmark)

    Duchene, Sebastián; Frey, Amy; Alfaro-Núñez, Luis Alonso

    2012-01-01

    The sea turtles are a group of cretaceous origin containing seven recognized living species: leatherback, hawksbill, Kemp's ridley, olive ridley, loggerhead, green, and flatback. The leatherback is the single member of the Dermochelidae family, whereas all other sea turtles belong in Cheloniidae...... distributions, shedding light on complex migration patterns and possible geographic or climatic events as driving forces of sea-turtle distribution. We have sequenced complete mitogenomes for all sea-turtle species, including samples from their geographic range extremes, and performed phylogenetic analyses...... to assess sea-turtle evolution with a large molecular dataset. We found variation in the length of the ATP8 gene and a highly variable site in ND4 near a proton translocation channel in the resulting protein. Complete mitogenomes show strong support and resolution for phylogenetic relationships among all...

  17. A New Perspective on Polyploid Fragaria (Strawberry) Genome Composition Based on Large-Scale, Multi-Locus Phylogenetic Analysis.

    Science.gov (United States)

    Yang, Yilong; Davis, Thomas M

    2017-12-01

    The subgenomic compositions of the octoploid (2n = 8× = 56) strawberry (Fragaria) species, including the economically important cultivated species Fragaria x ananassa, have been a topic of long-standing interest. Phylogenomic approaches utilizing next-generation sequencing technologies offer a new window into species relationships and the subgenomic compositions of polyploids. We have conducted a large-scale phylogenetic analysis of Fragaria (strawberry) species using the Fluidigm Access Array system and 454 sequencing platform. About 24 single-copy or low-copy nuclear genes distributed across the genome were amplified and sequenced from 96 genomic DNA samples representing 16 Fragaria species from diploid (2×) to decaploid (10×), including the most extensive sampling of octoploid taxa yet reported. Individual gene trees were constructed by different tree-building methods. Mosaic genomic structures of diploid Fragaria species consisting of sequences at different phylogenetic positions were observed. Our findings support the presence in octoploid species of genetic signatures from at least five diploid ancestors (F. vesca, F. iinumae, F. bucharica, F. viridis, and at least one additional allele contributor of unknown identity), and questions the extent to which distinct subgenomes are preserved over evolutionary time in the allopolyploid Fragaria species. In addition, our data support divergence between the two wild octoploid species, F. virginiana and F. chiloensis. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. A phylogenetic perspective on species diversity, β-diversity and biogeography for the microbial world.

    Science.gov (United States)

    Barberán, Albert; Casamayor, Emilio O

    2014-12-01

    There is an increasing interest to combine phylogenetic data with distributional and ecological records to assess how natural communities arrange under an evolutionary perspective. In the microbial world, there is also a need to go beyond the problematic species definition to deeply explore ecological patterns using genetic data. We explored links between evolution/phylogeny and community ecology using bacterial 16S rRNA gene information from a high-altitude lakes district data set. We described phylogenetic community composition, spatial distribution, and β-diversity and biogeographical patterns applying evolutionary relatedness without relying on any particular operational taxonomic unit definition. High-altitude lakes districts usually contain a large mosaic of highly diverse small water bodies and conform a fine biogeographical model of spatially close but environmentally heterogeneous ecosystems. We sampled 18 lakes in the Pyrenees with a selection criteria focused on capturing the maximum environmental variation within the smallest geographical area. The results showed highly diverse communities nonrandomly distributed with phylogenetic β-diversity patterns mainly shaped by the environment and not by the spatial distance. Community similarity based on both bacterial taxonomic composition and phylogenetic β-diversity shared similar patterns and was primarily structured by similar environmental drivers. We observed a positive relationship between lake area and phylogenetic diversity with a slope consistent with highly dispersive planktonic organisms. The phylogenetic approach incorporated patterns of common ancestry into bacterial community analysis and emerged as a very convenient analytical tool for direct inter- and intrabiome biodiversity comparisons and sorting out microbial habitats with potential application in conservation studies. © 2014 John Wiley & Sons Ltd.

  19. A guide to phylogenetic metrics for conservation, community ecology and macroecology

    Science.gov (United States)

    Cadotte, Marc W.; Carvalho, Silvia B.; Davies, T. Jonathan; Ferrier, Simon; Fritz, Susanne A.; Grenyer, Rich; Helmus, Matthew R.; Jin, Lanna S.; Mooers, Arne O.; Pavoine, Sandrine; Purschke, Oliver; Redding, David W.; Rosauer, Dan F.; Winter, Marten; Mazel, Florent

    2016-01-01

    ABSTRACT The use of phylogenies in ecology is increasingly common and has broadened our understanding of biological diversity. Ecological sub‐disciplines, particularly conservation, community ecology and macroecology, all recognize the value of evolutionary relationships but the resulting development of phylogenetic approaches has led to a proliferation of phylogenetic diversity metrics. The use of many metrics across the sub‐disciplines hampers potential meta‐analyses, syntheses, and generalizations of existing results. Further, there is no guide for selecting the appropriate metric for a given question, and different metrics are frequently used to address similar questions. To improve the choice, application, and interpretation of phylo‐diversity metrics, we organize existing metrics by expanding on a unifying framework for phylogenetic information. Generally, questions about phylogenetic relationships within or between assemblages tend to ask three types of question: how much; how different; or how regular? We show that these questions reflect three dimensions of a phylogenetic tree: richness, divergence, and regularity. We classify 70 existing phylo‐diversity metrics based on their mathematical form within these three dimensions and identify ‘anchor’ representatives: for α‐diversity metrics these are PD (Faith's phylogenetic diversity), MPD (mean pairwise distance), and VPD (variation of pairwise distances). By analysing mathematical formulae and using simulations, we use this framework to identify metrics that mix dimensions, and we provide a guide to choosing and using the most appropriate metrics. We show that metric choice requires connecting the research question with the correct dimension of the framework and that there are logical approaches to selecting and interpreting metrics. The guide outlined herein will help researchers navigate the current jungle of indices. PMID:26785932

  20. Phylogenetic patterns in populations of Chilean species of the genus Orestias (Teleostei: Cyprinodontidae): results of mitochondrial DNA analysis.

    Science.gov (United States)

    Lüssen, Arne; Falk, Thomas M; Villwock, Wolfgang

    2003-10-01

    Patterns of molecular genetic differentiation among taxa of the "agassii species complex" (Parenti, 1984) were analysed based on partial mtDNA control region sequences. Special attention has been paid to Chilean populations of Orestias agassii and species from isolated lakes of northern Chile, e.g., O. agassii, Orestias chungarensis, Orestias parinacotensis, Orestias laucaensis, and Orestias ascotanensis. Orestias tschudii, Orestias luteus, and Orestias ispi were analysed comparatively. Our findings support the utility of mtDNA control region sequences for phylogenetic studies within the "agassii species complex" and confirmed the monophyly of this particular lineage, excluding O. luteus. However, the monophyly of further morphologically defined lineages within the "agassii complex" appears doubtful. No support was found for the utility of these data sets for inferring phylogenetic relationships between more distantly related taxa originating from Lake Titicaca.

  1. Phylogenetic signal in the acoustic parameters of the advertisement calls of four clades of anurans.

    Science.gov (United States)

    Gingras, Bruno; Mohandesan, Elmira; Boko, Drasko; Fitch, W Tecumseh

    2013-07-01

    Anuran vocalizations, especially their advertisement calls, are largely species-specific and can be used to identify taxonomic affiliations. Because anurans are not vocal learners, their vocalizations are generally assumed to have a strong genetic component. This suggests that the degree of similarity between advertisement calls may be related to large-scale phylogenetic relationships. To test this hypothesis, advertisement calls from 90 species belonging to four large clades (Bufo, Hylinae, Leptodactylus, and Rana) were analyzed. Phylogenetic distances were estimated based on the DNA sequences of the 12S mitochondrial ribosomal RNA gene, and, for a subset of 49 species, on the rhodopsin gene. Mean values for five acoustic parameters (coefficient of variation of root-mean-square amplitude, dominant frequency, spectral flux, spectral irregularity, and spectral flatness) were computed for each species. We then tested for phylogenetic signal on the body-size-corrected residuals of these five parameters, using three statistical tests (Moran's I, Mantel, and Blomberg's K) and three models of genetic distance (pairwise distances, Abouheif's proximities, and the variance-covariance matrix derived from the phylogenetic tree). A significant phylogenetic signal was detected for most acoustic parameters on the 12S dataset, across statistical tests and genetic distance models, both for the entire sample of 90 species and within clades in several cases. A further analysis on a subset of 49 species using genetic distances derived from rhodopsin and from 12S broadly confirmed the results obtained on the larger sample, indicating that the phylogenetic signals observed in these acoustic parameters can be detected using a variety of genetic distance models derived either from a variable mitochondrial sequence or from a conserved nuclear gene. We found a robust relationship, in a large number of species, between anuran phylogenetic relatedness and acoustic similarity in the

  2. Phylogenomic and MALDI-TOF MS analysis of Streptococcus sinensis HKU4T reveals a distinct phylogenetic clade in the genus Streptococcus.

    Science.gov (United States)

    Teng, Jade L L; Huang, Yi; Tse, Herman; Chen, Jonathan H K; Tang, Ying; Lau, Susanna K P; Woo, Patrick C Y

    2014-10-20

    Streptococcus sinensis is a recently discovered human pathogen isolated from blood cultures of patients with infective endocarditis. Its phylogenetic position, as well as those of its closely related species, remains inconclusive when single genes were used for phylogenetic analysis. For example, S. sinensis branched out from members of the anginosus, mitis, and sanguinis groups in the 16S ribosomal RNA gene phylogenetic tree, but it was clustered with members of the anginosus and sanguinis groups when groEL gene sequences used for analysis. In this study, we sequenced the draft genome of S. sinensis and used a polyphasic approach, including concatenated genes, whole genomes, and matrix-assisted laser desorption ionization-time of flight mass spectrometry to analyze the phylogeny of S. sinensis. The size of the S. sinensis draft genome is 2.06 Mb, with GC content of 42.2%. Phylogenetic analysis using 50 concatenated genes or whole genomes revealed that S. sinensis formed a distinct cluster with Streptococcus oligofermentans and Streptococcus cristatus, and these three streptococci were clustered with the "sanguinis group." As for phylogenetic analysis using hierarchical cluster analysis of the mass spectra of streptococci, S. sinensis also formed a distinct cluster with S. oligofermentans and S. cristatus, but these three streptococci were clustered with the "mitis group." On the basis of the findings, we propose a novel group, named "sinensis group," to include S. sinensis, S. oligofermentans, and S. cristatus, in the Streptococcus genus. Our study also illustrates the power of phylogenomic analyses for resolving ambiguities in bacterial taxonomy. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Sequence and phylogenetic analysis of virulent Newcastle disease virus isolates from Pakistan during 2009–2013 reveals circulation of new sub genotype

    International Nuclear Information System (INIS)

    Siddique, Naila; Naeem, Khalid; Abbas, Muhammad Athar; Ali Malik, Akbar; Rashid, Farooq; Rafique, Saba; Ghafar, Abdul; Rehman, Abdul

    2013-01-01

    Despite observing the standard bio-security measures at commercial poultry farms and extensive use of Newcastle disease vaccines, a new genotype VII-f of Newcastle disease virus (NDV) got introduced in Pakistan during 2011. In this regard 300 ND outbreaks recorded so far have resulted into huge losses of approximately USD 200 million during 2011–2013. A total of 33 NDV isolates recovered during 2009–2013 throughout Pakistan were characterized biologically and phylogenetically. The phylogenetic analysis revealed a new velogenic sub genotype VII-f circulating in commercial and domestic poultry along with the earlier reported sub genotype VII-b. Partial sequencing of Fusion gene revealed two types of cleavage site motifs; lentogenic 112 GRQGRL 117 and velogenic 112 RRQKRF 117 along with some point mutations indicative of genetic diversity. We report here a new sub genotype of virulent NDV circulating in commercial and backyard poultry in Pakistan and provide evidence for the possible genetic diversity which may be causing new NDV out breaks. - Highlights: • The first report of isolation of new genotype VII-f of virulent Newcastle disease virus (NDV) in Pakistan. • We report the partial Fusion gene sequences of new genotype VII-f of virulent NDV from Pakistan. • We report the phylogenetic relationship of new NDV strains with reported NDV strains. • Provide outbreak history of new virulent NDV strain in commercial and backyard poultry in Pakistan. • We provide possible evidence for the role of backyard poultry in NDV outbreaks

  4. Phylogenetic relationships among zooxanthellae (Symbiodinium) associated to excavating sponges (Cliona spp.) reveal an unexpected lineage in the Caribbean.

    Science.gov (United States)

    Granados, C; Camargo, C; Zea, S; Sánchez, J A

    2008-11-01

    Phylogenetic relationships of symbiotic dinoflagellate lineages, distributed in all tropical and subtropical seas, suggest strategies for long distance dispersal but at the same time strong host specialization. Zooxanthellae (Symbiodinium: Dinophyta), which are associated to diverse shallow-water cnidarians, also engage in symbioses with some sponge species of the genus Cliona. In the Caribbean, zooxanthellae-bearing Cliona has recently become abundant due to global warming, overfishing, and algae abundance. Using molecular techniques, the symbionts from five excavating species (Clionacaribbaea, C. tenuis, C. varians, C. aprica and C. laticavicola) from the southern and southwestern Caribbean were surveyed. Several DNA sequence regions were used in order to confirm zooxanthellae identity; 18S rDNA, domain V of chloroplast large subunit (cp23S), internal transcribed spacer 2 (ITS2), and ITS2 secondary structure. Sequence analyses corroborated the presence of three zooxanthellae clades: A, B, and G. Presence of clades A and B in common boring sponges of the Caribbean fit with the general pattern of the province. The discovery of clade G for the first time in any organism of the Atlantic Ocean leads us to consider this unusual finding as a phylogenetic relict through common ancestors of sponge clades or an invasion of the sponge from the Indo-Pacific.

  5. Comparative analyses of the complete mitochondrial genomes of Dosinia clams and their phylogenetic position within Veneridae.

    Science.gov (United States)

    Lv, Changda; Li, Qi; Kong, Lingfeng

    2018-01-01

    Mitochondrial genomes have proved to be a powerful tool in resolving phylogenetic relationship. In order to understand the mitogenome characteristics and phylogenetic position of the genus Dosinia, we sequenced the complete mitochondrial genomes of Dosinia altior and Dosinia troscheli (Bivalvia: Veneridae), compared them with that of Dosinia japonica and established a phylogenetic tree for Veneridae. The mitogenomes of D. altior (17,536 bp) and D. troscheli (17,229 bp) are the two smallest in Veneridae, which include 13 protein-coding genes, 2 ribosomal RNA genes, 22 tRNA genes, and non-coding regions. The mitogenomes of the Dosinia species are similar in size, gene content, AT content, AT- and GC- skews, and gene arrangement. The phylogenetic relationships of family Veneridae were established based on 12 concatenated protein-coding genes using maximum likelihood and Bayesian analyses, which supported that Dosininae and Meretricinae have a closer relationship, with Tapetinae being the sister taxon. The information obtained in this study will contribute to further understanding of the molecular features of bivalve mitogenomes and the evolutionary history of the genus Dosinia.

  6. The space of ultrametric phylogenetic trees.

    Science.gov (United States)

    Gavryushkin, Alex; Drummond, Alexei J

    2016-08-21

    The reliability of a phylogenetic inference method from genomic sequence data is ensured by its statistical consistency. Bayesian inference methods produce a sample of phylogenetic trees from the posterior distribution given sequence data. Hence the question of statistical consistency of such methods is equivalent to the consistency of the summary of the sample. More generally, statistical consistency is ensured by the tree space used to analyse the sample. In this paper, we consider two standard parameterisations of phylogenetic time-trees used in evolutionary models: inter-coalescent interval lengths and absolute times of divergence events. For each of these parameterisations we introduce a natural metric space on ultrametric phylogenetic trees. We compare the introduced spaces with existing models of tree space and formulate several formal requirements that a metric space on phylogenetic trees must possess in order to be a satisfactory space for statistical analysis, and justify them. We show that only a few known constructions of the space of phylogenetic trees satisfy these requirements. However, our results suggest that these basic requirements are not enough to distinguish between the two metric spaces we introduce and that the choice between metric spaces requires additional properties to be considered. Particularly, that the summary tree minimising the square distance to the trees from the sample might be different for different parameterisations. This suggests that further fundamental insight is needed into the problem of statistical consistency of phylogenetic inference methods. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  7. Complete genome of a European hepatitis C virus subtype 1g isolate: phylogenetic and genetic analyses.

    Science.gov (United States)

    Bracho, Maria A; Saludes, Verónica; Martró, Elisa; Bargalló, Ana; González-Candelas, Fernando; Ausina, Vicent

    2008-06-05

    Hepatitis C virus isolates have been classified into six main genotypes and a variable number of subtypes within each genotype, mainly based on phylogenetic analysis. Analyses of the genetic relationship among genotypes and subtypes are more reliable when complete genome sequences (or at least the full coding region) are used; however, so far 31 of 80 confirmed or proposed subtypes have at least one complete genome available. Of these, 20 correspond to confirmed subtypes of epidemic interest. We present and analyse the first complete genome sequence of a HCV subtype 1g isolate. Phylogenetic and genetic distance analyses reveal that HCV-1g is the most divergent subtype among the HCV-1 confirmed subtypes. Potential genomic recombination events between genotypes or subtype 1 genomes were ruled out. We demonstrate phylogenetic congruence of previously deposited partial sequences of HCV-1g with respect to our sequence. In light of this, we propose changing the current status of its subtype-specific designation from provisional to confirmed.

  8. Large-Scale Genomic Analysis of Codon Usage in Dengue Virus and Evaluation of Its Phylogenetic Dependence

    Directory of Open Access Journals (Sweden)

    Edgar E. Lara-Ramírez

    2014-01-01

    Full Text Available The increasing number of dengue virus (DENV genome sequences available allows identifying the contributing factors to DENV evolution. In the present study, the codon usage in serotypes 1–4 (DENV1–4 has been explored for 3047 sequenced genomes using different statistics methods. The correlation analysis of total GC content (GC with GC content at the three nucleotide positions of codons (GC1, GC2, and GC3 as well as the effective number of codons (ENC, ENCp versus GC3 plots revealed mutational bias and purifying selection pressures as the major forces influencing the codon usage, but with distinct pressure on specific nucleotide position in the codon. The correspondence analysis (CA and clustering analysis on relative synonymous codon usage (RSCU within each serotype showed similar clustering patterns to the phylogenetic analysis of nucleotide sequences for DENV1–4. These clustering patterns are strongly related to the virus geographic origin. The phylogenetic dependence analysis also suggests that stabilizing selection acts on the codon usage bias. Our analysis of a large scale reveals new feature on DENV genomic evolution.

  9. Phylogenetic Analysis of Nucleus-Encoded Acetyl-CoA Carboxylases Targeted at the Cytosol and Plastid of Algae.

    KAUST Repository

    Huerlimann, Roger

    2015-07-01

    The understanding of algal phylogeny is being impeded by an unknown number of events of horizontal gene transfer (HGT), and primary and secondary/tertiary endosymbiosis. Through these events, previously heterotrophic eukaryotes developed photosynthesis and acquired new biochemical pathways. Acetyl-CoA carboxylase (ACCase) is a key enzyme in the fatty acid synthesis and elongation pathways in algae, where ACCase exists in two locations (cytosol and plastid) and in two forms (homomeric and heteromeric). All algae contain nucleus-encoded homomeric ACCase in the cytosol, independent of the origin of the plastid. Nucleus-encoded homomeric ACCase is also found in plastids of algae that arose from a secondary/tertiary endosymbiotic event. In contrast, plastids of algae that arose from a primary endosymbiotic event contain heteromeric ACCase, which consists of three nucleus-encoded and one plastid-encoded subunits. These properties of ACCase provide the potential to inform on the phylogenetic relationships of hosts and their plastids, allowing different hypothesis of endosymbiotic events to be tested. Alveolata (Dinoflagellata and Apicomplexa) and Chromista (Stramenopiles, Haptophyta and Cryptophyta) have traditionally been grouped together as Chromalveolata, forming the red lineage. However, recent genetic evidence groups the Stramenopiles, Alveolata and green plastid containing Rhizaria as SAR, excluding Haptophyta and Cryptophyta. Sequences coding for plastid and cytosol targeted homomeric ACCases were isolated from Isochrysis aff. galbana (TISO), Chromera velia and Nannochloropsis oculata, representing three taxonomic groups for which sequences were lacking. Phylogenetic analyses show that cytosolic ACCase strongly supports the SAR grouping. Conversely, plastidial ACCase groups the SAR with the Haptophyta, Cryptophyta and Prasinophyceae (Chlorophyta). These two ACCase based, phylogenetic relationships suggest that the plastidial homomeric ACCase was acquired by the

  10. A phylogenetic analysis of the sugar porters in hemiascomycetous yeasts.

    Science.gov (United States)

    Palma, Margarida; Goffeau, André; Spencer-Martins, Isabel; Baret, Philippe V

    2007-01-01

    A total of 214 members of the sugar porter (SP) family (TC 2.A.1.1) from eight hemiascomycetous yeasts: Saccharomyces cerevisiae, Candida glabrata, Kluyveromyces lactis, Ashbya (Eremothecium) gossypii, Debaryomyces hansenii, Yarrowia lipolytica, Candida albicans and Pichia stipitis, were identified. The yeast SPs were classified in 13 different phylogenetic clusters. Specific sugar substrates could be allocated to nine phylogenetic clusters, including two novel TC clusters that are specific to fungi, i.e. the glycerol:H(+) symporter (2.A.1.1.38) and the high-affinity glucose transporter (2.A.1.1.39). Four phylogenetic clusters are identified by the preliminary fifth number Z23, Z24, Z25 and Z26 and the substrates of their members remain undetermined. The amplification of the SP clusters across the Hemiascomycetes reflects adaptation to specific carbon and energy sources available in the habitat of each yeast species. (c) 2007 S. Karger AG, Basel.

  11. Suitability of cuticular pores and sensilla for harpacticoid copepod species delineation and phylogenetic reconstruction.

    Science.gov (United States)

    Karanovic, Tomislav; Kim, Kichoon

    2014-11-01

    Cuticular organs have not been described systematically in harpacticoids until recently, and they haven ever been used as characters for reconstructing phylogenetic relationships in any crustacean group. We survey cuticular pores and sensilla on somites in ten Miraciidae species, belonging to six genera, from Korea, Australia, and Russia. Nine species belong to the subfamily Stenheliinae, while the outgroup belongs to the subfamily Diosaccinae. We aim to compare phylogenetic trees reconstructed for these harpactioids based on: 1) cuticular organs (with 76 characters scored, 71% of them phylogenetically informative); 2) traditionally used macro-morphological characters (66 scored, 77% of them informative);and 3) mtCOI DNA data. All analyses suggest that cuticular organs are useful characters for harpacticoid species delineation, although not as sensitive as some fast-evolving molecular markers. Reconstructed cladograms based on all three datasets show very high bootstrap values for clades representing distinct genera, suggesting that cuticular organs are suitable characters for studying phylogenetic relationships. Bootstrap values for the more basal nodes differ among the different cladograms,as do the sister-group relationships they suggest, indicating that cuticular organs probably have different evolutionary constraints from macro-morphological characters. Cuticular organs could be quite useful in the study of old museum specimens and fossil crustaceans.

  12. Comparative evolutionary diversity and phylogenetic structure across multiple forest dynamics plots: a mega-phylogeny approach

    Directory of Open Access Journals (Sweden)

    David Lee Erickson

    2014-11-01

    Full Text Available Forest dynamics plots, which now span longitudes, latitudes, and habitat types across the globe, offer unparalleled insights into the ecological and evolutionary processes that determine how species are assembled into communities. Understanding phylogenetic relationships among species in a community has become an important component of assessing assembly processes. However, the application of evolutionary information to questions in community ecology has been limited in large part by the lack of accurate estimates of phylogenetic relationships among individual species found within communities, and is particularly limiting in comparisons between communities. Therefore, streamlining and maximizing the information content of these community phylogenies is a priority. To test the viability and advantage of a multi-community phylogeny, we constructed a multi-plot mega-phylogeny of 1,347 species of trees across 15 forest dynamics plots in the ForestGEO network using DNA barcode sequence data (rbcL, matK and psbA-trnH and compared community phylogenies for each individual plot with respect to support for topology and branch lengths, which affect evolutionary inference of community processes. The levels of taxonomic differentiation across the phylogeny were examined by quantifying the frequency of resolved nodes throughout. In addition, three phylogenetic distance metrics that are commonly used to infer assembly processes were estimated for each plot (Phylogenetic Distance [PD], Mean Phylogenetic Distance [MPD], and Mean Nearest Taxon Distance [MNTD]. Lastly, we examine the partitioning of phylogenetic diversity among community plots through quantification of inter-community MPD and MNTD. Overall, evolutionary relationships were highly resolved across the DNA barcode-based mega-phylogeny, and phylogenetic resolution for each community plot was improved when estimated within the context of the mega-phylogeny. Likewise, when compared with phylogenies for

  13. What is the phylogenetic signal limit from mitogenomes? The reconciliation between mitochondrial and nuclear data in the Insecta class phylogeny

    Directory of Open Access Journals (Sweden)

    Talavera Gerard

    2011-10-01

    limits of the phylogenetic signal that can be extracted from Insecta mitogenomes. Based on the combined use of the five best topology-performing genes we obtained comparable results to whole mitogenomes, highlighting the important role of data quality. Conclusion We show for the first time that mitogenomic data agrees with nuclear and morphological data for several of the most controversial insect evolutionary relationships, adding a new independent source of evidence to study relationships among insect orders. We propose that deeper divergences cannot be inferred with the current available methods due to sequence saturation and compositional bias inconsistencies. Our exploratory analysis indicates that the CAT model is the best dealing with LBA and it could be useful for other groups and datasets with similar phylogenetic difficulties.

  14. Molecular phylogenetics of mastodon and Tyrannosaurus rex.

    Science.gov (United States)

    Organ, Chris L; Schweitzer, Mary H; Zheng, Wenxia; Freimark, Lisa M; Cantley, Lewis C; Asara, John M

    2008-04-25

    We report a molecular phylogeny for a nonavian dinosaur, extending our knowledge of trait evolution within nonavian dinosaurs into the macromolecular level of biological organization. Fragments of collagen alpha1(I) and alpha2(I) proteins extracted from fossil bones of Tyrannosaurus rex and Mammut americanum (mastodon) were analyzed with a variety of phylogenetic methods. Despite missing sequence data, the mastodon groups with elephant and the T. rex groups with birds, consistent with predictions based on genetic and morphological data for mastodon and on morphological data for T. rex. Our findings suggest that molecular data from long-extinct organisms may have the potential for resolving relationships at critical areas in the vertebrate evolutionary tree that have, so far, been phylogenetically intractable.

  15. A Genome-Scale Investigation of How Sequence, Function, and Tree-Based Gene Properties Influence Phylogenetic Inference.

    Science.gov (United States)

    Shen, Xing-Xing; Salichos, Leonidas; Rokas, Antonis

    2016-09-02

    Molecular phylogenetic inference is inherently dependent on choices in both methodology and data. Many insightful studies have shown how choices in methodology, such as the model of sequence evolution or optimality criterion used, can strongly influence inference. In contrast, much less is known about the impact of choices in the properties of the data, typically genes, on phylogenetic inference. We investigated the relationships between 52 gene properties (24 sequence-based, 19 function-based, and 9 tree-based) with each other and with three measures of phylogenetic signal in two assembled data sets of 2,832 yeast and 2,002 mammalian genes. We found that most gene properties, such as evolutionary rate (measured through the percent average of pairwise identity across taxa) and total tree length, were highly correlated with each other. Similarly, several gene properties, such as gene alignment length, Guanine-Cytosine content, and the proportion of tree distance on internal branches divided by relative composition variability (treeness/RCV), were strongly correlated with phylogenetic signal. Analysis of partial correlations between gene properties and phylogenetic signal in which gene evolutionary rate and alignment length were simultaneously controlled, showed similar patterns of correlations, albeit weaker in strength. Examination of the relative importance of each gene property on phylogenetic signal identified gene alignment length, alongside with number of parsimony-informative sites and variable sites, as the most important predictors. Interestingly, the subsets of gene properties that optimally predicted phylogenetic signal differed considerably across our three phylogenetic measures and two data sets; however, gene alignment length and RCV were consistently included as predictors of all three phylogenetic measures in both yeasts and mammals. These results suggest that a handful of sequence-based gene properties are reliable predictors of phylogenetic signal

  16. Structure-constrained sparse canonical correlation analysis with an application to microbiome data analysis.

    Science.gov (United States)

    Chen, Jun; Bushman, Frederic D; Lewis, James D; Wu, Gary D; Li, Hongzhe

    2013-04-01

    Motivated by studying the association between nutrient intake and human gut microbiome composition, we developed a method for structure-constrained sparse canonical correlation analysis (ssCCA) in a high-dimensional setting. ssCCA takes into account the phylogenetic relationships among bacteria, which provides important prior knowledge on evolutionary relationships among bacterial taxa. Our ssCCA formulation utilizes a phylogenetic structure-constrained penalty function to impose certain smoothness on the linear coefficients according to the phylogenetic relationships among the taxa. An efficient coordinate descent algorithm is developed for optimization. A human gut microbiome data set is used to illustrate this method. Both simulations and real data applications show that ssCCA performs better than the standard sparse CCA in identifying meaningful variables when there are structures in the data.

  17. Molecular characterization of Hepatozoon sp. from Brazilian dogs and its phylogenetic relationship with other Hepatozoon spp.

    Science.gov (United States)

    Forlano, M D; Teixeira, K R S; Scofield, A; Elisei, C; Yotoko, K S C; Fernandes, K R; Linhares, G F C; Ewing, S A; Massard, C L

    2007-04-10

    To characterize phylogenetically the species which causes canine hepatozoonosis at two rural areas of Rio de Janeiro State, Brazil, we used universal or Hepatozoon spp. primer sets for the 18S SSU rRNA coding region. DNA extracts were obtained from blood samples of thirteen dogs naturally infected, from four experimentally infected, and from five puppies infected by vertical transmission from a dam, that was experimentally infected. DNA of sporozoites of Hepatozoon americanum was used as positive control. The amplification of DNA extracts from blood of dogs infected with sporozoites of Hepatozoon spp. was observed in the presence of primers to 18S SSU rRNA gene of Hepatozoon spp., whereas DNA of H. americanum sporozoites was amplified in the presence of either universal or Hepatozoon spp.-specific primer sets; the amplified products were approximately 600bp in size. Cloned PCR products obtained from DNA extracts of blood from two dogs experimentally infected with Hepatozoon sp. were sequenced. The consensus sequence, derived from six sequence data sets, were blasted against sequences of 18S SSU rRNA of Hepatozoon spp. available at GenBank and aligned to homologous sequences to perform the phylogenetic analysis. This analysis clearly showed that our sequence clustered, independently of H. americanum sequences, within a group comprising other Hepatozoon canis sequences. Our results confirmed the hypothesis that the agent causing hepatozoonosis in the areas studied in Brazil is H. canis, supporting previous reports that were based on morphological and morphometric analyses.

  18. Phylogenetic relationships of Acheilognathidae (Cypriniformes: Cyprinoidea) as revealed from evidence of both nuclear and mitochondrial gene sequence variation: evidence for necessary taxonomic revision in the family and the identification of cryptic species.

    Science.gov (United States)

    Chang, Chia-Hao; Li, Fan; Shao, Kwang-Tsao; Lin, Yeong-Shin; Morosawa, Takahiro; Kim, Sungmin; Koo, Hyeyoung; Kim, Won; Lee, Jae-Seong; He, Shunping; Smith, Carl; Reichard, Martin; Miya, Masaki; Sado, Tetsuya; Uehara, Kazuhiko; Lavoué, Sébastien; Chen, Wei-Jen; Mayden, Richard L

    2014-12-01

    Bitterlings are relatively small cypriniform species and extremely interesting evolutionarily due to their unusual reproductive behaviors and their coevolutionary relationships with freshwater mussels. As a group, they have attracted a great deal of attention in biological studies. Understanding the origin and evolution of their mating system demands a well-corroborated hypothesis of their evolutionary relationships. In this study, we provide the most comprehensive phylogenetic reconstruction of species relationships of the group based on partitioned maximum likelihood and Bayesian methods using DNA sequence variation of nuclear and mitochondrial genes on 41 species, several subspecies and three undescribed species. Our findings support the monophyly of the Acheilognathidae. Two of the three currently recognized genera are not monophyletic and the family can be subdivided into six clades. These clades are further regarded as genera based on both their phylogenetic relationships and a reappraisal of morphological characters. We present a revised classification for the Acheilognathidae with five genera/lineages: Rhodeus, Acheilognathus (new constitution), Tanakia (new constitution), Paratanakia gen. nov., and Pseudorhodeus gen. nov. and an unnamed clade containing five species currently referred to as "Acheilognathus". Gene trees of several bitterling species indicate that the taxa are not monophyletic. This result highlights a potentially dramatic underestimation of species diversity in this family. Using our new phylogenetic framework, we discuss the evolution of the Acheilognathidae relative to classification, taxonomy and biogeography. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. SNPhylo: a pipeline to construct a phylogenetic tree from huge SNP data.

    Science.gov (United States)

    Lee, Tae-Ho; Guo, Hui; Wang, Xiyin; Kim, Changsoo; Paterson, Andrew H

    2014-02-26

    Phylogenetic trees are widely used for genetic and evolutionary studies in various organisms. Advanced sequencing technology has dramatically enriched data available for constructing phylogenetic trees based on single nucleotide polymorphisms (SNPs). However, massive SNP data makes it difficult to perform reliable analysis, and there has been no ready-to-use pipeline to generate phylogenetic trees from these data. We developed a new pipeline, SNPhylo, to construct phylogenetic trees based on large SNP datasets. The pipeline may enable users to construct a phylogenetic tree from three representative SNP data file formats. In addition, in order to increase reliability of a tree, the pipeline has steps such as removing low quality data and considering linkage disequilibrium. A maximum likelihood method for the inference of phylogeny is also adopted in generation of a tree in our pipeline. Using SNPhylo, users can easily produce a reliable phylogenetic tree from a large SNP data file. Thus, this pipeline can help a researcher focus more on interpretation of the results of analysis of voluminous data sets, rather than manipulations necessary to accomplish the analysis.

  20. Complete Chloroplast Genomes of Papaver rhoeas and Papaver orientale: Molecular Structures, Comparative Analysis, and Phylogenetic Analysis

    Directory of Open Access Journals (Sweden)

    Jianguo Zhou

    2018-02-01

    Full Text Available Papaver rhoeas L. and P. orientale L., which belong to the family Papaveraceae, are used as ornamental and medicinal plants. The chloroplast genome has been used for molecular markers, evolutionary biology, and barcoding identification. In this study, the complete chloroplast genome sequences of P. rhoeas and P. orientale are reported. Results show that the complete chloroplast genomes of P. rhoeas and P. orientale have typical quadripartite structures, which are comprised of circular 152,905 and 152,799-bp-long molecules, respectively. A total of 130 genes were identified in each genome, including 85 protein-coding genes, 37 tRNA genes, and 8 rRNA genes. Sequence divergence analysis of four species from Papaveraceae indicated that the most divergent regions are found in the non-coding spacers with minimal differences among three Papaver species. These differences include the ycf1 gene and intergenic regions, such as rpoB-trnC, trnD-trnT, petA-psbJ, psbE-petL, and ccsA-ndhD. These regions are hypervariable regions, which can be used as specific DNA barcodes. This finding suggested that the chloroplast genome could be used as a powerful tool to resolve the phylogenetic positions and relationships of Papaveraceae. These results offer valuable information for future research in the identification of Papaver species and will benefit further investigations of these species.

  1. Phylogenetic analysis of pelecaniformes (aves based on osteological data: implications for waterbird phylogeny and fossil calibration studies.

    Directory of Open Access Journals (Sweden)

    Nathan D Smith

    2010-10-01

    Full Text Available Debate regarding the monophyly and relationships of the avian order Pelecaniformes represents a classic example of discord between morphological and molecular estimates of phylogeny. This lack of consensus hampers interpretation of the group's fossil record, which has major implications for understanding patterns of character evolution (e.g., the evolution of wing-propelled diving and temporal diversification (e.g., the origins of modern families. Relationships of the Pelecaniformes were inferred through parsimony analyses of an osteological dataset encompassing 59 taxa and 464 characters. The relationships of the Plotopteridae, an extinct family of wing-propelled divers, and several other fossil pelecaniforms (Limnofregata, Prophaethon, Lithoptila, ?Borvocarbo stoeffelensis were also assessed. The antiquity of these taxa and their purported status as stem members of extant families makes them valuable for studies of higher-level avian diversification.Pelecaniform monophyly is not recovered, with Phaethontidae recovered as distantly related to all other pelecaniforms, which are supported as a monophyletic Steganopodes. Some anatomical partitions of the dataset possess different phylogenetic signals, and partitioned analyses reveal that these discrepancies are localized outside of Steganopodes, and primarily due to a few labile taxa. The Plotopteridae are recovered as the sister taxon to Phalacrocoracoidea, and the relationships of other fossil pelecaniforms representing key calibration points are well supported, including Limnofregata (sister taxon to Fregatidae, Prophaethon and Lithoptila (successive sister taxa to Phaethontidae, and ?Borvocarbo stoeffelensis (sister taxon to Phalacrocoracidae. These relationships are invariant when 'backbone' constraints based on recent avian phylogenies are imposed.Relationships of extant pelecaniforms inferred from morphology are more congruent with molecular phylogenies than previously assumed, though

  2. [Phylogenetic relationships of the species of Oxytropis DC. subg. Oxytropis and Phacoxytropis (Fabaceae) from Asian Russia inferred from the nucleotide sequence analysis of the intergenic spacers of the chloroplast genome].

    Science.gov (United States)

    Kholina, A B; Kozyrenko, M M; Artyukova, E V; Sandanov, D V; Andrianova, E A

    2016-08-01

    The nucleotide sequence analysis of trnH–psbA, trnL–trnF, and trnS–trnG intergenic spacer regions of chloroplast DNA performed in the representatives of the genus Oxytropis from Asian Russia provided clarification of the phylogenetic relationships of some species and sections in the subgenera Oxytropis and Phacoxytropis and in the genus Oxytropis as a whole. Only the section Mesogaea corresponds to the subgenus Phacoxytropis, while the section Janthina of the same subgenus groups together with the sections of the subgenus Oxytropis. The sections Chrysantha and Ortholoma of the subgenus Oxytropis are not only closely related to each other, but together with the section Mesogaea, they are grouped into the subgenus Phacoxytropis. It seems likely that the sections Chrysantha and Ortholoma should be assigned to the subgenus Phacoxytropis, and the section Janthina should be assigned to the subgenus Oxytropis. The molecular differences were identified between O. coerulea and O. mandshurica from the section Janthina that were indicative of considerable divergence of their chloroplast genomes and the species independence of the taxa. The species independence of O. czukotica belonging to the section Arctobia was also confirmed.

  3. The eastern Asian and eastern and western North American floristic disjunction: congruent phylogenetic patterns in seven diverse genera.

    Science.gov (United States)

    Xiang, Q Y; Soltis, D E; Soltis, P S

    1998-10-01

    One of the most remarkable examples of intercontinental disjunction of the North Temperate Flora involves eastern Asia and eastern and western North America. Although there has been considerable interest in this phytogeographic pattern for over 150 years (e.g., Gray, 1859; Li, 1952; Graham, 1972; Boufford and Spongberg, 1983; Wu, 1983; Tiffney, 1985a, 1985b), relationships among taxa displaying the disjunction remain obscure. Understanding phylogenetic relationships is, however, a prerequisite for historical biogeographic analyses of this distributional pattern. To understand better the relationships of taxa displaying this intercontinental disjunction, phylogenetic analyses were conducted using a variety of DNA data sets for species of four genera (Cornus, Boykinia, Tiarella, and Trautvetteria) that occur in eastern Asia, eastern North America, and western North America. An area cladogram was constructed for each of the four genera, all of which show a similar pattern of relationship: the eastern Asian species are sister to all North American species. An identical phylogenetic pattern is also found in three other taxa exhibiting this disjunction (Aralia sect. Aralia, Calycanthus, and Adiantum pedatum). The congruent phylogenetic pattern found in these seven diverse genera raises the possibility of a common origin of the eastern Asia, eastern and western North America disjunction. The data are in agreement with the long-standing hypothesis that this well-known floristic disjunction represents the fragmentation of a once continuous Mixed Mesophytic forest community and suggest that the disjunction may have involved only two major vicariance events: an initial split between Eurasia and North America, followed by the isolation of floras between eastern and western North America. However, congruence between phylogenies and geographic distributions does not necessarily indicate an identical phytogeographic history. Taxa exhibiting the same phylogenetic pattern may have

  4. Molecular Identification and Phylogenetic Relationships of Pleurotus spp. Diversity in Malaysia by ITS Marker

    International Nuclear Information System (INIS)

    Zaiton Abdul Kadir; Azhar Mohamad; Nie, H.J.

    2016-01-01

    Pleurotus species is an edible mushroom in Malaysia which is commonly known as Oyster mushroom and grow by small holder farmers. This species is important for nutraceutical, pharmaceutical and cosmoceutical industries. However, there is some mis identification due to phenotypic variation in which the species shared some similarities due to environmental factors, and thus create troublesome. Thus, eleven isolates of Pleurotus sample which comprise of 4 different species were collected from different locations in Malaysia were used for strain and species identification including mutant line Pleurotus. Pleurotus pulmonarius coded as ATCC 62887 was used as a reference. Total genomic DNA was extracted, quantified and amplified by using rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) ITS8-F: 5"'AGTCGTAACAAGGTTTCCGTAGGTG3"' and ITS6-R: 5"'TTCCCGCTTCACTCGC-AGT3"'primers. The PCR products were directly sequenced for BLAST evaluation. Phylogenetic (UPGMA) was constructed by using CLC Sequence Viewer 6.8.1. It clearly shown distinct clades of the Pleurotus species and strains. Pleurotus pulmonarius were found to be grouped in one group while Pleurotus florida and Pleurotus columbinus were in the other different clade. For Pleurotus geesteranus, which has the most nucleotide similarity and morphology with Pleurotus pulmonarius, was grouped in its own clade and was single isolated. Thus, ITS marker found to be reliable, rapid, robust and reproducible approach in screening of Pleurotus species and its variants for taxonomical purposes and phylogenetic analysis. (author)

  5. Genetic characterization and phylogenetic analysis of porcine circovirus type 2 (PCV2) in Serbia.

    Science.gov (United States)

    Savic, Bozidar; Milicevic, Vesna; Jakic-Dimic, Dobrila; Bojkovski, Jovan; Prodanovic, Radisa; Kureljusic, Branislav; Potkonjak, Aleksandar; Savic, Borivoje

    2012-01-01

    Porcine circovirus type 2 (PCV2) is the main causative agent of postweaning multisystemic wasting syndrome (PMWS). To characterize and determine the genetic diversity of PCV2 in the porcine population of Serbia, nucleotide and deduced amino acid sequences of the open reading frame 2 (ORF2) of PCV2 collected from the tissues of pigs that either had died as a result of PMWS or did not exhibit disease symptoms were analyzed. Sequencing and phylogenetic analysis showed considerable diversity among PCV2 ORF2 sequences and the existence of two main PCV2 genotypes, PCV2b and PCV2a, with at least three clusters, 1A/B, 1C and 2D. In order to provide further proof that the 1C strain is circulating in the porcine population, the whole viral genome of one PCV2 isolate was sequenced. Genotyping and phylogenetic analysis using the entire viral genome sequences confirmed that there was a PMWS-associated 1C strain emerging in Serbia. Our analysis also showed that PCV2b is dominant in the porcine population, and that it is exclusively associated with PMWS occurrences in the country. These data constitute a useful basis for further epidemiological studies regarding the heterogeneity of PCV2 strains on the European continent.

  6. Phylogenetic analysis of New Zealand earthworms (Oligochaeta: Megascolecidae) reveals ancient clades and cryptic taxonomic diversity.

    Science.gov (United States)

    Buckley, Thomas R; James, Sam; Allwood, Julia; Bartlam, Scott; Howitt, Robyn; Prada, Diana

    2011-01-01

    We have constructed the first ever phylogeny for the New Zealand earthworm fauna (Megascolecinae and Acanthodrilinae) including representatives from other major continental regions. Bayesian and maximum likelihood phylogenetic trees were constructed from 427 base pairs from the mitochondrial large subunit (16S) rRNA gene and 661 base pairs from the nuclear large subunit (28S) rRNA gene. Within the Acanthodrilinae we were able to identify a number of well-supported clades that were restricted to continental landmasses. Estimates of nodal support for these major clades were generally high, but relationships among clades were poorly resolved. The phylogenetic analyses revealed several independent lineages in New Zealand, some of which had a comparable phylogenetic depth to monophyletic groups sampled from Madagascar, Africa, North America and Australia. These results are consistent with at least some of these clades having inhabited New Zealand since rifting from Gondwana in the Late Cretaceous. Within the New Zealand Acanthodrilinae, major clades tended to be restricted to specific regions of New Zealand, with the central North Island and Cook Strait representing major biogeographic boundaries. Our field surveys of New Zealand and subsequent identification has also revealed extensive cryptic taxonomic diversity with approximately 48 new species sampled in addition to the 199 species recognized by previous authors. Our results indicate that further survey and taxonomic work is required to establish a foundation for future biogeographic and ecological research on this vitally important component of the New Zealand biota. Copyright © 2010 Elsevier Inc. All rights reserved.

  7. [Phylogenetic analysis of genomes of Vibrio cholerae strains isolated on the territory of Rostov region].

    Science.gov (United States)

    Kuleshov, K V; Markelov, M L; Dedkov, V G; Vodop'ianov, A S; Kermanov, A V; Pisanov, R V; Kruglikov, V D; Mazrukho, A B; Maleev, V V; Shipulin, G A

    2013-01-01

    Determination of origin of 2 Vibrio cholerae strains isolated on the territory of Rostov region by using full genome sequencing data. Toxigenic strain 2011 EL- 301 V. cholerae 01 El Tor Inaba No. 301 (ctxAB+, tcpA+) and nontoxigenic strain V. cholerae O1 Ogawa P- 18785 (ctxAB-, tcpA+) were studied. Sequencing was carried out on the MiSeq platform. Phylogenetic analysis of the genomes obtained was carried out based on comparison of conservative part of the studied and 54 previously sequenced genomes. 2011EL-301 strain genome was presented by 164 contigs with an average coverage of 100, N50 parameter was 132 kb, for strain P- 18785 - 159 contigs with a coverage of69, N50 - 83 kb. The contigs obtained for strain 2011 EL-301 were deposited in DDBJ/EMBL/GenBank databases with access code AJFN02000000, for strain P-18785 - ANHS00000000. 716 protein-coding orthologous genes were detected. Based on phylogenetic analysis strain P- 18785 belongs to PG-1 subgroup (a group of predecessor strains of the 7th pandemic). Strain 2011EL-301 belongs to groups of strains of the 7th pandemic and is included into the cluster with later isolates that are associated with cases of cholera in South Africa and cases of import of cholera to the USA from Pakistan. The data obtained allows to establish phylogenetic connections with V cholerae strains isolated earlier.

  8. Phylogenetic Tree Analysis of the Cold-Hot Nature of Traditional Chinese Marine Medicine for Possible Anticancer Activity

    Directory of Open Access Journals (Sweden)

    Xianjun Fu

    2017-01-01

    Full Text Available Traditional Chinese Marine Medicine (TCMM represents one of the medicinal resources for research and development of novel anticancer drugs. In this study, to investigate the presence of anticancer activity (AA displayed by cold or hot nature of TCMM, we analyzed the association relationship and the distribution regularity of TCMMs with different nature (613 TCMMs originated from 1,091 species of marine organisms via association rules mining and phylogenetic tree analysis. The screened association rules were collected from three taxonomy groups: (1 Bacteria superkingdom, Phaeophyceae class, Fucales order, Sargassaceae family, and Sargassum genus; (2 Viridiplantae kingdom, Streptophyta phylum, Malpighiales class, and Rhizophoraceae family; (3 Holothuroidea class, Aspidochirotida order, and Holothuria genus. Our analyses showed that TCMMs with closer taxonomic relationship were more likely to possess anticancer bioactivity. We found that the cluster pattern of marine organisms with reported AA tended to cluster with cold nature TCMMs. Moreover, TCMMs with salty-cold nature demonstrated properties for softening hard mass and removing stasis to treat cancers, and species within Metazoa or Viridiplantae kingdom of cold nature were more likely to contain AA properties. We propose that TCMMs from these marine groups may enable focused bioprospecting for discovery of novel anticancer drugs derived from marine bioresources.

  9. Molecular cloning, phylogenetic analysis and heat shock response of Babesia gibsoni heat shock protein 90.

    Science.gov (United States)

    Yamasaki, Masahiro; Tsuboi, Yoshihiro; Taniyama, Yusuke; Uchida, Naohiro; Sato, Reeko; Nakamura, Kensuke; Ohta, Hiroshi; Takiguchi, Mitsuyoshi

    2016-09-01

    The Babesia gibsoni heat shock protein 90 (BgHSP90) gene was cloned and sequenced. The length of the gene was 2,610 bp with two introns. This gene was amplified from cDNA corresponding to full length coding sequence (CDS) with an open reading frame of 2,148 bp. A phylogenetic analysis of the CDS of HSP90 gene showed that B. gibsoni was most closely related to B. bovis and Babesia sp. BQ1/Lintan and lies within a phylogenetic cluster of protozoa. Moreover, mRNA transcription profile for BgHSP90 exposed to high temperature were examined by quantitative real-time reverse transcription-polymerase chain reaction. BgHSP90 levels were elevated when the parasites were incubated at 43°C for 1 hr.

  10. PhySortR: a fast, flexible tool for sorting phylogenetic trees in R.

    Science.gov (United States)

    Stephens, Timothy G; Bhattacharya, Debashish; Ragan, Mark A; Chan, Cheong Xin

    2016-01-01

    A frequent bottleneck in interpreting phylogenomic output is the need to screen often thousands of trees for features of interest, particularly robust clades of specific taxa, as evidence of monophyletic relationship and/or reticulated evolution. Here we present PhySortR, a fast, flexible R package for classifying phylogenetic trees. Unlike existing utilities, PhySortR allows for identification of both exclusive and non-exclusive clades uniting the target taxa based on tip labels (i.e., leaves) on a tree, with customisable options to assess clades within the context of the whole tree. Using simulated and empirical datasets, we demonstrate the potential and scalability of PhySortR in analysis of thousands of phylogenetic trees without a priori assumption of tree-rooting, and in yielding readily interpretable trees that unambiguously satisfy the query. PhySortR is a command-line tool that is freely available and easily automatable.

  11. Comprehensive untargeted metabolomics of Lychnnophorinae subtribe (Asteraceae: Vernonieae in a phylogenetic context.

    Directory of Open Access Journals (Sweden)

    Maria Elvira Poleti Martucci

    Full Text Available Members of the subtribe Lychnophorinae occur mostly within the Cerrado domain of the Brazilian Central Plateau. The relationships between its 11 genera, as well as between Lychnophorinae and other subtribes belonging to the tribe Vernonieae, have recently been investigated upon a phylogeny based on molecular and morphological data. We report the use of a comprehensive untargeted metabolomics approach, combining HPLC-MS and GC-MS data, followed by multivariate analyses aiming to assess the congruence between metabolomics data and the phylogenetic hypothesis, as well as its potential as a chemotaxonomic tool. We analyzed 78 species by UHPLC-MS and GC-MS in both positive and negative ionization modes. The metabolic profiles obtained for these species were treated in MetAlign and in MSClust and the matrices generated were used in SIMCA for hierarchical cluster analyses, principal component analyses and orthogonal partial least square discriminant analysis. The results showed that metabolomic analyses are mostly congruent with the phylogenetic hypothesis especially at lower taxonomic levels (Lychnophora or Eremanthus. Our results confirm that data generated using metabolomics provide evidence for chemotaxonomical studies, especially for phylogenetic inference of the Lychnophorinae subtribe and insight into the evolution of the secondary metabolites of this group.

  12. Detection and phylogenetic analysis of infectious pancreatic necrosis virus in Chile.

    Science.gov (United States)

    Tapia, D; Eissler, Y; Torres, P; Jorquera, E; Espinoza, J C; Kuznar, J

    2015-10-27

    Infectious pancreatic necrosis virus (IPNV) is the etiological agent of a highly contagious disease that is endemic to salmon farming in Chile and causes great economic losses to the industry. Here we compared different diagnostic methods to detect IPNV in field samples, including 3 real-time reverse transcription PCR (qRT-PCR) assays, cell culture isolation, and indirect fluorescent antibody test (IFAT). Additionally, we performed a phylogenetic analysis to investigate the genogroups prevailing in Chile, as well as their geographic distribution and virulence. The 3 qRT-PCR assays used primers that targeted regions of the VP2 and VP1 genes of the virus and were tested in 46 samples, presenting a fair agreement within their results. All samples were positive for at least 2 of the qRT-PCR assays, 29 were positive for cell culture, and 23 for IFAT, showing less sensitivity for these latter 2 methods. For the phylogenetic analysis, portions of 1180 and 523 bp of the VP2 region of segment A were amplified by RT-PCR, sequenced and compared with sequences from reference strains and from isolates reported by previous studies carried out in Chile. Most of the sequenced isolates belonged to genogroup 5 (European origin), and 5 were classified within genogroup 1 (American origin). Chilean isolates formed clusters within each of the genogroups found, evidencing a clear differentiation from the reference strains. To our knowledge, this is the most extensive study completed for IPNV in Chile, covering isolates from sea- and freshwater salmon farms and showing a high prevalence of this virus in the country.

  13. A Phylogenetic and Phenotypic Analysis of Salmonella enterica Serovar Weltevreden, an Emerging Agent of Diarrheal Disease in Tropical Regions.

    Directory of Open Access Journals (Sweden)

    Carine Makendi

    2016-02-01

    Full Text Available Salmonella enterica serovar Weltevreden (S. Weltevreden is an emerging cause of diarrheal and invasive disease in humans residing in tropical regions. Despite the regional and international emergence of this Salmonella serovar, relatively little is known about its genetic diversity, genomics or virulence potential in model systems. Here we used whole genome sequencing and bioinformatics analyses to define the phylogenetic structure of a diverse global selection of S. Weltevreden. Phylogenetic analysis of more than 100 isolates demonstrated that the population of S. Weltevreden can be segregated into two main phylogenetic clusters, one associated predominantly with continental Southeast Asia and the other more internationally dispersed. Subcluster analysis suggested the local evolution of S. Weltevreden within specific geographical regions. Four of the isolates were sequenced using long read sequencing to produce high quality reference genomes. Phenotypic analysis in Hep-2 cells and in a murine infection model indicated that S. Weltevreden were significantly attenuated in these models compared to the classical S. Typhimurium reference strain SL1344. Our work outlines novel insights into this important emerging pathogen and provides a baseline understanding for future research studies.

  14. Phylogenetic analysis of of Sarcocystis nesbitti (Coccidia: Sarcocystidae) suggests a snake as its probable definitive host

    Science.gov (United States)

    Sarcocystis nesbitti was first described by Mandour in 1969 from rhesus monkey muscle. Its definitive host remains unknown. 18SrRNA gene of Sarcocystis nesbitti was amplified, sequenced, and subjected to phylogenetic analysis. Among those congeners available for comparison, it shares closest affinit...

  15. The complete mitochondrial genome of Somanniathelphusa boyangensis and phylogenetic analysis of Genus Somanniathelphusa (Crustacea: Decapoda: Parathelphusidae.

    Directory of Open Access Journals (Sweden)

    Xin-Nan Jia

    Full Text Available In this study, the authors first obtained the mitochondrial genome of Somanniathelphusa boyangensis. The results showed that the mitochondrial genome is 17,032bp in length, included 13 protein-coding genes, 2 rRNAs genes, 22 tRNAs genes and 1 putative control region, and it has the characteristics of the metazoan mitochondrial genome A+T bias. All tRNA genes display the typical clover-leaf secondary structure except tRNASer(AGN, which has lost the dihydroxyuridine arm. The GenBank database contains the mitochondrial genomes of representatives of approximately 22 families of Brachyura, comprising 56 species, including 4 species of freshwater crab. The authors established the phylogenetic relationships using the maximum likelihood and Bayesian inference methods. The phylogenetic relationship indicated that the molecular taxonomy of S. boyangensis is consistent with current morphological classification, and Parathelphusidae and Potamidae are derived within the freshwater clade or as part of it. In addition, the authors used the COX1 sequence of Somanniathelphusa in GenBank and the COX1 sequence of S. boyangensis to estimated the divergence time of this genus. The result displayed that the divergence time of Somanniathelphusa qiongshanensis is consistent with the separation of Hainan Island from mainland China in the Beibu Gulf, and the divergence time for Somanniathelphusa taiwanensis and Somanniathelphusa amoyensis is consistent with the separation of Taiwan Province from Mainland China at Fujian Province. These data indicate that geologic events influenced speciation of the genus Somanniathelphusa.

  16. BIMLR: a method for constructing rooted phylogenetic networks from rooted phylogenetic trees.

    Science.gov (United States)

    Wang, Juan; Guo, Maozu; Xing, Linlin; Che, Kai; Liu, Xiaoyan; Wang, Chunyu

    2013-09-15

    Rooted phylogenetic trees constructed from different datasets (e.g. from different genes) are often conflicting with one another, i.e. they cannot be integrated into a single phylogenetic tree. Phylogenetic networks have become an important tool in molecular evolution, and rooted phylogenetic networks are able to represent conflicting rooted phylogenetic trees. Hence, the development of appropriate methods to compute rooted phylogenetic networks from rooted phylogenetic trees has attracted considerable research interest of late. The CASS algorithm proposed by van Iersel et al. is able to construct much simpler networks than other available methods, but it is extremely slow, and the networks it constructs are dependent on the order of the input data. Here, we introduce an improved CASS algorithm, BIMLR. We show that BIMLR is faster than CASS and less dependent on the input data order. Moreover, BIMLR is able to construct much simpler networks than almost all other methods. BIMLR is available at http://nclab.hit.edu.cn/wangjuan/BIMLR/. © 2013 Elsevier B.V. All rights reserved.

  17. Comparative evolutionary diversity and phylogenetic structure across multiple forest dynamics plots: a mega-phylogeny approach

    Science.gov (United States)

    Erickson, David L.; Jones, Frank A.; Swenson, Nathan G.; Pei, Nancai; Bourg, Norman A.; Chen, Wenna; Davies, Stuart J.; Ge, Xue-jun; Hao, Zhanqing; Howe, Robert W.; Huang, Chun-Lin; Larson, Andrew J.; Lum, Shawn K. Y.; Lutz, James A.; Ma, Keping; Meegaskumbura, Madhava; Mi, Xiangcheng; Parker, John D.; Fang-Sun, I.; Wright, S. Joseph; Wolf, Amy T.; Ye, W.; Xing, Dingliang; Zimmerman, Jess K.; Kress, W. John

    2014-01-01

    Forest dynamics plots, which now span longitudes, latitudes, and habitat types across the globe, offer unparalleled insights into the ecological and evolutionary processes that determine how species are assembled into communities. Understanding phylogenetic relationships among species in a community has become an important component of assessing assembly processes. However, the application of evolutionary information to questions in community ecology has been limited in large part by the lack of accurate estimates of phylogenetic relationships among individual species found within communities, and is particularly limiting in comparisons between communities. Therefore, streamlining and maximizing the information content of these community phylogenies is a priority. To test the viability and advantage of a multi-community phylogeny, we constructed a multi-plot mega-phylogeny of 1347 species of trees across 15 forest dynamics plots in the ForestGEO network using DNA barcode sequence data (rbcL, matK, and psbA-trnH) and compared community phylogenies for each individual plot with respect to support for topology and branch lengths, which affect evolutionary inference of community processes. The levels of taxonomic differentiation across the phylogeny were examined by quantifying the frequency of resolved nodes throughout. In addition, three phylogenetic distance (PD) metrics that are commonly used to infer assembly processes were estimated for each plot [PD, Mean Phylogenetic Distance (MPD), and Mean Nearest Taxon Distance (MNTD)]. Lastly, we examine the partitioning of phylogenetic diversity among community plots through quantification of inter-community MPD and MNTD. Overall, evolutionary relationships were highly resolved across the DNA barcode-based mega-phylogeny, and phylogenetic resolution for each community plot was improved when estimated within the context of the mega-phylogeny. Likewise, when compared with phylogenies for individual plots, estimates of

  18. Sequence and phylogenetic analysis of virulent Newcastle disease virus isolates from Pakistan during 2009–2013 reveals circulation of new sub genotype

    Energy Technology Data Exchange (ETDEWEB)

    Siddique, Naila, E-mail: naila.nrlpd@gmail.com [National Reference Laboratory for Poultry Diseases, Animal Sciences Institute, National Agricultural Research Center, Islamabad (Pakistan); Naeem, Khalid; Abbas, Muhammad Athar; Ali Malik, Akbar; Rashid, Farooq; Rafique, Saba; Ghafar, Abdul; Rehman, Abdul [National Reference Laboratory for Poultry Diseases, Animal Sciences Institute, National Agricultural Research Center, Islamabad (Pakistan)

    2013-09-15

    Despite observing the standard bio-security measures at commercial poultry farms and extensive use of Newcastle disease vaccines, a new genotype VII-f of Newcastle disease virus (NDV) got introduced in Pakistan during 2011. In this regard 300 ND outbreaks recorded so far have resulted into huge losses of approximately USD 200 million during 2011–2013. A total of 33 NDV isolates recovered during 2009–2013 throughout Pakistan were characterized biologically and phylogenetically. The phylogenetic analysis revealed a new velogenic sub genotype VII-f circulating in commercial and domestic poultry along with the earlier reported sub genotype VII-b. Partial sequencing of Fusion gene revealed two types of cleavage site motifs; lentogenic {sup 112}GRQGRL{sup 117} and velogenic {sup 112}RRQKRF{sup 117} along with some point mutations indicative of genetic diversity. We report here a new sub genotype of virulent NDV circulating in commercial and backyard poultry in Pakistan and provide evidence for the possible genetic diversity which may be causing new NDV out breaks. - Highlights: • The first report of isolation of new genotype VII-f of virulent Newcastle disease virus (NDV) in Pakistan. • We report the partial Fusion gene sequences of new genotype VII-f of virulent NDV from Pakistan. • We report the phylogenetic relationship of new NDV strains with reported NDV strains. • Provide outbreak history of new virulent NDV strain in commercial and backyard poultry in Pakistan. • We provide possible evidence for the role of backyard poultry in NDV outbreaks.

  19. Molecular identification and phylogenetic analysis of important medicinal plant species in genus Paeonia based on rDNA-ITS, matK, and rbcL DNA barcode sequences.

    Science.gov (United States)

    Kim, W J; Ji, Y; Choi, G; Kang, Y M; Yang, S; Moon, B C

    2016-08-05

    This study was performed to identify and analyze the phylogenetic relationship among four herbaceous species of the genus Paeonia, P. lactiflora, P. japonica, P. veitchii, and P. suffruticosa, using DNA barcodes. These four species, which are commonly used in traditional medicine as Paeoniae Radix and Moutan Radicis Cortex, are pharmaceutically defined in different ways in the national pharmacopoeias in Korea, Japan, and China. To authenticate the different species used in these medicines, we evaluated rDNA-internal transcribed spacers (ITS), matK and rbcL regions, which provide information capable of effectively distinguishing each species from one another. Seventeen samples were collected from different geographic regions in Korea and China, and DNA barcode regions were amplified using universal primers. Comparative analyses of these DNA barcode sequences revealed species-specific nucleotide sequences capable of discriminating the four Paeonia species. Among the entire sequences of three barcodes, marker nucleotides were identified at three positions in P. lactiflora, eleven in P. japonica, five in P. veitchii, and 25 in P. suffruticosa. Phylogenetic analyses also revealed four distinct clusters showing homogeneous clades with high resolution at the species level. The results demonstrate that the analysis of these three DNA barcode sequences is a reliable method for identifying the four Paeonia species and can be used to authenticate Paeoniae Radix and Moutan Radicis Cortex at the species level. Furthermore, based on the assessment of amplicon sizes, inter/intra-specific distances, marker nucleotides, and phylogenetic analysis, rDNA-ITS was the most suitable DNA barcode for identification of these species.

  20. SILVA tree viewer: interactive web browsing of the SILVA phylogenetic guide trees

    OpenAIRE

    Beccati, Alan; Gerken, Jan; Quast, Christian; Yilmaz, Pelin; Glöckner, Frank Oliver

    2017-01-01

    Background Phylogenetic trees are an important tool to study the evolutionary relationships among organisms. The huge amount of available taxa poses difficulties in their interactive visualization. This hampers the interaction with the users to provide feedback for the further improvement of the taxonomic framework. Results The SILVA Tree Viewer is a web application designed for visualizing large phylogenetic trees without requiring the download of any software tool or data files. The SILVA T...

  1. Phylogenetic Analysis of Apple scar skin viroid Isolates in Korea

    Directory of Open Access Journals (Sweden)

    Kang Hee Cho

    2015-12-01

    Full Text Available To identify genome sequences of Apple scar skin viroid (ASSVd isolates in Korea, the field survey was performed from ‘Hongro’ apple orchards located in eight sites in South Korea (Bongwha, Cheongsong, Dangjin, Gimchoen, Muju, Mungyeong, Suwon, and Yeongwol. ASSVd was detected by RT-PCR and PCR fragments were cloned into cloning vector. Full-length viral genomes of eight ASSVd isolates were sequenced and compared with 21 isolates reported previously from Korea, India, China, Japan and Greece. Eight isolates in this study showed 92.2-99.7% nucleotide sequence identities with those reported previously. Phylogenetic analysis showed that seven isolates reported in this study belong to the same group distinct from other groups.

  2. Phylogenetic relationships of German heavy draught horse breeds inferred from mitochondrial DNA D-loop variation.

    Science.gov (United States)

    Aberle, K S; Hamann, H; Drögemüller, C; Distl, O

    2007-04-01

    We analysed a 610-bp mitochondrial (mt)DNA D-loop fragment in a sample of German draught horse breeds and compared the polymorphic sites with sequences from Arabian, Hanoverian, Exmoor, Icelandic, Sorraia and Przewalski's Horses as well as with Suffolk, Shire and Belgian horses. In a total of 65 horses, 70 polymorphic sites representing 47 haplotypes were observed. The average percentage of polymorphic sites was 11.5% for the mtDNA fragment analysed. In the nine different draught horse breeds including South German, Mecklenburg, Saxon Thuringa coldblood, Rhenisch German, Schleswig Draught Horse, Black Forest Horse, Shire, Suffolk and Belgian, 61 polymorphic sites and 24 haplotypes were found. The phylogenetic analysis failed to show monophyletic groups for the draught horses. The analysis indicated that the draught horse populations investigated consist of diverse genetic groups with respect to their maternal lineage.

  3. One tree to link them all: a phylogenetic dataset for the European tetrapoda.

    Science.gov (United States)

    Roquet, Cristina; Lavergne, Sébastien; Thuiller, Wilfried

    2014-08-08

    Since the ever-increasing availability of phylogenetic informative data, the last decade has seen an upsurge of ecological studies incorporating information on evolutionary relationships among species. However, detailed species-level phylogenies are still lacking for many large groups and regions, which are necessary for comprehensive large-scale eco-phylogenetic analyses. Here, we provide a dataset of 100 dated phylogenetic trees for all European tetrapods based on a mixture of supermatrix and supertree approaches. Phylogenetic inference was performed separately for each of the main Tetrapoda groups of Europe except mammals (i.e. amphibians, birds, squamates and turtles) by means of maximum likelihood (ML) analyses of supermatrix applying a tree constraint at the family (amphibians and squamates) or order (birds and turtles) levels based on consensus knowledge. For each group, we inferred 100 ML trees to be able to provide a phylogenetic dataset that accounts for phylogenetic uncertainty, and assessed node support with bootstrap analyses. Each tree was dated using penalized-likelihood and fossil calibration. The trees obtained were well-supported by existing knowledge and previous phylogenetic studies. For mammals, we modified the most complete supertree dataset available on the literature to include a recent update of the Carnivora clade. As a final step, we merged the phylogenetic trees of all groups to obtain a set of 100 phylogenetic trees for all European Tetrapoda species for which data was available (91%). We provide this phylogenetic dataset (100 chronograms) for the purpose of comparative analyses, macro-ecological or community ecology studies aiming to incorporate phylogenetic information while accounting for phylogenetic uncertainty.

  4. Phylogenetic analysis, fumonisin production and pathogenicity of Fusarium fujikuroi strains isolated from rice in the Philippines.

    Science.gov (United States)

    Cruz, Alejandra; Marín, Patricia; González-Jaén, M Teresa; Aguilar, Kristel Grace I; Cumagun, Christian Joseph R

    2013-09-01

    Fusarium fujikuroi Nirenberg is a maize and rice pathogen causing important agricultural losses and produces fumonisins - mycotoxins which pose health risk to humans and farm animals. However, little information is available about the phylogenetics of this species and its ability to produce fumonisins in rice. We studied 32 strains isolated from rice in the Philippines and performed a phylogenetic analysis using the partial sequence of Elongation Factor 1 alpha (EF-1α) including isolates belonging to closely related species. Fumonisin B1 (FB1 ) production was analyzed in 7-day-old cultures grown in fumonisin-inducing medium by an enzyme-linked immunosorbent assay-based method and by real-time reverse transcriptase-polymerase chain reaction using primers for FUM1 gene, a key gene in fumonisin biosynthesis. Nucleotide diversities per site (π) were 0.00024 ± 0.00022 (standard deviation) for the 32 F. fujikuroi strains from the Philippines and 0.00189 ± 0.00143 for all 34 F. fujikuroi strains, respectively. F. fujikuroi isolates grouped into one cluster separated from the rest of isolates belonging to the closely related F. proliferatum and showed very low variability, irrespective of their geographic origin. The cluster containing strains of F. proliferatum showed higher intraspecific variability than F. fujikuroi. Thirteen of the 32 strains analyzed were FB1 producers (40.62%), with production ranging from 0.386 to 223.83 ppm. All isolates analyzed showed FUM1 gene expression above 1 and higher than the CT value of the non-template control sample. Both seedling stunting and elongation were induced by the isolates in comparison with the control. F. fujikuroi are distinct from F. proliferatum isolates based on phytogenetic analysis and are potential fumonisin producers because all are positive for FUM1 gene expression. No relationship between fumonisin production and pathogenicity could be observed. © 2013 Society of Chemical Industry.

  5. Treelink: data integration, clustering and visualization of phylogenetic trees.

    Science.gov (United States)

    Allende, Christian; Sohn, Erik; Little, Cedric

    2015-12-29

    Phylogenetic trees are central to a wide range of biological studies. In many of these studies, tree nodes need to be associated with a variety of attributes. For example, in studies concerned with viral relationships, tree nodes are associated with epidemiological information, such as location, age and subtype. Gene trees used in comparative genomics are usually linked with taxonomic information, such as functional annotations and events. A wide variety of tree visualization and annotation tools have been developed in the past, however none of them are intended for an integrative and comparative analysis. Treelink is a platform-independent software for linking datasets and sequence files to phylogenetic trees. The application allows an automated integration of datasets to trees for operations such as classifying a tree based on a field or showing the distribution of selected data attributes in branches and leafs. Genomic and proteonomic sequences can also be linked to the tree and extracted from internal and external nodes. A novel clustering algorithm to simplify trees and display the most divergent clades was also developed, where validation can be achieved using the data integration and classification function. Integrated geographical information allows ancestral character reconstruction for phylogeographic plotting based on parsimony and likelihood algorithms. Our software can successfully integrate phylogenetic trees with different data sources, and perform operations to differentiate and visualize those differences within a tree. File support includes the most popular formats such as newick and csv. Exporting visualizations as images, cluster outputs and genomic sequences is supported. Treelink is available as a web and desktop application at http://www.treelinkapp.com .

  6. Effect of site-specific heterogeneous evolution on phylogenetic reconstruction: a simple evaluation.

    Science.gov (United States)

    Cheng, Qiqun; Su, Zhixi; Zhong, Yang; Gu, Xun

    2009-07-15

    Recent studies have shown that heterogeneous evolution may mislead phylogenetic analysis, which has been neglected for a long time. We evaluate the effect of heterogeneous evolution on phylogenetic analysis, using 18 fish mitogenomic coding sequences as an example. Using the software DIVERGE, we identify 198 amino acid sites that have experienced heterogeneous evolution. After removing these sites, the rest of sites are shown to be virtually homogeneous in the evolutionary rate. There are some differences between phylogenetic trees built with heterogeneous sites ("before tree") and without heterogeneous sites ("after tree"). Our study demonstrates that for phylogenetic reconstruction, an effective approach is to identify and remove sites with heterogeneous evolution, and suggests that researchers can use the software DIVERGE to remove the influence of heterogeneous evolution before reconstructing phylogenetic trees.

  7. Relating phylogenetic trees to transmission trees of infectious disease outbreaks.

    Science.gov (United States)

    Ypma, Rolf J F; van Ballegooijen, W Marijn; Wallinga, Jacco

    2013-11-01

    Transmission events are the fundamental building blocks of the dynamics of any infectious disease. Much about the epidemiology of a disease can be learned when these individual transmission events are known or can be estimated. Such estimations are difficult and generally feasible only when detailed epidemiological data are available. The genealogy estimated from genetic sequences of sampled pathogens is another rich source of information on transmission history. Optimal inference of transmission events calls for the combination of genetic data and epidemiological data into one joint analysis. A key difficulty is that the transmission tree, which describes the transmission events between infected hosts, differs from the phylogenetic tree, which describes the ancestral relationships between pathogens sampled from these hosts. The trees differ both in timing of the internal nodes and in topology. These differences become more pronounced when a higher fraction of infected hosts is sampled. We show how the phylogenetic tree of sampled pathogens is related to the transmission tree of an outbreak of an infectious disease, by the within-host dynamics of pathogens. We provide a statistical framework to infer key epidemiological and mutational parameters by simultaneously estimating the phylogenetic tree and the transmission tree. We test the approach using simulations and illustrate its use on an outbreak of foot-and-mouth disease. The approach unifies existing methods in the emerging field of phylodynamics with transmission tree reconstruction methods that are used in infectious disease epidemiology.

  8. Phylogenetic study of Class Armophorea (Alveolata, Ciliophora based on 18S-rDNA data

    Directory of Open Access Journals (Sweden)

    Thiago da Silva Paiva

    2013-01-01

    Full Text Available The 18S rDNA phylogeny of Class Armophorea, a group of anaerobic ciliates, is proposed based on an analysis of 44 sequences (out of 195 retrieved from the NCBI/GenBank database. Emphasis was placed on the use of two nucleotide alignment criteria that involved variation in the gap-opening and gap-extension parameters and the use of rRNA secondary structure to orientate multiple-alignment. A sensitivity analysis of 76 data sets was run to assess the effect of variations in indel parameters on tree topologies. Bayesian inference, maximum likelihood and maximum parsimony phylogenetic analyses were used to explore how different analytic frameworks influenced the resulting hypotheses. A sensitivity analysis revealed that the relationships among higher taxa of the Intramacronucleata were dependent upon how indels were determined during multiple-alignment of nucleotides. The phylogenetic analyses rejected the monophyly of the Armophorea most of the time and consistently indicated that the Metopidae and Nyctotheridae were related to the Litostomatea. There was no consensus on the placement of the Caenomorphidae, which could be a sister group of the Metopidae + Nyctorheridae, or could have diverged at the base of the Spirotrichea branch or the Intramacronucleata tree.

  9. Phylogenetic congruence between subtropical trees and their associated fungi.

    Science.gov (United States)

    Liu, Xubing; Liang, Minxia; Etienne, Rampal S; Gilbert, Gregory S; Yu, Shixiao

    2016-12-01

    Recent studies have detected phylogenetic signals in pathogen-host networks for both soil-borne and leaf-infecting fungi, suggesting that pathogenic fungi may track or coevolve with their preferred hosts. However, a phylogenetically concordant relationship between multiple hosts and multiple fungi in has rarely been investigated. Using next-generation high-throughput DNA sequencing techniques, we analyzed fungal taxa associated with diseased leaves, rotten seeds, and infected seedlings of subtropical trees. We compared the topologies of the phylogenetic trees of the soil and foliar fungi based on the internal transcribed spacer (ITS) region with the phylogeny of host tree species based on matK , rbcL , atpB, and 5.8S genes. We identified 37 foliar and 103 soil pathogenic fungi belonging to the Ascomycota and Basidiomycota phyla and detected significantly nonrandom host-fungus combinations, which clustered on both the fungus phylogeny and the host phylogeny. The explicit evidence of congruent phylogenies between tree hosts and their potential fungal pathogens suggests either diffuse coevolution among the plant-fungal interaction networks or that the distribution of fungal species tracked spatially associated hosts with phylogenetically conserved traits and habitat preferences. Phylogenetic conservatism in plant-fungal interactions within a local community promotes host and parasite specificity, which is integral to the important role of fungi in promoting species coexistence and maintaining biodiversity of forest communities.

  10. The phylogenetic relationships of insectivores with special reference to the lesser hedgehog tenrec as inferred from the complete sequence of their mitochondrial genome.

    Science.gov (United States)

    Nikaido, Masato; Cao, Ying; Okada, Norihiro; Hasegawa, Masami

    2003-02-01

    The complete mitochondrial genome of a lesser hedgehog tenrec Echinops telfairi was determined in this study. It is an endemic African insectivore that is found specifically in Madagascar. The tenrec's back is covered with hedgehog-like spines. Unlike other spiny mammals, such as spiny mice, spiny rats, spiny dormice and porcupines, lesser hedgehog tenrecs look amazingly like true hedgehogs (Erinaceidae). However, they are distinguished morphologically from hedgehogs by the absence of a jugal bone. We determined the complete sequence of the mitochondrial genome of a lesser hedgehog tenrec and analyzed the results phylogenetically to determine the relationships between the tenrec and other insectivores (moles, shrews and hedgehogs), as well as the relationships between the tenrec and endemic African mammals, classified as Afrotheria, that have recently been shown by molecular analysis to be close relatives of the tenrec. Our data confirmed the afrotherian status of the tenrec, and no direct relation was recovered between the tenrec and the hedgehog. Comparing our data with those of others, we found that within-species variations in the mitochondrial DNA of lesser hedgehog tenrecs appear to be the largest recognized to date among mammals, apart from orangutans, which might be interesting from the view point of evolutionary history of tenrecs on Madagascar.

  11. Phylogenetic analysis reveals a cryptic species Blastomyces gilchristii, sp. nov. within the human pathogenic fungus Blastomyces dermatitidis.

    Directory of Open Access Journals (Sweden)

    Elizabeth M Brown

    Full Text Available Analysis of the population genetic structure of microbial species is of fundamental importance to many scientific disciplines because it can identify cryptic species, reveal reproductive mode, and elucidate processes that contribute to pathogen evolution. Here, we examined the population genetic structure and geographic differentiation of the sexual, dimorphic fungus Blastomyces dermatitidis, the causative agent of blastomycosis.Criteria for Genealogical Concordance Phylogenetic Species Recognition (GCPSR applied to seven nuclear loci (arf6, chs2, drk1, fads, pyrF, tub1, and its-2 from 78 clinical and environmental isolates identified two previously unrecognized phylogenetic species. Four of seven single gene phylogenies examined (chs2, drk1, pyrF, and its-2 supported the separation of Phylogenetic Species 1 (PS1 and Phylogenetic Species 2 (PS2 which were also well differentiated in the concatenated chs2-drk1-fads-pyrF-tub1-arf6-its2 genealogy with all isolates falling into one of two evolutionarily independent lineages. Phylogenetic species were genetically distinct with interspecific divergence 4-fold greater than intraspecific divergence and a high Fst value (0.772, P<0.001 indicative of restricted gene flow between PS1 and PS2. Whereas panmixia expected of a single freely recombining population was not observed, recombination was detected when PS1 and PS2 were assessed separately, suggesting reproductive isolation. Random mating among PS1 isolates, which were distributed across North America, was only detected after partitioning isolates into six geographic regions. The PS2 population, found predominantly in the hyper-endemic regions of northwestern Ontario, Wisconsin, and Minnesota, contained a substantial clonal component with random mating detected only among unique genotypes in the population.These analyses provide evidence for a genetically divergent clade within Blastomyces dermatitidis, which we use to describe a novel species

  12. Phylogenetic analysis of West Nile virus isolated in Italy in 2008.

    Science.gov (United States)

    Savini, G; Monaco, F; Calistri, P; Lelli, R

    2008-11-27

    In Italy the first occurrence of West Nile virus (WNV) infection was reported in Tuscany region during the late summer of 1998. In August 2008, the WNV infection re-emerged in Italy, in areas surrounding the Po river delta, and involving three regions Lombardy, Emilia Romagna and Veneto. WNV was isolated from blood and organs samples of one horse, one donkey, one pigeon (Columba livia) and three magpies (Pica pica). The phylogenetic analysis of the isolates, conducted on 255 bp in the region coding for the E protein, indicates that these isolates belong to the lineage I among the European strains. According to the analysis, both the 1998 and 2008 Italian strains as well as isolates from Romania, Russia, Senegal and Kenya fell in the same sub-cluster.

  13. Taxonomic revision and phylogenetic relationships of Dasyloricaria Isbrücker & Nijssen, 1979 (Siluriformes: Loricariidae, with description of a new species

    Directory of Open Access Journals (Sweden)

    Alejandro Londoño-Burbano

    Full Text Available ABSTRACT A taxonomic revision and phylogenetic analysis were completed for Dasyloricaria . The genus includes three valid species: D . filamentosa and D . latiura previously included in the genus, and a new species described herein. Dasyloricaria have a restricted trans-Andean distribution, with D . filamentosa occurring at the lower and middle Magdalena, lower Cauca, and Sinu in Colombia, and lago Maracaibo basin in Colombia and Venezuela; D . latiura in the Atrato and the Tuyra basins in Colombia and Panama, respectively; and the new species in the upper and middle Magdalena basin in Colombia. New synonyms for D . filamentosa and D . latiura are proposed, and a lectotype is designated for the latter. Dasyloricaria is herein recognized as monophyletic, with D . filamentosa as the sister group of D . latiura , and the new speciesas sister to that clade. Spatuloricaria is hypothesized to be the sister group of Dasyloricaria based on synapomorphies of the neurocranium, branchial arches and external morphology features. The subtribe Rineloricariina was partially corroborated through the phylogenetic analysis. An identification key for the species of Dasyloricaria is provided.

  14. Are Ichthyosporea animals or fungi? Bayesian phylogenetic analysis of elongation factor 1alpha of Ichthyophonus irregularis.

    Science.gov (United States)

    Ragan, Mark A; Murphy, Colleen A; Rand, Thomas G

    2003-12-01

    Ichthyosporea is a recently recognized group of morphologically simple eukaryotes, many of which cause disease in aquatic organisms. Ribosomal RNA sequence analyses place Ichthyosporea near the divergence of the animal and fungal lineages, but do not allow resolution of its exact phylogenetic position. Some of the best evidence for a specific grouping of animals and fungi (Opisthokonta) has come from elongation factor 1alpha, not only phylogenetic analysis of sequences but also the presence or absence of short insertions and deletions. We sequenced the EF-1alpha gene from the ichthyosporean parasite Ichthyophonus irregularis and determined its phylogenetic position using neighbor-joining, parsimony and Bayesian methods. We also sequenced EF-1alpha genes from four chytrids to provide broader representation within fungi. Sequence analyses and the presence of a characteristic 12 amino acid insertion strongly indicate that I. irregularis is a member of Opisthokonta, but do not resolve whether I. irregularis is a specific relative of animals or of fungi. However, the EF-1alpha of I. irregularis exhibits a two amino acid deletion heretofore reported only among fungi.

  15. Identification of Tunisian Leishmania spp. by PCR amplification of cysteine proteinase B (cpb) genes and phylogenetic analysis.

    Science.gov (United States)

    Chaouch, Melek; Fathallah-Mili, Akila; Driss, Mehdi; Lahmadi, Ramzi; Ayari, Chiraz; Guizani, Ikram; Ben Said, Moncef; Benabderrazak, Souha

    2013-03-01

    Discrimination of the Old World Leishmania parasites is important for diagnosis and epidemiological studies of leishmaniasis. We have developed PCR assays that allow the discrimination between Leishmania major, Leishmania tropica and Leishmania infantum Tunisian species. The identification was performed by a simple PCR targeting cysteine protease B (cpb) gene copies. These PCR can be a routine molecular biology tools for discrimination of Leishmania spp. from different geographical origins and different clinical forms. Our assays can be an informative source for cpb gene studying concerning drug, diagnostics and vaccine research. The PCR products of the cpb gene and the N-acetylglucosamine-1-phosphate transferase (nagt) Leishmania gene were sequenced and aligned. Phylogenetic trees of Leishmania based cpb and nagt sequences are close in topology and present the classic distribution of Leishmania in the Old World. The phylogenetic analysis has enabled the characterization and identification of different strains, using both multicopy (cpb) and single copy (nagt) genes. Indeed, the cpb phylogenetic analysis allowed us to identify the Tunisian Leishmania killicki species, and a group which gathers the least evolved isolates of the Leishmania donovani complex, that was originated from East Africa. This clustering confirms the African origin for the visceralizing species of the L. donovani complex. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Phylogenetic constrains on mycorrhizal specificity in eight Dendrobium (Orchidaceae) species.

    Science.gov (United States)

    Xing, Xiaoke; Ma, Xueting; Men, Jinxin; Chen, Yanhong; Guo, Shunxing

    2017-05-01

    Plant phylogeny constrains orchid mycorrhizal (OrM) fungal community composition in some orchids. Here, we investigated the structures of the OrM fungal communities of eight Dendrobium species in one niche to determine whether similarities in the OrM fungal communities correlated with the phylogeny of the host plants and whether the Dendrobium-OrM fungal interactions are phylogenetically conserved. A phylogeny based on DNA data was constructed for the eight coexisting Dendrobium species, and the OrM fungal communities were characterized by their roots. There were 31 different fungal lineages associated with the eight Dendrobium species. In total, 82.98% of the identified associations belonging to Tulasnellaceae, and a smaller proportion involved members of the unknown Basidiomycota (9.67%). Community analyses revealed that phylogenetically related Dendrobium tended to interact with a similar set of Tulasnellaceae fungi. The interactions between Dendrobium and Tulasnellaceae fungi were significantly influenced by the phylogenetic relationships among the Dendrobium species. Our results provide evidence that the mycorrhizal specificity in the eight coexisting Dendrobium species was phylogenetically conserved.

  17. The Complete Chloroplast Genome Sequences of Five Epimedium Species: Lights into Phylogenetic and Taxonomic Analyses

    Science.gov (United States)

    Zhang, Yanjun; Du, Liuwen; Liu, Ao; Chen, Jianjun; Wu, Li; Hu, Weiming; Zhang, Wei; Kim, Kyunghee; Lee, Sang-Choon; Yang, Tae-Jin; Wang, Ying

    2016-01-01

    Epimedium L. is a phylogenetically and economically important genus in the family Berberidaceae. We here sequenced the complete chloroplast (cp) genomes of four Epimedium species using Illumina sequencing technology via a combination of de novo and reference-guided assembly, which was also the first comprehensive cp genome analysis on Epimedium combining the cp genome sequence of E. koreanum previously reported. The five Epimedium cp genomes exhibited typical quadripartite and circular structure that was rather conserved in genomic structure and the synteny of gene order. However, these cp genomes presented obvious variations at the boundaries of the four regions because of the expansion and contraction of the inverted repeat (IR) region and the single-copy (SC) boundary regions. The trnQ-UUG duplication occurred in the five Epimedium cp genomes, which was not found in the other basal eudicotyledons. The rapidly evolving cp genome regions were detected among the five cp genomes, as well as the difference of simple sequence repeats (SSR) and repeat sequence were identified. Phylogenetic relationships among the five Epimedium species based on their cp genomes showed accordance with the updated system of the genus on the whole, but reminded that the evolutionary relationships and the divisions of the genus need further investigation applying more evidences. The availability of these cp genomes provided valuable genetic information for accurately identifying species, taxonomy and phylogenetic resolution and evolution of Epimedium, and assist in exploration and utilization of Epimedium plants. PMID:27014326

  18. The complete chloroplast genome sequences of five Epimedium species: lights into phylogenetic and taxonomic analyses

    Directory of Open Access Journals (Sweden)

    Yanjun eZhang

    2016-03-01

    Full Text Available Epimedium L. is a phylogenetically and economically important genus in the family Berberidaceae. We here sequenced the complete chloroplast (cp genomes of four Epimedium species using Illumina sequencing technology via a combination of de novo and reference-guided assembly, which was also the first comprehensive cp genome analysis on Epimedium combining the cp genome sequence of E. koreanum previously reported. The five Epimedium cp genomes exhibited typical quadripartite and circular structure that was rather conserved in genomic structure and the synteny of gene order. However, these cp genomes presented obvious variations at the boundaries of the four regions because of the expansion and contraction of the inverted repeat (IR region and the single-copy (SC boundary regions. The trnQ-UUG duplication occurred in the five Epimedium cp genomes, which was not found in the other basal eudicotyledons. The rapidly evolving cp genome regions were detected among the five cp genomes, as well as the difference of simple sequence repeats (SSR and repeat sequence were identified. Phylogenetic relationships among the five Epimedium species based on their cp genomes showed accordance with the updated system of the genus on the whole, but reminded that the evolutionary relationships and the divisions of the genus need further investigation applying more evidences. The availability of these cp genomes provided valuable genetic information for accurately identifying species, taxonomy and phylogenetic resolution and evolution of Epimedium, and assist in exploration and utilization of Epimedium plants.

  19. Phylogenetics of neotropical Platymiscium (Leguminosae

    DEFF Research Database (Denmark)

    Saslis-Lagoudakis, C. Haris; Chase, Mark W; Robinson, Daniel N

    2008-01-01

    Platymiscium is a neotropical legume genus of forest trees in the Pterocarpus clade of the pantropical "dalbergioid" clade. It comprises 19 species (29 taxa), distributed from Mexico to southern Brazil. This study presents a molecular phylogenetic analysis of Platymiscium and allies inferred from...

  20. Inferring phylogenetic networks by the maximum parsimony criterion: a case study.

    Science.gov (United States)

    Jin, Guohua; Nakhleh, Luay; Snir, Sagi; Tuller, Tamir

    2007-01-01

    Horizontal gene transfer (HGT) may result in genes whose evolutionary histories disagree with each other, as well as with the species tree. In this case, reconciling the species and gene trees results in a network of relationships, known as the "phylogenetic network" of the set of species. A phylogenetic network that incorporates HGT consists of an underlying species tree that captures vertical inheritance and a set of edges which model the "horizontal" transfer of genetic material. In a series of papers, Nakhleh and colleagues have recently formulated a maximum parsimony (MP) criterion for phylogenetic networks, provided an array of computationally efficient algorithms and heuristics for computing it, and demonstrated its plausibility on simulated data. In this article, we study the performance and robustness of this criterion on biological data. Our findings indicate that MP is very promising when its application is extended to the domain of phylogenetic network reconstruction and HGT detection. In all cases we investigated, the MP criterion detected the correct number of HGT events required to map the evolutionary history of a gene data set onto the species phylogeny. Furthermore, our results indicate that the criterion is robust with respect to both incomplete taxon sampling and the use of different site substitution matrices. Finally, our results show that the MP criterion is very promising in detecting HGT in chimeric genes, whose evolutionary histories are a mix of vertical and horizontal evolution. Besides the performance analysis of MP, our findings offer new insights into the evolution of 4 biological data sets and new possible explanations of HGT scenarios in their evolutionary history.

  1. Molecular phylogenetic and expression analysis of the complete WRKY transcription factor family in maize.

    Science.gov (United States)

    Wei, Kai-Fa; Chen, Juan; Chen, Yan-Feng; Wu, Ling-Juan; Xie, Dao-Xin

    2012-04-01

    The WRKY transcription factors function in plant growth and development, and response to the biotic and abiotic stresses. Although many studies have focused on the functional identification of the WRKY transcription factors, much less is known about molecular phylogenetic and global expression analysis of the complete WRKY family in maize. In this study, we identified 136 WRKY proteins coded by 119 genes in the B73 inbred line from the complete genome and named them in an orderly manner. Then, a comprehensive phylogenetic analysis of five species was performed to explore the origin and evolutionary patterns of these WRKY genes, and the result showed that gene duplication is the major driving force for the origin of new groups and subgroups and functional divergence during evolution. Chromosomal location analysis of maize WRKY genes indicated that 20 gene clusters are distributed unevenly in the genome. Microarray-based expression analysis has revealed that 131 WRKY transcripts encoded by 116 genes may participate in the regulation of maize growth and development. Among them, 102 transcripts are stably expressed with a coefficient of variation (CV) value of WRKY genes with the CV value of >15% are further analysed to discover new organ- or tissue-specific genes. In addition, microarray analyses of transcriptional responses to drought stress and fungal infection showed that maize WRKY proteins are involved in stress responses. All these results contribute to a deep probing into the roles of WRKY transcription factors in maize growth and development and stress tolerance.

  2. Identification and phylogenetic analysis of novel cytochrome P450 1A genes from ungulate species.

    Science.gov (United States)

    Darwish, Wageh Sobhy; Kawai, Yusuke; Ikenaka, Yoshinori; Yamamoto, Hideaki; Muroya, Tarou; Ishizuka, Mayumi

    2010-09-01

    As part of an ongoing effort to understand the biological response of wild and domestic ungulates to different environmental pollutants such as dioxin-like compounds, cDNAs encoding for CYP1A1 and CYP1A2 were cloned and characterized. Four novel CYP1A cDNA fragments from the livers of four wild ungulates (elephant, hippopotamus, tapir and deer) were identified. Three fragments from hippopotamus, tapir and deer were classified as CYP1A2, and the other fragment from elephant was designated as CYP1A1/2. The deduced amino acid sequences of these fragment CYP1As showed identities ranging from 76 to 97% with other animal CYP1As. The phylogenetic analysis of these fragments showed that both elephant and hippopotamus CYP1As made separate branches, while tapir and deer CYP1As were located beside that of horse and cattle respectively in the phylogenetic tree. Analysis of dN/dS ratio among the identified CYP1As indicated that odd toed ungulate CYP1A2s were exposed to different selection pressure.

  3. Phylogenetic relationships and morphological evolution in Lentinus, Polyporellus and Neofavolus, emphasizing southeastern Asian taxa.

    Science.gov (United States)

    Seelan, Jaya Seelan Sathiya; Justo, Alfredo; Nagy, Laszlo G; Grand, Edward A; Redhead, Scott A; Hibbett, David

    2015-01-01

    The genus Lentinus (Polyporaceae, Basidiomycota) is widely documented from tropical and temperate forests and is taxonomically controversial. Here we studied the relationships between Lentinus subg. Lentinus sensu Pegler (i.e. sections Lentinus, Tigrini, Dicholamellatae, Rigidi, Lentodiellum and Pleuroti and polypores that share similar morphological characters). We generated sequences of internal transcribed spacers (ITS) and partial 28S regions of nuc rDNA and genes encoding the largest subunit of RNA polymerase II (RPB1), focusing on Lentinus subg. Lentinus sensu Pegler and the Neofavolus group, combined these data with sequences from GenBank (including RPB2 gene sequences) and performed phylogenetic analyses with maximum likelihood and Bayesian methods. We also evaluated the transition in hymenophore morphology between Lentinus, Neofavolus and related polypores with ancestral state reconstruction. Single-gene phylogenies and phylogenies combining ITS and 28S with RPB1 and RPB2 genes all support existence of a Lentinus/Polyporellus clade and a separate Neofavolus clade. Polyporellus (represented by P. arcularius, P. ciliatus, P. brumalis) forms a clade with species representing Lentinus subg. Lentinus sensu Pegler (1983), excluding L. suavissimus. Lentinus tigrinus appears as the sister group of Polyporellus in the four-gene phylogeny, but this placement was weakly supported. All three multigene analyses and the single-gene analysis using ITS strongly supported Polyporus tricholoma as the sister group of the Lentinus/Polyporellus clade; only the 28S rRNA phylogeny failed to support this placement. Under parsimony the ancestral hymenophoral configuration for the Lentinus/Polyporellus clade is estimated to be circular pores, with independent transitions to angular pores and lamellae. The ancestral state for the Neofavolus clade is estimated to be angular pores, with a single transition to lamellae in L. suavissimus. We propose that Lentinus suavissimus (section

  4. Phylogenetic relationships of Sarcocystis neurona of horses and opossums to other cyst-forming coccidia deduced from SSU rRNA gene sequences.

    Science.gov (United States)

    Elsheikha, Hany M; Lacher, David W; Mansfield, Linda S

    2005-11-01

    Phylogenetic analyses based on sequences of the nuclear-encoded small subunit rRNA (ssurRNA) gene were performed to examine the origin, phylogeny, and biogeographic relationships of Sarcocystis neurona isolates from opossums and horses from the State of Michigan, USA, in relation to other cyst-forming coccidia. A total of 31 taxa representing all recognized subfamilies and genera of Sarcocystidae were included in the analyses with clonal isolates of two opossum and two horse S. neurona. Phylogenies obtained by the four tree-building methods were consistent with the classical taxonomy based on morphological criteria. The "isosporid" coccidia Neospora, Toxoplasma, Besnoitia, Isospora lacking stieda bodies, and Hyaloklossia formed a sister group to the Sarcocystis spp. Sarcocystis species were divided into three main lineages; S. neurona isolates were located in the second lineage and clustered with S. mucosa, S. dispersa, S. lacertae, S. rodentifelis, S. muris, and Frenkelia spp. Alignment of S. neurona SSU rRNA gene sequences of Michigan opossum isolates (MIOP5, MIOP20) and a S. neurona Michigan horse isolate (MIH8) showed 100% identity. These Michigan isolates differed in 2/1085 bp (0.2%) from a Kentucky S. neurona horse isolate (SN5). Additionally, S. neurona isolates from horses and opossums were identical based on the ultrastructural features and PCR-RFLP analyses thus forming a phylogenetically indistinct group in these regions. These findings revealed the concordance between the morphological and molecular data and confirmed that S. neurona from opossums and horses originated from the same phylogenetic origin.

  5. Phylogenetic turnover during subtropical forest succession across environmental and phylogenetic scales

    OpenAIRE

    Purschke, Oliver; Michalski, Stefan G.; Bruelheide, Helge; Durka, Walter

    2017-01-01

    Abstract Although spatial and temporal patterns of phylogenetic community structure during succession are inherently interlinked and assembly processes vary with environmental and phylogenetic scales, successional studies of community assembly have yet to integrate spatial and temporal components of community structure, while accounting for scaling issues. To gain insight into the processes that generate biodiversity after disturbance, we combine analyses of spatial and temporal phylogenetic ...

  6. Complete genome of a European hepatitis C virus subtype 1g isolate: phylogenetic and genetic analyses

    Directory of Open Access Journals (Sweden)

    Bargalló Ana

    2008-06-01

    Full Text Available Abstract Background Hepatitis C virus isolates have been classified into six main genotypes and a variable number of subtypes within each genotype, mainly based on phylogenetic analysis. Analyses of the genetic relationship among genotypes and subtypes are more reliable when complete genome sequences (or at least the full coding region are used; however, so far 31 of 80 confirmed or proposed subtypes have at least one complete genome available. Of these, 20 correspond to confirmed subtypes of epidemic interest. Results We present and analyse the first complete genome sequence of a HCV subtype 1g isolate. Phylogenetic and genetic distance analyses reveal that HCV-1g is the most divergent subtype among the HCV-1 confirmed subtypes. Potential genomic recombination events between genotypes or subtype 1 genomes were ruled out. We demonstrate phylogenetic congruence of previously deposited partial sequences of HCV-1g with respect to our sequence. Conclusion In light of this, we propose changing the current status of its subtype-specific designation from provisional to confirmed.

  7. A Closer Look at Bacteroides: Phylogenetic Relationship and Genomic Implications of a Life in the Human Gut

    DEFF Research Database (Denmark)

    Karlsson, Fredrik H.; Ussery, David; Nielsen, Jens

    2011-01-01

    The human gut is extremely densely inhabited by bacteria mainly from two phyla, Bacteroidetes and Firmicutes, and there is a great interest in analyzing whole-genome sequences for these species because of their relation to human health and disease. Here, we do whole-genome comparison of 105...... of extracytoplasmic function σ factors (ECF σ factors) and two component systems for extracellular signal transduction compared to other Bacteroidetes/Chlorobi species. A whole-genome phylogenetic analysis shows a very little difference between the Parabacteroides and Bacteroides genera. Further analysis shows...... of members of the Bacteroidetes/Chlorobi phylum by whole genome comparison. Gut living Bacteroides have an enriched set of glycan, vitamin, and cofactor enzymes important for diet digestion....

  8. Phylogenetic relationships in the genus Leonardoxa (Leguminosae: Caesalpinioideae) inferred from chloroplast trnL intron and trnL-trnF intergenic spacer sequences.

    Science.gov (United States)

    Brouat, Carine; Gielly, Ludovic; McKey, Doyle

    2001-01-01

    The African genus LEONARDOXA: (Leguminosae: Caesalpinioideae) comprises two Congolean species and a group of four mostly allopatric subspecies principally located in Cameroon and clustered together in the L. africana complex. LEONARDOXA: provides a good opportunity to investigate the evolutionary history of ant-plant mutualisms, as it exhibits various grades of ant-plant interactions from diffuse to obligate and symbiotic associations. We present in this paper the first molecular phylogenetic study of this genus. We sequenced both the chloroplast DNA trnL intron (677 aligned base pairs [bp]) and trnL-trnF intergene spacer (598 aligned bp). Inferred phylogenetic relationships suggested first that the genus is paraphyletic. The L. africana complex is clearly separated from the two Congolean species, and the integrity of the genus is thus in question. In the L. africana complex, our data showed a lack of congruence between clades suggested by morphological and chloroplast characters. This, and the low level of molecular divergence found between subspecies, suggests gene flow and introgressive events in the L. africana complex.

  9. Molecular characterization and phylogenetic relationship of wild type 1 poliovirus strains circulating across Pakistan and Afghanistan bordering areas during 2010-2012.

    Directory of Open Access Journals (Sweden)

    Shahzad Shaukat

    Full Text Available Pakistan and Afghanistan share a long uncontrolled border with extensive population movement on both sides. Wild poliovirus transmission has never been interrupted in this block due to war against terrorism, poor public health infrastructure, misconceptions about polio vaccines and inadequate immunization activities. All these issues complicate the eradication operations and reinforce the complexity of wiping out poliomyelitis from this region. This study illustrates the origins and routes of cross-border wild poliovirus type 1 (WPV1 transmission during 2010-2012 between Pakistan and Afghanistan. Sequence analyses were conducted based on complete VP1 capsid protein sequences for WPV1 study strains to determine the origin of poliovirus genetic lineages and their evolutionary relationships. Phylogenetic tree was constructed from VP1 gene sequences applying Maximum Likelihood method using Kimura 2- parameter model in MEGA program v 5.0. A total of 72 (14.3% out of 502 wild-type 1 polioviruses were found circulating in border areas of both countries during 2010-2012. Molecular phylogenetic analysis classified these strains in to two sub-genotypes with four clusters and 18 lineages. Genetic data confirmed that the most of WPV1 lineages (12; 66.6% were transmitted from Pakistan to Afghanistan. However, the genetic diversity was significantly reduced during 2012 as most of the lineages were completely eliminated. In conclusion, Pakistan-Afghanistan block has emerged as a single poliovirus reservoir sharing the multiple poliovirus lineages due to uncontrolled movement of people across the borders between two countries. If it is neglected, it can jeopardize the extensive global efforts done so-far to eradicate the poliovirus infection. Our data will be helpful to devise the preventive strategies for effective control of wild poliovirus transmission in this region.

  10. Phylogenetic analysis of some Newcastle disease virus isolates from the Sudan

    Directory of Open Access Journals (Sweden)

    N.A. Elmardi

    2016-06-01

    Full Text Available A reverse transcription-polymerase chain reaction (RT-PCR was used to amplify 1412 bp of the fusion protein gene (F gene of four Newcastle disease virus (NDV isolates; two velogenic (TY-1/90 and DIK-90 and two lentogenic isolates (Dongla 88/1 and GD.S.1. Following sequencing, nucleotide sequences were annotated and 894 bp were compared phylogenetically with those from strains previously reported in the Sudan and the virus strains published on the GenBank. It could be demonstrated that TY-1/90 and DIK-90 strains belong to the genotype VI of NDV and are in close genetic relationship to sub- genotype VIb. TY-1/90 and DIK-90 strains were observed to be genetically unrelated to the earlier Sudanese isolates of 1970/80s and the late of 2000s suggesting a different origin. The close genetic relationship to the European and African pigeon paramyxovirus type 1 (PPMV-1 suggests a common ancestor. Dongola, GD.S.1 strains were classified into genotype II that comprises non-pathogenic lentogenic NDV strains. The present genetic classification of NDV isolates of the Sudan provides valuable information on genotypes of NDV. Further molecular epidemiological investigations of the recent outbreaks of Newcastle disease in the Sudan are needed in order to improve the efficiency of control strategies and vaccine development.

  11. The Independent Evolution Method Is Not a Viable Phylogenetic Comparative Method.

    Directory of Open Access Journals (Sweden)

    Randi H Griffin

    Full Text Available Phylogenetic comparative methods (PCMs use data on species traits and phylogenetic relationships to shed light on evolutionary questions. Recently, Smaers and Vinicius suggested a new PCM, Independent Evolution (IE, which purportedly employs a novel model of evolution based on Felsenstein's Adaptive Peak Model. The authors found that IE improves upon previous PCMs by producing more accurate estimates of ancestral states, as well as separate estimates of evolutionary rates for each branch of a phylogenetic tree. Here, we document substantial theoretical and computational issues with IE. When data are simulated under a simple Brownian motion model of evolution, IE produces severely biased estimates of ancestral states and changes along individual branches. We show that these branch-specific changes are essentially ancestor-descendant or "directional" contrasts, and draw parallels between IE and previous PCMs such as "minimum evolution". Additionally, while comparisons of branch-specific changes between variables have been interpreted as reflecting the relative strength of selection on those traits, we demonstrate through simulations that regressing IE estimated branch-specific changes against one another gives a biased estimate of the scaling relationship between these variables, and provides no advantages or insights beyond established PCMs such as phylogenetically independent contrasts. In light of our findings, we discuss the results of previous papers that employed IE. We conclude that Independent Evolution is not a viable PCM, and should not be used in comparative analyses.

  12. Reconstruction of phylogenetic trees of prokaryotes using maximal common intervals.

    Science.gov (United States)

    Heydari, Mahdi; Marashi, Sayed-Amir; Tusserkani, Ruzbeh; Sadeghi, Mehdi

    2014-10-01

    One of the fundamental problems in bioinformatics is phylogenetic tree reconstruction, which can be used for classifying living organisms into different taxonomic clades. The classical approach to this problem is based on a marker such as 16S ribosomal RNA. Since evolutionary events like genomic rearrangements are not included in reconstructions of phylogenetic trees based on single genes, much effort has been made to find other characteristics for phylogenetic reconstruction in recent years. With the increasing availability of completely sequenced genomes, gene order can be considered as a new solution for this problem. In the present work, we applied maximal common intervals (MCIs) in two or more genomes to infer their distance and to reconstruct their evolutionary relationship. Additionally, measures based on uncommon segments (UCS's), i.e., those genomic segments which are not detected as part of any of the MCIs, are also used for phylogenetic tree reconstruction. We applied these two types of measures for reconstructing the phylogenetic tree of 63 prokaryotes with known COG (clusters of orthologous groups) families. Similarity between the MCI-based (resp. UCS-based) reconstructed phylogenetic trees and the phylogenetic tree obtained from NCBI taxonomy browser is as high as 93.1% (resp. 94.9%). We show that in the case of this diverse dataset of prokaryotes, tree reconstruction based on MCI and UCS outperforms most of the currently available methods based on gene orders, including breakpoint distance and DCJ. We additionally tested our new measures on a dataset of 13 closely-related bacteria from the genus Prochlorococcus. In this case, distances like rearrangement distance, breakpoint distance and DCJ proved to be useful, while our new measures are still appropriate for phylogenetic reconstruction. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  13. A taxonomic and phylogenetic re-appraisal of the genus Curvularia

    Science.gov (United States)

    Species of Curvularia are important plant and human pathogens worldwide. In this study, the genus Curvularia is re-assessed based on molecular phylogenetic analysis and morphological observations of available isolates and specimens. A multi-gene phylogenetic tree inferred from ITS, TEF and GPDH gene...

  14. PhyDesign: an online application for profiling phylogenetic informativeness

    Directory of Open Access Journals (Sweden)

    Townsend Jeffrey P

    2011-05-01

    Full Text Available Abstract Background The rapid increase in number of sequenced genomes for species across of the tree of life is revealing a diverse suite of orthologous genes that could potentially be employed to inform molecular phylogenetic studies that encompass broader taxonomic sampling. Optimal usage of this diversity of loci requires user-friendly tools to facilitate widespread cost-effective locus prioritization for phylogenetic sampling. The Townsend (2007 phylogenetic informativeness provides a unique empirical metric for guiding marker selection. However, no software or automated methodology to evaluate sequence alignments and estimate the phylogenetic informativeness metric has been available. Results Here, we present PhyDesign, a platform-independent online application that implements the Townsend (2007 phylogenetic informativeness analysis, providing a quantitative prediction of the utility of loci to solve specific phylogenetic questions. An easy-to-use interface facilitates uploading of alignments and ultrametric trees to calculate and depict profiles of informativeness over specified time ranges, and provides rankings of locus prioritization for epochs of interest. Conclusions By providing these profiles, PhyDesign facilitates locus prioritization increasing the efficiency of sequencing for phylogenetic purposes compared to traditional studies with more laborious and low capacity screening methods, as well as increasing the accuracy of phylogenetic studies. Together with a manual and sample files, the application is freely accessible at http://phydesign.townsend.yale.edu.

  15. Evolution and Phylogenetic Diversity of Yam Species (Dioscorea spp.: Implication for Conservation and Agricultural Practices.

    Directory of Open Access Journals (Sweden)

    Marie Florence Sandrine Ngo Ngwe

    Full Text Available Yams (Dioscorea spp. consist of approximately 600 species. Presently, these species are threatened by genetic erosion due to many factors such as pest attacks and farming practices. In parallel, complex taxonomic boundaries in this genus makes it more challenging to properly address the genetic diversity of yam and manage its germplasm. As a first step toward evaluating and preserving the genetic diversity yam species, we use a phylogenetic diversity (PD approach that has the advantage to investigate phylogenetic relationships and test hypotheses of species monophyly while alleviating to the problem of ploidy variation within and among species. The Bayesian phylogenetic analysis of 62 accessions from 7 species from three regions of Cameroon showed that most Dioscorea sections were monophyletic, but species within sections were generally non-monophyletic. The wild species D. praehensilis and cultivated D. cayenensis were the species with the highest PD. At the opposite, D. esculenta has a low PD and future studies should focus on this species to properly address its conservation status. We also show that wild species show a stronger genetic structure than cultivated species, which potentially reflects the management of the yam germplasm by farmers. These findings show that phylogenetic diversity is a promising approach for an initial investigation of genetic diversity in a crop consisting of closely related species.

  16. Identification of putative orthologous genes for the phylogenetic reconstruction of temperate woody bamboos (Poaceae: Bambusoideae).

    Science.gov (United States)

    Zhang, Li-Na; Zhang, Xian-Zhi; Zhang, Yu-Xiao; Zeng, Chun-Xia; Ma, Peng-Fei; Zhao, Lei; Guo, Zhen-Hua; Li, De-Zhu

    2014-09-01

    The temperate woody bamboos (Arundinarieae) are highly diverse in morphology but lack a substantial amount of genetic variation. The taxonomy of this lineage is intractable, and the relationships within the tribe have not been well resolved. Recent studies indicated that this tribe could have a complex evolutionary history. Although phylogenetic studies of the tribe have been carried out, most of these phylogenetic reconstructions were based on plastid data, which provide lower phylogenetic resolution compared with nuclear data. In this study, we intended to identify a set of desirable nuclear genes for resolving the phylogeny of the temperate woody bamboos. Using two different methodologies, we identified 209 and 916 genes, respectively, as putative single copy orthologous genes. A total of 112 genes was successfully amplified and sequenced by next-generation sequencing technologies in five species sampled from the tribe. As most of the genes exhibited intra-individual allele heterozygotes, we investigated phylogenetic utility by reconstructing the phylogeny based on individual genes. Discordance among gene trees was observed and, to resolve the conflict, we performed a range of analyses using BUCKy and HybTree. While caution should be taken when inferring a phylogeny from multiple conflicting genes, our analysis indicated that 74 of the 112 investigated genes are potential markers for resolving the phylogeny of the temperate woody bamboos. © 2014 John Wiley & Sons Ltd.

  17. Sequence comparison and phylogenetic analysis of core gene of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-07-19

    Jul 19, 2010 ... and antisense primers, a single band of 573 base pairs .... Amino acid sequence alignment of Cluster I and Cluster II of phylogenetic tree. First ten sequences ... sequence weighting, postion-spiecific gap penalties and weight.

  18. Molecular phylogenetics, vocalizations, and species limits in Celeus woodpeckers (Aves: Picidae).

    Science.gov (United States)

    Benz, Brett W; Robbins, Mark B

    2011-10-01

    Species limits and the evolutionary mechanisms that have shaped diversification of woodpeckers and allies (Picidae) remain obscure, as inter and intraspecific phylogenetic relationships have yet to be comprehensively resolved for most genera. Herein, we analyzed 5020 base pairs of nucleotide sequence data from the mitochondrial and nuclear genomes to reconstruct the evolutionary history of Celeus woodpeckers. Broad geographic sampling was employed to assess species limits in phenotypically variable lineages and provide a first look at the evolution of song and plumage traits in this poorly known Neotropical genus. Our results strongly support the monophyly of Celeus and reveal several novel relationships across a shallow phylogenetic topology. We confirm the close sister relationship between Celeus spectabilis and the enigmatic Celeus obrieni, both of which form a clade with Celeus flavus. The Mesoamerican Celeus castaneus was placed as sister to a Celeus undatus-grammicus lineage, with the species status of the latter drawn into question given the lack of substantial genetic, morphological, and vocal variation in these taxa. We recovered paraphyly in Celeus elegans; however, this result appears to be the consequence of mitochondrial introgression from Celeus lugubris considering the monophyly of elegans at the ß-FIBI7 locus. A second instance of paraphyly was observed in Celeus flavescens with deep genetic splits and substantial phenotypic variation indicating the presence of two distinct species in this broadly distributed lineage. As such, we advocate elevation of Celeus flavescens ochraceus to species status. Our analysis of Celeus vocalizations and plumage characters demonstrates a pattern of lability consistent with a relatively recent origin of the genus and potentially rapid speciation history. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Calculation of evolutionary correlation between individual genes and full-length genome: a method useful for choosing phylogenetic markers for molecular epidemiology.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    Full Text Available Individual genes or regions are still commonly used to estimate the phylogenetic relationships among viral isolates. The genomic regions that can faithfully provide assessments consistent with those predicted with full-length genome sequences would be preferable to serve as good candidates of the phylogenetic markers for molecular epidemiological studies of many viruses. Here we employed a statistical method to evaluate the evolutionary relationships between individual viral genes and full-length genomes without tree construction as a way to determine which gene can match the genome well in phylogenetic analyses. This method was performed by calculation of linear correlations between the genetic distance matrices of aligned individual gene sequences and aligned genome sequences. We applied this method to the phylogenetic analyses of porcine circovirus 2 (PCV2, measles virus (MV, hepatitis E virus (HEV and Japanese encephalitis virus (JEV. Phylogenetic trees were constructed for comparisons and the possible factors affecting the method accuracy were also discussed in the calculations. The results revealed that this method could produce results consistent with those of previous studies about the proper consensus sequences that could be successfully used as phylogenetic markers. And our results also suggested that these evolutionary correlations could provide useful information for identifying genes that could be used effectively to infer the genetic relationships.

  20. Phylogenetic analysis of Bacillus subtilis strains applicable to natto (fermented soybean) production.

    Science.gov (United States)

    Kubo, Yuji; Rooney, Alejandro P; Tsukakoshi, Yoshiki; Nakagawa, Rikio; Hasegawa, Hiromasa; Kimura, Keitarou

    2011-09-01

    Spore-forming Bacillus strains that produce extracellular poly-γ-glutamic acid were screened for their application to natto (fermented soybean food) fermentation. Among the 424 strains, including Bacillus subtilis and B. amyloliquefaciens, which we isolated from rice straw, 59 were capable of fermenting natto. Biotin auxotrophism was tightly linked to natto fermentation. A multilocus nucleotide sequence of six genes (rpoB, purH, gyrA, groEL, polC, and 16S rRNA) was used for phylogenetic analysis, and amplified fragment length polymorphism (AFLP) analysis was also conducted on the natto-fermenting strains. The ability to ferment natto was inferred from the two principal components of the AFLP banding pattern, and natto-fermenting strains formed a tight cluster within the B. subtilis subsp. subtilis group.